LitCovid-sentences  

PMC:7354481 / 57200-58905 JSONTXT 6 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T425 0-296 Sentence denotes Table 3 The mutational comparison of selected miRs found on the Wuhan genome compared to other SARS-CoV-2 strains isolated from different geographical regions. % represents the number of viral genome sequences with a single base change in that miR sequence. n = number of viral genomes analysed.
T426 297-368 Sentence denotes miRs Alignment Wuhan/China Italy Spain France England USA India
T427 369-427 Sentence denotes n = 28 n = 44 n = 133 n = 104 n = 104 n = 104 n = 34
T428 428-479 Sentence denotes hsa-miR-8066 ccaaaagaucacauug 0 0 0 0 0 0 0
T429 480-544 Sentence denotes hsa-miR-5197-3p auucgaagacccagucccuacuu 0 0 0 0 0 0.9% 0
T430 545-599 Sentence denotes hsa-miR-3611 ugagaagcaagaaauucuu 0 0 0 0 0 0 0
T431 600-655 Sentence denotes hsa-miR-3934-3p ucagguuggacagcugg 0 0 0 0 0 0 0
T432 656-739 Sentence denotes hsa-miR-1307-3p accgaggccacgcggagu 3.5% 2.2% 8.27% 1.92% 2.88% 2.88% 38.23%
T433 740-800 Sentence denotes hsa-miR-3691-3p gagauguugacacagacuuugu 0 0 0 0 0 0 0
T434 801-867 Sentence denotes hsa-miR-1468-5p cucaguuugccuguuu 0 0 2.25% 0.96% 0 0 8.83%
T435 868-926 Sentence denotes hsa-miR-3120-5p uguagaggaggcaaagacag 0 0 0 0 0 0 0
T436 927-982 Sentence denotes hsa-miR-3914 caucucacuugcugguuccu 0 0 0 0 0 0 0
T437 983-1044 Sentence denotes hsa-miR-3672 ugagucucauggaaaaca 0 0 0.75% 0.96% 0 0 0
T438 1045-1105 Sentence denotes hsa-miR-378c acugggcauugauuuagaugagugg 0 0 0 0 0 0 0
T439 1106-1164 Sentence denotes hsa-miR-7107-3p ccaaaaagagaaagucaaca 0 0 0 0 0 0 0
T440 1165-1223 Sentence denotes hsa-miR-1287-5p acucaaaccacugaaacagc 0 0 0 0 0 0 0
T441 1224-1281 Sentence denotes hsa-miR-10397-5p uucuucaccugaugcugu 0 0 0 0 0 0 0
T442 1282-1341 Sentence denotes hsa-miR-584-3p gccugguuugccuggcac 0 0 0.75% 0 0 0 0
T443 1342-1400 Sentence denotes hsa-miR-3085-3p ucuggcuguuauggcc 0 0 0 0 0 0.96% 0
T444 1401-1462 Sentence denotes hsa-miR-3191-3p cugucuauccaguugcgucacca 0 0 0 0 0 0 0
T445 1463-1526 Sentence denotes hsa-miR-3529-3p uggcagacgggcgauuuuguu 0 0 0 0 0 0 2.94%
T446 1527-1588 Sentence denotes hsa-miR-3682-5p auagcacaaguagauguag 0 0 0 0 0 0.96% 0
T447 1589-1645 Sentence denotes hsa-miR-148b-3p aaguucuaugaugcacag 0 0 0 0 0 0 0
T448 1646-1705 Sentence denotes hsa-miR-129-2-3p ugauuuuuguggaaagggcu 0 0 0 0 0 0 0