4.1. Construction of the Expression Plasmid
A bicistronic operon for the simultaneous expression of human Tα1 (UniProt P06454, residues 2–29) and the E. coli N-acetyltransferase RimJ (UniProt P0A948) flanked by the restriction sites NdeI and HindIII was prepared using gene synthesis (Thermofisher Scientific, Regensburg, Germany). To this end, the coding sequence of human Tα1 was codon-optimized for expression in E. coli and linked to the RimJ structural gene via the nucleotide sequence GCCTGAAGAGCAGAAAATAAA comprising a “GCC” alanine codon, the opal stop codon “TGA”, a SapI restriction site for insertion of the PAS gene cassette, and a ribosome-binding site (RBS). The entire gene fragment was subcloned via NdeI and HindIII on a derivative of pASK75 [36] for cytoplasmic expression under control of the tetracycline promoter/operator (tetp/o). Subsequently, a substantially non-repetitive sequence-verified PAS gene cassette [34] encoding a PAS#1 polypeptide of 601 amino acids was inserted via the SapI restriction site to create the expression vector for the C-terminally PASylated thymosin α1 (Tα1-PAS), pASK75-Tα1-PAS#1(600)/RimJ. To construct a plasmid for the bacterial production of an N-terminally PASylated Tα1 (PAS-Tα1), the synthetic gene of human Tα1 was amplified via PCR using the primers THY-For (5’-AGCTCTTCTGCCAGTGATGCAGCAGTTGATACC) and THY-Rev (5’-GCTCAAGCTTAGTTCTCGGCTTCTTCCAC). The PCR product was digested with SapI and HindIII and inserted via these restriction sites downstream of the PAS#1(600) sequence preceded by Met and Pro encoded on a suitable pASK75 plasmid derivative.