T78 |
0-645 |
Sentence |
denotes |
Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding. |