LitCovid-sentences  

PMC:7075884 / 1855-43843 JSONTXT 14 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T14 0-12 Sentence denotes Introduction
T15 13-100 Sentence denotes Ginkgolic acids are alkylphenol constituents of the leaves and fruits of Ginkgo biloba.
T16 101-225 Sentence denotes Ginkgo biloba extracts (GBE) have been used as herbal supplements since at least the 16th century and remain widely in use1.
T17 226-393 Sentence denotes Major constituents of GBE include terpine trilactones (ginkgolide A, B, C, J, and bilobalide), flavonoid glycosides (quercetin and rutin), as well as Ginkgolic acids2.
T18 394-534 Sentence denotes Ginkgolic acids are a mixture of several 2-hydroxy-6-alkylbenzoic acids in which the most common alkyl chains contain 13, 15, or 17 carbons.
T19 535-615 Sentence denotes The 15 and 17 carbon chains are unsaturated at positions 8 and 10, respectively.
T20 616-716 Sentence denotes The 3 Ginkgolic acid (GA) structures are, therefore, designated C13:0, C15:1, and C17:1 (Table S1)3.
T21 717-1042 Sentence denotes GA has shown pleiotropic effects in vitro, including: antitumor effects through inhibition of lipogenesis; decreased expression of invasion associated proteins through AMPK activation; potential rescue of amyloid-β (Aβ) induced synaptic impairment; and inhibition of HIV protease activity as well as HIV viral replication4–7.
T22 1043-1133 Sentence denotes GA was also reported to have activity against Escherichia coli and Staphylococcus aureus8.
T23 1134-1397 Sentence denotes Several ways in which GA works have been suggested including by SUMOylation inhibition activity; blocking formation of the E1-SUMO intermediate9; inhibition of fatty acid synthase10; non-specific SIRT inhibition11; and activation of protein phosphatase type-2C12.
T24 1398-1580 Sentence denotes Here we report that GA shows antiviral activity against Herpes simplex virus 1 (HSV-1), Human cytomegalovirus (HCMV), and Zika virus (ZIKV) primarily through viral fusion inhibition.
T25 1581-1674 Sentence denotes In addition, we show inhibition of entry of a replication-defective non-enveloped adenovirus.
T26 1675-1741 Sentence denotes The antiviral effects were observed below the cytotoxic threshold.
T27 1742-2014 Sentence denotes We believe that broad spectrum antiviral activity is achieved through the inhibition of viral entry and that this effect could be therapeutically utilized systemically in the context of severe acute viral disease, or topically for the treatment of cutaneous viral lesions.
T28 2015-2381 Sentence denotes We show a broad spectrum of fusion inhibition by GA of all three classes of fusion proteins13 including: pathogenic human enveloped viruses from Class I (ZIKV, HIV, EBOV, and influenza A virus (IAV)), Class II (Venezuelan equine encephalitis virus (VEEV) and Semliki Forest virus (SFV)), and Class III (vesicular stomatitis virus (VSV) and Epstein Barr virus (EBV)).
T29 2382-2488 Sentence denotes Taken together, our experiments suggest that GA inhibits viral entry by blocking the initial fusion event.
T30 2490-2497 Sentence denotes Results
T31 2498-2722 Sentence denotes In reporting the results of our experiments, we apply the term “infection” to measurements of virus cytopathic effect in permissive cells, and the term “replication” to the measurement of genome copies or protein expression.
T32 2723-2842 Sentence denotes We chose to use GA C15:1 as the main GA type in our experiments because it is the one most used experimentally to date.
T33 2843-2916 Sentence denotes However, we also tested GA C13:0 and GA C17:1 in some of our experiments.
T34 2917-2960 Sentence denotes Unless stated otherwise, GA C15:1 was used.
T35 2962-2978 Sentence denotes GA IC50 vs. EC50
T36 2979-3164 Sentence denotes The toxicity EC50 of GA on HEp-2 cells in MEM supplemented with 1% fetal bovine serum (FBS) was 27.63 ± 2.21 μM (Fig. S1A) or 63.5 ± 3.2 μM (Fig. S1B) on cells supplemented with 5% FBS.
T37 3165-3357 Sentence denotes In cells infected with HCMV strain CH19 and supplemented with 1% FBS, the 50% inhibitory concentration (IC50) was 6.83 ± 1.08 μM, and with 10% bovine serum, the IC50 of GA was 41 μM (Fig. 1A).
T38 3358-3538 Sentence denotes The toxicity EC50 of GA on HFF cells was 14.00 μM ± 0.1 in MEM medium supplemented with 1% FBS (Fig. S1C), and 137.04 μM ± 10.44 (Fig. S1D) in MEM medium supplemented with 10% FBS.
T39 3539-3668 Sentence denotes The results indicated that the activity and toxicity of GA is affected by the serum concentration in the medium (see discussion).
T40 3669-4056 Sentence denotes Figure 1 Ginkgolic Acids (C13:0, C15:1, C17:1) inhibit HCMV in a dose-dependent manner and prevents plaque formation. (A) Monolayers of human foreskin fibroblasts (HFF) were inoculated with 50–100 cells infected with one of two cell-associated clinical isolates of HCMV (CH19 and BI-6) in a total of 4 wells per drug concentration followed by treatment with medium containing 0–10 µM GA.
T41 4057-4204 Sentence denotes Viral infection was allowed to progress for 7 days when the mean number of HCMV plaques per concentration was counted, and the IC50 was determined.
T42 4205-4677 Sentence denotes The effects of different concentrations of FBS and time delay on the IC50 are also shown. (B) Dose-dependent inhibitory effect of GA on infection by the cell-free virus strain PT30CMV-GFP. (C) Inhibitory effect of 10 µM GA C15:1 compared to 16 µM GCV on HCMV-GFP cell-free infection. (D) Inhibitory effect of 10 µM GA C13:0 on HCMV-GFP infection, and (E) Inhibitory effect of 10 µM GA C17:1 on cell-free HCMV-GFP infection. (B–E) representing average of 20 scanned fields.
T43 4679-4741 Sentence denotes GA inhibits HCMV infection in human foreskin fibroblasts (HFF)
T44 4742-4835 Sentence denotes To assess the effect of GA on HCMV infection, dilutions of 1 µM to 20 µM were made (Fig. 1A).
T45 4836-5005 Sentence denotes Monolayers of human foreskin fibroblasts (HFF) were incubated for 1 hour with GA and then infected with two cell-associated clinical isolates of HCMV: CH1914 and BI-615.
T46 5006-5207 Sentence denotes Because neither virus produces extracellular virus, plates for plaque assays were inoculated with 50–100 infected cells per well, and then treated with medium containing 1–20 µM GA, or vehicle control.
T47 5208-5309 Sentence denotes Viral infection was allowed to progress for 7 days, and then quantitated by plaque reduction assay14.
T48 5310-5414 Sentence denotes GA inhibited infection of BI-6 and CH19 with an IC50 of 7.26 ± 0.92 μM and 6.83 ± 1.08 μM, respectively.
T49 5415-5536 Sentence denotes To further assess the effect of GA on plaque formation, we used the CMVPT30-GFP strain, which produces cell-free virions.
T50 5537-5694 Sentence denotes HFF monolayers in 24-well plates pretreated with GA (1–20 µM) for 1 h were inoculated with 50–100 plaque-forming units of CMVPT30-GFP per well.16, (Fig. 1B).
T51 5695-5771 Sentence denotes The number of plaques were counted after 7 days and the IC50 was determined.
T52 5772-5872 Sentence denotes As predicted by the previously-determined IC50, at 5 and at 10 µM the antiviral effect was apparent.
T53 5873-5990 Sentence denotes Furthermore, at 10 µM, only single cells were infected, indicating that there was no cell-to-cell virus transmission.
T54 5991-6102 Sentence denotes These results may be explained as inhibition of secondary infections or that viral entry may be a target of GA.
T55 6103-6297 Sentence denotes To verify these results, we compared the inhibition of infection by GA using a plaque reduction assay (PRA) similar to the PRA for ganciclovir (GCV), the preferred antiviral HCMV drug of choice.
T56 6298-6522 Sentence denotes The results showed that although there was strong inhibition of the virus at 16 µM GCV, there were still visible plaques (>5 adjacent cells showing HCMV cytopathic effect) indicating cell-to-cell transmission of the virions.
T57 6523-6724 Sentence denotes On the contrary, CMVPT30-GFP infected monolayers that were treated with 10 µM GA only displayed individual infected cells in intact HFF monolayers, (Fig. 1C), thus indicating no cell-cell transmission.
T58 6725-6762 Sentence denotes We also tested GA C17:1 and GA C13:0.
T59 6763-6870 Sentence denotes Both GA compounds had a strong inhibitory effect on HCMV infection by PRA, similar to GA C15:1 (Fig. 1D,E).
T60 6871-6962 Sentence denotes None of the GA structures showed cytotoxicity at their active concentrations, respectively.
T61 6964-7000 Sentence denotes GA inhibits HSV-1 and ZIKV infection
T62 7001-7177 Sentence denotes We tested GA on HSV-1, a rapidly replicating and lytic DNA virus, and on ZIKV, an RNA virus which has neither glycoprotein conservation nor common receptors with HCMV or HSV-1.
T63 7178-7284 Sentence denotes To test whether GA inhibits HSV-1, we designed an experiment to test the direct effect of GA on the virus.
T64 7285-7335 Sentence denotes For this experiment, we used HEp-2 and 293T cells.
T65 7336-7571 Sentence denotes 1 × 107 PFU HSV-1 strain F was treated for 1 hour with GA (50 µM) or with vehicle in serum free DMEM and then each of these were used to infect HEp2 or 293T cells at an MOI of 0.5 in 199V medium with a final concentration of 2.5 µM GA.
T66 7572-7683 Sentence denotes As a control, the virus that was originally treated with the vehicle was then supplemented also with 2.5 µM GA.
T67 7684-7872 Sentence denotes To test for successful viral infection of HEp2 and 293T cells, production of HSV-1 immediate early (ICP27), early (ICP8), and late (US11) proteins was analyzed by Western Blot (Fig. 2A,B).
T68 7873-8020 Sentence denotes The results showed that in the treated HSV-1 F stock there was complete inhibition of viral replication, as indicated by lack of protein synthesis.
T69 8021-8159 Sentence denotes This implies that viral entry may be a target of GA, because direct treatment of HSV-1 with GA blocks downstream HSV-1 protein production.
T70 8160-8403 Sentence denotes To test the effect of GA on HSV-1 replication, HEp2 cell monolayers were grown to 90% confluency in a 6-well plate, treated with 10 µM GA C15:1 or vehicle for 1 hour in 199V medium, and then inoculated with HSV-1 strain F for protein analysis.
T71 8404-8481 Sentence denotes HSV-1 ICP27, ICP8, and US11 proteins were detected by Western Blot (Fig. 2C).
T72 8482-8572 Sentence denotes The results showed profound inhibition of immediate early, early, and late viral proteins.
T73 8573-8739 Sentence denotes The inhibition of the full temporal range of HSV-1 proteins implies that inhibition of viral replication occurs by blocking the entry of virions into the target cell.
T74 8740-8937 Sentence denotes To evaluate the effect of GA on progeny virions, the supernatant of GFP-HSV-1 strain 17+ infected Vero cells at an MOI of 1 was collected after 20 h and titered by plaque reduction assay (Fig. 2D).
T75 8938-9033 Sentence denotes The results showed a significant decrease of approximately 2 log in the GA-treated cell titers.
T76 9034-9318 Sentence denotes Figure 2 GA inhibits HSV-1 infection. (A) 1 × 107 PFU HSV-1 strain F were treated for 1 hour with 50 µM GA (Lanes 1–3) or with vehicle (Lanes 4–6) in serum free DMEM and then were used to infect HEp2 or 293T cells at an MOI of 0.5 in 199V medium with final concentration of 2.5 µM GA.
T77 9319-9928 Sentence denotes 6-well cultures of HEp-2 (A) or 293T (B) were then infected, and at 5, 10 and 29 hours post-inoculation, cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, US11 and β-Actin. (C) HEp2 cell monolayers were treated with 10 µM GA C15:1 or vehicle for 1 hour in 199V medium and then infected with HSV-1 strain F at 4, 8, 12, 24 and 32 hours post-inoculation cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, US11 and β-Actin.
T78 9929-10121 Sentence denotes Normalized ratios of protein expression are in the bar graph. (D) Titration by plaque assay of Vero cells pretreated with 10 µM GA C15:1 or vehicle and then infected with GFP-HSV-1 strain 17+.
T79 10122-10330 Sentence denotes To test the effect of GA on ZIKV infection, NHA were grown to 90% confluency in a 24-well plate, treated with GA or DMSO for 3 hours without serum and then infected with ZIKV strain PRVABC59 at an MOI of 0.3.
T80 10331-10452 Sentence denotes The next day, supernatant was replaced with fresh medium containing GA or DMSO and cells were incubated at 37 °C, 5% CO2.
T81 10453-10649 Sentence denotes On day 7, viability was determined with the MTS Cell Proliferation Assay (Promega), and then these cells were harvested to extract total RNA for quantification of ZIKV RNA by Taqman based qRT-PCR.
T82 10650-10777 Sentence denotes The results showed 70% to 80% viability at 5 µM to 20 µM GA, compared to less than 40% viability for the vehicle-treated cells.
T83 10778-10867 Sentence denotes Furthermore, an 80–90% decrease in ZIKV RNA was observed at 5 µM to 20 µM GA (Fig. 3A,B).
T84 10868-10948 Sentence denotes We concluded that GA inhibits entry of Zika virions and prevents NHA cell death.
T85 10949-11164 Sentence denotes This suggests that the mechanism of inhibition that appears to be targeted in HSV and HCMV by GA is conserved among enveloped viruses that have no homologous glycoproteins and use different cell receptors for entry.
T86 11165-11355 Sentence denotes To test the direct effect of GA on ZIKV, 5 × 105 PFU ZIKV were treated for 1 hour with GA (10 µM/ml) or with vehicle in 199V medium, and then were used to infect Vero cells at an MOI of 0.5.
T87 11356-11481 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell free viral RNA copy number determination (Fig. 3C).
T88 11482-11602 Sentence denotes The results indicated that the GA-treated ZIKV was completely inhibited, as indicated by cell free ZIKV RNA copy number.
T89 11603-11744 Sentence denotes This suggests that viral entry of ZIKV, may be a target of GA because direct treatment of ZIKV with GA blocks downstream ZIKV RNA production.
T90 11745-11842 Sentence denotes Figure 3 GA inhibits ZIKV infection. (A) Viability of NHA infected with ZIKV and treated with GA.
T91 11843-12001 Sentence denotes NHA were grown in 24-well plates to >80% confluency and treated with GA (0–20 µM) or DMSO for 3 hours and infected with ZIKV strain PRVABC59 at an MOI of 0.3.
T92 12002-12273 Sentence denotes At 12 hpi, supernatants were carefully removed and replaced with fresh AGM. (B) 7 days post infection, samples were analyzed for cell viability by the MTS assay and then live cells were harvested for RNA and processed with Taqman based real-time PCR to quantify ZIKV RNA.
T93 12274-12495 Sentence denotes Experiments were performed in duplicate three independent times and the data were analyzed by t-test (* indicates p ≤ 0.05). (C) Cell free ZIKV in 199V medium was pretreated with 10 µM GA or with DMSO for 1 hour at 37 °C.
T94 12496-12609 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T95 12610-12714 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T96 12715-12830 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell free viral RNA copy number determination.
T97 12831-12873 Sentence denotes Experiments were performed in triplicates.
T98 12875-12913 Sentence denotes GA inhibits a non-enveloped adenovirus
T99 12914-13055 Sentence denotes To assess the effect of GA on non-enveloped virus, we also tested its antiviral activity on adenovirus, which is internalized by endocytosis.
T100 13056-13161 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T101 13162-13367 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T102 13368-13445 Sentence denotes The inoculated Vero cells were evaluated by fluorescence microscopy (Fig. 4).
T103 13446-13544 Sentence denotes The results showed significant HSV-1 inhibition, as well as inhibition of entry of the adenovirus.
T104 13545-13707 Sentence denotes Figure 4 GA inhibits non-enveloped human adenovirus. (A) Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T105 13708-13819 Sentence denotes The cells were infected with GFP-HSV-1 virus at an MOI of 0.5 in medium containing 10 µM GA C15:1 for 24 hours.
T106 13820-14024 Sentence denotes Infection was evaluated by light (lower panels) and fluorescence (upper panels) microscopy. (B) Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM of GA C15:1 or DMSO vehicle.
T107 14025-14205 Sentence denotes The cells were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T108 14206-14307 Sentence denotes Inhibition of entry was evaluated by light (lower panels) and fluorescence (upper panels) microscopy.
T109 14309-14386 Sentence denotes GA inhibits cell fusion induced by all three classes of viral fusion proteins
T110 14387-14440 Sentence denotes Our data suggested that GA targets virus-cell fusion.
T111 14441-14598 Sentence denotes To assess the activity of GA C15:1 on virus-cell fusion we modeled virus-cell fusion by the fusion of cells expressing viral fusion proteins to target cells.
T112 14599-14664 Sentence denotes Cell-cell fusion was monitored by the spread of fluorescent dyes.
T113 14665-14806 Sentence denotes Based on crystallographically identified three-dimensional structures, the folds of all virus fusion proteins fall into one of three classes.
T114 14807-14959 Sentence denotes Effector COS7 cells were transfected to express all three classes of fusion proteins (Table S2), including ZIKV, HIV, EBOV, IAV, SFV, VEEV, VSV and EBV.
T115 14960-15195 Sentence denotes The COS7 cells were loaded with calcein AM and bound to 293T target cells that were either unlabeled or, for purposes of microscopic identification, loaded with the aqueous dye CMAC, as illustrated for EBOV GP-induced fusion (Fig. 5A).
T116 15196-15324 Sentence denotes We tested the effect of adding GA on cell-cell fusion mediated by four class I, two class II, and two class III fusion proteins.
T117 15325-15400 Sentence denotes For all eight proteins, 10 µM GA C15:1 completely blocked fusion (Fig. 5B).
T118 15401-15560 Sentence denotes Furthermore, when EBOV GP was treated with 5 µM or with 10 µM GA C13:0, GA C15:1, or GA C17:1 (Fig. 5C), 10 µM of all GA derivatives completely blocked fusion.
T119 15561-15792 Sentence denotes Figure 5 GA inhibits cell fusion induced by all three classes of fusion proteins. (A) In the two top panels, typical images used to visualize the extent of fusion in the absence (control, left) and presence of GA (right) are shown.
T120 15793-15943 Sentence denotes Fused cells (light blue, due to mixing of the green calcein in effector cells and dark blue CMAC in target cells) are marked by arrows in the control.
T121 15944-15991 Sentence denotes Cells did not fuse in the presence of 10 µM GA.
T122 15992-16045 Sentence denotes The extent of fusion is quantitated in the bar graph.
T123 16046-16106 Sentence denotes The experiments used EBOV GP as the fusion protein. (n = 3).
T124 16107-16284 Sentence denotes For all bars of experiments using cell-cell fusion, means ± SEM are shown. (B) Extent of cell-cell fusion induced by fusion proteins from three classes of viral fusion proteins.
T125 16285-16550 Sentence denotes The proteins for class I are: ZIKV (Zika E), HIV Env, EBOV (Ebola GP), IAV (Influenza HA); for class II: SFV (Semliki forest virus) E1/E2, VEEV (Venezuelan Equine Encephalitis Virus) E; for class III: VSV (Vesicular Stomatitis Virus) G, EBV (Epstein Barr Virus) gB.
T126 16551-16680 Sentence denotes Effector cells were transfected (except for HIV Env which was stably expressed in a cell line) with the indicated viral proteins.
T127 16681-16734 Sentence denotes Each was bound and allowed to fuse with target cells.
T128 16735-16828 Sentence denotes The reduction in fusion caused by adding 10 µM GA is shown as low grey bars labeled 10 µM GA.
T129 16829-17019 Sentence denotes For every fusion protein, the presence of GA abolished fusion. n = 3 for each fusion protein. (C) Effect of two different concentrations of GA with different side chains on cell-cell fusion.
T130 17020-17144 Sentence denotes When GA was removed, fusion was restored (Fig. 6A, Bar 4), indicating that GA interferes with fusion in a reversible manner.
T131 17145-17397 Sentence denotes Viral fusion, regardless of fusion protein, proceeds through the creation of hemifusion, an intermediate state in which proximal lipid monolayer leaflets of membranes, in contact with one another, have merged, but the distal monolayers remain distinct.
T132 17398-17545 Sentence denotes Because inhibition of fusion was universal, independent of viral protein, it is extremely unlikely that GA targeted the fusion proteins themselves.
T133 17546-17672 Sentence denotes This is consistent with GA inhibiting the creation of the hemifusion intermediate, and universal inhibition would be expected.
T134 17673-17848 Sentence denotes It is well known that agents conferring positive spontaneous curvature, such as lysophosphatidylcholine (LPC), inhibit fusion induced by viral and non-viral fusion proteins17.
T135 17849-18056 Sentence denotes Likewise, the cone-shaped lipid oleic acid (OA) has a negative spontaneous membrane curvature, which favors hemifusion when present in the outer bilayer, and its presence relieves the inhibition of fusion18.
T136 18057-18197 Sentence denotes The addition of OA together with GA abolished the inhibitory effect of GA (Fig. 6B), indicating that GA induces positive membrane curvature.
T137 18198-18333 Sentence denotes Figure 6 OA together with GA abolished the inhibitory effect of GA. (A) Dissecting the stages of fusion affected by the presence of GA.
T138 18334-18369 Sentence denotes Bar 1, control: GA was not present.
T139 18370-18422 Sentence denotes Bar 2: GA was maintained throughout the experiments.
T140 18423-18429 Sentence denotes Bar 3:
T141 18430-18511 Sentence denotes Effector and target cells were incubated for 30 min. in the presence of 10 µM GA.
T142 18512-18645 Sentence denotes The neutral pH bathing solution was then replaced by a pH 5.7 solution, which did not contain GA, and this was maintained for 10 min.
T143 18646-18750 Sentence denotes The low pH bathing solution was replaced by one at neutral pH, also without GA, and fusion was measured.
T144 18751-18757 Sentence denotes Bar 4:
T145 18758-19030 Sentence denotes The same protocol was followed as for experiments of bar 3, but prior to acidification, the GA-containing neutral pH solution was replaced by a GA-free neutral pH solution that was maintained for 10 min to allow GA in the membranes to dissociate into the aqueous solution.
T146 19031-19092 Sentence denotes This almost restored the extent of fusion to that of control.
T147 19093-19099 Sentence denotes Bar 5:
T148 19100-19200 Sentence denotes The same protocol as for experiments of bar 3 was used, but GA was maintained through acidification.
T149 19201-19260 Sentence denotes The subsequent neutral pH wash solution did not contain GA.
T150 19261-19416 Sentence denotes EBOV GP was the fusion protein for these experiments. (n = 3). (B) The inhibition of cell-cell fusion by GA is reversed by the presence of oleic acid (OA).
T151 19417-19430 Sentence denotes Upper panels:
T152 19431-19554 Sentence denotes Massive dye mixing was observed for control (left image), but none was observed in the presence of 10 µM GA (middle image).
T153 19555-19663 Sentence denotes Addition of 250 µM OA along with GA (right image), resulted in the same degree of fusion as for the control.
T154 19664-19722 Sentence denotes Extent of fusion is quantified in the bar graphs. (n = 3).
T155 19724-19820 Sentence denotes GA inhibition of enveloped viruses correlates with inhibition of viral DNA and protein synthesis
T156 19821-19970 Sentence denotes To validate the PRA observations, we tested whether there is an effect on downstream viral DNA synthesis in HCMV infected cells when treated with GA.
T157 19971-20087 Sentence denotes HFF were inoculated with HCMV for 3 hours, then washed and incubated with different concentrations of GA or vehicle.
T158 20088-20223 Sentence denotes DNA was extracted from 4 pooled wells of HFF at 7 days post inoculation, and then analyzed by qPCR targeting the viral polymerase gene.
T159 20224-20325 Sentence denotes DNA copies were reduced in a dose dependent manner by the addition of GA to culture medium (Fig. 7A).
T160 20326-20479 Sentence denotes Although HCMV DNA copy numbers were reduced by GA, this could be secondary to inhibition of virus entry rather than direct inhibition of DNA replication.
T161 20480-20626 Sentence denotes Figure 7 GA inhibits HSV-1 replication by inhibition of viral protein synthesis and HCMV by DNA synthesis. (A) Effect of GA on HCMV DNA synthesis.
T162 20627-20754 Sentence denotes Viral replication is inhibited in the presence of increasing concentration of GA, as determined by decreasing viral DNA copies.
T163 20755-20868 Sentence denotes DNA was extracted from 4 pooled wells of HFF at 7 dpi, then analyzed by qPCR targeting the viral polymerase gene.
T164 20869-21039 Sentence denotes DNA copies were reduced in a dose dependent manner by the addition of GA to culture medium as determined by ANOVA analysis with pairwise post-hoc t-test analysis in SPSS.
T165 21040-21138 Sentence denotes Data are presented as mean percent of control. (*5 µM p = 0.014, 8 µM p = 0.003, 10 µM p = 0.002).
T166 21139-21330 Sentence denotes 6 well cultures of HEp-2 (B) or 293T (C) were infected with HSV-1 strain F at an MOI of 1 for 2 hours, then washed with 199V and supplemented with 10 µM GA (Lanes 1–4) or vehicle (Lanes 5–8).
T167 21331-21541 Sentence denotes Mock (M), 5, 11 and 24 hours after inoculation, cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, β-Actin and US11.
T168 21542-21604 Sentence denotes Normalized ratios of protein expression are in the bar graphs.
T169 21605-21689 Sentence denotes Viral protein synthesis was determined in HSV-infected cells following GA treatment.
T170 21690-21900 Sentence denotes Untreated HEp-2 and 293T cells were infected with HSV-1 F’ at an MOI of 1 for 2 hours, allowing the virions to internalize into the cells, then washed with 199V medium and supplemented with 10 µM GA or vehicle.
T171 21901-21981 Sentence denotes The viral replication was evaluated by Western Blot detection of HSV-1 proteins.
T172 21982-22188 Sentence denotes Although the infection of HEp-2 and 293T cells had been initiated, the addition of 10 µM GA to the infected HEp-2 and 293T cells inhibited the virus replication from the point of exposure to GA (Fig. 7B,C).
T173 22189-22267 Sentence denotes The observed effect could be the result of inhibition of secondary infections.
T174 22268-22471 Sentence denotes However, the early down regulation of HSV proteins, occurring prior to a complete viral replication cycle, suggests that there could be a secondary inhibitory mechanism targeting viral protein synthesis.
T175 22473-22483 Sentence denotes Discussion
T176 22484-22581 Sentence denotes The Ginkgolic acids C13:0, C15:1 and C17:1 are commercially available compounds of Ginkgo leaves.
T177 22582-22834 Sentence denotes The antioxidative activity of GA has been reported to have multiple therapeutic effects including the treatment of cardiovascular disease, HIV infection, bacterial infections such as Escherichia coli and Staphylococcus aureus, and some tumors7,8,19,20.
T178 22835-23195 Sentence denotes It has been suggested that GA may operate by several other pathways including: inhibition of fatty acid synthase10; non-specific SIRT inhibition11; activation of protein phosphatase type-2C12; suppression of STAT3 activation through induction of PTEN and SHP-1 Tyrosine Phosphatase21, and protection against Aβ-induced synaptic dysfunction in the hippocampus6.
T179 23196-23399 Sentence denotes In this study, we are the first to report the fusion inhibitory effect of GA on enveloped viruses representing the three classes of fusion proteins and the inhibition of a non-enveloped human adenovirus.
T180 23400-23499 Sentence denotes We also report a potential secondary mechanism of action involving viral DNA and protein synthesis.
T181 23500-23611 Sentence denotes Our results are consistent with previous reports of the inhibitory effect of GA on DNA and protein synthesis22.
T182 23612-23709 Sentence denotes The mechanism of action through which GA affects DNA and protein synthesis is not yet understood.
T183 23710-23907 Sentence denotes It may bind to the host cell receptors and activate different cell signaling pathways and/or cause cell cycle arrest, which may explain the inhibitory effect of GA on rapidly dividing cancer cells.
T184 23908-23983 Sentence denotes It may also enter the cells and work directly on DNA and protein synthesis.
T185 23984-24035 Sentence denotes Experiments to address these questions are ongoing.
T186 24036-24128 Sentence denotes To assess the effect of GA on infectious viruses, we performed GA dose-response experiments.
T187 24129-24216 Sentence denotes The cells were treated with different GA concentrations ranging between 1 µM and 20 µM.
T188 24217-24288 Sentence denotes We demonstrated a dose dependent effect of GA on HCMV, HSV-1, and ZIKV.
T189 24289-24454 Sentence denotes The effect of GA was tested in several cell types including HEp-2 (human epithelial carcinoma), 293T (human embryonic kidney), HFF and NHA (normal human astrocytes).
T190 24455-24585 Sentence denotes GA was shown to have a viral inhibitory effect in all of the tested cells with no cytotoxicity within the active inhibitory range.
T191 24586-24703 Sentence denotes Berg et al. evaluated the cytotoxicity and mutagenicity of GA in male Chinese hamster lung fibroblasts (V79 cells)23.
T192 24704-24857 Sentence denotes Their results showed toxicity on cells grown in DMEM supplemented with 10% FBS after 24 hours in GA concentrations above 50 µM, with no mutagenic effect.
T193 24858-25022 Sentence denotes Ahlemeyer et al. reported that 500 µM GA induced neuronal death and activated protein phosphatase type-2C in chick embryonic neurons growing in DMEM with 20% FBS12.
T194 25023-25176 Sentence denotes B.M Hausen, evaluated the sensitizing capacity of GA in guinea pigs, determining 1000 ppm (2.886 mM) GA as safe to avoid inducing an allergic reaction24.
T195 25177-25290 Sentence denotes Viral infections of permissive cells are regularly performed in 199 or MEM medium supplemented with 1% or 2% FBS.
T196 25291-25484 Sentence denotes However, when we tested the activity and toxicity of GA on the cells used in our research, we also incubated the cells with GA in the cells’ recommended growth medium (see results and Fig. S1).
T197 25485-25597 Sentence denotes The results indicated that the activity and toxicity of GA is affected by the serum concentration in the medium.
T198 25598-25759 Sentence denotes We concluded that GA interacts with serum factors, which lowers its antiviral activity, and researchers using GA should address this issue in future experiments.
T199 25760-25883 Sentence denotes In vivo experiments in an animal model are needed to assess the actual therapeutic antiviral effect and cytotoxicity of GA.
T200 25884-26022 Sentence denotes GA’s universal inhibition of viral protein-mediated cell-cell fusion indicates that its inhibitory effect is by a common fusion mechanism.
T201 26023-26151 Sentence denotes LPC also universally blocks membrane fusion; it does so by conferring spontaneous positive curvature, which prevents hemifusion.
T202 26152-26278 Sentence denotes This block can be relieved, regardless of fusion protein, by the addition of the negative spontaneous curvature agent OA25,26.
T203 26279-26472 Sentence denotes The finding that OA relieves the GA-induced inhibition of EBOV GP-mediated fusion implies that, similar to LPC, GA acts by producing positive spontaneous curvature and this prevents hemifusion.
T204 26473-26643 Sentence denotes A number of rigid amphipathic fusion inhibitors (RAFI) with positive spontaneous curvature have been shown to inhibit fusion induced by unrelated viral fusion proteins27.
T205 26644-26835 Sentence denotes In the future, it would be interesting to measure the values of the spontaneous curvatures of GA and RAFI and to relate them to the concentration of OA necessary to relieve fusion inhibition.
T206 26836-27038 Sentence denotes For the inhibition of non-enveloped adenovirus, we suggest that since GA affects lipid bilayer curvature, it would be predicted to affect the endocytic entry of a non-enveloped virus such as adenovirus.
T207 27039-27256 Sentence denotes In addition, as we report here, GA appears to have potential secondary mechanisms of viral DNA and protein synthesis inhibition, and these would be predicted to be targeted in both enveloped and non-enveloped viruses.
T208 27257-27452 Sentence denotes In conclusion, we have shown a consistent inhibitory effect of GA on the fusion of a variety of enveloped viruses, including important pathogens such as EBOV, HIV, ZIKA, HSV-1, HCMV, EBV and IAV.
T209 27453-27596 Sentence denotes We also have shown inhibition of a non-enveloped human adenovirus, which suggests a potential inhibitory effect on other non-enveloped viruses.
T210 27597-27718 Sentence denotes Furthermore, we found that GA might possibly inhibit HCMV viral DNA and HSV-1 protein synthesis by a secondary mechanism.
T211 27719-28076 Sentence denotes Thus, in light of the antiviral effect of GA on established viral infections of permissive cells, GA potentially could be used to treat acute viral infections (e.g. Coronavirus (COVID-19), EBOV, ZIKV, IAV and measles), and it might be determined to be useful in topical application for the successful treatment of active lesions (e.g. HSV-1, HSV-2 and VZV).
T212 28077-28254 Sentence denotes Finally, our approach for GA usage to inhibit enveloped virus infection is fundamentally different from traditional microbicidal strategies that target virus genome replication.
T213 28255-28399 Sentence denotes We anticipate that it could complement other direct antiviral agents and offer a new class of inhibitors of enveloped and non-enveloped viruses.
T214 28401-28408 Sentence denotes Methods
T215 28410-28431 Sentence denotes Cells, viruses and GA
T216 28432-28617 Sentence denotes HEp2 cells, obtained from the American Type Culture Collection (ATCC Rockville, MD), were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (FBS).
T217 28618-28710 Sentence denotes HEK293T/17 (293T) cells obtained from the ATCC were grown in DMEM supplemented with 10% FBS.
T218 28711-28804 Sentence denotes HSV-1 strain F, a limited-passage isolate, is the prototype strain used in this laboratory28.
T219 28805-28872 Sentence denotes GFP-HSV-1 (strain 17), was a generous gift from Dr. Peter O’Hare29.
T220 28873-29062 Sentence denotes Vero cells obtained from the ATCC were cultured in complete DMEM (cDMEM) containing 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, and 10 mM Hepes buffer at 37 °C with 5% CO2.
T221 29063-29327 Sentence denotes Fetal-derived Normal Human Astrocytes (NHA, Lonza) were maintained in Astrocyte Growth Medium (AGM, Lonza) supplemented with 0.3% FBS, 30 µl/mL ascorbic acid, 1 µl/mL rhEGF, 30 µg/mL gentamicin, 15 μg/mL amphotericin B, 2.5 µl/mL insulin, and 10 µl/mL L-glutamine.
T222 29328-29380 Sentence denotes Early passages (1–4) were used in these experiments.
T223 29381-29479 Sentence denotes HCMV studies were performed using cell-associated low-passage clinical isolates CH1914 and BI-615.
T224 29480-29589 Sentence denotes CH19 is resistant to the first-line HCMV antiviral drug, ganciclovir (GCV), while BI-6 is susceptible to GCV.
T225 29590-29724 Sentence denotes Additional experiments were performed using CMVPT30-GFP16, which expresses green fluorescent protein and produces extracellular virus.
T226 29725-29947 Sentence denotes ZIKV strain PRVABC59 obtained from the American Type Culture Collection (ATCC; Manassas, VA) was propagated in Vero cells grown in T-150 flasks by infection at 1:50 dilution of viral stock (MOI 0.25) in the absence of FBS.
T227 29948-30026 Sentence denotes The medium was removed and replaced 6 h post-infection (hpi) with fresh cDMEM.
T228 30027-30188 Sentence denotes Supernatant was collected at 72 hpi, clarified by centrifugation at 350 × g for 5 min, and filtered through a 0.45-μm surfactant-free cellulose acetate membrane.
T229 30189-30323 Sentence denotes For mock infections, supernatant was collected from uninfected Vero cells and prepared by the same protocol used to make virus stocks.
T230 30324-30357 Sentence denotes Virus was titered by focus assay.
T231 30358-30732 Sentence denotes Briefly, infected Vero cells, 24 hpi were fixed and permeabilized using Cytofix/Cytoperm Solution Kit (BD Biosciences) according to the manufacturer’s instructions and stained with a mouse monoclonal antibody (mAb) specific for flavivirus group envelope proteins (1:250; EMD Millipore; clone D1–4G2-4-15) followed by incubation with an anti-mouse IgG - PE (1:1000 dilution).
T232 30733-30893 Sentence denotes Samples were run through an LSR II flow cytometer and data were collected with FACSDiva software (BD Biosciences) and analyzed using FlowJo Software (TreeStar).
T233 30894-30931 Sentence denotes Human Adenovirus Type5 (dE1/E3), Cat.
T234 30932-30936 Sentence denotes No.:
T235 30937-30977 Sentence denotes 1060, was purchased from Vector Biolabs.
T236 30978-31055 Sentence denotes GA C13:0, C15:1, and C17:1, were purchased from Sigma Aldrich, St. Louis, MO.
T237 31056-31119 Sentence denotes GA was diluted in methanol or DMSO to a concentration of 50 mM.
T238 31120-31249 Sentence denotes Effects of GA in all assays and models used in this study have been compared to vehicle-treated (i.e. methanol or DMSO) controls.
T239 31250-31324 Sentence denotes Cells or viral stocks were treated with the indicated concentration of GA.
T240 31326-31347 Sentence denotes Western blot analyses
T241 31348-31560 Sentence denotes For HSV-1, cells were harvested at the indicated times, collected by low-speed centrifugation and rinsed in PBS, then resuspended in RIPA lysis buffer and protease inhibitors (Complete Protease Inhibitor; Roche).
T242 31561-31637 Sentence denotes Approximately 60 μg of protein per sample was subjected to further analysis.
T243 31638-31848 Sentence denotes Proteins were electrophoretically separated on 8 to 10% denaturing polyacrylamide gels, electrically transferred to nitrocellulose sheets, blocked by 5% BSA in Tween PBS and reacted with the primary antibodies.
T244 31849-32006 Sentence denotes The mouse monoclonal antibody to US11 (Goodwin Institute for Cancer Research), and the mouse monoclonal antibody to ICP8, were used at a dilution of 1:1,000.
T245 32007-32078 Sentence denotes The mouse monoclonal antibody to ICP27 was used at a dilution of 1:250.
T246 32079-32159 Sentence denotes The mouse monoclonal antibody to β-actin (Sigma) was used at a 1:5,000 dilution.
T247 32160-32299 Sentence denotes Membranes were then reacted with the appropriate secondary antibody conjugated either to alkaline phosphatase or to horseradish peroxidase.
T248 32300-32532 Sentence denotes Protein bands were visualized with 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium (Denville Scientific, Inc.) or with ECL Western Blot detection reagents (Amersham Biosciences) according to the manufacturer’s instruction.
T249 32534-32552 Sentence denotes Cytotoxicity tests
T250 32553-32645 Sentence denotes Cells grown in 96 or 48 well plates were exposed to different concentrations of GA for 24 h.
T251 32646-32749 Sentence denotes Cell viability was determined by Alamarblue® assay (Thermo Fisher Scientific, Catalog number: DAL1025).
T252 32750-32851 Sentence denotes Pair-wise Student t-tests were used to compare the outcome of a treatment as compared to the control.
T253 32852-32879 Sentence denotes Error bars are SEM (n ≥ 3).
T254 32881-32904 Sentence denotes Viral stock preparation
T255 32905-33236 Sentence denotes Confluent Vero cells in 75-cm2 flasks were infected with HSV in 3 ml of 199V (Gibco; 199 medium supplemented with 1% heat-inactivated FBS and 1% penicillin/streptomycin) medium at a multiplicity of infection (MOI) of 0.01 pfu/cell and incubated by gentle shaking for 2 hours at 37 °C with 5% CO2 to allow cells to absorb the virus.
T256 33237-33338 Sentence denotes After 2 hours, 199 V was aspirated from the cell culture and Vero cells were gently washed with DPBS.
T257 33339-33483 Sentence denotes 3 ml of fresh DMEM/5% FBS medium was added and the cells were incubated for 2 to 3 days until 100% of the cells display cytopathic effect (CPE).
T258 33484-33639 Sentence denotes When 100% CPE was observed, the flask was placed at −80 °C for 15 min, then allowed to warm up at room temperature and 3 ml of cold sterile milk was added.
T259 33640-33699 Sentence denotes The cells were collected into a 15 ml tube and kept on ice.
T260 33700-33975 Sentence denotes To free virus particles from the cellular debris, Vero cells were sonicated three times (letting the cell suspension cool on ice for 1 min between sonications), for 30 seconds using a Branson Sonifier with microtip at an output setting of 4 (approximate Power Output of 15%).
T261 33976-34082 Sentence denotes The virus stock was aliquoted and transferred to sterile, screw-capped cryovials and was stored at −80 °C.
T262 34083-34130 Sentence denotes The viral titer was determined by plaque assay.
T263 34132-34150 Sentence denotes HSV-1 plaque assay
T264 34151-34371 Sentence denotes GA (10 µM) was incubated on the monolayers of Vero cells (6-well plate) with 199V (Gibco; supplemented with 1% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin) at 37 °C for 1 hour prior to inoculation.
T265 34372-34468 Sentence denotes Following incubation, the supernatants were aspirated and cells were washed two times with DPBS.
T266 34469-34567 Sentence denotes GFP-HSV-1 strain 17+29, at an MOI of 1 was incubated on the cells with 199V at 37 °C for 24 hours.
T267 34568-34610 Sentence denotes The supernatant was collected and titered.
T268 34611-34805 Sentence denotes Various 10-fold dilutions of collected supernatants were incubated on monolayers of fresh Vero cells (6-well plate) at 37 °C on a shaker for 2 h to allow the virus to attach and enter the cells.
T269 34806-35064 Sentence denotes The supernatants were aspirated and cells were incubated with 20 mg/mL of human serum (Sigma-H4522) in DMEM (Dulbecco’s Modified Eagle’s medium, supplemented with 5% FBS and 1% penicillin/streptomycin) for 3 days at 37 °C in 5% CO2 to allow plaque formation.
T270 35065-35251 Sentence denotes For plaque counting, the cells were fixed with 100% methanol for 5 min. at room temperature and stained with 10% KaryoMax Giemsa stain in distilled water for 20 min. at room temperature.
T271 35252-35350 Sentence denotes Viral titer was calculated through plaque counting and expressed as plaque-forming units (PFU)/ml.
T272 35352-35364 Sentence denotes ZIKV studies
T273 35365-35460 Sentence denotes Cell free ZIKV in 199V medium was pretreated with 10 µM/ml GA or with DMSO for 1 hour at 37 °C.
T274 35461-35574 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T275 35575-35679 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T276 35680-35795 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell-free viral RNA copy number determination.
T277 35796-35935 Sentence denotes NHA were grown in 24 well plates to >80% confluency, treated with GA C15:1 (0–20 µM) for 3 h, and then infected with ZIKV at an MOI of 0.3.
T278 35936-36054 Sentence denotes Supernatant was carefully removed and replaced at 12 hpi with fresh AGM replenished with GA at 0–20 µM concentrations.
T279 36055-36291 Sentence denotes Cell viability was assessed at 7 days post-inoculation by Celltiter Aqueous One solution cell proliferation assay (Promega, Madison, WI), and live cells were carefully harvested to extract RNA by the RNeasy kit (Qiagen, Germantown, MD).
T280 36292-36603 Sentence denotes RNA was quantified using a Nanodrop2000 (ThermoFisher), treated with DNaseI (Sigma-Aldrich) for 15 min at room temperature to remove DNA contamination, and subsequently, DNaseI was inactivated by heating at 70 °C for 15 min. cDNA was synthesized from 0.2–1 μg of RNA using Qscript supermix (Quanta Biosciences).
T281 36604-36791 Sentence denotes Quantitative real-time PCR (qRT-PCR) reactions were performed in a 20 μl solution containing 10 μl TaqMan Gene Expression Master Mix (Life Technologies), 500 nM primers, and 300 nM probe.
T282 36792-36924 Sentence denotes Reactions were performed in an Applied Biosystems 7900HT sequence detection system (Thermo Fisher Scientific) using SDS2.3 software.
T283 36925-37050 Sentence denotes The reaction conditions were, 50 °C for 2 min, 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
T284 37051-37152 Sentence denotes Samples were run in duplicate or triplicates, and template controls were included wherever necessary.
T285 37153-37290 Sentence denotes Fold change in RNA expression was calculated by relative quantification using the comparative CT method with GAPDH as endogenous control.
T286 37291-37384 Sentence denotes The primers and probe were designed using the PrimerQuest tool (Integrated DNA Technologies).
T287 37385-37430 Sentence denotes The sequences of the primers were as follows:
T288 37431-37709 Sentence denotes ZIKV-F-CGCTGCCCAACACAAGGT; ZIKV-R-, GCTCCCTTTGCCAAAAAGTCCACA, and ZIKV-probe, 5′/56-FAM/ACCTTGACA/ZEN/AGCAGTCAGACACTCAA/3IABkFQ; and human specific GAPDH-F-GGTGTGAACCATGAGAAGTATGA; GAPDH-R-GAGTCCTTCCACGATACCAAAG; and GAPDH-probe, 5′/56-FAM/AGATCATCA/ZEN/GCAATGCCTCCTGCA/3IABkFQ.
T289 37711-37723 Sentence denotes HCMV studies
T290 37724-37895 Sentence denotes HFF were grown in 24 well plates to 100% confluency in MEM with 10% FBS to establish viral inhibition of two low-passage clinical strains (BI-6 and CH19) via plaque assay.
T291 37896-38055 Sentence denotes Cells infected with low-passage HCMV clinical strains (CH19 and BI6) do not release extracellular virus, but they display typical HCMV cytopathic effect (CPE).
T292 38056-38130 Sentence denotes The percentage of infected cells was estimated visually in HFF monolayers.
T293 38131-38220 Sentence denotes Dilutions of trypsinized cells were used as inocula for HFF monolayers in 24 well plates.
T294 38221-38348 Sentence denotes After 7 days in culture, plaques were counted to determine the average number of plaques in 4-well replicates of each dilution.
T295 38349-38438 Sentence denotes The optimal dilution for each virus strain produced an average of 60–80 plaques per well.
T296 38439-38515 Sentence denotes CMVPT30-GFP having undergone multiple passages produces extracellular virus.
T297 38516-38599 Sentence denotes Viral infection was quantitatively determined by PRA of culture supernatant medium.
T298 38600-38794 Sentence denotes Cells were either exposed to GA for three hours prior to inoculation, or were inoculated prior to addition of medium containing GA at concentrations of 1, 2, 5, 10, and 20 µM in MEM with 1% FBS.
T299 38795-38860 Sentence denotes One set of four wells was treated with DMSO as a vehicle control.
T300 38861-38950 Sentence denotes For each experiment the remaining concentrations were represented in quadruplicate wells.
T301 38951-39140 Sentence denotes Plates were read beginning at 7 days post inoculation (dpi) to determine the GA concentration producing a reduction of 50% in the number of plaques relative to vehicle control wells (IC50).
T302 39141-39283 Sentence denotes Data were normalized to the vehicle controls, and probit analysis in SPSS was used to obtain 95% confidence intervals of the mean IC50 values.
T303 39285-39321 Sentence denotes HCMV DNA extraction and quantitation
T304 39322-39405 Sentence denotes HCMV infected monolayers were trypsinized and pooled at the termination of the PRA.
T305 39406-39499 Sentence denotes DNA was extracted from the pooled monolayers using the Blood gDNA kit (Promega, Madison, WI).
T306 39500-39594 Sentence denotes HCMV DNA was quantitated using a validated in-house assay, which targets the DNA polymerase30.
T307 39595-39677 Sentence denotes Reactions were performed on an Applied Biosystems 7500 (Thermo Fisher Scientific).
T308 39679-39714 Sentence denotes Infection of GFP-expressing viruses
T309 39715-39820 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T310 39821-40026 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T311 40027-40078 Sentence denotes Infection was evaluated by fluorescence microscopy.
T312 40080-40104 Sentence denotes Cell-cell fusion vectors
T313 40105-40208 Sentence denotes In these experiments, we used cell-cell fusion systems of ZIKV, HIV, EBOV, IVA, VEEV, VSV, SFV and EBV.
T314 40209-40293 Sentence denotes The plasmids, fusion proteins, and the related references are described in Table S2.
T315 40295-40313 Sentence denotes Fusion experiments
T316 40314-40387 Sentence denotes Nucleated cell-cell fusion, experiments were performed as described31,32.
T317 40388-40532 Sentence denotes Calcein-AM was loaded into effector cells expressing the fusion protein, and 7-amino-4-chloromethylcoumarin (CMAC) was loaded into target cells.
T318 40533-40569 Sentence denotes Mixing of dyes was scored as fusion.
T319 40570-40717 Sentence denotes Fusion experiments for each viral protein were performed as previously described: EBOV GP32; HIV33; SFV E1/E2 and IAV HA34; VEEV E, VSV, and EBV35.
T320 40718-40822 Sentence denotes Unless stated otherwise, EBOV GP was used as the fusion protein and C15:1 GA was used to inhibit fusion.
T321 40823-40907 Sentence denotes As shown in Fig. 2B, C15:1 GA inhibited fusion for the eight tested fusion proteins.
T322 40908-40983 Sentence denotes Figure 2C documents that fusion was blockaded by GA C13:0, C15:1, or C17:1.
T323 40985-41005 Sentence denotes Statistical analysis
T324 41006-41086 Sentence denotes For HCMV plaque assays, data were analyzed using one-way ANOVA analysis in SPSS.
T325 41087-41164 Sentence denotes For BI6 n = 25; degrees of freedom between groups = 4 and within groups = 20.
T326 41165-41187 Sentence denotes The F value is 68.827.
T327 41188-41266 Sentence denotes For CH19 n = 24; degrees of freedom between groups = 4 and within groups = 19.
T328 41267-41289 Sentence denotes The F value is 41.090.
T329 41290-41428 Sentence denotes For fusion experiments, Pair-wise Student t-tests were used to compare the outcome of a manipulation on fusion as compared to the control.
T330 41429-41456 Sentence denotes Error bars are SEM (n ≥ 3).
T331 41457-41511 Sentence denotes HCMV DNA copy numbers expressed as percent of control.
T332 41512-41545 Sentence denotes Significance was set at P < 0.05.
T333 41546-41595 Sentence denotes P values were obtained using a two-tailed t-test.
T334 41596-41641 Sentence denotes All measurements were performed in duplicate.
T335 41642-41684 Sentence denotes Standard curves were included on each run.
T336 41685-41802 Sentence denotes For ZIKV, the data were analyzed using unpaired, two tailed student’s t test and represented as mean± standard error.
T337 41803-41933 Sentence denotes Experiments were done independently at least three times and a value of p ≤ 0.05 indicated a statistically significant difference.
T338 41935-41960 Sentence denotes Supplementary information
T339 41962-41988 Sentence denotes Supplementary Information.