> top > docs > PMC:6988269 > spans > 6607-7510 > annotations

PMC:6988269 / 6607-7510 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T16 59-63 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T17 501-505 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T18 709-713 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T14 217-221 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T15 358-366 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T16 358-362 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T17 375-379 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T54 59-63 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T55 138-140 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T56 263-265 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T57 277-279 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T58 317-320 http://purl.obolibrary.org/obo/NCBITaxon_9596 denotes Pan
T59 371-374 http://purl.obolibrary.org/obo/NCBITaxon_9397 denotes bat
T60 430-432 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T61 501-505 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T62 709-713 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T19 11-26 Chemical denotes Oligonucleotide http://purl.obolibrary.org/obo/CHEBI_7754
T20 138-140 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T21 263-265 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T22 277-279 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T23 430-432 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T10 54-58 http://purl.obolibrary.org/obo/GO_0003968 denotes RdRP

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T48 0-53 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 54-126 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 127-265 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 266-432 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 433-498 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 499-571 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 572-645 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 646-706 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 707-772 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 773-844 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 845-903 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
125 421-424 Gene denotes mix Gene:83881
126 254-257 Gene denotes mix Gene:83881
127 190-199 Species denotes 2019-nCoV Tax:2697049
128 217-225 Species denotes SARS-CoV Tax:694009
129 347-356 Species denotes 2019-nCoV Tax:2697049
130 358-366 Species denotes SARS-CoV Tax:694009
131 375-392 Species denotes SARS-related CoVs Tax:694009