LitCovid-sentences  

PMC:7019868 / 1647-31530 JSONTXT 12 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T11 0-2 Sentence denotes 1.
T12 3-15 Sentence denotes Introduction
T13 16-157 Sentence denotes Porcine epidemic diarrhea virus (PEDV) is an enveloped, positive-sense and single stranded RNA virus belonging to the genus Alphacoronavirus.
T14 158-367 Sentence denotes PEDV is the causative agent of porcine epidemic diarrhea (PED), a historic, highly contagious enteric swine disease characterized by diarrhea, dehydration and poor growth performance in pigs at all ages [1,2].
T15 368-564 Sentence denotes PED was first identified in 1971 in the United Kingdom, and subsequently became an endemic disease in the Europe and most Asian countries with a low mortality rate and limited economic losses [1].
T16 565-705 Sentence denotes For decades, the disease was controlled through the use of live attenuated vaccines (LAVs) derived from the PEDV prototypes, CV777- or DR13.
T17 706-839 Sentence denotes Unfortunately, in late 2010, a new highly virulent PEDV strain emerged in China and quickly spread worldwide, including Taiwan [3,4].
T18 840-1100 Sentence denotes Moreover, the conventional LAV failed to induce protection against this new virulent PEDV strain, consequently resulting in nearly 100% mortality amongst neonatal piglets and leading to substantial economic impacts on swine markets in the affected regions [5].
T19 1101-1164 Sentence denotes Phylogenetic analysis categorizes PEDV into two genogroups [2].
T20 1165-1362 Sentence denotes Genogroup I consists primarily of the historic, low-virulent PEDV strains that appeared around 1970, whereas genogroup II is composed of the highly virulent PEDV strains, which emerged after 2010s.
T21 1363-1570 Sentence denotes Both genogroups can be further divided into two subgroups each, namely G1a, G1b, G2a and G2b though a recent phylogenetic study identified a novel recombinant PEDV strain classified into a new G1c clade [6].
T22 1571-1682 Sentence denotes The complete genome of PEDV is approximately 28 kilobase pairs and consists of seven open reading frames (ORF).
T23 1683-1955 Sentence denotes Out of the seven, four ORFs are responsible for encoding structural proteins, namely the spike (S) glycoprotein as well as envelop (E), membrane (M), and nucleocapsid (N) proteins, which are crucial for viral morphogenesis and establishment of infection establishment [7].
T24 1956-2133 Sentence denotes Among all coronaviruses, S glycoprotein plays a particularly essential role in cell-virus interaction and acts as the vital determinants of viral virulence/attenuation [8,9,10].
T25 2134-2275 Sentence denotes S glycoprotein is a homotrimeric type I fusion protein, which can be cleaved into two parts—the S1 and S2 subunits—by cellular protease [11].
T26 2276-2482 Sentence denotes The S1 subunit contains the receptor binding domain (RBD) and several neutralizing epitopes that are essential for determining host and tissue tropism, and triggering protective host immunity, respectively.
T27 2483-2583 Sentence denotes Therefore, the S1 subunit has long been considered to be the primary target for vaccine development.
T28 2584-2725 Sentence denotes The S2 domain, on the other hand, mediates membrane fusion which facilitates release of viral RNA and infection to the neighboring cells [8].
T29 2726-2834 Sentence denotes LAVs have been shown to be the most effective way to elicit protective immunity against PEDV infection [12].
T30 2835-3011 Sentence denotes Therefore, to combat the emergence of PED as well as to immediately suppress any future outbreaks, studies have been carried out to develop safe and effective vaccines [13,14].
T31 3012-3267 Sentence denotes Aside from serial cell culture or animal passages, the reverse genetic system, which rescues genetically modified attenuated viruses, is now the common approach in generating LAV candidates for both human and animal viral diseases, including PEDV [15,16].
T32 3268-3441 Sentence denotes To this end, understanding the molecular biology and identification of virulent/attenuating determinant(s) are necessary for the rational design of potential LAV candidates.
T33 3442-3665 Sentence denotes Comparison of the genomic differences between the Vero cell-cultured attenuated G2b PEDV and their corresponding parental virulent strains has revealed a common pattern of mutation that particularly affects the S gene [12].
T34 3666-3971 Sentence denotes While the observation is reasonable considering the fundamental role of S protein in PEDV infection and induction of host immunity, a recent publication found that a singular S gene exchange had no influence on the virulence of the highly virulent G2b BJ2011C strain and avirulent G1a CHM2013 strain [17].
T35 3972-4208 Sentence denotes In the present study, we utilized reverse genetics to examine the role of the S gene in the attenuation process of PEDV using the highly virulent and attenuated G2b PEDV Pintung (PEDVPT) 52 strains, the PEDVPT-P5 and PEDVPT-P96 viruses.
T36 4209-4284 Sentence denotes Nonetheless, our findings were discordant with previous reported data [17].
T37 4285-4395 Sentence denotes We found that replacement of the S gene with the iPEDVPT-P5 virus enabled iPEDVPT-P96 to regain its virulence.
T38 4396-4520 Sentence denotes A reciprocal approach revealed that iPEDVPT-P5 virus became partly attenuated after the S gene was exchanged to iPEDVPT-P96.
T39 4521-4641 Sentence denotes Collectively, we concluded that the S gene is of critical importance to the attenuation process of the PEDVPT 52 strain.
T40 4642-4732 Sentence denotes However, mutation in the S gene alone could not completely attenuate the iPEDVPT-P5 virus.
T41 4733-4817 Sentence denotes Thus, gene(s) other than S gene could also play a role in determining the virulence.
T42 4819-4821 Sentence denotes 2.
T43 4822-4843 Sentence denotes Materials and Methods
T44 4845-4849 Sentence denotes 2.1.
T45 4850-4866 Sentence denotes Ethics Statement
T46 4867-5126 Sentence denotes All procedures involving animal experiment were reviewed, approved and conducted in strict accordance with the Institutional Animal Care and Use Committee (IACUC) of National Taiwan University (Taiwan, Republic of China) with the approval No.: NTU105EL-00160.
T47 5128-5132 Sentence denotes 2.2.
T48 5133-5150 Sentence denotes Cells and Viruses
T49 5151-5177 Sentence denotes Vero C1008 cells (ATCC No.
T50 5178-5427 Sentence denotes CRL-1586) were maintained in growth medium containing Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Grand Island, NY, USA) supplemented with 10% fetal bovine protein (FBS), 250 ng/mL Amphotericin B, 100 U/mL Penicillin and 100 μg/mL Streptomycin.
T51 5428-5741 Sentence denotes The recombinant viruses (iPEDVPT-P5 and iPEDVPT-P96), and the chimeric viruses (iPEDVPT-P5-96S and iPEDVPT-P96-5S), were propagated in post-inoculation medium (PI medium) containing DMEM supplemented with 0.3% tryptose phosphate broth (TBP), 0.02% yeast extract, and 10 μg/mL trypsin as described previously [18].
T52 5743-5747 Sentence denotes 2.3.
T53 5748-5853 Sentence denotes Generation and Recovery of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses
T54 5854-5930 Sentence denotes The strategy used to recover iPEDVPT-P96 has been described previously [19].
T55 5931-6040 Sentence denotes The approach to constructing a cDNA clone of iPEDVPT-P5 was technically identical to that of the iPEDVPT-P96.
T56 6041-6308 Sentence denotes However, we split the plasmid B into two fragments because the sequence remained toxic to the One Shot™ TOP10 Chemically Competent E. coli cells (Invitrogen, Carlsbad, USA) despite propagation in LB broth supplemented with 10% SOC medium and being incubated at 30 °C.
T57 6309-6507 Sentence denotes To generate chimeric viruses carrying heterologous spike (S) genes, namely the iPEDVPT-P5-96S and iPEDVPT-P96-5S, cDNA clones of iPEDVPT-P5 and iPEDVPT-P96, respectively, were used as the backbones.
T58 6508-6634 Sentence denotes The sequences covering the complete S gene of each virus were exchanged without disruption to the remaining genomic structure.
T59 6635-6735 Sentence denotes Sequence differences in the S genes of iPEDVPT-P5 and iPEDVPT-P96 viruses are summarized in Table 1.
T60 6736-6928 Sentence denotes Each plasmid was digested with corresponding type-IIS restriction enzymes as designated in Figure S1, gel-purified, assembled and phenol-chloroform extracted to generate the full-length cDNAs.
T61 6929-7247 Sentence denotes The cDNAs were then in vitro transcribed to the full-length RNA transcripts using a mMessage mMachine T7 transcription kit (Ambion, Austin, CA, USA) and immediately electroporated into 800 μL of 107 cells/mL Vero cells in RNase-free phosphate buffered saline (PBS) along with 5 μg of PEDV nucleocapsid (N) transcripts.
T62 7248-7440 Sentence denotes After electroporation, the cells were allowed to recover in growth medium for approximately 16 h and then maintained in PI-medium until cytopathic effects involved over 90% of cell monolayers.
T63 7441-7575 Sentence denotes The whole flasks were subjected to one freeze-and-thaw cycle and the rescued viruses were passaged once to generate viral stocks (P1).
T64 7576-7680 Sentence denotes The viral stocks were titrated on Vero cells in 96-well plates to determine the viral titer (see below).
T65 7682-7686 Sentence denotes 2.4.
T66 7687-7794 Sentence denotes In Vitro Characterization of Recombinant iPEDVPT-P5, iPEDVPT-P96, iPEDVPT-P5-96S and iPEDVPT-P96-5S Viruses
T67 7796-7802 Sentence denotes 2.4.1.
T68 7803-7849 Sentence denotes Immunofluorescence Assay and Syncytia Analysis
T69 7850-7967 Sentence denotes Immunofluorescence assay (IFA) was performed to detect PEDV antigens as previously described with modifications [18].
T70 7968-8120 Sentence denotes Briefly, Vero cells in 96-well plates (1.75 × 104 cells/well) were infected with the designated P1viruses at a multiplicity of infection (MOI) of 0.005.
T71 8121-8329 Sentence denotes At 18 h post-infection, cells were fixed with 80% ice-cold acetone, air-dried, and then incubated with an in-house anti-PEDV S antibody, P4B [20], at a dilution of 1:1000 at room temperature (RT) for 1 h (h).
T72 8330-8542 Sentence denotes After being washed three times with phosphate-buffered saline (PBS), the FITC-conjugated monoclonal goat anti-mouse-IG antibody (BD Pharmingen, San Jose, CA, USA) was applied at a dilution of 1:500 at RT for 1 h.
T73 8543-8716 Sentence denotes Following the final wash step, the cells were counterstained with mounting medium with 4′,6-diamidino-2-phenylindole (DAPI; Abcam, Cambridge, MA, USA) in the dark for 1 min.
T74 8717-8816 Sentence denotes Images were visualized and captured using ZOE fluorescent cell imager (Bio-Rad, Hercules, CA, USA).
T75 8817-8928 Sentence denotes Syncytia analysis were performed concurrently along with IFA by calculating the number of nuclei per syncytium.
T76 8930-8936 Sentence denotes 2.4.2.
T77 8937-8954 Sentence denotes Sequence Analysis
T78 8955-9600 Sentence denotes Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding.
T79 9602-9608 Sentence denotes 2.4.3.
T80 9609-9658 Sentence denotes Growth Kinetics, Viral Titration and Plaque Assay
T81 9659-9833 Sentence denotes Confluent monolayers of Vero cells were seeded onto six-well plates (5 × 105 cells/well) and infected with each virus at a MOI of 1 and 0.001 at 37 °C for 1 h in triplicates.
T82 9834-9944 Sentence denotes The cells were then washed twice with Dulbecco’s phosphate-buffered saline (DPBS) and maintained in PI medium.
T83 9945-10142 Sentence denotes The supernatants at indicated time points were collected and proceeded for viral quantification on Vero cells in 96-well plates using the standard 50% tissue-culture infectious dose (TCID50) assay.
T84 10143-10346 Sentence denotes In brief, Vero cells in 96-well plates were washed twice with DPBS and then incubated with a 10-fold serially diluted culture supernatant acquired from the aforementioned six-well plate at 37 °C for 1 h.
T85 10347-10448 Sentence denotes After absorption, the inoculum was removed and replaced with fresh PI-medium following one wash step.
T86 10449-10533 Sentence denotes The titers were determined at 72 h post-infection using the Reed–Muench method [21].
T87 10534-10628 Sentence denotes Plaque assays were performed as previously described [19] to characterize plaque morphologies.
T88 10629-10846 Sentence denotes Briefly, after absorption of PEDVs at an MOI of 0.0001, confluent monolayers of Vero cells in six-well plates were washed twice with DPBS and then covered with an overlay of pre-warmed PI medium containing 1% agarose.
T89 10847-10957 Sentence denotes After solidification of the overlays, the plates were incubated at 37 °C for 72 h to produce distinct plaques.
T90 10958-11066 Sentence denotes The cells were then fixed in 3.16% neutral-buffered formalin for 1 h before removing the semisolid overlays.
T91 11067-11159 Sentence denotes The plates were stained with 1% crystal violet in 20% ethanol and distilled water for 1 min.
T92 11160-11307 Sentence denotes Viral plaques were inspected after washing off the crystal violet solution, rinsing the plates with water, and air-drying at room temperature (RT).
T93 11309-11313 Sentence denotes 2.5.
T94 11314-11331 Sentence denotes Animal Experiment
T95 11332-11648 Sentence denotes Thirty-seven, six-day-old, Large White × Duroc, crossbred, fecal PEDV and TGEV shedding-negative suckling piglets were purchased from a conventional pig farm devoid of G2b PEDV infection history based on the negative result of our long-term surveillance of serum antibody and colostrum against PEDV in this pig farm.
T96 11649-11911 Sentence denotes These piglets from different sows were fed with artificial milk and were randomly assigned to five groups, acclimated for one day, and then inoculated orally with indicative recombinant viruses at a dose of 2 mL of 0.5 × 102 TCID50/mL or PI-medium, respectively.
T97 11912-11963 Sentence denotes Clinical signs and weight gain were recorded daily.
T98 11964-12025 Sentence denotes Fecal consistency was monitored daily and scored visually as:
T99 12026-12104 Sentence denotes 0 = normal, 1 = loose, 2 = semi-fluid, and 3 = watery as previously described.
T100 12105-12209 Sentence denotes Calculation of average daily weight gain was only performed on piglets that were not humanly euthanized.
T101 12210-12257 Sentence denotes The formula used for calculation is as follows:
T102 12258-12290 Sentence denotes Weight gained/ surviving period.
T103 12292-12298 Sentence denotes 2.5.1.
T104 12299-12342 Sentence denotes Quantification of PEDV Fecal Viral Shedding
T105 12343-12424 Sentence denotes Methods to quantify fecal PEDV viral shedding has been described previously [19].
T106 12425-12685 Sentence denotes Briefly, fecal samples collected from rectal swabs were resuspended in DPBS and then subjected to automated nucleic acid extraction using Cador Pathogen 96 QIAcube HT Kit with QIAcube (Qiagen Inc., Hilden, Germany) according to the manufacturer’s instructions.
T107 12686-12977 Sentence denotes Complementary DNA was synthesized via reverse transcription using QuantiNova™ Reverse Transcription kit (Qiagen Inc., Hilden, Germany) and proceeded to quantitative real-time PCR analysis using the primer-probe set published previously on a CFX96 Thermal Cycler (Bio-Rad, Hercules, CA, USA).
T108 12978-13115 Sentence denotes The thermal profile comprised an initial denaturation at 95 °C for 2 min and then 45 cycles of 95 °C for 15 s followed by 60 °C for 15 s.
T109 13116-13355 Sentence denotes The detection limit of the assay was determined by generating standard curves from serial 10-fold dilutions of known amounts of in vitro transcribed RNA followed by reverse transcription and real-time PCR quantification as described above.
T110 13356-13422 Sentence denotes The detection limit was calculated as 4.8 log10 RNA copies per mL.
T111 13424-13430 Sentence denotes 2.5.2.
T112 13431-13470 Sentence denotes Histopathology and Immunohistochemistry
T113 13471-13729 Sentence denotes At three days post-inoculation, three pigs from each virus-treated group and one pig from mock group were humanely euthanized by electrocution followed by exsanguination for histopathological and immunohistochemical assessments, as described previously [22].
T114 13730-14047 Sentence denotes Duodenum, jejunum, ileum, cecum, colon, rectum and mesenteric lymph nodes were collected, formalin-fixed, paraffin-embedded, sectioned at 4 μm, and stained routinely with hematoxylin and eosin (H&E) for morphometric analysis by assessing the ratio of villi height to crypt depth blindly by one veterinary pathologist.
T115 14048-14128 Sentence denotes Immunohistochemistry was performed to evaluate the distribution of PEDV antigen.
T116 14129-14376 Sentence denotes Briefly, formalin-fixed paraffin-embedded tissues were sectioned at 4 μm, deparaffined in xylene, rehydrated in serially diluted ethanol, and proceeded to epitope retrieval with the Trilogy antigen retrieval system (Cell Marque, Rocklin, CA, USA).
T117 14377-14685 Sentence denotes After being washed three times with Tris-buffered saline plus 0.1% Tween 20 (TBST), tissue slides were treated with 3% hydrogen peroxidase (KYB, New Taipei City, Taiwan) and 10% normal goat serum (Dako, Carpinteria, CA, USA) to block the endogenous peroxidase activity and non-specific signals, respectively.
T118 14686-14877 Sentence denotes For antigen detection, an in-house anti-PEDV N antibody, DE-1, at a dilution of 1:1000 in 10% normal goat serum was applied to the slides for 1 h at RT followed by three times wash with TBST.
T119 14878-15176 Sentence denotes The first antibodies were then captured using the polyclonal anti-rabbit/mouse immunoglobulin, EnVision-DAB+ system (Agilent Technologies, Santa Clara, CA, USA) at RT for 1 h and color was developed afterward with 3, 3′-diaminobenzidine (DAB) chromogen (Agilent Technologies, Santa Clara, CA, USA).
T120 15177-15313 Sentence denotes The slides were counterstained with hematoxylin (MUTO, Tokyo, Japan), mounted in Entellan (Merck, Darmstadt, Germany) and cover slipped.
T121 15314-15404 Sentence denotes Positive signals were visualized under an inverted light microscope (Nikon, Tokyo, Japan).
T122 15406-15410 Sentence denotes 2.6.
T123 15411-15431 Sentence denotes Statistical Analysis
T124 15432-15496 Sentence denotes All values were expressed as the mean standard ± deviation (SD).
T125 15497-15675 Sentence denotes Comparison of syncytia size and villous height to crypt depth (VH:CD) ratio were analyzed using statistical software GraphPad Prism 6.0 (GraphPad Prism Inc., San Diego, CA, USA).
T126 15676-15798 Sentence denotes Variables were compared using the non-parametrical Kruskal–Wallis test; p < 0.05 was considered statistically significant.
T127 15800-15802 Sentence denotes 3.
T128 15803-15810 Sentence denotes Results
T129 15812-15816 Sentence denotes 3.1.
T130 15817-15846 Sentence denotes Recovery of recombinant PEDVs
T131 15847-16084 Sentence denotes We have recently developed a reverse genetic platform of PEDV and have successfully generated a recombinant virus, iPEDVPT-P96, which is phenotypically comparable to its parental attenuated Taiwan PEDV-Pintung 52 strain, PEDVPT-P96 [19].
T132 16085-16387 Sentence denotes To study the role of the S gene in the attenuation mechanism of PEDVPT-P96, we further generated the recombinant, highly virulent Taiwan PEDVPT 52 strain, iPEDVPT-P5, and two chimeric viruses (iPEDVPT-P5-96S and iPEDVPT-P96-5S) by replacing the complete sequence of the S gene reciprocally (Figure S1).
T133 16388-16504 Sentence denotes In general, the approach to rescue the new recombinant viruses were virtually the same as published previously [19].
T134 16505-16740 Sentence denotes However, for the generation of iPEDVPT-P5 and iPEDVPT-P5-96S, we split the plasmid B to two fragments at nucleotide position of 9654 according to Hou et al. [23] in order to compensate for the instability caused by the toxic sequences.
T135 16741-16903 Sentence denotes The in vitro and in vivo properties of iPEDVPT-P5 were confirmed similarly to those of the parental PEDVPT-P5 strain in a seven-day-old conventional piglet model.
T136 16904-17029 Sentence denotes At 24–48 h post-electroporation, typical PEDV cytopathic effects of giant syncytia were observed for all recombinant viruses.
T137 17030-17250 Sentence denotes Viral stocks were prepared by passaging viruses in Vero cells one additional time (P1), and the presence of PEDV was confirmed by detection of PEDV S protein by immunofluorescence assay (Figure 1A) and sequence analyses.
T138 17252-17256 Sentence denotes 3.2.
T139 17257-17303 Sentence denotes In Vitro Characterization of Recombinant PEDVs
T140 17304-17468 Sentence denotes The in vitro characteristics of the recombinant viruses were compared by evaluation of the size of syncytia, growth kinetics in Vero cells, and plaque morphologies.
T141 17469-17546 Sentence denotes All recombinant viruses induced formation of syncytia by 18 h post-infection.
T142 17547-17781 Sentence denotes Viruses carrying the identical S gene exhibited similar fusogenic ability as suggested by the comparable number of nuclei per syncytium; representative micrographs used to count the number of nuclei in syncytia are shown in Figure 1A.
T143 17782-17964 Sentence denotes Remarkably, viruses carrying S gene derived from iPEDVPT-P96, induced 3.5 to 4 times larger syncytia than the other two viruses containing S gene derived from iPEDVPT-P5 (Figure 1B).
T144 17965-18156 Sentence denotes Replication of all recombinant viruses in Vero cells were examined by performing both one-step and multistep growth kinetics at a multiplicity of infection (MOI) of 1 and 0.001, respectively.
T145 18157-18465 Sentence denotes Interestingly, although replacement of the S gene resulted in an alteration of the replication kinetics and efficiency, leading to similar growth curve patterns between viruses carrying the identical S gene sequence, it did not fully reverse the capability of virus yield, at least in Vero cells (Figure 1C).
T146 18466-18578 Sentence denotes We observed that plaque morphologies of the four recombinant viruses correlated to the results of syncytia size.
T147 18579-18895 Sentence denotes At 72 h post-infection, both iPEDVPT-P5 and iPEDVPT-P96-5S induced barely visible viral plaques in Vero cells macroscopically, whereas iPEDVPT-P96 and iPEDVPT-5-96S generated distinct and comparable viral plaques with the plaque size of iPEDVPT-P5-96S being slightly smaller than that of the iPEDVPT-P96 (Figure 1D).
T148 18896-19070 Sentence denotes These data suggested that the exchange of the S gene between iPEDVPT-P5 and iPEDVPT-P96 affected the fusogenicity and, to a lesser extent, replication kinetics in Vero cells.
T149 19072-19076 Sentence denotes 3.3.
T150 19077-19157 Sentence denotes Investigation of the Role of Spike Gene on the Pathogenicity of PEDVPT 52 strain
T151 19158-19444 Sentence denotes To evaluate the pathogenicity related to S gene replacement in PEDVPT 52 strain, we orally inoculated 2 mL of 5 × 102 TCID50/mL of iPEDVPT-P5, iPEDVPT-P5-96S, iPEDVPT-P96, iPEDVPT-P96-5S viruses and with PI medium in seven-day-old crossbred piglets assigned in the corresponding groups.
T152 19445-19571 Sentence denotes Parameters used to assess the pathogenicity of different recombinant viruses were summarized in Table 2 and shown in Figure 2.
T153 19572-19728 Sentence denotes The target sequences of the recombinant viruses at the time point of peak fecal viral shedding in each pig was confirmed identical to the original inoculum.
T154 19729-19851 Sentence denotes No viral RNA shedding, diarrhea or mortality was detected in the mock-treated group during the entire experimental course.
T155 19852-20157 Sentence denotes Piglets inoculated with recombinant viruses carrying the S gene derived from the highly virulent iPEDVPT-P5, namely the iPEDVPT-P5 itself and iPEDVPT-P96-5S, had an early onset of clinical symptoms including diarrhea, anorexia and decreased activity, and peak viral shedding at 1 d post-inoculation (DPI).
T156 20158-20424 Sentence denotes At 3 DPI, piglets inoculated with iPEDVPT-P5 (n = 3) and iPEDVPT-P96-5S (n = 3) both exhibited extensive PEDV-induced villous blunting and atrophy in the jejunum and, to a lesser extent, in the ileum; histological changes in the duodenum were not obvious (Figure 3).
T157 20425-20581 Sentence denotes Mortality rates of both groups were comparable, reaching 50% at 2 (iPEDVPT-P5 group) and 5 (iPEDVPT-P96-5S group) DPI and ultimately exceeded 80% by 10 DPI.
T158 20582-20785 Sentence denotes In comparison, inoculation with iPEDVPT-P5-96S and iPEDVPT-P96 viruses containing the S gene derived from the attenuated iPEDVPT-P96, induced a delayed onset of clinical symptoms and peak viral shedding.
T159 20786-21037 Sentence denotes Histological evaluation of piglets inoculated with both viruses (iPEDVPT-P96, n = 3; iPEDVPT-P5-96S, n = 3) at 3 DPI revealed a much milder degree of villous atrophy in the jejunum with conspicuous villous hyperplasia compared to the other two groups.
T160 21038-21193 Sentence denotes Notably, iPEDVPT-P5-96S-treated piglets exhibited statistically significant severer villous atrophy in jejunum than iPEDVPT-P96-treated piglets (Figure 3).
T161 21194-21495 Sentence denotes Despite the similar pattern and severity of viral shedding and clinical symptoms, inoculation with iPEDVPT-P5-96S eventually resulted in a higher mortality rate (40% in iPEDVPT-P96 and 80 % and iPEDVPT-P5-96S) and lower average daily weight gain by 10 DPI than those upon inoculation with iPEDVPT-P96.
T162 21496-21713 Sentence denotes These data suggested that iPEDVPT-P96 fully regained virulence by replacement of the S gene from the virulent PEDVPT 52 strains and the complementary approach can only partially reduce the virulence of the iPEDVPT-P5.
T163 21714-21985 Sentence denotes In agreement with the previous study, immunohistochemistry using anti-PEDV nucleocapsid monoclonal antibody demonstrated positive signals predominantly in the jejunal and ileal enterocytes at the top of villi (Figure 4) but occasionally within the mesenteric lymph nodes.
T164 21986-22071 Sentence denotes No difference in the viral distribution was identified among the recombinant viruses.
T165 22073-22075 Sentence denotes 4.
T166 22076-22086 Sentence denotes Discussion
T167 22087-22245 Sentence denotes Porcine epidemic diarrhea (PED) to date remains a colossal burden to the global swine industries owing to the lack of successful vaccine in the field [12,13].
T168 22246-22552 Sentence denotes Moreover, other emerging and re-emerging swine enteric coronaviruses, including porcine deltacoronavirus (PDCoV) [24], and swine acute diarrhea syndrome coronavirus (SADS-CoV) [25], further complicate the field condition by affecting diagnostic accuracy and increasing the risk of viral recombination [26].
T169 22553-22687 Sentence denotes Hence, there is still a pressing need to develop a safe and effective vaccine, particularly the LAV, to mount this disastrous disease.
T170 22688-22845 Sentence denotes The reverse genetics system is a powerful and widely used tool to study viral pathogenesis and novel LAV design by active modification of genes of interests.
T171 22846-23029 Sentence denotes Previous studies using reverse genetics on other coronaviruses have identified many virulent/attenuating determinants that might be shared among different genus of coronaviruses [12].
T172 23030-23167 Sentence denotes Nevertheless, direct evidences of attenuation due to harboring those mutated determinant(s) in pigs are still limited in PEDV [16,23,27].
T173 23168-23492 Sentence denotes In the present study, to investigate the role of the S gene in the attenuation process of the PEDVPT 52 strain, we generated four infectious cDNA clones of G2b PEDV, including the parental virulent iPEDVPT-P5, attenuated iPEDVPT-P96, as well as two chimeric viruses (iPEDVPT-P5-96S and iPEDVPT-P96-5S) with exchanged S gene.
T174 23493-23724 Sentence denotes We found that the iPEDVPT-P96 virus fully regained the virulence after the exchange of S gene derived from the highly virulent iPEDVPT-P5 virus, showing comparable patterns of viral shedding, diarrhea and histopathological changes.
T175 23725-23944 Sentence denotes Our data confirmed that the S gene is the primary attenuating determinant of the iPEDVPT-P96 virus and the genetic backbone other than the S gene involving the attenuation of the iPEDVPT-P96 might be of less importance.
T176 23945-24124 Sentence denotes However, the iPEDVPT-P5-96S still exhibited partial virulence resulting in severer villous attenuation and higher mortality rate compared to those caused by the iPEDVPT-P96 virus.
T177 24125-24201 Sentence denotes This result supports that the virulence of PEDV might be a multigenic event.
T178 24202-24326 Sentence denotes In the present study, the first pair of cDNA clones of a virulent G2b PEDV and its derived attenuated strain were generated.
T179 24327-24566 Sentence denotes Since these two viruses were closely related to each other, this established platform would allow for easier manipulate in studying the effect of single nucleotide polymorphism for identifying potential virulent/attenuating determinate(s).
T180 24567-24700 Sentence denotes In the present study, we demonstrated that reversion of virulence or attenuation occurred after the S gene was reciprocally replaced.
T181 24701-24970 Sentence denotes However, this finding is in disagreement with previously published results by Wang et al. [17], indicating that there was an absence of virulence reversion after S gene substitution between the highly virulent G2b strain, BJ2011C, and the avirulent G1a strain, CHM2013.
T182 24971-25070 Sentence denotes There could be a few reasons for the discrepancy between our observations that of previous studies.
T183 25071-25119 Sentence denotes First, the autonomy of the viruses is different.
T184 25120-25369 Sentence denotes Viral attenuation in serial cell-culture or animal passage is a progressive process that involves a series of gene mutations and the subsequent alternated cooperative interplay between gene products and mechanisms influencing cell-virus interaction.
T185 25370-25601 Sentence denotes Although the patterns of attenuating mutation are similar among G2b PEDV strains, the asynchronous mutations between different PEDV strains could lead to loss of the cooperative or complementary function(s) for other gene products.
T186 25602-25689 Sentence denotes In the previous study, the used viral strains belonged to different genogroups [17,28].
T187 25690-25789 Sentence denotes Efficient viral assembly requires proper signaling and interaction between each structural protein.
T188 25790-26086 Sentence denotes Since the BJ2011C virus belonged to genogroup 2b, we speculated that the reason a singular S gene exchange failed to reverse the virulence of the avirulent G1a CHM2013 strain might be due to, at least in part, the suboptimal cooperation between structural proteins in terms of PEDV morphogenesis.
T189 26087-26177 Sentence denotes Second, the degree of attenuation differed between the CHM2013 virus and PEDVPT-P96 virus.
T190 26178-26457 Sentence denotes Comparing to the avirulent CHM2013 virus that induced no detectable viral shedding in two-day-old piglets, iPEDVPT-P96 virus retained some levels of virulence as it caused viral shedding, observable clinical symptoms, and even mortality in the seven-day-old conventional piglets.
T191 26458-26688 Sentence denotes Besides the S gene [17,28], the abolishment of the function of non-structural proteins (NSPs) alone has been demonstrated to attenuate highly virulent PEDVs by disrupting the antagonistic ability of host interferons (IFN) [16,27].
T192 26689-26808 Sentence denotes That means, when the function of certain NSP was abated, PEDVs lose its virulence, regardless of the S gene they carry.
T193 26809-27023 Sentence denotes Therefore, variations of NSPs in the CHM2013 virus might have a critical effect on its virulence, and the effect might be stronger than that contributed by the S gene derived from the highly virulent BJ2011C virus.
T194 27024-27300 Sentence denotes Similarly, we also speculated that the IFN-suppressive function provided by NSP(s) might also contribute to virulent differences between the iPEDVPT-P5-96S and iPEDVPT-P96 since nine mutations were identified in NSPs in the iPEDVPT-P96 as compared with that of PEDVPT-P5 [18].
T195 27301-27382 Sentence denotes Regardless, further studies are needed to clarify the hypotheses mentioned above.
T196 27383-27565 Sentence denotes Sequence comparison between the autologous highly virulent PEDVPT-P5 and attenuated PEDVPT-P96 revealed several amino acid substitutions [18], especially in the S gene (see Table 1).
T197 27566-27706 Sentence denotes Consistent with other studies, these mutations chiefly accumulated in the S2 domain, presumably because of adaptation to Vero cells [12,29].
T198 27707-28027 Sentence denotes In the present study, the enhanced fusogenic ability in vitro was distinctly ascribed to the S gene, more specifically the S2 domain, derived from iPEDVPT-P96 and presumably represented the evolutionary process to increase viral progeny since Vero cells are not of swine-origin but readily susceptible to PEDV infection.
T199 28028-28278 Sentence denotes Animal experiments with seven-day-old piglets revealed that the exchange of the S gene from the iPEDVPT-P96 resulted in a delayed onset of peak viral shedding, diarrhea, and milder villous atrophy when examined histologically at 3 d post-inoculation.
T200 28279-28567 Sentence denotes Additionally, in contrast to the findings published by Wang et al. [17], Suzuki et al. [30] reported that replacement of the entire S gene or S1 sequence from a highly virulent OKN-1/JPN/2013 American type PEDV strain enabled the attenuated rPEDVGFP-CV777 to acquire virulence in piglets.
T201 28568-28725 Sentence denotes In iPEDVPT-P96 virus, however, only two amino acid substitutions were identified in the S10 (C144T) and S1B (T554C) domains compared to the iPEDVPT-P5 virus.
T202 28726-28880 Sentence denotes For PEDV, S10 and S1B domains are known to contain sialic acid-binding and receptor-binding domains, respectively; thus, are crucial for viral entry [31].
T203 28881-29064 Sentence denotes Although Hou et al. [23] previously showed that deletion of 197 amino acids in S10 domain of PEDV resulted in attenuation in piglets, a more specific epitope has yet to be identified.
T204 29065-29264 Sentence denotes Therefore, we are curious about whether only these two mutations in iPEDVPT-P96 can attenuate the highly virulent iPEDVPT-P5 virus or if the S2 domain must be primarily accounted for the attenuation.
T205 29265-29327 Sentence denotes Future studies will be conducted to elucidate these questions.
T206 29328-29577 Sentence denotes In this study, the first pair of cDNA clones for a virulent G2b PEDV, and its derived attenuated strain were generated, allowing us to use both gain-of-function and lose-of-function approaches to studying the role of the S gene in PEDV pathogenesis.
T207 29578-29729 Sentence denotes We confirmed that the S gene is a crucial virulent/attenuating determinant for the iPEDVPT-P96, but its importance varies among different PEDV strains.
T208 29730-29883 Sentence denotes Thus, other studies’ results alongside our results will provide valuable information for the future generation of novel chimeric or multivalent vaccines.