PMC:3589482 / 5360-17439 JSON TXT

Annnotations TAB JSON ListView MergeView

bionlp-st-ge-2016-spacy-parsed

2_test

{"project":"2_test","denotations":[{"id":"23472114-12048245-87899172","span":{"begin":493,"end":495},"obj":"12048245"},{"id":"23472114-9892694-87899173","span":{"begin":3473,"end":3475},"obj":"9892694"},{"id":"23472114-2744487-87899174","span":{"begin":5079,"end":5081},"obj":"2744487"},{"id":"23472114-12048245-87899175","span":{"begin":8513,"end":8515},"obj":"12048245"},{"id":"T60199","span":{"begin":493,"end":495},"obj":"12048245"},{"id":"T16742","span":{"begin":3473,"end":3475},"obj":"9892694"},{"id":"T12110","span":{"begin":5079,"end":5081},"obj":"2744487"},{"id":"T93715","span":{"begin":8513,"end":8515},"obj":"12048245"}],"text":"Experimental Procedures\n\nCell Culture\nMurine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro). Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL). Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum. Cell viability was determined using the trypan blue (Sigma) dye exclusion method. All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza). Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.\n\nReal-time Quantitative PCR (qPCR)\nThe RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells. For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).\n\nDNA Sequence Analysis\nThe DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion. Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations. Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing. The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer). This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.\n\nWestern Blot Assays\nWhole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes. Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight. Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35]. Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).\n\nConstruction of SerpinB2 Reporter Gene Plasmids\nThe PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261. The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480. Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase. The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87. The control empty vector was pGL3 Basic (Promega).\nLuciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36]. The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb. The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37]. The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case. Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter. Sequence verified constructs were used in the experiments.\n\nTransient Transfection and Luciferase Assays (RAW264.7 Macrophages)\nRAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent.\n\nLentiviral shRNAs, Packaging and Transduction\npLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis.\n\nTransient Transfection and Luciferase Assays (MEF Cells)\nCebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec). Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated. In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA). Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega). Each experiment was repeated at least three times, and triplicate samples were employed for each sample. Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.\n\nElectrophoretic Mobility Shift Assays\nRadiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP. RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41]. DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature. Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm. For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody. Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).\n\nChromatin Immunoprecipitation (ChIP) Assay\nChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications. Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice. Cells extracts were prepared using a commercially available kit (Millipore). Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher). An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore). Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore). The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen). DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.\n\nStatistical Analysis\nData are presented as mean ± SEM per group. Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant. P-values \u003c0.05 were considered significant."}

pmc-enju-pas

bionlp-st-ge-2016-test-proteins

bionlp-st-ge-2016-uniprot

UBERON-AE

{"project":"UBERON-AE","denotations":[{"id":"T5964","span":{"begin":6555,"end":6561},"obj":"http://purl.obolibrary.org/obo/UBERON_0000479"},{"id":"T4259","span":{"begin":3206,"end":3210},"obj":"http://purl.obolibrary.org/obo/UBERON_0001913"},{"id":"T3158","span":{"begin":995,"end":1000},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"},{"id":"T3157","span":{"begin":594,"end":599},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"},{"id":"T3156","span":{"begin":186,"end":191},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"}],"text":"Experimental Procedures\n\nCell Culture\nMurine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro). Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL). Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum. Cell viability was determined using the trypan blue (Sigma) dye exclusion method. All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza). Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.\n\nReal-time Quantitative PCR (qPCR)\nThe RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells. For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).\n\nDNA Sequence Analysis\nThe DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion. Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations. Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing. The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer). This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.\n\nWestern Blot Assays\nWhole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes. Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight. Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35]. Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).\n\nConstruction of SerpinB2 Reporter Gene Plasmids\nThe PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261. The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480. Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase. The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87. The control empty vector was pGL3 Basic (Promega).\nLuciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36]. The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb. The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37]. The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case. Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter. Sequence verified constructs were used in the experiments.\n\nTransient Transfection and Luciferase Assays (RAW264.7 Macrophages)\nRAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent.\n\nLentiviral shRNAs, Packaging and Transduction\npLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis.\n\nTransient Transfection and Luciferase Assays (MEF Cells)\nCebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec). Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated. In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA). Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega). Each experiment was repeated at least three times, and triplicate samples were employed for each sample. Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.\n\nElectrophoretic Mobility Shift Assays\nRadiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP. RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41]. DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature. Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm. For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody. Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).\n\nChromatin Immunoprecipitation (ChIP) Assay\nChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications. Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice. Cells extracts were prepared using a commercially available kit (Millipore). Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher). An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore). Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore). The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen). DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.\n\nStatistical Analysis\nData are presented as mean ± SEM per group. Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant. P-values \u003c0.05 were considered significant."}

GO-BP

GO-MF

GO-CC

sentences

ICD10

{"project":"ICD10","denotations":[{"id":"T3171","span":{"begin":1131,"end":1151},"obj":"http://purl.bioontology.org/ontology/ICD10/A49.3"}],"text":"Experimental Procedures\n\nCell Culture\nMurine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro). Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL). Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum. Cell viability was determined using the trypan blue (Sigma) dye exclusion method. All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza). Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.\n\nReal-time Quantitative PCR (qPCR)\nThe RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells. For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).\n\nDNA Sequence Analysis\nThe DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion. Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations. Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing. The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer). This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.\n\nWestern Blot Assays\nWhole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes. Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight. Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35]. Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).\n\nConstruction of SerpinB2 Reporter Gene Plasmids\nThe PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261. The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480. Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase. The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87. The control empty vector was pGL3 Basic (Promega).\nLuciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36]. The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb. The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37]. The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case. Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter. Sequence verified constructs were used in the experiments.\n\nTransient Transfection and Luciferase Assays (RAW264.7 Macrophages)\nRAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent.\n\nLentiviral shRNAs, Packaging and Transduction\npLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis.\n\nTransient Transfection and Luciferase Assays (MEF Cells)\nCebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec). Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated. In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA). Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega). Each experiment was repeated at least three times, and triplicate samples were employed for each sample. Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.\n\nElectrophoretic Mobility Shift Assays\nRadiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP. RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41]. DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature. Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm. For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody. Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).\n\nChromatin Immunoprecipitation (ChIP) Assay\nChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications. Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice. Cells extracts were prepared using a commercially available kit (Millipore). Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher). An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore). Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore). The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen). DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.\n\nStatistical Analysis\nData are presented as mean ± SEM per group. Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant. P-values \u003c0.05 were considered significant."}

simple1

BioNLP16_DUT

BioNLP16_Messiy

DLUT931

bionlp-st-ge-2016-test-ihmc

bionlp-st-ge-2016-test-tees

testone

test3

PMC:3589482 / 5360-17439 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:3589482 / 5360-17439 JSON TXT