> top > docs > PMC:6988269 > spans > 6534-7844 > annotations

PMC:6988269 / 6534-7844 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T16 132-136 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T17 574-578 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T18 782-786 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T19 1006-1010 Body_part denotes C; S http://purl.org/sig/ont/fma/fma284995

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T14 290-294 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T15 431-439 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T16 431-435 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091
T17 448-452 Disease denotes SARS http://purl.obolibrary.org/obo/MONDO_0005091

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T54 132-136 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T55 211-213 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T56 336-338 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T57 350-352 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T58 390-393 http://purl.obolibrary.org/obo/NCBITaxon_9596 denotes Pan
T59 444-447 http://purl.obolibrary.org/obo/NCBITaxon_9397 denotes bat
T60 503-505 http://purl.obolibrary.org/obo/CLO_0008307 denotes P2
T61 574-578 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T62 782-786 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T63 977-978 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T64 984-985 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T65 996-997 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T66 1004-1005 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T67 1072-1073 http://purl.obolibrary.org/obo/CLO_0001021 denotes b
T68 1183-1187 http://purl.obolibrary.org/obo/CLO_0001550 denotes a 10
T69 1252-1253 http://purl.obolibrary.org/obo/CLO_0001020 denotes a

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T19 84-99 Chemical denotes Oligonucleotide http://purl.obolibrary.org/obo/CHEBI_7754
T20 211-213 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T21 336-338 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T22 350-352 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T23 503-505 Chemical denotes P2 http://purl.obolibrary.org/obo/CHEBI_33472
T24 1024-1044 Chemical denotes 6-carboxyfluorescein http://purl.obolibrary.org/obo/CHEBI_39073
T25 1204-1212 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T10 127-131 http://purl.obolibrary.org/obo/GO_0003968 denotes RdRP

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T47 0-72 Sentence denotes Table 1 Primers and probes, real-time RT-PCR for 2019 novel coronavirus
T48 73-126 Sentence denotes Assay/use Oligonucleotide Sequencea Concentrationb
T49 127-199 Sentence denotes RdRP gene RdRp_SARSr-F GTGARATGGTCATGTGTGGCGG Use 600 nM per reaction
T50 200-338 Sentence denotes RdRp_SARSr-P2 FAM-CAGGTGGAACCTCATCAGGAGATGC-BBQ Specific for 2019-nCoV, will not detect SARS-CoV.Use 100 nM per reaction and mix with P1
T51 339-505 Sentence denotes RdRP_SARSr-P1 FAM-CCAGGTGGWACRTCATCMGGTGATGC-BBQ Pan Sarbeco-Probe will detect 2019-nCoV, SARS-CoV and bat-SARS-related CoVs.Use 100 nM per reaction and mix with P2
T52 506-571 Sentence denotes RdRp_SARSr-R CARATGTTAAASACACTATTAGCATA Use 800 nM per reaction
T53 572-644 Sentence denotes E gene E_Sarbeco_F ACAGGTACGTTAATAGTTAATAGCGT Use 400 nm per reaction
T54 645-718 Sentence denotes E_Sarbeco_P1 FAM-ACACTAGCCATCCTTACTGCGCTTCG-BBQ Use 200 nm per reaction
T55 719-779 Sentence denotes E_Sarbeco_R ATATTGCAGCAGTACGCACACA Use 400 nm per reaction
T56 780-845 Sentence denotes N gene N_Sarbeco_F CACATTGGCACCCGCAATC Use 600 nm per reaction
T57 846-917 Sentence denotes N_Sarbeco_P FAM-ACTTCCTCAAGGAACAACATTGCCA-BBQ Use 200 nm per reaction
T58 918-976 Sentence denotes N_Sarbeco_R GAGGAACGAGAAGAGGCTTG Use 800 nm per reaction
T59 977-1018 Sentence denotes a W is A/T; R is G/A; M is A/C; S is G/C.
T60 1019-1023 Sentence denotes FAM:
T61 1024-1071 Sentence denotes 6-carboxyfluorescein; BBQ: blackberry quencher.
T62 1072-1310 Sentence denotes b Optimised concentrations are given in nanomol per litre (nM) based on the final reaction mix, e.g. 1.5 µL of a 10 µM primer stock solution per 25 µL total reaction volume yields a final concentration of 600 nM as indicated in the table.

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
125 494-497 Gene denotes mix Gene:83881
126 327-330 Gene denotes mix Gene:83881
127 263-272 Species denotes 2019-nCoV Tax:2697049
128 290-298 Species denotes SARS-CoV Tax:694009
129 420-429 Species denotes 2019-nCoV Tax:2697049
130 431-439 Species denotes SARS-CoV Tax:694009
131 448-465 Species denotes SARS-related CoVs Tax:694009
133 50-72 Species denotes 2019 novel coronavirus Tax:2697049
135 1024-1044 Chemical denotes 6-carboxyfluorescein MESH:C024098
137 1163-1166 Gene denotes mix Gene:83881