LitCovid-sentences  

PMC:6988269 / 6534-7844 JSONTXT 8 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T47 0-72 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 73-126 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 127-199 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 200-338 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 339-505 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 506-571 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 572-644 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 645-718 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 719-779 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 780-845 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 846-917 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 918-976 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 977-1018 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 1019-1023 Sentence denotes FAM:
T61 1024-1071 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 1072-1310 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.