LitCovid-sentences  

PMC:7075884 / 30256-43788 JSONTXT 13 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T214 0-7 Sentence denotes Methods
T215 9-30 Sentence denotes Cells, viruses and GA
T216 31-216 Sentence denotes HEp2 cells, obtained from the American Type Culture Collection (ATCC Rockville, MD), were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (FBS).
T217 217-309 Sentence denotes HEK293T/17 (293T) cells obtained from the ATCC were grown in DMEM supplemented with 10% FBS.
T218 310-403 Sentence denotes HSV-1 strain F, a limited-passage isolate, is the prototype strain used in this laboratory28.
T219 404-471 Sentence denotes GFP-HSV-1 (strain 17), was a generous gift from Dr. Peter O’Hare29.
T220 472-661 Sentence denotes Vero cells obtained from the ATCC were cultured in complete DMEM (cDMEM) containing 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, and 10 mM Hepes buffer at 37 °C with 5% CO2.
T221 662-926 Sentence denotes Fetal-derived Normal Human Astrocytes (NHA, Lonza) were maintained in Astrocyte Growth Medium (AGM, Lonza) supplemented with 0.3% FBS, 30 µl/mL ascorbic acid, 1 µl/mL rhEGF, 30 µg/mL gentamicin, 15 μg/mL amphotericin B, 2.5 µl/mL insulin, and 10 µl/mL L-glutamine.
T222 927-979 Sentence denotes Early passages (1–4) were used in these experiments.
T223 980-1078 Sentence denotes HCMV studies were performed using cell-associated low-passage clinical isolates CH1914 and BI-615.
T224 1079-1188 Sentence denotes CH19 is resistant to the first-line HCMV antiviral drug, ganciclovir (GCV), while BI-6 is susceptible to GCV.
T225 1189-1323 Sentence denotes Additional experiments were performed using CMVPT30-GFP16, which expresses green fluorescent protein and produces extracellular virus.
T226 1324-1546 Sentence denotes ZIKV strain PRVABC59 obtained from the American Type Culture Collection (ATCC; Manassas, VA) was propagated in Vero cells grown in T-150 flasks by infection at 1:50 dilution of viral stock (MOI 0.25) in the absence of FBS.
T227 1547-1625 Sentence denotes The medium was removed and replaced 6 h post-infection (hpi) with fresh cDMEM.
T228 1626-1787 Sentence denotes Supernatant was collected at 72 hpi, clarified by centrifugation at 350 × g for 5 min, and filtered through a 0.45-μm surfactant-free cellulose acetate membrane.
T229 1788-1922 Sentence denotes For mock infections, supernatant was collected from uninfected Vero cells and prepared by the same protocol used to make virus stocks.
T230 1923-1956 Sentence denotes Virus was titered by focus assay.
T231 1957-2331 Sentence denotes Briefly, infected Vero cells, 24 hpi were fixed and permeabilized using Cytofix/Cytoperm Solution Kit (BD Biosciences) according to the manufacturer’s instructions and stained with a mouse monoclonal antibody (mAb) specific for flavivirus group envelope proteins (1:250; EMD Millipore; clone D1–4G2-4-15) followed by incubation with an anti-mouse IgG - PE (1:1000 dilution).
T232 2332-2492 Sentence denotes Samples were run through an LSR II flow cytometer and data were collected with FACSDiva software (BD Biosciences) and analyzed using FlowJo Software (TreeStar).
T233 2493-2530 Sentence denotes Human Adenovirus Type5 (dE1/E3), Cat.
T234 2531-2535 Sentence denotes No.:
T235 2536-2576 Sentence denotes 1060, was purchased from Vector Biolabs.
T236 2577-2654 Sentence denotes GA C13:0, C15:1, and C17:1, were purchased from Sigma Aldrich, St. Louis, MO.
T237 2655-2718 Sentence denotes GA was diluted in methanol or DMSO to a concentration of 50 mM.
T238 2719-2848 Sentence denotes Effects of GA in all assays and models used in this study have been compared to vehicle-treated (i.e. methanol or DMSO) controls.
T239 2849-2923 Sentence denotes Cells or viral stocks were treated with the indicated concentration of GA.
T240 2925-2946 Sentence denotes Western blot analyses
T241 2947-3159 Sentence denotes For HSV-1, cells were harvested at the indicated times, collected by low-speed centrifugation and rinsed in PBS, then resuspended in RIPA lysis buffer and protease inhibitors (Complete Protease Inhibitor; Roche).
T242 3160-3236 Sentence denotes Approximately 60 μg of protein per sample was subjected to further analysis.
T243 3237-3447 Sentence denotes Proteins were electrophoretically separated on 8 to 10% denaturing polyacrylamide gels, electrically transferred to nitrocellulose sheets, blocked by 5% BSA in Tween PBS and reacted with the primary antibodies.
T244 3448-3605 Sentence denotes The mouse monoclonal antibody to US11 (Goodwin Institute for Cancer Research), and the mouse monoclonal antibody to ICP8, were used at a dilution of 1:1,000.
T245 3606-3677 Sentence denotes The mouse monoclonal antibody to ICP27 was used at a dilution of 1:250.
T246 3678-3758 Sentence denotes The mouse monoclonal antibody to β-actin (Sigma) was used at a 1:5,000 dilution.
T247 3759-3898 Sentence denotes Membranes were then reacted with the appropriate secondary antibody conjugated either to alkaline phosphatase or to horseradish peroxidase.
T248 3899-4131 Sentence denotes Protein bands were visualized with 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium (Denville Scientific, Inc.) or with ECL Western Blot detection reagents (Amersham Biosciences) according to the manufacturer’s instruction.
T249 4133-4151 Sentence denotes Cytotoxicity tests
T250 4152-4244 Sentence denotes Cells grown in 96 or 48 well plates were exposed to different concentrations of GA for 24 h.
T251 4245-4348 Sentence denotes Cell viability was determined by Alamarblue® assay (Thermo Fisher Scientific, Catalog number: DAL1025).
T252 4349-4450 Sentence denotes Pair-wise Student t-tests were used to compare the outcome of a treatment as compared to the control.
T253 4451-4478 Sentence denotes Error bars are SEM (n ≥ 3).
T254 4480-4503 Sentence denotes Viral stock preparation
T255 4504-4835 Sentence denotes Confluent Vero cells in 75-cm2 flasks were infected with HSV in 3 ml of 199V (Gibco; 199 medium supplemented with 1% heat-inactivated FBS and 1% penicillin/streptomycin) medium at a multiplicity of infection (MOI) of 0.01 pfu/cell and incubated by gentle shaking for 2 hours at 37 °C with 5% CO2 to allow cells to absorb the virus.
T256 4836-4937 Sentence denotes After 2 hours, 199 V was aspirated from the cell culture and Vero cells were gently washed with DPBS.
T257 4938-5082 Sentence denotes 3 ml of fresh DMEM/5% FBS medium was added and the cells were incubated for 2 to 3 days until 100% of the cells display cytopathic effect (CPE).
T258 5083-5238 Sentence denotes When 100% CPE was observed, the flask was placed at −80 °C for 15 min, then allowed to warm up at room temperature and 3 ml of cold sterile milk was added.
T259 5239-5298 Sentence denotes The cells were collected into a 15 ml tube and kept on ice.
T260 5299-5574 Sentence denotes To free virus particles from the cellular debris, Vero cells were sonicated three times (letting the cell suspension cool on ice for 1 min between sonications), for 30 seconds using a Branson Sonifier with microtip at an output setting of 4 (approximate Power Output of 15%).
T261 5575-5681 Sentence denotes The virus stock was aliquoted and transferred to sterile, screw-capped cryovials and was stored at −80 °C.
T262 5682-5729 Sentence denotes The viral titer was determined by plaque assay.
T263 5731-5749 Sentence denotes HSV-1 plaque assay
T264 5750-5970 Sentence denotes GA (10 µM) was incubated on the monolayers of Vero cells (6-well plate) with 199V (Gibco; supplemented with 1% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin) at 37 °C for 1 hour prior to inoculation.
T265 5971-6067 Sentence denotes Following incubation, the supernatants were aspirated and cells were washed two times with DPBS.
T266 6068-6166 Sentence denotes GFP-HSV-1 strain 17+29, at an MOI of 1 was incubated on the cells with 199V at 37 °C for 24 hours.
T267 6167-6209 Sentence denotes The supernatant was collected and titered.
T268 6210-6404 Sentence denotes Various 10-fold dilutions of collected supernatants were incubated on monolayers of fresh Vero cells (6-well plate) at 37 °C on a shaker for 2 h to allow the virus to attach and enter the cells.
T269 6405-6663 Sentence denotes The supernatants were aspirated and cells were incubated with 20 mg/mL of human serum (Sigma-H4522) in DMEM (Dulbecco’s Modified Eagle’s medium, supplemented with 5% FBS and 1% penicillin/streptomycin) for 3 days at 37 °C in 5% CO2 to allow plaque formation.
T270 6664-6850 Sentence denotes For plaque counting, the cells were fixed with 100% methanol for 5 min. at room temperature and stained with 10% KaryoMax Giemsa stain in distilled water for 20 min. at room temperature.
T271 6851-6949 Sentence denotes Viral titer was calculated through plaque counting and expressed as plaque-forming units (PFU)/ml.
T272 6951-6963 Sentence denotes ZIKV studies
T273 6964-7059 Sentence denotes Cell free ZIKV in 199V medium was pretreated with 10 µM/ml GA or with DMSO for 1 hour at 37 °C.
T274 7060-7173 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T275 7174-7278 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T276 7279-7394 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell-free viral RNA copy number determination.
T277 7395-7534 Sentence denotes NHA were grown in 24 well plates to >80% confluency, treated with GA C15:1 (0–20 µM) for 3 h, and then infected with ZIKV at an MOI of 0.3.
T278 7535-7653 Sentence denotes Supernatant was carefully removed and replaced at 12 hpi with fresh AGM replenished with GA at 0–20 µM concentrations.
T279 7654-7890 Sentence denotes Cell viability was assessed at 7 days post-inoculation by Celltiter Aqueous One solution cell proliferation assay (Promega, Madison, WI), and live cells were carefully harvested to extract RNA by the RNeasy kit (Qiagen, Germantown, MD).
T280 7891-8202 Sentence denotes RNA was quantified using a Nanodrop2000 (ThermoFisher), treated with DNaseI (Sigma-Aldrich) for 15 min at room temperature to remove DNA contamination, and subsequently, DNaseI was inactivated by heating at 70 °C for 15 min. cDNA was synthesized from 0.2–1 μg of RNA using Qscript supermix (Quanta Biosciences).
T281 8203-8390 Sentence denotes Quantitative real-time PCR (qRT-PCR) reactions were performed in a 20 μl solution containing 10 μl TaqMan Gene Expression Master Mix (Life Technologies), 500 nM primers, and 300 nM probe.
T282 8391-8523 Sentence denotes Reactions were performed in an Applied Biosystems 7900HT sequence detection system (Thermo Fisher Scientific) using SDS2.3 software.
T283 8524-8649 Sentence denotes The reaction conditions were, 50 °C for 2 min, 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
T284 8650-8751 Sentence denotes Samples were run in duplicate or triplicates, and template controls were included wherever necessary.
T285 8752-8889 Sentence denotes Fold change in RNA expression was calculated by relative quantification using the comparative CT method with GAPDH as endogenous control.
T286 8890-8983 Sentence denotes The primers and probe were designed using the PrimerQuest tool (Integrated DNA Technologies).
T287 8984-9029 Sentence denotes The sequences of the primers were as follows:
T288 9030-9308 Sentence denotes ZIKV-F-CGCTGCCCAACACAAGGT; ZIKV-R-, GCTCCCTTTGCCAAAAAGTCCACA, and ZIKV-probe, 5′/56-FAM/ACCTTGACA/ZEN/AGCAGTCAGACACTCAA/3IABkFQ; and human specific GAPDH-F-GGTGTGAACCATGAGAAGTATGA; GAPDH-R-GAGTCCTTCCACGATACCAAAG; and GAPDH-probe, 5′/56-FAM/AGATCATCA/ZEN/GCAATGCCTCCTGCA/3IABkFQ.
T289 9310-9322 Sentence denotes HCMV studies
T290 9323-9494 Sentence denotes HFF were grown in 24 well plates to 100% confluency in MEM with 10% FBS to establish viral inhibition of two low-passage clinical strains (BI-6 and CH19) via plaque assay.
T291 9495-9654 Sentence denotes Cells infected with low-passage HCMV clinical strains (CH19 and BI6) do not release extracellular virus, but they display typical HCMV cytopathic effect (CPE).
T292 9655-9729 Sentence denotes The percentage of infected cells was estimated visually in HFF monolayers.
T293 9730-9819 Sentence denotes Dilutions of trypsinized cells were used as inocula for HFF monolayers in 24 well plates.
T294 9820-9947 Sentence denotes After 7 days in culture, plaques were counted to determine the average number of plaques in 4-well replicates of each dilution.
T295 9948-10037 Sentence denotes The optimal dilution for each virus strain produced an average of 60–80 plaques per well.
T296 10038-10114 Sentence denotes CMVPT30-GFP having undergone multiple passages produces extracellular virus.
T297 10115-10198 Sentence denotes Viral infection was quantitatively determined by PRA of culture supernatant medium.
T298 10199-10393 Sentence denotes Cells were either exposed to GA for three hours prior to inoculation, or were inoculated prior to addition of medium containing GA at concentrations of 1, 2, 5, 10, and 20 µM in MEM with 1% FBS.
T299 10394-10459 Sentence denotes One set of four wells was treated with DMSO as a vehicle control.
T300 10460-10549 Sentence denotes For each experiment the remaining concentrations were represented in quadruplicate wells.
T301 10550-10739 Sentence denotes Plates were read beginning at 7 days post inoculation (dpi) to determine the GA concentration producing a reduction of 50% in the number of plaques relative to vehicle control wells (IC50).
T302 10740-10882 Sentence denotes Data were normalized to the vehicle controls, and probit analysis in SPSS was used to obtain 95% confidence intervals of the mean IC50 values.
T303 10884-10920 Sentence denotes HCMV DNA extraction and quantitation
T304 10921-11004 Sentence denotes HCMV infected monolayers were trypsinized and pooled at the termination of the PRA.
T305 11005-11098 Sentence denotes DNA was extracted from the pooled monolayers using the Blood gDNA kit (Promega, Madison, WI).
T306 11099-11193 Sentence denotes HCMV DNA was quantitated using a validated in-house assay, which targets the DNA polymerase30.
T307 11194-11276 Sentence denotes Reactions were performed on an Applied Biosystems 7500 (Thermo Fisher Scientific).
T308 11278-11313 Sentence denotes Infection of GFP-expressing viruses
T309 11314-11419 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T310 11420-11625 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T311 11626-11677 Sentence denotes Infection was evaluated by fluorescence microscopy.
T312 11679-11703 Sentence denotes Cell-cell fusion vectors
T313 11704-11807 Sentence denotes In these experiments, we used cell-cell fusion systems of ZIKV, HIV, EBOV, IVA, VEEV, VSV, SFV and EBV.
T314 11808-11892 Sentence denotes The plasmids, fusion proteins, and the related references are described in Table S2.
T315 11894-11912 Sentence denotes Fusion experiments
T316 11913-11986 Sentence denotes Nucleated cell-cell fusion, experiments were performed as described31,32.
T317 11987-12131 Sentence denotes Calcein-AM was loaded into effector cells expressing the fusion protein, and 7-amino-4-chloromethylcoumarin (CMAC) was loaded into target cells.
T318 12132-12168 Sentence denotes Mixing of dyes was scored as fusion.
T319 12169-12316 Sentence denotes Fusion experiments for each viral protein were performed as previously described: EBOV GP32; HIV33; SFV E1/E2 and IAV HA34; VEEV E, VSV, and EBV35.
T320 12317-12421 Sentence denotes Unless stated otherwise, EBOV GP was used as the fusion protein and C15:1 GA was used to inhibit fusion.
T321 12422-12506 Sentence denotes As shown in Fig. 2B, C15:1 GA inhibited fusion for the eight tested fusion proteins.
T322 12507-12582 Sentence denotes Figure 2C documents that fusion was blockaded by GA C13:0, C15:1, or C17:1.
T323 12584-12604 Sentence denotes Statistical analysis
T324 12605-12685 Sentence denotes For HCMV plaque assays, data were analyzed using one-way ANOVA analysis in SPSS.
T325 12686-12763 Sentence denotes For BI6 n = 25; degrees of freedom between groups = 4 and within groups = 20.
T326 12764-12786 Sentence denotes The F value is 68.827.
T327 12787-12865 Sentence denotes For CH19 n = 24; degrees of freedom between groups = 4 and within groups = 19.
T328 12866-12888 Sentence denotes The F value is 41.090.
T329 12889-13027 Sentence denotes For fusion experiments, Pair-wise Student t-tests were used to compare the outcome of a manipulation on fusion as compared to the control.
T330 13028-13055 Sentence denotes Error bars are SEM (n ≥ 3).
T331 13056-13110 Sentence denotes HCMV DNA copy numbers expressed as percent of control.
T332 13111-13144 Sentence denotes Significance was set at P < 0.05.
T333 13145-13194 Sentence denotes P values were obtained using a two-tailed t-test.
T334 13195-13240 Sentence denotes All measurements were performed in duplicate.
T335 13241-13283 Sentence denotes Standard curves were included on each run.
T336 13284-13401 Sentence denotes For ZIKV, the data were analyzed using unpaired, two tailed student’s t test and represented as mean± standard error.
T337 13402-13532 Sentence denotes Experiments were done independently at least three times and a value of p ≤ 0.05 indicated a statistically significant difference.