> top > projects > LitCovid-sentences > docs > PMC:7354481 > annotations
LitCovid-sentences  

PMC:7354481 JSONTXT 18 Projects

Annnotations TAB TSV DIC JSON TextAE Lectin_function

Id Subject Object Predicate Lexical cue
T1 0-186 Sentence denotes The Prediction of miRNAs in SARS-CoV-2 Genomes: hsa-miR Databases Identify 7 Key miRs Linked to Host Responses and Virus Pathogenicity-Related KEGG Pathways Significant for Comorbidities
T2 188-196 Sentence denotes Abstract
T3 197-331 Sentence denotes Severe acute respiratory syndrome coronavirus-2 (SARS-CoV-2) is a member of the betacoronavirus family, which causes COVID-19 disease.
T4 332-623 Sentence denotes SARS-CoV-2 pathogenicity in humans leads to increased mortality rates due to alterations of significant pathways, including some resulting in exacerbated inflammatory responses linked to the “cytokine storm” and extensive lung pathology, as well as being linked to a number of comorbidities.
T5 624-822 Sentence denotes Our current study compared five SARS-CoV-2 sequences from different geographical regions to those from SARS, MERS and two cold viruses, OC43 and 229E, to identify the presence of miR-like sequences.
T6 823-960 Sentence denotes We identified seven key miRs, which highlight considerable differences between the SARS-CoV-2 sequences, compared with the other viruses.
T7 961-1136 Sentence denotes The level of conservation between the five SARS-CoV-2 sequences was identical but poor compared with the other sequences, with SARS showing the highest degree of conservation.
T8 1137-1324 Sentence denotes This decrease in similarity could result in reduced levels of transcriptional control, as well as a change in the physiological effect of the virus and associated host-pathogen responses.
T9 1325-1423 Sentence denotes MERS and the milder symptom viruses showed greater differences and even significant sequence gaps.
T10 1424-1564 Sentence denotes This divergence away from the SARS-CoV-2 sequences broadly mirrors the phylogenetic relationships obtained from the whole-genome alignments.
T11 1565-1815 Sentence denotes Therefore, patterns of mutation, occurring during sequence divergence from the longer established human viruses to the more recent ones, may have led to the emergence of sequence motifs that can be related directly to the pathogenicity of SARS-CoV-2.
T12 1816-2008 Sentence denotes Importantly, we identified 7 key-microRNAs (miRs 8066, 5197, 3611, 3934-3p, 1307-3p, 3691-3p, 1468-5p) with significant links to KEGG pathways linked to viral pathogenicity and host responses.
T13 2009-2183 Sentence denotes According to Bioproject data (PRJNA615032), SARS-CoV-2 mediated transcriptomic alterations were similar to the target pathways of the selected 7 miRs identified in our study.
T14 2184-2302 Sentence denotes This mechanism could have considerable significance in determining the symptom spectrum of future potential pandemics.
T15 2303-2480 Sentence denotes KEGG pathway analysis revealed a number of critical pathways linked to the seven identified miRs that may provide insight into the interplay between the virus and comorbidities.
T16 2481-2628 Sentence denotes Based on our reported findings, miRNAs may constitute potential and effective therapeutic approaches in COVID-19 and its pathological consequences.
T17 2630-2632 Sentence denotes 1.
T18 2633-2645 Sentence denotes Introduction
T19 2646-2830 Sentence denotes The emergence of SARS-coronavirus-2 (SARS-CoV-2), which causes coronavirus-mediated disease 2019, or COVID-19, has now spread pandemically, resulting in a serious global health crisis.
T20 2831-2934 Sentence denotes Coronaviruses are positive-single stranded RNA (+ssRNA) zoonotic viruses with a ~30 kb genome (approx).
T21 2935-3044 Sentence denotes The coronavirus subfamily is divided into four genera: α, β, γ, and δ, based on serotype and genome features.
T22 3045-3178 Sentence denotes The genome of a typical CoV codes for at least 6 different open reading frames (ORFs), which have variations based on the CoV type 4.
T23 3179-3310 Sentence denotes Some ORFs encode non-structural proteins while others code for structural proteins required for viral replication and pathogenesis.
T24 3311-3498 Sentence denotes Structural proteins include the spike (S) glycoprotein, which has various roles in SARS-CoV based on sequence analysis and might share similar viral genomic and transcriptomic complexity.
T25 3499-3633 Sentence denotes Other proteins include matrix (M) protein, small envelope (E) protein, and nucleocapsid (N) protein for virus entrance and spread [1].
T26 3634-3770 Sentence denotes SARS-CoV-2 infections mainly target the lungs with respect to other viral infections, which begin with upper respiratory tract symptoms.
T27 3771-3950 Sentence denotes However, it is obvious that an important differentiating feature of the current SARS-CoV-2 infection is that it does not follow regular viral lower respiratory infection pathways.
T28 3951-4031 Sentence denotes There are a wide variety of clinical symptoms presented by SARS-CoV-2 infection.
T29 4032-4377 Sentence denotes Mainly (otherwise unexplained) fever and a failure to breathe fully are the most frequent symptoms, with non-productive cough, sneezing, sudden loss of smell and/or taste, pain in the chest cavity (mostly anteriorly), headache and prominent muscle ache, abdominal pain with diarrhoea, and neurological symptoms with facial nerve involvement [2].
T30 4378-4501 Sentence denotes Patients are generally referred to hospital when fever does not subside for 2 to 3 days, or respiratory effort gets harder.
T31 4502-4685 Sentence denotes Clinical observation indicates that elderly patients present more unexplained fever for 3 days, in contrast to younger patients who present with difficulty in breathing without fever.
T32 4686-5008 Sentence denotes In addition, the current lack of successful therapeutic intervention strategies to prevent the disease, or overcome serious mortality rates as a result of difficult lung pathophysiology mediated by SARS-CoV-2 infection, requires clarification of the molecular aetiology behind the mild or severe conditions of the disease.
T33 5009-5180 Sentence denotes Increasing mortality rates are the major obstacle in the management of the disease in existing healthcare systems, which have insufficient numbers of intensive care units.
T34 5181-5337 Sentence denotes Clinically, the initiation of acute respiratory distress syndrome (ARDS), which is the predominant severe pathology, leads to diffuse alveolar damage (DAD).
T35 5338-5596 Sentence denotes In addition, the presence of a cytokine storm, the excessive and uncontrolled release of pro-inflammatory cytokines such as IL-6, TNFα, IL-1β, IL-8, and IL2R, is associated with ARDS, hypercoagulation and increased erythematosus sedimentation rate (ESR) [3].
T36 5597-5738 Sentence denotes SARS-CoV-2, as well as other viruses, leads to pathophysiological problems in the host cells, and alters the expression of a number of genes.
T37 5739-5844 Sentence denotes Thus, clarification of molecular regulators on human cells is important to evaluate molecular mechanisms.
T38 5845-6088 Sentence denotes MicroRNAs (miRs) are non-coding RNAs of length approximately 20–22 nucleotides; they post-transcriptionally regulate gene expression by binding to the 3′-untranslated regions of target mRNAs, leading to degradation or translational inhibition.
T39 6089-6393 Sentence denotes Each miR can target hundreds of mRNAs within a given cell type, and a single mRNA is often the target of multiple miRs, and thus over half of the human transcriptome is predicted to be under miR regulation, embedding this post-transcriptional control pathway within nearly every biological process [4,5].
T40 6394-6487 Sentence denotes Virally expressed miRs have recently been discovered, especially in viruses with DNA genomes.
T41 6488-6651 Sentence denotes The best-known viral miRs are found mostly in herpesvirus families, where they enhance bilateral crosstalk between viral pathogenesis and host response mechanisms.
T42 6652-6796 Sentence denotes Additionally, it has been shown that different virus families such as delta bovine leukaemia virus and foamy retroviruses could encode miRs [6].
T43 6797-6933 Sentence denotes As previously shown, viral miRs are critical in the immune evasion mechanisms, affecting host immunity-related gene regulation networks.
T44 6934-7090 Sentence denotes This bilateral effect results in a rapid increase during the virus resistance against host defence mechanisms and leads to their survival in host cells [7].
T45 7091-7329 Sentence denotes The scope of miR generation from ssRNA viral genomes has been controversial, mainly due to the potentially deleterious effect of ssRNA viral genome cleavage into pre-/pri-miRs, making it unavailable for packaging into new virus particles.
T46 7330-7452 Sentence denotes However, predictive studies on RNA viral genomes reveal RNA structures, which are conceivable Drosha and Dicer substrates.
T47 7453-7639 Sentence denotes One of the well-described annotations was performed for HIV to define HIV-1 TAR RNA, a 59-nt long sequence that could generate a stem-loop structure similar to the pre-miR structure [8].
T48 7640-7716 Sentence denotes The identified numbers of viral miRs are not as many as for other organisms.
T49 7717-7888 Sentence denotes One of the reasons for this is that viral miRs, due to their cytoplasmic location in host cells, render interaction with nuclear miR biogenesis elements of the host cells.
T50 7889-7977 Sentence denotes Another hypothesis is that the cleavage of the viral RNA genome could generate miRs [9].
T51 7978-8163 Sentence denotes According to data obtained using in silico screening, there are fewer identified virus miRs compared with other species, and their functional roles in host cells are not well described.
T52 8164-8275 Sentence denotes Therefore, greater effort is required to identify novel virally encoded miRs and to predict their host targets.
T53 8276-8355 Sentence denotes Conversely, host cell miRs may alter the biological effect of the viruses [10].
T54 8356-8775 Sentence denotes Several interactions between viruses and the miRs in the host cells have been reported: the virus may either avoid being targeted by the cellular miRs [11]; block the cellular miRs to regulate key proteins in main signalling pathways [12,13]; synthesize their own viral miRs to create a more favourable cellular environment to survive in the host cells [14], or simply use the cellular miRs to their own advantage [15].
T55 8776-8883 Sentence denotes It should also be noted that host cell miR repertoires change dramatically in response to various diseases.
T56 8884-9095 Sentence denotes Several underlying cardiovascular and lung conditions may significantly alter host miR expression, which would affect virus-host lung cell interactions, and may significantly determine the course of the disease.
T57 9096-9258 Sentence denotes The existence of sequences within the ssRNA viral genome with a high degree of sequence similarity to human (or mammalian) sequences is unlikely to be accidental.
T58 9259-9472 Sentence denotes Hypothetically, some viral ssRNA molecules may be channelled into the miR processing pathways influencing the host cell, whilst other ssRNAs are packaged, combinations of which may increase overall viral activity.
T59 9473-9580 Sentence denotes The general prediction mechanism of putative miRs is based on the determination of seed region specificity.
T60 9581-9712 Sentence denotes The seed sequence, which is the critical part of the target prediction, is essential for the binding of the miR to the target mRNA.
T61 9713-9873 Sentence denotes The seed sequence or seed region is referred to as an evolutionary conserved heptameric sequence, which is mostly situated at positions 2–7 from the miR 5’-end.
T62 9874-10030 Sentence denotes Therefore, point mutations at seed regions are critical to evaluate the target specificity and functional consequences of the potential miR and target mRNA.
T63 10031-10243 Sentence denotes The complex interaction between the viruses and the host miRs mostly become more advantageous for the viruses as they enable them to avoid the immune system response and allow them to employ the host’s miRs [16].
T64 10244-10414 Sentence denotes Recently it has been suggested that miRs play a role in the host’s defence system against viral infections such as HIV-1, HSV, HCV, dengue and influenza [17,18,19,20,21].
T65 10415-10499 Sentence denotes Therefore, targeting specific miRs could prove to be a novel strategy for treatment.
T66 10500-10592 Sentence denotes The best-known anti-miR treatment for viral infection is targeting miR-122 to cure HCV [18].
T67 10593-10743 Sentence denotes It has also been reported that anti-miR-based HCV therapy is genotype independent, which makes it safe, effective and well tolerated by patients [22].
T68 10744-10955 Sentence denotes In this study, our first aim was to identify human miRs that show sequence similarities to the SARS-CoV-2 genome, and their conservation ratio in SARS-CoV-2 isolates obtained from different geographical regions.
T69 10956-11169 Sentence denotes Following determination of significantly similar miR sequences, we evaluated their potential effect on host cells through analysis of their target genes and related KEGG and GO pathways using bioinformatics tools.
T70 11170-11361 Sentence denotes In the final part of the study, the miR-mediated alterations of different pathways were compared to public transcriptome data obtained from SARS-CoV-2-infected cell and tissue biopsy samples.
T71 11362-11559 Sentence denotes To this end, the study aims to clarify the role of potential miR-mimic sequences in the SARS-CoV-2 genome with their host target genes, which may propose a new perspective for antiviral strategies.
T72 11561-11563 Sentence denotes 2.
T73 11564-11584 Sentence denotes Material and Methods
T74 11586-11590 Sentence denotes 2.1.
T75 11591-11607 Sentence denotes Genome Sequences
T76 11608-11865 Sentence denotes The SARS-CoV-2 genome sequences from China, Italy, Spain (Valencia), and those for MERS, SARS, OC43 and 229E were obtained from NCBI (GenBank: NC_045512.2, LC528232.1, MT066156.1, MT198652.2, KT225476.2, NC_004718.3, NC_006213.1, NC_002645.1, respectively).
T77 11866-12127 Sentence denotes The SARS-CoV-2 genome sequences from England (hCoV-19/England/20136087804/2020|EPI_ISL_420910, no treatment) and Turkey (hCoV-19/Turkey/GLAB-CoV008/2020) were obtained from the China National Bioinformatics Center, GISAID database [23] (https://www.gisaid.org).
T78 12128-12350 Sentence denotes In addition, a SARS-CoV-2 strain isolated from a Turkish patient, and infected to Vero E6 cells passage 4 sequence (hCoV-19/Turkey/ERAGEM-001/2020;) was used for alignment studies with the miRBase mature miRNA search tool.
T79 12352-12371 Sentence denotes 2.2. miR Prediction
T80 12372-12550 Sentence denotes The miRTarget and miRBase programmes were used to predict the similarities between the SARS-CoV-2 genome and human miRs; e-value <10 and score >70 were considered as significant.
T81 12551-12696 Sentence denotes DianaTools miRPath V3 were then used to create heat maps for pathways affected by selected miRs, focusing on the microT-CDS version 5.0 database.
T82 12697-12757 Sentence denotes The p value threshold was 0.05 and microT threshold was 0.8.
T83 12758-12815 Sentence denotes Heatmap analysis was done with pathway intersection [24].
T84 12817-12821 Sentence denotes 2.3.
T85 12822-12866 Sentence denotes Mutational Analysis of Potential miRNA Sites
T86 12867-13072 Sentence denotes Viral genome sequencing data was obtained from the GISAID database (https://www.gisaid.org), and analysed as multiple sequence alignments using the Clustal Omega at EBI (www.ebi.ac.uk/Tools/msa/clustalo/).
T87 13074-13078 Sentence denotes 2.4.
T88 13079-13095 Sentence denotes Pathway Analysis
T89 13096-13326 Sentence denotes Bioproject data was obtained from PRJNA615032 bioproject trancriptome data, which includes lung biopsies from SARS-CoV-2-infected patients and healthy volunteers as well as mock and SARS-CoV-2-transfected NHEB and A549 cell lines.
T90 13327-13485 Sentence denotes The data have been deposited with links to BioProject accession number PRJNA615032 in the NCBI BioProject database (https://www.ncbi.nlm.nih.gov/bioproject/).
T91 13486-13562 Sentence denotes All the selected data were reanalysed at the Rosalind bioinformatics server.
T92 13563-13747 Sentence denotes Data analysis was performed according to 1.5 fold change between untransfected and transfected cell lines in a data pool calculation for both cell lines at p < 0.05 significance level.
T93 13748-13903 Sentence denotes Data was analyzed by Rosalind (https://rosalind.onramp.bio/), with a HyperScale architecture developed by OnRamp BioInformatics, Inc. (San Diego, CA, USA).
T94 13904-13943 Sentence denotes Reads were trimmed using cutadapt [25].
T95 13944-13991 Sentence denotes Quality scores were assessed using FastQC [26].
T96 13992-14070 Sentence denotes Reads were aligned to the Homo sapiens genome built by GRCh38 using STAR [27].
T97 14071-14205 Sentence denotes Individual sample reads were quantified using HTseq [28] and normalized via relative log expression (RLE) using DESeq2 R library [29].
T98 14206-14346 Sentence denotes Read distribution percentages, violin plots, identity heatmaps, and sample MDS plots were generated as part of the QC step using RSeQC [30].
T99 14347-14449 Sentence denotes DEseq2 was also used to calculate fold changes and p-values and perform optional covariate correction.
T100 14450-14667 Sentence denotes Clustering of genes for the final heatmap of differentially expressed genes was done using the PAM (partitioning around medoids) method using the fpc R library (https://cran.r-project.org/web/packages/fpc/index.html).
T101 14668-14798 Sentence denotes Hypergeometric distribution was used to analyze the enrichment of pathways, gene ontology, domain structure, and other ontologies.
T102 14799-14944 Sentence denotes The topGO R library [31], was used to determine local similarities and dependencies between GO terms in order to perform Elim pruning correction.
T103 14945-15100 Sentence denotes Several database sources were referenced for enrichment analysis, including Interpro [32], NCBI [33], MSigDB [34,35], REACTOME [36], and WikiPathways [37].
T104 15101-15193 Sentence denotes Enrichment was calculated relative to a set of background genes relevant for the experiment.
T105 15195-15197 Sentence denotes 3.
T106 15198-15205 Sentence denotes Results
T107 15207-15211 Sentence denotes 3.1.
T108 15212-15324 Sentence denotes Analysis of SARS-CoV-2 Viral Genome for miR Sequences with High Human Similarity and Functional Characterisation
T109 15325-15490 Sentence denotes The miRBase online database holds 2565 miR sequences and from these we identified regions of the SARS-CoV-2 viral genome, which showed high similarity to human miRs.
T110 15491-15591 Sentence denotes Similarly, we analysed SARS-CoV-2 genomes obtained from different geographical areas for comparison.
T111 15592-15714 Sentence denotes Despite the relatively large SARS-COV-2 genome, only a few miRs were found to show similarities with human miRs (Table 1).
T112 15715-16370 Sentence denotes We have found five highly significant miRs from four different countries; Turkey, Italy, Spain, and the UK; one RefSeq sequence from Wuhan and one SARS-CoV-2 genome from the VeroE6 cell line: miR-8066 (e-values; 1.6 for Wuhan, 2.8 for Valencia, 1.6 for both Italy and England, 2.8 for VeroE6 cells SARS-CoV-2 genomes); miR-5197-3p (e-values; 1.6 for Wuhan, 2.1 for VeroE6 cells, 2.8 for Valencia and 1.9 for both Italy and England SARS-CoV-2 genomes), and miR-3611 (e-values; 2.8 for Wuhan, 3.3 for Valencia and 2.8 for both Italy and England, 2.8 for VeroE6 cells SARS-CoV-2 genomes); miR-3934-3p (e-values; 3.4–5.0), and miR-1307-3p (e-values; 4.3–6.3).
T113 16371-16471 Sentence denotes We could, however, detect a similar alignment with miR-1307-3p in SARS-CoV-2-infected Vero E6 cells.
T114 16472-16635 Sentence denotes Additionally, we found that the same miR sequences exist within four genomes of SARS-CoV-2, within the lower e-values of 5.0–10.0 were miR-3691-3p and miR-1468-5p.
T115 16636-16723 Sentence denotes Again, miR-3691-3p was not a positive hit in the SARS-CoV-2-infected Vero E6 cell line.
T116 16724-16806 Sentence denotes All of these miR similarities to human miRs were conserved in all studied genomes.
T117 16807-16908 Sentence denotes We then used DianaTools to identify the potential pathways to which these miRs contribute (Figure 1).
T118 16909-17016 Sentence denotes The functional characterizations of these highly conserved miRs were analyzed with KEGG molecular pathways.
T119 17017-17246 Sentence denotes The selected intersected pathways were analyzed as significant targets as p value 0.05 with threshold value 0.8 and Fisher’s Exact Test (hypergeometric distribution) calculations by miRPath version 3.0 in the microT-CDS database.
T120 17247-17547 Sentence denotes As shown in Figure 1. miR-8066 and miR-5197-3p are critical on TGF-β and mucin type O-Glycan biosynthesis pathways. miR-8066 is also related to cytokine-cytokine receptor interaction. miR-5197 is significantly related to morphine addiction and metabolism of xenobiotics by cytochrome P450 mechanisms.
T121 17548-17894 Sentence denotes These two miRs were highly conserved, and their coexistence was significant within the four-genome search. miR-3611 was the other leading miR, which possesses co-occurrence potential with miR-8066 and miR-5197 in all genomes that were effective on GABAergic synapse, morphine addiction and metabolism of xenobiotics by cytochrome P450 mechanisms.
T122 17895-18216 Sentence denotes Although co-occurrences of miR-1468-5p and miR-1307-3p were similar to miR-3611, it was less effective on all evaluated metabolic pathways. miR-3934-3p was effective on glycosaminoglycan biosynthesis—heparan sulfate/heparin, other types of O-glycan biosynthesis, and vitamin digestion-absorption mechanisms, respectively.
T123 18217-18534 Sentence denotes When we evaluated significant union gene-based pathway alterations for selected miRNAs, we found that mucin type O-glycan biosynthesis, morphine addiction, TGF-β signaling pathway, axon guidance and GABAergic synapse mechanisms were significantly affected according to KEGG pathway analysis on the miRPath (Table 2A).
T124 18535-18630 Sentence denotes In a similar setting, GO enrichment analysis results were again obtained from miRPath analysis.
T125 18631-18910 Sentence denotes We determined that the clusters, based on the selected miRs’ target genes, were organelle, cellular nitrogen compound metabolic process, ion binding, biosynthetic process, nucleic acid binding transcriptional factor activity, and cellular protein modification process (Table 2B).
T126 18911-18988 Sentence denotes In the current analysis, we detected mutations in miR-1307 and miR-8066 only.
T127 18989-19090 Sentence denotes Additionally, a mutation on miR-129-2-3p was found on only the Icelandic SARS-CoV-2 genome (Table 3).
T128 19091-19244 Sentence denotes Moreover, miR-129-2-3p is one of the selected miR (Table 1) found only in the Wuhan and Italy genomes, although in less than 5% of the genomes sequenced.
T129 19245-19451 Sentence denotes These three miRs are potentially involved in mucin type O-glycan biosynthesis, TGF-β signalling pathway, amphetamine addiction, cytokine-cytokine receptor interaction and nicotinate-nicotinamide metabolism.
T130 19452-19566 Sentence denotes All of these pathways are associated with host responses against SARS-CoV-2, and virus pathogenesis in host cells.
T131 19567-19699 Sentence denotes The mutations on selected miRs may affect their presence in different strains and may alter their potential host-mediated responses.
T132 19700-19775 Sentence denotes The remainder of the miRs, presented in Table 3, was found to be conserved.
T133 19776-19918 Sentence denotes Therefore, our data suggest that either these sequences are crucial for SARS-CoV-2, or their locations are important for the virus to survive.
T134 19919-20084 Sentence denotes Using the GISAID database, we analysed a sample of viral genomic sequences from several geographical areas for mutations in the potential miR sequences (n = 28–133).
T135 20085-20184 Sentence denotes The majority of the miRs studied showed very few base changes in these sequences, with <1% overall.
T136 20185-20277 Sentence denotes MiRs miR-1468-5p and, particularly, miR-1307-3p showed an increased percentage of mutations.
T137 20278-20400 Sentence denotes All the mutations analysed reduced the microRNA base similarity and decreased the score value to below significance (<70).
T138 20401-20587 Sentence denotes Due to the increased mutation ratios in SARS-CoV-2 strains isolated from different geographical regions, we checked the conservation of miR mimic sequences in different sequence results.
T139 20588-20814 Sentence denotes The comparison of depicted miR sequences from different SARS-Cov-2 strains (Table S1), with the Wuhan SARS-CoV-2 (HCOV-19/WUHAN/WH01/2019|EPI_ISL_406798|2019-12-26), was analyzed by BLAST nucleotide search with default values.
T140 20816-20820 Sentence denotes 3.2.
T141 20821-20921 Sentence denotes Analysis of Gene Alterations in NHEB Bronchial Epithelial and A549 Cells Due to SARS-CoV-2 Infection
T142 20922-21102 Sentence denotes In the final part of the study, we analyzed the gene expression alterations due to SARS-CoV-2-mediated infection in NHEB bronchial epithelial cells and A549 lung cancer cell lines.
T143 21103-21234 Sentence denotes For this purpose, we used the Bioproject PRJNA615032 publicly available data with the Rosalind bioinformatics data analysis server.
T144 21235-21348 Sentence denotes The meta-analysis results were evaluated for the differential gene expression at a 1.5 fold change cut-off level.
T145 21349-21549 Sentence denotes In total, 124 genes were selected according to a statistical p value threshold of <0.05, and analyzed for the related signaling axis to understand the disease pathophysiology, as shown in Figure 2A,B.
T146 21550-21641 Sentence denotes While 104 genes were upregulated in SARS-CoV-2-infected cells, 20 genes were downregulated.
T147 21642-21792 Sentence denotes All of these genes were also analysed using cluster analysis tools provided by the Rosalind bioinformatic data analysis server for different pathways.
T148 21793-21968 Sentence denotes As shown in Table 4, the Wiki pathways, Bioplanet, KEGG, REACTOME, Panther, Pathway Interaction DB, and the number of virus-host response pathways, were significantly altered.
T149 21969-22098 Sentence denotes These significantly altered pathways showed correspondingly similar patterns with SARS-CoV-2-mediated known clinical pathologies.
T150 22099-22193 Sentence denotes These pathways were based on major differences of the target genes for inflammation responses.
T151 22194-22356 Sentence denotes The predicted pathways in cell lines showed similar significance with selected miRs that mainly target inflammation and virus pathogenesis (Figure 1 and Table 2).
T152 22357-22570 Sentence denotes Thus, we concluded that the selected miRs, that showed high similarity with human miRs, are also the critical targets, which project the major clinical pathophysiological conditions related to pathway alterations.
T153 22572-22574 Sentence denotes 4.
T154 22575-22585 Sentence denotes Discussion
T155 22586-22729 Sentence denotes In the current study, we identified potentially similar miR sequences of human miRs and SARS-Cov-2 strains from different geographical regions.
T156 22730-22939 Sentence denotes For this purpose, we selected different genome sequence studies released recently in PubMed® and GISAID databases, which included genome results for SARS-CoV-2 strains from four different geographical regions.
T157 22940-23029 Sentence denotes We first aligned all the sequences with the mature hsa-miR database presented in miRBase.
T158 23030-23384 Sentence denotes During this study, we made a cluster according to the co-existence of significantly aligned hsa-miRs with the SARS-CoV-2 genome and their biological significance in human cells. miRPath version 3 was used for the determination of the selected miRs’ potential biological effects via searching target gene-related results found in the KEGG and GO pathways.
T159 23385-23549 Sentence denotes The mutational alterations were also analyzed for different miRs, which showed significant alignment scores with SARS-CoV-2 genomes from other geographical regions.
T160 23550-23707 Sentence denotes Concomitantly, we also analyzed and compared Bioproject PRJNA615032 trancriptome data obtained from normal vs SARS-CoV-2-infected lung tissue biopsy samples.
T161 23708-23813 Sentence denotes Data was submitted by tenOever Lab, Microbiology, Icahn School of Medicine at Mount Sinai on 24-Mar-2020.
T162 23814-24102 Sentence denotes In addition, the gene expression differences between A549 and NHEB cell line data and the gene expression differences between normal and infected lung tissue samples were analyzed in the REACTOME database (https://reactome.org/) to propose the potentially affected signaling axis members.
T163 24103-24247 Sentence denotes The clinical outcome of severe condition patients is discussed below, for selected miRs and their potential biological importance in host cells.
T164 24249-24253 Sentence denotes 4.1.
T165 24254-24306 Sentence denotes Biological Significance of Top Ranked miRs in Humans
T166 24308-24323 Sentence denotes 4.1.1. miR-8066
T167 24324-24441 Sentence denotes Recently, the N nucleocapsid gene-related putative miR candidates were shown through in silico prediction tools [38].
T168 24442-24590 Sentence denotes In a similar manner, we determined miR-8066, a mature sequence found on SARS-CoV-2 genomes, in SARS-CoV-2 genome alignment analysis with human miRs.
T169 24591-24754 Sentence denotes Additionally, miR-8067, which possesses a similar biological role to miR-8066, was identified as a stem loop region sequence in all SARS-CoV-2 genomes (Figure S1).
T170 24755-24876 Sentence denotes Previous reports showed that both miRs are found in plasma samples of sepsis patients with severe clinical outcomes [39].
T171 24877-25015 Sentence denotes Similar miR family members such as miR-8054, miR-8057, miR-8061, and miR-8068, were also found in a non-survivor group of sepsis patients.
T172 25016-25148 Sentence denotes It has been shown by in silico analysis that certain miRNAs have the core motifs of AUUGUUG, and that miR-8066 is one of these [40].
T173 25149-25381 Sentence denotes When miRs have this motif, it increases their likelihood to bind and activate Nf κB-mediated TLR-8 expression and induce cytokine synthesis [40]. miR-8066 was identified at high levels in tissue biopsies as well as in exosomes [41].
T174 25382-25571 Sentence denotes Therefore, SARS-CoV-2-mediated alterations of miRs may act as autocrine or paracrine agonists of host cells to trigger pro-inflammatory cytokines, due to their increased NfKB activity [42].
T175 25572-25702 Sentence denotes Similar findings were also suggested for cancer cells, which showed miR alterations in association with inflammation markers [43].
T176 25703-25887 Sentence denotes There is preliminary data about the existence of sequence similarity of human miRs in the spike region of the SARS-CoV-2 genome for both forward and reverse complementary strands [44].
T177 25888-26028 Sentence denotes Hsa-miR-8055, which was also previously shown to be a sepsis marker, was found to be involved in T-cell responses to specific antigens [45].
T178 26029-26270 Sentence denotes One of the differentially expressed circRNAs in children with fulminant myocarditis, Circ_0071542, was suggested to regulate the expression of MAPK, a well-characterized target in the development of disease through binding hsa-miR-8055 [45].
T179 26271-26524 Sentence denotes In our current study, we found that the miR-8066 sequence is present in four different SARS-CoV-2 genomes and shows strong association in KEGG pathways for TGF-beta signalling, mucin type O-glycan biosynthesis and cytokine-cytokine receptor interaction.
T180 26525-26686 Sentence denotes These targeted pathways are known, critical mediators for the clinical outcomes for SARS-CoV-2-infected patients and give us insight about virus pathophysiology.
T181 26687-26898 Sentence denotes It is well established that for enveloped viruses, such as SARS-CoV-2, N- or O-glycosylation of S protein determines the viral entry and membrane fusion with functional elicitation of host immune responses [46].
T182 26899-27070 Sentence denotes The high-resolution LC-MS/MS experiment was performed to detect site-specific quantitative N-linked and O-linked glycan profiling on SARS-CoV-2 subunit S1 and S2 proteins.
T183 27071-27234 Sentence denotes The glycan profiling showed that two unexpected O-glycosylation sites on the receptor-binding domain (RBD) of subunit S1 increased the pathogenicity of SARS-CoV-2.
T184 27235-27428 Sentence denotes Therefore, our understanding of complex sialylated N-glycans and sialylated mucin type O-glycans on the functional RBD domain may help to evaluate better therapeutic or vaccine strategies [47].
T185 27429-27568 Sentence denotes Moreover, miR-8066 alters N-glycosylation patterns according to the microT-CDS pathway and may have biomarker potential for this mechanism.
T186 27569-27765 Sentence denotes In addition, miR-8066 is found to be associated with one of the critical clinical problems of COVID-19, the cytokine storm, owing to its potential effect on the cytokine-cytokine receptor pathway.
T187 27766-27929 Sentence denotes It is well established that miR-8066 affects PRLR, CXCL6, IL6, IL17 and ACVR1 target genes, which are crucial members of the cytokine regulatory network (Table 2).
T188 27930-28372 Sentence denotes According to previous NGS platform results obtained from healthy versus SARS-CoV-2-infected lung tissue biopsies (Bioproject PRJNA615032), the most highly upregulated pathways are chemokine binding receptors (p value 7.94 × 10−4), FGFR activation pathways (p value 0.002) and its downstream pathway (p value 0.001), neutrophil degranulation (p value 0.003), and IL10 (p value 0.005), when compared with normal lung tissue biopsies (Table S2).
T189 28373-28573 Sentence denotes On the contrary, according to the REACTOME pathway analysis of Bioproject PRJNA615032 data, neutrophil degradation was also downregulated in SARS-CoV-2-infected biopsy specimens (p value 1.74 × 10−6).
T190 28574-28909 Sentence denotes Briefly, the downregulation of host cell responses’ related pathway members such as SRP-dependent co-translational protein targeting to membrane, L13a-mediated translational silencing of ceruloplasmin expression antigen processing, ribosomal organization, and the ERAD pathway, were observed in COVID-19-positive lung biopsy specimens.
T191 28910-29116 Sentence denotes All of these preliminary gene expression differences, between normal and SARS-CoV-2-infected lung biopsies, are associated with detected miR pathways and highlight common clinical presentations of patients.
T192 29117-29349 Sentence denotes Each of these biological mechanisms, according to potential disease progression-related alterations in the host genome, is highly associated with TGF-β, which is a cytokine affecting a number of host responses during infection [48].
T193 29350-29492 Sentence denotes TGF-β mediates the immune responses of host cells, as well as altering tissue remodelling by affecting cell survival, apoptosis and migration.
T194 29493-29756 Sentence denotes It has been demonstrated that SARS-CoV N protein potentiate Smad-3 mediated TGF-β activation, and plasminogen activator inhibitor-1 (PAI-1), leading to severe pulmonary fibrosis and inactivation of pro-apoptotic genes by complex formation of Smad3 and Smad4 [48].
T195 29758-29773 Sentence denotes 4.1.2. miR-5197
T196 29774-29898 Sentence denotes miR-5197-3p was identified as the most effective miR to interact with the guide RNA of SARS-CoV, MERS-CoV and COVID-19 [49].
T197 29899-30158 Sentence denotes According to a recent study, out of 2565 miRNAs, only three critical miRs, 5197-3p, 4778-3p and 6864-5p could interact with complete complementary miR (cc-miR) and possess a critical therapeutic potential due to their binding affinity on SARS-CoV-2 guide RNA.
T198 30159-30400 Sentence denotes It was suggested that the generation of miR-5197-3p-based complete complementary miRNA may possess a significant therapeutic response, owing to its structural affinity to guide RNA of SARS-CoV-2, without any side effects on human genes [49].
T199 30401-30558 Sentence denotes Previous patents on hsa-miR-5197-5p indicated that any drug targeting this miR might be critical in the treatment of hepatitis B infections (WO2018193902A1).
T200 30559-30717 Sentence denotes Similar to this finding, it was shown that miR-5197-3p might be used in vaccine strategies in the herpes simplex virus (HSV-1) (WO2013109604A1WO2013109604A1).
T201 30718-30850 Sentence denotes In another study, allelic variances of hsa-miR-5197 were found to be highly associated with non-small cell lung cancer (NSCLC) [50].
T202 30851-31050 Sentence denotes According to the Harvard and MD Anderson databases, miR-5197 shows significant differences between Caucasians and Chinese populations (data gained from a Han Chinese cohort from Nanjing, China) [50].
T203 31051-31159 Sentence denotes The rs2042253 polymorphism (T>C variation) of miR-5197 provided a protective effect on lung cancer survival.
T204 31160-31293 Sentence denotes Moreover, this SNP is reported to have a high read frequency for paediatric acute lymphoblastic leukemia (ALL) in the UK cohort [51].
T205 31294-31449 Sentence denotes High throughput analysis of 408 lung cancer patients showed that miR-5197 polymorphism is highly correlated with chemotherapy-induced severe toxicity [52].
T206 31450-31641 Sentence denotes It has been accepted that nucleotide variations in pre-miRNAs may have contributed to the stability of stem-loop structure and may affect recognition sites for Drosha and Dicer cleavage [53].
T207 31642-31856 Sentence denotes In our current study, we did not find any mutations in miR-5197 sequences obtained from different SARS-CoV-2 genomes, however we found that mucin type O-glycan biosynthesis was related to both miRs 5197-3 and 8066.
T208 31857-32030 Sentence denotes This KEGG pathway has been involved in the cell-to-cell transmission of human T cell leukemia virus type 1 (HTLV-1) [54] and plays roles in Ebola virus cell attachment [55].
T209 32031-32148 Sentence denotes HIV-1 infection of T cells has also been shown to result in altered glycosylation of cell surface glycoproteins [56].
T210 32149-32199 Sentence denotes O-glycans are also linked to avian influenza [57].
T211 32200-32295 Sentence denotes Mucosal O-linked glycans are furthermore associated with herpes simplex virus 1 infection [58].
T212 32296-32440 Sentence denotes Mucin type O-glycan biosynthesis miR pathways have been identified in avian oncogenic retrovirus (Avian leukosis virus subgroup J (ALV-J)) [59].
T213 32441-32634 Sentence denotes This KEGG pathway is therefore related both to human as well as veterinary viral infections and further studies will be needed to establish the function of miR-5197 during SARS-CoV-2 infection.
T214 32636-32651 Sentence denotes 4.1.3. miR-3611
T215 32652-32764 Sentence denotes In our current study, we found that miR-3611 is a positive hit for stem loop region and mature miRNA prediction.
T216 32765-32953 Sentence denotes Because of its potential presence in SARS-CoV-2-mediated cellular responses, we have analysed data from the lung tissue biopsy database (PRJNA615032 Bioproject) to understand its function.
T217 32954-33053 Sentence denotes A previous study reported altered miRNA expression in chronic obstructive pulmonary disease (COPD).
T218 33054-33158 Sentence denotes COPD is an airway disorder and respiratory disease that is associated with persistent inflammation [60].
T219 33159-33317 Sentence denotes A study on miR expression analysis, conducted on COPD and healthy volunteers, showed significant down-regulation of miR-3611 expression in COPD patients [61].
T220 33318-33411 Sentence denotes The long non-coding RNA, H19, has been linked to many carcinomas, including lung cancer [62].
T221 33412-33621 Sentence denotes It has been shown that miR-3611 is significantly down-regulated in a H19 knockdown lung cancer cell line (SPC-A1), which indicated overexpression of this miR in ‘normal’ H19 intact lung cancer cell lines [63].
T222 33622-33776 Sentence denotes In our study, we identified that miR-3611 shows high similarity with all four main SARS-CoV-2 genomes and we did not detect any mutations between genomes.
T223 33777-33929 Sentence denotes However, miR-3611 was strongly associated with KEGG pathways for metabolism of xenobiotics by cytochrome P450, morphine addiction and GABAergic synapse.
T224 33930-34021 Sentence denotes Moreover, morphine addiction was, besides linkage with miR-3611, also linked to miR-5197-3.
T225 34022-34212 Sentence denotes This KEGG pathway has been related to enhanced HIV-1 infection [30] and morphine treatment has been shown to promote HIV-1 replication in macrophages via inhibition of the TLR9 pathway [64].
T226 34213-34333 Sentence denotes Furthermore, an increased rate of HIV-1/HTLV-I infection has been observed due to morphine in injection drug users [65].
T227 34334-34428 Sentence denotes Morphine is also associated with enhanced hepatitis C virus (HCV) replicon expression [66,67].
T228 34429-34662 Sentence denotes Opioids have furthermore been shown to enhance simian acquired immunodeficiency syndrome (SAIDS) in rhesus monkeys [68], while reduced clearance of pulmonary influenza virus infection was observed in morphine-treated Lewis rats [69].
T229 34663-34851 Sentence denotes Interestingly, opioids such as morphine are also used as indirect antitussives to suppress cough, which is commonly associated with respiratory viral infections [70], including SARS-CoV-2.
T230 34852-35027 Sentence denotes Indeed, morphine was used in recent cases in China during sedation and analgesia for endotracheal intubation, to avoid patients’ cough and agitation during the procedure [39].
T231 35028-35176 Sentence denotes In light of the association of morphine with promotion of viral replication, it may have effects in SARS-CoV-2 that need to be further investigated.
T232 35178-35196 Sentence denotes 4.1.4. miR-3934-3p
T233 35197-35454 Sentence denotes miRNA expression profiles have been used to classify cancers into various subtypes. miR3934 is found upregulated in colon cancer and was suggested as a biomarker for lung cancer as its expression correlated with survival rate and prognosis of NSCLC [71,72].
T234 35455-35567 Sentence denotes Moreover, it has been reported that miR-3934-5p expression significantly increases in NSCLC cell line A549 [73].
T235 35568-35714 Sentence denotes It is also a SNP linked to TGF-β signalling and has been identified as downregulated in rectal carcinoma mucosa, compared with normal mucosa [74].
T236 35715-35789 Sentence denotes In addition, it was shown that miR-3934-3p downregulated TGFBR1 and SMAD3.
T237 35790-35890 Sentence denotes In a similar vein, HSV-1 viral infection led to a significant down-regulation of these targets [74].
T238 35891-36026 Sentence denotes Moreover, the activation of the TGF-β/Smad pathway is critical for lung fibrosis, which was previously shown in SARS-CoV-related cases.
T239 36027-36149 Sentence denotes Dysregulation of ACE2 may influence the toll-receptor signalling pathway, via IL6, and affect downstream immune responses.
T240 36150-36311 Sentence denotes Irrespective of SARS-CoV-2 or pneumonia in TCGA-LUAD, the altered immunoreaction was the primary cause (lung adenocarcinoma; SARS-CoV-2; ACE2; miR-125b-5p; IL6).
T241 36312-36518 Sentence denotes TGF-β and cigarette smoke have been shown to suppress miR-141-5p to promote CCR5 expression on primary bronchial epithelial cells, which results in increased viral entry and infection by R5-tropic HIV [75].
T242 36519-36788 Sentence denotes Given that TGF-β signalling is upregulated by trans-activator (Tat) protein, cigarette smoke and in chronic lung diseases, it has been determined the effects of persistent TGF-β signalling on HIV infection in primary bronchial epithelium re-differentiated ex vivo [75].
T243 36789-36999 Sentence denotes In our current study, miR-3934-3p was found to be associated with KEGG pathways for glycosaminoglycan biosynthesis heparan sulfate/heparin, mucin type O-glycan biosynthesis and vitamin digestion and absorption.
T244 37000-37046 Sentence denotes The relevance of these pathways is as follows:
T245 37047-37136 Sentence denotes “Glycosaminoglycan biosynthesis—heparan sulfate/heparin” was here related to miRs 3934-3.
T246 37137-37287 Sentence denotes Heparan sulfate proteoglycans have previously been identified to provide the binding sites for SARS-CoV-2 invasion at the early attachment phase [76].
T247 37288-37412 Sentence denotes Furthermore, human coronavirus NL63 has been shown to utilise heparan sulfate proteoglycans for target cell attachment [77].
T248 37413-37569 Sentence denotes This KEGG pathway has been related to Ebola virus, where heparan sulfate has been identified as an important mediator in polarised epithelial cells [78,79].
T249 37570-37836 Sentence denotes In hepatitis C viral infection, the virus hijacks this pathway via interaction with apolipoprotein E for cell entry [63], while heparan sulfate proteoglycans are required for cellular binding of the hepatitis E virus ORF2 capsid protein and for viral infection [70].
T250 37837-38028 Sentence denotes Endogenous HERV-K furthermore binds to heparin for cell entry [80], and, while heparin has been found to further Zika virus infection, it acts as an antiviral against Dengue replication [81].
T251 38029-38334 Sentence denotes Heparin sulphate is identified as an inhibitory regulator of porcine epidemic diarrhoea virus infection [82] and acts as an attachment factor for rabies virus entry and infection [83], as well as an enhancer of Nipah and Hendra virus infections, which are highly pathogenic, zoonotic paramyxoviruses [84].
T252 38335-38443 Sentence denotes This highlights the importance of this KEGG pathway both in human, zoonotic and veterinary viral infections.
T253 38444-38543 Sentence denotes Another important pathway, vitamin digestion and absorption, was found to be related to miR-3934-3.
T254 38544-38674 Sentence denotes This KEGG pathway has been highlighted amongst others as a link between dysbiosis of the gut microbiome and chronic diseases [85].
T255 38675-38842 Sentence denotes Furthermore, intestinal triglyceride-rich lipoproteins have been related to vitamin metabolism in relation to coronary artery disease as well as viral infections [86].
T256 38843-38994 Sentence denotes In AIDS, malabsorption of vitamin 12 has been related to gastric secretory failure, including chronic diarrhoea, due to advanced HIV infection [87,88].
T257 38995-39089 Sentence denotes Additionally, vitamin A deficiency has been associated with more progressive HIV disease [89].
T258 39090-39274 Sentence denotes Veterinary viral infections, such as infectious bronchitis virus (IBV) and reovirus (RV) in chickens, have been identified to affect vitamin A metabolism due to epithelial damage [90].
T259 39275-39387 Sentence denotes Interestingly, a link between vitamin D deficiency and SARS-CoV-2 infection severity was recently reported [91].
T260 39388-39587 Sentence denotes Also, vitamin B3 was found to be highly effective to help lung tissue damage repair [92] and it was suggested to be given to COVID-19 patients as soon as the CT lung abnormalities were detected [93].
T261 39589-39607 Sentence denotes 4.1.5. miR-1307-3p
T262 39608-39776 Sentence denotes miR-1307 has previously been shown to be one of the lung-tissue-associated miRs [94] and was reported as an especially important target in lung development in newborns.
T263 39777-39954 Sentence denotes Expression of mir-1307-3p has furthermore been linked to acid metabolism in response to aspirin in human cardiac and peri-cardiac fat-derived mesenchymal stem cells (MSCs) [95].
T264 39955-40205 Sentence denotes Moreover, it was shown that several miRs, including miR-1307-3p, are involved in TGF-β and semaphorin signalling, as well as inflammatory responses. miRs play an important role, especially during lung morphogenesis in the early stages of development.
T265 40206-40323 Sentence denotes Interestingly, miR-1307 has been associated with the severity of pulmonary hypertension in systemic scleroderma [96].
T266 40324-40642 Sentence denotes Persistent problems with SARS-CoV-2-infected patients, such as oxygen dependency, urgent need for mechanical ventilation, persistent wheezing, and increased risk for pulmonary infections correlate with involvement of miR-1307-3p, as indicated above, due to its role in pulmonary hypertension and chronic lung diseases.
T267 40643-40861 Sentence denotes The TGF-β superfamily plays critical roles in pre- and postnatal lung development, importantly shaping alveolarisation and controlling the extracellular matrix composition and tissue homeostasis, among other functions.
T268 40862-40965 Sentence denotes TGF-β signalling is therefore strongly linked to both pulmonary and cardiovascular diseases [97,98,99].
T269 40967-40985 Sentence denotes 4.1.6. miR-3691-3p
T270 40986-41173 Sentence denotes It has been shown that oxidative stress, which has detrimental effects on intercellular communication, plays an important role in many lung pathologies such as acute lung injury and COPD.
T271 41174-41337 Sentence denotes A proteomic profile of exosomes from human bronchial epithelial cells, under normoxia and hypoxia, has reported reduced expression of miR-3691-3p in hypoxia [100].
T272 41338-41498 Sentence denotes Interestingly, miR3691-3p targets several cell signalling pathways, such as TGF-β signalling, FGF2 and also VCAM1, which is relevant for lung injury and repair.
T273 41499-41677 Sentence denotes In the current study, we have also identified that miR3691-3p exists in four of the genomes, which we have extensively studied here, and therefore it seems to be a conserved miR.
T274 41679-41696 Sentence denotes 4.1.7. miR1468-5p
T275 41697-41913 Sentence denotes Sudden cardiac death is a major problem amongst the unexplained deaths in COVID-19, and it has been identified that many of those patients suffered from primary myocardial fibrosis (PMF), without any known aetiology.
T276 41914-42209 Sentence denotes Recently, higher expression of miR-1468-3p was identified as a disease-associated and age-dependent cardiac biomarker, as it promotes cardiac fibrosis and cell senescence, although no difference was noted in the mature form of miR-1468 between healthy and COVID-19-diseased cardiac tissue [101].
T277 42210-42388 Sentence denotes TGF-β1 plays a key role in fibrosis-related pathologies including cardiac fibrosis, and, furthermore, miR-1468 activates non-canonical TGF-β1 and MAPKs signalling pathways [101].
T278 42389-42908 Sentence denotes Moreover, miR-1468-5p expression has been found to be upregulated in regulatory T cells, which have a significant role in autoimmune disorders, transplant rejection, allergic diseases, and asthma [102]. miR-1468-5p has previously been associated with glioma, where it inhibits growth and cell cycle progression by targeting ribonucleotide reductase large subunit M1 (RRM1), based on a study on patients from the Chinese Glioma Genome Atlas [103]. miR-1468-5 is also linked to progressing hepatocellular carcinoma [104].
T279 42909-43042 Sentence denotes Interestingly, in Alzheimer’s disease, miR-1468-5p has been identified to be at lower abundance compared with healthy controls [105].
T280 43043-43169 Sentence denotes It has furthermore been identified as a biomarker in late seizure in patients with spontaneous intracerebral haemorrhage [49].
T281 43170-43278 Sentence denotes The link between miR-1468-5 in viral infection and other comorbidities will need to be further investigated.
T282 43279-43430 Sentence denotes miR-129-2-3p, here identified as a common mutated miR, has previously been identified as a regulator in human cancer development and progression [106].
T283 43431-43574 Sentence denotes It has been identified as a diagnostic and prognostic biomarker for renal cell carcinoma [107] and a suppressor of serous ovarian cancer [104].
T284 43575-43778 Sentence denotes Its upregulation suppresses breast cancer cell proliferation and induces its apoptosis, while downregulation, via hypermethylation, increases breast cancer progression due to BCL2L2 overexpression [107].
T285 43779-44025 Sentence denotes It furthermore attenuates cell migration and invasion in renal cell carcinoma by affecting the downregulation of various metastasis-related genes [108]. miR129-2 has been linked to a range of haematological malignancies, including lymphoma [109].
T286 44026-44162 Sentence denotes It is also linked to lung adenocarcinoma including regulation of cell proliferation [110], as well as to hepatocellular carcinoma [111].
T287 44163-44356 Sentence denotes Interestingly, miR-129-2-3p has been found to be upregulated in human papilloma virus-positive (HPV) head and neck squamous cell carcinoma [112] and in HPV transfected keratinocyte cells [113].
T288 44357-44528 Sentence denotes In the light of increasing understanding of the link between SARS-CoV-2 and comorbidities, underlying changes in miR-129-2-3p expression may be of considerable importance.
T289 44529-44669 Sentence denotes A number of KEGG pathways have been strongly linked to the main miRs identified as being related to sequences within the SARS-CoV-2 genomes.
T290 44670-45486 Sentence denotes These include: “Mucin type O-glycan biosynthesis”, “TGF-β signalling pathway”, “Morphine addiction”, “Metabolism of xenobiotics by cytochrome P450”, “Other types of O-glycan biosynthesis”, “Vitamin digestion and absorption”, “Glycosaminoglycan biosynthesis—heparan sulfate/heparin”, “GABAergic synapse”, “Cytokine-cytokine receptor interaction”, “Signalling pathways regulating pluripotency of stem cells”, “Amphetamine addiction”, “Axon guidance”, “Hippo signalling pathway”, “Prolactin signalling pathway”, “mRNA surveillance pathway”, “Glycosphingolipid biosynthesis—lacto and neolacto series”, “Bile secretion”, “Circadian entrainment”, “N-glycan biosynthesis”, “Mismatch repair”, “Drug metabolism—cytochrome P450”, “Glutamatergic synapse”, “Glycosaminoglycan degradation”, “Antigen processing and presentation”.
T291 45487-45823 Sentence denotes The relevance of several of these KEGG pathways has been discussed above in direct relation to the various miRs and provides a novel insight into the putative interplay of these pathways and the microRNAs identified in COVID-19, and may also help in furthering understanding of the interplay of miRs, viral infections and comorbidities.
T292 45825-45827 Sentence denotes 5.
T293 45828-45839 Sentence denotes Conclusions
T294 45840-45917 Sentence denotes Previous epidemics have been caused by betacoronaviruses, especially in Asia.
T295 45918-46070 Sentence denotes As expected, several similarities and differences in the epidemiology, clinical features, and management of SARS, MERS, and SARS-CoV-19 were seen [114].
T296 46071-46184 Sentence denotes However, none of the previous infections has caused global pandemics of the scale currently caused by SARS-CoV-2.
T297 46185-46480 Sentence denotes In our study, analysis of several SARS-CoV-19 genomes, which were isolated from different geographical regions, shows significant similarity scores with human miRs, which target a subset of genes related to pathways affecting virus pathogenicity and host responses observed in COVID-19 patients.
T298 46481-46635 Sentence denotes The numbers of in silico prediction-based studies that show miRNA mimicking sequences of SARS-CoV-2 genome and miR-mediated host responses are increasing.
T299 46636-46892 Sentence denotes It was suggested that, as hsa-miR-4661-3p may target the S gene of SARS-CoV-2, and a virus-encoded miRNA miR147-3p could enhance the expression of TMPRSS2 to promote SARS-CoV-2 infection in the gut, host miRs are critical in the progression of the disease.
T300 46893-47053 Sentence denotes In our current study we identified that seven completely complementary miRNAs of COVID-19 (cc-miRc) prevent viral replication and protein translation processes.
T301 47054-47144 Sentence denotes Similar predictions and biological proofs were determined for MERS and SARS-CoV [115,116].
T302 47145-47362 Sentence denotes By way of comparison to other human coronaviruses, multiple sequence alignment was carried out, comparing the four SARS-CoV-2 sequences with those from SARS, MERS and two cold viruses, OC43 and 229E (Table S3), [115].
T303 47363-47507 Sentence denotes The symptom spectrum for these viruses differ from that of SARS-CoV-2, therefore it is instructive to see if the miR-like sequences are present.
T304 47508-47656 Sentence denotes We identified seven key miRs, which highlight considerable differences between the SARS-CoV-2 sequences, compared with the other viruses (Table S2).
T305 47657-47795 Sentence denotes In each case, the four SARS-CoV-2 sequences are identical, but, for the most part, the level of conservation in the other genomes is poor.
T306 47796-47993 Sentence denotes Across the four sequences, which for SARS generally show the highest degree of conservation: one ‘miR’ is completely conserved (miR-1468), while others range from two to ten nucleotide differences.
T307 47994-48189 Sentence denotes Whilst it is possible that this decrease in similarity could result in reduced levels of transcriptional control, it is clear that there will be a change in the physiological effect of the virus.
T308 48190-48296 Sentence denotes The proposed miR1307 has been suggested as a therapeutic target in the prevention of SARS-CoV-2 infection.
T309 48297-48452 Sentence denotes Therefore, more studies on in silico patterns within the SARS-CoV-2 genome may provide a deeper understanding about miR-based novel therapeutics [117,118].
T310 48453-48604 Sentence denotes MERS shows greater divergence across these segments and the two milder symptom viruses show even greater differences or even significant sequence gaps.
T311 48605-48745 Sentence denotes This divergence away from the SARS-CoV-2 sequences broadly mirrors the phylogenetic relationships obtained from the whole-genome alignments.
T312 48746-49008 Sentence denotes Thus it can be argued that patterns of mutation, occurring during sequence divergence from the longer established human viruses to the more recent ones, have led to the emergence of sequence motifs that can be related directly to the pathogenicity of SARS-CoV-2.
T313 49009-49127 Sentence denotes This mechanism could have considerable significance in determining the symptom spectrum of future potential pandemics.
T314 49128-49305 Sentence denotes KEGG pathway analysis revealed a number of critical pathways linked to the seven identified miRs that may provide insight into the interplay between the virus and comorbidities.
T315 49306-49535 Sentence denotes Based on our reported findings, miRs may constitute a potential and effective therapeutic approach to cure COVID19 infection and its pathological consequences, requiring further validation in large cohort patient-derived samples.
T316 49537-49552 Sentence denotes Acknowledgments
T317 49553-49712 Sentence denotes We gratefully acknowledge the authors, originating and submitting laboratories of the sequences from GISAID’s EpiFlu™ Database on which this research is based.
T318 49713-49740 Sentence denotes The list is detailed below.
T319 49741-49809 Sentence denotes All submitters of data may be contacted directly via www.gisaid.org.
T320 49810-49918 Sentence denotes We are thankful authors of related accession numbers for designated virus names from different laboratories.
T321 49919-51084 Sentence denotes Monica Galiano, Shahjahan Miah, Angie Lackenby, Omolola Akinbami, Tiina Talts, Leena Bhaw, Richard Myers, Steven Platt, Kirstin Edwards, Jonathan Hubb, Joanna Ellis, Maria Zambon (EPI_ISL_420910 hCoV-19/England/20136087804/2020 Europe/United Kingdom/England 2020-03-25 Respiratory Virus Unit, Microbiology Services Colindale, Public Health England Respiratory Virus Unit, Microbiology Services Colindale, Public Health England); Shaikh Terkis Islam Pavel, Hazel Yetiskin, Gunsu Aydin, Can Holyavkin, Muhammet Ali Uygut, Zehra B Dursun, İlhami Celik, Alper Iseri, Aykut Ozdarendeli (EPI_ISL_424366 hCoV-19/Turkey/ERAGEM-001/2020 Europe/Turkey/Kayseri2020-03-17 Vaccine Research, Development and Application Center, Erciyes UniversityGen Era Diagnostics Inc.); Ilker Karacan, Tugba Kizilboga Akgun, Bugra Agaoglu, Gizem Alkurt, Jale Yildiz, Betsi Köse, Elifnaz Çelik, Mehtap Aydın, Levent Doganay, Gizem Dinler Doganay (EPI_ISL_427391hCoV-19/Turkey/GLAB-CoV008/2020 Europe/Turkey/Istanbul 2020-04-13 Genomic Laboratory (GLAB) (Conjoint lab of Health Directorate of Istanbul and Istanbul Technical University) Genomic Laboratory (GLAB), Istanbul Technical University).
T322 51086-51109 Sentence denotes Supplementary Materials
T323 51110-51191 Sentence denotes The following are available online at https://www.mdpi.com/1999-4915/12/6/614/s1.
T324 51192-51201 Sentence denotes Table S1.
T325 51202-51336 Sentence denotes List of the SARS-CoV-2 strains isolated from different geographical regions that included for the conservation of miR mimic sequences.
T326 51337-51494 Sentence denotes Table S2.Upregulated pathways from SARS-CoV-2 infected lung tissue biopsies when compared to the healthy lung biopsies, obtained from Bioproject PRJNA615032.
T327 51495-51504 Sentence denotes Table S3.
T328 51505-51681 Sentence denotes Segments spanning the putative viral miR sequences were taken from a complete genome multiple sequence alignment of geographically different SARS-CoV-2 and other coronaviruses.
T329 51682-51852 Sentence denotes Figure S1. miR8067 structure is drawn with miREval algorithm (http://mimirna.centenary.org.au/mireval/) as a stem loop prediction sequence found on the SARS-CoV-2 genome.
T330 51853-51889 Sentence denotes Click here for additional data file.
T331 51891-51911 Sentence denotes Author Contributions
T332 51912-52010 Sentence denotes Original draft preparation, review and editing, E.D.A., A.D., G.H.G., S.A., S.C., S.L. and P.U.-O.
T333 52011-52087 Sentence denotes All authors have read and agreed to the published version of the manuscript.
T334 52089-52096 Sentence denotes Funding
T335 52097-52140 Sentence denotes This research received no external funding.
T336 52142-52163 Sentence denotes Conflicts of Interest
T337 52164-52208 Sentence denotes The authors declare no conflict of interest.
T338 52210-52323 Sentence denotes Figure 1 Heat map analysis of KEGG pathway (A) and GO analysis (B) for selected miRs on the microT-CDS database.
T339 52324-52371 Sentence denotes The heat map is drawn with miRPATH (version 3).
T340 52372-52452 Sentence denotes Neighbourhood lines indicate the shared target mRNAs found in a defined pathway.
T341 52453-52646 Sentence denotes Figure 2 Rosalind meta-analysis for Bioproject PRJNA615032 was used for differential gene expression between SARS-CoV-2-infected NHEB and A549 cells with their (mock treated) controls (n = 3).
T342 52647-52861 Sentence denotes 1.5 fold change was accepted as threshold value. (A) MA plot view of differential expression of upregulated and downregulated genes. (B) Heatmap analysis of each clone for 204 differentially expressed gene targets.
T343 52862-52975 Sentence denotes Table 1 Similar microRNA (miR) sequences found in SARS-CoV-2-released genomes from different geographical areas.
T344 52976-53052 Sentence denotes miRs Score E-Value Alignment Wuhan Italy UK Valencia Turkey Vero E6
T345 53053-53202 Sentence denotes NC_045512.2 MT066156.1 hCoV-19/England/20136087804/2020|EPI_ISL_420910 MT198652.2 hCoV-19/Turkey/GLAB-CoV008/2020 hCoV-19/Turkey/ERAGEM-001/2020
T346 53203-53247 Sentence denotes hsa-miR-8066 80 1.6–2.8 √ √ √ √ √ √
T347 53248-53295 Sentence denotes hsa-miR-5197-3p 79 1.6–2.8 √ √ √ √ √ √
T348 53296-53340 Sentence denotes hsa-miR-3611 77 2.8–3.8 √ √ √ √ √ √
T349 53341-53388 Sentence denotes hsa-miR-3934-3p 76 3.4–5.0 √ √ √ √ √ √
T350 53389-53436 Sentence denotes hsa-miR-1468-5p 71 4.7–8.8 √ √ √ √ √ √
T351 53437-53481 Sentence denotes hsa-miR-1307-3p 72 4.3–6.3 √ √ √ √ √
T352 53482-53526 Sentence denotes hsa-miR-3691-3p 74 5.0–9.5 √ √ √ √ √
T353 53527-53572 Sentence denotes hsa-miR-3120-5p 73 6.0–7.2 √ √ √ √ √
T354 53573-53615 Sentence denotes hsa-miR-3914 73 6.0–8.5 √ √ √ √ √
T355 53616-53656 Sentence denotes hsa-miR-3672 72 7.3–9.8 X X X X
T356 53657-53702 Sentence denotes hsa-miR-7107-3p 73 6.0–6.2 √ √ √ √ √
T357 53703-53748 Sentence denotes hsa-miR-1287-5p 73 6.0–8.3 √ √ √ √ √
T358 53749-53791 Sentence denotes hsa-miR-129-2-3p 73 6.0–7.7 √ √ √
T359 53792-53830 Sentence denotes hsa-miR-378c 71 8.8–9.3 √ √ √
T360 53831-53874 Sentence denotes hsa-miR-10397-5p 72 6.9–10.0 √ √ √
T361 53875-53910 Sentence denotes hsa-miR-584-3p 72 7.3–9.8 √ √
T362 53911-53952 Sentence denotes hsa-miR-3085-3p 71 8.8–9.9 √ √ √
T363 53953-53992 Sentence denotes hsa-miR-3191-3p 70 7.4–8.5 √ √
T364 53993-54032 Sentence denotes hsa-miR-148b-3p 72 8.2–9.8 √ √
T365 54033-54064 Sentence denotes hsa-miR-3529-3p 69 9.0 √
T366 54065-54099 Sentence denotes hsa-miR-3682-5p 68 9.0 √ √
T367 54100-54226 Sentence denotes Table 2 The KEGG (A) and GO (B) enrichment analysis results for miR-8066, 5197-3p, 3611, 3934-3p, 1468-5p, 3691, and 1307-3p.
T368 54227-54272 Sentence denotes KEGG Pathway (A) p-Value #genes #miRNAs
T369 54273-54324 Sentence denotes Mucin type O-Glycan biosynthesis 2.52 × 10−2 7 3
T370 54325-54371 Sentence denotes TGF-beta signaling pathway 4.96 × 10−1 12 4
T371 54372-54411 Sentence denotes Morphine addiction 0.0001128919 14 5
T372 54412-54476 Sentence denotes Metabolism of xenobiotics by cytochrome P450 0.0002215491 5 2
T373 54477-54533 Sentence denotes Other types of O-glycan biosynthesis 0.0003646344 1 1
T374 54534-54585 Sentence denotes Vitamin digestion and absorption 0.001008222 2 1
T375 54586-54658 Sentence denotes Glycosaminoglycan biosynthesis—heparan sulfate/heparin 0.00385809 1 1
T376 54659-54695 Sentence denotes GABAergic synapse 0.01342039 13 4
T377 54696-54752 Sentence denotes Cytokine-cytokine receptor interaction 0.02096334 9 1
T378 54753-54825 Sentence denotes Signaling pathways regulating pluripotency of stem cells 0.180299 9 1
T379 54826-54864 Sentence denotes Amphetamine addiction 0.2150865 7 1
T380 54865-54896 Sentence denotes Axon guidance 0.2239648 22 3
T381 54897-54937 Sentence denotes Hippo signaling pathway 0.2278356 7 1
T382 54938-54982 Sentence denotes Prolactin signaling pathway 0.2284669 5 1
T383 54983-55025 Sentence denotes mRNA surveillance pathway 0.2795597 1 1
T384 55026-55099 Sentence denotes Glycosphingolipid biosynthesis—lacto and neolacto series 0.3157068 1 1
T385 55100-55131 Sentence denotes Bile secretion 0.4120997 1 1
T386 55132-55170 Sentence denotes Circadian entrainment 0.4608082 9 1
T387 55171-55208 Sentence denotes N-Glycan biosynthesis 0.488078 2 1
T388 55209-55241 Sentence denotes Mismatch repair 0.6174557 1 1
T389 55242-55290 Sentence denotes Drug metabolism—cytochrome P450 0.7063987 6 1
T390 55291-55329 Sentence denotes Glutamatergic synapse 0.7319762 6 1
T391 55330-55376 Sentence denotes Glycosaminoglycan degradation 0.7395672 2 1
T392 55377-55429 Sentence denotes Antigen processing and presentation 0.7591685 1 1
T393 55430-55474 Sentence denotes GO Category (B) p-Value #genes #miRNAs
T394 55475-55503 Sentence denotes organelle 1 × 10−38 848 6
T395 55504-55567 Sentence denotes cellular nitrogen compound metabolic process 1 × 10−12 414 7
T396 55568-55597 Sentence denotes ion binding 8 × 10−8 495 7
T397 55598-55636 Sentence denotes biosynthetic process 3 × 10−7 351 7
T398 55637-55705 Sentence denotes nucleic acid binding transcription factor activity 4 × 10−2 115 6
T399 55706-55760 Sentence denotes cellular protein modification process 2 × 101 205 7
T400 55761-55797 Sentence denotes molecular_function 5 × 103 1303 7
T401 55798-55834 Sentence denotes cellular_component 1 × 105 1312 7
T402 55835-55866 Sentence denotes enzyme binding 2 × 105 119 5
T403 55867-55898 Sentence denotes gene expression 3 × 105 54 6
T404 55899-55960 Sentence denotes protein binding transcription factor activity 1 × 106 52 5
T405 55961-56004 Sentence denotes blood coagulation 0.000176061599974 44 6
T406 56005-56046 Sentence denotes protein complex 0.00115693944276 290 5
T407 56047-56111 Sentence denotes post-translational protein modification 0.00185490003064 19 5
T408 56112-56180 Sentence denotes neurotrophin TRK receptor signaling pathway 0.00197464302174 24 5
T409 56181-56227 Sentence denotes synaptic transmission 0.00204631087649 42 5
T410 56228-56287 Sentence denotes cellular protein metabolic process 0.00275618650845 39 5
T411 56288-56346 Sentence denotes small molecule metabolic process 0.00275618650845 170 7
T412 56347-56400 Sentence denotes cytoskeletal protein binding 0.00396272124679 68 4
T413 56401-56445 Sentence denotes cell-cell signaling 0.00396272124679 60 5
T414 56446-56500 Sentence denotes transcription, DNA-templated 0.00450420995446 208 6
T415 56501-56577 Sentence denotes symbiosis, encompassing mutualism through parasitism 0.0140041886634 41 5
T416 56578-56620 Sentence denotes catabolic process 0.0141620388146 142 6
T417 56621-56682 Sentence denotes Fc-epsilon receptor signaling pathway 0.0222360628043 15 6
T418 56683-56732 Sentence denotes cellular component assembly 0.02375306792 99 5
T419 56733-56813 Sentence denotes transcription initiation from RNA polymerase II promoter 0.0250016205995 24 5
T420 56814-56849 Sentence denotes nucleoplasm 0.0335128910566 92 6
T421 56850-56893 Sentence denotes platelet activation 0.0350801245107 20 5
T422 56894-56975 Sentence denotes positive regulation of telomere maintenance via telomerase 0.0370638891992 3 3
T423 56976-57156 Sentence denotes RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription 0.0448871926331 32 5
T424 57157-57199 Sentence denotes O-glycan processing 0.0449415771561 8 5
T425 57200-57496 Sentence denotes Table 3 The mutational comparison of selected miRs found on the Wuhan genome compared to other SARS-CoV-2 strains isolated from different geographical regions. % represents the number of viral genome sequences with a single base change in that miR sequence. n = number of viral genomes analysed.
T426 57497-57568 Sentence denotes miRs Alignment Wuhan/China Italy Spain France England USA India
T427 57569-57627 Sentence denotes n = 28 n = 44 n = 133 n = 104 n = 104 n = 104 n = 34
T428 57628-57679 Sentence denotes hsa-miR-8066 ccaaaagaucacauug 0 0 0 0 0 0 0
T429 57680-57744 Sentence denotes hsa-miR-5197-3p auucgaagacccagucccuacuu 0 0 0 0 0 0.9% 0
T430 57745-57799 Sentence denotes hsa-miR-3611 ugagaagcaagaaauucuu 0 0 0 0 0 0 0
T431 57800-57855 Sentence denotes hsa-miR-3934-3p ucagguuggacagcugg 0 0 0 0 0 0 0
T432 57856-57939 Sentence denotes hsa-miR-1307-3p accgaggccacgcggagu 3.5% 2.2% 8.27% 1.92% 2.88% 2.88% 38.23%
T433 57940-58000 Sentence denotes hsa-miR-3691-3p gagauguugacacagacuuugu 0 0 0 0 0 0 0
T434 58001-58067 Sentence denotes hsa-miR-1468-5p cucaguuugccuguuu 0 0 2.25% 0.96% 0 0 8.83%
T435 58068-58126 Sentence denotes hsa-miR-3120-5p uguagaggaggcaaagacag 0 0 0 0 0 0 0
T436 58127-58182 Sentence denotes hsa-miR-3914 caucucacuugcugguuccu 0 0 0 0 0 0 0
T437 58183-58244 Sentence denotes hsa-miR-3672 ugagucucauggaaaaca 0 0 0.75% 0.96% 0 0 0
T438 58245-58305 Sentence denotes hsa-miR-378c acugggcauugauuuagaugagugg 0 0 0 0 0 0 0
T439 58306-58364 Sentence denotes hsa-miR-7107-3p ccaaaaagagaaagucaaca 0 0 0 0 0 0 0
T440 58365-58423 Sentence denotes hsa-miR-1287-5p acucaaaccacugaaacagc 0 0 0 0 0 0 0
T441 58424-58481 Sentence denotes hsa-miR-10397-5p uucuucaccugaugcugu 0 0 0 0 0 0 0
T442 58482-58541 Sentence denotes hsa-miR-584-3p gccugguuugccuggcac 0 0 0.75% 0 0 0 0
T443 58542-58600 Sentence denotes hsa-miR-3085-3p ucuggcuguuauggcc 0 0 0 0 0 0.96% 0
T444 58601-58662 Sentence denotes hsa-miR-3191-3p cugucuauccaguugcgucacca 0 0 0 0 0 0 0
T445 58663-58726 Sentence denotes hsa-miR-3529-3p uggcagacgggcgauuuuguu 0 0 0 0 0 0 2.94%
T446 58727-58788 Sentence denotes hsa-miR-3682-5p auagcacaaguagauguag 0 0 0 0 0 0.96% 0
T447 58789-58845 Sentence denotes hsa-miR-148b-3p aaguucuaugaugcacag 0 0 0 0 0 0 0
T448 58846-58905 Sentence denotes hsa-miR-129-2-3p ugauuuuuguggaaagggcu 0 0 0 0 0 0 0
T449 58906-59036 Sentence denotes Table 4 BioProject data analysis for differential gene expression between non-treated and SARS-CoV-2-treated NEHB and A549 cells.
T450 59037-59057 Sentence denotes WikiPathways p-Adj
T451 59058-59114 Sentence denotes Photodynamic therapy-induced NF-kB survival signaling 0
T452 59115-59150 Sentence denotes IL-18 signaling pathway 8.6 × 10−9
T453 59151-59214 Sentence denotes miRNAs involvement in the immune response in sepsis 2.4 × 10−8
T454 59215-59262 Sentence denotes Cytokines and Inflammatory Response 9.9 × 10−7
T455 59263-59288 Sentence denotes Lung fibrosis 2.5 × 10−6
T456 59289-59306 Sentence denotes BioPlanet p-Adj
T457 59307-59322 Sentence denotes Oncostatin M 0
T458 59323-59374 Sentence denotes Interleukin-1 regulation of extracellular matrix 0
T459 59375-59415 Sentence denotes Interleukin-5 regulation of apoptosis 0
T460 59416-59487 Sentence denotes TNF-alpha effects on cytokine activity, cell motility, and apoptosis 0
T461 59488-59575 Sentence denotes Immune system signaling by interferons, interleukins, prolactin, and growth hormones 0
T462 59576-59588 Sentence denotes KEGG p-Adj
T463 59589-59624 Sentence denotes IL-17 signaling pathway 1.3 × 10−9
T464 59625-59658 Sentence denotes TNF signaling pathway 1.6 × 10−9
T465 59659-59684 Sentence denotes Legionellosis 3.5 × 10−9
T466 59685-59717 Sentence denotes Rheumatoid arthritis 5.4 × 10−9
T467 59718-59768 Sentence denotes Cytokine-cytokine receptor interaction 6.6 × 10−9
T468 59769-59784 Sentence denotes PANTHER p-Adj
T469 59785-59824 Sentence denotes Plasminogen activating cascade 0.00156
T470 59825-59865 Sentence denotes Toll receptor signaling pathway 0.00911
T471 59866-59896 Sentence denotes CCKR signaling map ST 0.02550
T472 59897-59933 Sentence denotes Apoptosis signaling pathway 0.10282
T473 59934-59960 Sentence denotes Blood coagulation 0.10433
T474 59961-59977 Sentence denotes REACTOME p-Adj
T475 59978-60021 Sentence denotes Interferon alpha/beta signaling 1.6 × 10−9
T476 60022-60058 Sentence denotes Interleukin-10 signaling 2.5 × 10−9
T477 60059-60113 Sentence denotes Interleukin-4 and Interleukin-13 signaling 2.4 × 10−7
T478 60114-60161 Sentence denotes Formation of the cornified envelope 1.3 × 10−5
T479 60162-60206 Sentence denotes Chemokine receptors bind chemokines 0.00047
T480 60207-60240 Sentence denotes Small Molecule Pathway DB p-Adj
T481 60241-60274 Sentence denotes CD40L Signalling Pathway 0.25268
T482 60275-60307 Sentence denotes NF-kB Signaling Pathway 0.25268
T483 60308-60345 Sentence denotes Toll-Like Receptor Pathway 2 0.25268
T484 60346-60386 Sentence denotes Capecitabine Metabolism Pathway 0.25268
T485 60387-60423 Sentence denotes Capecitabine Action Pathway 0.25268
T486 60424-60438 Sentence denotes BIOCYC p-Adj
T487 60439-60471 Sentence denotes vitamin D3 biosynthesis 0.03597
T488 60472-60514 Sentence denotes guanosine nucleotides degradation 0.03597
T489 60515-60549 Sentence denotes retinoate biosynthesis II 0.03597
T490 60550-60596 Sentence denotes guanosine nucleotides degradation III 0.03597
T491 60597-60642 Sentence denotes adenosine nucleotides degradation II 0.03597
T492 60643-60673 Sentence denotes Pathway Interaction DB p-Adj
T493 60674-60755 Sentence denotes Validated transcriptional targets of AP1 family members Fra1 and Fra2 3.8 × 10−5
T494 60756-60795 Sentence denotes IL23-mediated signaling events 0.00050
T495 60796-60825 Sentence denotes CD40/CD40L signaling 0.02539
T496 60826-60877 Sentence denotes Glucocorticoid receptor regulatory network 0.02603
T497 60878-60915 Sentence denotes LPA receptor mediated events 0.04171