CORD-19-Sentences  

CORD-19:fec0c97b9bdc012b76f082b8bcd6ba0efbb4f5c3 JSONTXT 8 Projects

Annnotations TAB TSV DIC JSON TextAE

Id Subject Object Predicate Lexical cue
TextSentencer_T1 0-90 Sentence denotes Viral gain-of-function experiments uncover residues under diversifying selection in nature
TextSentencer_T1 0-90 Sentence denotes Viral gain-of-function experiments uncover residues under diversifying selection in nature
TextSentencer_T2 92-100 Sentence denotes Abstract
TextSentencer_T2 92-100 Sentence denotes Abstract
TextSentencer_T3 101-244 Sentence denotes Viral gain-of-function mutations are commonly observed in the laboratory; however, it is unknown whether those mutations also evolve in nature.
TextSentencer_T3 101-244 Sentence denotes Viral gain-of-function mutations are commonly observed in the laboratory; however, it is unknown whether those mutations also evolve in nature.
TextSentencer_T4 245-447 Sentence denotes We identify two key residues in the host recognition protein of bacteriophage l that are necessary to exploit a new receptor; both residues repeatedly evolved among homologs from environmental samples.
TextSentencer_T4 245-447 Sentence denotes We identify two key residues in the host recognition protein of bacteriophage l that are necessary to exploit a new receptor; both residues repeatedly evolved among homologs from environmental samples.
TextSentencer_T5 448-600 Sentence denotes Our results provide evidence for widespread host-shift evolution in nature and a proof of concept for integrating experiments with genomic epidemiology.
TextSentencer_T5 448-600 Sentence denotes Our results provide evidence for widespread host-shift evolution in nature and a proof of concept for integrating experiments with genomic epidemiology.
TextSentencer_T6 601-727 Sentence denotes Many viruses can expand their host range with a few mutations 1-3 that enable the exploitation of new cellular receptors 2,3 .
TextSentencer_T6 601-727 Sentence denotes Many viruses can expand their host range with a few mutations 1-3 that enable the exploitation of new cellular receptors 2,3 .
TextSentencer_T7 728-1016 Sentence denotes Such mutations may be the first steps toward an epidemic outbreak; this observation has driven an expansion of theoretical 4 , experimental and surveillance studies of host-range shifts in emergent pathogens, including avian influenza 5-8 , coronaviruses 9,10 , HIV 11 and ebolavirus 12 .
TextSentencer_T7 728-1016 Sentence denotes Such mutations may be the first steps toward an epidemic outbreak; this observation has driven an expansion of theoretical 4 , experimental and surveillance studies of host-range shifts in emergent pathogens, including avian influenza 5-8 , coronaviruses 9,10 , HIV 11 and ebolavirus 12 .
TextSentencer_T8 1017-1144 Sentence denotes Ideally, laboratory evolution experiments could be used to accelerate our understanding of how viruses expand their host range.
TextSentencer_T8 1017-1144 Sentence denotes Ideally, laboratory evolution experiments could be used to accelerate our understanding of how viruses expand their host range.
TextSentencer_T9 1145-1347 Sentence denotes However, it is not clear whether viral evolution observed under the chemical and physical environments of a laboratory can faithfully inform us about viral evolution in nature, for at least two reasons.
TextSentencer_T9 1145-1347 Sentence denotes However, it is not clear whether viral evolution observed under the chemical and physical environments of a laboratory can faithfully inform us about viral evolution in nature, for at least two reasons.
TextSentencer_T10 1348-1477 Sentence denotes First, evolutionary trajectories might be sensitive to differences in environmental conditions between the laboratory and nature.
TextSentencer_T10 1348-1477 Sentence denotes First, evolutionary trajectories might be sensitive to differences in environmental conditions between the laboratory and nature.
TextSentencer_T11 1478-1657 Sentence denotes Second, the number of evolutionary paths sampled in laboratory experiments is very small compared to natural virus diversity due to the enormous size of viral All rights reserved.
TextSentencer_T11 1478-1657 Sentence denotes Second, the number of evolutionary paths sampled in laboratory experiments is very small compared to natural virus diversity due to the enormous size of viral All rights reserved.
TextSentencer_T12 1658-1694 Sentence denotes No reuse allowed without permission.
TextSentencer_T12 1658-1694 Sentence denotes No reuse allowed without permission.
TextSentencer_T13 1696-1708 Sentence denotes populations.
TextSentencer_T13 1696-1708 Sentence denotes populations.
TextSentencer_T14 1709-1969 Sentence denotes Indeed, some researchers have called for the suspension of virus gain-of-function laboratory experiments 13 on the grounds that they would tell us little about real-world viral evolution at the risk of constructing viral strains that are pandemic to new hosts.
TextSentencer_T14 1709-1969 Sentence denotes Indeed, some researchers have called for the suspension of virus gain-of-function laboratory experiments 13 on the grounds that they would tell us little about real-world viral evolution at the risk of constructing viral strains that are pandemic to new hosts.
TextSentencer_T15 1970-2252 Sentence denotes Here, we use a harmless virus, bacteriophage l, to demonstrate how gain-of-function experiments can identify mutations that mimic those that occur in nature: we find that two amino acid residues that are critical for gain of function in the laboratory recurrently evolve in nature.
TextSentencer_T15 1970-2252 Sentence denotes Here, we use a harmless virus, bacteriophage l, to demonstrate how gain-of-function experiments can identify mutations that mimic those that occur in nature: we find that two amino acid residues that are critical for gain of function in the laboratory recurrently evolve in nature.
TextSentencer_T16 2253-2458 Sentence denotes Typical laboratory strains of l infect Escherichia coli by binding to the outer membrane protein LamB 14 , but the phage rapidly evolves in the laboratory to exploit a different membrane protein, OmpF 3 .
TextSentencer_T16 2253-2458 Sentence denotes Typical laboratory strains of l infect Escherichia coli by binding to the outer membrane protein LamB 14 , but the phage rapidly evolves in the laboratory to exploit a different membrane protein, OmpF 3 .
TextSentencer_T17 2459-2587 Sentence denotes Since OmpF is not the usual E. coli receptor for l, these experiments are a proxy for the ability of the phage to switch hosts.
TextSentencer_T17 2459-2587 Sentence denotes Since OmpF is not the usual E. coli receptor for l, these experiments are a proxy for the ability of the phage to switch hosts.
TextSentencer_T18 2588-2717 Sentence denotes The evolved gain-of-function phenotype in l, OmpF + , involves multiple non-synonymous mutations in the host-recognition gene J.
TextSentencer_T18 2588-2717 Sentence denotes The evolved gain-of-function phenotype in l, OmpF + , involves multiple non-synonymous mutations in the host-recognition gene J.
TextSentencer_T19 2718-2843 Sentence denotes Each OmpF + isolate had between 4 and 10 single nucleotide substitutions in J, and none had insertions or deletions (indels).
TextSentencer_T19 2718-2843 Sentence denotes Each OmpF + isolate had between 4 and 10 single nucleotide substitutions in J, and none had insertions or deletions (indels).
TextSentencer_T20 2844-3026 Sentence denotes 97% of the substitutions in 24 independently evolved OmpF + l phage occurred in the J protein 3 between residues 960-1132, which we call the 'specificity region' of J ( Figure 1A ).
TextSentencer_T20 2844-3026 Sentence denotes 97% of the substitutions in 24 independently evolved OmpF + l phage occurred in the J protein 3 between residues 960-1132, which we call the 'specificity region' of J ( Figure 1A ).
TextSentencer_T21 3027-3271 Sentence denotes By comparing J among OmpF + and OmpF -l, Meyer et al. (2012) suggested that the OmpF + innovation required four mutations: one at residue 1012, two in the codon for residue 1107, and a fourth mutation somewhere between residues 990 to 1000 3 .
TextSentencer_T21 3027-3271 Sentence denotes By comparing J among OmpF + and OmpF -l, Meyer et al. (2012) suggested that the OmpF + innovation required four mutations: one at residue 1012, two in the codon for residue 1107, and a fourth mutation somewhere between residues 990 to 1000 3 .
TextSentencer_T22 3272-3487 Sentence denotes In this study, we directly tested this hypothesis by using Multiplexed Automated Genome Engineering (MAGE) 15 to construct two combinatorial genetic libraries of the J mutations that evolved in Meyer et al. (2012) .
TextSentencer_T22 3272-3487 Sentence denotes In this study, we directly tested this hypothesis by using Multiplexed Automated Genome Engineering (MAGE) 15 to construct two combinatorial genetic libraries of the J mutations that evolved in Meyer et al. (2012) .
TextSentencer_T23 3488-3615 Sentence denotes We constructed the first library by focusing on 10 commonly evolved J mutations 3 , from which we sequenced 33 OmpF + isolates.
TextSentencer_T23 3488-3615 Sentence denotes We constructed the first library by focusing on 10 commonly evolved J mutations 3 , from which we sequenced 33 OmpF + isolates.
TextSentencer_T24 3616-3811 Sentence denotes All strains possessed the target mutation at residue 1012 and both target mutations at residue 1107; by contrast, some strains lacked a fourth mutation between residues 990 and 1000 ( Figure 1 ).
TextSentencer_T24 3616-3811 Sentence denotes All strains possessed the target mutation at residue 1012 and both target mutations at residue 1107; by contrast, some strains lacked a fourth mutation between residues 990 and 1000 ( Figure 1 ).
TextSentencer_T25 3812-3886 Sentence denotes We call the mutations at residues 1012 and 1107 the "canonical mutations".
TextSentencer_T25 3812-3886 Sentence denotes We call the mutations at residues 1012 and 1107 the "canonical mutations".
TextSentencer_T26 3887-4040 Sentence denotes To test whether the three canonical mutations were sufficient to confer the OmpF + phenotype, we constructed a synthetic phage with just these mutations.
TextSentencer_T26 3887-4040 Sentence denotes To test whether the three canonical mutations were sufficient to confer the OmpF + phenotype, we constructed a synthetic phage with just these mutations.
TextSentencer_T27 4041-4252 Sentence denotes Even though the synthetic phage was viable, it proved unable to exploit cells without the ancestral LamB receptor, demonstrating that at least four J mutations were necessary for laboratory-evolved OmpF + phage.
TextSentencer_T27 4041-4252 Sentence denotes Even though the synthetic phage was viable, it proved unable to exploit cells without the ancestral LamB receptor, demonstrating that at least four J mutations were necessary for laboratory-evolved OmpF + phage.
TextSentencer_T28 4253-4449 Sentence denotes To find what further mutations might be needed to confer the OmpF + phenotype, we constructed a second MAGE library using the phage with the three canonical J mutations as the All rights reserved.
TextSentencer_T28 4253-4449 Sentence denotes To find what further mutations might be needed to confer the OmpF + phenotype, we constructed a second MAGE library using the phage with the three canonical J mutations as the All rights reserved.
TextSentencer_T29 4450-4486 Sentence denotes No reuse allowed without permission.
TextSentencer_T29 4450-4486 Sentence denotes No reuse allowed without permission.
TextSentencer_T30 4487-4746 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint baseline, and random combinations of 19 other J mutations found in the OmpF + l evolved by Meyer et al. (2012) .
TextSentencer_T30 4487-4746 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint baseline, and random combinations of 19 other J mutations found in the OmpF + l evolved by Meyer et al. (2012) .
TextSentencer_T31 4747-4805 Sentence denotes Screening this second library produced 88 OmpF + isolates.
TextSentencer_T31 4747-4805 Sentence denotes Screening this second library produced 88 OmpF + isolates.
TextSentencer_T32 4806-4943 Sentence denotes One OmpF + isolate had just a single extra mutation in amino acid position 1083 in addition to the three canonical mutations (Figure 1 ).
TextSentencer_T32 4806-4943 Sentence denotes One OmpF + isolate had just a single extra mutation in amino acid position 1083 in addition to the three canonical mutations (Figure 1 ).
TextSentencer_T33 4944-5101 Sentence denotes However, the majority of the OmpF + genotypes did not possess this specific mutation, signifying that its function could be substituted by other J mutations.
TextSentencer_T33 4944-5101 Sentence denotes However, the majority of the OmpF + genotypes did not possess this specific mutation, signifying that its function could be substituted by other J mutations.
TextSentencer_T34 5102-5348 Sentence denotes In total, this experiment revealed that four mutations are sufficient to evolve the innovation, but only two specific amino acid changes (at residues 1012 and 1107) are universally required to access OmpF in the context of laboratory experiments.
TextSentencer_T34 5102-5348 Sentence denotes In total, this experiment revealed that four mutations are sufficient to evolve the innovation, but only two specific amino acid changes (at residues 1012 and 1107) are universally required to access OmpF in the context of laboratory experiments.
TextSentencer_T35 5349-5479 Sentence denotes We then asked whether natural J sequences reflected the host-shift evolutionary dynamics seen in our gain-of-function experiments.
TextSentencer_T35 5349-5479 Sentence denotes We then asked whether natural J sequences reflected the host-shift evolutionary dynamics seen in our gain-of-function experiments.
TextSentencer_T36 5480-5599 Sentence denotes We collected and aligned full-length homologous J protein sequences from UniRef100 16 (1,207 highly similar sequences).
TextSentencer_T36 5480-5599 Sentence denotes We collected and aligned full-length homologous J protein sequences from UniRef100 16 (1,207 highly similar sequences).
TextSentencer_T37 5600-5789 Sentence denotes Most sequences were prophage uncovered in the genomes of their Enterobacteriaceae hosts, including bacterial genera Escherichia, Salmonella, Citrobacter, Edwardsiella, and even Cronobacter.
TextSentencer_T37 5600-5789 Sentence denotes Most sequences were prophage uncovered in the genomes of their Enterobacteriaceae hosts, including bacterial genera Escherichia, Salmonella, Citrobacter, Edwardsiella, and even Cronobacter.
TextSentencer_T38 5790-5894 Sentence denotes Recall that 97% of substitutions in OmpF + gain-of-function experiments occur in the specificity region.
TextSentencer_T38 5790-5894 Sentence denotes Recall that 97% of substitutions in OmpF + gain-of-function experiments occur in the specificity region.
TextSentencer_T39 5895-5964 Sentence denotes Likewise, the natural J homologs had disproportionate variation here:
TextSentencer_T39 5895-5964 Sentence denotes Likewise, the natural J homologs had disproportionate variation here:
TextSentencer_T40 5965-6101 Sentence denotes 30% of the total amino acid variation occurred in the specificity region, despite only being 15% of the total length of J ( Figure 2A ).
TextSentencer_T40 5965-6101 Sentence denotes 30% of the total amino acid variation occurred in the specificity region, despite only being 15% of the total length of J ( Figure 2A ).
TextSentencer_T41 6102-6262 Sentence denotes This nonrandom clustering of variation in the specificity region strongly suggests that J has experienced substantial diversifying selection on host attachment.
TextSentencer_T41 6102-6262 Sentence denotes This nonrandom clustering of variation in the specificity region strongly suggests that J has experienced substantial diversifying selection on host attachment.
TextSentencer_T42 6263-6590 Sentence denotes Furthermore, the 17 residues engineered into the MAGE libraries were significantly more variable than randomly chosen groups of 17 residues from J (non-parametric bootstrap: p < 10 -5 ) and from the specificity region 960-1132 (non-parametric bootstrap: p = 0.0054) showing the experiments had identified evolutionary hotspots.
TextSentencer_T42 6263-6590 Sentence denotes Furthermore, the 17 residues engineered into the MAGE libraries were significantly more variable than randomly chosen groups of 17 residues from J (non-parametric bootstrap: p < 10 -5 ) and from the specificity region 960-1132 (non-parametric bootstrap: p = 0.0054) showing the experiments had identified evolutionary hotspots.
TextSentencer_T43 6591-6854 Sentence denotes However, the specific 17 amino acid substitutions evolved in the laboratory were not common in natural homologs suggesting that the selection experiments had the resolution to predict where changes would evolve, but not the exact change (Supplementary Figure 1) .
TextSentencer_T43 6591-6854 Sentence denotes However, the specific 17 amino acid substitutions evolved in the laboratory were not common in natural homologs suggesting that the selection experiments had the resolution to predict where changes would evolve, but not the exact change (Supplementary Figure 1) .
TextSentencer_T44 6855-7123 Sentence denotes Focusing in on the two residues critical for the OmpF + gain of function, 1012 and 1107, we find that they alone are more variable than random pairs of sites in J (non-parametric bootstrap: p = 0.00101) and the specificity region (non-parametric bootstrap: p = 0.036).
TextSentencer_T44 6855-7123 Sentence denotes Focusing in on the two residues critical for the OmpF + gain of function, 1012 and 1107, we find that they alone are more variable than random pairs of sites in J (non-parametric bootstrap: p = 0.00101) and the specificity region (non-parametric bootstrap: p = 0.036).
TextSentencer_T45 7124-7281 Sentence denotes But what is more remarkable is the observation that in-frame indels are common in the regions around sites 1012 and 1107 ( Figure 2B ; Supplementary Data 1).
TextSentencer_T45 7124-7281 Sentence denotes But what is more remarkable is the observation that in-frame indels are common in the regions around sites 1012 and 1107 ( Figure 2B ; Supplementary Data 1).
TextSentencer_T46 7282-7424 Sentence denotes We measured indel variation over J homologs using gap entropy: a two-state entropy counting each position in each aligned All rights reserved.
TextSentencer_T46 7282-7424 Sentence denotes We measured indel variation over J homologs using gap entropy: a two-state entropy counting each position in each aligned All rights reserved.
TextSentencer_T47 7425-7461 Sentence denotes No reuse allowed without permission.
TextSentencer_T47 7425-7461 Sentence denotes No reuse allowed without permission.
TextSentencer_T48 7462-7552 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T48 7462-7552 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T49 7553-7719 Sentence denotes To analyze J protein evolutionary dynamics in more depth, we built maximum-likelihood phylogenetic trees for J ( Figure 2C ) and its specificity region ( Figure 2D ).
TextSentencer_T49 7553-7719 Sentence denotes To analyze J protein evolutionary dynamics in more depth, we built maximum-likelihood phylogenetic trees for J ( Figure 2C ) and its specificity region ( Figure 2D ).
TextSentencer_T50 7720-7940 Sentence denotes The trees are very different (normalized Robinson-Foulds distance = 0.94 out of 1.00), indicating that recombination has caused the history of the specificity region to differ from the history of the rest of the protein.
TextSentencer_T50 7720-7940 Sentence denotes The trees are very different (normalized Robinson-Foulds distance = 0.94 out of 1.00), indicating that recombination has caused the history of the specificity region to differ from the history of the rest of the protein.
TextSentencer_T51 7941-8080 Sentence denotes This means that the specificity region is an evolutionary module that commonly recombines and circulates as a unit in the phage population.
TextSentencer_T51 7941-8080 Sentence denotes This means that the specificity region is an evolutionary module that commonly recombines and circulates as a unit in the phage population.
TextSentencer_T52 8081-8187 Sentence denotes This observation supports the notion that this region has elevated rates of evolution and diversification.
TextSentencer_T52 8081-8187 Sentence denotes This observation supports the notion that this region has elevated rates of evolution and diversification.
TextSentencer_T53 8188-8290 Sentence denotes Using the second phylogeny, we calculated site-specific evolutionary rates for the specificity region.
TextSentencer_T53 8188-8290 Sentence denotes Using the second phylogeny, we calculated site-specific evolutionary rates for the specificity region.
TextSentencer_T54 8291-8602 Sentence denotes The 17 residues studied in the MAGE experiments evolve faster than equallysized random samples taken from the specificity region (non-parametric bootstrap, p = 0.0067) and residues 1012 and 1107 evolve faster than random pairs of sites sampled from the specificity region (non-parametric bootstrap, p = 0.0073).
TextSentencer_T54 8291-8602 Sentence denotes The 17 residues studied in the MAGE experiments evolve faster than equallysized random samples taken from the specificity region (non-parametric bootstrap, p = 0.0067) and residues 1012 and 1107 evolve faster than random pairs of sites sampled from the specificity region (non-parametric bootstrap, p = 0.0073).
TextSentencer_T55 8603-8764 Sentence denotes Together, the accelerated rate of change and increased entropy at residues 1012 and 1107 suggest that these sites have experienced strong diversifying selection.
TextSentencer_T55 8603-8764 Sentence denotes Together, the accelerated rate of change and increased entropy at residues 1012 and 1107 suggest that these sites have experienced strong diversifying selection.
TextSentencer_T56 8765-8956 Sentence denotes Our combinatorial genetic studies showed that these particular residues determine receptor tropism, so it is reasonable to conclude that their unique evolution is due to host-range evolution.
TextSentencer_T56 8765-8956 Sentence denotes Our combinatorial genetic studies showed that these particular residues determine receptor tropism, so it is reasonable to conclude that their unique evolution is due to host-range evolution.
TextSentencer_T57 8957-9125 Sentence denotes Mathematical theory has demonstrated that receptor-use evolution should lead to diversification since accessing new host types alters the phages' ecological niches 19 .
TextSentencer_T57 8957-9125 Sentence denotes Mathematical theory has demonstrated that receptor-use evolution should lead to diversification since accessing new host types alters the phages' ecological niches 19 .
TextSentencer_T58 9126-9264 Sentence denotes Indeed, diversification was observed in a related experiment where l evolved to exploit two host cell types with different receptors 20 .
TextSentencer_T58 9126-9264 Sentence denotes Indeed, diversification was observed in a related experiment where l evolved to exploit two host cell types with different receptors 20 .
TextSentencer_T59 9265-9390 Sentence denotes To test whether indels at 1012 and 1107 cause diversification, we compared the branches where indels occur versus all others.
TextSentencer_T59 9265-9390 Sentence denotes To test whether indels at 1012 and 1107 cause diversification, we compared the branches where indels occur versus all others.
TextSentencer_T60 9391-9574 Sentence denotes If the indels cause ecological differentiation, then they should reduce intraspecific competition for hosts and facilitate the long-term maintenance of distinct evolutionary lineages.
TextSentencer_T60 9391-9574 Sentence denotes If the indels cause ecological differentiation, then they should reduce intraspecific competition for hosts and facilitate the long-term maintenance of distinct evolutionary lineages.
TextSentencer_T61 9575-9668 Sentence denotes Indeed, the branches on which indels occur are significantly longer than All rights reserved.
TextSentencer_T61 9575-9668 Sentence denotes Indeed, the branches on which indels occur are significantly longer than All rights reserved.
TextSentencer_T62 9669-9705 Sentence denotes No reuse allowed without permission.
TextSentencer_T62 9669-9705 Sentence denotes No reuse allowed without permission.
TextSentencer_T63 9706-10032 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint the other branches of the specificity-region phylogeny (Kruskal-Wallis test, p < 10 -8 ; visualized by the discrete indel clades colored in lavender and light green in Figure 2D ).
TextSentencer_T63 9706-10032 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint the other branches of the specificity-region phylogeny (Kruskal-Wallis test, p < 10 -8 ; visualized by the discrete indel clades colored in lavender and light green in Figure 2D ).
TextSentencer_T64 10033-10329 Sentence denotes The congruence we find between laboratory and natural evolution in l contrasts with work showing that beneficial mutations in Richard Lenski's long-term experiment anti- Together, these studies show that selection experiments on viruses cultured in the laboratory can inform evolution in nature.
TextSentencer_T64 10033-10329 Sentence denotes The congruence we find between laboratory and natural evolution in l contrasts with work showing that beneficial mutations in Richard Lenski's long-term experiment anti- Together, these studies show that selection experiments on viruses cultured in the laboratory can inform evolution in nature.
TextSentencer_T65 10330-10482 Sentence denotes Based on the patterns of J sequence variation observed, we suggest that host-range evolution is common in this group of viruses, and perhaps others too.
TextSentencer_T65 10330-10482 Sentence denotes Based on the patterns of J sequence variation observed, we suggest that host-range evolution is common in this group of viruses, and perhaps others too.
TextSentencer_T66 10483-10613 Sentence denotes While the frequency of host-range evolution may be unsettling, our work also demonstrates potential methods to combat host shifts.
TextSentencer_T66 10483-10613 Sentence denotes While the frequency of host-range evolution may be unsettling, our work also demonstrates potential methods to combat host shifts.
TextSentencer_T67 10614-10794 Sentence denotes In particular, worrisome mutations can be identified with functional genetic experiments as described here or with other laboratory techniques such as deep mutational scanning 23 .
TextSentencer_T67 10614-10794 Sentence denotes In particular, worrisome mutations can be identified with functional genetic experiments as described here or with other laboratory techniques such as deep mutational scanning 23 .
TextSentencer_T68 10795-10965 Sentence denotes This information can be combined with genomic surveillance efforts underway 24,25 to devise more effective disease management strategies to eradicate problematic strains.
TextSentencer_T68 10795-10965 Sentence denotes This information can be combined with genomic surveillance efforts underway 24,25 to devise more effective disease management strategies to eradicate problematic strains.
TextSentencer_T69 10966-11119 Sentence denotes We modified λ strain cI857 (provided by Ing-Nang Wang, SUNY Albany) integrated into the genome of HWEC106 (provided by Harris Wang, Columbia University).
TextSentencer_T69 10966-11119 Sentence denotes We modified λ strain cI857 (provided by Ing-Nang Wang, SUNY Albany) integrated into the genome of HWEC106 (provided by Harris Wang, Columbia University).
TextSentencer_T70 11120-11199 Sentence denotes We engineered the J substitutions into λ by using MAGE 15,26 on strain HWEC106.
TextSentencer_T70 11120-11199 Sentence denotes We engineered the J substitutions into λ by using MAGE 15,26 on strain HWEC106.
TextSentencer_T71 11200-11276 Sentence denotes MAGE uses the λ-red recombineering system provided on the pKD46 plasmid 27 .
TextSentencer_T71 11200-11276 Sentence denotes MAGE uses the λ-red recombineering system provided on the pKD46 plasmid 27 .
TextSentencer_T72 11277-11343 Sentence denotes For a description of the oligos used, see Supplementary Table S1 .
TextSentencer_T72 11277-11343 Sentence denotes For a description of the oligos used, see Supplementary Table S1 .
TextSentencer_T73 11344-11364 Sentence denotes All rights reserved.
TextSentencer_T73 11344-11364 Sentence denotes All rights reserved.
TextSentencer_T74 11365-11401 Sentence denotes No reuse allowed without permission.
TextSentencer_T74 11365-11401 Sentence denotes No reuse allowed without permission.
TextSentencer_T75 11402-11647 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint For the first, 10-mutation library, we ran 18 rounds of MAGE and then screened for OmpF + isolates.
TextSentencer_T75 11402-11647 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint For the first, 10-mutation library, we ran 18 rounds of MAGE and then screened for OmpF + isolates.
TextSentencer_T76 11648-11768 Sentence denotes For the second library, we edited λ with oligos 'a3034g' and 'g3319a t3321a' to introduce the canonical three mutations.
TextSentencer_T76 11648-11768 Sentence denotes For the second library, we edited λ with oligos 'a3034g' and 'g3319a t3321a' to introduce the canonical three mutations.
TextSentencer_T77 11769-11884 Sentence denotes Next, we performed a number of different MAGE trials in order to maximize the number of unique alleles we observed.
TextSentencer_T77 11769-11884 Sentence denotes Next, we performed a number of different MAGE trials in order to maximize the number of unique alleles we observed.
TextSentencer_T78 11885-11934 Sentence denotes See Supplementary Table S2 for our MAGE strategy.
TextSentencer_T78 11885-11934 Sentence denotes See Supplementary Table S2 for our MAGE strategy.
TextSentencer_T79 11935-12113 Sentence denotes To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 .
TextSentencer_T79 11935-12113 Sentence denotes To screen the edited phage for OmpF + genotypes, we induced the MAGE lysogen libraries and plated the phage on lawns of lamB − E. coli strain JW3996 from the KEIO collection 28 .
TextSentencer_T80 12114-12240 Sentence denotes Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility.
TextSentencer_T80 12114-12240 Sentence denotes Plaques were picked from the lawns and the C-terminus of the J gene was Sanger sequenced at the Genewiz La Jolla, CA facility.
TextSentencer_T81 12241-12281 Sentence denotes Unpurified PCR products (Forward primer:
TextSentencer_T81 12241-12281 Sentence denotes Unpurified PCR products (Forward primer:
TextSentencer_T82 12282-12322 Sentence denotes 5' CGCATCGTTCACCTCTCACT; Reverse primer:
TextSentencer_T82 12282-12322 Sentence denotes 5' CGCATCGTTCACCTCTCACT; Reverse primer:
TextSentencer_T83 12323-12364 Sentence denotes 5' CCTGCGGGCGGTTTGTCATTT) were submitted.
TextSentencer_T83 12323-12364 Sentence denotes 5' CCTGCGGGCGGTTTGTCATTT) were submitted.
TextSentencer_T84 12365-12726 Sentence denotes We used the evcouplings pipeline 29 to generate a jackhmmer 30 alignment of 1,207 fulllength J homologs (parameter settings: bitscore = 0.2 ; theta = 0.999; seqid_filter = 95 and 99 (thresholds for filtering highly similar sequences); minimum_sequence_coverage = 99 (require sequences to align to 99% of wild-type J protein); and minimum_sequence_coverage = 50.
TextSentencer_T84 12365-12726 Sentence denotes We used the evcouplings pipeline 29 to generate a jackhmmer 30 alignment of 1,207 fulllength J homologs (parameter settings: bitscore = 0.2 ; theta = 0.999; seqid_filter = 95 and 99 (thresholds for filtering highly similar sequences); minimum_sequence_coverage = 99 (require sequences to align to 99% of wild-type J protein); and minimum_sequence_coverage = 50.
TextSentencer_T85 12727-12854 Sentence denotes When analyzing the specificity region (say, constructing a phylogeny), we used residues 960-1132 of this full-length alignment.
TextSentencer_T85 12727-12854 Sentence denotes When analyzing the specificity region (say, constructing a phylogeny), we used residues 960-1132 of this full-length alignment.
TextSentencer_T86 12855-13012 Sentence denotes We used RAxML 31 to generate maximum-likelihood phylogenies using automatically selected amino acid substitution matrices (PROTGAMMAAUTO) based on model fit.
TextSentencer_T86 12855-13012 Sentence denotes We used RAxML 31 to generate maximum-likelihood phylogenies using automatically selected amino acid substitution matrices (PROTGAMMAAUTO) based on model fit.
TextSentencer_T87 13013-13185 Sentence denotes To account for recombination when estimating site-specific evolutionary rates in the specificity region, we first ran a modified SBP algorithm 32 on the specificity region.
TextSentencer_T87 13013-13185 Sentence denotes To account for recombination when estimating site-specific evolutionary rates in the specificity region, we first ran a modified SBP algorithm 32 on the specificity region.
TextSentencer_T88 13186-13335 Sentence denotes We found a putative recombination breakpoint at residue 1000, supported by Akaike's information criterion but not the Bayesian information criterion.
TextSentencer_T88 13186-13335 Sentence denotes We found a putative recombination breakpoint at residue 1000, supported by Akaike's information criterion but not the Bayesian information criterion.
TextSentencer_T89 13336-13496 Sentence denotes We therefore partitioned the specificity region at residue 1000 and re-calculated trees for each partition using FastTree 33 with an LG substitution matrix 34 .
TextSentencer_T89 13336-13496 Sentence denotes We therefore partitioned the specificity region at residue 1000 and re-calculated trees for each partition using FastTree 33 with an LG substitution matrix 34 .
TextSentencer_T90 13497-13684 Sentence denotes We next calculated site-specific evolutionary rates with LEISR 35 , a scalable implementation of Rate4Site 36 that accounts for recombination breakpoints, using an LG substitution matrix.
TextSentencer_T90 13497-13684 Sentence denotes We next calculated site-specific evolutionary rates with LEISR 35 , a scalable implementation of Rate4Site 36 that accounts for recombination breakpoints, using an LG substitution matrix.
TextSentencer_T91 13685-13801 Sentence denotes We calculated the Robinson-Foulds distance between our maximum-likelihood phylogenies for J and All rights reserved.
TextSentencer_T91 13685-13801 Sentence denotes We calculated the Robinson-Foulds distance between our maximum-likelihood phylogenies for J and All rights reserved.
TextSentencer_T92 13802-13838 Sentence denotes No reuse allowed without permission.
TextSentencer_T92 13802-13838 Sentence denotes No reuse allowed without permission.
TextSentencer_T93 13839-14031 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint its specificity region using ete3-compare 37 .
TextSentencer_T93 13839-14031 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint its specificity region using ete3-compare 37 .
TextSentencer_T94 14032-14160 Sentence denotes We divided the Robinson-Foulds distance (2276.00) by its maximum possible value (2412.00) to get the normalized distance (0.94).
TextSentencer_T94 14032-14160 Sentence denotes We divided the Robinson-Foulds distance (2276.00) by its maximum possible value (2412.00) to get the normalized distance (0.94).
TextSentencer_T95 14161-14207 Sentence denotes We calculated gap entropy at each position as:
TextSentencer_T95 14161-14207 Sentence denotes We calculated gap entropy at each position as:
TextSentencer_T96 14208-14331 Sentence denotes where p is the frequency of gap characters at that position, and 1 -p is the frequency of all amino acids at that position.
TextSentencer_T96 14208-14331 Sentence denotes where p is the frequency of gap characters at that position, and 1 -p is the frequency of all amino acids at that position.
TextSentencer_T97 14332-14453 Sentence denotes For all non-parametric bootstrap calculations, we used 100,000 bootstraps, and chose groups of sites without replacement.
TextSentencer_T97 14332-14453 Sentence denotes For all non-parametric bootstrap calculations, we used 100,000 bootstraps, and chose groups of sites without replacement.
TextSentencer_T98 14454-14654 Sentence denotes For example, when testing for high entropy in the 17 MAGE residues, we generated an empirical null distribution by randomly choosing 17 different residues for one sample, and resampling 100,000 times.
TextSentencer_T98 14454-14654 Sentence denotes For example, when testing for high entropy in the 17 MAGE residues, we generated an empirical null distribution by randomly choosing 17 different residues for one sample, and resampling 100,000 times.
TextSentencer_T99 14655-14714 Sentence denotes We used the same procedure for our evolutionary-rate tests.
TextSentencer_T99 14655-14714 Sentence denotes We used the same procedure for our evolutionary-rate tests.
TextSentencer_T100 14715-14982 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint Amino acid and nucleotide changes are indicated by positions bookended by the wild-type state and then the evolved state.
TextSentencer_T100 14715-14982 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint Amino acid and nucleotide changes are indicated by positions bookended by the wild-type state and then the evolved state.
TextSentencer_T101 14983-15049 Sentence denotes Amino acids in position 997 and 1107 have multiple derived states.
TextSentencer_T101 14983-15049 Sentence denotes Amino acids in position 997 and 1107 have multiple derived states.
TextSentencer_T102 15050-15070 Sentence denotes All rights reserved.
TextSentencer_T102 15050-15070 Sentence denotes All rights reserved.
TextSentencer_T103 15071-15107 Sentence denotes No reuse allowed without permission.
TextSentencer_T103 15071-15107 Sentence denotes No reuse allowed without permission.
TextSentencer_T104 15108-15330 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint OTUs have at least 5% divergence from each other, and are labeled as in (C).
TextSentencer_T104 15108-15330 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint OTUs have at least 5% divergence from each other, and are labeled as in (C).
TextSentencer_T105 15331-15351 Sentence denotes All rights reserved.
TextSentencer_T105 15331-15351 Sentence denotes All rights reserved.
TextSentencer_T106 15352-15388 Sentence denotes No reuse allowed without permission.
TextSentencer_T106 15352-15388 Sentence denotes No reuse allowed without permission.
TextSentencer_T107 15389-15610 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint Supplementary Table S1 | Oligonucleotides (oligos) used to edit l genomes.
TextSentencer_T107 15389-15610 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint Supplementary Table S1 | Oligonucleotides (oligos) used to edit l genomes.
TextSentencer_T108 15611-15675 Sentence denotes Oligos were designed slightly differently for the two libraries.
TextSentencer_T108 15611-15675 Sentence denotes Oligos were designed slightly differently for the two libraries.
TextSentencer_T109 15676-15740 Sentence denotes For the first, we inserted a synonymous change near each target.
TextSentencer_T109 15676-15740 Sentence denotes For the first, we inserted a synonymous change near each target.
TextSentencer_T110 15741-15837 Sentence denotes This was done as a silent tag to improve our confidence that an edit had been made successfully.
TextSentencer_T110 15741-15837 Sentence denotes This was done as a silent tag to improve our confidence that an edit had been made successfully.
TextSentencer_T111 15838-15982 Sentence denotes We did not do this for the second library because we found that all intentional nonsynonymous changes were accompanied by the synonymous change.
TextSentencer_T111 15838-15982 Sentence denotes We did not do this for the second library because we found that all intentional nonsynonymous changes were accompanied by the synonymous change.
TextSentencer_T112 15983-16125 Sentence denotes Additionally, for the first library, when mutations fell within 90 bases, we designed a separate oligo for each possible mutation combination.
TextSentencer_T112 15983-16125 Sentence denotes Additionally, for the first library, when mutations fell within 90 bases, we designed a separate oligo for each possible mutation combination.
TextSentencer_T113 16126-16239 Sentence denotes For the second library, we ordered a mixed pool of oligos synthesized that had all combinations of the mutations.
TextSentencer_T113 16126-16239 Sentence denotes For the second library, we ordered a mixed pool of oligos synthesized that had all combinations of the mutations.
TextSentencer_T114 16240-16283 Sentence denotes Asterisks indicate phosphorothioated bases.
TextSentencer_T114 16240-16283 Sentence denotes Asterisks indicate phosphorothioated bases.
TextSentencer_T115 16284-16304 Sentence denotes All rights reserved.
TextSentencer_T115 16284-16304 Sentence denotes All rights reserved.
TextSentencer_T116 16305-16341 Sentence denotes No reuse allowed without permission.
TextSentencer_T116 16305-16341 Sentence denotes No reuse allowed without permission.
TextSentencer_T117 16342-16432 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T117 16342-16432 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T118 16433-16523 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T118 16433-16523 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T119 16524-16614 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T119 16524-16614 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T120 16615-16705 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T120 16615-16705 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder.
TextSentencer_T121 16706-16851 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint
TextSentencer_T121 16706-16851 Sentence denotes The copyright holder for this preprint (which was not peer-reviewed) is the author/funder. . https://doi.org/10.1101/242495 doi: bioRxiv preprint