| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T133 |
0-4 |
Sentence |
denotes |
4.1. |
| T134 |
5-43 |
Sentence |
denotes |
Construction of the Expression Plasmid |
| T135 |
44-331 |
Sentence |
denotes |
A bicistronic operon for the simultaneous expression of human Tα1 (UniProt P06454, residues 2–29) and the E. coli N-acetyltransferase RimJ (UniProt P0A948) flanked by the restriction sites NdeI and HindIII was prepared using gene synthesis (Thermofisher Scientific, Regensburg, Germany). |
| T136 |
332-672 |
Sentence |
denotes |
To this end, the coding sequence of human Tα1 was codon-optimized for expression in E. coli and linked to the RimJ structural gene via the nucleotide sequence GCCTGAAGAGCAGAAAATAAA comprising a “GCC” alanine codon, the opal stop codon “TGA”, a SapI restriction site for insertion of the PAS gene cassette, and a ribosome-binding site (RBS). |
| T137 |
673-852 |
Sentence |
denotes |
The entire gene fragment was subcloned via NdeI and HindIII on a derivative of pASK75 [36] for cytoplasmic expression under control of the tetracycline promoter/operator (tetp/o). |
| T138 |
853-1143 |
Sentence |
denotes |
Subsequently, a substantially non-repetitive sequence-verified PAS gene cassette [34] encoding a PAS#1 polypeptide of 601 amino acids was inserted via the SapI restriction site to create the expression vector for the C-terminally PASylated thymosin α1 (Tα1-PAS), pASK75-Tα1-PAS#1(600)/RimJ. |
| T139 |
1144-1406 |
Sentence |
denotes |
To construct a plasmid for the bacterial production of an N-terminally PASylated Tα1 (PAS-Tα1), the synthetic gene of human Tα1 was amplified via PCR using the primers THY-For (5’-AGCTCTTCTGCCAGTGATGCAGCAGTTGATACC) and THY-Rev (5’-GCTCAAGCTTAGTTCTCGGCTTCTTCCAC). |
| T140 |
1407-1609 |
Sentence |
denotes |
The PCR product was digested with SapI and HindIII and inserted via these restriction sites downstream of the PAS#1(600) sequence preceded by Met and Pro encoded on a suitable pASK75 plasmid derivative. |
