PMC:7033275 / 6084-6091 JSONTXT

Complete Genome Sequences of Five Human Coronavirus NL63 Strains Causing Respiratory Illness in Hospitalized Children in China Microbiology Resource Announcement Zhang et al. We report the complete genome sequences of five human coronavirus NL63 (HCoV-NL63) strains obtained using next-generation sequencing. The five HCoV-NL63 strains were obtained from hospitalized children with severe acute respiratory infection detected in Guangdong, China. This study provides several complete genomes of HCoV-NL63 and improves our understanding of HCoV-NL63 evolution in China. Abstract ABSTRACT We report the complete genome sequences of five human coronavirus NL63 (HCoV-NL63) strains obtained using next-generation sequencing. The five HCoV-NL63 strains were obtained from hospitalized children with severe acute respiratory infection detected in Guangdong, China. This study provides several complete genomes of HCoV-NL63 and improves our understanding of HCoV-NL63 evolution in China. ANNOUNCEMENT Human coronavirus NL63 (HCoV-NL63) is a member of the family Coronaviridae, genus Alphacoronavirus, and was first discovered in 2004 (1). HCoV-NL63 is mainly associated with the common cold in children, the elderly, and immunocompromised patients (2, 3). The genome of HCoV-NL63 is about 27 kb with a conserved gene order of 5′-orf1ab-spike (S)-orf3-envelope (E)-membrane (M)-nucleocapsid (N)-poly (A). The species tropism of HCoV-NL63 is determined by spike glycoprotein. HCoV-NL63 and severe acute respiratory syndrome coronavirus (SARS-CoV) share the same cell receptor, angiotensin converting enzyme 2 (ACE-2) (4, 5), for entry into host cells, and HCoV-NL63 is recognized as a common cause of upper respiratory tract infection and has been prevalent worldwide. Here, nasopharyngeal swab samples were collected from hospitalized children with severe acute respiratory infection in Guangzhou, China, in 2018. This study was performed in strict accordance with human subject protection guidance provided by the Research Ethics Committee of Guangzhou Medical University. The respiratory samples were filtered with 0.22-μm filters, RNA extraction was performed using a Qiagen viral RNA extraction kit, and extracted RNA was used for sequence-independent single-primer amplification (SISPA) (6, 7) as follows: a reverse transcription reaction was performed with SuperScript III reverse transcriptase using a primer containing a fixed sequence, followed by a random hexamer at the 3′ end (FR26RV, GCCGGAGCTCTGCAGATATCNNNNNN). Then, Klenow fragment polymerase (New England Biolabs) was used for DNA synthesis. Finally, PCR amplification was conducted using primers consisting of the fixed portions of the random primers (FR26, GCCGGAGCTCTGCAGATATC). Purified DNA was used for next-generation sequencing (NGS). Libraries were prepared with the Nextera XT kit (Illumina), and paired-end reads (2 × 125 bp) determined using a HiSeq 2500 instrument were used for cleaning and assembling using CLC Genomics Workbench version 11.0. Illumina sequencing yielded about 10 million reads per sample. Reads were assembled into contigs with a de novo assembly model, and the contig sequences were then extracted for subsequent analysis. Partial genome sequences of five HCoV-NL63 strains were obtained by NGS methods. Meanwhile, sets of specific primer pairs were designed and used to amplify the gap region of HCoV-NL63, which was used for genome assemblies using the SeqMan subprogram of the DNAStar software version 7.1.0 with default parameters (Table 1). Finally, five complete genome sequences of HCoV-NL63 were obtained using next-generation sequencing and Sanger sequencing methods together and were designated strains ChinaGD01 (27,531 bp), ChinaGD02 (27,516 bp), ChinaGD03 (27,516 bp), ChinaGD04 (27,532 bp), and ChinaGD05 (27,544 bp). The five HCoV-NL63 strains presented here were aligned using MAFFT version 7.158 (8) and showed 98.5 to ∼99.1% nucleotide homology with the prototype HCoV-NL63 virus (GenBank accession number NC_005831.2) as estimated using MEGA version 5.10 software (9) (Fig. 1). TABLE 1 Primers used for the genome sequencing of HCoV-NL63 Primer Sequence (5′–3′) Target (nucleotide position) or amplification method Size (bp) 1F CCTGGCCTCTTGCTTTTTCACATGT 20504 1,686 1R ACTTCGACGGTTGAGAAACAAATAG 22189 1,686 2F CGCGTTAAGAGTGGTTCACCAGGTG 22059 1,623 2R CAAAGCTGCAAGCCGTCCAGTAATT 23681 1,623 3F TTCAATTCAAGCCGATCAACAAGTT 23624 1,600 3R GTCATCAATTAATCGAAGGAACATC 25223 1,600 4F CGAAGAGCCTGTTGTTGGTATAGTC 25153 1,690 4R AACACGCTTCCAACGAGGTTTCTTC 26849 1,690 5F CCAGGGCTGATAAGCCTTCTCAGTT 26800 754 5R GTGTATCCATATCAAAAACAATATC 27553 754 6F TGAGGATGTTTGTGTTTGTTTTGAC 18864 1,710 6R GTCAGGAACACCTAATTGTAACATA 20573 1,710 7F TGCGTGGTTGGTTGGGTATGGATGT 17234 1,682 7R ACGCTCATACGAACCCTGAATACTA 18915 1,682 8F ATTCAGCAACTGGTTCCTTAGATGT 15479 1,808 8R GTTATCGCCACAAACATGAGCACTT 17286 1,808 9F CTCCCTACTATGACACAGCTGAATC 14005 1,596 9R AGCCGCAAAGAGTCTAAGTGTATCT 15600 1,596 10F GACCGTACAACTATTCAAAGTGTTG 12398 1,659 10R GTTCTTTACCACTAATAGCATACTT 14056 1,659 11F GGGCTATGGCTAATGGTTATACAAG 9801 1,435 11R TTTGCGATATTCATGGCACGCTTCA 11235 1,435 12F ACCCTTCAGAGTGTTGCTTCATCAT 11090 1,378 12R AGTCGAGCTGCACTAGAACCCCTTG 12467 1,378 13F CAACCACTGTAACTAGCTTTCATGG 7758 2,103 13R CTGCCAAAATAGAATAGCACTCAAC 9860 2,103 14F GTCAAAAGGGTGATGCTGAAGAGGC 5424 2,394 14R TCAACTGACCATTCTCAATGTACTT 7817 2,394 15F TAGAGATGAATTGGGTGTTCGTGTT 3424 2,043 15R GGTCCAACATCACCTGTAACAAATT 5466 2,043 16F GCAGATGTTCCAGATGCTTTTCAAT 1637 1,864 16R GCAACTGTACAAGTGTGGTACTAAT 3500 1,864 17F CAGCAATTATGTTCTTCAGGACTTT 565 1,118 17R GTGTAAATGTGCGATAAACTGATTG 1682 1,118 18F CTTAAAGAATTTTTCTATCTATAGA 1 1,056 18R CATGCACCAACACTCCAACTCTCAG 1056 1,056 GSP 1 CGAAGAGCCTGTTGTTGGTATAGTC 3′ RACEa Unknown AP GGCCACGCGTCGACTAGTACTTTTTTTTTTTTTTTTT 3′ RACE Unknown GSP 2 CCAGGGCTGATAAGCCTTCTCAGTT Nested PCR Unknown AUAP GGCCACGCGTCGACTAGTAC Nested PCR Unknown AAP GGCCACGCGTCGACTAGTACGGGGGGGGGG 5′ RACE Unknown GSP 1 GTGTAAATGTGCGATAAACTGATTG 5′ RACE Unknown AUAP GGCCACGCGTCGACTAGTAC Nested PCR Unknown GSP 2 CATGCACCAACACTCCAACTCTCAG Nested PCR Unknown GSP3 CCATGGCCAAAAACAACATCAAAGT Nested PCR Unknown a RACE, rapid amplification of cDNA ends. FIG 1 Phylogenetic analysis of HCoV-NL63 based on complete genomes. The complete genomes of 69 coronavirus references were obtained from the GenBank database, and multiple alignments were performed using MAFFT version 7.158 with default parameters. The phylogenetic tree was constructed using the neighbor-joining method with 1,000 bootstraps in MEGA version 5.10 with default parameters. The numbers at the nodes represent bootstrap support. Bootstrap values greater than 70% were considered statistically significant for grouping. The HCoV-NL63 strains presented in this study are marked with red circles. Only two complete genome sequences of HCoV-NL63 associated with acute respiratory illness have been obtained and reported in China. The complete genome sequence data from our study will provide insight into the evolution and genetic diversity of HCoV-NL63 in China. Data availability. The complete genome sequences of the five newly identified HCoV-NL63 strains have been deposited in GenBank under the accession numbers MK334043, MK334044, MK334045, MK334046, and MK334047. The sequencing reads are available in the SRA database under BioProject accession number PRJNA601331. ACKNOWLEDGMENTS This research was supported by grants from the National Key Research and Development Program of China (2018YFC1200100), National Natural Science Foundation of China (NSFC 81702047, 81772191, 91842106, and 8181101118), State Key Laboratory of Respiratory Disease (SKLRD-QN-201715 and SKLRD-QN-201912), National Key Technology R&D Program (2018YFC1311900), Guangdong Science and Technology Foundation (2019B030316028), 2015 Thousand Talents Plan Award of China, China Postdoctoral Science Foundation, and the Ph.D. Start-up Fund of the Natural Science Foundation of Guangdong Province, China.

Document structure show

Annnotations TAB TSV DIC JSON TextAE

last updated at 2021-04-26 01:46:25 UTC

  • Denotations: 0
  • Blocks: 0
  • Relations: 0