> top > projects > LitCovid-sentences > docs > PMC:7668588 > annotations
LitCovid-sentences  

PMC:7668588 JSONTXT 9 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T1 0-126 Sentence denotes Development and evaluation of a rapid and simple diagnostic assay for COVID-19 based on loop-mediated isothermal amplification
T2 127-153 Sentence denotes Rapid RT-LAMP for COVID-19
T3 155-163 Sentence denotes Abstract
T4 164-303 Sentence denotes Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is a highly pathogenic novel coronavirus that has caused a worldwide outbreak.
T5 304-466 Sentence denotes Here we describe a reverse transcription loop-mediated isothermal amplification (RT-LAMP) assay that uses a portable device for efficient detection of SARS-CoV-2.
T6 467-600 Sentence denotes This RT-LAMP assay specifically detected SARS-CoV-2 without cross-reacting with the most closely related human coronavirus, SARS-CoV.
T7 601-789 Sentence denotes Clinical evaluation of nasal swab samples from suspected SARS-CoV-2 pneumonia (COVID-19) patients showed that the assay could detect over 23.7 copies within 15 min with a 100% probability.
T8 790-979 Sentence denotes Since the RT-LAMP assay can be performed with a portable battery-supported device, it is a rapid, simple, and sensitive diagnostic assay for COVID-19 that can be available at point-of-care.
T9 980-1177 Sentence denotes We also developed the RT-LAMP assay without the RNA extraction step–Direct RT-LAMP, which could detect more than 1.43 x 103 copies within 15 min with a 100% probability in clinical evaluation test.
T10 1178-1411 Sentence denotes Although the Direct RT-LAMP assay was less sensitive than the standard RT-LAMP, the Direct RT-LAMP assay can be available as the rapid first screening of COVID-19 in poorly equipped areas, such as rural areas in developing countries.
T11 1413-1427 Sentence denotes Author summary
T12 1428-1590 Sentence denotes Rapid, accurate and simple diagnostic assay is required to provide an appropriate treatment and establish a surveillance system to prevent the spread of COVID-19.
T13 1591-1737 Sentence denotes In this study, we developed the RT-LAMP assay using a portable platform equipped with a battery for detection of SARS-CoV-2 in clinical specimens.
T14 1738-1785 Sentence denotes It could detect over 23.7 copies within 15 min.
T15 1786-1932 Sentence denotes Since RNA extraction step is one of the main obstacles for rapid diagnosis, we also developed the RT-LAMP assay without this step, Direct RT-LAMP.
T16 1933-2032 Sentence denotes This assay could detect over 203 copies of viral RNA in virus-spiked swab solution within 10.5 min.
T17 2033-2271 Sentence denotes Since our RT-LAMP assay is a rapid, simple and highly sensitive diagnostic system for identifying COVID-19 case, it would be useful for the detection of SARS-CoV-2, especially in the field or the settings with insufficient infrastructure.
T18 2273-2285 Sentence denotes Introduction
T19 2286-2463 Sentence denotes In December 2019, an outbreak of pneumonia caused by a novel coronavirus, severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), was first reported in Wuhan, China [1,2].
T20 2464-2629 Sentence denotes SARS-CoV-2 has rapidly spread worldwide, and the World Health Organization (WHO) has declared the corona virus disease (COVID-19) as a pandemic on 11 March 2020 [3].
T21 2630-2806 Sentence denotes Until the day of the announcement, over 4,962,707 confirmed cases of SARS-CoV-2 pneumonia in at least 200 countries of all continents, except Antarctica, had been reported [4].
T22 2807-2979 Sentence denotes COVID-19 is usually characterized by fever, cough, and myalgia or fatigue, and shows a mortality of 3.4% with progressive respiratory failure or multiple organ failure [5].
T23 2980-3114 Sentence denotes The median incubation period of COVID-19 is 5.1 days in 50 provinces, regions, and countries outside Wuhan, Hubei province, China [6].
T24 3115-3332 Sentence denotes However, several reports described that SARS-CoV-2 may show a longer incubation period (~19 days) and human-to-human transmission in the incubation period, making difficult to prevent the infection from spreading [7].
T25 3333-3482 Sentence denotes The transmission mechanism of SARS-CoV-2 has not been fully elucidated, although it shows a highly communicable ability through aerosol droplets [8].
T26 3483-3650 Sentence denotes Currently, early detection of SARS-CoV-2 and adequate isolation of patients are the most effective countermeasures to prevent human-to-human transmission of the virus.
T27 3651-3878 Sentence denotes Therefore, development of an on-site, rapid, and sensitive diagnostic assay for SARS-CoV-2 infections is of top priority to provide an appropriate treatment and establish a surveillance system to prevent the spread of COVID-19.
T28 3879-3985 Sentence denotes SARS-CoV-2 infection is diagnosed in the laboratory mainly using nucleic acid amplification tests (NAATs).
T29 3986-4198 Sentence denotes Several reverse transcription-quantitative PCR (RT-qPCR) assays were developed by WHO soon after the report of genome sequences of SARS-CoV-2, and are currently the gold standard to detect virus-specific RNA [9].
T30 4199-4357 Sentence denotes However, RT-qPCR requires a step of viral RNA extraction prior to the test and the use of a qPCR thermal cycler instrument connected to stable electric power.
T31 4358-4499 Sentence denotes Moreover, there is potential risk of viral RNA degradation during sample transport to the laboratory due to inappropriate storage conditions.
T32 4500-4731 Sentence denotes Thus, novel diagnostic technologies that can be conducted at the point-of-care, including rural areas of developing countries in which stable electricity may be unavailable, are crucial to control and monitor SARS-CoV-2 infections.
T33 4732-4966 Sentence denotes Reverse transcription loop-mediated isothermal amplification (RT-LAMP) is a rapid and sensitive RNA detection method performed under simple isothermal conditions using four or six target sequence-specific oligonucleotide primers [10].
T34 4967-5139 Sentence denotes Since LAMP reactions can be performed using a battery-driven portable equipment, RT-LAMP assay is suitable for on-site diagnosis even in insufficiently equipped facilities.
T35 5140-5367 Sentence denotes We have previously developed RT-LAMP assays for Ebola and Zika viruses in response to recent outbreaks of associated diseases, and the assays have been deployed for field surveillance in Guinea and Brazil, respectively [11–13].
T36 5368-5475 Sentence denotes Here, we report an RT-LAMP assay specific for SARS-CoV-2 with a comparable sensitivity to standard RT-qPCR.
T37 5476-5602 Sentence denotes This assay shows a potential to be performed without the RNA extraction step, representing a rapid and simple diagnostic NAAT.
T38 5604-5625 Sentence denotes Materials and methods
T39 5627-5643 Sentence denotes Ethics statement
T40 5644-5739 Sentence denotes This study was approved by the Institutional Review Boards of Nagasaki University (approval no.
T41 5740-5751 Sentence denotes 200409234).
T42 5753-5791 Sentence denotes Viral RNA and synthesized standard RNA
T43 5792-5988 Sentence denotes Viral RNA of SARS-CoV-2 and SARS-CoV were kindly provided by the Japanese National Institute of Infectious Diseases (NIID), and Dr. Koichi Morita from the Nagasaki University, Japan, respectively.
T44 5989-6301 Sentence denotes To calculate the copy number of viral genome detection in both LAMP and quantitative PCR (qPCR) assays, synthesized RNAs were prepared using T7 RiboMAX Express Large Scale RNA Production System (Promega) with the artificially synthesized DNA of the viral target sequence conjugated with the T7 promoter sequence.
T45 6303-6321 Sentence denotes LAMP primer design
T46 6322-6430 Sentence denotes LAMP primers for SARS-CoV-2 detection were designed based on the sequences of the ORF1b region of the virus.
T47 6431-6610 Sentence denotes The SARS-CoV-2 sequences available in GenBank and GISAID were aligned using BioEdit 7.0.5.3 software (http://www.mbio.ncsu.edu/BioEdit/bioedit.html) to identify conserved regions.
T48 6611-6755 Sentence denotes A consensus sequence of the ORF1b region was used to design LAMP primers through Primer Explorer V5 software (Eiken; http://primerexplorer.jp/).
T49 6756-6802 Sentence denotes The RT-LAMP assay requires a set of 6 primers:
T50 6803-6894 Sentence denotes 2 outer primers (F3 and B3), 2 inner primers (FIP and BIP), and 2 loop primers (LF and LB).
T51 6895-7054 Sentence denotes FIP consists of a complementary sequence of F1 and a sense sequence of F2, whereas BIP includes a complementary sequence of B1 and a sense sequence of B2 (10).
T52 7055-7140 Sentence denotes The detailed primer sequences used for SARS-CoV-2 amplification are shown in Table 1.
T53 7141-7176 Sentence denotes Table 1 Sequences of LAMP primers.
T54 7177-7205 Sentence denotes Name Type Sequence (5’–3’)
T55 7206-7247 Sentence denotes LAMP_ORF1b-1_F3 F3 AACCTGAGTTTTATGAGGCT
T56 7248-7291 Sentence denotes LAMP_ORF1b-1_B3 B3 TCCTAAGTAAAGTTGAGTCACA
T57 7292-7360 Sentence denotes LAMP_ORF1b-1_FIP FIP TGCAAGCACCACATCTTAATGAAGTCGCATACAGTCTTACAGGCT
T58 7361-7428 Sentence denotes LAMP_ORF1b-1_BIP BIP ACGACCATGTCATATCAACATCACAACATCACAACCTGGAGCAT
T59 7429-7470 Sentence denotes LAMP_ORF1b-1_LF LF CAAAGAACACAAGCCCCAAC
T60 7471-7518 Sentence denotes LAMP_ORF1b-1_LB LB GTCTTGTCTGTTAATCCGTATGTTTG
T61 7519-7563 Sentence denotes LAMP_ORF1b-2_F3 F3 GGTTTTTTCACTTACATTTGTGG
T62 7564-7608 Sentence denotes LAMP_ORF1b-2_B3 B3 TCCTCCAAAATATGTAATTTGCA
T63 7609-7676 Sentence denotes LAMP_ORF1b-2_FIP FIP GCGAAGTGTCCCATGAGCTTATAAACTAGCTCTTGGAGGTTCCG
T64 7677-7747 Sentence denotes LAMP_ORF1b-2_BIP BIP AATGCGTCATCATCTGAAGCATTTTCATAACCATCTATTTGTTCGCG
T65 7748-7792 Sentence denotes LAMP_ORF1b-2_LF LF TCAGCATTCCAAGAATGTTCTGT
T66 7793-7840 Sentence denotes LAMP_ORF1b-2_LB LB ATTGGATGTAATTATCTTGGCAAACC
T67 7842-7855 Sentence denotes RT-LAMP assay
T68 7856-8036 Sentence denotes RT-LAMP was performed with Isothermal Master mix reagent ISO-004 (Canon medical systems) using the Genelyzer FIII real-time fluorescence detection platform (Canon medical systems).
T69 8037-8326 Sentence denotes The reaction mixture (total volume = 25 μL) contained 15 μL of Isothermal Master Mix, 1 U of AMV Reverse Transcriptase (Nippon gene), 20 pmol (each) of FIP and BIP primers, 5 pmol (each) of F3 and B3 outer primers, 10 pmol (each) of F and B loop primers, and 5 μL of RNA sample (template).
T70 8327-8611 Sentence denotes The reaction was performed at the following conditions: for the ORF1b-1 primer set, 68°C for 20 min, followed by a dissociation analysis at 95°C–75°C with the temperature change rate of 0.1°C/s; for the ORF1b-2 primer set, 67°C for 20 min, followed by a similar dissociation analysis.
T71 8612-8696 Sentence denotes Extracted RNA from samples or heat inactivated swab samples were used as a template.
T72 8697-8794 Sentence denotes Synthesized RNAs containing the target sequence of the LAMP assay were used as positive controls.
T73 8795-8908 Sentence denotes Nonspecific amplification was excluded by comparing the melting temperature to that of the positive control [13].
T74 8910-8923 Sentence denotes RT-qPCR assay
T75 8924-9034 Sentence denotes RT-qPCR was performed using the One Step PrimeScript III RT-qPCR Mix (Takara Bio) as reported previously [14].
T76 9035-9253 Sentence denotes The reaction mixture (total volume = 20 μL) contained 10 μL of 2× One Step PrimeScript III RT-qPCR Mix, 0.4 μL of ROX Reference Dye, 2 μL of 10× primer-probe mixture, 2 μL of RNA sample, and 5.6 μL of RNase-free water.
T77 9254-9321 Sentence denotes Two different sets of primer-probe mixture were used in this study.
T78 9322-9518 Sentence denotes The first set was developed by NIID (NIID-qPCR) and used with the final concentration of 500 nM, 700 nM, and 200 nM of the forward primer, reverse primer, and FAM-labeled probe, respectively [15].
T79 9519-9685 Sentence denotes The second primer-probe set was reported by WHO for detection of E gene of SARS-CoV-2 and SARS (WHO-qPCR), and used 400 nM of each primer and 200 nM of the probe [9].
T80 9686-9948 Sentence denotes The NIID-qPCR reaction was performed using the StepOnePlus instrument (Applied Biosystems) with a thermal cycle program of 52°C for 5 min, 95°C for 10 sec, followed by 45 cycles of 95°C for 5 sec, and 60°C for 30 sec WHO-qPCR was performed with the same program.
T81 9949-10013 Sentence denotes Cut-off values were set at the threshold cycle (Ct) value of 40.
T82 10014-10155 Sentence denotes To quantify viral RNA, a standard curve was generated with 10-fold serial dilutions of synthesized standard RNA of the qPCR target sequences.
T83 10157-10206 Sentence denotes Validation of the assays using clinical specimens
T84 10207-10343 Sentence denotes A validation study was performed using 224 nasal swab samples collected in Nagasaki prefecture, Japan, without any clinical information.
T85 10344-10478 Sentence denotes For RT-LAMP and RT-qPCR, RNA was extracted using QIAamp Viral RNA Mini Kit (QIAGEN) according to the instructions of the manufacturer.
T86 10479-10573 Sentence denotes For Direct RT-LAMP, the samples were heated at 95°C for 10 min for inactivation of SARS-CoV-2.
T87 10574-10725 Sentence denotes Aliquots of 5 μL of RNA samples or heat inactivated swab samples were used for the LAMP assay with ORF1b-1 primer set and RT-qPCR with NIID primer set.
T88 10727-10734 Sentence denotes Results
T89 10736-10795 Sentence denotes Sensitivity of RT-LAMP assay using in vitro synthesized RNA
T90 10796-10941 Sentence denotes We designed two SARS-CoV-2 specific LAMP primer sets that targeted conserved sequences in the ORF1b region (name: ORF1b-1 and ORF1b-2) (Table 1).
T91 10942-11133 Sentence denotes To examine the sensitivity of the RT-LAMP assay for SARS-CoV-2, serial 10-fold dilutions of in vitro synthesized RNA possessing the target sequence of Wuhan-Hu-1 strain were used as template.
T92 11134-11318 Sentence denotes All (6/6) or 83% (5/6) of the reactions with 50 copies of RNA yielded positive results with ORF1b-1 (RT-LAMP/ORF1b-1) or ORF 1b-2 primer sets (RT-LAMP/ORF1b-2), respectively (Table 2).
T93 11319-11417 Sentence denotes Additionally, RT-LAMP/ORF1b-1 could detect samples containing 5 RNA copies once in six replicates.
T94 11418-11554 Sentence denotes Moreover, both RT-LAMP/ORF1b-1 and RT-LAMP/ORF1b-2 could detect 500 RNA copies within 8 min and 50 RNA copies within 11.8 min (Table 2).
T95 11555-11680 Sentence denotes These results indicate that this RT-LAMP assay can be used as a rapid and sensitive test for the detection of SARS-CoV-2 RNA.
T96 11681-11738 Sentence denotes Table 2 Sensitivity and detection time of RT-LAMP assay.
T97 11739-11746 Sentence denotes ORF1b-1
T98 11747-11781 Sentence denotes Copies/reaction 500 50 5 Water
T99 11782-11808 Sentence denotes Time (min) 7.5 9.0 - -
T100 11809-11826 Sentence denotes 7.3 8.8 10.5 -
T101 11827-11842 Sentence denotes 8.0 11.8 - -
T102 11843-11855 Sentence denotes 6.8 9.3 -
T103 11856-11870 Sentence denotes 6.8 9.0 - -
T104 11871-11885 Sentence denotes 7.3 8.5 - -
T105 11886-11909 Sentence denotes Average 7.3 9.4 - -
T106 11910-11928 Sentence denotes SD 0.4 1.1 - -
T107 11929-11957 Sentence denotes Positive 6/6 6/6 1/6 0/6
T108 11958-11965 Sentence denotes ORF1b-2
T109 11966-12001 Sentence denotes Copies/ reaction 500 50 5 Water
T110 12002-12029 Sentence denotes Time (min) 8.0 11.8 - -
T111 12030-12042 Sentence denotes 7.8 - - -
T112 12043-12058 Sentence denotes 7.3 11.5 - -
T113 12059-12073 Sentence denotes 7.5 9.0 - -
T114 12074-12088 Sentence denotes 7.3 9.5 - -
T115 12089-12104 Sentence denotes 6.8 10.3 - -
T116 12105-12129 Sentence denotes Average 7.4 10.4 - -
T117 12130-12148 Sentence denotes SD 0.4 1.1 - -
T118 12149-12177 Sentence denotes Positive 6/6 5/6 0/6 0/6
T119 12179-12207 Sentence denotes Specificity of RT-LAMP assay
T120 12208-12441 Sentence denotes Following this, to examine the specificity of the RT-LAMP assay, we performed the assay using RNAs extracted from SARS-CoV, which is the most closely related human coronavirus to SARS-CoV-2, and SARS-CoV-2 (n = 2 for each viral RNA).
T121 12442-12596 Sentence denotes The RT-LAMP did not detect SARS-CoV RNA regardless of the primer set used, while SARS-CoV-2 RNA was successfully detected with both primer sets (Table 3).
T122 12597-12751 Sentence denotes We confirmed the presence of SARS-CoV RNA using RT-qPCR with WHO primer (Table 3, Ct = 27.5 (7,780 copies) and 27.7 (6,890 copies) in duplicated samples).
T123 12752-12832 Sentence denotes These results indicate that our RT-LAMP assay is highly specific for SARS-CoV-2.
T124 12833-12871 Sentence denotes Table 3 Specificity of RT-LAMP assay.
T125 12872-12900 Sentence denotes Primer set SARS SARS-CoV-2
T126 12901-12938 Sentence denotes RT-LAMP(min) ORF1b-1 - - + (11.5)
T127 12939-12962 Sentence denotes ORF1b-2 - - + (9.75)
T128 12963-13000 Sentence denotes RT-qPCR (Ct) WHO + (27.5) + (27.7)
T129 13002-13064 Sentence denotes Sensitivity comparison between RT-LAMP assay and RT-qPCR assay
T130 13065-13338 Sentence denotes To compare the sensitivity of RT-LAMP/ORF1b-1, RT-LAMP/ORF1b-2, and RT-qPCR assays using the NIID (RT-qPCR/NIID) or the WHO (RT-qPCR/WHO) primer sets, we prepared 10-fold serial dilutions of viral RNA extracted from SARS-CoV-2 JPN/TY/WK-521 strain (GISAID: EPI-ISL-408667).
T131 13339-13451 Sentence denotes All RT-LAMP and RT-qPCR assays could detect the viral RNA in all samples of dilutions lower than 10−4 (Table 4).
T132 13452-13510 Sentence denotes The average detection time of RT-LAMP assays was 12.8 min.
T133 13511-13707 Sentence denotes The Ct values of the RT-qPCR/NIID and RT-qPCR/WHO for 10−4 dilution samples were 37.75±0.21 and 35.81±0.19, which corresponded to 15.9±2.2 and 26.7±4.0 copies per reaction, respectively (Table 4).
T134 13708-13854 Sentence denotes In addition, RT-qPCR/NIID and RT-qPCR/WHO assays detected the 10−5 dilution of the viral RNA samples twice and once in 3 replicates, respectively.
T135 13855-14025 Sentence denotes Furthermore, the RT-LAMP/ORF1b-1 assay also detected the 10−5 virus dilution once in 3 replicates; although, the RT-LAMP/ORF1b-2 failed to detect these samples (Table 4).
T136 14026-14136 Sentence denotes The 10−5 dilution was estimated to include 5.6 copies in RT-qPCR/NIID and 2.6 copies in RT-qPCR/WHO (Table 4).
T137 14137-14302 Sentence denotes Taken together, these results indicate that the RT-LAMP/ORF1b-1 assay has almost the same sensitivity as RT-qPCR assay, which is a highly sensitive detection method.
T138 14303-14373 Sentence denotes Table 4 Comparison of sensitivity between RT-qPCR and RT-LAMP assays.
T139 14374-14400 Sentence denotes Dilution rate of viral RNA
T140 14401-14430 Sentence denotes 10−2 10−3 10−4 10−5 Water
T141 14431-14480 Sentence denotes RT-LAMP ORF1b_1 Time (min) 6.5 7.8 9.0 - -
T142 14481-14502 Sentence denotes 6.3 7.3 9.0 9.5 -
T143 14503-14523 Sentence denotes 6.5 7.8 12.8 - -
T144 14524-14553 Sentence denotes Average 6.4 7.6 10.3 - -
T145 14554-14577 Sentence denotes SD 0.1 0.2 1.8 - -
T146 14578-14611 Sentence denotes Positive 3/3 3/3 3/3 1/3 0/3
T147 14612-14652 Sentence denotes ORF1b_2 Time (min) 6.8 7.5 9.5 - -
T148 14653-14673 Sentence denotes 6.0 7.8 10.8 - -
T149 14674-14694 Sentence denotes 6.8 7.5 10.5 - -
T150 14695-14724 Sentence denotes Average 6.5 7.6 10.3 - -
T151 14725-14748 Sentence denotes SD 0.4 0.1 0.5 - -
T152 14749-14782 Sentence denotes Positive 3/3 3/3 3/3 0/3 0/3
T153 14783-14837 Sentence denotes RT-qPCR NIID Ct value 30.93 34.08 37.59 39.08 -
T154 14838-14867 Sentence denotes 30.79 34.12 38.05 39.34 -
T155 14868-14893 Sentence denotes 30.60 33.79 37.61 - -
T156 14894-14932 Sentence denotes Average 30.77 34.00 37.75 39.21 -
T157 14933-14962 Sentence denotes SD 0.14 0.15 0.21 0.13 -
T158 14963-15008 Sentence denotes copies/ reaction 2036.9 214.4 17.5 6.1 -
T159 15009-15036 Sentence denotes 2249.6 208.6 12.7 5.0 -
T160 15037-15062 Sentence denotes 2577.0 264.4 17.3 - -
T161 15063-15099 Sentence denotes Average 2287.8 229.1 15.9 5.6 -
T162 15100-15128 Sentence denotes SD 222.1 25.0 2.2 0.5 -
T163 15129-15162 Sentence denotes Positive 3/3 3/3 3/3 2/3 0/3
T164 15163-15207 Sentence denotes WHO Ct value 29.31 32.80 35.96 38.93 -
T165 15208-15233 Sentence denotes 29.23 32.72 35.94 - -
T166 15234-15259 Sentence denotes 29.41 32.79 35.55 - -
T167 15260-15298 Sentence denotes Average 29.32 32.77 35.81 38.93 -
T168 15299-15328 Sentence denotes SD 0.07 0.03 0.19 0.00 -
T169 15329-15374 Sentence denotes copies/ reaction 3503.2 254.9 23.7 2.6 -
T170 15375-15400 Sentence denotes 3694.3 269.0 24.1 - -
T171 15401-15426 Sentence denotes 3246.6 256.5 32.4 - -
T172 15427-15463 Sentence denotes Average 3481.4 260.2 26.7 2.6 -
T173 15464-15491 Sentence denotes SD 183.5 6.3 4.0 0.0 -
T174 15492-15525 Sentence denotes Positive 3/3 3/3 3/3 1/3 0/3
T175 15527-15582 Sentence denotes Evaluation of RT-LAMP assay without RNA extraction step
T176 15583-15701 Sentence denotes In most cases, genome analysis for detection of RNA viruses requires a step of RNA extraction from clinical specimens.
T177 15702-15798 Sentence denotes Since this step usually takes about 30 min, it is one of the main obstacles for rapid diagnosis.
T178 15799-16001 Sentence denotes Therefore, the feasibility of the RT-LAMP assay without RNA extraction for clinical specimens was evaluated using human nasal and oral mixed swab suspensions spiked with SARS-CoV-2 JPN/TY/WK-521 strain.
T179 16002-16096 Sentence denotes We prepared the nasal and oral mixed swab samples with 10-fold serial dilutions of SARS-CoV-2.
T180 16097-16184 Sentence denotes These mixed swab samples were heated at 95°C for 10 min for inactivation of SARS-CoV-2.
T181 16185-16345 Sentence denotes We conducted RT-LAMP/ORF1b-1 and RT-qPCR/NIID assays with the heat inactivated swab samples, which we named “Direct RT-LAMP” and “Direct RT-qPCR,” respectively.
T182 16346-16526 Sentence denotes Simultaneously, we also conducted RT-LAMP/ORF1b-1 and RT-qPCR/NIID assays using RNAs extracted from the nasal and oral mixed swab samples spiked with SARS-CoV-2 as reference tests.
T183 16527-16660 Sentence denotes Sample viral dilutions ranging from 10−2 to 10−6 dilution were detected within 10.5 min in both RT-LAMP and Direct RT-LAMP (Table 5).
T184 16661-16829 Sentence denotes Furthermore, both Direct RT-LAMP and RT-LAMP could detect 10−7 diluted virus samples with 33% probability; nevertheless, RT-qPCR could efficiently detect these samples.
T185 16830-16890 Sentence denotes In this swab spike tests, both assays have same sensitivity.
T186 16891-16985 Sentence denotes However, the detection time for Direct RT-LAMP is longer than that of RT-LAMP (mean 0.75 min).
T187 16986-17092 Sentence denotes Therefore, composition of swab samples may affect the efficiency of genome amplification in RT-LAMP assay.
T188 17093-17250 Sentence denotes Standard RT-qPCR using extracted RNA indicated that 10−6 and 10−7 dilution include 203 ± 21.4 and 12.8 ± 4.78 copies of viral RNA per reaction, respectively.
T189 17251-17383 Sentence denotes Taken together, these results suggest that Direct RT-LAMP assay can be used as a rapid and sensitive diagnostic test for SARS-CoV-2.
T190 17384-17449 Sentence denotes Table 5 Evaluation of RT-LAMP assay without RNA extraction step.
T191 17450-17472 Sentence denotes Dilution rate of virus
T192 17473-17525 Sentence denotes Template 10−2 10−3 10−4 10−5 10−6 10−7 Water
T193 17526-17599 Sentence denotes Direct RT-LAMP Swab solution Time (min) 5.5 6.0 6.8 7.5 10.5 - -
T194 17600-17632 Sentence denotes 5.3 6.0 6.8 7.3 9.0 10.5 -
T195 17633-17662 Sentence denotes 5.5 6.0 7.3 7.5 9.0 - -
T196 17663-17701 Sentence denotes Average 5.4 6.0 6.9 7.4 9.5 - -
T197 17702-17735 Sentence denotes SD 0.1 0.0 0.2 0.1 0.7 - -
T198 17736-17779 Sentence denotes Positive 3/3 3/3 3/3 3/3 3/3 1/3 0/3
T199 17780-17835 Sentence denotes RT-LAMP RNA Time (min) 4.3 5.0 5.8 6.5 7.3 - -
T200 17836-17865 Sentence denotes 5.5 6.0 7.3 7.5 9.0 - -
T201 17866-17897 Sentence denotes 4.8 5.8 6.3 6.8 7.5 9.5 -
T202 17898-17936 Sentence denotes Average 4.8 5.6 6.4 6.9 7.9 - -
T203 17937-17970 Sentence denotes SD 0.5 0.4 0.6 0.4 0.8 - -
T204 17971-18014 Sentence denotes Positive 3/3 3/3 3/3 3/3 3/3 1/3 0/3
T205 18015-18095 Sentence denotes Direct RT-qPCR Swab solution Ct value 23.14 26.47 29.86 33.43 36.40 - -
T206 18096-18135 Sentence denotes 23.22 26.50 29.87 33.29 36.93 - -
T207 18136-18175 Sentence denotes 23.01 26.46 29.75 33.28 36.96 - -
T208 18176-18224 Sentence denotes Average 23.12 26.48 29.83 33.34 36.76 - -
T209 18225-18263 Sentence denotes SD 0.09 0.02 0.05 0.07 0.26 - -
T210 18264-18337 Sentence denotes copies/ reaction 1.14× 106 9.07×104 6.92×103 4.62×102 4.87×101 - -
T211 18338-18393 Sentence denotes 1.06× 106 8.84×104 6.89×103 5.12×102 3.25×101 - -
T212 18394-18450 Sentence denotes 1.25× 10−6 9.15×104 7.50×103 5.17×102 3.17×101 - -
T213 18451-18514 Sentence denotes Average 1.15×106 9.02×104 7.10×104 4.97×102 3.77×101 - -
T214 18515-18573 Sentence denotes SD 7.73×104 1.30×103 2.81×102 2.49×101 7.85×100 - -
T215 18574-18617 Sentence denotes Positive 3/3 3/3 3/3 3/3 3/3 0/3 0/3
T216 18618-18685 Sentence denotes RT-qPCR RNA Ct value 20.89 24.29 27.76 31.13 34.70 38.95 -
T217 18686-18729 Sentence denotes 20.97 24.34 27.80 31.18 34.35 37.66 -
T218 18730-18773 Sentence denotes 20.75 24.28 27.65 31.00 34.51 38.16 -
T219 18774-18826 Sentence denotes Average 20.87 24.30 27.74 31.10 34.52 38.26 -
T220 18827-18868 Sentence denotes SD 0.09 0.03 0.07 0.07 0.14 0.53 -
T221 18869-18948 Sentence denotes copies/ reaction 6.23×106 4.75×105 3.41×104 2.64×103 1.77×102 7.03×100 -
T222 18949-19010 Sentence denotes 5.85×106 4.56×105 3.29×104 2.55×103 2.29×102 1.87×101 -
T223 19011-19072 Sentence denotes 6.93×106 4.77×105 3.72×104 2.92×103 2.04×102 1.28×101 -
T224 19073-19143 Sentence denotes Average 6.33×106 4.69×105 3.47×104 2.71×103 2.03×102 1.28×101 -
T225 19144-19209 Sentence denotes SD 4.45×105 9.44×104 1.78×103 1.56×102 2.14×101 4.78×100 -
T226 19210-19253 Sentence denotes Positive 3/3 3/3 3/3 3/3 3/3 3/3 0/3
T227 19255-19307 Sentence denotes Evaluation of RT-LAMP assay using clinical specimens
T228 19308-19530 Sentence denotes To evaluate the diagnostic accuracy of RT-LAMP and Direct RT-LAMP, we analyzed 224 nasal swab samples from suspected COVID-19 patients using these experimental protocols at the same time has RT-qPCR/NIID as reference test.
T229 19531-19687 Sentence denotes Sixteen samples were suspended in Hank's Balanced Salt Solution (HBSS) and the remaining samples were suspended in phosphate-buffered saline (PBS) solution.
T230 19688-19911 Sentence denotes As shown in Fig 1, the detection time of RT-LAMP and Direct RT-LAMP was significantly correlated with copy number of SARS-CoV-2 RNA (Peason’s correlation (r) = -0.25 and -0.22, for RT-LAMP and Direct RT-LAMP, respectively).
T231 19912-20049 Sentence denotes This correlation indicates that viral RNA copies in clinical samples could be roughly estimated from the detection time of RT-LAMP assay.
T232 20050-20157 Sentence denotes Fig 1 Detection time of SARS-CoV-2 RNA from clinical specimens with the RT-LAMP and Direct RT-LAMP assays.
T233 20158-20338 Sentence denotes Detection time of clinical samples determined by RT-LAMP/ORF1b-1 (A) and Direct RT-LAMP/ORF1b-1 (B) were plotted to viral RNA copy numbers per reaction with reference RT-qPCR/NIID.
T234 20339-20420 Sentence denotes The samples suspended by PBS or HBSS are shown as blue or red dots, respectively.
T235 20421-20581 Sentence denotes The detection time for Direct RT-LAMP using PBS-suspended samples PBS was delayed on average by only 0.45 min compared with RT-LAMP using extracted RNA (Fig 2).
T236 20582-20846 Sentence denotes In contrast, the detection time of Direct RT-LAMP using HBSS-suspended swab samples was 3 to 8 min (mean 4.8 min) later than that of RT-LAMP using extracted RNA (Fig 2), suggesting that HBSS is not appropriate as swab sample suspension solution for Direct RT-LAMP.
T237 20847-20948 Sentence denotes Therefore, the results of the 16 samples suspended in HBSS were excluded from the analysis (Table 6).
T238 20949-21020 Sentence denotes Fig 2 Comparison of detection time between RT-LAMP and Direct RT-LAMP.
T239 21021-21118 Sentence denotes The delay time of detection by Direct RT-LAMP is shown for nasal swabs suspended in HBSS and PBS.
T240 21119-21255 Sentence denotes Table 6 Diagnostic accuracy of the RT-LAMP assay and the Direct RT-LAMP assay for SARS-CoV-2 compared with the reference RT-qPCR assay.
T241 21256-21279 Sentence denotes RT-LAMP Direct RT-LAMP
T242 21280-21361 Sentence denotes Copies/reaction Positive Negative Sensitivity Positive Negative Sensitivity
T243 21362-21409 Sentence denotes RT-qPCR Positive >107 2 0 100% 1 0 100%
T244 21410-21443 Sentence denotes 106−107 17 0 100% 14 0 100%
T245 21444-21477 Sentence denotes 105−106 24 0 100% 17 0 100%
T246 21478-21511 Sentence denotes 104−105 18 0 100% 21 0 100%
T247 21512-21544 Sentence denotes 103−104 18 0 100% 16 1 94%
T248 21545-21576 Sentence denotes 102−103 18 0 100% 9 8 53%
T249 21577-21608 Sentence denotes 101−102 12 2 86% 2 18 10%
T250 21609-21636 Sentence denotes 101> 10 5 67% 0 19 0%
T251 21637-21729 Sentence denotes negative 15 67 A total of 126 samples were deemed positive by the reference RT-qPCR assay.
T252 21730-21870 Sentence denotes In this evaluation test, the RNA amount of each clinical sample was estimated to be in the range from 1.3 to 6.88 x 107 copies per reaction.
T253 21871-22043 Sentence denotes The RT-LAMP/ORF1b-1 assay detected all clinical samples that had more than 23.7 copies of viral RNA as positive for SARS-CoV-2 with 100% probability (Table 6 and S1 Table).
T254 22044-22141 Sentence denotes Detection probabilities of the assay were 50% for 10–19.8 copies and 67% for less than 10 copies.
T255 22142-22215 Sentence denotes All positive results were obtained within 14.5 min (Fig 1A and S1 Table).
T256 22216-22371 Sentence denotes The Direct RT-LAMP with ORF1b-1 primer set detected samples that had more than 1.43 x 103 copies of viral RNA with 100% probability (Table 6 and S2 Table).
T257 22372-22472 Sentence denotes The assay still showed 53% and 10% probabilities for 102−103 and 101−102 viral copies, respectively.
T258 22473-22555 Sentence denotes The minimum copy numbers which were possible to detect was 70.8 copies (S2 Table).
T259 22556-22787 Sentence denotes For samples that had 7.08 x 101−1.41 x 103 viral copies, composition of swab samples seem to affect the results; although, the results were consistent with those from Direct RT-LAMP for swab samples spiked with the virus (Table 5).
T260 22788-22952 Sentence denotes Therefore, it should be carefully noted that low viral RNA copy numbers may not be detected by this Direct RT-LAMP assay depending on the composition of the sample.
T261 22953-23051 Sentence denotes And, this Direct RT-LAMP assay cannot be used to prove a negative result for SARS-CoV-2 infection.
T262 23053-23063 Sentence denotes Discussion
T263 23064-23184 Sentence denotes In this study, we developed a rapid and sensitive diagnostic assay for SARS-CoV-2 infections, which is based on RT-LAMP.
T264 23185-23303 Sentence denotes The assay could detect 23.7 copies of viral RNA within 15 min from clinical specimens (Fig 1A, Table 6, and S1 Table).
T265 23304-23521 Sentence denotes Currently, RT-qPCR is the gold standard assay of COVID-19 diagnosis and takes at least 2–3 hours to complete all processes including RNA extraction followed by a quantitative PCR step using a real-time thermal cycler.
T266 23522-23692 Sentence denotes To shorten the assay time, several research groups developed RT-LAMP assays against SARS-CoV-2 [16–21]; however, the detection sensitivity and assay time can be improved.
T267 23693-23885 Sentence denotes Huang et al. reported a novel RT-LAMP assay that could detect 2 copies of viral RNA after an additional gel electrophoresis step, requiring more assay time than the normal RT-LAMP method [21].
T268 23886-24044 Sentence denotes In addition to RT-LAMP, we also developed a remarkable rapid assay, Direct RT-LAMP, that does not require the extraction of viral RNA from clinical specimens.
T269 24045-24153 Sentence denotes This assay could detect 203 copies of viral RNA in the virus-spiked swab solution within 10.5 min (Table 5).
T270 24154-24282 Sentence denotes The LAMP method has an excellent specificity accomplished by 6 to 8 different primer binding regions in the target DNA sequence.
T271 24283-24432 Sentence denotes Nevertheless, several viruses require multiple sets of primers to detect whole lineages/genotypes due to genetic diversity of their genome sequences.
T272 24433-24526 Sentence denotes Lassa virus (LASV) has 6 lineages and has highly diverse genome even within the same lineage.
T273 24527-24653 Sentence denotes There is a single report of a RT-LAMP assay for LASV, and the assay requires 3 sets of primers to detect only lineage II [22].
T274 24654-24825 Sentence denotes Zika virus also shows diversity in genome sequences between Asian and African genotypes, requiring the mixture of 2 primer sets to detect all strains in one reaction [13].
T275 24826-24999 Sentence denotes Fortunately, SARS-CoV-2 shows lower genetic diversity worldwide, and therefore would be suitable to be diagnosed using the simple RT-LAMP assay with one primer set (S1 Fig).
T276 25000-25211 Sentence denotes Before the emergence of SARS-CoV-2, two large outbreaks of novel coronavirus diseases were reported: severe acute respiratory syndrome (SARS) in 2002, and Middle East respiratory syndrome (MERS) in 2012 [23,24].
T277 25212-25376 Sentence denotes For the molecular diagnosis for these diseases, RT-PCR and RT-qPCR were used as gold standard assays with an immediate announcement of recommended protocols by WHO.
T278 25377-25501 Sentence denotes Several years since the emergence of these coronavirus diseases, RT-LAMP assays were developed for faster diagnosis [25,26].
T279 25502-25730 Sentence denotes For SARS, Thai et al. developed a RT-LAMP assay which is 100-fold more sensitive than RT-PCR [25] and showed clear linearity between viral titer and detection time, and that could detect SARS-CoV even in RT-PCR negative samples.
T280 25731-25816 Sentence denotes Similar to SARS, several RT-LAMP assays were developed for the detection of MERS-CoV.
T281 25817-26013 Sentence denotes Shirato et al. developed a RT-LAMP assay for MERS with a sensitivity comparable to standard RT-qPCR, and with sufficient specificity to distinguish MERS-CoV from 20 other respiratory viruses [26].
T282 26014-26151 Sentence denotes These past reports indicate advantages in using RT-LAMP assays to detect coronavirus from clinical specimens with sufficient sensitivity.
T283 26152-26356 Sentence denotes A recent clinical study that evaluated respiratory tract specimens of COVID-19 patients with severe and mild symptoms showed the initial viral load of 6.17 and 5.11 log10 copies per mL, respectively [27].
T284 26357-26571 Sentence denotes Posterior oropharyngeal saliva, which might represent a non-invasive reasonable specimen acceptable by patients, contained 4 to 8 log10 copies of viral genome per mL in the first 5 days from the symptom onset [27].
T285 26572-26782 Sentence denotes Similarly, experimental SARS-CoV-2 infection of rhesus monkeys showed that the initial viral load in nasal or throat swabs also contained 4 to 8 log10 copies of viral genome per mL within the first 5 days [28].
T286 26783-27045 Sentence denotes Again, our RT-LAMP assay could detect 23.7 copies of SARS-CoV-2 viral RNA, approximately equivalent to 1,778 copies per mL in clinical specimens, effectively detecting SARS-CoV-2 in samples from patients with both severe and mild symptoms during the acute phase.
T287 27046-27253 Sentence denotes Whereas, our Direct RT-LAMP is approximately 60-fold less sensitive than RT-LAMP in the assay for clinical specimens, indicating the reliable detection limit of approximately 5 log10 copies per mL (Table 6).
T288 27254-27469 Sentence denotes Thus, although this Direct RT-LAMP assay detects SARS-CoV-2 in high viral titer samples, it should not be used as a sole molecular diagnostic method but used with another assay such as qPCR to avoid false negatives.
T289 27470-27789 Sentence denotes Nevertheless, Direct RT-LAMP would significantly contribute to the rapid first screening of COVID-19 during an outbreak (1) in the high-risk population (e.g. pregnant women, individuals with a pre-existing illness) who needs an immediate care, and (2) in the resource-limited settings where a centrifuge is unavailable.
T290 27790-27935 Sentence denotes We also found that HBSS affected the detection time of Direct RT-LAMP (Fig 2), indicating that HBSS contains inhibitors of RT-LAMP amplification.
T291 27936-28024 Sentence denotes Therefore, in the Direct RT-LAMP assay, it is preferable to suspend swab samples in PBS.
T292 28025-28176 Sentence denotes Since the RT-LAMP assay can be performed with a portable battery-driven device, it may be available at point-of-care, even in poorly-equipped settings.
T293 28177-28425 Sentence denotes Taken together, our results suggest that this new RT-LAMP protocol can be useful as a rapid and sensitive diagnostic assay for COVID-19, and that the Direct RT-LAMP version could also be made available as a much simpler, faster, and low-cost assay.
T294 28426-28622 Sentence denotes These new assays may contribute to public health control in countries undergoing COVID-19 epidemics, not only for early disease detection, but also to monitor future expansion of viral infections.
T295 28624-28646 Sentence denotes Supporting information
T296 28647-28752 Sentence denotes S1 Table The detection time of the RT-LAMP assay in clinical samples of less than 100 copies in Table 6.
T297 28753-28759 Sentence denotes (DOCX)
T298 28760-28796 Sentence denotes Click here for additional data file.
T299 28797-28911 Sentence denotes S2 Table The detection time of the Direct RT-LAMP assay in clinical samples of less than 104 copies per reaction.
T300 28912-28918 Sentence denotes (DOCX)
T301 28919-28955 Sentence denotes Click here for additional data file.
T302 28956-28992 Sentence denotes S1 Fig Specificity of LAMP primers.
T303 28993-29147 Sentence denotes Nucleotide sequences of 40 reference genomes widely selected from each continent, including the Wuhan-Hu-1 strain, are shown for each primer binding site.
T304 29148-29203 Sentence denotes No mutations were observed in all primer binding sites.
T305 29204-29209 Sentence denotes (TIF)
T306 29210-29246 Sentence denotes Click here for additional data file.
T307 29248-29344 Sentence denotes We would like to thank Dr. Koichi Morita (Nagasaki University) for providing SARS-CoV viral RNA.
T308 29345-29483 Sentence denotes We also thank the National Institute of Infectious Diseases (NIID), Japan for providing SARS-CoV-2 JPN/TY/WK-521 strain and its viral RNA.
T309 29484-29622 Sentence denotes We are grateful to all the members of the Department of Emerging Infectious Diseases, Institute of Tropical Medicine, Nagasaki University.