| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T48 |
0-53 |
Sentence |
denotes |
Assay/use Oligonucleotide Sequencea Concentrationb |
| T49 |
54-126 |
Sentence |
denotes |
RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction |
| T50 |
127-265 |
Sentence |
denotes |
RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1 |
| T51 |
266-432 |
Sentence |
denotes |
RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2 |
| T52 |
433-498 |
Sentence |
denotes |
RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction |
| T53 |
499-571 |
Sentence |
denotes |
E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction |
| T54 |
572-645 |
Sentence |
denotes |
E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction |
| T55 |
646-706 |
Sentence |
denotes |
E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction |
| T56 |
707-772 |
Sentence |
denotes |
N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction |
| T57 |
773-844 |
Sentence |
denotes |
N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction |
| T58 |
845-903 |
Sentence |
denotes |
N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction |
