> top > projects > LitCovid-sentences > docs > PMC:6988269 > annotations
LitCovid-sentences  

PMC:6988269 JSONTXT 23 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
T1 0-67 Sentence denotes Detection of 2019 novel coronavirus (2019-nCoV) by real-time RT-PCR
T2 69-77 Sentence denotes Abstract
T3 78-88 Sentence denotes Background
T4 89-403 Sentence denotes The ongoing outbreak of the recently emerged novel coronavirus (2019-nCoV) poses a challenge for public health laboratories as virus isolates are unavailable while there is growing evidence that the outbreak is more widespread than initially thought, and international spread through travellers does already occur.
T5 405-408 Sentence denotes Aim
T6 409-555 Sentence denotes We aimed to develop and deploy robust diagnostic methodology for use in public health laboratory settings without having virus material available.
T7 557-564 Sentence denotes Methods
T8 565-760 Sentence denotes Here we present a validated diagnostic workflow for 2019-nCoV, its design relying on close genetic relatedness of 2019-nCoV with SARS coronavirus, making use of synthetic nucleic acid technology.
T9 762-769 Sentence denotes Results
T10 770-861 Sentence denotes The workflow reliably detects 2019-nCoV, and further discriminates 2019-nCoV from SARS-CoV.
T11 862-1053 Sentence denotes Through coordination between academic and public laboratories, we confirmed assay exclusivity based on 297 original clinical specimens containing a full spectrum of human respiratory viruses.
T12 1054-1177 Sentence denotes Control material is made available through European Virus Archive – Global (EVAg), a European Union infrastructure project.
T13 1179-1189 Sentence denotes Conclusion
T14 1190-1361 Sentence denotes The present study demonstrates the enormous response capacity achieved through coordination of academic and public laboratories in national and European research networks.
T15 1363-1375 Sentence denotes Introduction
T16 1376-1566 Sentence denotes According to the World Health Organization (WHO), the WHO China Country Office was informed of cases of pneumonia of unknown aetiology in Wuhan City, Hubei Province, on 31 December 2019 [1].
T17 1567-1698 Sentence denotes A novel coronavirus currently termed 2019-nCoV was officially announced as the causative agent by Chinese authorities on 7 January.
T18 1699-2047 Sentence denotes A viral genome sequence was released for immediate public health support via the community online resource virological.org on 10 January (Wuhan-Hu-1, GenBank accession number MN908947 [2]), followed by four other genomes deposited on 12 January in the viral sequence database curated by the Global Initiative on Sharing All Influenza Data (GISAID).
T19 2048-2287 Sentence denotes The genome sequences suggest presence of a virus closely related to the members of a viral species termed severe acute respiratory syndrome (SARS)-related CoV, a species defined by the agent of the 2002/03 outbreak of SARS in humans [3,4].
T20 2288-2396 Sentence denotes The species also comprises a large number of viruses mostly detected in rhinolophid bats in Asia and Europe.
T21 2397-2487 Sentence denotes As at 20 January 2019, 282 laboratory-confirmed human cases have been notified to WHO [5].
T22 2488-2635 Sentence denotes Confirmed cases in travellers from Wuhan were announced on 13 and 17 January in Thailand as well as on 15 January in Japan and 19 January in Korea.
T23 2636-2798 Sentence denotes The extent of human-to-human transmission of 2019-nCoV is unclear at the time of writing of this report but there is evidence of some human-to-human transmission.
T24 2799-2904 Sentence denotes Among the foremost priorities to facilitate public health interventions is reliable laboratory diagnosis.
T25 2905-3018 Sentence denotes In acute respiratory infection, RT-PCR is routinely used to detect causative viruses from respiratory secretions.
T26 3019-3270 Sentence denotes We have previously demonstrated the feasibility of introducing robust detection technology based on real-time RT-PCR in public health laboratories during international health emergencies by coordination between public and academic laboratories [6-12].
T27 3271-3416 Sentence denotes In all of these situations, virus isolates were available as the primary substrate for establishing and controlling assays and assay performance.
T28 3417-3578 Sentence denotes In the present case of 2019-nCoV, virus isolates or samples from infected patients have so far not become available to the international public health community.
T29 3579-3784 Sentence denotes We report here on the establishment and validation of a diagnostic workflow for 2019-nCoV screening and specific confirmation, designed in absence of available virus isolates or original patient specimens.
T30 3785-3933 Sentence denotes Design and validation were enabled by the close genetic relatedness to the 2003 SARS-CoV, and aided by the use of synthetic nucleic acid technology.
T31 3935-3942 Sentence denotes Methods
T32 3944-4031 Sentence denotes Clinical samples and coronavirus cell culture supernatants for initial assay evaluation
T33 4032-4194 Sentence denotes Cell culture supernatants containing typed coronaviruses and other respiratory viruses were provided by Charité and University of Hong Kong research laboratories.
T34 4195-4464 Sentence denotes Respiratory samples were obtained during 2019 from patients hospitalised at Charité medical centre and tested by the NxTAG respiratory pathogen panel (Luminex, S´Hertogenbosch, The Netherlands) or in cases of MERS-CoV by the MERS-CoV upE assay as published before [10].
T35 4465-4708 Sentence denotes Additional samples were selected from biobanks at the Rijksinstituut voor Volksgezondheid en Milieu (RIVM), Bilthoven, at Erasmus University Medical Center, Rotterdam, at Public Health England (PHE), London, and at the University of Hong Kong.
T36 4709-4827 Sentence denotes Samples from all collections comprised sputum as well as nose and throat swabs with or without viral transport medium.
T37 4828-5297 Sentence denotes Faecal samples containing bat-derived SARS-related CoV samples (identified by GenBank accession numbers) were tested: KC633203, Betacoronavirus BtCoV/Rhi_eur/BB98–98/BGR/2008; KC633204, Betacoronavirus BtCoV/Rhi_eur/BB98–92/BGR/2008; KC633201, Betacoronavirus BtCoV/Rhi_bla/BB98–22/BGR/2008; GU190221 Betacoronavirus Bat coronavirus BR98–19/BGR/2008; GU190222 Betacoronavirus Bat coronavirus BM98–01/BGR/2008; GU190223, Betacoronavirus Bat coronavirus BM98–13/BGR/2008.
T38 5298-5366 Sentence denotes All synthetic RNA used in this study was photometrically quantified.
T39 5368-5382 Sentence denotes RNA extraction
T40 5383-5569 Sentence denotes RNA was extracted from clinical samples with the MagNA Pure 96 system (Roche, Penzberg, Germany) and from cell culture supernatants with the viral RNA mini kit (QIAGEN, Hilden, Germany).
T41 5571-5606 Sentence denotes Real-time reverse-transcription PCR
T42 5607-6059 Sentence denotes A 25 μL reaction contained 5 μL of RNA, 12.5 μL of 2 × reaction buffer provided with the Superscript III one step RT-PCR system with Platinum Taq Polymerase (Invitrogen, Darmstadt, Germany; containing 0.4 mM of each deoxyribont triphosphates (dNTP) and 3.2 mM magnesium sulphate), 1 μL of reverse transcriptase/Taq mixture from the kit, 0.4 μL of a 50 mM magnesium sulphate solution (Invitrogen), and 1 μg of nonacetylated bovine serum albumin (Roche).
T43 6060-6145 Sentence denotes Primer and probe sequences, as well as optimised concentrations are shown in Table 1.
T44 6146-6230 Sentence denotes All oligonucleotides were synthesised and provided by Tib-Molbiol (Berlin, Germany).
T45 6231-6389 Sentence denotes Thermal cycling was performed at 55 °C for 10 min for reverse transcription, followed by 95 °C for 3 min and then 45 cycles of 95 °C for 15 s, 58 °C for 30 s.
T46 6390-6533 Sentence denotes Participating laboratories used either Roche Light Cycler 480II or Applied Biosystems ViiA7 instruments (Applied Biosystems, Hong Kong, China).
T47 6534-6606 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 6607-6660 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 6661-6733 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 6734-6872 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 6873-7039 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 7040-7105 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 7106-7178 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 7179-7252 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 7253-7313 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 7314-7379 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 7380-7451 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 7452-7510 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 7511-7552 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 7553-7557 Sentence denotes FAM:
T61 7558-7605 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 7606-7844 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.
T63 7846-7884 Sentence denotes Protocol options and application notes
T64 7885-8059 Sentence denotes Laboratories participating in the evaluation used the TaqMan Fast Virus 1-Step Master Mix (Thermo Fisher) with the same oligonucleotide concentrations and cycling conditions.
T65 8060-8134 Sentence denotes The QIAGEN One-Step RT-PCR Kit was also tested and found to be compatible.
T66 8135-8303 Sentence denotes The intended cross-reactivity of all assays with viral RNA of SARS-CoV allows us to use the assays without having to rely on external sources of specific 2019-nCoV RNA.
T67 8304-8450 Sentence denotes For a routine workflow, we recommend the E gene assay as the first-line screening tool, followed by confirmatory testing with the RdRp gene assay.
T68 8451-8624 Sentence denotes Application of the RdRp gene assay with dual colour technology can discriminate 2019-nCoV (both probes positive) from SARS-CoV RNA if the latter is used as positive control.
T69 8625-8725 Sentence denotes Alternatively, laboratories may choose to run the RdRp assay with only the 2019-nCoV-specific probe.
T70 8727-8744 Sentence denotes Ethical statement
T71 8745-8891 Sentence denotes The internal use of samples for diagnostic workflow optimisation was agreed under the medical ethical rules of each of the participating partners.
T72 8893-8900 Sentence denotes Results
T73 8901-9043 Sentence denotes Before public release of virus sequences from cases of 2019-nCoV, we relied on social media reports announcing detection of a SARS-like virus.
T74 9044-9112 Sentence denotes We thus assumed that a SARS-related CoV is involved in the outbreak.
T75 9113-9234 Sentence denotes We downloaded all complete and partial (if > 400 nt) SARS-related virus sequences available in GenBank by 1 January 2020.
T76 9235-9434 Sentence denotes The list (n = 729 entries) was manually checked and artificial sequences (laboratory-derived, synthetic, etc), as well as sequence duplicates were removed, resulting in a final list of 375 sequences.
T77 9435-9534 Sentence denotes These sequences were aligned and the alignment was used for assay design (Supplementary Figure S1).
T78 9535-9693 Sentence denotes Upon release of the first 2019-nCoV sequence at virological.org, three assays were selected based on how well they matched to the 2019-nCoV genome (Figure 1).
T79 9694-9874 Sentence denotes The alignment was complemented by additional sequences released independently on GISAID (https://www.gisaid.org), confirming the good matching of selected primers to all sequences.
T80 9875-10011 Sentence denotes Alignments of primer binding domains with 2019-nCoV, SARS-CoV as well as selected bat-associated SARS-related CoV are shown in Figure 2.
T81 10012-10122 Sentence denotes Figure 1 Relative positions of amplicon targets on the SARS coronavirus and the 2019 novel coronavirus genome
T82 10123-10293 Sentence denotes E: envelope protein gene; M: membrane protein gene; N: nucleocapsid protein gene; ORF: open reading frame; RdRp: RNA-dependent RNA polymerase gene; S: spike protein gene.
T83 10294-10380 Sentence denotes Numbers below amplicons are genome positions according to SARS-CoV, GenBank NC_004718.
T84 10381-10480 Sentence denotes Figure 2 Partial alignments of oligonucleotide binding regions, SARS-related coronaviruses (n = 9)
T85 10481-10682 Sentence denotes The panels show six available sequences of 2019-nCoV, aligned to the corresponding partial sequences of SARS-CoV strain Frankfurt 1, which can be used as a positive control for all three RT-PCR assays.
T86 10683-10952 Sentence denotes The alignment also contains a closely related bat virus (Bat SARS-related CoV isolate bat-SL-CoVZC45, GenBank accession number MG772933) as well as the most distant member within the SARS-related bat CoV clade, detected in Bulgaria (GenBank accession number NC_014470).
T87 10953-11028 Sentence denotes Dots represent identical nucleotides compared with the WH_Human_1 sequence.
T88 11029-11068 Sentence denotes Nucleotide substitutions are specified.
T89 11069-11123 Sentence denotes Blue arrows: oligonucleotides as specified in Table 1.
T90 11124-11185 Sentence denotes More comprehensive alignments can be found in the Supplement.
T91 11187-11238 Sentence denotes Assay sensitivity based on SARS coronavirus virions
T92 11239-11410 Sentence denotes To obtain a preliminary assessment of analytical sensitivity, we used purified cell culture supernatant containing SARS-CoV strain Frankfurt-1 virions grown on Vero cells.
T93 11411-11523 Sentence denotes The supernatant was ultrafiltered and thereby concentrated from a ca 20-fold volume of cell culture supernatant.
T94 11524-11663 Sentence denotes The concentration step simultaneously reduces the relative concentration of background nucleic acids such as not virion-packaged viral RNA.
T95 11664-11823 Sentence denotes The virion preparation was quantified by real-time RT-PCR using a specific in vitro-transcribed RNA quantification standard as described in Drosten et al. [8].
T96 11824-11982 Sentence denotes All assays were subjected to replicate testing in order to determine stochastic detection frequencies at each assay’s sensitivity end point (Figure 3A and B).
T97 11983-12157 Sentence denotes All assays were highly sensitive, with best results obtained for the E gene and RdRp gene assays (5.2 and 3.8 copies per reaction at 95% detection probability, respectively).
T98 12158-12210 Sentence denotes These two assays were chosen for further evaluation.
T99 12211-12415 Sentence denotes One of the laboratories participating in the external evaluation used other basic RT-PCR reagents (TaqMan Fast Virus 1-Step Master Mix) and repeated the sensitivity study, with equivalent results (E gene:
T100 12416-12448 Sentence denotes 3.2 RNA copies/reaction (95% CI:
T101 12449-12464 Sentence denotes 2.2–6.8); RdRP:
T102 12465-12497 Sentence denotes 3.7 RNA copies/reaction (95% CI:
T103 12498-12507 Sentence denotes 2.8–8.0).
T104 12508-12672 Sentence denotes Of note, the N gene assay also performed well but was not subjected to intensive further validation because it was slightly less sensitive (Supplementary Figure S2)
T105 12673-12818 Sentence denotes Figure 3 Determination of limits of detection based on SARS coronavirus genomic RNA and 2019 novel coronavirus-specific in vitro transcribed RNA
T106 12819-12901 Sentence denotes CI: confidence intervals; c/r: copies per reaction; IVT: in vitro-transcribed RNA.
T107 12902-12904 Sentence denotes A:
T108 12905-12955 Sentence denotes E gene assay, evaluated with SARS-CoV genomic RNA.
T109 12956-12958 Sentence denotes B:
T110 12959-13011 Sentence denotes RdRp gene assay evaluated with SARS-CoV genomic RNA.
T111 13012-13097 Sentence denotes C: E-gene assay, evaluated with 2019-nCoV-specific in vitro-transcribed RNA standard.
T112 13098-13100 Sentence denotes D:
T113 13101-13185 Sentence denotes RdRp gene assay evaluated with 2019-nCoV-specific in vitro-transcribed RNA standard.
T114 13186-13233 Sentence denotes The x-axis shows input RNA copies per reaction.
T115 13234-13466 Sentence denotes The y-axis shows positive results in all parallel reactions performed, squares are experimental data points resulting from replicate testing of given concentrations (x-axis) in parallels assays (eight replicate reactions per point).
T116 13467-13530 Sentence denotes Technical limits of detection are given in the panels headings.
T117 13531-13585 Sentence denotes The inner line is a probit curve (dose-response rule).
T118 13586-13620 Sentence denotes The outer dotted lines are 95% CI.
T119 13622-13720 Sentence denotes Sensitivity based on in vitro-transcribed RNA identical to 2019 novel coronavirus target sequences
T120 13721-14006 Sentence denotes Although both assays detected 2019-nCoV without polymorphisms at oligonucleotide binding sites (Figure 2), we additionally generated in vitro-transcribed RNA standards that exactly matched the sequence of 2019-nCoV for absolute quantification and studying the limit of detection (LOD).
T121 14007-14133 Sentence denotes Replicate reactions were done at concentrations around the detection end point determined in preliminary dilution experiments.
T122 14134-14287 Sentence denotes The resulting LOD from replicate tests was 3.9 copies per reaction for the E gene assay and 3.6 copies per reaction for the RdRp assay (Figure 3C and D).
T123 14288-14443 Sentence denotes These figures were close to the 95% hit rate of 2.9 copies per reaction, according to the Poisson distribution, expected when one RNA molecule is detected.
T124 14445-14521 Sentence denotes Discrimination of 2019 novel coronavirus from SARS coronavirus by RdRp assay
T125 14522-14858 Sentence denotes Following the rationale that SARS-CoV RNA can be used as a positive control for the entire laboratory procedure, thus obviating the need to handle 2019-nCoV RNA, we formulated the RdRp assay so that it contains two probes: a broad-range probe reacting with SARS-CoV and 2019-nCoV and an additional probe that reacts only with 2019-nCoV.
T126 14859-15013 Sentence denotes By limiting dilution experiments, we confirmed that both probes, whether used individually or in combination, provided the same LOD for each target virus.
T127 15014-15115 Sentence denotes The specific probe RdRP_SARSr-P2 detected only the 2019-nCoV RNA transcript but not the SARS-CoV RNA.
T128 15117-15173 Sentence denotes Detection range for SARS-related coronaviruses from bats
T129 15174-15368 Sentence denotes At present, the potential exposure to a common environmental source in early reported cases implicates the possibility of independent zoonotic infections with increased sequence variability [5].
T130 15369-15567 Sentence denotes To show that the assays can detect other bat-associated SARS-related viruses, we used the E gene assay to test six bat-derived faecal samples available from Drexler et al. [13] und Muth et al. [14].
T131 15568-15636 Sentence denotes These virus-positive samples stemmed from European rhinolophid bats.
T132 15637-15770 Sentence denotes Detection of these phylogenetic outliers within the SARS-related CoV clade suggests that all Asian viruses are likely to be detected.
T133 15771-15917 Sentence denotes This would, theoretically, ensure broad sensitivity even in case of multiple independent acquisitions of variant viruses from an animal reservoir.
T134 15919-15938 Sentence denotes Specificity testing
T135 15940-15958 Sentence denotes Chemical stability
T136 15959-16191 Sentence denotes To exclude non-specific reactivity of oligonucleotides among each other, causing artificial fluorescent signals, all assays were tested 120 times in parallel with water and no other nucleic acid except the provided oligonucleotides.
T137 16192-16252 Sentence denotes In none of these reactions was any positive signal detected.
T138 16254-16295 Sentence denotes Cross-reactivity with other coronaviruses
T139 16296-16476 Sentence denotes Cell culture supernatants containing all endemic human coronaviruses (HCoV)‑229E, ‑NL63, ‑OC43 and ‑HKU1 as well as MERS-CoV were tested in duplicate in all three assays (Table 2).
T140 16477-16558 Sentence denotes For the non-cultivable HCoV-HKU1, supernatant from human airway culture was used.
T141 16559-16733 Sentence denotes Viral RNA concentration in all samples was determined by specific real-time RT-PCRs and in vitro-transcribed RNA standards designed for absolute quantification of viral load.
T142 16734-16839 Sentence denotes Additional undiluted (but not quantified) cell culture supernatants were tested as summarised in Table 2.
T143 16840-16905 Sentence denotes These were additionally mixed into negative human sputum samples.
T144 16906-16988 Sentence denotes None of the tested viruses or virus preparations showed reactivity with any assay.
T145 16989-17175 Sentence denotes Table 2 Tests of known respiratory viruses and bacteria in clinical samples and cell culture preparations for cross-reactivity in 2019 novel coronavirus E and RdRp gene assays (n = 310)
T146 17176-17247 Sentence denotes Clinical samples with known viruses Clinical samplesa Virus isolatesb
T147 17248-17265 Sentence denotes HCoV-HKU1 14 1c
T148 17266-17283 Sentence denotes HCoV-OC43 16 2d
T149 17284-17301 Sentence denotes HCoV-NL63 14 1e
T150 17302-17319 Sentence denotes HCoV-229E 18 2f
T151 17320-17335 Sentence denotes MERS-CoV 5 1g
T152 17336-17365 Sentence denotes Influenza A(H1N1)pdm09 17 1
T153 17366-17390 Sentence denotes Influenza A(H3N2) 16 1
T154 17391-17421 Sentence denotes Influenza A (untyped) 11 NA
T155 17422-17445 Sentence denotes Influenza A(H5N1) 1 1
T156 17446-17469 Sentence denotes Influenza A(H7N9) 0 1
T157 17470-17511 Sentence denotes Influenza B (Victoria or Yamagata) 31 1
T158 17512-17542 Sentence denotes Rhinovirus/enterovirus 31 NA
T159 17543-17584 Sentence denotes Respiratory syncytial virus (A/B) 33 NA
T160 17585-17614 Sentence denotes Parainfluenza 1 virus 12 NA
T161 17615-17644 Sentence denotes Parainfluenza 2 virus 11 NA
T162 17645-17674 Sentence denotes Parainfluenza 3 virus 14 NA
T163 17675-17704 Sentence denotes Parainfluenza 4 virus 11 NA
T164 17705-17734 Sentence denotes Human metapneumovirus 16 NA
T165 17735-17752 Sentence denotes Adenovirus 13 1
T166 17753-17775 Sentence denotes Human bocavirus 6 NA
T167 17776-17791 Sentence denotes Legionella spp.
T168 17793-17798 Sentence denotes 3 NA
T169 17799-17814 Sentence denotes Mycoplasma spp.
T170 17816-17821 Sentence denotes 4 NA
T171 17822-17854 Sentence denotes Total clinical samples 297 NA
T172 17855-17988 Sentence denotes a For samples with multiple viruses detected, the virus with highest concentration is listed, as indicated by real-time PCR Ct value.
T173 17989-18054 Sentence denotes b Directly quantified or spiked in human negative-testing sputum.
T174 18055-18120 Sentence denotes c 1 × 105 RNA copies/mL, determined by specific real-time RT-PCR.
T175 18121-18167 Sentence denotes Isolated from human airway epithelial culture.
T176 18168-18249 Sentence denotes d 1 × 1010 RNA copies/mL, determined by specific real-time RT-PCR of one isolate.
T177 18250-18331 Sentence denotes The other isolate was not quantified but spiked in human negative-testing sputum.
T178 18332-18397 Sentence denotes e 4 × 109 RNA copies/mL, determined by specific real-time RT-PCR.
T179 18398-18478 Sentence denotes f 3 × 109 RNA copies/mL, determined by specific real-time RT-PCR of one isolate.
T180 18479-18556 Sentence denotes The other isolate was not quantified spiked in human negative-testing sputum.
T181 18557-18622 Sentence denotes g 1 × 108 RNA copies/mL, determined by specific real-time RT-PCR.
T182 18624-18737 Sentence denotes Exclusivity of 2019 novel coronavirus based on clinical samples pre-tested positive for other respiratory viruses
T183 18738-18999 Sentence denotes Using the E and RdRp gene assays, we tested a total of 297 clinical samples from patients with respiratory disease from the biobanks of five laboratories that provide diagnostic services (one in Germany, two in the Netherlands, one in Hong Kong, one in the UK).
T184 19000-19214 Sentence denotes We selected 198 samples from three university medical centres where patients from general and intensive care wards as well as mainly paediatric outpatient departments are seen (Germany, the Netherlands, Hong Kong).
T185 19215-19381 Sentence denotes The remaining samples were contributed by national public health services performing surveillance studies (RIVM, PHE), with samples mainly submitted by practitioners.
T186 19382-19581 Sentence denotes The samples contained the broadest range of respiratory agents possible and reflected the general spectrum of virus concentrations encountered in diagnostic laboratories in these countries (Table 2).
T187 19582-19640 Sentence denotes In total, this testing yielded no false positive outcomes.
T188 19641-19767 Sentence denotes In four individual test reactions, weak initial reactivity was seen but they were negative upon retesting with the same assay.
T189 19768-20004 Sentence denotes These signals were not associated with any particular virus, and for each virus with which initial positive reactivity occurred, there were other samples that contained the same virus at a higher concentration but did not test positive.
T190 20005-20325 Sentence denotes Given the results from the extensive technical qualification described above, it was concluded that this initial reactivity was not due to chemical instability of real-time PCR probes but most probably to handling issues caused by the rapid introduction of new diagnostic tests and controls during this evaluation study.
T191 20327-20337 Sentence denotes Discussion
T192 20338-20510 Sentence denotes The present report describes the establishment of a diagnostic workflow for detection of an emerging virus in the absence of physical sources of viral genomic nucleic acid.
T193 20511-20780 Sentence denotes Effective assay design was enabled by the willingness of scientists from China to share genome information before formal publication, as well as the availability of broad sequence knowledge from ca 15 years of investigation of SARS-related viruses in animal reservoirs.
T194 20781-20996 Sentence denotes The relative ease with which assays could be designed for this virus, in contrast to SARS-CoV in 2003, proves the huge collective value of descriptive studies of disease ecology and viral genome diversity [8,15-17].
T195 20997-21056 Sentence denotes Real-time RT-PCR is widely deployed in diagnostic virology.
T196 21057-21279 Sentence denotes In the case of a public health emergency, proficient diagnostic laboratories can rely on this robust technology to establish new diagnostic tests within their routine services before pre-formulated assays become available.
T197 21280-21552 Sentence denotes In addition to information on reagents, oligonucleotides and positive controls, laboratories working under quality control programmes need to rely on documentation of technical qualification of the assay formulation as well as data from external clinical evaluation tests.
T198 21553-21722 Sentence denotes The provision of control RNA templates has been effectively implemented by the EVAg project that provides virus-related reagents from academic research collections [18].
T199 21723-21977 Sentence denotes SARS-CoV RNA was retrievable from EVAg before the present outbreak; specific products such as RNA transcripts for the here-described assays were first retrievable from the EVAg online catalogue on 14 January 2020 (https://www.european-virus-archive.com).
T200 21978-22234 Sentence denotes Technical qualification data based on cell culture materials and synthetic constructs, as well as results from exclusivity testing on 75 clinical samples, were included in the first version of the diagnostic protocol provided to the WHO on 13 January 2020.
T201 22235-22464 Sentence denotes Based on efficient collaboration in an informal network of laboratories, these data were augmented within 1 week comprise testing results based on a wide range of respiratory pathogens in clinical samples from natural infections.
T202 22465-22685 Sentence denotes Comparable evaluation studies during regulatory qualification of in vitro diagnostic assays can take months for organisation, legal implementation and logistics and typically come after the peak of an outbreak has waned.
T203 22686-23027 Sentence denotes The speed and effectiveness of the present deployment and evaluation effort were enabled by national and European research networks established in response to international health crises in recent years, demonstrating the enormous response capacity that can be released through coordinated action of academic and public laboratories [18-22].
T204 23028-23186 Sentence denotes This laboratory capacity not only supports immediate public health interventions but enables sites to enrol patients during rapid clinical research responses.
T205 23188-23204 Sentence denotes Acknowledgements
T206 23205-23488 Sentence denotes This work was funded by European Union DG Research through projects Prepare (GA602525), Compare (GA643476), and EVAg (GA653316); by European Union DG SANCO through EVD-LabNet, as well as by the German Ministry of Research through projects RAPID (01KI1723A) and DZIF (301-4-7-01.703).
T207 23489-23659 Sentence denotes We gratefully acknowledge the authors, the originating and submitting laboratories for their sequence and metadata shared through GISAID, on which this research is based.
T208 23660-23725 Sentence denotes All authors of data may be contacted directly via www.gisaid.org:
T209 23726-24058 Sentence denotes National Institute for Viral Disease Control and Prevention, China CDC (Wenjie Tan, Xiang Zhao, Wenling Wang, Xuejun Ma, Yongzhong Jiang, Roujian Lu, Ji Wang, Weimin Zhou, Peihua Niu, Peipei Liu,Faxian Zhan, Weifeng Shi, Baoying Huang, Jun Liu, Li Zhao, Yao Meng, Xiaozhou He, Fei Ye, Na Zhu, Yang Li, Jing Chen, Wenbo Xu, George F.
T210 24059-24673 Sentence denotes Gao, Guizhen Wu); Wuhan Institute of Virology, Chinese Academy of Sciences (Peng Zhou, Xing-Lou Yang, Ding-Yu Zhang, Lei Zhang, Yan Zhu, Hao-Rui Si, Zhengli Shi); Institute of Pathogen Biology, Chinese Academy of Medical Sciences and Peking Union Medical College (Lili Ren, Jianwei Wang, Qi Jin, Zichun Xiang, Yongjun Li, Zhiqiang Wu, Chao Wu, Yiwei Liu); and National Institute for Communicable Disease Control and Prevention (ICDC), China CDC (Zhang Y-Z, Wu, F, Chen Y-M, Pei Y-Y, Xu L, Wang W, Zhao S, Yu B, Hu Y, Tao Z-W, Song Z-G, Tian J-H, Zhang Y-L, Liu Y, Zheng J-J, Dai F-H, Wang Q-M, She J-L and Zhu T-Y)
T211 24674-24765 Sentence denotes We thank Marta Zuchowski, Sigrid Kersten, and Joerg Hofmann for help with sample logistics.
T212 24766-24850 Sentence denotes In vitro-transcribed control RNA for the E gene assay can be acquired from author C.
T213 24851-24931 Sentence denotes D. through the European Virus Archive platform (www.european-virus-archive.com),
T214 24933-24954 Sentence denotes Conflict of interest:
T215 24955-24969 Sentence denotes None declared.
T216 24970-24998 Sentence denotes Authors’ contributions: VMC:
T217 24999-25068 Sentence denotes Planned and conducted experiments, conceptualised the laboratory work
T218 25069-25072 Sentence denotes OL:
T219 25073-25142 Sentence denotes Planned and conducted experiments, conceptualised the laboratory work
T220 25143-25146 Sentence denotes MK:
T221 25147-25180 Sentence denotes Planned and conducted experiments
T222 25181-25184 Sentence denotes RM:
T223 25185-25254 Sentence denotes Planned and conducted experiments, conceptualised the laboratory work
T224 25255-25258 Sentence denotes AM:
T225 25259-25328 Sentence denotes Planned and conducted experiments, conceptualised the laboratory work
T226 25329-25334 Sentence denotes DKWC:
T227 25335-25368 Sentence denotes Planned and conducted experiments
T228 25369-25372 Sentence denotes TB:
T229 25373-25406 Sentence denotes Planned and conducted experiments
T230 25407-25410 Sentence denotes SB:
T231 25411-25444 Sentence denotes Planned and conducted experiments
T232 25445-25448 Sentence denotes JS:
T233 25449-25482 Sentence denotes Planned and conducted experiments
T234 25483-25487 Sentence denotes MLS:
T235 25488-25521 Sentence denotes Planned and conducted experiments
T236 25522-25528 Sentence denotes DGJCM:
T237 25529-25562 Sentence denotes Planned and conducted experiments
T238 25563-25567 Sentence denotes BLH:
T239 25568-25601 Sentence denotes Planned and conducted experiments
T240 25602-25607 Sentence denotes BvdV:
T241 25608-25641 Sentence denotes Planned and conducted experiments
T242 25642-25647 Sentence denotes SvdB:
T243 25648-25681 Sentence denotes Planned and conducted experiments
T244 25682-25685 Sentence denotes LW:
T245 25686-25719 Sentence denotes Planned and conducted experiments
T246 25720-25723 Sentence denotes GG:
T247 25724-25757 Sentence denotes Planned and conducted experiments
T248 25758-25762 Sentence denotes JLR:
T249 25763-25809 Sentence denotes Contributed to overall study conceptualization
T250 25810-25813 Sentence denotes JE:
T251 25814-25883 Sentence denotes Planned and conducted experiments, conceptualised the laboratory work
T252 25884-25887 Sentence denotes MZ:
T253 25888-25959 Sentence denotes Planned laboratory work, contributed to overall study conceptualization
T254 25960-25963 Sentence denotes MP:
T255 25964-26035 Sentence denotes Planned laboratory work, contributed to overall study conceptualization
T256 26036-26039 Sentence denotes HG:
T257 26040-26086 Sentence denotes Contributed to overall study conceptualization
T258 26087-26090 Sentence denotes CR:
T259 26091-26146 Sentence denotes Planned experiments, conceptualised the laboratory work
T260 26147-26152 Sentence denotes MPGK:
T261 26153-26208 Sentence denotes Planned experiments, conceptualised the laboratory work
T262 26209-26212 Sentence denotes CD:
T263 26213-26331 Sentence denotes Planned experiments, conceptualised the laboratory work, conceptualised the overall study, wrote the manuscript draft.
T264 26333-26351 Sentence denotes Supplementary Data
T265 26352-26362 Sentence denotes Supplement
T266 26363-26399 Sentence denotes Click here for additional data file.