> top > projects > LitCovid-sentences > docs > PMC:7795856 > annotations
LitCovid-sentences  

PMC:7795856 JSONTXT 9 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T1 0-22 Sentence denotes PASylated Thymosin α1:
T2 23-104 Sentence denotes A Long-Acting Immunostimulatory Peptide for Applications in Oncology and Virology
T3 106-114 Sentence denotes Abstract
T4 115-358 Sentence denotes Thymosin α1 (Tα1) is an immunostimulatory peptide for the treatment of hepatitis B virus (HBV) and hepatitis C virus (HCV) infections and used as an immune enhancer, which also offers prospects in the context of COVID-19 infections and cancer.
T5 359-522 Sentence denotes Manufacturing of this N-terminally acetylated 28-residue peptide is demanding, and its short plasma half-life limits in vivo efficacy and requires frequent dosing.
T6 523-686 Sentence denotes Here, we combined the PASylation technology with enzymatic in situ N-acetylation by RimJ to produce a long-acting version of Tα1 in Escherichia coli at high yield.
T7 687-802 Sentence denotes ESI-MS analysis of the purified fusion protein indicated the expected composition without any signs of proteolysis.
T8 803-971 Sentence denotes SEC analysis revealed a 10-fold expanded hydrodynamic volume resulting from the fusion with a conformationally disordered Pro/Ala/Ser (PAS) polypeptide of 600 residues.
T9 972-1133 Sentence denotes This size effect led to a plasma half-life in rats extended by more than a factor 8 compared to the original synthetic peptide due to retarded kidney filtration.
T10 1134-1251 Sentence denotes Our study provides the basis for therapeutic development of a next generation thymosin α1 with prolonged circulation.
T11 1252-1524 Sentence denotes Generally, the strategy of producing an N-terminally protected PASylated peptide solves three major problems of peptide drugs: (i) instability in the expression host, (ii) rapid degradation by serum exopeptidases, and (iii) low bioactivity because of fast renal clearance.
T12 1526-1528 Sentence denotes 1.
T13 1529-1541 Sentence denotes Introduction
T14 1542-1660 Sentence denotes Thymosin α1 (Tα1) is an immunostimulatory peptide initially isolated from calf thymus [1] and also abundant in humans.
T15 1661-1950 Sentence denotes Tα1 is synthesized as the N-terminal moiety of the highly acidic (pI = 3.7) prothymosin α (ProTα), a peculiar cytoplasmic protein due to the absence of any sulfur-containing as well as aromatic side chains and, in particular, its random coil structure under physiological conditions [2,3].
T16 1951-2096 Sentence denotes Cleaved by the lysosomal asparaginyl endopeptidase (legumain; δ-secretase), the N-terminally acetylated 28-residue peptide Tα1 gets released [4].
T17 2097-2369 Sentence denotes Tα1 plays a significant role in activating and regulating various cells of the immune system [5], e.g., by stimulating toll-like receptor (TLR)-2 and TLR-9 on myeloid and plasmacytoid dendritic cells (DCs), which results in the secretion of immune-related cytokines [6,7].
T18 2370-2537 Sentence denotes Furthermore, Tα1 increases the number of activated T helper (Th) cells and provokes a shift towards the Th1 subclass, thus promoting the cell-mediated immune response.
T19 2538-2732 Sentence denotes In addition, Tα1 was reported to reduce apoptosis of immune cells [8] and to upregulate the expression of major histocompatibility complex I (MHC I) molecules [9] as well as tumor antigens [10].
T20 2733-3042 Sentence denotes Interestingly, Tα1 mediates increased intracellular glutathione (GSH) levels [11], which not only inhibits the growth of certain cancer cells in vitro [7,12], but also blocks the assembly of virus particles by hindering disulfide bond formation that is required for envelope glycoprotein oligomerization [13].
T21 3043-3116 Sentence denotes These features offer a broad range of clinical applications for Tα1 [14].
T22 3117-3265 Sentence denotes In fact, a chemically synthesized Tα1 peptide drug has been marketed for more than 20 years under the trade name Zadaxin™ in more than 30 countries.
T23 3266-3468 Sentence denotes Zadaxin™ is clinically approved for the treatment of chronic hepatitis B (HBV), chronic hepatitis C (HCV), as a vaccine adjuvant, and as adjuvant therapy for chemotherapy-induced immune suppression [7].
T24 3469-3660 Sentence denotes Of note, the use of Tα1 has recently undergone reassessment in the context of modern cancer immunotherapies, as there is indication that this peptide may support immune checkpoint inhibition.
T25 3661-3878 Sentence denotes Preclinical data provide evidence that Tα1 transforms so called cold tumors, which poorly respond to immune checkpoint inhibitors, into highly lymphocyte-infiltrated tumors and, thus, boosts therapeutic efficacy [15].
T26 3879-4150 Sentence denotes Indeed, a retrospective study evaluating clinical phase II data reported an increase in overall survival of melanoma patients receiving sequentially Tα1 and the immune checkpoint inhibitor ipilimumab, a CTLA-4-blocking antibody, compared to ipilimumab therapy alone [16].
T27 4151-4342 Sentence denotes Moreover, Tα1 was shown to prevent intestinal toxicity in a murine model of anti-CTLA-4-induced colitis, hence contributing to an improved safety profile of immune checkpoint inhibitors [17].
T28 4343-4519 Sentence denotes Beyond that, emerging indications such as cystic fibrosis [18], multiple sclerosis [19], and sepsis [20] further emphasize the huge potential of this small therapeutic peptide.
T29 4520-4619 Sentence denotes Finally, with the outbreak of the COVID-19 pandemic, Tα1 recently gained new attention in virology.
T30 4620-4753 Sentence denotes Clinical symptoms of COVID-19 to some extent resemble a pathogen-induced sepsis, which justifies immunomodulatory Tα1 treatment [21].
T31 4754-4969 Sentence denotes Along these lines, Chinese medical staff members at high risk of COVID-19 infection already received a weekly Tα1 injection in combination with human interferon 1 (hIFN-α) nasal drops as a prophylactic measure [22].
T32 4970-5187 Sentence denotes Furthermore, a recent retrospective study in treated Chinese patients revealed that Tα1 significantly reduced the mortality of severe COVID-19 by restoration of lymphocytopenia and reversion of exhausted T cells [23].
T33 5188-5307 Sentence denotes However, there are two major drawbacks of the currently marketed Tα1, both of which are related to its peptidic nature.
T34 5308-5370 Sentence denotes First, the biopharmaceutical production of Tα1 is challenging.
T35 5371-5628 Sentence denotes Apart from the posttranslational modification via N-terminal acetylation, chemical synthesis of Tα1 is complex, and obstacles comprise the large number of required protecting groups as well as the aggregation tendency of intermediates during synthesis [24].
T36 5629-5737 Sentence denotes Furthermore, the overall yield of the solid-phase synthesis is low, typically reaching only around 25% [25].
T37 5738-5854 Sentence denotes On the other hand, the biotechnological production as a recombinant peptide in an economic manner has failed so far.
T38 5855-6009 Sentence denotes Short peptides, in general, are quickly degraded in the bacterial cytoplasm; thus, efficient one-step production of mature Tα1 in E. coli is not feasible.
T39 6010-6240 Sentence denotes An alternative would be expression as part of a larger protein such as natural ProTα [26], as artificial concatamers [27], in fusion with an intein [28] or in fusion with a highly expressed bacterial protein like thioredoxin [29].
T40 6241-6390 Sentence denotes In each case, enzymatic or chemical cleavage is necessary to liberate the mature peptide, which complicates the biopharmaceutical downstream process.
T41 6391-6559 Sentence denotes Second, after administration in vivo, the small peptide Tα1 is quickly eliminated via renal filtration with a terminal plasma half-life in humans of less than 3 h [30].
T42 6560-6664 Sentence denotes This limits its clinical efficacy and, to maintain viable drug levels, would require twice daily dosing.
T43 6665-6953 Sentence denotes In the present study, we applied the PASylation® technology in order to overcome both of these obstacles of the currently available Tα1 drug and to create a long-lasting N-terminally acetylated therapeutic peptide, also offering cheap and efficient biotechnological production in E. coli.
T44 6954-7172 Sentence denotes To this end, we combined fusion with a 600-residue polypeptide comprising the small natural L-amino acids Pro, Ala, and Ser [31] with in situ N-acetylation by overexpressing the host cell N-acetyltransferase RimJ [32].
T45 7173-7528 Sentence denotes The genetically encoded uncharged “PAS” sequence is highly soluble and structurally disordered, with an expanded hydrodynamic volume, thus showing a biophysical behavior very similar to the chemical polymer polyethylene glycol (PEG), which has been utilized for plasma half-life extension of a series of other therapeutic peptides and proteins [33,34,35].
T46 7530-7532 Sentence denotes 2.
T47 7533-7540 Sentence denotes Results
T48 7542-7546 Sentence denotes 2.1.
T49 7547-7596 Sentence denotes Cloning and Bacterial Production of PASylated Tα1
T50 7597-7990 Sentence denotes To achieve C-terminal PASylation of N-terminally acetylated Tα1, a plasmid harboring a bicistronic operon was constructed to allow the simultaneous expression of human Tα1 (UniProtKB ID: P06454; residues 2–29), C-terminally fused with a PAS polypeptide comprising 601 amino acids [34], and the E. coli N-acetyltransferase RimJ (UniProtKB ID: P0A948) based on the vector pASK75 (Figure 1) [36].
T51 7991-8173 Sentence denotes In a parallel attempt, a plasmid encoding an N-terminally PASylated Tα1 was constructed, again, using plasmid pASK75 as the backbone (this time omitting the RimJ cistron, see below).
T52 8174-8362 Sentence denotes Cytoplasmic gene expression was performed in both cases on a 2 L shake flask scale using the E. coli strain NEBexpress under control of the chemically inducible tet promoter/operator [36].
T53 8363-8452 Sentence denotes The whole cell lysate was analyzed prior to and 15 h after induction by Western blotting.
T54 8453-8758 Sentence denotes Using a monoclonal antibody that recognizes an epitope of the PAS#1 sequence, a distinct band with an approximate molecular size above 250 kDa was detected (Figure 1b), which demonstrated successful bacterial expression of the full-length C-terminally PASylated Tα1 (Tα1-PAS) without signs of degradation.
T55 8759-9075 Sentence denotes Of note, the unusually slow migration of Tα1-PAS (52.7 kD) in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) is well known for PASylated proteins [31,37] and can be explained by the poor binding of SDS (which provides the electrophoretic driving force) to the strongly hydrophilic PAS sequence.
T56 9077-9081 Sentence denotes 2.2.
T57 9082-9141 Sentence denotes Purification and In Vitro Characterization of PASylated Tα1
T58 9142-9361 Sentence denotes The uncharged PAS moiety, which does not alter the isoelectric point of the target peptide, facilitates classical protein precipitation by ammonium sulfate, thus providing an efficient and inexpensive purification step.
T59 9362-9606 Sentence denotes After adjusting the cleared whole cell extract prepared by mechanical cell lysis to 30% ammonium sulfate saturation, most of the host cell proteins remained in solution while both PAS-Tα1 and PAS-Tα1 were selectively recovered as a precipitate.
T60 9607-9773 Sentence denotes To remove residual E. coli proteins, the redissolved precipitate was subjected to ion exchange chromatography on a salt-tolerant anion exchange (AEX) resin at pH 8.5.
T61 9774-10041 Sentence denotes Even though the PASylated Tα1 peptide with a calculated pI of 4.3 [38] for both versions should be negatively charged under these conditions and, hence, is expected to adsorb to the resin, the recombinant fusion proteins were quantitatively found in the flow-through.
T62 10042-10170 Sentence denotes Possibly, the voluminous PAS polymer partially shields the small peptide from ionic interactions with the chromatography matrix.
T63 10171-10291 Sentence denotes Nevertheless, this step resulted in efficient depletion both of residual host cell proteins and of bacterial endotoxins.
T64 10292-10573 Sentence denotes The protein solutions were dialyzed against a citrate buffer at pH 3.0 and subsequently applied to a strong cation exchange (CEX) column, which resulted in a bound fraction for PAS-Tα1, whereas both a flow-through fraction and a bound fraction were observed for Tα1-PAS (Figure 2).
T65 10574-10822 Sentence denotes Electrospray ionization mass spectrometry (ESI-MS) analysis of Tα1-PAS in the flow-through revealed a molecular mass of 52,734.56 Da (Figure 2a), which exactly matches the calculated mass for the N-terminally acetylated gene product (52,734.56 Da).
T66 10823-11027 Sentence denotes In this case, the start methionine of Tα1-PAS (followed by a Ser residue) was fully processed, presumably by the bacterial methionine aminopeptidase [39], then followed by N-terminal acetylation via RimJ.
T67 11028-11379 Sentence denotes In contrast, the column-bound peptide fraction, which was eluted using a salt concentration gradient, showed a molecular mass of 52,692.38 Da (Figure 2b), which corresponds to the calculated mass for the non-acetylated processed polypeptide (52,692.54 Da) accompanied by some minor peaks below 40 kDa, most likely due to residual host cell impurities.
T68 11380-11538 Sentence denotes Accordingly, this CEX step enabled separation of the desired N-acetylated Tα1-PAS from its non-acetylated precursor as a result of a single charge difference.
T69 11539-11730 Sentence denotes In comparison, the fully column-bound non-acetylated PAS-Tα1 showed a single molecular mass of 52,789.8 Da (Figure 3) corresponding to the intact peptide, again, lacking the start methionine.
T70 11731-11857 Sentence denotes Both PASylated peptide preparations had a purity > 96% as indicated by reverse-phase chromatography (Figure 2c and Figure 3c).
T71 11858-11960 Sentence denotes For Tα1-PAS, we performed a final AEX polishing step, which also allowed concentration of the peptide.
T72 11961-12087 Sentence denotes At pH 10, the acetylated Tα1-PAS bound to a strong AEX resin and eluted as a homogenous peak in a salt concentration gradient.
T73 12088-12234 Sentence denotes The endotoxin content of this fraction was very low, with < 0.1 EU/mg, and the final yield was 15 mg acetylated Tα1-PAS per 1 L bacterial culture.
T74 12235-12436 Sentence denotes In comparison, the final yield of the fully column-bound (non-acetylated) PAS-Tα1 reached 50 mg per 1 L bacterial culture after CEX chromatography and, again, the endotoxin content was below 0.1 EU/mg.
T75 12437-12625 Sentence denotes Analytical size exclusion chromatography (SEC) of both PASylated peptide versions revealed a single symmetric peak without any signs of aggregation or truncation (Figure 2d and Figure 3d).
T76 12626-12692 Sentence denotes The N-terminally acetylated Tα1-PAS eluted at 13.5 mL (bed volume:
T77 12693-12814 Sentence denotes 24 mL), whereas PAS-Tα1 eluted at 13.2 mL, thus indicating apparent molecular sizes of 557 kDa and 665 kDa, respectively.
T78 12815-13125 Sentence denotes This is more than 10 times (Tα1-PAS) or even 12 times (PAS-Tα1) larger than the true molecular mass of both PASylated peptides (52.7 kDa), which demonstrates the huge expansion of the hydrodynamic molecular volume caused by the random-coil structure of the PAS polymer, in line with previous observations [35].
T79 13127-13131 Sentence denotes 2.3.
T80 13132-13189 Sentence denotes PASylation Strongly Prolongs Tα1 Pharmacokinetics in Rats
T81 13190-13347 Sentence denotes To mimic the clinically approved route of Zadaxin™ administration, the N-acetylated Tα1-PAS was injected subcutaneously into the dorsal area of rats (N = 5).
T82 13348-13484 Sentence denotes The injected dose of 3.4 mg/kg Tα1-PAS was well tolerated without any drug-related adverse events or significant changes in body weight.
T83 13485-13706 Sentence denotes The Tα1-PAS plasma levels at various sampling times were analyzed using a quantitative sandwich ELISA developed to detect only Tα1-PAS and no endogenous rat Tα1, which shares 100% sequence identity with the human peptide.
T84 13707-13882 Sentence denotes The pharmacokinetic (PK) profile of Tα1-PAS (Figure 4) exhibited a typical curve according to the Bateman function [40], with a Cmax of 25.6 ± 4.4 mg/L at tmax = 22.7 ± 1.1 h.
T85 13883-14101 Sentence denotes Curve fitting with the WinNonlin software revealed a drastically extended terminal half-life of 15.9 ± 0.9 h, which is more than 8-fold longer than the one for the native peptide (τ1/2 = 1.9 h) published for rats [41].
T86 14102-14269 Sentence denotes The strong impact of PASylation on the PK profile is also reflected by other parameters such as the large area under the curve (AUC) and slow clearance (CL) (Table 1).
T87 14271-14273 Sentence denotes 3.
T88 14274-14284 Sentence denotes Discussion
T89 14285-14485 Sentence denotes The present data demonstrate that the PASylation technology can solve two major problems of a peptide drug: (i) instability in the expression host and (ii) low bioactivity due to fast renal clearance.
T90 14486-14727 Sentence denotes Typically, small peptides, if expressed in a soluble state in E. coli, are quickly degraded by host cell proteases [42] and, thus, require production as larger fusion proteins as well as subsequent release by site-specific cleavage in vitro.
T91 14728-14970 Sentence denotes Here, fusion with a random-coil forming PAS sequence of ~600 amino acids prevented proteolytic degradation and allowed cost-efficient one-step production of the intact fusion protein in E. coli without the need of additional processing steps.
T92 14971-15397 Sentence denotes Of note, in contrast to classical approaches, which involve the use of an insoluble fusion partner, for example, an α-galactosidase fragment in the case of insulin [43], to provoke formation of inclusion bodies and protect the gene product from intracellular proteolysis, the PASylated Tα1 peptide was recovered as a soluble fusion protein, thus allowing direct purification from the cell extract without solubilization steps.
T93 15398-15522 Sentence denotes Furthermore, the C-terminally attached PAS moiety was compatible with N-terminal acetylation by RimJ as confirmed by ESI-MS.
T94 15523-15851 Sentence denotes Yields of our expression study at the research scale reached 15 mg purified acetylated Tα1-PAS and even 50 mg PAS-Tα1 per 1 L bacterial culture (at an optical density (OD) of 3), which surpasses the reported yield of a bacterially produced (yet probably non-acetylated and non-glycosylated) Tα1-Fc fusion protein (16 mg/L) [44].
T95 15852-16093 Sentence denotes Still, there is considerable opportunity of improvement for both versions of the PASylated peptide by optimizing the expression plasmid and the production process, including high cell density fermentation under controlled feeding conditions.
T96 16094-16285 Sentence denotes Apart from that, the absence of a prominent band for the co-expressed enzyme RimJ in SDS-PAGE despite approximately 50% N-terminal acetylation of Tα1-PAS also indicates room for amelioration.
T97 16286-16516 Sentence denotes Optimization of the ribosome-binding site preceding the RimJ cistron or changing the order within the bicistronic operon should boost biosynthesis of the enzyme and result in increased yield of the N-terminally acetylated Tα1-PAS.
T98 16517-16782 Sentence denotes Finally, the use of a high-efficiency secretory bacterial expression system such as ESETEC [45] or CORYNEX [46,47] should lead to higher product titers as previously demonstrated for other PASylated fusion proteins such as PASylated human growth hormone (hGH) [48].
T99 16783-16962 Sentence denotes The yield of functional PAS-hGH was more than 100-fold higher with the ESETEC system than in a conventional laboratory strain of E. coli, reaching several grams per liter culture.
T100 16963-17112 Sentence denotes Attachment of the PAS sequence at either end of the Tα1 peptide increased the hydrodynamic volume by more than an order of magnitude as shown by SEC.
T101 17113-17339 Sentence denotes This strongly expanded molecular size resulted in a plasma half-life in rats of around 16 h after a subcutaneous injection of Tα1-PAS, which is more than an 8-fold increase compared to the unmodified peptide drug (1.9 h) [41].
T102 17340-17537 Sentence denotes Based on in vitro cell culture assays with human serum albumin fusion proteins [49], both the C-terminus and the N-terminus of Tα1 should be permissible to modification while retaining bioactivity.
T103 17538-17728 Sentence denotes This was also shown in animal tumor models for C-terminal fusion with an immunoglobulin Fc fragment [41], an internalizing arginylglycylaspartic acid peptide iRGD [50], and thymopentin [51].
T104 17729-17976 Sentence denotes However, in the case of Tα1, some caution is appropriate regarding the significance of in vitro cell culture assays as its mode of action is complex and involves different receptors provoking multiple biological effects on various cell types [52].
T105 17977-18169 Sentence denotes Second, a prolonged circulation in the body as demonstrated here via application of the PASylation technology influences both binding kinetics and bioactivity, which is not reflected in vitro.
T106 18170-18544 Sentence denotes While attachment of large macromolecules, such as PAS polypeptides or albumin, but also PEG [53], can lead to lower receptor association rates for bioactive peptides or proteins, this is usually overcompensated by the drastically prolonged in vivo half-life, which results in a strongly enhanced bioactivity as demonstrated for multiple PASylated biopharmaceuticals [37,54].
T107 18545-18703 Sentence denotes In the case of Tα1, superior effects in preclinical cancer models due to prolonged circulation were recently demonstrated for a Tα1-Fc fusion protein [41,44].
T108 18704-18919 Sentence denotes Such studies would be the obvious next step to investigate enhanced in vivo bioactivity of PASylated Tα1, and it will be interesting to see whether its N-terminally or C-terminally PASylated version performs better.
T109 18920-19215 Sentence denotes In comparison with other published approaches to prolong the circulation of Tα1, the measured terminal half-life of Tα1-PAS is even longer than the value of around 8.2 h reported for a corresponding PEGylated peptide after an intravenous injection into the tail vein of Sprague–Dawley rats [55].
T110 19216-19356 Sentence denotes This modified Tα1 was prepared by chemically coupling a 5 kDa methoxypolyethylene glycol maleimide via an engineered N-terminal Cys residue.
T111 19357-19593 Sentence denotes Of note, according to the rules of allometric scaling, a much longer half-life in the range of several days can be expected for Tα1-PAS in humans [56,57], which would allow weekly dosing while achieving a lasting pharmacological effect.
T112 19594-19838 Sentence denotes According to the prescription information for Zadaxin™ to treat chronic hepatitis B, the recommended dose for the monotherapy, or the combination therapy with interferon, is a 1.6 mg subcutaneous injection twice weekly over 6 months (52 doses).
T113 19839-19949 Sentence denotes Consequently, weekly or biweekly injections would considerably decrease patient burden and improve compliance.
T114 19950-20164 Sentence denotes Moreover, a more continuous plasma level above the minimum effective dose due to slower clearance, as illustrated by the drastically increased AUC, should boost in vivo efficacy and open new treatment perspectives.
T115 20165-20553 Sentence denotes Especially in preclinical animal models, which typically suffer from a much quicker drug clearance compared to humans [37] owing to their smaller body size, a long-acting Tα1 should lead to more convincing pharmacodynamic (PD) effects and pave the way for biopharmaceutical development for novel indications such as cystic fibrosis [18], HIV-1 infection [58], sepsis [20], or cancer [59].
T116 20554-20692 Sentence denotes For example, cancer studies have demonstrated that high doses of the conventional peptide are required to achieve antitumor activity [60].
T117 20693-20812 Sentence denotes The beneficial application of the PASylation technology demonstrated in this work can be transferred to other peptides.
T118 20813-21028 Sentence denotes There are more than 7000 naturally occurring peptides covering a wide range of physiological functions [61], including many peptides with proven therapeutic potential, which could profit from the presented approach.
T119 21029-21258 Sentence denotes Examples are therapeutically active peptides such as thymosin beta 4 [62,63], the C-type natriuretic peptide (CNP) [64], human parathyroid hormone (PTH) [65], relaxin [66], or glucagon-like peptide-1 (GLP-1) and its analogs [67].
T120 21259-21486 Sentence denotes Today, it is generally recognized that intrinsic weaknesses of this drug class, such as poor stability and short circulating plasma half-life, need to be addressed in order to transform peptides into efficacious medicines [61].
T121 21487-21595 Sentence denotes The approach described here, N- or C-terminal PASylation, optionally combined with acetylation, solves both.
T122 21596-21794 Sentence denotes On the one hand, N-terminal acetylation protects peptides from proteolytic degradation by exoproteases, for example, dipeptidyl peptidase-4 (DPP-IV), as shown for N-terminally acetylated GLP-1 [68].
T123 21795-22034 Sentence denotes On the other hand, PASylation increases the hydrodynamic volume of the peptide above the pore size of the glomerular basement membrane, hence retarding kidney filtration and prolonging the pharmacodynamic effect of its fusion partner [31].
T124 22035-22107 Sentence denotes Furthermore, PASylation can serve as a linker to join two peptides [69].
T125 22108-22232 Sentence denotes This is of particular interest if both entities act synergistically, for example, GLP-1 and GIP [70] or Tα1 and GM-CSF [71].
T126 22233-22498 Sentence denotes Alternatively, the biologically active protein/peptide can be linked via the PAS sequence to a targeting domain such as the arginylglycylaspartic acid peptide RGD peptide which binds to integrins αVβ3 and αVβ5 in order to enhance tumor penetration and accumulation.
T127 22499-22656 Sentence denotes In fact, fusion of the short-acting Tα1 with the tumor-targeting iRGD peptide using a Gly4 linker has recently demonstrated enhanced antitumor activity [50].
T128 22657-22829 Sentence denotes In contrast to synthetic PEG linkers, which are commonly used for bioconjugations, the recombinant PAS sequence exhibits a precisely defined size and is biodegradable [72].
T129 22830-23009 Sentence denotes The PAS polypeptide itself is stable in blood plasma but quickly degraded by intracellular enzymes, thus avoiding organ accumulation [31], a well-known effect for PEGylation [73].
T130 23010-23327 Sentence denotes Moreover, PAS sequences are non-immunogenic in animals [31,74] and offer a one-step production of PASylated peptides in various commercially scalable expression systems including bacteria, yeasts, or mammalian cells [35,48], which would even allow the preparation of peptides carrying posttranslational modifications.
T131 23329-23331 Sentence denotes 4.
T132 23332-23353 Sentence denotes Materials and Methods
T133 23355-23359 Sentence denotes 4.1.
T134 23360-23398 Sentence denotes Construction of the Expression Plasmid
T135 23399-23686 Sentence denotes A bicistronic operon for the simultaneous expression of human Tα1 (UniProt P06454, residues 2–29) and the E. coli N-acetyltransferase RimJ (UniProt P0A948) flanked by the restriction sites NdeI and HindIII was prepared using gene synthesis (Thermofisher Scientific, Regensburg, Germany).
T136 23687-24027 Sentence denotes To this end, the coding sequence of human Tα1 was codon-optimized for expression in E. coli and linked to the RimJ structural gene via the nucleotide sequence GCCTGAAGAGCAGAAAATAAA comprising a “GCC” alanine codon, the opal stop codon “TGA”, a SapI restriction site for insertion of the PAS gene cassette, and a ribosome-binding site (RBS).
T137 24028-24207 Sentence denotes The entire gene fragment was subcloned via NdeI and HindIII on a derivative of pASK75 [36] for cytoplasmic expression under control of the tetracycline promoter/operator (tetp/o).
T138 24208-24498 Sentence denotes Subsequently, a substantially non-repetitive sequence-verified PAS gene cassette [34] encoding a PAS#1 polypeptide of 601 amino acids was inserted via the SapI restriction site to create the expression vector for the C-terminally PASylated thymosin α1 (Tα1-PAS), pASK75-Tα1-PAS#1(600)/RimJ.
T139 24499-24761 Sentence denotes To construct a plasmid for the bacterial production of an N-terminally PASylated Tα1 (PAS-Tα1), the synthetic gene of human Tα1 was amplified via PCR using the primers THY-For (5’-AGCTCTTCTGCCAGTGATGCAGCAGTTGATACC) and THY-Rev (5’-GCTCAAGCTTAGTTCTCGGCTTCTTCCAC).
T140 24762-24964 Sentence denotes The PCR product was digested with SapI and HindIII and inserted via these restriction sites downstream of the PAS#1(600) sequence preceded by Met and Pro encoded on a suitable pASK75 plasmid derivative.
T141 24966-24970 Sentence denotes 4.2.
T142 24971-25020 Sentence denotes Bacterial Production of Recombinant PASylated Tα1
T143 25021-25218 Sentence denotes The BL21 derivative E. coli strain NEBexpress® (New England Biolabs, Frankfurt am Main, Germany) was transformed with the plasmids pASK75-Tα1-PAS#1(600)/RimJ or pASK75-MP-PAS#1(600)-Tα1 from above.
T144 25219-25374 Sentence denotes Two milliliters of Terrific Broth supplemented with 100 µg/mL ampicillin (TBamp) was inoculated with a single colony and grown overnight at 37 °C, 170 rpm.
T145 25375-25512 Sentence denotes This overnight culture was used to inoculate a 50 mL preculture, which was grown under the same conditions until OD550 = 1.1 was reached.
T146 25513-25637 Sentence denotes Subsequently, the 50 mL preculture was transferred into 2 L TBamp and incubated in a 5 L baffled flask at 37 °C and 100 rpm.
T147 25638-25786 Sentence denotes After reaching OD550 = 0.6, the temperature was decreased to 26 °C and the cells were subsequently induced at OD550 = 1 with 200 µg/mL aTc for 15 h.
T148 25788-25792 Sentence denotes 4.3.
T149 25793-25822 Sentence denotes Purification of PASylated Tα1
T150 25823-25986 Sentence denotes Bacteria were harvested by centrifugation and disrupted in the presence of 100 mM citric acid using an EmulsiFlex C5 cell homogenizer (Avestin, Mannheim, Germany).
T151 25987-26142 Sentence denotes After centrifugation for 20 min (39,200× g) at 16 °C, the supernatant was filter-sterilized using a 0.45 µm syringe filter (Sartorius, Göttingen, Germany).
T152 26143-26287 Sentence denotes The clear filtrate was adjusted with ammonium sulfate to 30% saturation, stirred for 30 min at RT, and centrifuged for 30 min (39,200× g) at RT.
T153 26288-26476 Sentence denotes The precipitate was solubilized in subtractive AEX buffer (sAEX; 20 mM Tris/HCl, 1 mM EDTA, pH 8.5), filter-sterilized, and dialyzed twice against a 100-fold volume of sAEX buffer at 4 °C.
T154 26477-26626 Sentence denotes Subsequent chromatography steps were performed on an ÄKTA Explorer 100 system (GE Healthcare, Freiburg, Germany) operated at a flow rate of 5 mL/min.
T155 26627-26795 Sentence denotes The dialyzed sample (Tα1-PAS or PAS-Tα1) was first applied to a 5 mL TOYOPEARL NH2-750F column (Tosoh Bioscience, Griesheim, Germany) equilibrated with the sAEX buffer.
T156 26796-26954 Sentence denotes The flow-through containing the PASylated Tα1 was collected and dialyzed twice against a 100-fold volume of the CEX buffer (20 mM Na-citrate, pH 3.0) at 4 °C.
T157 26955-27087 Sentence denotes The protein solution was then applied to an 85 mL TOYOPEARL Sulfate-650F column (Tosoh Bioscience) equilibrated with the CEX buffer.
T158 27088-27232 Sentence denotes PAS-Tα1 quantitatively bound to the column and the pure protein was eluted using a NaCl concentration gradient (0–250 mM over 2 column volumes).
T159 27233-27455 Sentence denotes In the case of Tα1-PAS, the CEX flow-through fraction contained the N-terminally acetylated protein, whereas the non-acetylated Tα1-PAS stayed bound to the column and could again be eluted in a NaCl concentration gradient.
T160 27456-27727 Sentence denotes The acetylated Tα1-PAS fraction from the flow-through was dialyzed twice against AEX buffer (20 mM ethanolamine/HCl, pH 10) and then applied to a 100 mL Fractogel® EMD TMAE (M)strong anion exchanger (Merck Millipore, Burlington, MA, USA) equilibrated with the AEX buffer.
T161 27728-27868 Sentence denotes This time, highly pure acetylated Tα1-PAS was eluted using a NaCl concentration gradient (0–200 mM over 2 column volumes) in the AEX buffer.
T162 27869-28012 Sentence denotes Both purified PASylated peptides were dialyzed 5 times against a 200-fold volume of water, lyophilized, and stored at −20 °C until further use.
T163 28014-28018 Sentence denotes 4.4.
T164 28019-28059 Sentence denotes Analytical Size Exclusion Chromatography
T165 28060-28247 Sentence denotes Analytical SEC was performed on a 24 mL Superose® 6 10/300 GL column (GE Healthcare) using an ÄKTA Explorer 10 system operated at a flow rate of 0.5 mL/min with PBS as the running buffer.
T166 28248-28702 Sentence denotes To determine the apparent molecular size, purified PAS-Tα1 or PAS-Tα1 (100 µL) was applied to the column and the elution volume was used for linear interpolation from a half-logarithmic calibration line obtained using the reference proteins thyroglobulin (octamer), thyroglobulin (tetramer), apoferritin, β-amylase, alcohol dehydrogenase (tetramer), transferrin, ovalbumin, and carboanhydrase as well as blue dextran (all from Merck, Darmstadt, Germany).
T167 28704-28708 Sentence denotes 4.5.
T168 28709-28733 Sentence denotes Endotoxin Quantification
T169 28734-29077 Sentence denotes Tα1-PAS samples were diluted to 1 mg/mL in endotoxin-free water (Veolia Water Technologies, Celle, Germany), heated to 90 °C for 5 min, and, after cooling down to RT, bacterial endotoxins were quantified using an Endosafe® system (Charles River Laboratories, Wilmington, MA, USA) with an FDA-licensed PTS™ cartridge (10–0.1 EU/mL sensitivity).
T170 29079-29083 Sentence denotes 4.6.
T171 29084-29105 Sentence denotes Western Blot Analysis
T172 29106-29416 Sentence denotes The whole cell protein extract was applied to a 4–12% SurePAGE™ Bis–Tris gradient gel (Genscript, Piscataway, NJ, USA) with 3-(N-morpholino)propanesulfonic acid (MOPS) as running buffer and electrotransferred onto a nitrocellulose membrane using an iBlot 1 dry blotting system (ThermoFisher, Waltham, MA, USA).
T173 29417-29574 Sentence denotes After washing 3 times with PBS supplemented with 0.1% v/v Tween 20 (PBS/T), the membrane was incubated with 1 µg/mL anti-PAS antibody in PBS/T for 1 h at RT.
T174 29575-29746 Sentence denotes The membrane was washed 3 times with PBS/T and incubated with a 1:5000 dilution of a goat anti-mouse IgG (Fc-specific) alkaline phosphatase (AP) conjugate (Merck) for 1 h.
T175 29747-29973 Sentence denotes After washing twice with PBS/T and twice with PBS, the blot was developed by a chromogenic reaction using BCIP (37.5 µg/mL) and NBT (150 µg/mL) in alkaline phosphatase buffer (100 mM Tris/HCl, pH 8.8, 100 mM NaCl, 5 mM MgCl2).
T176 29975-29979 Sentence denotes 4.7.
T177 29980-30040 Sentence denotes Reverse-Phase Chromatography (RPC) and ESI Mass Spectrometry
T178 30041-30294 Sentence denotes Directly after the CEX chromatography, a 200 µl sample of PAS-Tα1 or PAS-Tα1 was adjusted to 2% v/v acetonitrile, 0.1% v/v formic acid and applied to a Resource RPC 1 mL column (GE Healthcare) equilibrated with 2% v/v acetonitrile, 0.1% v/v formic acid.
T179 30295-30517 Sentence denotes The protein was eluted using a concentration gradient of up to 80% v/v acetonitrile, 0.1% v/v formic acid over 20 column volumes at a flow rate of 2 mL/min while spectrophotometrically monitoring protein elution at 225 nm.
T180 30518-30696 Sentence denotes The eluted protein fraction was directly injected into a maXis quadrupole time of flight (Q-TOF) instrument (Bruker Daltonics, Bremen, Germany) operated in the positive ion mode.
T181 30697-30770 Sentence denotes Raw data was deconvoluted using the MaxEntX algorithm (Bruker Daltonics).
T182 30772-30776 Sentence denotes 4.8.
T183 30777-30809 Sentence denotes Pharmacokinetic Analysis in Rats
T184 30810-30949 Sentence denotes A PK study in female Wistar rats at 8–9 weeks of age was conducted at the Aurigon Toxicological Research Center (ATRC, Dunakeszi, Hungary).
T185 30950-31091 Sentence denotes Up to 3 animals per cage were housed in a controlled environment at 22 ± 3 °C with a relative humidity of 50 ± 20%, 12 h light and 12 h dark.
T186 31092-31216 Sentence denotes Endotoxin-free purified Tα1-PAS (3.4 mg/kg) was administered subcutaneously via a single injection into the rat dorsal area.
T187 31217-31294 Sentence denotes Blood samples (100 µL) were taken from 5 animals each at various time points.
T188 31295-31554 Sentence denotes Following collection in tubes containing tri-potassium ethylenediaminetetraacetic acid (K3-EDTA) (Greiner Bio-One, Frickenhausen, Germany), samples were centrifuged at room temperature for 10 min (3000× g) and the resulting plasma was stored at −15 to −30 °C.
T189 31555-31802 Sentence denotes Tα1-PAS in these samples was quantified using sandwich ELISA (see below) and the data were analyzed using the Phoenix WinNonlin 6.3 software (Certara, Princeton, NJ, USA) using a one-compartment model assuming 1st order absorption and elimination.
T190 31804-31808 Sentence denotes 4.9.
T191 31809-31843 Sentence denotes Quantification of Purified Tα1-PAS
T192 31844-31934 Sentence denotes Due to the absence of aromatic side chains, PASylated Tα1 does not absorb light at 280 nm.
T193 31935-32057 Sentence denotes Thus, for reliable quantification via the peptide backbone absorption, an extinction coefficient at 225 nm was determined.
T194 32058-32171 Sentence denotes To this end, highly pure Tα1-PAS was lyophilized from water, weighed, and dissolved in a defined volume of water.
T195 32172-32406 Sentence denotes The concentration of this Tα1-PAS solution was additionally quantified by measuring the backbone peptide groups using UV absorption at 205 nm using a generic calculated extinction coefficient [75], which led to a fair agreement (±6%).
T196 32407-32560 Sentence denotes The absorbance at 225 nm was measured for various dilutions of the gravimetrically prepared peptide stock solution and plotted against the concentration.
T197 32561-32668 Sentence denotes The linear range was fitted by a straight line, resulting in an extinction coefficient of 253,057 M−1⋅cm−1.
T198 32669-32773 Sentence denotes While most buffers strongly absorb light at 205 nm, such a spectral overlap is usually absent at 225 nm.
T199 32775-32780 Sentence denotes 4.10.
T200 32781-32818 Sentence denotes ELISA Quantification of PASylated Tα1
T201 32819-32939 Sentence denotes A 96-well Nunc Maxisorb ELISA plate (ThermoFisher) was coated with 100 µg/mL anti-PAS antibody in PBS at 4 °C overnight.
T202 32940-33080 Sentence denotes After washing twice with PBS/T, free binding sites were blocked with 3% w/v bovine serum albumin (BSA) in PBS/T at room temperature for 1 h.
T203 33081-33303 Sentence denotes After washing 3 times with PBS/T, the rat plasma samples were applied in dilution series in PBS/T supplemented with 0.5% (v/v) plasma from an untreated animal (to maintain a constant proportion of rat plasma constituents).
T204 33304-33452 Sentence denotes In the same manner, a standard curve was prepared using dilution series of purified Tα1-PAS (used for spiking rat plasma) at defined concentrations.
T205 33453-33522 Sentence denotes After incubation for 1 h at RT, wells were washed 3 times with PBS/T.
T206 33523-33785 Sentence denotes To detect bound Tα1-PAS, wells were incubated for 1 h with 50 µl of a 1 µg/mL PBS/T solution of the second anti-PAS antibody conjugated with alkaline phosphatase using the Lightning-Link alkaline phosphatase antibody labeling kit (BioTechne, Wiesbaden, Germany).
T207 33786-33915 Sentence denotes After washing twice with PBS/T and twice with PBS, the enzymatic activity was detected using p-nitrophenyl phosphate (0.5 mg/mL).
T208 33916-34206 Sentence denotes To this end, the plate was incubated for 20 min at 30 °C, the absorbance was measured at 405 nm using a SpectraMax M5e microtiter plate reader (Molecular Devices, Sunnyvale, CA, USA) and the Tα1-PAS concentrations in rat plasma samples were quantified by comparison with the standard curve.
T209 34208-34223 Sentence denotes Acknowledgments
T210 34224-34437 Sentence denotes The authors wish to thank Nicole Däschlein, Hyun-Jin Kim and Rebecca Walser, all at XL-protein, for help in gene cloning and western blotting and Corinna Brandt and Stefan Achatz at TUM for performing MS analyses.
T211 34438-34561 Sentence denotes Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.
T212 34563-34583 Sentence denotes Author Contributions
T213 34584-34680 Sentence denotes Conceptualization, U.B. and A.S.; experimental work, U.B.; manuscript preparation, U.B. and A.S.
T214 34681-34757 Sentence denotes All authors have read and agreed to the published version of the manuscript.
T215 34759-34766 Sentence denotes Funding
T216 34767-34810 Sentence denotes This research received no external funding.
T217 34812-34848 Sentence denotes Institutional Review Board Statement
T218 34849-34987 Sentence denotes The study was conducted in compliance with applicable animal welfare regulations (Institutional Animal Care and Use Committee approval No.
T219 34988-35006 Sentence denotes 2020_ATRC/5999_F).
T220 35007-35233 Sentence denotes The permission code for PK studies (PK, metabolism, and bioequivalence) was PE/EA/1374-5/2017 and the permitting authority was the Government Office for Pest County, Directorate of Food Chain Safety and Animal Health, Hungary.
T221 35235-35261 Sentence denotes Informed Consent Statement
T222 35262-35277 Sentence denotes Not applicable.
T223 35279-35306 Sentence denotes Data Availability Statement
T224 35307-35396 Sentence denotes The data presented in this study are available on request from the corresponding authors.
T225 35398-35419 Sentence denotes Conflicts of Interest
T226 35420-35486 Sentence denotes U.B. and A.S. are co-founders and shareholders of XL-protein GmbH.
T227 35487-35500 Sentence denotes Abbreviations
T228 35501-35520 Sentence denotes AEX Anion exchange
T229 35521-35545 Sentence denotes AP Alkaline phosphatase
T230 35546-35584 Sentence denotes aTc Anhydrotetracycline hydrochloride
T231 35585-35608 Sentence denotes AUC Area und the curve
T232 35609-35651 Sentence denotes BCIP 5-Bromo-4-chloro-3-indoxyl phosphate
T233 35652-35677 Sentence denotes BSA Bovine serum albumin
T234 35678-35698 Sentence denotes CEX Cation exchange
T235 35699-35712 Sentence denotes CL Clearance
T236 35713-35756 Sentence denotes Cmax Maximum (or peak) serum concentration
T237 35757-35788 Sentence denotes CNP C-type natriuretic peptide
T238 35789-35850 Sentence denotes CORYNEX Corynebacterium glutamicum protein expression system
T239 35851-35908 Sentence denotes COVID-19 Severe acute respiratory syndrome coronavirus 2
T240 35909-35960 Sentence denotes CTLA-4 Cytotoxic T-lymphocyte-associated protein 4
T241 35961-35978 Sentence denotes CV Column volume
T242 35979-35999 Sentence denotes DCs Dendritic cells
T243 36000-36030 Sentence denotes DPP-IV Dipeptidyl peptidase-4
T244 36031-36071 Sentence denotes ELISA Enzyme-linked immunosorbent assay
T245 36072-36108 Sentence denotes ESETEC E. coli secretion technology
T246 36109-36158 Sentence denotes ESI-MS Electrospray ionization mass spectrometry
T247 36159-36199 Sentence denotes FPLC Fast protein liquid chromatography
T248 36200-36213 Sentence denotes GCC Glucagon
T249 36214-36263 Sentence denotes GIP Glucose-dependent insulinotropic polypeptide
T250 36264-36294 Sentence denotes GLP-1 Glucagon-like peptide 1
T251 36295-36351 Sentence denotes GM-CSF Granulocyte-macrophage colony-stimulating factor
T252 36352-36389 Sentence denotes GSH γ-L-Glutamyl-L-cysteinyl-glycine
T253 36390-36412 Sentence denotes HBV Hepatitis B virus
T254 36413-36435 Sentence denotes HCV Hepatitis C virus
T255 36436-36461 Sentence denotes hGH Human growth hormone
T256 36462-36488 Sentence denotes hIFN-α Human interferon 1
T257 36489-36526 Sentence denotes HIV-1 Human immunodeficiency virus I
T258 36527-36581 Sentence denotes iRGD Internalizing arginylglycylaspartic acid peptide
T259 36582-36636 Sentence denotes K3-EDTA Tri-potassium ethylenediaminetetraacetic acid
T260 36637-36674 Sentence denotes MHC Major histocompatibility complex
T261 36675-36717 Sentence denotes MOPS 3-(N-morpholino)propanesulfonic acid
T262 36718-36745 Sentence denotes NBT Nitro blue tetrazolium
T263 36746-36775 Sentence denotes OD Optical density at 550 nm
T264 36776-36810 Sentence denotes PAS Proline/alanine-rich sequence
T265 36811-36846 Sentence denotes PAS-Tα1 N-terminally PASylated Tα1
T266 36847-36877 Sentence denotes PBS Phosphate-buffered saline
T267 36878-36898 Sentence denotes PD Pharmacodynamics
T268 36899-36923 Sentence denotes PEG Polyethylene glycol
T269 36924-36928 Sentence denotes p.i.
T270 36930-36944 Sentence denotes Post injection
T271 36945-36965 Sentence denotes PK Pharmacokinetics
T272 36966-36990 Sentence denotes ProTα Prothymosin alpha
T273 36991-37015 Sentence denotes PTH Parathyroid hormone
T274 37016-37048 Sentence denotes Q-TOF Quadrupole time of flight
T275 37049-37075 Sentence denotes RBS Ribosome-binding site
T276 37076-37107 Sentence denotes RGD Arginylglycylaspartic acid
T277 37108-37162 Sentence denotes RimJ Ribosomal-protein-S5-alanine N-acetyltransferase
T278 37163-37196 Sentence denotes RPC Reverse phase chromatography
T279 37197-37217 Sentence denotes RT Room temperature
T280 37218-37252 Sentence denotes SEC Size exclusion chromatography
T281 37253-37320 Sentence denotes SDS-PAGE Sodium dodecyl sulfate polyacrylamide gel electrophoresis
T282 37321-37353 Sentence denotes τ1/2α Half-life of distribution
T283 37354-37382 Sentence denotes τ1/2β Elimination half-life
T284 37383-37404 Sentence denotes Tα1 Thymosin alpha 1
T285 37405-37453 Sentence denotes Tα1-PAS C-terminally PASylated Thymosin alpha 1
T286 37454-37492 Sentence denotes tetp/o Tetracycline promoter/operator
T287 37493-37510 Sentence denotes Th T helper cell
T288 37511-37539 Sentence denotes tlpp Lipoprotein terminator
T289 37540-37567 Sentence denotes TLR-2 Toll-like receptor 1
T290 37568-37595 Sentence denotes TLR-9 Toll-like receptor 2
T291 37596-37621 Sentence denotes TMAE Trimethylaminoethyl
T292 37622-37646 Sentence denotes tmax Time to reach Cmax
T293 37648-37846 Sentence denotes Figure 1 Bacterial production of N-terminally acetylated Tα1-PAS. (a) Expression vector for Tα1-PAS and the N-acetyltransferase RimJ from a bicistronic operon under control of the inducible tetp/o.
T294 37847-38251 Sentence denotes The gene cassette cloned on pASK75 comprises the T7 phage ribosome binding site (T7 RBS) followed by the coding sequence for human Tα1 fused to a 601-residue PAS#1 sequence, the second RBS, the coding sequence for RimJ, and the lipoprotein terminator (tlpp). (b) Western blot analysis after 4–12% SDS–PAGE of Tα1-PAS in the E. coli whole cell lysate using an antibody directed against the PAS#1 sequence.
T295 38252-38409 Sentence denotes M, protein size standard; lane 1, whole cell extract before induction; lane 2, whole cell extract 15 h after induction. (c) 10% SDS-PAGE of purified Tα1-PAS.
T296 38410-38576 Sentence denotes M, protein size standard; lane 1, Tα1-PAS after ammonium sulfate precipitation, subtractive anion exchange (AEX), cation exchange (CEX), and final AEX chromatography.
T297 38577-38869 Sentence denotes Figure 2 Analysis of Tα1-PAS N-acetylation, peptide purity, and hydrodynamic volume. (a) The deconvoluted ESI-MS spectrum of the Tα1-PAS flow-through fraction after the subtractive AEX step (see text) shows a molecular mass of 52,734.56 Da, corresponding to N-acetylated Tα1-PAS (calc. mass:
T298 38870-39367 Sentence denotes 52,734.56 Da). (b) ESI-MS analysis of the bound and eluted peptide fraction from the same chromatography reveals a molecular mass of 52,692.37 Da, which matches the calculated mass of non-acetylated Tα1-PAS (52,692.54 Da). (c) Reverse-phase chromatography of the flow-through fraction indicates a purity > 96% for N-acetylated Tα1-PAS. (d) Analytical SEC of the finally purified Tα1-PAS in the presence of phosphate-buffered saline (PBS) results in a single peak with an elution volume of 13.5 mL.
T299 39368-39514 Sentence denotes Comparison with a half-logarithmic calibration curve (inset) indicates an expanded hydrodynamic volume with an apparent molecular size of 557 kDa.
T300 39515-39719 Sentence denotes Figure 3 Preparation of an N-terminally PASylated version of the Tα1 peptide and analysis of its integrity, purity, and hydrodynamic volume. (a) Expression vector for the bacterial production of PAS-Tα1.
T301 39720-40373 Sentence denotes The gene cassette cloned on pASK75 comprises the T7 RBS, the coding region for a 601-residue PAS#1 sequence preceded by a start methionine and a proline codon, the human Tα1 sequence, and, finally, tlpp. (b) The deconvoluted ESI-MS spectrum of PAS-Tα1 purified from the E. coli cell extract by subtractive AEX and CEX (see text) reveals a molecular mass of 52,789.69 Da, which matches the calculated mass for PAS-Tα1 with a fully processed start methionine (52,789.66 Da). (c) Reverse-phase chromatography indicates a purity > 96% for PAS-Tα1. (d) Analytical SEC of the purified PAS-Tα1 in PBS results in a single peak with an elution volume of 13.2 mL.
T302 40374-40528 Sentence denotes Comparison with a half-logarithmic calibration curve (inset) indicates a strongly expanded hydrodynamic volume with an apparent molecular size of 665 kDa.
T303 40529-40580 Sentence denotes Figure 4 PK study of N-acetylated Tα1-PAS in rats.
T304 40581-40677 Sentence denotes Tα1-PAS was subcutaneously injected at a dose of 3.4 mg/kg b.w. into female Wistar rats (N = 5).
T305 40678-40764 Sentence denotes The concentration of the fusion protein in plasma was quantified using sandwich ELISA.
T306 40765-40872 Sentence denotes Data were plotted against the sampling time post injection (p.i.) and fitted using a one-compartment model.
T307 40873-40970 Sentence denotes The PK profile shows distinct absorption and elimination phases (for PK parameters, see Table 1).
T308 40971-41026 Sentence denotes Table 1 Pharmacokinetic properties of Tα1-PAS in rats.
T309 41027-41045 Sentence denotes Parameter Tα1-PAS
T310 41046-41069 Sentence denotes Cmax (mg/L) 25.6 ± 4.4
T311 41070-41090 Sentence denotes tmax (h) 22.7 ± 1.1
T312 41091-41123 Sentence denotes AUC0-∞ (h µg/mL) 1586.7 ± 295.1
T313 41124-41145 Sentence denotes τ1/2α (h) 15.7 ± 0.8
T314 41146-41167 Sentence denotes τ1/2β (h) 15.9 ± 0.9
T315 41168-41191 Sentence denotes CL (mL/h/kg) 2.2 ± 0.4