> top > docs > PMC:3589482 > spans > 5360-17439 > annotations

PMC:3589482 / 5360-17439 JSONTXT

Annnotations TAB JSON ListView MergeView

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T8966 12013-12014 JJ denotes t
T8965 12003-12010 NN denotes Student
T8964 12000-12002 CC denotes or
T8963 11998-11999 -RRB- denotes )
T8962 11993-11998 NNP denotes ANOVA
T8961 11992-11993 -LRB- denotes (
T8960 11983-11991 NN denotes variance
T8959 11980-11982 IN denotes of
T8958 11971-11979 NN denotes analysis
T8957 11967-11970 DT denotes the
T8956 11961-11966 VBG denotes using
T8955 11952-11960 VBN denotes analyzed
T8954 11947-11951 VBD denotes were
T8953 11939-11946 NNS denotes Results
T8952 11937-11938 . denotes .
T8951 11932-11937 NN denotes group
T8950 11928-11931 IN denotes per
T8949 11924-11927 NNP denotes SEM
T8948 11922-11923 NN denotes ±
T8947 11917-11921 JJ denotes mean
T8946 11914-11916 IN denotes as
T8945 11904-11913 VBN denotes presented
T8944 11900-11903 VBP denotes are
T8943 11895-11899 NNP denotes Data
T8942 11886-11894 NNP denotes Analysis
T8941 11874-11885 NNP denotes Statistical
T8897 11871-11872 . denotes .
T8896 11845-11870 CD denotes TTCTTGGAAAGCTGGCACTGTGTG3
T8895 11844-11845 NN denotes ′
T8894 11843-11844 CD denotes 5
T8893 11841-11842 -RRB- denotes )
T8892 11838-11841 CD denotes +19
T8891 11837-11838 CD denotes /
T8890 11836-11837 CD denotes 5
T8889 11835-11836 FW denotes −
T8888 11834-11835 -LRB- denotes (
T8887 11826-11833 NN denotes reverse
T8886 11824-11825 : denotes ;
T8885 11798-11823 NNP denotes AAGACTCCCACAGATGGTGGCTGT3
T8884 11797-11798 CD denotes ′
T8883 11796-11797 CD denotes 5
T8882 11794-11795 -RRB- denotes )
T8881 11791-11794 CD denotes 315
T8880 11790-11791 NN denotes −
T8879 11789-11790 CD denotes /
T8878 11786-11789 CD denotes 338
T8877 11785-11786 FW denotes −
T8876 11784-11785 -LRB- denotes (
T8875 11776-11783 RB denotes forward
T8874 11774-11775 : denotes :
T8873 11766-11774 NN denotes promoter
T8872 11757-11765 JJ denotes proximal
T8871 11748-11756 NNP denotes SerpinB2
T8870 11744-11747 DT denotes the
T8869 11740-11743 IN denotes for
T8868 11731-11739 JJ denotes specific
T8867 11723-11730 NNS denotes primers
T8866 11719-11722 CC denotes and
T8865 11712-11718 NN denotes method
T8864 11706-11711 JJ denotes green
T8863 11701-11705 NNP denotes SYBR
T8862 11697-11700 DT denotes the
T8861 11691-11696 VBG denotes using
T8860 11686-11690 NNP denotes qPCR
T8859 11683-11685 IN denotes by
T8858 11680-11682 CC denotes or
T8857 11676-11679 NNP denotes PCR
T8856 11658-11675 JJ denotes semi-quantitative
T8855 11655-11657 IN denotes by
T8854 11645-11654 VBN denotes amplified
T8853 11641-11644 VBD denotes was
T8852 11637-11640 NNP denotes DNA
T8851 11635-11636 . denotes .
T8850 11634-11635 -RRB- denotes )
T8849 11628-11634 NNP denotes Qiagen
T8848 11627-11628 -LRB- denotes (
T8847 11623-11626 NNP denotes Kit
T8846 11610-11622 NNP denotes Purification
T8845 11606-11609 NNP denotes PCR
T8844 11597-11605 NNP denotes QIAquick
T8843 11593-11596 DT denotes the
T8842 11587-11592 VBG denotes using
T8841 11578-11586 VBN denotes purified
T8840 11573-11577 RB denotes then
T8839 11569-11572 VBD denotes was
T8838 11565-11568 NNP denotes DNA
T8837 11561-11564 DT denotes The
T8836 11559-11560 . denotes .
T8835 11558-11559 NNP denotes C
T8834 11557-11558 CD denotes °
T8833 11555-11557 CD denotes 62
T8832 11552-11554 IN denotes at
T8831 11548-11551 NNS denotes hrs
T8830 11546-11547 CD denotes 2
T8829 11542-11545 IN denotes for
T8828 11540-11541 NNP denotes K
T8827 11529-11539 NNP denotes Proteinase
T8826 11524-11528 IN denotes with
T8825 11515-11523 VBN denotes digested
T8824 11510-11514 VBD denotes were
T8823 11501-11509 NNS denotes proteins
T8822 11497-11500 DT denotes the
T8821 11493-11496 CC denotes and
T8820 11491-11492 -RRB- denotes )
T8819 11482-11491 NNP denotes Millipore
T8818 11481-11482 -LRB- denotes (
T8817 11474-11480 NNP denotes Buffer
T8816 11466-11473 NNP denotes Elution
T8815 11461-11465 NNP denotes ChIP
T8814 11458-11460 IN denotes in
T8813 11451-11457 VBN denotes eluted
T8812 11447-11450 VBD denotes was
T8811 11437-11446 NN denotes chromatin
T8810 11431-11436 VBN denotes bound
T8809 11427-11430 DT denotes the
T8808 11425-11426 , denotes ,
T8807 11419-11425 VBN denotes washed
T8806 11414-11418 VBD denotes were
T8805 11408-11413 NNS denotes beads
T8804 11404-11407 DT denotes The
T8803 11402-11403 . denotes .
T8802 11401-11402 -RRB- denotes )
T8801 11392-11401 NNP denotes Millipore
T8800 11391-11392 -LRB- denotes (
T8799 11385-11390 NNS denotes beads
T8798 11376-11384 JJ denotes magnetic
T8797 11369-11375 VBD denotes coated
T8796 11367-11368 NNP denotes G
T8795 11359-11366 NNP denotes Protein
T8794 11354-11358 IN denotes with
T8793 11343-11353 NN denotes incubation
T8792 11337-11342 IN denotes after
T8791 11327-11336 VBN denotes collected
T8790 11322-11326 VBD denotes were
T8789 11313-11321 NNS denotes products
T8788 11294-11312 JJ denotes Immunoprecipitated
T8787 11292-11293 . denotes .
T8786 11291-11292 -RRB- denotes )
T8785 11282-11291 NNP denotes Millipore
T8784 11281-11282 -LRB- denotes (
T8783 11280-11281 -RRB- denotes )
T8782 11274-11280 NNP denotes CTD4H8
T8781 11268-11273 NNP denotes Clone
T8780 11267-11268 -LRB- denotes (
T8779 11264-11266 NNP denotes II
T8778 11253-11263 NN denotes polymerase
T8777 11249-11252 NNP denotes RNA
T8776 11245-11248 CC denotes and
T8775 11243-11244 -RRB- denotes )
T8774 11228-11243 NNPS denotes Biotechnologies
T8773 11223-11227 NNP denotes Cruz
T8772 11217-11222 NNP denotes Santa
T8771 11216-11217 -LRB- denotes (
T8770 11215-11216 -RRB- denotes )
T8769 11208-11215 JJ denotes sc-2027
T8768 11207-11208 -LRB- denotes (
T8767 11203-11206 NNP denotes IgG
T8766 11196-11202 NN denotes rabbit
T8765 11189-11195 JJ denotes normal
T8764 11187-11188 , denotes ,
T8763 11186-11187 -RRB- denotes )
T8762 11177-11186 NN denotes sc-16993X
T8761 11176-11177 -LRB- denotes (
T8760 11174-11175 -RRB- denotes )
T8759 11170-11174 CD denotes T217
T8758 11169-11170 -LRB- denotes (
T8757 11167-11168 NN denotes β
T8756 11166-11167 : denotes -
T8755 11159-11166 NNP denotes p-C/EBP
T8754 11157-11158 , denotes ,
T8753 11156-11157 -RRB- denotes )
T8752 11149-11156 NN denotes sc-150X
T8751 11148-11149 -LRB- denotes (
T8971 12036-12044 NNS denotes P-values
T8970 12034-12035 . denotes .
T8969 12026-12034 JJ denotes relevant
T8968 12020-12025 WRB denotes where
T8967 12015-12019 NN denotes test
T8253 10418-10419 . denotes .
T8252 10417-10418 -RRB- denotes )
T8251 10411-10417 JJ denotes sc-158
T8250 10410-10411 -LRB- denotes (
T8249 10408-10409 NN denotes ε
T8248 10407-10408 : denotes -
T8247 10397-10407 JJ denotes anti-C/EBP
T8246 10393-10396 CC denotes and
T8245 10391-10392 -RRB- denotes )
T8244 10385-10391 JJ denotes sc-151
T8243 10384-10385 -LRB- denotes (
T8242 10382-10383 NN denotes δ
T8241 10381-10382 : denotes -
T8240 10371-10381 JJ denotes anti-C/EBP
T8239 10369-10370 , denotes ,
T8238 10368-10369 -RRB- denotes )
T8237 10362-10368 JJ denotes sc-150
T8236 10361-10362 -LRB- denotes (
T8235 10359-10360 NN denotes β
T8234 10358-10359 : denotes -
T8233 10348-10358 JJ denotes anti-C/EBP
T8232 10346-10347 , denotes ,
T8231 10345-10346 -RRB- denotes )
T8230 10340-10345 JJ denotes sc-61
T8229 10339-10340 -LRB- denotes (
T8228 10337-10338 NN denotes α
T8227 10336-10337 : denotes -
T8226 10326-10336 JJ denotes anti-C/EBP
T8225 10324-10325 : denotes :
T8224 10320-10324 NNP denotes Cruz
T8223 10314-10319 NNP denotes Santa
T8222 10309-10313 IN denotes from
T8221 10299-10308 VBN denotes purchased
T8220 10294-10298 VBD denotes were
T8219 10283-10293 NNS denotes Antibodies
T8218 10281-10282 . denotes .
T8217 10273-10281 NN denotes antibody
T8216 10267-10272 NNP denotes C/EBP
T8215 10258-10266 JJ denotes specific
T8214 10255-10257 IN denotes of
T8213 10252-10254 NN denotes µg
T8212 10250-10251 CD denotes 4
T8211 10245-10249 IN denotes with
T8210 10241-10244 NN denotes ice
T8209 10238-10240 IN denotes on
T8208 10234-10237 NNS denotes hrs
T8207 10232-10233 CD denotes 2
T8206 10218-10231 JJ denotes pre-incubated
T8205 10213-10217 VBD denotes were
T8204 10204-10212 NNS denotes extracts
T8203 10196-10203 JJ denotes nuclear
T8202 10194-10195 , denotes ,
T8201 10188-10194 NNS denotes assays
T8200 10177-10187 JJ denotes supershift
T8199 10173-10176 IN denotes For
T8198 10171-10172 . denotes .
T8197 10165-10171 NNP denotes 10V/cm
T8196 10162-10164 IN denotes at
T8195 10158-10161 NNP denotes TBE
T8194 10155-10157 CD denotes 1x
T8193 10152-10154 IN denotes in
T8192 10150-10151 -RRB- denotes )
T8191 10149-10150 -RRB- denotes )
T8190 10142-10149 NNP denotes Bio-Rad
T8189 10141-10142 -LRB- denotes (
T8188 10126-10140 NN denotes bis-acrylamide
T8187 10125-10126 : denotes :
T8186 10115-10125 NN denotes acrylamide
T8185 10113-10114 CD denotes 1
T8184 10112-10113 NN denotes ∶
T8183 10110-10112 CD denotes 29
T8182 10109-10110 -LRB- denotes (
T8181 10104-10108 NNS denotes gels
T8180 10089-10103 NN denotes polyacrylamide
T8179 10087-10088 NN denotes %
T8178 10086-10087 CD denotes 5
T8177 10083-10085 IN denotes on
T8176 10071-10082 NN denotes temperature
T8175 10066-10070 NN denotes room
T8174 10063-10065 IN denotes at
T8173 10047-10062 NN denotes electrophoresis
T8172 10044-10046 IN denotes by
T8171 10035-10043 VBN denotes resolved
T8170 10030-10034 VBD denotes were
T8169 10021-10029 NNS denotes products
T8168 10012-10020 NN denotes reaction
T8167 10004-10011 VBG denotes Binding
T8166 10002-10003 . denotes .
T8165 9991-10002 NN denotes temperature
T8750 11146-11147 NN denotes β
T8749 11145-11146 : denotes -
T8748 11140-11145 SYM denotes C/EBP
T8747 11138-11139 : denotes :
T8746 11128-11138 NNS denotes antibodies
T8745 11118-11127 VBG denotes following
T8744 11114-11117 DT denotes the
T8743 11111-11113 IN denotes of
T8742 11108-11110 NN denotes µg
T8741 11106-11107 CD denotes 1
T8740 11100-11105 JJS denotes least
T8739 11097-11099 IN denotes at
T8738 11092-11096 IN denotes with
T8737 11082-11091 JJ denotes overnight
T8736 11080-11081 NNP denotes C
T8735 11079-11080 CD denotes °
T8734 11078-11079 CD denotes 4
T8733 11075-11077 IN denotes at
T8732 11056-11074 VBN denotes immunoprecipitated
T8731 11052-11055 VBD denotes was
T8730 11042-11051 NN denotes chromatin
T8729 11039-11041 IN denotes of
T8728 11032-11038 NN denotes amount
T8727 11026-11031 JJ denotes equal
T8726 11023-11025 DT denotes An
T8725 11021-11022 . denotes .
T8724 11020-11021 -RRB- denotes )
T8723 11014-11020 NNP denotes Fisher
T8722 11013-11014 -LRB- denotes (
T8721 11000-11012 NNP denotes Dismembrator
T8720 10994-10999 NNP denotes Sonic
T8719 10992-10993 DT denotes a
T8718 10986-10991 VBG denotes using
T8717 10982-10985 NN denotes ice
T8716 10979-10981 IN denotes on
T8715 10969-10978 NNS denotes intervals
T8714 10965-10968 NN denotes min
T8713 10963-10964 CD denotes 1
T8712 10958-10962 IN denotes with
T8711 10954-10957 NN denotes sec
T8710 10951-10953 CD denotes 15
T8709 10947-10950 IN denotes for
T8708 10941-10946 NNS denotes times
T8707 10939-10940 CD denotes 5
T8706 10929-10938 VBN denotes sonicated
T8705 10924-10928 VBD denotes were
T8704 10916-10923 VBZ denotes lysates
T8703 10908-10915 NNP denotes Nuclear
T8702 10906-10907 . denotes .
T8701 10905-10906 -RRB- denotes )
T8700 10896-10905 NNP denotes Millipore
T8699 10895-10896 -LRB- denotes (
T8698 10891-10894 NN denotes kit
T8697 10881-10890 JJ denotes available
T8696 10868-10880 RB denotes commercially
T8695 10866-10867 DT denotes a
T8694 10860-10865 VBG denotes using
T8693 10851-10859 JJ denotes prepared
T8692 10846-10850 VBD denotes were
T8691 10837-10845 NNS denotes extracts
T8690 10831-10836 NNS denotes Cells
T8689 10829-10830 . denotes .
T8688 10826-10829 NN denotes ice
T8687 10823-10825 IN denotes on
T8686 10813-10822 VBN denotes collected
T8685 10809-10812 CC denotes and
T8684 10801-10808 VBD denotes scraped
T8683 10799-10800 , denotes ,
T8682 10796-10799 NNP denotes PBS
T8681 10791-10795 JJ denotes cold
T8680 10786-10790 IN denotes with
T8679 10779-10785 VBN denotes washed
T8678 10774-10778 VBD denotes were
T8677 10768-10773 NNS denotes cells
T8676 10766-10767 , denotes ,
T8675 10755-10766 NN denotes temperature
T8674 10750-10754 NN denotes room
T8673 10747-10749 IN denotes at
T8672 10743-10746 NN denotes min
T8671 10741-10742 CD denotes 5
T8670 10737-10740 IN denotes for
T8669 10729-10736 NN denotes glycine
T8668 10724-10728 IN denotes with
T8667 10711-10723 VBG denotes neutralizing
T8666 10707-10710 CC denotes and
T8665 10703-10706 NN denotes min
T8664 10700-10702 CD denotes 10
T8663 10696-10699 IN denotes for
T8662 10684-10695 NN denotes temperature
T8661 10679-10683 NN denotes room
T8660 10676-10678 IN denotes at
T8659 10663-10675 NN denotes formaldehyde
T8658 10661-10662 NN denotes %
T8657 10660-10661 CD denotes 1
T8656 10655-10659 IN denotes with
T8655 10645-10654 NN denotes chromatin
T8654 10641-10644 DT denotes the
T8653 10628-10640 VBG denotes crosslinking
T8652 10622-10627 IN denotes after
T8651 10620-10621 , denotes ,
T8650 10613-10620 RB denotes Briefly
T8649 10611-10612 . denotes .
T8648 10598-10611 NNS denotes modifications
T8647 10592-10597 JJ denotes minor
T8646 10587-10591 IN denotes with
T8645 10585-10586 , denotes ,
T8644 10573-10585 NN denotes manufacturer
T8643 10569-10572 DT denotes the
T8642 10566-10568 IN denotes by
T8641 10554-10565 VBN denotes recommended
T8640 10551-10553 IN denotes as
T8639 10549-10550 , denotes ,
T8638 10548-10549 -RRB- denotes )
T8637 10539-10548 NNP denotes Millipore
T8636 10538-10539 -LRB- denotes (
T8635 10534-10537 NN denotes kit
T8634 10532-10533 NN denotes ™
T8633 10522-10532 NNP denotes Magna-ChIP
T8632 10512-10521 JJ denotes available
T8631 10499-10511 RB denotes commercially
T8630 10497-10498 DT denotes a
T8629 10491-10496 VBG denotes using
T8628 10481-10490 VBN denotes performed
T8627 10476-10480 VBD denotes were
T8626 10469-10475 NNS denotes assays
T8625 10464-10468 NNP denotes ChIP
T8624 10458-10463 NNP denotes Assay
T8623 10456-10457 -RRB- denotes )
T8622 10452-10456 NNP denotes ChIP
T8621 10451-10452 -LRB- denotes (
T8620 10431-10450 NNP denotes Immunoprecipitation
T8619 10421-10430 NNP denotes Chromatin
T8164 9986-9990 NN denotes room
T8163 9983-9985 IN denotes at
T8162 9975-9982 NNS denotes minutes
T8161 9972-9974 CD denotes 20
T8160 9968-9971 IN denotes for
T8159 9958-9967 VBN denotes performed
T8158 9953-9957 VBD denotes were
T8157 9947-9952 NN denotes probe
T8156 9933-9946 VBN denotes radiolabelled
T8155 9930-9932 IN denotes of
T8154 9928-9929 -RRB- denotes )
T8153 9926-9928 NN denotes ng
T8152 9922-9925 CD denotes 0.2
T8151 9919-9921 TO denotes to
T8150 9914-9918 CD denotes 0.05
T8149 9913-9914 -LRB- denotes (
T8148 9909-9912 NN denotes cpm
T8147 9902-9908 CD denotes 20,000
T8146 9899-9901 TO denotes to
T8145 9892-9898 CD denotes 10,000
T8144 9888-9891 CC denotes and
T8143 9879-9887 NNS denotes extracts
T8142 9871-9878 JJ denotes nuclear
T8141 9868-9870 IN denotes of
T8140 9865-9867 NN denotes µg
T8139 9863-9864 CD denotes 6
T8107 9759-9769 VBG denotes containing
T8106 9757-9758 -RRB- denotes )
T8105 9755-9757 NN denotes µl
T8104 9752-9754 CD denotes 25
T8103 9751-9752 -LRB- denotes (
T8102 9741-9750 NNS denotes reactions
T8101 9733-9740 JJ denotes binding
T8100 9729-9732 NNP denotes DNA
T8099 9727-9728 . denotes .
T8098 9726-9727 NNP denotes ]
T8097 9724-9726 CD denotes 41
T8096 9723-9724 NNP denotes [
T8095 9716-9722 NN denotes method
T8094 9710-9715 NN denotes lysis
T8093 9700-9709 NN denotes detergent
T8092 9696-9699 DT denotes the
T8091 9693-9695 IN denotes by
T8090 9684-9692 VBN denotes prepared
T8089 9679-9683 VBD denotes were
T8088 9670-9678 NNS denotes extracts
T8087 9662-9669 JJ denotes nuclear
T8086 9656-9661 CD denotes 264.7
T8085 9652-9655 NNP denotes RAW
T8084 9650-9651 . denotes .
T8083 9647-9650 NNP denotes ATP
T8082 9646-9647 : denotes -
T8081 9645-9646 NNP denotes ]
T8080 9640-9645 NNP denotes γ-32P
T8079 9639-9640 NNP denotes [
T8078 9635-9638 CC denotes and
T8077 9628-9634 NN denotes kinase
T8076 9613-9627 NN denotes polynucleotide
T8075 9610-9612 CD denotes T4
T8074 9604-9609 VBG denotes using
T8073 9595-9603 JJ denotes prepared
T8072 9590-9594 VBD denotes were
T8071 9583-9589 NNS denotes assays
T8070 9577-9582 NN denotes shift
T8069 9573-9576 NN denotes gel
T8068 9569-9572 IN denotes for
T8067 9562-9568 NNS denotes probes
T8066 9546-9561 NN denotes oligonucleotide
T8065 9530-9545 JJ denotes double-stranded
T8064 9528-9529 , denotes ,
T8063 9515-9528 NNP denotes Radiolabelled
T8062 9508-9514 NNP denotes Assays
T8061 9502-9507 NNP denotes Shift
T8060 9493-9501 NNP denotes Mobility
T8059 9477-9492 NNP denotes Electrophoretic
T7797 9474-9475 . denotes .
T7796 9470-9474 NN denotes blot
T7795 9462-9469 JJ denotes western
T7794 9459-9461 IN denotes by
T7793 9448-9458 NN denotes expression
T7792 9442-9447 JJ denotes equal
T7791 9438-9441 IN denotes for
T7790 9430-9437 VBN denotes checked
T7789 9426-9429 VBD denotes was
T7788 9417-9425 NNS denotes proteins
T7787 9410-9416 JJ denotes mutant
T7786 9393-9409 NN denotes phospho-acceptor
T7785 9391-9392 NN denotes β
T7784 9390-9391 : denotes -
T7783 9385-9390 NNP denotes C/EBP
T7782 9381-9384 DT denotes the
T7781 9378-9380 IN denotes of
T7780 9367-9377 NN denotes Expression
T7779 9365-9366 . denotes .
T7778 9359-9365 NN denotes sample
T7777 9354-9358 DT denotes each
T7776 9350-9353 IN denotes for
T7775 9341-9349 VBN denotes employed
T7774 9336-9340 VBD denotes were
T7773 9328-9335 NNS denotes samples
T7772 9317-9327 NN denotes triplicate
T7771 9313-9316 CC denotes and
T7770 9311-9312 , denotes ,
T7769 9306-9311 NNS denotes times
T7768 9300-9305 CD denotes three
T7767 9294-9299 JJS denotes least
T7766 9291-9293 IN denotes at
T7765 9282-9290 VBN denotes repeated
T7764 9278-9281 VBD denotes was
T7763 9267-9277 NN denotes experiment
T7762 9262-9266 DT denotes Each
T7761 9260-9261 . denotes .
T7760 9259-9260 -RRB- denotes )
T7759 9252-9259 NNP denotes Promega
T7758 9251-9252 -LRB- denotes (
T7757 9238-9250 RB denotes respectively
T7756 9236-9237 , denotes ,
T7755 9232-9236 NNPS denotes Kits
T7754 9225-9231 NNP denotes System
T7753 9219-9224 NNP denotes Assay
T7752 9212-9218 NNP denotes Enzyme
T7751 9196-9211 NNP denotes β-Galactosidase
T7750 9192-9195 CC denotes and
T7749 9185-9191 NNP denotes System
T7748 9179-9184 NNP denotes Assay
T7747 9168-9178 NNP denotes Luciferase
T7746 9164-9167 DT denotes the
T7745 9158-9163 VBG denotes using
T7744 9156-9157 NNP denotes ]
T7743 9154-9156 CD denotes 38
T7742 9153-9154 NNP denotes [
T7741 9137-9152 JJ denotes β-galactosidase
T7740 9134-9136 IN denotes of
T7739 9129-9133 DT denotes that
T7738 9126-9128 TO denotes to
T7737 9115-9125 VBN denotes normalized
T7736 9111-9114 CC denotes and
T7735 9100-9110 VBN denotes determined
T7734 9096-9099 VBD denotes was
T7733 9087-9095 NN denotes activity
T7732 9076-9086 JJ denotes Luciferase
T7731 9074-9075 . denotes .
T7730 9073-9074 -RRB- denotes )
T7729 9070-9073 NN denotes DNA
T7728 9064-9069 JJ denotes total
T7727 9061-9063 NN denotes µg
T7726 9057-9060 CD denotes 1.0
T7725 9053-9056 CD denotes 0.6
T7724 9052-9053 -LRB- denotes (
T7723 9037-9051 VBN denotes co-transfected
T7722 9032-9036 VBD denotes were
T7721 9025-9031 NN denotes vector
T7720 9017-9024 VB denotes control
T7719 9014-9016 CC denotes or
T7718 9012-9013 NNP denotes ]
T7717 9010-9012 CD denotes 40
T7716 9009-9010 NNP denotes [
T7715 9007-9008 NNP denotes ]
T7714 9005-9007 CD denotes 38
T7713 9004-9005 NNP denotes [
T7712 9002-9003 -RRB- denotes )
T7711 8998-9002 NNP denotes S64A
T7710 8996-8997 , denotes ,
T7709 8991-8996 CD denotes T217A
T7708 8989-8990 , denotes ,
T7707 8984-8989 CD denotes T188A
T7706 8983-8984 -LRB- denotes (
T7705 8975-8982 NNS denotes mutants
T7704 8958-8974 NN denotes phospho-acceptor
T7703 8956-8957 NN denotes β
T7702 8955-8956 : denotes -
T7701 8950-8955 SYM denotes C/EBP
T7700 8947-8949 CC denotes or
T7699 8945-8946 NN denotes β
T7698 8944-8945 : denotes -
T7697 8939-8944 NNP denotes C/EBP
T7696 8930-8938 VBG denotes encoding
T7695 8921-8929 NNS denotes plasmids
T7694 8919-8920 , denotes ,
T7693 8908-8919 NNS denotes experiments
T7692 8903-8907 DT denotes some
T7691 8900-8902 IN denotes In
T7690 8898-8899 . denotes .
T7689 8889-8898 VBN denotes indicated
T7688 8883-8888 WRB denotes where
T7687 8879-8882 NNS denotes hrs
T7686 8877-8878 CD denotes 4
T7685 8873-8876 IN denotes for
T7684 8871-8872 -RRB- denotes )
T7683 8866-8871 NN denotes ng/ml
T7682 8862-8865 CD denotes 100
T7681 8861-8862 -LRB- denotes (
T7680 8857-8860 NNP denotes LPS
T7679 8852-8856 IN denotes with
T7678 8841-8851 NN denotes incubation
T7677 8838-8840 TO denotes to
T7676 8832-8837 RB denotes prior
T7675 8828-8831 NNS denotes hrs
T7674 8825-8827 CD denotes 48
T7673 8821-8824 IN denotes for
T7672 8811-8820 VBN denotes incubated
T7671 8807-8810 CC denotes and
T7670 8800-8806 VBZ denotes plates
T7669 8795-8799 RB denotes well
T7668 8792-8794 CD denotes 24
T7667 8789-8791 IN denotes in
T7666 8783-8788 NNS denotes media
T7665 8772-8782 JJ denotes pre-warmed
T7664 8769-8771 TO denotes to
T7663 8757-8768 VBN denotes transferred
T7662 8752-8756 VBD denotes were
T7661 8746-8751 NNS denotes cells
T7660 8734-8745 JJ denotes Transfected
T7659 8732-8733 . denotes .
T7658 8731-8732 -RRB- denotes )
T7657 8727-8731 NN denotes msec
T7656 8724-8726 CD denotes 30
T7655 8722-8723 , denotes ,
T7654 8721-8722 NNP denotes V
T7653 8716-8720 CD denotes 1350
T7652 8714-8715 , denotes ,
T7651 8709-8714 NN denotes pulse
T7650 8707-8708 CD denotes 1
T7649 8706-8707 -LRB- denotes (
T7648 8699-8705 NN denotes system
T7647 8697-8698 NN denotes ™
T7646 8693-8697 NNP denotes Neon
T7645 8682-8692 NNP denotes Invitrogen
T7644 8678-8681 DT denotes the
T8138 9861-9862 , denotes ,
T8137 9860-9861 -RRB- denotes )
T8136 9855-9860 JJ denotes dI-dC
T8135 9854-9855 -LRB- denotes (
T8134 9849-9853 NN denotes poly
T8133 9846-9848 NN denotes µg
T8132 9844-9845 CD denotes 1
T8131 9842-9843 , denotes ,
T8130 9832-9842 NN denotes Ficoll-400
T8129 9830-9831 NN denotes %
T8128 9828-9830 CD denotes 20
T8127 9826-9827 , denotes ,
T8126 9818-9826 NN denotes glycerol
T8125 9816-9817 NN denotes %
T8124 9814-9816 CD denotes 30
T8123 9812-9813 , denotes ,
T8122 9809-9812 NNP denotes DTT
T8121 9806-9808 NNP denotes mM
T8120 9804-9805 CD denotes 2
T8119 9802-9803 , denotes ,
T8118 9799-9802 NNP denotes BSA
T8117 9796-9798 NN denotes ml
T8116 9795-9796 NN denotes /
T8115 9793-9795 NN denotes µg
T8114 9790-9792 CD denotes 10
T8113 9788-9789 , denotes ,
T8112 9785-9788 CD denotes 7.9
T8111 9782-9784 NNP denotes pH
T8110 9776-9781 NNP denotes HEPES
T8109 9773-9775 NNP denotes mM
T8108 9770-9772 CD denotes 10
T7643 8672-8677 VBG denotes using
T7642 8656-8671 NN denotes electroporation
T7641 8653-8655 IN denotes by
T7640 8651-8652 -RRB- denotes )
T7639 8649-8651 NN denotes ng
T7638 8645-8648 CD denotes 200
T7637 8644-8645 -LRB- denotes (
T7636 8636-8643 NN denotes plasmid
T7635 8627-8635 NN denotes reporter
T7634 8603-8626 JJ denotes β-actin-β-galactosidase
T7633 8601-8602 DT denotes a
T7632 8596-8600 IN denotes with
T7631 8590-8595 IN denotes along
T7630 8588-8589 -RRB- denotes )
T7629 8586-8588 NN denotes ng
T7628 8582-8585 CD denotes 400
T7627 8581-8582 -LRB- denotes (
T7626 8573-8580 NN denotes plasmid
T7625 8564-8572 NN denotes reporter
T7624 8553-8563 NN denotes luciferase
T7623 8543-8552 VBN denotes indicated
T7622 8539-8542 DT denotes the
T7621 8534-8538 IN denotes with
T7620 8522-8533 VBN denotes transfected
T7619 8517-8521 VBD denotes were
T7618 8515-8516 NNP denotes ]
T7602 5958-5959 -LRB- denotes (
T7601 5951-5957 NNP denotes Assays
T7600 5940-5950 NNP denotes Luciferase
T7599 5936-5939 CC denotes and
T7598 5923-5935 NNP denotes Transfection
T7597 5913-5922 NNP denotes Transient
T7141 8429-8430 . denotes .
T7140 8421-8429 NN denotes analysis
T7139 8416-8420 NN denotes blot
T7138 8408-8415 JJ denotes western
T7137 8405-8407 IN denotes by
T7136 8395-8404 VBN denotes confirmed
T7135 8391-8394 VBD denotes was
T7134 8381-8390 NN denotes knockdown
T7133 8379-8380 NN denotes β
T7132 8378-8379 : denotes -
T7131 8373-8378 SYM denotes C/EBP
T7130 8371-8372 . denotes .
T7129 8362-8371 NN denotes knockdown
T7128 8357-8361 NN denotes gene
T7127 8347-8356 JJ denotes effective
T7126 8343-8346 IN denotes for
T7125 8337-8342 VB denotes allow
T7124 8334-8336 TO denotes to
T7123 8330-8333 NNS denotes hrs
T7122 8327-8329 CD denotes 72
T7121 8323-8326 IN denotes for
T7120 8315-8322 RBR denotes further
T7119 8305-8314 VBD denotes incubated
T7118 8301-8304 CC denotes and
T7117 8295-8300 NNS denotes media
T7116 8288-8294 NN denotes growth
T7115 8282-8287 JJ denotes fresh
T7114 8277-8281 IN denotes with
T7113 8268-8276 VBN denotes replaced
T7112 8264-8267 VBD denotes was
T7111 8252-8263 NN denotes supernatant
T7110 8241-8251 JJ denotes lentiviral
T7109 8237-8240 DT denotes The
T7108 8235-8236 . denotes .
T7107 8232-8235 NNS denotes hrs
T7106 8229-8231 CD denotes 24
T7105 8225-8228 IN denotes for
T7104 8223-8224 -RRB- denotes )
T7103 8210-8223 NNP denotes Bioanalytical
T7102 8201-8209 NNP denotes American
T7101 8200-8201 -LRB- denotes (
T7100 8190-8199 NNP denotes Polybrene
T7099 8187-8189 NN denotes ml
T7098 8186-8187 NN denotes /
T7097 8184-8186 NN denotes µg
T7096 8182-8183 CD denotes 8
T7095 8178-8181 CC denotes and
T7094 8166-8177 NN denotes supernatant
T7093 8155-8165 JJ denotes lentiviral
T7092 8151-8154 DT denotes the
T7091 8146-8150 IN denotes with
T7090 8138-8145 VBN denotes treated
T7089 8133-8137 VBD denotes were
T7088 8127-8132 NNS denotes cells
T7087 8120-8126 NN denotes target
T7086 8116-8119 DT denotes The
T7085 8114-8115 . denotes .
T7084 8108-8114 NN denotes filter
T7083 8105-8107 NN denotes µm
T7082 8100-8104 CD denotes 0.45
T7081 8098-8099 DT denotes a
T7080 8090-8097 IN denotes through
T7079 8083-8089 VBN denotes passed
T7078 8079-8082 CC denotes and
T7077 8074-8078 NNS denotes mins
T7076 8071-8073 CD denotes 10
T7075 8067-8070 IN denotes for
T7074 8065-8066 NN denotes g
T7073 8059-8064 CD denotes 2,000
T7072 8056-8058 IN denotes at
T7071 8041-8055 NN denotes centrifugation
T7070 8038-8040 IN denotes by
T7069 8030-8037 VBN denotes cleared
T7068 8028-8029 , denotes ,
T7067 8016-8028 NN denotes transfection
T7066 8010-8015 IN denotes after
T7065 8006-8009 NNS denotes hrs
T7064 8003-8005 CD denotes 48
T7063 7993-8002 VBN denotes collected
T7062 7989-7992 VBD denotes was
T7061 7977-7988 NN denotes supernatant
T7060 7966-7976 JJ denotes lentiviral
T7059 7962-7965 DT denotes The
T7058 7960-7961 . denotes .
T7057 7959-7960 -RRB- denotes )
T7056 7949-7959 NNP denotes Invitrogen
T7055 7948-7949 -LRB- denotes (
T7054 7940-7947 NN denotes reagent
T7617 8513-8515 CD denotes 34
T7616 8512-8513 NNP denotes [
T7615 8510-8511 -RRB- denotes )
T7614 8507-8510 CD denotes 105
T7613 8506-8507 CD denotes ×
T7612 8505-8506 CD denotes 1
T7611 8504-8505 -LRB- denotes (
T7610 8499-8503 NNS denotes MEFs
T7609 8497-8498 CD denotes −
T7608 8496-8497 VBD denotes /
T7607 8495-8496 NNP denotes −
T7606 8489-8494 NNP denotes Cebpb
T7605 8487-8488 -RRB- denotes )
T7604 8482-8487 NNPS denotes Cells
T7603 8478-8481 NNP denotes MEF
T7053 7935-7939 CD denotes 2000
T7052 7921-7934 NNP denotes Lipofectamine
T7051 7915-7920 VBG denotes using
T7050 7913-7914 -RRB- denotes )
T7049 7911-7913 NN denotes µg
T7048 7906-7910 CD denotes 0.25
T7047 7905-7906 -LRB- denotes (
T7046 7897-7904 NN denotes plasmid
T7045 7888-7896 NN denotes envelope
T7044 7877-7887 NNP denotes pCMV-VSV-G
T7043 7873-7876 CC denotes and
T7042 7871-7872 , denotes ,
T7041 7870-7871 -RRB- denotes )
T7040 7868-7870 NN denotes µg
T7039 7863-7867 CD denotes 0.75
T7038 7862-7863 -LRB- denotes (
T7037 7854-7861 NN denotes plasmid
T7036 7844-7853 NN denotes packaging
T7035 7839-7843 NN denotes dvpr
T7034 7837-7839 CD denotes .2
T7033 7829-7837 JJ denotes pCMV-ΔR8
T7032 7827-7828 , denotes ,
T7031 7826-7827 -RRB- denotes )
T7030 7824-7826 NN denotes µg
T7029 7822-7823 CD denotes 1
T7028 7821-7822 -LRB- denotes (
T6999 7657-7664 NN denotes control
T6998 7655-7656 DT denotes a
T6997 7652-7654 IN denotes as
T6996 7646-7651 NNP denotes shRNA
T6995 7640-7645 NNP denotes CEBPB
T6994 7634-7639 JJ denotes human
T6993 7630-7633 DT denotes the
T6992 7625-7629 VBD denotes used
T6991 7622-7624 PRP denotes we
T6990 7612-7621 RB denotes therefore
T6989 7610-7611 : denotes ;
T6988 7603-7610 NNS denotes species
T6987 7597-7602 JJ denotes other
T6986 7593-7596 DT denotes the
T6985 7590-7592 IN denotes of
T6984 7584-7589 NNS denotes cells
T6983 7581-7583 IN denotes on
T6982 7576-7580 VBN denotes used
T6981 7571-7575 WRB denotes when
T6980 7569-7570 NN denotes β
T6979 7568-7569 : denotes -
T6978 7563-7568 NNP denotes C/EBP
T6977 7552-7562 JJ denotes endogenous
T6976 7549-7551 IN denotes of
T6975 7538-7548 NN denotes expression
T6974 7528-7537 VB denotes knockdown
T6973 7524-7527 RB denotes not
T6972 7521-7524 MD denotes can
T6971 7514-7520 NNS denotes shRNAs
T6970 7497-7513 JJ denotes species-specific
T6969 7491-7496 DT denotes these
T6968 7489-7490 , denotes ,
T6967 7480-7489 JJ denotes identical
T6966 7476-7479 RB denotes not
T6965 7472-7475 VBP denotes are
T6964 7464-7471 NNS denotes regions
T6963 7451-7463 JJ denotes untranslated
T6962 7449-7450 NN denotes ′
T6961 7448-7449 CD denotes 3
T6960 7442-7447 NN denotes cebpb
T6959 7436-7441 NN denotes mouse
T6958 7432-7435 CC denotes and
T6957 7426-7431 JJ denotes human
T6956 7422-7425 DT denotes the
T6955 7414-7421 IN denotes Because
T6954 7412-7413 . denotes .
T6953 7405-7412 NNS denotes studies
T6952 7399-7404 DT denotes these
T6951 7396-7398 IN denotes in
T6950 7391-7395 VBN denotes used
T6949 7386-7390 VBD denotes were
T6948 7380-7385 NN denotes cebpb
T6947 7374-7379 NN denotes mouse
T6946 7370-7373 CC denotes and
T6945 7364-7369 JJ denotes human
T6944 7360-7363 IN denotes for
T6943 7351-7359 NN denotes specific
T6942 7349-7350 -RRB- denotes )
T6941 7344-7349 NNP denotes shRNA
T6940 7343-7344 -LRB- denotes (
T6939 7338-7342 NNS denotes RNAs
T6938 7330-7337 NN denotes hairpin
T6937 7324-7329 JJ denotes short
T6936 7315-7323 VBG denotes carrying
T6935 7307-7314 NNS denotes vectors
T6934 7296-7306 JJ denotes lentiviral
T6933 7284-7295 NN denotes pLKO.1-puro
T6932 7271-7283 NNP denotes Transduction
T6931 7267-7270 CC denotes and
T6930 7257-7266 NN denotes Packaging
T6929 7255-7256 , denotes ,
T6928 7249-7255 NNP denotes shRNAs
T6927 7238-7248 NNP denotes Lentiviral
T6597 7235-7236 . denotes .
T6596 7228-7235 NN denotes reagent
T6595 7217-7227 NN denotes microassay
T6594 7209-7216 NN denotes protein
T6593 7201-7208 NNP denotes Bio-Rad
T6592 7197-7200 DT denotes the
T6591 7191-7196 VBG denotes using
T6590 7180-7190 VBN denotes determined
T6589 7176-7179 VBD denotes was
T6588 7162-7175 NN denotes concentration
T6587 7154-7161 NN denotes Protein
T6586 7152-7153 . denotes .
T6585 7151-7152 -RRB- denotes )
T6584 7143-7151 NN denotes activity
T6583 7136-7142 JJ denotes pRL-TK
T6582 7127-7135 VBD denotes affected
T6581 7123-7126 NNP denotes LPS
T6580 7120-7122 CC denotes or
T6579 7118-7119 NN denotes β
T6578 7117-7118 : denotes -
T6577 7112-7117 NNP denotes C/EBP
T6576 7097-7111 JJ denotes co-transfected
T6575 7091-7096 WRB denotes where
T6574 7090-7091 -LRB- denotes (
T6573 7076-7089 NN denotes concentration
T6572 7068-7075 NN denotes protein
T6571 7059-7067 JJ denotes cellular
T6570 7056-7058 TO denotes to
T6569 7053-7055 CC denotes or
T6568 7047-7052 NNS denotes units
T6567 7041-7046 JJ denotes light
T6566 7030-7040 NN denotes luciferase
T6565 7022-7029 NN denotes renilla
T6564 7015-7021 JJ denotes pRL-TK
T6563 7012-7014 TO denotes to
T6562 7005-7011 RB denotes either
T6561 6994-7004 VBD denotes normalized
T6560 6988-6993 NNS denotes units
T6559 6982-6987 JJ denotes light
T6558 6971-6981 JJ denotes luciferase
T6557 6963-6970 RB denotes firefly
T6556 6960-6962 IN denotes of
T6555 6953-6959 NN denotes number
T6554 6949-6952 DT denotes the
T6553 6946-6948 IN denotes as
T6552 6936-6945 VBN denotes expressed
T6551 6933-6935 VBZ denotes is
T6550 6924-6932 NN denotes activity
T6549 6915-6923 NN denotes Promoter
T6548 6913-6914 . denotes .
T6547 6902-6913 NNS denotes experiments
T6546 6890-6901 JJ denotes independent
T6545 6884-6889 CD denotes three
T6544 6878-6883 JJS denotes least
T6543 6875-6877 IN denotes at
T6542 6872-6874 IN denotes of
T6541 6864-6871 NNS denotes results
T6540 6860-6863 DT denotes the
T6539 6850-6859 VBP denotes represent
T6538 6837-6849 NNS denotes Measurements
T6537 6835-6836 . denotes .
T6536 6834-6835 -RRB- denotes )
T6535 6827-6834 NNP denotes Promega
T6534 6826-6827 -LRB- denotes (
T6533 6822-6825 NN denotes kit
T6532 6815-6821 NNP denotes System
T6531 6809-6814 NNP denotes Assay
T6530 6800-6808 NNP denotes Reporter
T6529 6784-6799 NNP denotes Dual-Luciferase
T6528 6782-6783 DT denotes a
T6527 6776-6781 VBG denotes using
T6526 6767-6775 VBN denotes measured
T6525 6763-6766 VBD denotes was
T6524 6754-6762 NN denotes activity
T6523 6743-6753 JJ denotes Luciferase
T6522 6741-6742 . denotes .
T6521 6738-6741 NNP denotes LPS
T6520 6732-6737 JJ denotes ng/ml
T6519 6728-6731 CD denotes 100
T6518 6725-6727 IN denotes of
T6517 6717-6724 NN denotes absence
T6516 6714-6716 CC denotes or
T6515 6705-6713 NN denotes presence
T6514 6701-6704 DT denotes the
T6513 6698-6700 IN denotes in
T6512 6691-6697 CC denotes either
T6511 6689-6690 NNP denotes C
T6510 6688-6689 CD denotes °
T6509 6686-6688 CD denotes 37
T6508 6683-6685 IN denotes at
T6507 6672-6682 NN denotes atmosphere
T6506 6668-6671 NN denotes air
T6505 6657-6667 JJ denotes humidified
T6504 6655-6656 NN denotes %
T6503 6653-6655 CD denotes 95
T6502 6649-6652 CC denotes and
T6501 6645-6648 CD denotes CO2
T6500 6643-6644 NN denotes %
T6499 6642-6643 CD denotes 5
T6498 6640-6641 DT denotes a
T6497 6637-6639 IN denotes in
T7027 7813-7820 NN denotes plasmid
T7026 7802-7812 NN denotes expression
T7025 7796-7801 NN denotes shRNA
T7024 7791-7795 DT denotes each
T7023 7789-7790 : denotes :
T7022 7781-7789 NNS denotes plasmids
T7021 7778-7780 IN denotes of
T7020 7770-7777 NN denotes mixture
T7019 7768-7769 DT denotes a
T7018 7763-7767 IN denotes with
T7017 7751-7762 VBN denotes transfected
T7016 7746-7750 VBD denotes were
T7015 7740-7745 NNS denotes cells
T7014 7731-7739 JJ denotes HEK-293T
T7013 7729-7730 , denotes ,
T7012 7720-7729 NNS denotes particles
T7011 7709-7719 JJ denotes lentiviral
T7010 7701-7708 VB denotes produce
T7009 7698-7700 TO denotes To
T7008 7696-7697 . denotes .
T7007 7695-7696 NNP denotes ]
T7006 7693-7695 CD denotes 38
T7005 7692-7693 NNP denotes [
T7004 7689-7691 IN denotes in
T7003 7686-7688 IN denotes as
T7002 7674-7685 NNS denotes experiments
T7001 7668-7673 DT denotes these
T7000 7665-7667 IN denotes in
T6496 6633-6636 NNS denotes hrs
T6495 6630-6632 CD denotes 16
T6494 6620-6629 VBD denotes incubated
T6493 6616-6619 CC denotes and
T6492 6610-6615 NNS denotes pools
T6491 6605-6609 NN denotes cell
T6490 6595-6604 JJ denotes identical
T6489 6591-6594 CD denotes two
T6488 6586-6590 IN denotes into
T6487 6578-6585 VBN denotes divided
T6486 6576-6577 , denotes ,
T6485 6570-6576 VBZ denotes plates
T6484 6562-6569 NN denotes culture
T6483 6555-6561 NN denotes tissue
T6482 6548-6554 JJ denotes 6-well
T6481 6545-6547 IN denotes in
T6480 6539-6544 NNS denotes media
T6479 6528-6538 JJ denotes pre-warmed
T6478 6525-6527 IN denotes of
T6477 6522-6524 NN denotes ml
T6476 6519-6521 CD denotes 10
T6475 6516-6518 TO denotes to
T6474 6504-6515 VBN denotes transferred
T6473 6499-6503 VBD denotes were
T6472 6493-6498 NNS denotes cells
T6471 6481-6492 JJ denotes Transfected
T6451 6355-6363 VBN denotes included
T6450 6351-6354 VBD denotes was
T6449 6342-6350 NN denotes enhancer
T6448 6338-6341 CC denotes and
T6447 6329-6337 NN denotes promoter
T6446 6324-6328 NNP denotes SV40
T6445 6320-6323 DT denotes the
T6444 6312-6319 VBZ denotes encodes
T6443 6306-6311 WDT denotes which
T6442 6298-6305 NN denotes plasmid
T6441 6290-6297 NN denotes control
T6440 6285-6289 JJ denotes pGL3
T6439 6283-6284 . denotes .
T6438 6282-6283 -RRB- denotes )
T6437 6279-6282 NNP denotes µFd
T6436 6275-6278 CD denotes 960
T6435 6273-6274 , denotes ,
T6434 6271-6273 NNP denotes kV
T6433 6266-6270 CD denotes 0.25
T6432 6265-6266 -LRB- denotes (
T6431 6256-6264 NNP denotes Extender
T6430 6244-6255 NNP denotes Capacitance
T6429 6242-6243 DT denotes a
T6428 6237-6241 IN denotes with
T6427 6230-6236 NNP denotes Pulser
T6426 6225-6229 NNP denotes Gene
T6425 6217-6224 NNP denotes Bio-Rad
T6424 6215-6216 DT denotes a
T6423 6209-6214 VBG denotes using
T6422 6193-6208 NN denotes electroporation
T6421 6190-6192 IN denotes by
T6420 6188-6189 -RRB- denotes )
T6419 6186-6188 NN denotes µg
T6418 6184-6185 CD denotes 2
T6417 6183-6184 -LRB- denotes (
T6416 6175-6182 NN denotes plasmid
T6415 6166-6174 NN denotes reporter
T6414 6158-6165 NN denotes control
T6413 6149-6157 JJ denotes internal
T6412 6147-6148 -RRB- denotes )
T6411 6140-6147 NNP denotes Promega
T6410 6139-6140 -LRB- denotes (
T6409 6137-6138 -RRB- denotes )
T6408 6135-6137 NNP denotes TK
T6407 6134-6135 -LRB- denotes (
T6406 6127-6133 NN denotes kinase
T6405 6113-6126 JJ denotes pRL-thymidine
T6404 6109-6112 DT denotes the
T6403 6104-6108 IN denotes with
T6402 6098-6103 IN denotes along
T6401 6096-6097 -RRB- denotes )
T6400 6094-6096 NN denotes µg
T6399 6091-6093 CD denotes 20
T6398 6090-6091 -LRB- denotes (
T6397 6082-6089 NN denotes plasmid
T6396 6073-6081 NN denotes reporter
T6395 6062-6072 NN denotes luciferase
T6394 6052-6061 VBN denotes indicated
T6393 6048-6051 DT denotes the
T6392 6043-6047 IN denotes with
T6391 6031-6042 VBN denotes transfected
T6390 6026-6030 VBD denotes were
T6389 6020-6025 NN denotes phase
T6388 6016-6019 VB denotes log
T6387 6013-6015 IN denotes in
T6386 6005-6012 VBG denotes growing
T6385 6003-6004 -RRB- denotes )
T6384 6000-6003 CD denotes 107
T6383 5999-6000 CD denotes ×
T6382 5998-5999 CD denotes 2
T6381 5997-5998 -LRB- denotes (
T6380 5991-5996 NNS denotes cells
T6379 5985-5990 CD denotes 264.7
T6378 5981-5984 NNP denotes RAW
T6377 5979-5980 -RRB- denotes )
T6376 5968-5979 NNP denotes Macrophages
T6375 5965-5967 CD denotes .7
T6374 5959-5965 NNP denotes RAW264
T6373 5958-5959 -LRB- denotes (
T6372 5951-5957 NNP denotes Assays
T6371 5940-5950 NNP denotes Luciferase
T6370 5936-5939 CC denotes and
T6369 5923-5935 NNP denotes Transfection
T6368 5913-5922 NNP denotes Transient
T6470 6479-6480 . denotes .
T6469 6469-6479 NNS denotes activities
T6468 6460-6468 NN denotes enhancer
T6467 6456-6459 CC denotes and
T6466 6447-6455 NN denotes promoter
T6465 6443-6446 IN denotes for
T6464 6434-6442 NN denotes standard
T6463 6425-6433 JJ denotes internal
T6462 6422-6424 DT denotes an
T6461 6419-6421 IN denotes as
T6460 6415-6418 CC denotes and
T6459 6413-6414 , denotes ,
T6458 6403-6413 NN denotes efficiency
T6457 6390-6402 NN denotes transfection
T6456 6386-6389 IN denotes for
T6455 6378-6385 NN denotes control
T6454 6369-6377 JJ denotes positive
T6453 6367-6368 DT denotes a
T6452 6364-6366 IN denotes as
T5894 5910-5911 . denotes .
T5893 5899-5910 NNS denotes experiments
T5892 5895-5898 DT denotes the
T5891 5892-5894 IN denotes in
T5890 5887-5891 VBN denotes used
T5889 5882-5886 VBD denotes were
T5888 5871-5881 NNS denotes constructs
T5887 5862-5870 VBD denotes verified
T5886 5853-5861 NN denotes Sequence
T5885 5851-5852 . denotes .
T5884 5843-5851 NN denotes promoter
T5883 5834-5842 NNP denotes SerpinB2
T5882 5827-5833 NN denotes murine
T5881 5817-5826 JJ denotes wild-type
T5880 5813-5816 DT denotes the
T5879 5810-5812 IN denotes of
T5878 5803-5809 NN denotes region
T5877 5799-5802 CD denotes +92
T5876 5798-5799 NN denotes /
T5875 5795-5798 CD denotes 539
T5874 5794-5795 NN denotes −
T5873 5790-5793 DT denotes the
T5872 5787-5789 IN denotes of
T5871 5781-5786 NN denotes place
T5870 5778-5780 IN denotes in
T5869 5768-5777 NN denotes pGLmP-539
T5868 5765-5767 IN denotes of
T5867 5759-5764 NNS denotes sites
T5866 5747-5758 NN denotes restriction
T5865 5745-5746 PRP denotes I
T5864 5741-5744 NNP denotes Xho
T5863 5737-5740 CC denotes and
T5862 5735-5736 PRP denotes I
T5861 5730-5734 NNP denotes EcoR
T5860 5726-5729 DT denotes the
T5859 5718-5725 IN denotes between
T5858 5711-5717 VBN denotes cloned
T5857 5707-5710 CC denotes and
T5856 5705-5706 PRP denotes I
T5855 5701-5704 NNP denotes Xho
T5854 5697-5700 CC denotes and
T5853 5695-5696 PRP denotes I
T5852 5690-5694 NNP denotes EcoR
T5851 5685-5689 IN denotes with
T5850 5676-5684 VBN denotes digested
T5849 5671-5675 VBD denotes were
T5848 5662-5670 NNS denotes products
T5847 5658-5661 NN denotes PCR
T5846 5646-5657 JJ denotes Recombinant
T5845 5644-5645 . denotes .
T5844 5640-5644 NN denotes case
T5843 5635-5639 DT denotes each
T5842 5632-5634 IN denotes in
T5841 5623-5631 NN denotes template
T5840 5619-5622 DT denotes the
T5839 5616-5618 IN denotes as
T5838 5611-5615 VBN denotes used
T5837 5607-5610 VBD denotes was
T5836 5597-5606 NN denotes pGLmP-539
T5835 5595-5596 . denotes .
T5834 5594-5595 -RRB- denotes )
T5833 5587-5594 NNP denotes Promega
T5832 5586-5587 -LRB- denotes (
T5831 5576-5585 NNP denotes GLprimer2
T5830 5572-5575 CC denotes and
T5829 5570-5571 -RRB- denotes )
T5828 5563-5570 NNP denotes Promega
T5827 5562-5563 -LRB- denotes (
T5826 5552-5561 JJ denotes RVprimer3
T5825 5547-5551 VBD denotes were
T5824 5539-5546 NNS denotes primers
T5823 5535-5538 NNP denotes PCR
T5822 5519-5534 NN denotes oligonucleotide
T5821 5510-5518 NN denotes flanking
T5820 5506-5509 DT denotes The
T5819 5504-5505 . denotes .
T5818 5503-5504 NNP denotes ]
T5817 5501-5503 CD denotes 37
T5816 5500-5501 NNP denotes [
T5815 5489-5499 RB denotes previously
T5814 5480-5488 VBN denotes reported
T5813 5475-5479 VBD denotes were
T5812 5459-5474 NN denotes pGLmP-539mAP-1b
T5811 5455-5458 CC denotes and
T5810 5453-5454 , denotes ,
T5809 5438-5453 NN denotes pGLmP-539mAP-1a
T5808 5436-5437 , denotes ,
T5807 5423-5436 NN denotes pGLmP-539mCRE
T5806 5421-5422 , denotes ,
T5805 5414-5421 NNS denotes mutants
T5804 5405-5413 VB denotes generate
T5803 5402-5404 TO denotes to
T5802 5397-5401 VBD denotes used
T5801 5389-5396 NNS denotes primers
T5800 5385-5388 NNP denotes PCR
T5799 5369-5384 NN denotes oligonucleotide
T5798 5365-5368 DT denotes The
T5797 5363-5364 . denotes .
T5796 5352-5363 NNS denotes mPAI2mCEBPb
T5795 5348-5351 CC denotes and
T5794 5336-5347 NNS denotes mPAI2mCEBPa
T5793 5334-5335 : denotes :
T5792 5331-5334 NNP denotes EBP
T5791 5330-5331 NNP denotes /
T5790 5319-5330 NNP denotes pGLmP-539mC
T5789 5317-5318 : denotes ;
T5788 5305-5317 NN denotes mPAI2mOct-2b
T5787 5301-5304 CC denotes and
T5786 5288-5300 NN denotes mPAI2mOct-2a
T5707 4840-4850 NNP denotes Luciferase
T5706 4838-4839 . denotes .
T5705 4837-4838 -RRB- denotes )
T5704 4830-4837 NNP denotes Promega
T5703 4829-4830 -LRB- denotes (
T5702 4823-4828 JJ denotes Basic
T5701 4818-4822 JJ denotes pGL3
T5700 4814-4817 VBD denotes was
T5699 4807-4813 NN denotes vector
T5698 4801-4806 JJ denotes empty
T5697 4793-4800 NN denotes control
T5696 4789-4792 DT denotes The
T5695 4787-4788 . denotes .
T5694 4779-4787 NNP denotes pGLmP-87
T5693 4771-4778 VB denotes produce
T5692 4768-4770 TO denotes to
T5691 4762-4767 JJ denotes Basic
T5690 4757-4761 JJ denotes pGL3
T5689 4754-4756 IN denotes of
T5688 4748-4753 NNS denotes sites
T5687 4736-4747 NN denotes restriction
T5686 4725-4735 VBP denotes polylinker
T5685 4723-4724 PRP denotes I
T5684 4717-4722 NNP denotes I/Xho
T5683 4713-4716 NNP denotes Kpn
T5682 4709-4712 DT denotes the
T5681 4704-4708 IN denotes into
T5680 4700-4703 CD denotes +92
T5679 4697-4699 TO denotes to
T5678 4694-4696 CD denotes 87
T5677 4693-4694 VBP denotes −
T5676 4685-4692 NNS denotes regions
T5675 4676-4684 NN denotes promoter
T5674 4667-4675 NNP denotes SerpinB2
T5673 4660-4666 NN denotes murine
T5672 4656-4659 DT denotes the
T5671 4647-4655 VB denotes subclone
T5670 4644-4646 TO denotes to
T5669 4639-4643 VBN denotes used
T5668 4634-4638 VBD denotes were
T5667 4630-4633 NNP denotes LUC
T5666 4626-4629 NNP denotes DW3
T5665 4622-4625 CC denotes and
T5664 4615-4621 NNP denotes BSPCR2
T5663 4607-4614 NNS denotes primers
T5662 4603-4606 NNP denotes PCR
T5661 4599-4602 DT denotes The
T5660 4597-4598 . denotes .
T5659 4591-4597 NN denotes ligase
T5658 4587-4590 NNP denotes DNA
T5657 4584-4586 CD denotes T4
T5656 4579-4583 IN denotes with
T5655 4574-4578 VBZ denotes ends
T5654 4567-4573 NN denotes vector
T5653 4563-4566 DT denotes the
T5652 4551-4562 VBG denotes re-ligating
T5651 4547-4550 CC denotes and
T5650 4545-4546 -RRB- denotes )
T5649 4542-4545 NNP denotes NEB
T5648 4541-4542 -LRB- denotes (
T5647 4530-4540 NN denotes polymerase
T5646 4526-4529 NNP denotes DNA
T5645 4523-4525 CD denotes T4
T5644 4518-4522 IN denotes with
T5643 4508-4517 NNS denotes overhangs
T5642 4506-4507 NN denotes ′
T5641 4505-4506 CD denotes 3
T5640 4502-4504 CC denotes or
T5639 4500-4501 NN denotes ′
T5638 4499-4500 CD denotes 5
T5637 4489-4498 JJ denotes resultant
T5636 4485-4488 DT denotes the
T5635 4478-4484 VBG denotes ending
T5634 4472-4477 JJ denotes blunt
T5633 4470-4471 , denotes ,
T5632 4469-4470 -RRB- denotes )
T5631 4457-4469 RB denotes respectively
T5630 4455-4456 PRP denotes I
T5629 4451-4454 NNP denotes Apo
T5628 4447-4450 CC denotes and
T5627 4443-4446 NNP denotes III
T5626 4439-4442 NNP denotes Hae
T5625 4437-4438 , denotes ,
T5624 4436-4437 PRP denotes I
T5623 4432-4435 NNP denotes Pac
T5622 4430-4431 , denotes ,
T5621 4429-4430 PRP denotes I
T5620 4423-4428 NNP denotes Bsu36
T5619 4421-4422 , denotes ,
T5618 4420-4421 PRP denotes I
T5617 4415-4419 NNP denotes BstX
T5616 4413-4414 , denotes ,
T5615 4412-4413 PRP denotes I
T5614 4408-4411 NNP denotes Apa
T5613 4406-4407 , denotes ,
T5612 4405-4406 PRP denotes I
T5611 4401-4404 FW denotes Sfi
T5610 4400-4401 -LRB- denotes (
T5609 4393-4399 NN denotes enzyme
T5608 4381-4392 NN denotes restriction
T5607 4374-4380 JJ denotes second
T5606 4372-4373 DT denotes a
T5605 4368-4371 CC denotes and
T5604 4366-4367 PRP denotes I
T5603 4361-4365 NNP denotes EcoR
T5602 4356-4360 IN denotes with
T5601 4345-4355 NN denotes pGLmP-3261
T5600 4335-4344 VBG denotes digesting
T5599 4332-4334 IN denotes by
T5598 4322-4331 VBN denotes generated
T5597 4317-4321 VBD denotes were
T5596 4315-4316 -RRB- denotes )
T5595 4306-4315 NN denotes pGLmP-189
T5594 4302-4305 CC denotes and
T5593 4292-4301 NN denotes pGLmP-539
T5592 4290-4291 , denotes ,
T5591 4281-4290 NN denotes pGLmP-694
T5590 4279-4280 , denotes ,
T5589 4269-4279 NN denotes pGLmP-1341
T5588 4267-4268 , denotes ,
T5587 4257-4267 NN denotes pGLmP-1686
T5586 4255-4256 , denotes ,
T5585 4245-4255 NN denotes pGLmP-2614
T5584 4243-4244 , denotes ,
T5583 4233-4243 NN denotes pGLmP-2751
T5582 4232-4233 -LRB- denotes (
T5581 4221-4231 NNS denotes constructs
T5580 4212-4220 NN denotes reporter
T5579 4201-4211 NN denotes luciferase
T5578 4192-4200 NNP denotes SerpinB2
T5577 4185-4191 NN denotes murine
T5576 4174-4184 JJ denotes Additional
T5575 4172-4173 . denotes .
T5574 4162-4172 NN denotes pGLmP-4480
T5573 4154-4161 VB denotes produce
T5572 4151-4153 TO denotes to
T5571 4140-4150 NN denotes pGLmP-3261
T5570 4137-4139 IN denotes of
T5569 4135-4136 -RRB- denotes )
T5568 4131-4135 CD denotes 3261
T5567 4130-4131 FW denotes −
T5566 4129-4130 -LRB- denotes (
T5565 4124-4128 NN denotes site
T5564 4122-4123 PRP denotes I
T5563 4117-4121 NNP denotes EcoR
T5562 4108-4116 NN denotes promoter
T5561 4099-4107 NNP denotes SerpinB2
T5560 4095-4098 DT denotes the
T5559 4092-4094 IN denotes of
T5558 4083-4091 RB denotes upstream
T5557 4071-4082 RB denotes immediately
T5556 4060-4070 JJ denotes sub-cloned
T5555 4056-4059 VBD denotes was
T5554 4045-4055 NN denotes pDB9402-42
T5553 4042-4044 IN denotes of
T5552 4035-4041 VBP denotes insert
T5551 4033-4034 PRP denotes I
T5550 4028-4032 NNP denotes EcoR
T5549 4024-4027 DT denotes The
T5548 4022-4023 . denotes .
T5547 4012-4022 NN denotes pGLmP-3261
T5546 4004-4011 VB denotes produce
T5545 4001-4003 TO denotes to
T5544 3999-4000 -RRB- denotes )
T5543 3992-3999 NNP denotes Promega
T5542 3991-3992 -LRB- denotes (
T5541 3985-3990 NNP denotes Basic
T5540 3980-3984 NNP denotes pGL3
T5539 3977-3979 IN denotes of
T5538 3971-3976 NNS denotes sites
T5537 3959-3970 NN denotes restriction
T5536 3948-3958 VBP denotes polylinker
T5535 3946-3947 PRP denotes I
T5534 3940-3945 NNP denotes I/Xho
T5533 3936-3939 NNP denotes Kpn
T5532 3932-3935 DT denotes the
T5531 3927-3931 IN denotes into
T5530 3919-3926 NNP denotes pDB9406
T5529 3914-3918 IN denotes from
T5528 3912-3913 -RRB- denotes )
T5527 3909-3912 CD denotes +92
T5526 3906-3908 TO denotes to
T5525 3901-3905 CD denotes 3261
T5524 3900-3901 FW denotes −
T5523 3899-3900 -LRB- denotes (
T5522 3890-3898 NN denotes promoter
T5521 3881-3889 NNP denotes SerpinB2
T5520 3877-3880 DT denotes the
T5519 3871-3876 VB denotes clone
T5518 3867-3870 CC denotes and
T5517 3859-3866 VB denotes amplify
T5516 3855-3858 NNP denotes PCR
T5515 3852-3854 TO denotes to
T5514 3847-3851 VBN denotes used
T5513 3842-3846 VBD denotes were
T5512 3840-3841 , denotes ,
T5511 3836-3840 NN denotes site
T5510 3824-3835 NN denotes restriction
T5509 3822-3823 PRP denotes I
T5508 3818-3821 NNP denotes Xho
T5507 3815-3817 DT denotes an
T5506 3804-3814 VBG denotes containing
T5505 3802-3803 , denotes ,
T5504 3799-3802 NNP denotes LUC
T5503 3795-3798 NNP denotes DW3
T5502 3791-3794 CC denotes and
T5501 3789-3790 , denotes ,
T5500 3785-3789 NN denotes site
T5499 3773-3784 NN denotes restriction
T5498 3771-3772 PRP denotes I
T5497 3767-3770 NNP denotes Kpn
T5496 3765-3766 DT denotes a
T5495 3754-3764 VBG denotes containing
T5494 3752-3753 , denotes ,
T5493 3749-3752 NNP denotes LUC
T5492 3745-3748 NNP denotes DW5
T5485 3697-3705 NNP denotes SerpinB2
T5484 3694-3696 IN denotes of
T5483 3681-3693 NN denotes Construction
T5785 5286-5287 : denotes :
T5784 5273-5286 NN denotes pGLmP-539mOct
T5783 5271-5272 : denotes ;
T5782 5270-5271 NN denotes b
T5781 5268-5270 CD denotes .1
T5780 5260-5268 NNP denotes mPAI2mPU
T5779 5256-5259 CC denotes and
T5778 5254-5255 DT denotes a
T5777 5252-5254 CD denotes .1
T5776 5244-5252 JJ denotes mPAI2mPU
T5775 5242-5243 : denotes :
T5774 5240-5242 CD denotes .1
T5773 5228-5240 NNP denotes pGLmP-539mPU
T5772 5226-5227 : denotes ;
T5771 5215-5226 NNP denotes mPAI2mEboxb
T5770 5211-5214 CC denotes and
T5769 5199-5210 NNS denotes mPAI2mEboxa
T5768 5197-5198 : denotes :
T5767 5183-5197 NN denotes pGLmP-539mEbox
T5766 5181-5182 : denotes :
T5765 5174-5181 VBZ denotes follows
T5764 5171-5173 IN denotes as
T5763 5166-5170 VBN denotes used
T5762 5161-5165 VBD denotes were
T5761 5157-5160 CC denotes and
T5760 5155-5156 , denotes ,
T5759 5153-5155 CD denotes S1
T5758 5151-5152 . denotes .
T5757 5148-5151 NNP denotes Fig
T5756 5145-5147 IN denotes in
T5755 5136-5144 VBN denotes provided
T5754 5132-5135 VBP denotes are
T5753 5122-5131 NNS denotes sequences
T5752 5115-5121 NN denotes primer
T5751 5111-5114 NNP denotes PCR
T5750 5095-5110 NN denotes oligonucleotide
T5749 5088-5094 JJ denotes mutant
T5748 5084-5087 DT denotes The
T5747 5082-5083 . denotes .
T5746 5081-5082 NNP denotes ]
T5745 5079-5081 CD denotes 36
T5744 5078-5079 NNP denotes [
T5743 5068-5077 VBN denotes described
T5742 5065-5067 IN denotes as
T5741 5055-5064 VBN denotes generated
T5740 5050-5054 VBD denotes were
T5739 5048-5049 -RRB- denotes )
T5738 5036-5048 RB denotes respectively
T5737 5032-5035 NNP denotes EBP
T5736 5031-5032 NN denotes /
T5735 5020-5031 JJ denotes pGLmP-539mC
T5734 5016-5019 CC denotes and
T5733 5002-5015 JJ denotes pGLmP-539mOct
T5732 5000-5001 , denotes ,
T5731 4998-5000 CD denotes .1
T5730 4986-4998 NNP denotes pGLmP-539mPU
T5729 4984-4985 , denotes ,
T5728 4970-4984 NNP denotes pGLmP-539mEbox
T5727 4969-4970 -LRB- denotes (
T5726 4963-4968 NNP denotes C/EBP
T5725 4959-4962 CC denotes and
T5724 4953-4958 NN denotes Oct-1
T5723 4951-4952 , denotes ,
T5722 4949-4951 CD denotes .1
T5721 4947-4949 NNP denotes PU
T5720 4945-4946 , denotes ,
T5719 4942-4945 NN denotes box
T5718 4940-4941 NNP denotes E
T5717 4932-4939 NNS denotes regions
T5716 4917-4931 JJ denotes LPS-responsive
T5715 4908-4916 NN denotes promoter
T5714 4899-4907 NNP denotes SerpinB2
T5713 4895-4898 DT denotes the
T5712 4892-4894 IN denotes in
T5711 4882-4891 NNS denotes mutations
T5710 4871-4881 VBG denotes containing
T5709 4860-4870 VBZ denotes constructs
T5708 4851-4859 NN denotes reporter
T5491 3737-3744 VBZ denotes primers
T5490 3733-3736 NNP denotes PCR
T5489 3729-3732 NNP denotes The
T5488 3720-3728 NNP denotes Plasmids
T5487 3715-3719 NNP denotes Gene
T5486 3706-3714 NNP denotes Reporter
T4651 3678-3679 . denotes .
T4650 3677-3678 -RRB- denotes )
T4649 3673-3677 NNP denotes Inc.
T4648 3671-3672 , denotes ,
T4647 3661-3671 NNP denotes Technology
T4646 3651-3660 NNP denotes Signaling
T4645 3646-3650 NNP denotes Cell
T4644 3645-3646 -LRB- denotes (
T4643 3637-3644 NN denotes tubulin
T4551 3124-3125 -RRB- denotes )
T4550 3114-3124 NNP denotes Invitrogen
T4549 3113-3114 -LRB- denotes (
T4548 3108-3112 NNS denotes gels
T4547 3101-3107 NNP denotes NuPAGE
T4546 3092-3100 NNP denotes Bis-Tris
T4545 3090-3091 NN denotes %
T4544 3088-3090 CD denotes 12
T4543 3086-3087 CD denotes 4
T4542 3083-3085 IN denotes on
T4541 3073-3082 VBN denotes separated
T4540 3068-3072 VBD denotes were
T4539 3059-3067 NNS denotes proteins
T4538 3057-3058 , denotes ,
T4537 3056-3057 -RRB- denotes )
T4536 3053-3056 NNP denotes SDS
T4535 3051-3052 NN denotes %
T4534 3048-3051 CD denotes 0.1
T4533 3046-3047 , denotes ,
T4532 3034-3046 NN denotes deoxycholate
T4531 3032-3033 NN denotes %
T4530 3029-3032 CD denotes 0.5
T4529 3027-3028 , denotes ,
T4528 3022-3027 NN denotes NP-40
T4527 3020-3021 NN denotes %
T4526 3017-3020 CD denotes 0.5
T4525 3015-3016 , denotes ,
T4524 3010-3015 NNP denotes X-100
T4523 3003-3009 NNP denotes Triton
T4522 3002-3003 NN denotes %
T4521 3001-3002 CD denotes 1
T4520 2999-3000 , denotes ,
T4519 2995-2999 NNP denotes NaCl
T4518 2992-2994 NNP denotes mM
T4517 2988-2991 CD denotes 150
T4516 2986-2987 , denotes ,
T4515 2982-2986 NNP denotes Tris
T4514 2979-2981 NNP denotes mM
T4513 2976-2978 CD denotes 10
T4512 2975-2976 -LRB- denotes (
T4511 2968-2974 NN denotes buffer
T4510 2963-2967 NNP denotes RIPA
T4509 2960-2962 IN denotes in
T4508 2951-2959 VBN denotes prepared
T4239 2904-2905 . denotes .
T4238 2896-2904 CD denotes AF339731
T4237 2894-2895 . denotes .
T4236 2892-2894 NNP denotes No
T4235 2882-2891 NNP denotes Accession
T4234 2877-2881 IN denotes with
T4233 2872-2876 NNP denotes Bank
T4232 2867-2871 NNP denotes Data
T4231 2849-2866 NNP denotes GenBank/EMBL/DDBJ
T4230 2846-2848 IN denotes in
T4229 2836-2845 VBN denotes deposited
T4228 2832-2835 VBD denotes was
T4227 2823-2831 NN denotes sequence
T4226 2818-2822 DT denotes This
T4225 2816-2817 . denotes .
T4224 2815-2816 -RRB- denotes )
T4223 2803-2815 NNP denotes Perkin-Elmer
T4222 2802-2803 -LRB- denotes (
T4221 2792-2801 NN denotes sequencer
T4220 2787-2791 NNP denotes 373A
T4219 2784-2786 NNP denotes PE
T4218 2782-2783 DT denotes a
T4217 2778-2781 CC denotes and
T4216 2776-2777 -RRB- denotes )
T4215 2764-2776 NNP denotes Perkin-Elmer
T4214 2763-2764 -LRB- denotes (
T4213 2759-2762 NN denotes kit
T4212 2750-2758 NN denotes reaction
T4211 2744-2749 JJ denotes ready
T4210 2733-2743 VBG denotes sequencing
T4209 2727-2732 NN denotes cycle
T4208 2716-2726 NN denotes terminator
T4207 2712-2715 NN denotes dye
T4206 2706-2711 NNP denotes PRISM
T4205 2702-2705 NNP denotes ABI
T4204 2698-2701 DT denotes the
T4203 2692-2697 VBG denotes using
T4202 2681-2691 VBN denotes determined
T4201 2677-2680 VBD denotes was
T4200 2670-2676 NN denotes region
T4199 2661-2669 NN denotes flanking
T4198 2659-2660 NN denotes ′
T4197 2658-2659 CD denotes 5
T4196 2653-2657 NN denotes gene
T4195 2644-2652 NNP denotes SerpinB2
T4194 2637-2643 NN denotes murine
T4193 2634-2636 NN denotes bp
T4192 2629-2633 CD denotes 4480
T4191 2625-2628 DT denotes the
T4190 2622-2624 IN denotes of
T4189 2613-2621 NN denotes sequence
T4188 2602-2612 NN denotes nucleotide
T4187 2598-2601 DT denotes The
T4186 2596-2597 . denotes .
T4185 2586-2596 NN denotes sequencing
T4184 2582-2585 NN denotes DNA
T4183 2578-2581 CC denotes and
T4182 2568-2577 NN denotes digestion
T4181 2561-2567 NN denotes enzyme
T4180 2549-2560 NN denotes restriction
T4179 2546-2548 IN denotes by
T4178 2537-2545 VBN denotes verified
T4177 2532-2536 VBD denotes were
T4176 2524-2531 NNS denotes inserts
T4175 2514-2523 VBN denotes Subcloned
T4174 2512-2513 . denotes .
T4173 2500-2512 NNS denotes orientations
T4172 2491-2499 JJ denotes opposite
T4171 2488-2490 IN denotes in
T4170 2481-2487 VBN denotes cloned
T4169 2479-2480 , denotes ,
T4168 2471-2479 NN denotes fragment
T4167 2465-2470 NNP denotes EcoRI
T4166 2457-2464 NNP denotes pDB9406
T4165 2453-2456 DT denotes the
T4164 2450-2452 IN denotes of
T4163 2441-2449 RB denotes upstream
T4162 2429-2440 RB denotes immediately
T4161 2421-2428 VBN denotes located
T4160 2419-2420 , denotes ,
T4159 2411-2419 NN denotes fragment
T4158 2403-2410 JJ denotes genomic
T4157 2397-2402 NNP denotes EcoRI
T4156 2394-2396 NN denotes kb
T4155 2390-2393 CD denotes 1.2
T4154 2388-2389 DT denotes a
T4153 2380-2387 VBP denotes contain
T4152 2369-2379 NN denotes pDB9402-42
T4151 2365-2368 CC denotes and
T4150 2354-2364 NN denotes pDB9402-41
T4149 2352-2353 : denotes ;
T4148 2348-2352 NN denotes site
T4147 2337-2347 NN denotes initiation
T4146 2323-2336 NN denotes transcription
T4145 2319-2322 DT denotes the
T4144 2310-2318 VBG denotes spanning
T4143 2301-2309 NN denotes fragment
T4142 2293-2300 JJ denotes genomic
T4141 2282-2292 NNP denotes EcoRI/SpeI
T4140 2279-2281 NN denotes kb
T4139 2275-2278 CD denotes 4.4
T4138 2273-2274 DT denotes a
T4137 2264-2272 VBZ denotes contains
T4136 2256-2263 JJ denotes pDB9406
T4135 2254-2255 . denotes .
T4134 2248-2254 NNP denotes Geneva
T4133 2245-2247 IN denotes of
T4132 2234-2244 NNP denotes University
T4131 2232-2233 , denotes ,
T4130 2227-2232 NNP denotes Belin
T4129 2217-2226 NNP denotes Dominique
T4128 2213-2216 NNP denotes Dr.
T4127 2210-2212 IN denotes by
T4126 2201-2209 VBN denotes provided
T4125 2194-2200 RB denotes kindly
T4124 2189-2193 VBD denotes were
T4123 2187-2188 , denotes ,
T4122 2181-2187 NN denotes strain
T4121 2175-2180 NN denotes mouse
T4642 3635-3636 FW denotes β
T4641 3634-3635 FW denotes /
T4640 3633-3634 VB denotes α
T4639 3629-3632 CC denotes and
T4638 3627-3628 -RRB- denotes )
T4637 3622-3627 NNP denotes GAPDH
T4636 3621-3622 -LRB- denotes (
T4635 3607-3620 NN denotes dehydrogenase
T4634 3580-3606 JJ denotes glyceraldehyde-3-phosphate
T4633 3578-3579 , denotes ,
T4632 3577-3578 -RRB- denotes )
T4631 3562-3577 NNPS denotes Biotechnologies
T4630 3557-3561 NNP denotes Cruz
T4629 3551-3556 NNP denotes Santa
T4628 3550-3551 -LRB- denotes (
T4627 3548-3549 -RRB- denotes )
T4626 3542-3548 JJ denotes sc-150
T4625 3541-3542 -LRB- denotes (
T4624 3539-3540 NN denotes β
T4623 3538-3539 : denotes -
T4622 3533-3538 SYM denotes C/EBP
T4621 3531-3532 : denotes :
T4620 3524-3531 VBP denotes include
T4619 3517-3523 NNS denotes assays
T4618 3512-3516 NN denotes blot
T4617 3504-3511 JJ denotes western
T4616 3500-3503 IN denotes for
T4615 3495-3499 VBN denotes used
T4614 3484-3494 NNS denotes antibodies
T4613 3478-3483 JJ denotes Other
T4612 3476-3477 . denotes .
T4611 3475-3476 NNP denotes ]
T4610 3473-3475 CD denotes 35
T4609 3472-3473 NNP denotes [
T4608 3469-3471 IN denotes in
T4607 3466-3468 IN denotes as
T4606 3461-3465 NNS denotes coli
T4605 3458-3460 NNP denotes E.
T4604 3455-3457 IN denotes in
T4603 3446-3454 VBN denotes produced
T4602 3438-3445 NN denotes protein
T4601 3431-3437 NN denotes fusion
T4600 3422-3430 NNP denotes SerpinB2
T4599 3411-3421 NNP denotes GST-murine
T4598 3399-3410 JJ denotes recombinant
T4597 3390-3398 JJ denotes purified
T4596 3388-3389 DT denotes a
T4595 3383-3387 IN denotes with
T4594 3370-3382 NN denotes immunization
T4593 3364-3369 IN denotes after
T4592 3355-3363 VBN denotes prepared
T4591 3350-3354 VBD denotes were
T4590 3339-3349 NNS denotes antibodies
T4589 3330-3338 NNP denotes SerpinB2
T4588 3319-3329 JJ denotes anti-mouse
T4587 3312-3318 NN denotes rabbit
T4586 3303-3311 VBD denotes purified
T4585 3294-3302 NNP denotes Affinity
T4584 3292-3293 . denotes .
T4583 3283-3292 JJ denotes overnight
T4582 3272-3282 NNS denotes antibodies
T4581 3264-3271 JJ denotes primary
T4580 3259-3263 IN denotes with
T4579 3249-3258 VBN denotes incubated
T4578 3245-3248 CC denotes and
T4577 3243-3244 , denotes ,
T4576 3242-3243 -RRB- denotes )
T4575 3234-3242 NN denotes Tween-20
T4574 3232-3233 NN denotes %
T4573 3229-3232 CD denotes 0.1
T4572 3227-3228 , denotes ,
T4571 3224-3227 NNP denotes PBS
T4570 3221-3223 NNP denotes 1X
T4569 3220-3221 -LRB- denotes (
T4568 3214-3219 NNP denotes PBS-T
T4567 3211-3213 IN denotes in
T4566 3206-3210 NN denotes milk
T4565 3204-3205 NN denotes %
T4564 3203-3204 CD denotes 5
T4563 3198-3202 IN denotes with
T4562 3190-3197 VBN denotes blocked
T4561 3177-3189 RB denotes subsequently
T4560 3172-3176 VBD denotes were
T4559 3162-3171 NNS denotes Membranes
T4558 3160-3161 . denotes .
T4557 3151-3160 NNS denotes membranes
T4556 3146-3150 NNP denotes PVDF
T4555 3143-3145 TO denotes to
T4554 3131-3142 VBD denotes transferred
T4553 3127-3130 CC denotes and
T4552 3125-3126 , denotes ,
T4120 2171-2174 CD denotes 129
T4119 2169-2170 DT denotes a
T4118 2164-2168 IN denotes from
T4117 2155-2163 VBN denotes prepared
T4116 2147-2154 NN denotes library
T4115 2139-2146 JJ denotes genomic
T4114 2137-2138 -RRB- denotes )
T4113 2127-2137 NNP denotes Stratagene
T4112 2126-2127 -LRB- denotes (
T4111 2119-2125 NNP denotes λFIXII
T4110 2117-2118 DT denotes a
T4109 2112-2116 IN denotes from
T4108 2103-2111 VBD denotes isolated
T4107 2099-2102 NNP denotes DNA
T4106 2091-2098 JJ denotes genomic
T4105 2080-2090 VBG denotes containing
T4104 2069-2079 NNP denotes pDB9402-42
T4103 2065-2068 CC denotes and
T4102 2054-2064 NNP denotes pDB9402-41
T4101 2052-2053 , denotes ,
T4100 2045-2052 NNP denotes pDB9406
T4099 2036-2044 NNP denotes Plasmids
T4098 2034-2035 . denotes .
T4097 2025-2034 NN denotes digestion
T4096 2021-2024 NNP denotes III
T4095 2009-2020 NN denotes exonuclease
T4063 1781-1789 NN denotes sequence
T4062 1777-1780 NNP denotes DNA
T4061 1773-1776 NNP denotes The
T4060 1764-1772 NNP denotes Analysis
T4059 1755-1763 NNP denotes Sequence
T3794 1748-1749 . denotes .
T3793 1747-1748 -RRB- denotes )
T3792 1737-1747 NNPS denotes Biosystems
T3791 1729-1736 NNP denotes Applied
T3790 1728-1729 -LRB- denotes (
T3789 1726-1727 -RRB- denotes )
T3788 1713-1726 NNP denotes Mm00607939_s1
T3787 1712-1713 -LRB- denotes (
T3786 1704-1711 JJ denotes β-actin
T3785 1700-1703 CC denotes and
T3784 1698-1699 -RRB- denotes )
T3783 1685-1698 NNP denotes Mm00843434_s1
T3782 1684-1685 -LRB- denotes (
T3781 1678-1683 NNP denotes Cebpb
T3780 1676-1677 , denotes ,
T3779 1675-1676 -RRB- denotes )
T3778 1662-1675 NNP denotes Mm00440905_m1
T3777 1661-1662 -LRB- denotes (
T3776 1643-1660 NNP denotes Serpinb2/SerpinB2
T3775 1639-1642 IN denotes for
T3774 1631-1638 NNS denotes primers
T3773 1627-1630 NNP denotes 20X
T3772 1616-1626 NNP denotes Expression
T3771 1611-1615 NNP denotes Gene
T3770 1609-1610 NNP denotes ®
T3769 1603-1609 NNP denotes TaqMan
T3768 1597-1602 VBG denotes using
T3767 1587-1596 VBN denotes performed
T3766 1583-1586 VBD denotes was
T3765 1578-1582 NNP denotes qPCR
T3764 1576-1577 . denotes .
T3763 1575-1576 -RRB- denotes )
T3762 1565-1575 NNPS denotes Biosystems
T3761 1557-1564 NNP denotes Applied
T3760 1556-1557 -LRB- denotes (
T3759 1547-1555 NNP denotes Reagents
T3758 1533-1546 NNP denotes Transcription
T3757 1525-1532 VB denotes Reverse
T3756 1523-1524 NNP denotes ®
T3755 1517-1523 NNP denotes TaqMan
T3754 1511-1516 VBG denotes using
T3753 1499-1510 VBN denotes transcribed
T3752 1491-1498 JJ denotes reverse
T3751 1487-1490 VBD denotes was
T3750 1483-1486 NNP denotes RNA
T3749 1477-1482 JJ denotes total
T3748 1474-1476 IN denotes of
T3747 1471-1473 NN denotes µg
T3746 1469-1470 CD denotes 1
T3745 1467-1468 , denotes ,
T3744 1458-1467 NN denotes synthesis
T3743 1453-1457 NNP denotes cDNA
T3742 1449-1452 IN denotes For
T3741 1447-1448 . denotes .
T3740 1442-1447 NNS denotes cells
T3739 1437-1441 IN denotes from
T3738 1433-1436 NNP denotes RNA
T3737 1427-1432 JJ denotes total
T3736 1419-1426 VB denotes isolate
T3735 1416-1418 TO denotes to
T3734 1411-1415 VBN denotes used
T3733 1407-1410 VBD denotes was
T3732 1405-1406 -RRB- denotes )
T3731 1399-1405 NNP denotes Qiagen
T3730 1398-1399 -LRB- denotes (
T3729 1394-1397 NNP denotes Kit
T3728 1389-1393 NNP denotes Mini
T3727 1382-1388 NNP denotes RNeasy
T3726 1378-1381 DT denotes The
T3725 1376-1377 -RRB- denotes )
T3724 1372-1376 NNP denotes qPCR
T3723 1371-1372 -LRB- denotes (
T3722 1367-1370 NNP denotes PCR
T3721 1354-1366 JJ denotes Quantitative
T3720 1344-1353 JJ denotes Real-time
T4094 2006-2008 IN denotes by
T4093 1995-2005 VBN denotes introduced
T4092 1985-1994 NNS denotes deletions
T4091 1974-1984 VBG denotes containing
T4090 1963-1973 NN denotes pDB9402-42
T4089 1959-1962 CC denotes and
T4088 1948-1958 NN denotes pDB9402-41
T4087 1943-1947 IN denotes from
T4086 1934-1942 VBN denotes prepared
T4085 1925-1933 NNS denotes plasmids
T4084 1922-1924 TO denotes to
T4083 1913-1921 NN denotes addition
T4082 1910-1912 IN denotes in
T4081 1908-1909 , denotes ,
T4080 1898-1908 NNP denotes pDB9402-42
T4079 1894-1897 CC denotes and
T4078 1883-1893 NNP denotes pDB9402-41
T4077 1881-1882 , denotes ,
T4076 1874-1881 NNP denotes pDB9406
T4075 1865-1873 NNS denotes plasmids
T4074 1855-1864 JJ denotes pUC-based
T4073 1851-1854 DT denotes the
T4072 1840-1850 VBG denotes sequencing
T4071 1837-1839 IN denotes by
T4070 1826-1836 VBN denotes determined
T4069 1822-1825 VBD denotes was
T4068 1813-1821 NN denotes promoter
T4067 1804-1812 NNP denotes SerpinB2
T4066 1797-1803 NN denotes murine
T4065 1793-1796 DT denotes the
T4064 1790-1792 IN denotes of
T3561 1341-1342 . denotes .
T3560 1336-1341 NNP denotes Sigma
T3559 1331-1335 IN denotes from
T3558 1322-1330 VBN denotes obtained
T3557 1318-1321 VBD denotes was
T3556 1316-1317 -RRB- denotes )
T3555 1311-1316 NNP denotes Re595
T3554 1304-1310 NNP denotes Strain
T3553 1294-1303 NN denotes minnesota
T3552 1283-1293 NN denotes Salmonella
T3551 1282-1283 -LRB- denotes (
T3550 1280-1281 -RRB- denotes )
T3549 1277-1280 NNP denotes LPS
T3548 1276-1277 -LRB- denotes (
T3547 1257-1275 NN denotes lipopolysaccharide
T3546 1247-1256 JJ denotes Bacterial
T3545 1245-1246 . denotes .
T3544 1244-1245 -RRB- denotes )
T3543 1239-1244 NNP denotes Lonza
T3542 1238-1239 -LRB- denotes (
T3541 1234-1237 NNP denotes Kit
T3540 1224-1233 NNP denotes Detection
T3539 1214-1223 NNP denotes MycoAlert
T3538 1210-1213 DT denotes the
T3537 1206-1209 CC denotes and
T3536 1204-1205 -RRB- denotes )
T3535 1199-1204 NNP denotes Sigma
T3534 1198-1199 -LRB- denotes (
T3533 1192-1197 CD denotes 33258
T3532 1186-1191 VB denotes stain
T3531 1178-1185 NNP denotes Hoechst
T3530 1172-1177 VBG denotes using
T3529 1163-1171 NN denotes staining
T3528 1155-1162 JJ denotes nuclear
T3527 1152-1154 IN denotes by
T3526 1142-1151 NN denotes infection
T3525 1131-1141 NNP denotes Mycoplasma
T3524 1123-1130 VB denotes exclude
T3523 1120-1122 TO denotes to
T3522 1112-1119 VBN denotes checked
T3521 1102-1111 RB denotes routinely
T3520 1097-1101 VBD denotes were
T3519 1088-1096 NNS denotes cultures
T3518 1084-1087 DT denotes All
T3517 1082-1083 . denotes .
T3516 1076-1082 NN denotes method
T3515 1066-1075 NN denotes exclusion
T3514 1062-1065 NN denotes dye
T3513 1060-1061 -RRB- denotes )
T3512 1055-1060 NNP denotes Sigma
T3511 1054-1055 -LRB- denotes (
T3477 838-843 NNS denotes media
T3476 829-837 CD denotes DMEM/F12
T3475 827-828 NN denotes %
T3474 825-827 CD denotes 50
T3473 822-824 IN denotes in
T3472 811-821 VBD denotes maintained
T3471 807-810 CC denotes and
T3470 805-806 , denotes ,
T3469 800-805 RB denotes later
T3468 795-799 NNS denotes days
T3467 793-794 CD denotes 5
T3466 791-792 CD denotes 3
T3465 784-790 NN denotes lavage
T3464 773-783 JJ denotes peritoneal
T3463 770-772 IN denotes by
T3462 761-769 VBN denotes followed
T3461 755-760 NN denotes broth
T3460 740-754 NN denotes thioglycollate
T3459 738-739 NN denotes %
T3458 737-738 CD denotes 3
T3457 732-736 IN denotes with
T3456 727-731 NNS denotes mice
T3455 719-726 NNP denotes C57BL/6
T3454 709-718 VBG denotes injecting
T3453 706-708 IN denotes by
T3452 697-705 VBN denotes obtained
T3451 692-696 VBD denotes were
T3450 680-691 NNS denotes macrophages
T3449 669-679 JJ denotes peritoneal
T3448 661-668 JJ denotes Primary
T3447 659-660 . denotes .
T3446 658-659 -RRB- denotes )
T3445 651-658 NNP denotes Cellgro
T3444 650-651 -LRB- denotes (
T3443 641-649 NN denotes solution
T3442 607-640 JJ denotes penicillin/streptomycin/glutamate
T3441 605-606 NN denotes %
T3440 604-605 CD denotes 1
T3439 600-603 CC denotes and
T3438 594-599 NN denotes serum
T3437 587-593 JJ denotes bovine
T3436 581-586 JJ denotes fetal
T3435 579-580 NN denotes %
T3434 577-579 CD denotes 10
T3433 572-576 IN denotes with
T3432 559-571 VBN denotes supplemented
T3431 557-558 -RRB- denotes )
T3430 547-557 NNP denotes Invitrogen
T3429 546-547 -LRB- denotes (
T3428 539-545 NN denotes medium
T3427 536-538 POS denotes 's
T3426 531-536 NNP denotes Eagle
T3425 522-530 VBN denotes modified
T3424 519-521 POS denotes 's
T3423 511-519 NNP denotes Dulbecco
T3422 508-510 IN denotes in
T3421 502-507 VBN denotes grown
T3420 497-501 VBD denotes were
T3419 495-496 NNP denotes ]
T3418 493-495 CD denotes 34
T3417 492-493 NNP denotes [
T3416 490-491 -RRB- denotes )
T3415 486-490 NNS denotes MEFs
T3414 485-486 -LRB- denotes (
T3413 473-484 NNS denotes fibroblasts
T3412 463-472 JJ denotes embryonic
T3411 457-462 NN denotes mouse
T3410 455-456 -RRB- denotes )
T3409 454-455 NN denotes −
T3408 453-454 CD denotes /
T3407 452-453 VBD denotes −
T3406 447-452 NNP denotes Cebpb
T3405 446-447 -LRB- denotes (
T3404 437-445 NN denotes knockout
T3403 433-436 CC denotes and
T3402 431-432 -RRB- denotes )
T3401 430-431 NNP denotes +
T3400 429-430 NNP denotes /
T3399 428-429 NNP denotes +
T3398 423-428 NNP denotes Cebpb
T3397 422-423 -LRB- denotes (
T3396 412-421 NNP denotes Wild-type
T3395 409-411 NNP denotes C.
T3394 408-409 NN denotes °
T3393 406-408 CD denotes 37
T3392 403-405 IN denotes at
T3391 392-402 NN denotes atmosphere
T3390 388-391 NN denotes air
T3389 377-387 JJ denotes humidified
T3388 375-376 NN denotes %
T3387 373-375 CD denotes 95
T3386 369-372 CC denotes and
T3385 365-368 CD denotes CO2
T3384 363-364 NN denotes %
T3383 362-363 CD denotes 5
T3382 359-361 IN denotes in
T3381 357-358 , denotes ,
T3380 346-357 NN denotes bicarbonate
T3379 339-345 NN denotes sodium
T3378 336-338 NN denotes mM
T3377 333-335 CD denotes 25
T3376 329-332 CC denotes and
T3375 327-328 -RRB- denotes )
T3374 322-327 NNS denotes HEPES
T3373 321-322 -LRB- denotes (
T3372 316-320 NN denotes acid
T3371 306-315 JJ denotes sulphonic
T3370 268-305 NNP denotes N-2-hydroxyethylpiperazine-N-2-ethane
T3369 265-267 NNP denotes mM
T3368 262-264 CD denotes 25
T3367 260-261 , denotes ,
T3366 248-260 NN denotes streptomycin
T3365 245-247 NN denotes ml
T3364 244-245 NN denotes /
T3363 242-244 NN denotes µg
T3362 238-241 CD denotes 100
T3361 236-237 , denotes ,
T3360 226-236 NN denotes penicillin
T3359 223-225 NN denotes ml
T3358 222-223 NN denotes /
T3357 220-222 NN denotes µg
T3356 216-219 CD denotes 200
T3355 214-215 , denotes ,
T3354 213-214 -RRB- denotes )
T3353 201-213 NNP denotes BioWhittaker
T3352 200-201 -LRB- denotes (
T3351 192-199 NN denotes supreme
T3350 186-191 NN denotes serum
T3349 184-185 NN denotes %
T3348 182-184 CD denotes 10
T3347 180-181 , denotes ,
T3346 179-180 -RRB- denotes )
T3345 176-179 NNP denotes BRL
T3344 170-175 NNP denotes Gibco
T3343 169-170 -LRB- denotes (
T3342 157-168 NNP denotes L-glutamine
T3341 154-156 NNP denotes mM
T3340 152-153 CD denotes 2
T3339 147-151 IN denotes with
T3338 134-146 VBN denotes supplemented
T3337 132-133 , denotes ,
T3336 131-132 -RRB- denotes )
T3335 128-131 NNP denotes BRL
T3334 122-127 NNP denotes Gibco
T3333 121-122 -LRB- denotes (
T3332 115-120 NNS denotes media
T3331 110-114 CD denotes 1640
T3330 105-109 NNP denotes RPMI
T3329 102-104 IN denotes in
T3328 91-101 VBN denotes maintained
T3327 86-90 VBD denotes were
T3326 84-85 -RRB- denotes )
T3325 78-84 CD denotes TIB-71
T3324 73-77 NNP denotes ATCC
T3323 72-73 -LRB- denotes (
T3322 66-71 NNS denotes cells
T3321 60-65 CD denotes 264.7
T3320 56-59 NNP denotes RAW
T3319 45-55 NN denotes macrophage
T3318 38-44 NNP denotes Murine
T3317 30-37 NNP denotes Culture
T3316 25-29 NNP denotes Cell
T3510 1049-1053 NN denotes blue
T3509 1042-1048 NN denotes trypan
T3508 1038-1041 DT denotes the
T3507 1032-1037 VBG denotes using
T3506 1021-1031 VBN denotes determined
T3505 1017-1020 VBD denotes was
T3504 1007-1016 NN denotes viability
T3503 1002-1006 NNP denotes Cell
T3502 1000-1001 . denotes .
T3501 995-1000 NN denotes serum
T3500 986-994 JJ denotes LPS-free
T3499 976-985 VBN denotes certified
T3498 973-975 IN denotes of
T3497 969-972 NN denotes use
T3496 965-968 DT denotes the
T3495 957-964 IN denotes through
T3494 948-956 NNS denotes cultures
T3493 943-947 NN denotes cell
T3492 939-942 DT denotes all
T3491 934-938 IN denotes from
T3490 920-933 NN denotes contamination
T3489 901-919 NN denotes lipopolysaccharide
T3488 891-900 JJ denotes bacterial
T3487 883-890 VB denotes exclude
T3486 880-882 TO denotes to
T3481 854-855 -RRB- denotes )
T3480 851-854 NNP denotes BRL
T3479 845-850 NNP denotes Gibco
T3478 844-845 -LRB- denotes (
T4507 2946-2950 VBD denotes were
T4506 2938-2945 NNS denotes lysates
T4505 2933-2937 NN denotes cell
T4504 2927-2932 NNP denotes Whole
T4503 2920-2926 NNP denotes Assays
T4502 2915-2919 NNP denotes Blot
T4501 2907-2914 JJ denotes Western
T4058 1751-1754 NNP denotes DNA
T3485 874-879 VBN denotes taken
T3484 869-873 VBD denotes were
T3483 857-868 NNS denotes Precautions
T3482 855-856 . denotes .
T8977 12078-12079 . denotes .
T8976 12067-12078 JJ denotes significant
T8975 12056-12066 VBN denotes considered
T8974 12051-12055 VBD denotes were
T8973 12046-12050 CD denotes 0.05
T8972 12045-12046 VBP denotes <
R2376 T3316 T3320 compound Cell,RAW
R2377 T3317 T3318 compound Culture,Murine
R2378 T3318 T3320 compound Murine,RAW
R2379 T3319 T3320 compound macrophage,RAW
R2380 T3320 T3328 nsubjpass RAW,maintained
R2381 T3321 T3322 nummod 264.7,cells
R2382 T3322 T3320 appos cells,RAW
R2383 T3323 T3320 punct (,RAW
R2384 T3324 T3320 appos ATCC,RAW
R2385 T3325 T3324 nummod TIB-71,ATCC
R2386 T3326 T3320 punct ),RAW
R2387 T3327 T3328 auxpass were,maintained
R2388 T3328 T3328 ROOT maintained,maintained
R2389 T3329 T3328 prep in,maintained
R2390 T3330 T3332 nmod RPMI,media
R2391 T3331 T3332 compound 1640,media
R2392 T3332 T3329 pobj media,in
R2393 T3333 T3335 punct (,BRL
R2394 T3334 T3335 compound Gibco,BRL
R2395 T3335 T3332 appos BRL,media
R2396 T3336 T3332 punct ),media
R2397 T3337 T3328 punct ",",maintained
R2398 T3338 T3328 conj supplemented,maintained
R2399 T3339 T3338 prep with,supplemented
R2400 T3340 T3342 nummod 2,L-glutamine
R2401 T3341 T3342 compound mM,L-glutamine
R2402 T3342 T3339 pobj L-glutamine,with
R2403 T3343 T3342 punct (,L-glutamine
R2404 T3344 T3345 compound Gibco,BRL
R2405 T3345 T3342 appos BRL,L-glutamine
R2406 T3346 T3342 punct ),L-glutamine
R2407 T3347 T3342 punct ",",L-glutamine
R2408 T3348 T3349 nummod 10,%
R2409 T3349 T3351 compound %,supreme
R2410 T3350 T3351 compound serum,supreme
R2411 T3351 T3342 appos supreme,L-glutamine
R2412 T3352 T3353 punct (,BioWhittaker
R2413 T3353 T3351 appos BioWhittaker,supreme
R2414 T3354 T3353 punct ),BioWhittaker
R2415 T3355 T3351 punct ",",supreme
R2416 T3356 T3360 nummod 200,penicillin
R2417 T3357 T3360 compound µg,penicillin
R2418 T3358 T3360 compound /,penicillin
R2419 T3359 T3360 compound ml,penicillin
R2420 T3360 T3351 conj penicillin,supreme
R2421 T3361 T3360 punct ",",penicillin
R2422 T3362 T3363 nummod 100,µg
R2423 T3363 T3366 nmod µg,streptomycin
R2424 T3364 T3366 nmod /,streptomycin
R2425 T3365 T3366 compound ml,streptomycin
R2426 T3366 T3360 conj streptomycin,penicillin
R2427 T3367 T3366 punct ",",streptomycin
R2428 T3368 T3372 nummod 25,acid
R2429 T3369 T3372 nmod mM,acid
R2430 T3370 T3372 nmod N-2-hydroxyethylpiperazine-N-2-ethane,acid
R2431 T3371 T3372 amod sulphonic,acid
R2432 T3372 T3380 nmod acid,bicarbonate
R2433 T3373 T3374 punct (,HEPES
R2434 T3374 T3372 appos HEPES,acid
R2435 T3375 T3374 punct ),HEPES
R2436 T3376 T3374 cc and,HEPES
R2437 T3377 T3380 nummod 25,bicarbonate
R2438 T3378 T3380 compound mM,bicarbonate
R2439 T3379 T3380 compound sodium,bicarbonate
R2440 T3380 T3366 conj bicarbonate,streptomycin
R2441 T3381 T3342 punct ",",L-glutamine
R2442 T3382 T3338 prep in,supplemented
R2443 T3383 T3384 nummod 5,%
R2444 T3384 T3382 pobj %,in
R2445 T3385 T3391 nummod CO2,atmosphere
R2446 T3386 T3385 cc and,CO2
R2447 T3387 T3388 nummod 95,%
R2448 T3388 T3391 nmod %,atmosphere
R2449 T3389 T3391 amod humidified,atmosphere
R2450 T3390 T3391 compound air,atmosphere
R2451 T3391 T3391 ROOT atmosphere,atmosphere
R2452 T3392 T3391 prep at,atmosphere
R2453 T3393 T3394 nummod 37,°
R2454 T3394 T3396 compound °,Wild-type
R2455 T3395 T3396 compound C.,Wild-type
R2456 T3396 T3392 pobj Wild-type,at
R2457 T3397 T3396 punct (,Wild-type
R2458 T3398 T3401 compound Cebpb,+
R2459 T3399 T3401 compound +,+
R2460 T3400 T3401 compound /,+
R2461 T3401 T3396 appos +,Wild-type
R2462 T3402 T3396 punct ),Wild-type
R2463 T3403 T3391 cc and,atmosphere
R2464 T3404 T3391 conj knockout,atmosphere
R2465 T3405 T3391 punct (,atmosphere
R2466 T3406 T3407 nsubj Cebpb,−
R2467 T3407 T3391 appos −,atmosphere
R2468 T3408 T3409 nummod /,−
R2469 T3409 T3407 appos −,−
R2470 T3410 T3407 punct ),−
R2471 T3411 T3413 nmod mouse,fibroblasts
R2472 T3412 T3413 amod embryonic,fibroblasts
R2473 T3413 T3391 appos fibroblasts,atmosphere
R2474 T3414 T3413 punct (,fibroblasts
R2475 T3415 T3413 appos MEFs,fibroblasts
R2476 T3416 T3413 punct ),fibroblasts
R2477 T3417 T3419 nmod [,]
R2478 T3418 T3419 nummod 34,]
R2479 T3419 T3421 nsubjpass ],grown
R2480 T3420 T3421 auxpass were,grown
R2481 T3421 T3421 ROOT grown,grown
R2482 T3422 T3421 prep in,grown
R2483 T3423 T3428 poss Dulbecco,medium
R2484 T3424 T3423 case 's,Dulbecco
R2485 T3425 T3428 amod modified,medium
R2486 T3426 T3428 poss Eagle,medium
R2487 T3427 T3426 case 's,Eagle
R2488 T3428 T3422 pobj medium,in
R2489 T3429 T3428 punct (,medium
R2490 T3430 T3428 appos Invitrogen,medium
R2491 T3431 T3428 punct ),medium
R2492 T3432 T3421 conj supplemented,grown
R2493 T3433 T3432 prep with,supplemented
R2494 T3434 T3435 nummod 10,%
R2495 T3435 T3438 nmod %,serum
R2496 T3436 T3438 amod fetal,serum
R2497 T3437 T3438 amod bovine,serum
R2498 T3438 T3433 pobj serum,with
R2499 T3439 T3438 cc and,serum
R2500 T3440 T3441 nummod 1,%
R2501 T3441 T3443 nmod %,solution
R2502 T3442 T3443 amod penicillin/streptomycin/glutamate,solution
R2503 T3443 T3438 conj solution,serum
R2504 T3444 T3445 punct (,Cellgro
R2505 T3445 T3443 appos Cellgro,solution
R2506 T3446 T3445 punct ),Cellgro
R2507 T3447 T3421 punct .,grown
R2508 T3448 T3450 amod Primary,macrophages
R2509 T3449 T3450 amod peritoneal,macrophages
R2510 T3450 T3452 nsubjpass macrophages,obtained
R2511 T3451 T3452 auxpass were,obtained
R2512 T3452 T3452 ROOT obtained,obtained
R2513 T3453 T3452 prep by,obtained
R2514 T3454 T3453 pcomp injecting,by
R2515 T3455 T3456 compound C57BL/6,mice
R2516 T3456 T3454 dobj mice,injecting
R2517 T3457 T3454 prep with,injecting
R2518 T3458 T3459 nummod 3,%
R2519 T3459 T3461 nmod %,broth
R2520 T3460 T3461 compound thioglycollate,broth
R2521 T3461 T3457 pobj broth,with
R2522 T3462 T3461 acl followed,broth
R2523 T3463 T3462 agent by,followed
R2524 T3464 T3465 amod peritoneal,lavage
R2525 T3465 T3463 pobj lavage,by
R2526 T3466 T3465 nummod 3,lavage
R2527 T3467 T3468 nummod 5,days
R2528 T3468 T3469 npadvmod days,later
R2529 T3469 T3462 advmod later,followed
R2530 T3470 T3452 punct ",",obtained
R2531 T3471 T3452 cc and,obtained
R2532 T3472 T3452 conj maintained,obtained
R2533 T3473 T3472 prep in,maintained
R2534 T3474 T3475 nummod 50,%
R2535 T3475 T3473 pobj %,in
R2536 T3476 T3477 nummod DMEM/F12,media
R2537 T3477 T3473 pobj media,in
R2538 T3478 T3480 punct (,BRL
R2539 T3479 T3480 compound Gibco,BRL
R2540 T3480 T3472 appos BRL,maintained
R2541 T3481 T3480 punct ),BRL
R2542 T3482 T3452 punct .,obtained
R2543 T3483 T3485 nsubjpass Precautions,taken
R2544 T3484 T3485 auxpass were,taken
R2545 T3485 T3485 ROOT taken,taken
R2546 T3486 T3487 aux to,exclude
R2547 T3487 T3485 advcl exclude,taken
R2548 T3488 T3490 amod bacterial,contamination
R2549 T3489 T3490 compound lipopolysaccharide,contamination
R2550 T3490 T3487 dobj contamination,exclude
R2551 T3491 T3490 prep from,contamination
R2552 T3492 T3494 det all,cultures
R2553 T3493 T3494 compound cell,cultures
R2554 T3494 T3491 pobj cultures,from
R2555 T3495 T3487 prep through,exclude
R2556 T3496 T3497 det the,use
R2557 T3497 T3495 pobj use,through
R2558 T3498 T3497 prep of,use
R2559 T3499 T3501 amod certified,serum
R2560 T3500 T3501 amod LPS-free,serum
R2561 T3501 T3498 pobj serum,of
R2562 T3502 T3485 punct .,taken
R2563 T3503 T3504 compound Cell,viability
R2564 T3504 T3506 nsubjpass viability,determined
R2565 T3505 T3506 auxpass was,determined
R2566 T3506 T3506 ROOT determined,determined
R2567 T3507 T3506 advcl using,determined
R2568 T3508 T3510 det the,blue
R2569 T3509 T3510 compound trypan,blue
R2570 T3510 T3516 nmod blue,method
R2571 T3511 T3510 punct (,blue
R2572 T3512 T3510 appos Sigma,blue
R2573 T3513 T3510 punct ),blue
R2574 T3514 T3515 compound dye,exclusion
R2575 T3515 T3516 compound exclusion,method
R2576 T3516 T3507 dobj method,using
R2577 T3517 T3506 punct .,determined
R2578 T3518 T3519 det All,cultures
R2579 T3519 T3522 nsubjpass cultures,checked
R2580 T3520 T3522 auxpass were,checked
R2581 T3521 T3522 advmod routinely,checked
R2582 T3522 T3522 ROOT checked,checked
R2583 T3523 T3524 aux to,exclude
R2584 T3524 T3522 xcomp exclude,checked
R2585 T3525 T3526 compound Mycoplasma,infection
R2586 T3526 T3524 dobj infection,exclude
R2587 T3527 T3526 prep by,infection
R2588 T3528 T3529 amod nuclear,staining
R2589 T3529 T3527 pobj staining,by
R2590 T3530 T3524 advcl using,exclude
R2591 T3531 T3532 nsubj Hoechst,stain
R2592 T3532 T3530 xcomp stain,using
R2593 T3533 T3535 nummod 33258,Sigma
R2594 T3534 T3535 punct (,Sigma
R2595 T3535 T3524 npadvmod Sigma,exclude
R2596 T3536 T3535 punct ),Sigma
R2597 T3537 T3535 cc and,Sigma
R2598 T3538 T3541 det the,Kit
R2599 T3539 T3541 compound MycoAlert,Kit
R2600 T3540 T3541 compound Detection,Kit
R2601 T3541 T3535 conj Kit,Sigma
R2602 T3542 T3541 punct (,Kit
R2603 T3543 T3541 appos Lonza,Kit
R2604 T3544 T3541 punct ),Kit
R2605 T3545 T3522 punct .,checked
R2606 T3546 T3547 amod Bacterial,lipopolysaccharide
R2607 T3547 T3558 nsubjpass lipopolysaccharide,obtained
R2608 T3548 T3549 punct (,LPS
R2609 T3549 T3547 appos LPS,lipopolysaccharide
R2610 T3550 T3547 punct ),lipopolysaccharide
R2611 T3551 T3555 punct (,Re595
R2612 T3552 T3555 compound Salmonella,Re595
R2613 T3553 T3555 compound minnesota,Re595
R2614 T3554 T3555 compound Strain,Re595
R2615 T3555 T3547 appos Re595,lipopolysaccharide
R2616 T3556 T3555 punct ),Re595
R2617 T3557 T3558 auxpass was,obtained
R2618 T3558 T3558 ROOT obtained,obtained
R2619 T3559 T3558 prep from,obtained
R2620 T3560 T3559 pobj Sigma,from
R2621 T3561 T3558 punct .,obtained
R2699 T3720 T3722 amod Real-time,PCR
R2700 T3721 T3722 compound Quantitative,PCR
R2701 T3722 T3722 ROOT PCR,PCR
R2702 T3723 T3724 punct (,qPCR
R2703 T3724 T3722 appos qPCR,PCR
R2704 T3725 T3722 punct ),PCR
R2705 T3726 T3729 det The,Kit
R2706 T3727 T3729 compound RNeasy,Kit
R2707 T3728 T3729 compound Mini,Kit
R2708 T3729 T3734 nsubjpass Kit,used
R2709 T3730 T3729 punct (,Kit
R2710 T3731 T3729 appos Qiagen,Kit
R2711 T3732 T3729 punct ),Kit
R2712 T3733 T3734 auxpass was,used
R2713 T3734 T3734 ROOT used,used
R2714 T3735 T3736 aux to,isolate
R2715 T3736 T3734 xcomp isolate,used
R2716 T3737 T3738 amod total,RNA
R2717 T3738 T3736 dobj RNA,isolate
R2718 T3739 T3736 prep from,isolate
R2719 T3740 T3739 pobj cells,from
R2720 T3741 T3734 punct .,used
R2721 T3742 T3751 prep For,was
R2722 T3743 T3744 compound cDNA,synthesis
R2723 T3744 T3742 pobj synthesis,For
R2724 T3745 T3751 punct ",",was
R2725 T3746 T3747 nummod 1,µg
R2726 T3747 T3751 nsubj µg,was
R2727 T3748 T3747 prep of,µg
R2728 T3749 T3750 amod total,RNA
R2729 T3750 T3748 pobj RNA,of
R2730 T3751 T3751 ROOT was,was
R2731 T3752 T3753 advmod reverse,transcribed
R2732 T3753 T3751 conj transcribed,was
R2733 T3754 T3753 advcl using,transcribed
R2734 T3755 T3756 compound TaqMan,®
R2735 T3756 T3757 nsubj ®,Reverse
R2736 T3757 T3754 xcomp Reverse,using
R2737 T3758 T3759 compound Transcription,Reagents
R2738 T3759 T3757 dobj Reagents,Reverse
R2739 T3760 T3762 punct (,Biosystems
R2740 T3761 T3762 compound Applied,Biosystems
R2741 T3762 T3759 appos Biosystems,Reagents
R2742 T3763 T3762 punct ),Biosystems
R2743 T3764 T3757 punct .,Reverse
R2744 T3765 T3767 nsubjpass qPCR,performed
R2745 T3766 T3767 auxpass was,performed
R2746 T3767 T3767 ROOT performed,performed
R2747 T3768 T3767 advcl using,performed
R2748 T3769 T3773 compound TaqMan,20X
R2749 T3770 T3773 compound ®,20X
R2750 T3771 T3773 compound Gene,20X
R2751 T3772 T3773 compound Expression,20X
R2752 T3773 T3774 compound 20X,primers
R2753 T3774 T3768 dobj primers,using
R2754 T3775 T3768 prep for,using
R2755 T3776 T3775 pobj Serpinb2/SerpinB2,for
R2756 T3777 T3778 punct (,Mm00440905_m1
R2757 T3778 T3776 appos Mm00440905_m1,Serpinb2/SerpinB2
R2758 T3779 T3776 punct ),Serpinb2/SerpinB2
R2759 T3780 T3776 punct ",",Serpinb2/SerpinB2
R2760 T3781 T3776 conj Cebpb,Serpinb2/SerpinB2
R2761 T3782 T3783 punct (,Mm00843434_s1
R2762 T3783 T3781 appos Mm00843434_s1,Cebpb
R2763 T3784 T3783 punct ),Mm00843434_s1
R2764 T3785 T3781 cc and,Cebpb
R2765 T3786 T3781 conj β-actin,Cebpb
R2766 T3787 T3786 punct (,β-actin
R2767 T3788 T3786 appos Mm00607939_s1,β-actin
R2768 T3789 T3786 punct ),β-actin
R2769 T3790 T3792 punct (,Biosystems
R2770 T3791 T3792 compound Applied,Biosystems
R2771 T3792 T3786 appos Biosystems,β-actin
R2772 T3793 T3767 punct ),performed
R2773 T3794 T3767 punct .,performed
R2952 T4058 T4060 compound DNA,Analysis
R2953 T4059 T4060 compound Sequence,Analysis
R2954 T4060 T4070 nsubjpass Analysis,determined
R2955 T4061 T4063 det The,sequence
R2956 T4062 T4063 compound DNA,sequence
R2957 T4063 T4060 appos sequence,Analysis
R2958 T4064 T4063 prep of,sequence
R2959 T4065 T4068 det the,promoter
R2960 T4066 T4068 compound murine,promoter
R2961 T4067 T4068 compound SerpinB2,promoter
R2962 T4068 T4064 pobj promoter,of
R2963 T4069 T4070 auxpass was,determined
R2964 T4070 T4070 ROOT determined,determined
R2965 T4071 T4070 prep by,determined
R2966 T4072 T4071 pcomp sequencing,by
R2967 T4073 T4075 det the,plasmids
R2968 T4074 T4075 amod pUC-based,plasmids
R2969 T4075 T4072 dobj plasmids,sequencing
R2970 T4076 T4072 npadvmod pDB9406,sequencing
R2971 T4077 T4076 punct ",",pDB9406
R2972 T4078 T4076 conj pDB9402-41,pDB9406
R2973 T4079 T4078 cc and,pDB9402-41
R2974 T4080 T4078 conj pDB9402-42,pDB9402-41
R2975 T4081 T4072 punct ",",sequencing
R2976 T4082 T4072 prep in,sequencing
R2977 T4083 T4082 pobj addition,in
R2978 T4084 T4083 prep to,addition
R2979 T4085 T4084 pobj plasmids,to
R2980 T4086 T4085 acl prepared,plasmids
R2981 T4087 T4086 prep from,prepared
R2982 T4088 T4087 pobj pDB9402-41,from
R2983 T4089 T4088 cc and,pDB9402-41
R2984 T4090 T4088 conj pDB9402-42,pDB9402-41
R2985 T4091 T4085 prep containing,plasmids
R2986 T4092 T4091 dobj deletions,containing
R2987 T4093 T4092 acl introduced,deletions
R2988 T4094 T4093 agent by,introduced
R2989 T4095 T4097 amod exonuclease,digestion
R2990 T4096 T4097 compound III,digestion
R2991 T4097 T4094 pobj digestion,by
R2992 T4098 T4070 punct .,determined
R2993 T4099 T4100 compound Plasmids,pDB9406
R2994 T4100 T4100 ROOT pDB9406,pDB9406
R2995 T4101 T4100 punct ",",pDB9406
R2996 T4102 T4100 conj pDB9402-41,pDB9406
R2997 T4103 T4102 cc and,pDB9402-41
R2998 T4104 T4102 conj pDB9402-42,pDB9402-41
R2999 T4105 T4108 prep containing,isolated
R3000 T4106 T4107 compound genomic,DNA
R3001 T4107 T4108 nsubj DNA,isolated
R3002 T4108 T4108 ROOT isolated,isolated
R3003 T4109 T4108 prep from,isolated
R3004 T4110 T4111 det a,λFIXII
R3005 T4111 T4116 nmod λFIXII,library
R3006 T4112 T4111 punct (,λFIXII
R3007 T4113 T4111 appos Stratagene,λFIXII
R3008 T4114 T4111 punct ),λFIXII
R3009 T4115 T4116 amod genomic,library
R3010 T4116 T4109 pobj library,from
R3011 T4117 T4108 advcl prepared,isolated
R3012 T4118 T4117 prep from,prepared
R3013 T4119 T4122 det a,strain
R3014 T4120 T4122 nummod 129,strain
R3015 T4121 T4122 compound mouse,strain
R3016 T4122 T4118 pobj strain,from
R3017 T4123 T4108 punct ",",isolated
R3018 T4124 T4126 auxpass were,provided
R3019 T4125 T4126 advmod kindly,provided
R3020 T4126 T4108 advcl provided,isolated
R3021 T4127 T4126 agent by,provided
R3022 T4128 T4130 compound Dr.,Belin
R3023 T4129 T4130 compound Dominique,Belin
R3024 T4130 T4127 pobj Belin,by
R3025 T4131 T4130 punct ",",Belin
R3026 T4132 T4130 conj University,Belin
R3027 T4133 T4132 prep of,University
R3028 T4134 T4133 pobj Geneva,of
R3029 T4135 T4108 punct .,isolated
R3030 T4136 T4137 nsubj pDB9406,contains
R3031 T4137 T4153 ccomp contains,contain
R3032 T4138 T4143 det a,fragment
R3033 T4139 T4140 nummod 4.4,kb
R3034 T4140 T4143 nmod kb,fragment
R3035 T4141 T4143 nmod EcoRI/SpeI,fragment
R3036 T4142 T4143 compound genomic,fragment
R3037 T4143 T4137 dobj fragment,contains
R3038 T4144 T4143 acl spanning,fragment
R3039 T4145 T4148 det the,site
R3040 T4146 T4147 compound transcription,initiation
R3041 T4147 T4148 compound initiation,site
R3042 T4148 T4144 dobj site,spanning
R3043 T4149 T4153 punct ;,contain
R3044 T4150 T4153 nsubj pDB9402-41,contain
R3045 T4151 T4150 cc and,pDB9402-41
R3046 T4152 T4150 conj pDB9402-42,pDB9402-41
R3047 T4153 T4153 ROOT contain,contain
R3048 T4154 T4159 det a,fragment
R3049 T4155 T4156 nummod 1.2,kb
R3050 T4156 T4159 nmod kb,fragment
R3051 T4157 T4159 nmod EcoRI,fragment
R3052 T4158 T4159 compound genomic,fragment
R3053 T4159 T4153 dobj fragment,contain
R3054 T4160 T4159 punct ",",fragment
R3055 T4161 T4159 acl located,fragment
R3056 T4162 T4163 advmod immediately,upstream
R3057 T4163 T4161 advmod upstream,located
R3058 T4164 T4163 prep of,upstream
R3059 T4165 T4168 det the,fragment
R3060 T4166 T4167 compound pDB9406,EcoRI
R3061 T4167 T4168 compound EcoRI,fragment
R3062 T4168 T4164 pobj fragment,of
R3063 T4169 T4161 punct ",",located
R3064 T4170 T4159 acl cloned,fragment
R3065 T4171 T4170 prep in,cloned
R3066 T4172 T4173 amod opposite,orientations
R3067 T4173 T4171 pobj orientations,in
R3068 T4174 T4153 punct .,contain
R3069 T4175 T4176 amod Subcloned,inserts
R3070 T4176 T4178 nsubjpass inserts,verified
R3071 T4177 T4178 auxpass were,verified
R3072 T4178 T4178 ROOT verified,verified
R3073 T4179 T4178 agent by,verified
R3074 T4180 T4181 compound restriction,enzyme
R3075 T4181 T4182 compound enzyme,digestion
R3076 T4182 T4179 pobj digestion,by
R3077 T4183 T4182 cc and,digestion
R3078 T4184 T4185 compound DNA,sequencing
R3079 T4185 T4182 conj sequencing,digestion
R3080 T4186 T4178 punct .,verified
R3081 T4187 T4189 det The,sequence
R3082 T4188 T4189 compound nucleotide,sequence
R3083 T4189 T4202 nsubjpass sequence,determined
R3084 T4190 T4189 prep of,sequence
R3085 T4191 T4196 det the,gene
R3086 T4192 T4196 nummod 4480,gene
R3087 T4193 T4196 nmod bp,gene
R3088 T4194 T4196 compound murine,gene
R3089 T4195 T4196 compound SerpinB2,gene
R3090 T4196 T4200 nmod gene,region
R3091 T4197 T4198 nummod 5,′
R3092 T4198 T4200 amod ′,region
R3093 T4199 T4200 amod flanking,region
R3094 T4200 T4190 pobj region,of
R3095 T4201 T4202 auxpass was,determined
R3096 T4202 T4202 ROOT determined,determined
R3097 T4203 T4202 advcl using,determined
R3098 T4204 T4209 det the,cycle
R3099 T4205 T4209 compound ABI,cycle
R3100 T4206 T4209 compound PRISM,cycle
R3101 T4207 T4208 compound dye,terminator
R3102 T4208 T4209 compound terminator,cycle
R3103 T4209 T4203 dobj cycle,using
R3104 T4210 T4203 conj sequencing,using
R3105 T4211 T4213 amod ready,kit
R3106 T4212 T4213 compound reaction,kit
R3107 T4213 T4210 dobj kit,sequencing
R3108 T4214 T4213 punct (,kit
R3109 T4215 T4210 conj Perkin-Elmer,sequencing
R3110 T4216 T4215 punct ),Perkin-Elmer
R3111 T4217 T4210 cc and,sequencing
R3112 T4218 T4221 det a,sequencer
R3113 T4219 T4221 compound PE,sequencer
R3114 T4220 T4221 compound 373A,sequencer
R3115 T4221 T4210 conj sequencer,sequencing
R3116 T4222 T4221 punct (,sequencer
R3117 T4223 T4221 appos Perkin-Elmer,sequencer
R3118 T4224 T4221 punct ),sequencer
R3119 T4225 T4202 punct .,determined
R3120 T4226 T4227 det This,sequence
R3121 T4227 T4229 nsubjpass sequence,deposited
R3122 T4228 T4229 auxpass was,deposited
R3123 T4229 T4229 ROOT deposited,deposited
R3124 T4230 T4229 prep in,deposited
R3125 T4231 T4233 compound GenBank/EMBL/DDBJ,Bank
R3126 T4232 T4233 compound Data,Bank
R3127 T4233 T4230 pobj Bank,in
R3128 T4234 T4229 prep with,deposited
R3129 T4235 T4236 compound Accession,No
R3130 T4236 T4234 pobj No,with
R3131 T4237 T4229 punct .,deposited
R3132 T4238 T4238 ROOT AF339731,AF339731
R3133 T4239 T4238 punct .,AF339731
R3322 T4532 T4528 appos deoxycholate,NP-40
R3323 T4533 T4532 punct ",",deoxycholate
R3324 T4534 T4535 nummod 0.1,%
R3325 T4535 T4536 compound %,SDS
R3326 T4536 T4532 appos SDS,deoxycholate
R3327 T4537 T4536 punct ),SDS
R3328 T4538 T4541 punct ",",separated
R3329 T4539 T4541 nsubjpass proteins,separated
R3330 T4540 T4541 auxpass were,separated
R3331 T4541 T4541 ROOT separated,separated
R3332 T4542 T4541 prep on,separated
R3333 T4543 T4542 pobj 4,on
R3334 T4544 T4545 nummod 12,%
R3335 T4545 T4548 compound %,gels
R3336 T4546 T4547 compound Bis-Tris,NuPAGE
R3337 T4547 T4548 compound NuPAGE,gels
R3338 T4548 T4541 appos gels,separated
R3339 T4549 T4550 punct (,Invitrogen
R3340 T4550 T4548 appos Invitrogen,gels
R3341 T4551 T4548 punct ),gels
R3342 T4552 T4541 punct ",",separated
R3343 T4553 T4541 cc and,separated
R3344 T4554 T4541 conj transferred,separated
R3345 T4555 T4554 prep to,transferred
R3346 T4556 T4557 compound PVDF,membranes
R3347 T4557 T4555 pobj membranes,to
R3348 T4558 T4541 punct .,separated
R3349 T4559 T4562 nsubjpass Membranes,blocked
R3350 T4560 T4562 auxpass were,blocked
R3351 T4561 T4562 advmod subsequently,blocked
R3352 T4562 T4562 ROOT blocked,blocked
R3353 T4563 T4562 prep with,blocked
R3354 T4564 T4565 nummod 5,%
R3355 T4565 T4566 compound %,milk
R3356 T4566 T4563 pobj milk,with
R3357 T4567 T4566 prep in,milk
R3358 T4568 T4567 pobj PBS-T,in
R3359 T4569 T4568 punct (,PBS-T
R3360 T4570 T4571 compound 1X,PBS
R3361 T4571 T4568 appos PBS,PBS-T
R3362 T4572 T4568 punct ",",PBS-T
R3363 T4573 T4574 nummod 0.1,%
R3364 T4574 T4575 compound %,Tween-20
R3365 T4575 T4568 appos Tween-20,PBS-T
R3366 T4576 T4568 punct ),PBS-T
R3367 T4577 T4562 punct ",",blocked
R3368 T4578 T4562 cc and,blocked
R3369 T4579 T4562 conj incubated,blocked
R3370 T4580 T4579 prep with,incubated
R3371 T4581 T4582 amod primary,antibodies
R3372 T4582 T4580 pobj antibodies,with
R3373 T4583 T4579 advmod overnight,incubated
R3374 T4584 T4562 punct .,blocked
R3375 T4585 T4586 nsubj Affinity,purified
R3376 T4586 T4586 ROOT purified,purified
R3377 T4587 T4590 compound rabbit,antibodies
R3378 T4588 T4589 compound anti-mouse,SerpinB2
R3379 T4589 T4590 compound SerpinB2,antibodies
R3380 T4590 T4592 nsubjpass antibodies,prepared
R3381 T4591 T4592 auxpass were,prepared
R3382 T4592 T4586 ccomp prepared,purified
R3383 T4593 T4592 prep after,prepared
R3384 T4594 T4593 pobj immunization,after
R3385 T4595 T4594 prep with,immunization
R3386 T4596 T4602 det a,protein
R3387 T4597 T4602 amod purified,protein
R3388 T4598 T4602 amod recombinant,protein
R3389 T4599 T4600 compound GST-murine,SerpinB2
R3390 T4600 T4602 compound SerpinB2,protein
R3391 T4601 T4602 compound fusion,protein
R3392 T4602 T4595 pobj protein,with
R3393 T4603 T4602 acl produced,protein
R3394 T4604 T4603 prep in,produced
R3395 T4605 T4606 compound E.,coli
R3396 T4606 T4604 pobj coli,in
R3397 T4607 T4603 prep as,produced
R3398 T4608 T4607 prep in,as
R3399 T4609 T4611 nmod [,]
R3400 T4610 T4611 nummod 35,]
R3401 T4611 T4608 pobj ],in
R3402 T4612 T4586 punct .,purified
R3403 T4613 T4614 amod Other,antibodies
R3404 T4614 T4620 nsubj antibodies,include
R3405 T4615 T4614 acl used,antibodies
R3406 T4616 T4615 prep for,used
R3407 T4617 T4619 amod western,assays
R3408 T4618 T4619 compound blot,assays
R3409 T4619 T4616 pobj assays,for
R3410 T4620 T4620 ROOT include,include
R3411 T4621 T4620 punct :,include
R3412 T4622 T4624 punct C/EBP,β
R3413 T4623 T4624 punct -,β
R3414 T4624 T4620 dobj β,include
R3415 T4625 T4624 punct (,β
R3416 T4626 T4624 appos sc-150,β
R3417 T4627 T4624 punct ),β
R3418 T4628 T4631 punct (,Biotechnologies
R3419 T4629 T4631 compound Santa,Biotechnologies
R3420 T4630 T4631 compound Cruz,Biotechnologies
R3421 T4631 T4624 parataxis Biotechnologies,β
R3422 T4632 T4631 punct ),Biotechnologies
R3423 T4633 T4631 punct ",",Biotechnologies
R3424 T4634 T4635 amod glyceraldehyde-3-phosphate,dehydrogenase
R3425 T4635 T4631 appos dehydrogenase,Biotechnologies
R3426 T4636 T4637 punct (,GAPDH
R3427 T4637 T4635 appos GAPDH,dehydrogenase
R3428 T4638 T4637 punct ),GAPDH
R3429 T4639 T4635 cc and,dehydrogenase
R3430 T4640 T4643 amod α,tubulin
R3431 T4641 T4643 compound /,tubulin
R3432 T4642 T4643 compound β,tubulin
R3433 T4643 T4635 conj tubulin,dehydrogenase
R3434 T4644 T4649 punct (,Inc.
R3435 T4645 T4649 nmod Cell,Inc.
R3436 T4646 T4649 nmod Signaling,Inc.
R3437 T4647 T4646 pobj Technology,Signaling
R3438 T4648 T4649 punct ",",Inc.
R3439 T4649 T4643 parataxis Inc.,tubulin
R3440 T4650 T4649 punct ),Inc.
R3441 T4651 T4620 punct .,include
R3844 T5483 T5483 ROOT Construction,Construction
R3845 T5484 T5483 prep of,Construction
R3846 T5485 T5486 compound SerpinB2,Reporter
R3847 T5486 T5488 compound Reporter,Plasmids
R3848 T5487 T5488 compound Gene,Plasmids
R3849 T5488 T5484 pobj Plasmids,of
R3850 T5489 T5490 det The,PCR
R3851 T5490 T5491 nsubj PCR,primers
R3852 T5491 T5491 ROOT primers,primers
R3853 T5492 T5493 poss DW5,LUC
R3854 T5493 T5491 dobj LUC,primers
R3855 T5494 T5491 punct ",",primers
R3856 T5495 T5491 advcl containing,primers
R3857 T5496 T5497 det a,Kpn
R3858 T5497 T5500 compound Kpn,site
R3859 T5498 T5500 compound I,site
R3860 T5499 T5500 compound restriction,site
R3861 T5500 T5495 dobj site,containing
R3862 T5501 T5491 punct ",",primers
R3863 T5502 T5491 cc and,primers
R3864 T5503 T5504 poss DW3,LUC
R3865 T5504 T5514 nsubj LUC,used
R3866 T5505 T5514 punct ",",used
R3867 T5506 T5514 advcl containing,used
R3868 T5507 T5508 det an,Xho
R3869 T5508 T5511 compound Xho,site
R3870 T5509 T5511 compound I,site
R3871 T5510 T5511 compound restriction,site
R3872 T5511 T5506 dobj site,containing
R3873 T5512 T5514 punct ",",used
R3874 T5513 T5514 auxpass were,used
R3875 T5514 T5491 conj used,primers
R3876 T5515 T5517 aux to,amplify
R3877 T5516 T5517 nsubj PCR,amplify
R3878 T5517 T5514 xcomp amplify,used
R3879 T5518 T5517 cc and,amplify
R3880 T5519 T5517 conj clone,amplify
R3881 T5520 T5522 det the,promoter
R3882 T5521 T5522 compound SerpinB2,promoter
R3883 T5522 T5519 dobj promoter,clone
R3884 T5523 T5522 punct (,promoter
R3885 T5524 T5522 appos −,promoter
R3886 T5525 T5522 appos 3261,promoter
R3887 T5526 T5525 prep to,3261
R3888 T5527 T5526 pobj +92,to
R3889 T5528 T5525 punct ),3261
R3890 T5529 T5519 prep from,clone
R3891 T5530 T5529 pobj pDB9406,from
R3892 T5531 T5519 prep into,clone
R3893 T5532 T5534 det the,I/Xho
R3894 T5533 T5534 compound Kpn,I/Xho
R3895 T5534 T5531 pobj I/Xho,into
R3896 T5535 T5536 nsubj I,polylinker
R3897 T5536 T5514 conj polylinker,used
R3898 T5537 T5538 compound restriction,sites
R3899 T5538 T5536 dobj sites,polylinker
R3900 T5539 T5538 prep of,sites
R3901 T5540 T5541 compound pGL3,Basic
R3902 T5541 T5539 pobj Basic,of
R3903 T5542 T5541 punct (,Basic
R3904 T5543 T5541 appos Promega,Basic
R3905 T5544 T5541 punct ),Basic
R3906 T5545 T5546 aux to,produce
R3907 T5546 T5536 advcl produce,polylinker
R3908 T5547 T5546 dobj pGLmP-3261,produce
R3909 T5548 T5536 punct .,polylinker
R3910 T5549 T5550 det The,EcoR
R3911 T5550 T5555 nsubj EcoR,was
R3912 T5551 T5552 nsubj I,insert
R3913 T5552 T5550 relcl insert,EcoR
R3914 T5553 T5552 prep of,insert
R3915 T5554 T5553 pobj pDB9402-42,of
R3916 T5555 T5555 ROOT was,was
R3917 T5556 T5555 acomp sub-cloned,was
R3918 T5557 T5558 advmod immediately,upstream
R3919 T5558 T5555 prep upstream,was
R3920 T5559 T5558 prep of,upstream
R3921 T5560 T5562 det the,promoter
R3922 T5561 T5562 compound SerpinB2,promoter
R3923 T5562 T5565 compound promoter,site
R3924 T5563 T5565 compound EcoR,site
R3925 T5564 T5565 compound I,site
R3926 T5565 T5559 pobj site,of
R3927 T5566 T5567 punct (,−
R3928 T5567 T5568 nmod −,3261
R3929 T5568 T5565 appos 3261,site
R3930 T5569 T5565 punct ),site
R3931 T5570 T5565 prep of,site
R3932 T5571 T5570 pobj pGLmP-3261,of
R3933 T5572 T5573 aux to,produce
R3934 T5573 T5555 advcl produce,was
R3935 T5574 T5573 dobj pGLmP-4480,produce
R3936 T5575 T5555 punct .,was
R3937 T5576 T5581 amod Additional,constructs
R3938 T5577 T5580 amod murine,reporter
R3939 T5578 T5580 compound SerpinB2,reporter
R3940 T5579 T5580 compound luciferase,reporter
R3941 T5580 T5581 compound reporter,constructs
R3942 T5581 T5598 nsubjpass constructs,generated
R3943 T5582 T5581 punct (,constructs
R3944 T5583 T5581 appos pGLmP-2751,constructs
R3945 T5584 T5583 punct ",",pGLmP-2751
R3946 T5585 T5583 conj pGLmP-2614,pGLmP-2751
R3947 T5586 T5585 punct ",",pGLmP-2614
R3948 T5587 T5585 conj pGLmP-1686,pGLmP-2614
R3949 T5588 T5587 punct ",",pGLmP-1686
R3950 T5589 T5587 conj pGLmP-1341,pGLmP-1686
R3951 T5590 T5589 punct ",",pGLmP-1341
R3952 T5591 T5589 conj pGLmP-694,pGLmP-1341
R3953 T5592 T5591 punct ",",pGLmP-694
R3954 T5593 T5591 conj pGLmP-539,pGLmP-694
R3955 T5594 T5593 cc and,pGLmP-539
R3956 T5595 T5593 conj pGLmP-189,pGLmP-539
R3957 T5596 T5581 punct ),constructs
R3958 T5597 T5598 auxpass were,generated
R3959 T5598 T5598 ROOT generated,generated
R3960 T5599 T5598 prep by,generated
R3961 T5600 T5599 pcomp digesting,by
R3962 T5601 T5600 dobj pGLmP-3261,digesting
R3963 T5602 T5600 prep with,digesting
R3964 T5603 T5602 pobj EcoR,with
R3965 T5604 T5614 dep I,Apa
R3966 T5605 T5604 cc and,I
R3967 T5606 T5609 det a,enzyme
R3968 T5607 T5608 amod second,restriction
R3969 T5608 T5609 compound restriction,enzyme
R3970 T5609 T5604 conj enzyme,I
R3971 T5610 T5609 punct (,enzyme
R3972 T5611 T5609 parataxis Sfi,enzyme
R3973 T5612 T5614 nsubj I,Apa
R3974 T5613 T5614 punct ",",Apa
R3975 T5614 T5614 ROOT Apa,Apa
R3976 T5615 T5617 nsubj I,BstX
R3977 T5616 T5615 punct ",",I
R3978 T5617 T5617 ROOT BstX,BstX
R3979 T5618 T5620 nsubj I,Bsu36
R3980 T5619 T5618 punct ",",I
R3981 T5620 T5620 ROOT Bsu36,Bsu36
R3982 T5621 T5623 nsubj I,Pac
R3983 T5622 T5621 punct ",",I
R3984 T5623 T5623 ROOT Pac,Pac
R3985 T5624 T5624 ROOT I,I
R3986 T5625 T5624 punct ",",I
R3987 T5626 T5627 compound Hae,III
R3988 T5627 T5624 appos III,I
R3989 T5628 T5627 cc and,III
R3990 T5629 T5627 conj Apo,III
R3991 T5630 T5624 appos I,I
R3992 T5631 T5624 appos respectively,I
R3993 T5632 T5624 punct ),I
R3994 T5633 T5652 punct ",",re-ligating
R3995 T5634 T5652 dep blunt,re-ligating
R3996 T5635 T5634 acl ending,blunt
R3997 T5636 T5639 det the,′
R3998 T5637 T5639 amod resultant,′
R3999 T5638 T5639 nummod 5,′
R4000 T5639 T5635 dobj ′,ending
R4001 T5640 T5639 cc or,′
R4002 T5641 T5642 nummod 3,′
R4003 T5642 T5643 compound ′,overhangs
R4004 T5643 T5639 conj overhangs,′
R4005 T5644 T5643 prep with,overhangs
R4006 T5645 T5647 amod T4,polymerase
R4007 T5646 T5647 compound DNA,polymerase
R4008 T5647 T5644 pobj polymerase,with
R4009 T5648 T5647 punct (,polymerase
R4010 T5649 T5647 appos NEB,polymerase
R4011 T5650 T5647 punct ),polymerase
R4012 T5651 T5643 cc and,overhangs
R4013 T5652 T5652 ROOT re-ligating,re-ligating
R4014 T5653 T5654 det the,vector
R4015 T5654 T5652 dobj vector,re-ligating
R4016 T5655 T5652 dep ends,re-ligating
R4017 T5656 T5655 prep with,ends
R4018 T5657 T5659 amod T4,ligase
R4019 T5658 T5659 compound DNA,ligase
R4020 T5659 T5656 pobj ligase,with
R4021 T5660 T5652 punct .,re-ligating
R4022 T5661 T5663 det The,primers
R4023 T5662 T5663 compound PCR,primers
R4024 T5663 T5669 nsubjpass primers,used
R4025 T5664 T5663 appos BSPCR2,primers
R4026 T5665 T5664 cc and,BSPCR2
R4027 T5666 T5667 poss DW3,LUC
R4028 T5667 T5664 conj LUC,BSPCR2
R4029 T5668 T5669 auxpass were,used
R4030 T5669 T5669 ROOT used,used
R4031 T5670 T5671 aux to,subclone
R4032 T5671 T5669 xcomp subclone,used
R4033 T5672 T5676 det the,regions
R4034 T5673 T5676 amod murine,regions
R4035 T5674 T5675 compound SerpinB2,promoter
R4036 T5675 T5676 compound promoter,regions
R4037 T5676 T5671 dobj regions,subclone
R4038 T5677 T5671 conj −,subclone
R4039 T5678 T5680 quantmod 87,+92
R4040 T5679 T5680 quantmod to,+92
R4041 T5680 T5677 dobj +92,−
R4042 T5681 T5677 prep into,−
R4043 T5682 T5684 det the,I/Xho
R4044 T5683 T5684 compound Kpn,I/Xho
R4045 T5684 T5681 pobj I/Xho,into
R4046 T5685 T5686 nsubj I,polylinker
R4047 T5686 T5669 conj polylinker,used
R4048 T5687 T5688 compound restriction,sites
R4049 T5688 T5686 dobj sites,polylinker
R4050 T5689 T5688 prep of,sites
R4051 T5690 T5691 amod pGL3,Basic
R4052 T5691 T5689 pobj Basic,of
R4053 T5692 T5693 aux to,produce
R4054 T5693 T5686 advcl produce,polylinker
R4055 T5694 T5693 dobj pGLmP-87,produce
R4056 T5695 T5686 punct .,polylinker
R4057 T5696 T5699 det The,vector
R4058 T5697 T5699 nmod control,vector
R4059 T5698 T5699 amod empty,vector
R4060 T5699 T5700 nsubj vector,was
R4061 T5700 T5700 ROOT was,was
R4062 T5701 T5702 amod pGL3,Basic
R4063 T5702 T5700 attr Basic,was
R4064 T5703 T5704 punct (,Promega
R4065 T5704 T5702 appos Promega,Basic
R4066 T5705 T5704 punct ),Promega
R4067 T5706 T5700 punct .,was
R4068 T5707 T5708 compound Luciferase,reporter
R4069 T5708 T5709 nsubj reporter,constructs
R4070 T5709 T5709 ROOT constructs,constructs
R4071 T5710 T5710 ROOT containing,containing
R4072 T5711 T5710 dobj mutations,containing
R4073 T5712 T5711 prep in,mutations
R4074 T5713 T5715 det the,promoter
R4075 T5714 T5715 compound SerpinB2,promoter
R4076 T5715 T5719 compound promoter,box
R4077 T5716 T5717 amod LPS-responsive,regions
R4078 T5717 T5719 compound regions,box
R4079 T5718 T5719 compound E,box
R4080 T5719 T5712 pobj box,in
R4081 T5720 T5710 punct ",",containing
R4082 T5721 T5722 compound PU,.1
R4083 T5722 T5724 nummod .1,Oct-1
R4084 T5723 T5722 punct ",",.1
R4085 T5724 T5710 appos Oct-1,containing
R4086 T5725 T5724 cc and,Oct-1
R4087 T5726 T5724 conj C/EBP,Oct-1
R4088 T5727 T5728 punct (,pGLmP-539mEbox
R4089 T5728 T5726 appos pGLmP-539mEbox,C/EBP
R4090 T5729 T5728 punct ",",pGLmP-539mEbox
R4091 T5730 T5726 conj pGLmP-539mPU,C/EBP
R4092 T5731 T5730 nummod .1,pGLmP-539mPU
R4093 T5732 T5730 punct ",",pGLmP-539mPU
R4094 T5733 T5730 conj pGLmP-539mOct,pGLmP-539mPU
R4095 T5734 T5733 cc and,pGLmP-539mOct
R4096 T5735 T5733 conj pGLmP-539mC,pGLmP-539mOct
R4097 T5736 T5737 compound /,EBP
R4098 T5737 T5741 nsubjpass EBP,generated
R4099 T5738 T5737 advmod respectively,EBP
R4100 T5739 T5741 punct ),generated
R4101 T5740 T5741 auxpass were,generated
R4102 T5741 T5709 ccomp generated,constructs
R4103 T5742 T5743 mark as,described
R4104 T5743 T5741 advcl described,generated
R4105 T5744 T5746 nmod [,]
R4106 T5745 T5746 nummod 36,]
R4107 T5746 T5743 dobj ],described
R4108 T5747 T5709 punct .,constructs
R4109 T5748 T5753 det The,sequences
R4110 T5749 T5753 amod mutant,sequences
R4111 T5750 T5753 compound oligonucleotide,sequences
R4112 T5751 T5752 compound PCR,primer
R4113 T5752 T5753 compound primer,sequences
R4114 T5753 T5755 nsubjpass sequences,provided
R4115 T5754 T5755 auxpass are,provided
R4116 T5755 T5755 ROOT provided,provided
R4117 T5756 T5755 prep in,provided
R4118 T5757 T5756 pobj Fig,in
R4119 T5758 T5755 punct .,provided
R4120 T5759 T5763 nsubjpass S1,used
R4121 T5760 T5759 punct ",",S1
R4122 T5761 T5759 cc and,S1
R4123 T5762 T5763 auxpass were,used
R4124 T5763 T5763 ROOT used,used
R4125 T5764 T5765 mark as,follows
R4126 T5765 T5763 advcl follows,used
R4127 T5766 T5767 punct :,pGLmP-539mEbox
R4128 T5767 T5767 ROOT pGLmP-539mEbox,pGLmP-539mEbox
R4129 T5768 T5767 punct :,pGLmP-539mEbox
R4130 T5769 T5767 appos mPAI2mEboxa,pGLmP-539mEbox
R4131 T5770 T5769 cc and,mPAI2mEboxa
R4132 T5771 T5769 conj mPAI2mEboxb,mPAI2mEboxa
R4133 T5772 T5767 punct ;,pGLmP-539mEbox
R4134 T5773 T5767 conj pGLmP-539mPU,pGLmP-539mEbox
R4135 T5774 T5773 nummod .1,pGLmP-539mPU
R4136 T5775 T5777 punct :,.1
R4137 T5776 T5777 compound mPAI2mPU,.1
R4138 T5777 T5767 appos .1,pGLmP-539mEbox
R4139 T5778 T5782 det a,b
R4140 T5779 T5778 cc and,a
R4141 T5780 T5782 nmod mPAI2mPU,b
R4142 T5781 T5782 nummod .1,b
R4143 T5782 T5777 appos b,.1
R4144 T5783 T5784 punct ;,pGLmP-539mOct
R4145 T5784 T5767 appos pGLmP-539mOct,pGLmP-539mEbox
R4146 T5785 T5784 punct :,pGLmP-539mOct
R4147 T5786 T5784 appos mPAI2mOct-2a,pGLmP-539mOct
R4148 T5787 T5786 cc and,mPAI2mOct-2a
R4149 T5788 T5786 conj mPAI2mOct-2b,mPAI2mOct-2a
R4150 T5789 T5792 punct ;,EBP
R4151 T5790 T5792 compound pGLmP-539mC,EBP
R4152 T5791 T5792 compound /,EBP
R4153 T5792 T5784 conj EBP,pGLmP-539mOct
R4154 T5793 T5792 punct :,EBP
R4155 T5794 T5792 appos mPAI2mCEBPa,EBP
R4156 T5795 T5794 cc and,mPAI2mCEBPa
R4157 T5796 T5794 conj mPAI2mCEBPb,mPAI2mCEBPa
R4158 T5797 T5792 punct .,EBP
R4159 T5798 T5801 det The,primers
R4160 T5799 T5801 compound oligonucleotide,primers
R4161 T5800 T5801 compound PCR,primers
R4162 T5801 T5802 nsubj primers,used
R4163 T5802 T5802 ROOT used,used
R4164 T5803 T5804 aux to,generate
R4165 T5804 T5802 xcomp generate,used
R4166 T5805 T5804 dobj mutants,generate
R4167 T5806 T5805 punct ",",mutants
R4168 T5807 T5805 appos pGLmP-539mCRE,mutants
R4169 T5808 T5807 punct ",",pGLmP-539mCRE
R4170 T5809 T5807 conj pGLmP-539mAP-1a,pGLmP-539mCRE
R4171 T5810 T5809 punct ",",pGLmP-539mAP-1a
R4172 T5811 T5809 cc and,pGLmP-539mAP-1a
R4173 T5812 T5809 conj pGLmP-539mAP-1b,pGLmP-539mAP-1a
R4174 T5813 T5814 auxpass were,reported
R4175 T5814 T5802 conj reported,used
R4176 T5815 T5814 advmod previously,reported
R4177 T5816 T5818 nmod [,]
R4178 T5817 T5818 nummod 37,]
R4179 T5818 T5814 dobj ],reported
R4180 T5819 T5802 punct .,used
R4181 T5820 T5824 det The,primers
R4182 T5821 T5824 amod flanking,primers
R4183 T5822 T5823 compound oligonucleotide,PCR
R4184 T5823 T5824 compound PCR,primers
R4185 T5824 T5825 nsubj primers,were
R4186 T5825 T5825 ROOT were,were
R4187 T5826 T5825 acomp RVprimer3,were
R4188 T5827 T5828 punct (,Promega
R4189 T5828 T5826 appos Promega,RVprimer3
R4190 T5829 T5828 punct ),Promega
R4191 T5830 T5826 cc and,RVprimer3
R4192 T5831 T5826 conj GLprimer2,RVprimer3
R4193 T5832 T5831 punct (,GLprimer2
R4194 T5833 T5831 appos Promega,GLprimer2
R4195 T5834 T5831 punct ),GLprimer2
R4196 T5835 T5825 punct .,were
R4197 T5836 T5838 nsubjpass pGLmP-539,used
R4198 T5837 T5838 auxpass was,used
R4199 T5838 T5838 ROOT used,used
R4200 T5839 T5838 prep as,used
R4201 T5840 T5841 det the,template
R4202 T5841 T5839 pobj template,as
R4203 T5842 T5838 prep in,used
R4204 T5843 T5844 det each,case
R4205 T5844 T5842 pobj case,in
R4206 T5845 T5838 punct .,used
R4207 T5846 T5848 amod Recombinant,products
R4208 T5847 T5848 compound PCR,products
R4209 T5848 T5850 nsubjpass products,digested
R4210 T5849 T5850 auxpass were,digested
R4211 T5850 T5850 ROOT digested,digested
R4212 T5851 T5850 prep with,digested
R4213 T5852 T5851 pobj EcoR,with
R4214 T5853 T5850 advcl I,digested
R4215 T5854 T5853 cc and,I
R4216 T5855 T5853 conj Xho,I
R4217 T5856 T5853 conj I,I
R4218 T5857 T5856 cc and,I
R4219 T5858 T5856 conj cloned,I
R4220 T5859 T5858 prep between,cloned
R4221 T5860 T5861 det the,EcoR
R4222 T5861 T5859 pobj EcoR,between
R4223 T5862 T5861 nummod I,EcoR
R4224 T5863 T5862 cc and,I
R4225 T5864 T5862 conj Xho,I
R4226 T5865 T5866 nsubj I,restriction
R4227 T5866 T5862 conj restriction,I
R4228 T5867 T5866 dobj sites,restriction
R4229 T5868 T5867 prep of,sites
R4230 T5869 T5868 pobj pGLmP-539,of
R4231 T5870 T5866 prep in,restriction
R4232 T5871 T5870 pobj place,in
R4233 T5872 T5871 prep of,place
R4234 T5873 T5878 det the,region
R4235 T5874 T5878 nmod −,region
R4236 T5875 T5874 nummod 539,−
R4237 T5876 T5878 amod /,region
R4238 T5877 T5878 nummod +92,region
R4239 T5878 T5872 pobj region,of
R4240 T5879 T5878 prep of,region
R4241 T5880 T5884 det the,promoter
R4242 T5881 T5884 amod wild-type,promoter
R4243 T5882 T5883 compound murine,SerpinB2
R4244 T5883 T5884 compound SerpinB2,promoter
R4245 T5884 T5879 pobj promoter,of
R4246 T5885 T5866 punct .,restriction
R4247 T5886 T5887 nsubj Sequence,verified
R4248 T5887 T5887 ROOT verified,verified
R4249 T5888 T5890 nsubjpass constructs,used
R4250 T5889 T5890 auxpass were,used
R4251 T5890 T5887 ccomp used,verified
R4252 T5891 T5890 prep in,used
R4253 T5892 T5893 det the,experiments
R4254 T5893 T5891 pobj experiments,in
R4255 T5894 T5887 punct .,verified
R4506 T6368 T6369 compound Transient,Transfection
R4507 T6369 T6386 nsubj Transfection,growing
R4508 T6370 T6369 cc and,Transfection
R4509 T6371 T6372 compound Luciferase,Assays
R4510 T6372 T6369 conj Assays,Transfection
R4511 T6373 T6376 punct (,Macrophages
R4512 T6374 T6376 nmod RAW264,Macrophages
R4513 T6375 T6376 nummod .7,Macrophages
R4514 T6376 T6372 appos Macrophages,Assays
R4515 T6377 T6376 punct ),Macrophages
R4516 T6378 T6372 conj RAW,Assays
R4517 T6379 T6378 nummod 264.7,RAW
R4518 T6380 T6369 appos cells,Transfection
R4519 T6381 T6380 punct (,cells
R4520 T6382 T6384 nummod 2,107
R4521 T6383 T6384 nummod ×,107
R4522 T6384 T6380 appos 107,cells
R4523 T6385 T6380 punct ),cells
R4524 T6386 T6386 ROOT growing,growing
R4525 T6387 T6386 prep in,growing
R4526 T6388 T6389 compound log,phase
R4527 T6389 T6387 pobj phase,in
R4528 T6390 T6391 auxpass were,transfected
R4529 T6391 T6386 conj transfected,growing
R4530 T6392 T6391 prep with,transfected
R4531 T6393 T6397 det the,plasmid
R4532 T6394 T6397 amod indicated,plasmid
R4533 T6395 T6397 compound luciferase,plasmid
R4534 T6396 T6397 compound reporter,plasmid
R4535 T6397 T6392 pobj plasmid,with
R4536 T6398 T6397 punct (,plasmid
R4537 T6399 T6400 nummod 20,µg
R4538 T6400 T6397 appos µg,plasmid
R4539 T6401 T6397 punct ),plasmid
R4540 T6402 T6391 prep along,transfected
R4541 T6403 T6402 prep with,along
R4542 T6404 T6406 det the,kinase
R4543 T6405 T6406 amod pRL-thymidine,kinase
R4544 T6406 T6403 pobj kinase,with
R4545 T6407 T6406 punct (,kinase
R4546 T6408 T6406 appos TK,kinase
R4547 T6409 T6406 punct ),kinase
R4548 T6410 T6411 punct (,Promega
R4549 T6411 T6406 appos Promega,kinase
R4550 T6412 T6411 punct ),Promega
R4551 T6413 T6414 amod internal,control
R4552 T6414 T6416 compound control,plasmid
R4553 T6415 T6416 compound reporter,plasmid
R4554 T6416 T6406 appos plasmid,kinase
R4555 T6417 T6419 punct (,µg
R4556 T6418 T6419 nummod 2,µg
R4557 T6419 T6416 appos µg,plasmid
R4558 T6420 T6406 punct ),kinase
R4559 T6421 T6391 agent by,transfected
R4560 T6422 T6421 pobj electroporation,by
R4561 T6423 T6391 advcl using,transfected
R4562 T6424 T6427 det a,Pulser
R4563 T6425 T6427 compound Bio-Rad,Pulser
R4564 T6426 T6427 compound Gene,Pulser
R4565 T6427 T6423 dobj Pulser,using
R4566 T6428 T6423 prep with,using
R4567 T6429 T6431 det a,Extender
R4568 T6430 T6431 compound Capacitance,Extender
R4569 T6431 T6428 pobj Extender,with
R4570 T6432 T6434 punct (,kV
R4571 T6433 T6434 nummod 0.25,kV
R4572 T6434 T6437 npadvmod kV,µFd
R4573 T6435 T6437 punct ",",µFd
R4574 T6436 T6437 nummod 960,µFd
R4575 T6437 T6437 ROOT µFd,µFd
R4576 T6438 T6437 punct ),µFd
R4577 T6439 T6386 punct .,growing
R4578 T6440 T6442 amod pGL3,plasmid
R4579 T6441 T6442 compound control,plasmid
R4580 T6442 T6451 nsubjpass plasmid,included
R4581 T6443 T6444 nsubj which,encodes
R4582 T6444 T6442 relcl encodes,plasmid
R4583 T6445 T6447 det the,promoter
R4584 T6446 T6447 compound SV40,promoter
R4585 T6447 T6444 dobj promoter,encodes
R4586 T6448 T6447 cc and,promoter
R4587 T6449 T6447 conj enhancer,promoter
R4588 T6450 T6451 auxpass was,included
R4589 T6451 T6451 ROOT included,included
R4590 T6452 T6451 prep as,included
R4591 T6453 T6455 det a,control
R4592 T6454 T6455 amod positive,control
R4593 T6455 T6452 pobj control,as
R4594 T6456 T6455 prep for,control
R4595 T6457 T6458 compound transfection,efficiency
R4596 T6458 T6456 pobj efficiency,for
R4597 T6459 T6451 punct ",",included
R4598 T6460 T6451 cc and,included
R4599 T6461 T6451 prep as,included
R4600 T6462 T6464 det an,standard
R4601 T6463 T6464 amod internal,standard
R4602 T6464 T6461 pobj standard,as
R4603 T6465 T6464 prep for,standard
R4604 T6466 T6469 nmod promoter,activities
R4605 T6467 T6466 cc and,promoter
R4606 T6468 T6466 conj enhancer,promoter
R4607 T6469 T6465 pobj activities,for
R4608 T6470 T6451 punct .,included
R4609 T6471 T6472 amod Transfected,cells
R4610 T6472 T6474 nsubjpass cells,transferred
R4611 T6473 T6474 auxpass were,transferred
R4612 T6474 T6474 ROOT transferred,transferred
R4613 T6475 T6474 prep to,transferred
R4614 T6476 T6477 nummod 10,ml
R4615 T6477 T6475 pobj ml,to
R4616 T6478 T6477 prep of,ml
R4617 T6479 T6480 amod pre-warmed,media
R4618 T6480 T6478 pobj media,of
R4619 T6481 T6477 prep in,ml
R4620 T6482 T6484 amod 6-well,culture
R4621 T6483 T6484 compound tissue,culture
R4622 T6484 T6485 compound culture,plates
R4623 T6485 T6481 pobj plates,in
R4624 T6486 T6485 punct ",",plates
R4625 T6487 T6474 conj divided,transferred
R4626 T6488 T6487 prep into,divided
R4627 T6489 T6492 nummod two,pools
R4628 T6490 T6492 amod identical,pools
R4629 T6491 T6492 compound cell,pools
R4630 T6492 T6488 pobj pools,into
R4631 T6493 T6487 cc and,divided
R4632 T6494 T6487 conj incubated,divided
R4633 T6495 T6496 nummod 16,hrs
R4634 T6496 T6494 dobj hrs,incubated
R4635 T6497 T6494 prep in,incubated
R4636 T6498 T6507 det a,atmosphere
R4637 T6499 T6500 nummod 5,%
R4638 T6500 T6507 nmod %,atmosphere
R4639 T6501 T6504 nummod CO2,%
R4640 T6502 T6501 cc and,CO2
R4641 T6503 T6504 nummod 95,%
R4642 T6504 T6507 nmod %,atmosphere
R4643 T6505 T6507 amod humidified,atmosphere
R4644 T6506 T6507 compound air,atmosphere
R4645 T6507 T6497 pobj atmosphere,in
R4646 T6508 T6494 prep at,incubated
R4647 T6509 T6510 nummod 37,°
R4648 T6510 T6508 pobj °,at
R4649 T6511 T6494 conj C,incubated
R4650 T6512 T6513 preconj either,in
R4651 T6513 T6494 prep in,incubated
R4652 T6514 T6515 det the,presence
R4653 T6515 T6513 pobj presence,in
R4654 T6516 T6515 cc or,presence
R4655 T6517 T6515 conj absence,presence
R4656 T6518 T6517 prep of,absence
R4657 T6519 T6521 nummod 100,LPS
R4658 T6520 T6521 amod ng/ml,LPS
R4659 T6521 T6518 pobj LPS,of
R4660 T6522 T6474 punct .,transferred
R4661 T6523 T6524 amod Luciferase,activity
R4662 T6524 T6526 nsubjpass activity,measured
R4663 T6525 T6526 auxpass was,measured
R4664 T6526 T6526 ROOT measured,measured
R4665 T6527 T6526 advcl using,measured
R4666 T6528 T6533 det a,kit
R4667 T6529 T6532 compound Dual-Luciferase,System
R4668 T6530 T6532 compound Reporter,System
R4669 T6531 T6532 compound Assay,System
R4670 T6532 T6533 compound System,kit
R4671 T6533 T6527 dobj kit,using
R4672 T6534 T6533 punct (,kit
R4673 T6535 T6533 appos Promega,kit
R4674 T6536 T6533 punct ),kit
R4675 T6537 T6526 punct .,measured
R4676 T6538 T6539 nsubj Measurements,represent
R4677 T6539 T6539 ROOT represent,represent
R4678 T6540 T6541 det the,results
R4679 T6541 T6539 dobj results,represent
R4680 T6542 T6541 prep of,results
R4681 T6543 T6544 advmod at,least
R4682 T6544 T6545 advmod least,three
R4683 T6545 T6547 nummod three,experiments
R4684 T6546 T6547 amod independent,experiments
R4685 T6547 T6542 pobj experiments,of
R4686 T6548 T6539 punct .,represent
R4687 T6549 T6550 compound Promoter,activity
R4688 T6550 T6552 nsubjpass activity,expressed
R4689 T6551 T6552 auxpass is,expressed
R4690 T6552 T6552 ROOT expressed,expressed
R4691 T6553 T6552 prep as,expressed
R4692 T6554 T6555 det the,number
R4693 T6555 T6553 pobj number,as
R4694 T6556 T6555 prep of,number
R4695 T6557 T6558 advmod firefly,luciferase
R4696 T6558 T6560 amod luciferase,units
R4697 T6559 T6560 amod light,units
R4698 T6560 T6556 pobj units,of
R4699 T6561 T6552 conj normalized,expressed
R4700 T6562 T6561 advmod either,normalized
R4701 T6563 T6564 aux to,pRL-TK
R4702 T6564 T6562 xcomp pRL-TK,either
R4703 T6565 T6566 compound renilla,luciferase
R4704 T6566 T6568 amod luciferase,units
R4705 T6567 T6568 amod light,units
R4706 T6568 T6564 dobj units,pRL-TK
R4707 T6569 T6564 cc or,pRL-TK
R4708 T6570 T6564 conj to,pRL-TK
R4709 T6571 T6573 amod cellular,concentration
R4710 T6572 T6573 compound protein,concentration
R4711 T6573 T6570 pobj concentration,to
R4712 T6574 T6573 punct (,concentration
R4713 T6575 T6582 advmod where,affected
R4714 T6576 T6582 nsubj co-transfected,affected
R4715 T6577 T6579 compound C/EBP,β
R4716 T6578 T6579 punct -,β
R4717 T6579 T6582 nsubj β,affected
R4718 T6580 T6579 cc or,β
R4719 T6581 T6579 conj LPS,β
R4720 T6582 T6573 relcl affected,concentration
R4721 T6583 T6584 amod pRL-TK,activity
R4722 T6584 T6582 dobj activity,affected
R4723 T6585 T6573 punct ),concentration
R4724 T6586 T6552 punct .,expressed
R4725 T6587 T6588 compound Protein,concentration
R4726 T6588 T6590 nsubjpass concentration,determined
R4727 T6589 T6590 auxpass was,determined
R4728 T6590 T6590 ROOT determined,determined
R4729 T6591 T6590 advcl using,determined
R4730 T6592 T6594 det the,protein
R4731 T6593 T6594 compound Bio-Rad,protein
R4732 T6594 T6591 dobj protein,using
R4733 T6595 T6596 compound microassay,reagent
R4734 T6596 T6594 appos reagent,protein
R4735 T6597 T6590 punct .,determined
R4969 T6927 T6928 compound Lentiviral,shRNAs
R4970 T6928 T6950 nsubjpass shRNAs,used
R4971 T6929 T6928 punct ",",shRNAs
R4972 T6930 T6935 nmod Packaging,vectors
R4973 T6931 T6930 cc and,Packaging
R4974 T6932 T6933 compound Transduction,pLKO.1-puro
R4975 T6933 T6930 conj pLKO.1-puro,Packaging
R4976 T6934 T6935 amod lentiviral,vectors
R4977 T6935 T6928 appos vectors,shRNAs
R4978 T6936 T6935 acl carrying,vectors
R4979 T6937 T6939 amod short,RNAs
R4980 T6938 T6939 compound hairpin,RNAs
R4981 T6939 T6936 dobj RNAs,carrying
R4982 T6940 T6939 punct (,RNAs
R4983 T6941 T6939 appos shRNA,RNAs
R4984 T6942 T6939 punct ),RNAs
R4985 T6943 T6935 conj specific,vectors
R4986 T6944 T6943 prep for,specific
R4987 T6945 T6948 amod human,cebpb
R4988 T6946 T6945 cc and,human
R4989 T6947 T6945 conj mouse,human
R4990 T6948 T6944 pobj cebpb,for
R4991 T6949 T6950 auxpass were,used
R4992 T6950 T6950 ROOT used,used
R4993 T6951 T6950 prep in,used
R4994 T6952 T6953 det these,studies
R4995 T6953 T6951 pobj studies,in
R4996 T6954 T6950 punct .,used
R4997 T6955 T6965 mark Because,are
R4998 T6956 T6964 det the,regions
R4999 T6957 T6960 amod human,cebpb
R5000 T6958 T6957 cc and,human
R5001 T6959 T6957 conj mouse,human
R5002 T6960 T6964 nmod cebpb,regions
R5003 T6961 T6962 nummod 3,′
R5004 T6962 T6964 compound ′,regions
R5005 T6963 T6964 compound untranslated,regions
R5006 T6964 T6965 nsubj regions,are
R5007 T6965 T6974 advcl are,knockdown
R5008 T6966 T6965 neg not,are
R5009 T6967 T6965 acomp identical,are
R5010 T6968 T6974 punct ",",knockdown
R5011 T6969 T6971 det these,shRNAs
R5012 T6970 T6971 amod species-specific,shRNAs
R5013 T6971 T6974 nsubj shRNAs,knockdown
R5014 T6972 T6974 aux can,knockdown
R5015 T6973 T6974 neg not,knockdown
R5016 T6974 T6992 ccomp knockdown,used
R5017 T6975 T6974 dobj expression,knockdown
R5018 T6976 T6975 prep of,expression
R5019 T6977 T6980 amod endogenous,β
R5020 T6978 T6980 compound C/EBP,β
R5021 T6979 T6980 punct -,β
R5022 T6980 T6976 pobj β,of
R5023 T6981 T6982 advmod when,used
R5024 T6982 T6974 advcl used,knockdown
R5025 T6983 T6982 prep on,used
R5026 T6984 T6983 pobj cells,on
R5027 T6985 T6984 prep of,cells
R5028 T6986 T6988 det the,species
R5029 T6987 T6988 amod other,species
R5030 T6988 T6985 pobj species,of
R5031 T6989 T6992 punct ;,used
R5032 T6990 T6992 advmod therefore,used
R5033 T6991 T6992 nsubj we,used
R5034 T6992 T6992 ROOT used,used
R5035 T6993 T6996 det the,shRNA
R5036 T6994 T6996 amod human,shRNA
R5037 T6995 T6996 compound CEBPB,shRNA
R5038 T6996 T6992 dobj shRNA,used
R5039 T6997 T6992 prep as,used
R5040 T6998 T6999 det a,control
R5041 T6999 T6997 pobj control,as
R5042 T7000 T6999 prep in,control
R5043 T7001 T7002 det these,experiments
R5044 T7002 T7000 pobj experiments,in
R5045 T7003 T6999 prep as,control
R5046 T7004 T7003 prep in,as
R5047 T7005 T7004 pobj [,in
R5048 T7006 T7007 nummod 38,]
R5049 T7007 T7003 pobj ],as
R5050 T7008 T6992 punct .,used
R5051 T7009 T7010 aux To,produce
R5052 T7010 T7017 advcl produce,transfected
R5053 T7011 T7012 amod lentiviral,particles
R5054 T7012 T7010 dobj particles,produce
R5055 T7013 T7017 punct ",",transfected
R5056 T7014 T7015 amod HEK-293T,cells
R5057 T7015 T7017 nsubjpass cells,transfected
R5058 T7016 T7017 auxpass were,transfected
R5059 T7017 T7017 ROOT transfected,transfected
R5060 T7018 T7017 prep with,transfected
R5061 T7019 T7020 det a,mixture
R5062 T7020 T7018 pobj mixture,with
R5063 T7021 T7020 prep of,mixture
R5064 T7022 T7021 pobj plasmids,of
R5065 T7023 T7017 punct :,transfected
R5066 T7024 T7027 det each,plasmid
R5067 T7025 T7027 amod shRNA,plasmid
R5068 T7026 T7027 compound expression,plasmid
R5069 T7027 T7027 ROOT plasmid,plasmid
R5070 T7028 T7030 punct (,µg
R5071 T7029 T7030 nummod 1,µg
R5072 T7030 T7027 appos µg,plasmid
R5073 T7031 T7027 punct ),plasmid
R5074 T7032 T7027 punct ",",plasmid
R5075 T7033 T7037 amod pCMV-ΔR8,plasmid
R5076 T7034 T7037 nummod .2,plasmid
R5077 T7035 T7037 compound dvpr,plasmid
R5078 T7036 T7037 compound packaging,plasmid
R5079 T7037 T7027 conj plasmid,plasmid
R5080 T7038 T7037 punct (,plasmid
R5081 T7039 T7040 nummod 0.75,µg
R5082 T7040 T7037 appos µg,plasmid
R5083 T7041 T7037 punct ),plasmid
R5084 T7042 T7037 punct ",",plasmid
R5085 T7043 T7017 cc and,transfected
R5086 T7044 T7046 compound pCMV-VSV-G,plasmid
R5087 T7045 T7046 compound envelope,plasmid
R5088 T7046 T7046 ROOT plasmid,plasmid
R5089 T7047 T7046 punct (,plasmid
R5090 T7048 T7049 nummod 0.25,µg
R5091 T7049 T7046 appos µg,plasmid
R5092 T7050 T7046 punct ),plasmid
R5093 T7051 T7017 advcl using,transfected
R5094 T7052 T7054 nmod Lipofectamine,reagent
R5095 T7053 T7054 nummod 2000,reagent
R5096 T7054 T7051 dobj reagent,using
R5097 T7055 T7054 punct (,reagent
R5098 T7056 T7054 appos Invitrogen,reagent
R5099 T7057 T7054 punct ),reagent
R5100 T7058 T7017 punct .,transfected
R5101 T7059 T7061 det The,supernatant
R5102 T7060 T7061 amod lentiviral,supernatant
R5103 T7061 T7063 nsubjpass supernatant,collected
R5104 T7062 T7063 auxpass was,collected
R5105 T7063 T7063 ROOT collected,collected
R5106 T7064 T7065 nummod 48,hrs
R5107 T7065 T7063 dobj hrs,collected
R5108 T7066 T7063 prep after,collected
R5109 T7067 T7066 pobj transfection,after
R5110 T7068 T7066 punct ",",after
R5111 T7069 T7063 conj cleared,collected
R5112 T7070 T7069 agent by,cleared
R5113 T7071 T7070 pobj centrifugation,by
R5114 T7072 T7069 prep at,cleared
R5115 T7073 T7074 nummod "2,000",g
R5116 T7074 T7072 pobj g,at
R5117 T7075 T7069 prep for,cleared
R5118 T7076 T7077 nummod 10,mins
R5119 T7077 T7075 pobj mins,for
R5120 T7078 T7069 cc and,cleared
R5121 T7079 T7069 conj passed,cleared
R5122 T7080 T7079 prep through,passed
R5123 T7081 T7084 det a,filter
R5124 T7082 T7084 nummod 0.45,filter
R5125 T7083 T7084 compound µm,filter
R5126 T7084 T7080 pobj filter,through
R5127 T7085 T7063 punct .,collected
R5128 T7086 T7088 det The,cells
R5129 T7087 T7088 compound target,cells
R5130 T7088 T7090 nsubjpass cells,treated
R5131 T7089 T7090 auxpass were,treated
R5132 T7090 T7090 ROOT treated,treated
R5133 T7091 T7090 prep with,treated
R5134 T7092 T7094 det the,supernatant
R5135 T7093 T7094 amod lentiviral,supernatant
R5136 T7094 T7091 pobj supernatant,with
R5137 T7095 T7094 cc and,supernatant
R5138 T7096 T7097 nummod 8,µg
R5139 T7097 T7100 compound µg,Polybrene
R5140 T7098 T7100 compound /,Polybrene
R5141 T7099 T7100 compound ml,Polybrene
R5142 T7100 T7094 conj Polybrene,supernatant
R5143 T7101 T7100 punct (,Polybrene
R5144 T7102 T7103 compound American,Bioanalytical
R5145 T7103 T7100 appos Bioanalytical,Polybrene
R5146 T7104 T7100 punct ),Polybrene
R5147 T7105 T7100 prep for,Polybrene
R5148 T7106 T7107 nummod 24,hrs
R5149 T7107 T7105 pobj hrs,for
R5150 T7108 T7090 punct .,treated
R5151 T7109 T7111 det The,supernatant
R5152 T7110 T7111 amod lentiviral,supernatant
R5153 T7111 T7113 nsubjpass supernatant,replaced
R5154 T7112 T7113 auxpass was,replaced
R5155 T7113 T7113 ROOT replaced,replaced
R5156 T7114 T7113 prep with,replaced
R5157 T7115 T7117 amod fresh,media
R5158 T7116 T7117 compound growth,media
R5159 T7117 T7114 pobj media,with
R5160 T7118 T7113 cc and,replaced
R5161 T7119 T7113 conj incubated,replaced
R5162 T7120 T7119 advmod further,incubated
R5163 T7121 T7125 mark for,allow
R5164 T7122 T7123 nummod 72,hrs
R5165 T7123 T7125 nsubj hrs,allow
R5166 T7124 T7125 aux to,allow
R5167 T7125 T7119 advcl allow,incubated
R5168 T7126 T7125 prep for,allow
R5169 T7127 T7129 amod effective,knockdown
R5170 T7128 T7129 compound gene,knockdown
R5171 T7129 T7126 pobj knockdown,for
R5172 T7130 T7113 punct .,replaced
R5173 T7131 T7113 punct C/EBP,replaced
R5174 T7132 T7133 punct -,β
R5175 T7133 T7134 compound β,knockdown
R5176 T7134 T7136 nsubjpass knockdown,confirmed
R5177 T7135 T7136 auxpass was,confirmed
R5178 T7136 T7136 ROOT confirmed,confirmed
R5179 T7137 T7136 agent by,confirmed
R5180 T7138 T7140 amod western,analysis
R5181 T7139 T7140 compound blot,analysis
R5182 T7140 T7137 pobj analysis,by
R5183 T7141 T7136 punct .,confirmed
R5403 T7597 T7598 compound Transient,Transfection
R5404 T7598 T7598 ROOT Transfection,Transfection
R5405 T7599 T7598 cc and,Transfection
R5406 T7600 T7601 compound Luciferase,Assays
R5407 T7601 T7598 conj Assays,Transfection
R5408 T7602 T7604 punct (,Cells
R5409 T7603 T7604 compound MEF,Cells
R5410 T7604 T7601 appos Cells,Assays
R5411 T7605 T7601 punct ),Assays
R5412 T7606 T7607 compound Cebpb,−
R5413 T7607 T7608 nsubj −,/
R5414 T7608 T7608 ROOT /,/
R5415 T7609 T7610 nummod −,MEFs
R5416 T7610 T7608 dobj MEFs,/
R5417 T7611 T7610 punct (,MEFs
R5418 T7612 T7614 nummod 1,105
R5419 T7613 T7614 nummod ×,105
R5420 T7614 T7610 appos 105,MEFs
R5421 T7615 T7610 punct ),MEFs
R5422 T7616 T7618 nmod [,]
R5423 T7617 T7618 nummod 34,]
R5424 T7618 T7620 nsubjpass ],transfected
R5425 T7619 T7620 auxpass were,transfected
R5426 T7620 T7620 ROOT transfected,transfected
R5427 T7621 T7620 prep with,transfected
R5428 T7622 T7626 det the,plasmid
R5429 T7623 T7626 amod indicated,plasmid
R5430 T7624 T7626 compound luciferase,plasmid
R5431 T7625 T7626 compound reporter,plasmid
R5432 T7626 T7621 pobj plasmid,with
R5433 T7627 T7626 punct (,plasmid
R5434 T7628 T7629 nummod 400,ng
R5435 T7629 T7626 appos ng,plasmid
R5436 T7630 T7626 punct ),plasmid
R5437 T7631 T7620 prep along,transfected
R5438 T7632 T7631 prep with,along
R5439 T7633 T7635 det a,reporter
R5440 T7634 T7635 amod β-actin-β-galactosidase,reporter
R5441 T7635 T7636 compound reporter,plasmid
R5442 T7636 T7632 pobj plasmid,with
R5443 T7637 T7636 punct (,plasmid
R5444 T7638 T7639 nummod 200,ng
R5445 T7639 T7636 appos ng,plasmid
R5446 T7640 T7636 punct ),plasmid
R5447 T7641 T7620 agent by,transfected
R5448 T7642 T7641 pobj electroporation,by
R5449 T7643 T7620 advcl using,transfected
R5450 T7644 T7648 det the,system
R5451 T7645 T7648 compound Invitrogen,system
R5452 T7646 T7648 compound Neon,system
R5453 T7647 T7648 compound ™,system
R5454 T7648 T7643 dobj system,using
R5455 T7649 T7648 punct (,system
R5456 T7650 T7651 nummod 1,pulse
R5457 T7651 T7648 appos pulse,system
R5458 T7652 T7648 punct ",",system
R5459 T7653 T7654 nummod 1350,V
R5460 T7654 T7648 conj V,system
R5461 T7655 T7654 punct ",",V
R5462 T7656 T7657 nummod 30,msec
R5463 T7657 T7654 appos msec,V
R5464 T7658 T7657 punct ),msec
R5465 T7659 T7620 punct .,transfected
R5466 T7660 T7661 amod Transfected,cells
R5467 T7661 T7663 nsubjpass cells,transferred
R5468 T7662 T7663 auxpass were,transferred
R5469 T7663 T7663 ROOT transferred,transferred
R5470 T7664 T7663 prep to,transferred
R5471 T7665 T7666 amod pre-warmed,media
R5472 T7666 T7664 pobj media,to
R5473 T7667 T7663 prep in,transferred
R5474 T7668 T7670 nummod 24,plates
R5475 T7669 T7670 intj well,plates
R5476 T7670 T7667 pobj plates,in
R5477 T7671 T7670 cc and,plates
R5478 T7672 T7663 advcl incubated,transferred
R5479 T7673 T7672 prep for,incubated
R5480 T7674 T7675 nummod 48,hrs
R5481 T7675 T7673 pobj hrs,for
R5482 T7676 T7672 advmod prior,incubated
R5483 T7677 T7676 prep to,prior
R5484 T7678 T7677 pobj incubation,to
R5485 T7679 T7672 prep with,incubated
R5486 T7680 T7679 pobj LPS,with
R5487 T7681 T7680 punct (,LPS
R5488 T7682 T7683 nummod 100,ng/ml
R5489 T7683 T7680 appos ng/ml,LPS
R5490 T7684 T7680 punct ),LPS
R5491 T7685 T7672 prep for,incubated
R5492 T7686 T7687 nummod 4,hrs
R5493 T7687 T7685 pobj hrs,for
R5494 T7688 T7689 advmod where,indicated
R5495 T7689 T7687 relcl indicated,hrs
R5496 T7690 T7663 punct .,transferred
R5497 T7691 T7691 ROOT In,In
R5498 T7692 T7693 det some,experiments
R5499 T7693 T7691 pobj experiments,In
R5500 T7694 T7693 punct ",",experiments
R5501 T7695 T7699 nmod plasmids,β
R5502 T7696 T7695 acl encoding,plasmids
R5503 T7697 T7699 compound C/EBP,β
R5504 T7698 T7699 punct -,β
R5505 T7699 T7694 dative β,","
R5506 T7700 T7699 cc or,β
R5507 T7701 T7703 punct C/EBP,β
R5508 T7702 T7703 punct -,β
R5509 T7703 T7705 nmod β,mutants
R5510 T7704 T7705 compound phospho-acceptor,mutants
R5511 T7705 T7699 conj mutants,β
R5512 T7706 T7705 punct (,mutants
R5513 T7707 T7705 appos T188A,mutants
R5514 T7708 T7707 punct ",",T188A
R5515 T7709 T7707 appos T217A,T188A
R5516 T7710 T7705 punct ",",mutants
R5517 T7711 T7705 appos S64A,mutants
R5518 T7712 T7705 punct ),mutants
R5519 T7713 T7715 nmod [,]
R5520 T7714 T7715 nummod 38,]
R5521 T7715 T7723 nsubjpass ],co-transfected
R5522 T7716 T7715 appos [,]
R5523 T7717 T7718 nummod 40,]
R5524 T7718 T7716 dobj ],[
R5525 T7719 T7716 cc or,[
R5526 T7720 T7721 amod control,vector
R5527 T7721 T7716 conj vector,[
R5528 T7722 T7723 auxpass were,co-transfected
R5529 T7723 T7723 ROOT co-transfected,co-transfected
R5530 T7724 T7723 punct (,co-transfected
R5531 T7725 T7727 nummod 0.6,µg
R5532 T7726 T7727 nummod 1.0,µg
R5533 T7727 T7723 appos µg,co-transfected
R5534 T7728 T7729 amod total,DNA
R5535 T7729 T7727 appos DNA,µg
R5536 T7730 T7727 punct ),µg
R5537 T7731 T7723 punct .,co-transfected
R5538 T7732 T7733 amod Luciferase,activity
R5539 T7733 T7735 nsubjpass activity,determined
R5540 T7734 T7735 auxpass was,determined
R5541 T7735 T7735 ROOT determined,determined
R5542 T7736 T7735 cc and,determined
R5543 T7737 T7735 conj normalized,determined
R5544 T7738 T7737 prep to,normalized
R5545 T7739 T7738 pobj that,to
R5546 T7740 T7739 prep of,that
R5547 T7741 T7742 compound β-galactosidase,[
R5548 T7742 T7740 pobj [,of
R5549 T7743 T7744 nummod 38,]
R5550 T7744 T7745 nsubj ],using
R5551 T7745 T7735 advcl using,determined
R5552 T7746 T7749 det the,System
R5553 T7747 T7749 compound Luciferase,System
R5554 T7748 T7749 compound Assay,System
R5555 T7749 T7745 dobj System,using
R5556 T7750 T7749 cc and,System
R5557 T7751 T7754 compound β-Galactosidase,System
R5558 T7752 T7754 compound Enzyme,System
R5559 T7753 T7754 compound Assay,System
R5560 T7754 T7749 conj System,System
R5561 T7755 T7749 conj Kits,System
R5562 T7756 T7745 punct ",",using
R5563 T7757 T7745 advmod respectively,using
R5564 T7758 T7759 punct (,Promega
R5565 T7759 T7757 appos Promega,respectively
R5566 T7760 T7759 punct ),Promega
R5567 T7761 T7735 punct .,determined
R5568 T7762 T7763 det Each,experiment
R5569 T7763 T7765 nsubjpass experiment,repeated
R5570 T7764 T7765 auxpass was,repeated
R5571 T7765 T7765 ROOT repeated,repeated
R5572 T7766 T7767 advmod at,least
R5573 T7767 T7768 advmod least,three
R5574 T7768 T7769 nummod three,times
R5575 T7769 T7765 npadvmod times,repeated
R5576 T7770 T7765 punct ",",repeated
R5577 T7771 T7765 cc and,repeated
R5578 T7772 T7773 compound triplicate,samples
R5579 T7773 T7775 nsubjpass samples,employed
R5580 T7774 T7775 auxpass were,employed
R5581 T7775 T7765 conj employed,repeated
R5582 T7776 T7775 prep for,employed
R5583 T7777 T7778 det each,sample
R5584 T7778 T7776 pobj sample,for
R5585 T7779 T7775 punct .,employed
R5586 T7780 T7788 nmod Expression,proteins
R5587 T7781 T7780 prep of,Expression
R5588 T7782 T7783 det the,C/EBP
R5589 T7783 T7781 pobj C/EBP,of
R5590 T7784 T7785 punct -,β
R5591 T7785 T7788 amod β,proteins
R5592 T7786 T7788 amod phospho-acceptor,proteins
R5593 T7787 T7788 amod mutant,proteins
R5594 T7788 T7790 nsubjpass proteins,checked
R5595 T7789 T7790 auxpass was,checked
R5596 T7790 T7790 ROOT checked,checked
R5597 T7791 T7790 prep for,checked
R5598 T7792 T7793 amod equal,expression
R5599 T7793 T7791 pobj expression,for
R5600 T7794 T7793 prep by,expression
R5601 T7795 T7796 amod western,blot
R5602 T7796 T7794 pobj blot,by
R5603 T7797 T7790 punct .,checked
R5781 T8059 T8063 compound Electrophoretic,Radiolabelled
R5782 T8060 T8061 compound Mobility,Shift
R5783 T8061 T8063 compound Shift,Radiolabelled
R5784 T8062 T8063 compound Assays,Radiolabelled
R5785 T8063 T8063 ROOT Radiolabelled,Radiolabelled
R5786 T8064 T8063 punct ",",Radiolabelled
R5787 T8065 T8067 amod double-stranded,probes
R5788 T8066 T8067 compound oligonucleotide,probes
R5789 T8067 T8073 nsubjpass probes,prepared
R5790 T8068 T8067 prep for,probes
R5791 T8069 T8070 compound gel,shift
R5792 T8070 T8071 compound shift,assays
R5793 T8071 T8068 pobj assays,for
R5794 T8072 T8073 auxpass were,prepared
R5795 T8073 T8063 npadvmod prepared,Radiolabelled
R5796 T8074 T8073 advcl using,prepared
R5797 T8075 T8077 nummod T4,kinase
R5798 T8076 T8077 compound polynucleotide,kinase
R5799 T8077 T8074 dobj kinase,using
R5800 T8078 T8077 cc and,kinase
R5801 T8079 T8083 compound [,ATP
R5802 T8080 T8083 compound γ-32P,ATP
R5803 T8081 T8083 compound ],ATP
R5804 T8082 T8083 punct -,ATP
R5805 T8083 T8077 conj ATP,kinase
R5806 T8084 T8073 punct .,prepared
R5807 T8085 T8090 nsubjpass RAW,prepared
R5808 T8086 T8088 nummod 264.7,extracts
R5809 T8087 T8088 amod nuclear,extracts
R5810 T8088 T8090 nsubjpass extracts,prepared
R5811 T8089 T8090 auxpass were,prepared
R5812 T8090 T8090 ROOT prepared,prepared
R5813 T8091 T8090 agent by,prepared
R5814 T8092 T8095 det the,method
R5815 T8093 T8094 compound detergent,lysis
R5816 T8094 T8095 compound lysis,method
R5817 T8095 T8091 pobj method,by
R5818 T8096 T8098 nmod [,]
R5819 T8097 T8098 nummod 41,]
R5820 T8098 T8095 appos ],method
R5821 T8099 T8090 punct .,prepared
R5822 T8100 T8159 nsubjpass DNA,performed
R5823 T8101 T8102 amod binding,reactions
R5824 T8102 T8100 dobj reactions,DNA
R5825 T8103 T8102 punct (,reactions
R5826 T8104 T8105 nummod 25,µl
R5827 T8105 T8102 appos µl,reactions
R5828 T8106 T8105 punct ),µl
R5829 T8107 T8105 acl containing,µl
R5830 T8108 T8111 nummod 10,pH
R5831 T8109 T8111 compound mM,pH
R5832 T8110 T8111 compound HEPES,pH
R5833 T8111 T8107 dobj pH,containing
R5834 T8112 T8111 nummod 7.9,pH
R5835 T8113 T8111 punct ",",pH
R5836 T8114 T8118 nummod 10,BSA
R5837 T8115 T8118 amod µg,BSA
R5838 T8116 T8118 nmod /,BSA
R5839 T8117 T8118 compound ml,BSA
R5840 T8118 T8111 appos BSA,pH
R5841 T8119 T8111 punct ",",pH
R5842 T8120 T8122 nummod 2,DTT
R5843 T8121 T8122 compound mM,DTT
R5844 T8122 T8111 conj DTT,pH
R5845 T8123 T8122 punct ",",DTT
R5846 T8124 T8125 nummod 30,%
R5847 T8125 T8126 compound %,glycerol
R5848 T8126 T8122 conj glycerol,DTT
R5849 T8127 T8126 punct ",",glycerol
R5850 T8128 T8129 nummod 20,%
R5851 T8129 T8130 compound %,Ficoll-400
R5852 T8130 T8126 appos Ficoll-400,glycerol
R5853 T8131 T8130 punct ",",Ficoll-400
R5854 T8132 T8134 nummod 1,poly
R5855 T8133 T8134 compound µg,poly
R5856 T8134 T8159 nsubjpass poly,performed
R5857 T8135 T8136 punct (,dI-dC
R5858 T8136 T8134 appos dI-dC,poly
R5859 T8137 T8136 punct ),dI-dC
R5860 T8138 T8134 punct ",",poly
R5861 T8139 T8140 nummod 6,µg
R5862 T8140 T8134 appos µg,poly
R5863 T8141 T8140 prep of,µg
R5864 T8142 T8143 amod nuclear,extracts
R5865 T8143 T8141 pobj extracts,of
R5866 T8144 T8140 cc and,µg
R5867 T8145 T8147 quantmod "10,000","20,000"
R5868 T8146 T8147 quantmod to,"20,000"
R5869 T8147 T8148 nummod "20,000",cpm
R5870 T8148 T8140 conj cpm,µg
R5871 T8149 T8153 punct (,ng
R5872 T8150 T8152 quantmod 0.05,0.2
R5873 T8151 T8152 quantmod to,0.2
R5874 T8152 T8153 nummod 0.2,ng
R5875 T8153 T8148 appos ng,cpm
R5876 T8154 T8153 punct ),ng
R5877 T8155 T8148 prep of,cpm
R5878 T8156 T8157 amod radiolabelled,probe
R5879 T8157 T8155 pobj probe,of
R5880 T8158 T8159 auxpass were,performed
R5881 T8159 T8159 ROOT performed,performed
R5882 T8160 T8159 prep for,performed
R5883 T8161 T8162 nummod 20,minutes
R5884 T8162 T8160 pobj minutes,for
R5885 T8163 T8162 prep at,minutes
R5886 T8164 T8165 compound room,temperature
R5887 T8165 T8163 pobj temperature,at
R5888 T8166 T8159 punct .,performed
R5889 T8167 T8169 amod Binding,products
R5890 T8168 T8169 compound reaction,products
R5891 T8169 T8171 nsubjpass products,resolved
R5892 T8170 T8171 auxpass were,resolved
R5893 T8171 T8171 ROOT resolved,resolved
R5894 T8172 T8171 agent by,resolved
R5895 T8173 T8172 pobj electrophoresis,by
R5896 T8174 T8171 prep at,resolved
R5897 T8175 T8176 compound room,temperature
R5898 T8176 T8174 pobj temperature,at
R5899 T8177 T8171 prep on,resolved
R5900 T8178 T8179 nummod 5,%
R5901 T8179 T8181 compound %,gels
R5902 T8180 T8181 compound polyacrylamide,gels
R5903 T8181 T8177 pobj gels,on
R5904 T8182 T8181 punct (,gels
R5905 T8183 T8184 nummod 29,∶
R5906 T8184 T8181 appos ∶,gels
R5907 T8185 T8184 nummod 1,∶
R5908 T8186 T8186 ROOT acrylamide,acrylamide
R5909 T8187 T8186 punct :,acrylamide
R5910 T8188 T8186 appos bis-acrylamide,acrylamide
R5911 T8189 T8190 punct (,Bio-Rad
R5912 T8190 T8188 appos Bio-Rad,bis-acrylamide
R5913 T8191 T8188 punct ),bis-acrylamide
R5914 T8192 T8186 punct ),acrylamide
R5915 T8193 T8186 prep in,acrylamide
R5916 T8194 T8195 nummod 1x,TBE
R5917 T8195 T8193 pobj TBE,in
R5918 T8196 T8186 prep at,acrylamide
R5919 T8197 T8196 pobj 10V/cm,at
R5920 T8198 T8186 punct .,acrylamide
R5921 T8199 T8205 prep For,were
R5922 T8200 T8201 amod supershift,assays
R5923 T8201 T8199 pobj assays,For
R5924 T8202 T8205 punct ",",were
R5925 T8203 T8204 amod nuclear,extracts
R5926 T8204 T8205 nsubj extracts,were
R5927 T8205 T8205 ROOT were,were
R5928 T8206 T8205 acomp pre-incubated,were
R5929 T8207 T8208 nummod 2,hrs
R5930 T8208 T8206 dobj hrs,pre-incubated
R5931 T8209 T8206 prep on,pre-incubated
R5932 T8210 T8209 pobj ice,on
R5933 T8211 T8206 prep with,pre-incubated
R5934 T8212 T8213 nummod 4,µg
R5935 T8213 T8211 pobj µg,with
R5936 T8214 T8213 prep of,µg
R5937 T8215 T8217 amod specific,antibody
R5938 T8216 T8217 compound C/EBP,antibody
R5939 T8217 T8214 pobj antibody,of
R5940 T8218 T8205 punct .,were
R5941 T8219 T8221 nsubjpass Antibodies,purchased
R5942 T8220 T8221 auxpass were,purchased
R5943 T8221 T8221 ROOT purchased,purchased
R5944 T8222 T8221 prep from,purchased
R5945 T8223 T8224 compound Santa,Cruz
R5946 T8224 T8222 pobj Cruz,from
R5947 T8225 T8228 punct :,α
R5948 T8226 T8228 amod anti-C/EBP,α
R5949 T8227 T8228 punct -,α
R5950 T8228 T8249 nmod α,ε
R5951 T8229 T8230 punct (,sc-61
R5952 T8230 T8228 parataxis sc-61,α
R5953 T8231 T8230 punct ),sc-61
R5954 T8232 T8228 punct ",",α
R5955 T8233 T8235 amod anti-C/EBP,β
R5956 T8234 T8235 punct -,β
R5957 T8235 T8228 appos β,α
R5958 T8236 T8237 punct (,sc-150
R5959 T8237 T8235 appos sc-150,β
R5960 T8238 T8237 punct ),sc-150
R5961 T8239 T8235 punct ",",β
R5962 T8240 T8242 amod anti-C/EBP,δ
R5963 T8241 T8242 punct -,δ
R5964 T8242 T8228 appos δ,α
R5965 T8243 T8244 punct (,sc-151
R5966 T8244 T8242 appos sc-151,δ
R5967 T8245 T8244 punct ),sc-151
R5968 T8246 T8244 cc and,sc-151
R5969 T8247 T8249 amod anti-C/EBP,ε
R5970 T8248 T8249 punct -,ε
R5971 T8249 T8221 npadvmod ε,purchased
R5972 T8250 T8251 punct (,sc-158
R5973 T8251 T8249 appos sc-158,ε
R5974 T8252 T8251 punct ),sc-158
R5975 T8253 T8221 punct .,purchased
R6238 T8619 T8620 compound Chromatin,Immunoprecipitation
R6239 T8620 T8620 ROOT Immunoprecipitation,Immunoprecipitation
R6240 T8621 T8622 punct (,ChIP
R6241 T8622 T8620 appos ChIP,Immunoprecipitation
R6242 T8623 T8620 punct ),Immunoprecipitation
R6243 T8624 T8625 compound Assay,ChIP
R6244 T8625 T8626 compound ChIP,assays
R6245 T8626 T8628 nsubjpass assays,performed
R6246 T8627 T8628 auxpass were,performed
R6247 T8628 T8628 ROOT performed,performed
R6248 T8629 T8628 advcl using,performed
R6249 T8630 T8635 det a,kit
R6250 T8631 T8632 advmod commercially,available
R6251 T8632 T8635 amod available,kit
R6252 T8633 T8635 nmod Magna-ChIP,kit
R6253 T8634 T8635 compound ™,kit
R6254 T8635 T8629 dobj kit,using
R6255 T8636 T8635 punct (,kit
R6256 T8637 T8635 appos Millipore,kit
R6257 T8638 T8635 punct ),kit
R6258 T8639 T8628 punct ",",performed
R6259 T8640 T8641 mark as,recommended
R6260 T8641 T8628 advcl recommended,performed
R6261 T8642 T8641 agent by,recommended
R6262 T8643 T8644 det the,manufacturer
R6263 T8644 T8642 pobj manufacturer,by
R6264 T8645 T8641 punct ",",recommended
R6265 T8646 T8641 prep with,recommended
R6266 T8647 T8648 amod minor,modifications
R6267 T8648 T8646 pobj modifications,with
R6268 T8649 T8628 punct .,performed
R6269 T8650 T8679 advmod Briefly,washed
R6270 T8651 T8679 punct ",",washed
R6271 T8652 T8679 prep after,washed
R6272 T8653 T8652 pcomp crosslinking,after
R6273 T8654 T8655 det the,chromatin
R6274 T8655 T8653 dobj chromatin,crosslinking
R6275 T8656 T8653 prep with,crosslinking
R6276 T8657 T8658 nummod 1,%
R6277 T8658 T8659 compound %,formaldehyde
R6278 T8659 T8656 pobj formaldehyde,with
R6279 T8660 T8659 prep at,formaldehyde
R6280 T8661 T8662 compound room,temperature
R6281 T8662 T8660 pobj temperature,at
R6282 T8663 T8653 prep for,crosslinking
R6283 T8664 T8665 nummod 10,min
R6284 T8665 T8663 pobj min,for
R6285 T8666 T8653 cc and,crosslinking
R6286 T8667 T8653 conj neutralizing,crosslinking
R6287 T8668 T8667 prep with,neutralizing
R6288 T8669 T8668 pobj glycine,with
R6289 T8670 T8667 prep for,neutralizing
R6290 T8671 T8672 nummod 5,min
R6291 T8672 T8670 pobj min,for
R6292 T8673 T8672 prep at,min
R6293 T8674 T8675 compound room,temperature
R6294 T8675 T8673 pobj temperature,at
R6295 T8676 T8679 punct ",",washed
R6296 T8677 T8679 nsubjpass cells,washed
R6297 T8678 T8679 auxpass were,washed
R6298 T8679 T8679 ROOT washed,washed
R6299 T8680 T8679 prep with,washed
R6300 T8681 T8682 amod cold,PBS
R6301 T8682 T8680 pobj PBS,with
R6302 T8683 T8679 punct ",",washed
R6303 T8684 T8679 conj scraped,washed
R6304 T8685 T8684 cc and,scraped
R6305 T8686 T8684 conj collected,scraped
R6306 T8687 T8686 prep on,collected
R6307 T8688 T8687 pobj ice,on
R6308 T8689 T8679 punct .,washed
R6309 T8690 T8691 compound Cells,extracts
R6310 T8691 T8692 nsubj extracts,were
R6311 T8692 T8692 ROOT were,were
R6312 T8693 T8692 acomp prepared,were
R6313 T8694 T8693 xcomp using,prepared
R6314 T8695 T8698 det a,kit
R6315 T8696 T8697 advmod commercially,available
R6316 T8697 T8698 amod available,kit
R6317 T8698 T8694 dobj kit,using
R6318 T8699 T8698 punct (,kit
R6319 T8700 T8698 appos Millipore,kit
R6320 T8701 T8698 punct ),kit
R6321 T8702 T8692 punct .,were
R6322 T8703 T8704 compound Nuclear,lysates
R6323 T8704 T8706 nsubjpass lysates,sonicated
R6324 T8705 T8706 auxpass were,sonicated
R6325 T8706 T8706 ROOT sonicated,sonicated
R6326 T8707 T8708 nummod 5,times
R6327 T8708 T8706 npadvmod times,sonicated
R6328 T8709 T8708 prep for,times
R6329 T8710 T8711 nummod 15,sec
R6330 T8711 T8709 pobj sec,for
R6331 T8712 T8706 prep with,sonicated
R6332 T8713 T8715 nummod 1,intervals
R6333 T8714 T8715 compound min,intervals
R6334 T8715 T8712 pobj intervals,with
R6335 T8716 T8715 prep on,intervals
R6336 T8717 T8716 pobj ice,on
R6337 T8718 T8706 advcl using,sonicated
R6338 T8719 T8721 det a,Dismembrator
R6339 T8720 T8721 compound Sonic,Dismembrator
R6340 T8721 T8718 dobj Dismembrator,using
R6341 T8722 T8721 punct (,Dismembrator
R6342 T8723 T8721 appos Fisher,Dismembrator
R6343 T8724 T8721 punct ),Dismembrator
R6344 T8725 T8706 punct .,sonicated
R6345 T8726 T8728 det An,amount
R6346 T8727 T8728 amod equal,amount
R6347 T8728 T8732 nsubjpass amount,immunoprecipitated
R6348 T8729 T8728 prep of,amount
R6349 T8730 T8729 pobj chromatin,of
R6350 T8731 T8732 auxpass was,immunoprecipitated
R6351 T8732 T8732 ROOT immunoprecipitated,immunoprecipitated
R6352 T8733 T8732 prep at,immunoprecipitated
R6353 T8734 T8735 nummod 4,°
R6354 T8735 T8736 nummod °,C
R6355 T8736 T8737 compound C,overnight
R6356 T8737 T8733 pobj overnight,at
R6357 T8738 T8737 prep with,overnight
R6358 T8739 T8740 advmod at,least
R6359 T8740 T8741 advmod least,1
R6360 T8741 T8742 nummod 1,µg
R6361 T8742 T8738 pobj µg,with
R6362 T8743 T8742 prep of,µg
R6363 T8744 T8746 det the,antibodies
R6364 T8745 T8746 amod following,antibodies
R6365 T8746 T8743 pobj antibodies,of
R6366 T8747 T8742 punct :,µg
R6367 T8748 T8750 punct C/EBP,β
R6368 T8749 T8750 punct -,β
R6369 T8750 T8742 appos β,µg
R6370 T8751 T8752 punct (,sc-150X
R6371 T8752 T8750 appos sc-150X,β
R6372 T8753 T8752 punct ),sc-150X
R6373 T8754 T8750 punct ",",β
R6374 T8755 T8757 compound p-C/EBP,β
R6375 T8756 T8757 punct -,β
R6376 T8757 T8750 appos β,β
R6377 T8758 T8757 punct (,β
R6378 T8759 T8757 appos T217,β
R6379 T8760 T8757 punct ),β
R6380 T8761 T8762 punct (,sc-16993X
R6381 T8762 T8757 appos sc-16993X,β
R6382 T8763 T8757 punct ),β
R6383 T8764 T8757 punct ",",β
R6384 T8765 T8766 amod normal,rabbit
R6385 T8766 T8779 compound rabbit,II
R6386 T8767 T8779 nmod IgG,II
R6387 T8768 T8769 punct (,sc-2027
R6388 T8769 T8767 appos sc-2027,IgG
R6389 T8770 T8769 punct ),sc-2027
R6390 T8771 T8774 punct (,Biotechnologies
R6391 T8772 T8774 compound Santa,Biotechnologies
R6392 T8773 T8774 compound Cruz,Biotechnologies
R6393 T8774 T8769 appos Biotechnologies,sc-2027
R6394 T8775 T8774 punct ),Biotechnologies
R6395 T8776 T8774 cc and,Biotechnologies
R6396 T8777 T8779 compound RNA,II
R6397 T8778 T8779 compound polymerase,II
R6398 T8779 T8750 conj II,β
R6399 T8780 T8779 punct (,II
R6400 T8781 T8782 compound Clone,CTD4H8
R6401 T8782 T8779 appos CTD4H8,II
R6402 T8783 T8779 punct ),II
R6403 T8784 T8779 punct (,II
R6404 T8785 T8779 appos Millipore,II
R6405 T8786 T8779 punct ),II
R6406 T8787 T8732 punct .,immunoprecipitated
R6407 T8788 T8789 amod Immunoprecipitated,products
R6408 T8789 T8791 nsubjpass products,collected
R6409 T8790 T8791 auxpass were,collected
R6410 T8791 T8791 ROOT collected,collected
R6411 T8792 T8791 prep after,collected
R6412 T8793 T8792 pobj incubation,after
R6413 T8794 T8791 prep with,collected
R6414 T8795 T8796 compound Protein,G
R6415 T8796 T8799 nmod G,beads
R6416 T8797 T8799 amod coated,beads
R6417 T8798 T8799 amod magnetic,beads
R6418 T8799 T8794 pobj beads,with
R6419 T8800 T8801 punct (,Millipore
R6420 T8801 T8799 appos Millipore,beads
R6421 T8802 T8799 punct ),beads
R6422 T8803 T8791 punct .,collected
R6423 T8804 T8805 det The,beads
R6424 T8805 T8807 nsubjpass beads,washed
R6425 T8806 T8807 auxpass were,washed
R6426 T8807 T8807 ROOT washed,washed
R6427 T8808 T8807 punct ",",washed
R6428 T8809 T8811 det the,chromatin
R6429 T8810 T8811 amod bound,chromatin
R6430 T8811 T8813 nsubjpass chromatin,eluted
R6431 T8812 T8813 auxpass was,eluted
R6432 T8813 T8807 conj eluted,washed
R6433 T8814 T8813 prep in,eluted
R6434 T8815 T8817 compound ChIP,Buffer
R6435 T8816 T8817 compound Elution,Buffer
R6436 T8817 T8814 pobj Buffer,in
R6437 T8818 T8817 punct (,Buffer
R6438 T8819 T8817 appos Millipore,Buffer
R6439 T8820 T8817 punct ),Buffer
R6440 T8821 T8813 cc and,eluted
R6441 T8822 T8823 det the,proteins
R6442 T8823 T8825 nsubjpass proteins,digested
R6443 T8824 T8825 auxpass were,digested
R6444 T8825 T8813 conj digested,eluted
R6445 T8826 T8825 prep with,digested
R6446 T8827 T8828 compound Proteinase,K
R6447 T8828 T8826 pobj K,with
R6448 T8829 T8825 prep for,digested
R6449 T8830 T8831 nummod 2,hrs
R6450 T8831 T8829 pobj hrs,for
R6451 T8832 T8825 prep at,digested
R6452 T8833 T8835 nummod 62,C
R6453 T8834 T8835 nummod °,C
R6454 T8835 T8832 pobj C,at
R6455 T8836 T8825 punct .,digested
R6456 T8837 T8838 det The,DNA
R6457 T8838 T8841 nsubjpass DNA,purified
R6458 T8839 T8841 auxpass was,purified
R6459 T8840 T8841 advmod then,purified
R6460 T8841 T8841 ROOT purified,purified
R6461 T8842 T8841 advcl using,purified
R6462 T8843 T8847 det the,Kit
R6463 T8844 T8847 compound QIAquick,Kit
R6464 T8845 T8847 compound PCR,Kit
R6465 T8846 T8847 compound Purification,Kit
R6466 T8847 T8842 dobj Kit,using
R6467 T8848 T8847 punct (,Kit
R6468 T8849 T8847 appos Qiagen,Kit
R6469 T8850 T8847 punct ),Kit
R6470 T8851 T8841 punct .,purified
R6471 T8852 T8854 nsubjpass DNA,amplified
R6472 T8853 T8854 auxpass was,amplified
R6473 T8854 T8854 ROOT amplified,amplified
R6474 T8855 T8854 agent by,amplified
R6475 T8856 T8857 compound semi-quantitative,PCR
R6476 T8857 T8855 pobj PCR,by
R6477 T8858 T8855 cc or,by
R6478 T8859 T8855 conj by,by
R6479 T8860 T8859 pobj qPCR,by
R6480 T8861 T8854 advcl using,amplified
R6481 T8862 T8865 det the,method
R6482 T8863 T8865 nmod SYBR,method
R6483 T8864 T8865 amod green,method
R6484 T8865 T8861 dobj method,using
R6485 T8866 T8865 cc and,method
R6486 T8867 T8865 conj primers,method
R6487 T8868 T8861 oprd specific,using
R6488 T8869 T8868 prep for,specific
R6489 T8870 T8873 det the,promoter
R6490 T8871 T8873 nmod SerpinB2,promoter
R6491 T8872 T8873 amod proximal,promoter
R6492 T8873 T8869 pobj promoter,for
R6493 T8874 T8854 punct :,amplified
R6494 T8875 T8875 ROOT forward,forward
R6495 T8876 T8880 punct (,−
R6496 T8877 T8880 nmod −,−
R6497 T8878 T8880 nummod 338,−
R6498 T8879 T8880 nummod /,−
R6499 T8880 T8880 ROOT −,−
R6500 T8881 T8880 nummod 315,−
R6501 T8882 T8880 punct ),−
R6502 T8883 T8880 nummod 5,−
R6503 T8884 T8885 nummod ′,AAGACTCCCACAGATGGTGGCTGT3
R6504 T8885 T8880 appos AAGACTCCCACAGATGGTGGCTGT3,−
R6505 T8886 T8887 punct ;,reverse
R6506 T8887 T8895 nmod reverse,′
R6507 T8888 T8887 punct (,reverse
R6508 T8889 T8892 nmod −,+19
R6509 T8890 T8892 nummod 5,+19
R6510 T8891 T8892 punct /,+19
R6511 T8892 T8887 appos +19,reverse
R6512 T8893 T8887 punct ),reverse
R6513 T8894 T8895 nummod 5,′
R6514 T8895 T8880 appos ′,−
R6515 T8896 T8895 nummod TTCTTGGAAAGCTGGCACTGTGTG3,′
R6516 T8897 T8854 punct .,amplified
R6551 T8941 T8942 compound Statistical,Analysis
R6552 T8942 T8943 compound Analysis,Data
R6553 T8943 T8945 nsubjpass Data,presented
R6554 T8944 T8945 auxpass are,presented
R6555 T8945 T8945 ROOT presented,presented
R6556 T8946 T8945 prep as,presented
R6557 T8947 T8949 amod mean,SEM
R6558 T8948 T8949 compound ±,SEM
R6559 T8949 T8946 pobj SEM,as
R6560 T8950 T8949 prep per,SEM
R6561 T8951 T8950 pobj group,per
R6562 T8952 T8945 punct .,presented
R6563 T8953 T8955 nsubjpass Results,analyzed
R6564 T8954 T8955 auxpass were,analyzed
R6565 T8955 T8955 ROOT analyzed,analyzed
R6566 T8956 T8955 advcl using,analyzed
R6567 T8957 T8958 det the,analysis
R6568 T8958 T8956 dobj analysis,using
R6569 T8959 T8958 prep of,analysis
R6570 T8960 T8959 pobj variance,of
R6571 T8961 T8962 punct (,ANOVA
R6572 T8962 T8960 appos ANOVA,variance
R6573 T8963 T8962 punct ),ANOVA
R6574 T8964 T8960 cc or,variance
R6575 T8965 T8967 poss Student,test
R6576 T8966 T8967 compound t,test
R6577 T8967 T8960 conj test,variance
R6578 T8968 T8969 advmod where,relevant
R6579 T8969 T8956 advcl relevant,using
R6580 T8970 T8955 punct .,analyzed
R6581 T8971 T8972 nsubj P-values,<
R6582 T8972 T8972 ROOT <,<
R6583 T8973 T8975 nsubjpass 0.05,considered
R6584 T8974 T8975 auxpass were,considered
R6585 T8975 T8972 ccomp considered,<
R6586 T8976 T8975 oprd significant,considered
R6587 T8977 T8972 punct .,<
R3291 T4501 T4506 amod Western,lysates
R3292 T4502 T4506 compound Blot,lysates
R3293 T4503 T4506 compound Assays,lysates
R3294 T4504 T4506 compound Whole,lysates
R3295 T4505 T4506 compound cell,lysates
R3296 T4506 T4508 nsubjpass lysates,prepared
R3297 T4507 T4508 auxpass were,prepared
R3298 T4508 T4541 ccomp prepared,separated
R3299 T4509 T4508 prep in,prepared
R3300 T4510 T4511 compound RIPA,buffer
R3301 T4511 T4509 pobj buffer,in
R3302 T4512 T4515 punct (,Tris
R3303 T4513 T4515 nummod 10,Tris
R3304 T4514 T4515 compound mM,Tris
R3305 T4515 T4541 nsubjpass Tris,separated
R3306 T4516 T4515 punct ",",Tris
R3307 T4517 T4519 nummod 150,NaCl
R3308 T4518 T4519 compound mM,NaCl
R3309 T4519 T4515 appos NaCl,Tris
R3310 T4520 T4519 punct ",",NaCl
R3311 T4521 T4522 nummod 1,%
R3312 T4522 T4524 compound %,X-100
R3313 T4523 T4524 compound Triton,X-100
R3314 T4524 T4519 conj X-100,NaCl
R3315 T4525 T4524 punct ",",X-100
R3316 T4526 T4527 nummod 0.5,%
R3317 T4527 T4528 compound %,NP-40
R3318 T4528 T4524 appos NP-40,X-100
R3319 T4529 T4528 punct ",",NP-40
R3320 T4530 T4531 nummod 0.5,%
R3321 T4531 T4532 compound %,deoxycholate

2_test

Id Subject Object Predicate Lexical cue
23472114-12048245-87899172 493-495 12048245 denotes 34
23472114-9892694-87899173 3473-3475 9892694 denotes 35
23472114-2744487-87899174 5079-5081 2744487 denotes 36
23472114-12048245-87899175 8513-8515 12048245 denotes 34
T60199 493-495 12048245 denotes 34
T16742 3473-3475 9892694 denotes 35
T12110 5079-5081 2744487 denotes 36
T93715 8513-8515 12048245 denotes 34

pmc-enju-pas

Id Subject Object Predicate Lexical cue
T8519 11628-11634 NN denotes Qiagen
T8938 12067-12078 JJ denotes significant
T8937 12056-12066 VB denotes considered
T8936 12051-12055 VB denotes were
T8935 12046-12050 CD denotes 0.05
T8934 12045-12046 SYM denotes <
T8933 12036-12044 NN denotes P-values
T8932 12026-12034 JJ denotes relevant
T8931 12020-12025 WRB denotes where
T8930 12015-12019 NN denotes test
T8929 12013-12014 NN denotes t
T8928 12003-12012 NN denotes Student’s
T8927 12000-12002 CC denotes or
T8926 11998-11999 -RRB- denotes )
T8925 11993-11998 NN denotes ANOVA
T8924 11992-11993 -LRB- denotes (
T8923 11983-11991 NN denotes variance
T8922 11980-11982 IN denotes of
T8921 11971-11979 NN denotes analysis
T8920 11967-11970 DT denotes the
T8919 11961-11966 VB denotes using
T8918 11952-11960 VB denotes analyzed
T8917 11947-11951 VB denotes were
T8916 11939-11946 NN denotes Results
T8915 11932-11937 NN denotes group
T8914 11928-11931 IN denotes per
T8913 11924-11927 NN denotes SEM
T8912 11922-11923 JJ denotes ±
T8911 11917-11921 JJ denotes mean
T8910 11914-11916 IN denotes as
T8909 11904-11913 VB denotes presented
T8908 11900-11903 VB denotes are
T8907 11895-11899 NN denotes Data
T8906 11886-11894 NN denotes Analysis
T8905 11874-11885 JJ denotes Statistical
T8554 11843-11871 NN denotes 5′TTCTTGGAAAGCTGGCACTGTGTG3’
T8553 11841-11842 -RRB- denotes )
T8552 11835-11841 CD denotes −5/+19
T8551 11834-11835 -LRB- denotes (
T8550 11826-11833 JJ denotes reverse
T8549 11824-11825 -COLON- denotes ;
T8548 11796-11824 NN denotes 5′AAGACTCCCACAGATGGTGGCTGT3’
T8547 11794-11795 -RRB- denotes )
T8546 11785-11794 CD denotes −338/−315
T8545 11784-11785 -LRB- denotes (
T8544 11776-11783 RB denotes forward
T8543 11774-11775 -COLON- denotes :
T8542 11766-11774 NN denotes promoter
T8541 11757-11765 JJ denotes proximal
T8540 11748-11756 NN denotes SerpinB2
T8539 11744-11747 DT denotes the
T8538 11740-11743 IN denotes for
T8537 11731-11739 JJ denotes specific
T8536 11723-11730 NN denotes primers
T8535 11719-11722 CC denotes and
T8534 11712-11718 NN denotes method
T8533 11706-11711 JJ denotes green
T8532 11701-11705 NN denotes SYBR
T8531 11697-11700 DT denotes the
T8530 11691-11696 VB denotes using
T8529 11686-11690 NN denotes qPCR
T8528 11683-11685 IN denotes by
T8527 11680-11682 CC denotes or
T8526 11676-11679 NN denotes PCR
T8525 11658-11675 JJ denotes semi-quantitative
T8524 11655-11657 IN denotes by
T8523 11645-11654 VB denotes amplified
T8522 11641-11644 VB denotes was
T8521 11637-11640 NN denotes DNA
T8520 11634-11635 -RRB- denotes )
T8518 11627-11628 -LRB- denotes (
T8517 11623-11626 NN denotes Kit
T8516 11610-11622 NN denotes Purification
T8515 11606-11609 NN denotes PCR
T8514 11597-11605 NNP denotes QIAquick
T8513 11593-11596 DT denotes the
T8512 11587-11592 VB denotes using
T8511 11578-11586 VB denotes purified
T8510 11573-11577 RB denotes then
T8509 11569-11572 VB denotes was
T8508 11565-11568 NN denotes DNA
T8507 11561-11564 DT denotes The
T8506 11555-11560 NNP denotes 62°C.
T8505 11552-11554 IN denotes at
T8504 11548-11551 NN denotes hrs
T8503 11546-11547 CD denotes 2
T8502 11542-11545 IN denotes for
T8501 11540-11541 NN denotes K
T8500 11529-11539 NN denotes Proteinase
T8499 11524-11528 IN denotes with
T8498 11515-11523 VB denotes digested
T8497 11510-11514 VB denotes were
T8496 11501-11509 NN denotes proteins
T8495 11497-11500 DT denotes the
T8494 11493-11496 CC denotes and
T8493 11491-11492 -RRB- denotes )
T8492 11482-11491 NNP denotes Millipore
T8491 11481-11482 -LRB- denotes (
T8490 11474-11480 NNP denotes Buffer
T8489 11466-11473 NNP denotes Elution
T8488 11461-11465 NNP denotes ChIP
T8487 11458-11460 IN denotes in
T8486 11451-11457 VB denotes eluted
T8485 11447-11450 VB denotes was
T8484 11437-11446 NN denotes chromatin
T8483 11431-11436 VB denotes bound
T8482 11427-11430 DT denotes the
T8481 11425-11426 -COMMA- denotes ,
T8480 11419-11425 VB denotes washed
T8479 11414-11418 VB denotes were
T8478 11408-11413 NN denotes beads
T8477 11404-11407 DT denotes The
T8476 11401-11402 -RRB- denotes )
T8475 11392-11401 NNP denotes Millipore
T8474 11391-11392 -LRB- denotes (
T8473 11385-11390 NN denotes beads
T8472 11376-11384 JJ denotes magnetic
T8471 11369-11375 VB denotes coated
T8470 11367-11368 NN denotes G
T8469 11359-11366 NN denotes Protein
T8468 11354-11358 IN denotes with
T8467 11343-11353 NN denotes incubation
T8466 11337-11342 IN denotes after
T8465 11327-11336 VB denotes collected
T8464 11322-11326 VB denotes were
T8463 11313-11321 NN denotes products
T8462 11294-11312 VB denotes Immunoprecipitated
T8461 11291-11292 -RRB- denotes )
T8460 11282-11291 NN denotes Millipore
T8459 11281-11282 -LRB- denotes (
T8458 11280-11281 -RRB- denotes )
T8457 11274-11280 NN denotes CTD4H8
T8456 11268-11273 NN denotes Clone
T8455 11267-11268 -LRB- denotes (
T8454 11264-11266 CD denotes II
T8453 11253-11263 NN denotes polymerase
T8452 11249-11252 NN denotes RNA
T8451 11245-11248 CC denotes and
T8450 11243-11244 -RRB- denotes )
T8449 11228-11243 NNP denotes Biotechnologies
T8448 11223-11227 NNP denotes Cruz
T8447 11217-11222 NNP denotes Santa
T8446 11216-11217 -LRB- denotes (
T8445 11215-11216 -RRB- denotes )
T8444 11208-11215 NN denotes sc-2027
T8443 11207-11208 -LRB- denotes (
T8442 11203-11206 NN denotes IgG
T8441 11196-11202 NN denotes rabbit
T8440 11189-11195 JJ denotes normal
T8439 11187-11188 -COMMA- denotes ,
T8438 11186-11187 -RRB- denotes )
T8437 11177-11186 NN denotes sc-16993X
T8436 11176-11177 -LRB- denotes (
T8435 11174-11175 -RRB- denotes )
T8434 11170-11174 NN denotes T217
T8433 11169-11170 -LRB- denotes (
T8432 11159-11168 NN denotes p-C/EBP-β
T8431 11157-11158 -COMMA- denotes ,
T8430 11156-11157 -RRB- denotes )
T8429 11149-11156 NN denotes sc-150X
T8428 11148-11149 -LRB- denotes (
T8427 11140-11147 NN denotes C/EBP-β
T8426 11138-11139 -COLON- denotes :
T8425 11128-11138 NN denotes antibodies
T8424 11118-11127 JJ denotes following
T8423 11114-11117 DT denotes the
T8422 11111-11113 IN denotes of
T8421 11108-11110 NN denotes µg
T8420 11106-11107 CD denotes 1
T8419 11100-11105 JJ denotes least
T8418 11097-11099 IN denotes at
T8417 11092-11096 IN denotes with
T8416 11082-11091 RB denotes overnight
T8415 11078-11081 NN denotes 4°C
T8414 11075-11077 IN denotes at
T8413 11056-11074 VB denotes immunoprecipitated
T8412 11052-11055 VB denotes was
T8411 11042-11051 NN denotes chromatin
T8410 11039-11041 IN denotes of
T8409 11032-11038 NN denotes amount
T8408 11026-11031 JJ denotes equal
T8407 11023-11025 DT denotes An
T8406 11020-11021 -RRB- denotes )
T8405 11014-11020 NNP denotes Fisher
T8404 11013-11014 -LRB- denotes (
T8403 11000-11012 NN denotes Dismembrator
T8402 10994-10999 JJ denotes Sonic
T8401 10992-10993 DT denotes a
T8400 10986-10991 VB denotes using
T8399 10982-10985 NN denotes ice
T8398 10979-10981 IN denotes on
T8397 10969-10978 NN denotes intervals
T8396 10965-10968 NN denotes min
T8395 10963-10964 CD denotes 1
T8394 10958-10962 IN denotes with
T8393 10954-10957 NN denotes sec
T8392 10951-10953 CD denotes 15
T8391 10947-10950 IN denotes for
T8390 10941-10946 NN denotes times
T8389 10939-10940 CD denotes 5
T8388 10929-10938 VB denotes sonicated
T8387 10924-10928 VB denotes were
T8386 10916-10923 NN denotes lysates
T8385 10908-10915 JJ denotes Nuclear
T8384 10905-10906 -RRB- denotes )
T8383 10896-10905 NN denotes Millipore
T8382 10895-10896 -LRB- denotes (
T8381 10891-10894 NN denotes kit
T8380 10881-10890 JJ denotes available
T8379 10868-10880 RB denotes commercially
T8378 10866-10867 DT denotes a
T8377 10860-10865 VB denotes using
T8376 10851-10859 VB denotes prepared
T8375 10846-10850 VB denotes were
T8374 10837-10845 NN denotes extracts
T8373 10831-10836 NN denotes Cells
T8372 10826-10829 NN denotes ice
T8371 10823-10825 IN denotes on
T8354 10737-10740 IN denotes for
T8353 10729-10736 NN denotes glycine
T8352 10724-10728 IN denotes with
T8351 10711-10723 VB denotes neutralizing
T8350 10707-10710 CC denotes and
T8349 10703-10706 NN denotes min
T8348 10700-10702 CD denotes 10
T8347 10696-10699 IN denotes for
T8346 10684-10695 NN denotes temperature
T8345 10679-10683 NN denotes room
T8344 10676-10678 IN denotes at
T8343 10663-10675 NN denotes formaldehyde
T8342 10661-10662 NN denotes %
T8341 10660-10661 CD denotes 1
T8340 10655-10659 IN denotes with
T8339 10645-10654 NN denotes chromatin
T8338 10641-10644 DT denotes the
T8337 10628-10640 VB denotes crosslinking
T8336 10622-10627 IN denotes after
T8335 10620-10621 -COMMA- denotes ,
T8334 10613-10620 RB denotes Briefly
T8333 10598-10611 NN denotes modifications
T8332 10592-10597 JJ denotes minor
T8331 10587-10591 IN denotes with
T8330 10585-10586 -COMMA- denotes ,
T8329 10573-10585 NN denotes manufacturer
T8328 10569-10572 DT denotes the
T8327 10566-10568 IN denotes by
T8326 10554-10565 VB denotes recommended
T8325 10551-10553 IN denotes as
T8324 10549-10550 -COMMA- denotes ,
T8323 10548-10549 -RRB- denotes )
T8322 10539-10548 NN denotes Millipore
T8321 10538-10539 -LRB- denotes (
T8320 10534-10537 NN denotes kit
T8319 10522-10533 JJ denotes Magna-ChIP™
T8318 10512-10521 JJ denotes available
T8317 10499-10511 RB denotes commercially
T8316 10497-10498 DT denotes a
T8315 10491-10496 VB denotes using
T8314 10481-10490 VB denotes performed
T8313 10476-10480 VB denotes were
T8312 10469-10475 NN denotes assays
T8311 10464-10468 NN denotes ChIP
T8310 10458-10463 NN denotes Assay
T8309 10456-10457 -RRB- denotes )
T8308 10452-10456 NN denotes ChIP
T8307 10451-10452 -LRB- denotes (
T8306 10431-10450 NN denotes Immunoprecipitation
T8305 10421-10430 NN denotes Chromatin
T8010 10417-10418 -RRB- denotes )
T8009 10411-10417 NN denotes sc-158
T8008 10410-10411 -LRB- denotes (
T8007 10397-10409 JJ denotes anti-C/EBP-ε
T8006 10393-10396 CC denotes and
T8005 10391-10392 -RRB- denotes )
T8004 10385-10391 NN denotes sc-151
T8003 10384-10385 -LRB- denotes (
T8002 10371-10383 JJ denotes anti-C/EBP-δ
T8001 10369-10370 -COMMA- denotes ,
T8000 10368-10369 -RRB- denotes )
T7999 10362-10368 NN denotes sc-150
T7998 10361-10362 -LRB- denotes (
T7997 10348-10360 JJ denotes anti-C/EBP-β
T7996 10346-10347 -COMMA- denotes ,
T7995 10345-10346 -RRB- denotes )
T7994 10340-10345 NN denotes sc-61
T7993 10339-10340 -LRB- denotes (
T7992 10326-10338 JJ denotes anti-C/EBP-α
T7991 10324-10325 -COLON- denotes :
T7990 10320-10324 NNP denotes Cruz
T7989 10314-10319 NNP denotes Santa
T7988 10309-10313 IN denotes from
T7987 10299-10308 VB denotes purchased
T7986 10294-10298 VB denotes were
T7985 10283-10293 NN denotes Antibodies
T7984 10273-10281 NN denotes antibody
T7983 10267-10272 NN denotes C/EBP
T7982 10258-10266 JJ denotes specific
T7981 10255-10257 IN denotes of
T7980 10252-10254 NN denotes µg
T7979 10250-10251 CD denotes 4
T7978 10245-10249 IN denotes with
T7977 10241-10244 NN denotes ice
T7976 10238-10240 IN denotes on
T7975 10234-10237 NN denotes hrs
T7974 10232-10233 CD denotes 2
T7973 10218-10231 JJ denotes pre-incubated
T7972 10213-10217 VB denotes were
T7971 10204-10212 NN denotes extracts
T7970 10196-10203 JJ denotes nuclear
T7969 10194-10195 -COMMA- denotes ,
T7968 10188-10194 NN denotes assays
T7967 10177-10187 NN denotes supershift
T7966 10173-10176 IN denotes For
T7965 10165-10171 NN denotes 10V/cm
T7964 10162-10164 IN denotes at
T7963 10158-10161 NN denotes TBE
T7962 10155-10157 NN denotes 1x
T7961 10152-10154 IN denotes in
T7960 10150-10151 -RRB- denotes )
T7959 10149-10150 -RRB- denotes )
T7958 10142-10149 NN denotes Bio-Rad
T7957 10141-10142 -LRB- denotes (
T7956 10126-10140 NN denotes bis-acrylamide
T7955 10125-10126 -COLON- denotes :
T7954 10115-10125 NN denotes acrylamide
T7953 10110-10114 CD denotes 29∶1
T7952 10109-10110 -LRB- denotes (
T7951 10104-10108 NN denotes gels
T7950 10089-10103 NN denotes polyacrylamide
T7949 10087-10088 NN denotes %
T7948 10086-10087 CD denotes 5
T7947 10083-10085 IN denotes on
T7946 10071-10082 NN denotes temperature
T7945 10066-10070 NN denotes room
T7944 10063-10065 IN denotes at
T7943 10047-10062 NN denotes electrophoresis
T7942 10044-10046 IN denotes by
T7941 10035-10043 VB denotes resolved
T7940 10030-10034 VB denotes were
T7939 10021-10029 NN denotes products
T7938 10012-10020 NN denotes reaction
T7937 10004-10011 NN denotes Binding
T7936 9991-10002 NN denotes temperature
T7935 9986-9990 NN denotes room
T7934 9983-9985 IN denotes at
T7933 9975-9982 NN denotes minutes
T7932 9972-9974 CD denotes 20
T7931 9968-9971 IN denotes for
T7930 9958-9967 VB denotes performed
T7929 9953-9957 VB denotes were
T7928 9947-9952 NN denotes probe
T7927 9933-9946 VB denotes radiolabelled
T7926 9930-9932 IN denotes of
T7925 9928-9929 -RRB- denotes )
T7924 9926-9928 NN denotes ng
T7923 9922-9925 CD denotes 0.2
T7922 9919-9921 TO denotes to
T7921 9914-9918 CD denotes 0.05
T7920 9913-9914 -LRB- denotes (
T7919 9909-9912 NN denotes cpm
T7918 9902-9908 CD denotes 20,000
T8370 10813-10822 VB denotes collected
T8369 10809-10812 CC denotes and
T8368 10801-10808 VB denotes scraped
T8367 10799-10800 -COMMA- denotes ,
T8366 10796-10799 NNP denotes PBS
T8365 10791-10795 JJ denotes cold
T8364 10786-10790 IN denotes with
T8363 10779-10785 VB denotes washed
T8362 10774-10778 VB denotes were
T8361 10768-10773 NN denotes cells
T8360 10766-10767 -COMMA- denotes ,
T8359 10755-10766 NN denotes temperature
T8358 10750-10754 NN denotes room
T8357 10747-10749 IN denotes at
T8356 10743-10746 NN denotes min
T8355 10741-10742 CD denotes 5
T7917 9899-9901 TO denotes to
T7916 9892-9898 CD denotes 10,000
T7915 9888-9891 CC denotes and
T7914 9879-9887 NN denotes extracts
T7913 9871-9878 JJ denotes nuclear
T7912 9868-9870 IN denotes of
T7911 9865-9867 NN denotes µg
T7910 9863-9864 CD denotes 6
T7909 9861-9862 -COMMA- denotes ,
T7908 9860-9861 -RRB- denotes )
T7907 9855-9860 NN denotes dI-dC
T7906 9854-9855 -LRB- denotes (
T7905 9849-9853 NN denotes poly
T7904 9846-9848 NN denotes µg
T7903 9844-9845 CD denotes 1
T7902 9842-9843 -COMMA- denotes ,
T7901 9832-9842 NN denotes Ficoll-400
T7900 9830-9831 NN denotes %
T7899 9828-9830 CD denotes 20
T7898 9826-9827 -COMMA- denotes ,
T7897 9818-9826 NN denotes glycerol
T7896 9816-9817 NN denotes %
T7895 9814-9816 CD denotes 30
T7894 9812-9813 -COMMA- denotes ,
T7893 9809-9812 NN denotes DTT
T7892 9806-9808 NN denotes mM
T7456 9470-9474 NN denotes blot
T7455 9462-9469 JJ denotes western
T7454 9459-9461 IN denotes by
T7453 9448-9458 NN denotes expression
T7452 9442-9447 JJ denotes equal
T7451 9438-9441 IN denotes for
T7450 9430-9437 VB denotes checked
T7449 9426-9429 VB denotes was
T7448 9417-9425 NN denotes proteins
T7447 9410-9416 JJ denotes mutant
T7446 9393-9409 NN denotes phospho-acceptor
T7445 9385-9392 NN denotes C/EBP-β
T7444 9381-9384 DT denotes the
T7443 9378-9380 IN denotes of
T7442 9367-9377 NN denotes Expression
T7441 9359-9365 NN denotes sample
T7440 9354-9358 DT denotes each
T7439 9350-9353 IN denotes for
T7438 9341-9349 VB denotes employed
T7437 9336-9340 VB denotes were
T7436 9328-9335 NN denotes samples
T7435 9317-9327 VB denotes triplicate
T7434 9313-9316 CC denotes and
T7433 9311-9312 -COMMA- denotes ,
T7432 9306-9311 NN denotes times
T7431 9300-9305 CD denotes three
T7430 9294-9299 JJ denotes least
T7429 9291-9293 IN denotes at
T7428 9282-9290 VB denotes repeated
T7427 9278-9281 VB denotes was
T7426 9267-9277 NN denotes experiment
T7425 9262-9266 DT denotes Each
T7424 9259-9260 -RRB- denotes )
T7423 9252-9259 NNP denotes Promega
T7422 9251-9252 -LRB- denotes (
T7421 9238-9250 RB denotes respectively
T7420 9236-9237 -COMMA- denotes ,
T7419 9232-9236 NNP denotes Kits
T7418 9225-9231 NNP denotes System
T7417 9219-9224 NNP denotes Assay
T7416 9212-9218 NNP denotes Enzyme
T7415 9196-9211 NNP denotes β-Galactosidase
T7414 9192-9195 CC denotes and
T7413 9185-9191 NNP denotes System
T7891 9804-9805 CD denotes 2
T7890 9802-9803 -COMMA- denotes ,
T7889 9799-9802 NNP denotes BSA
T7888 9793-9798 NN denotes µg/ml
T7887 9790-9792 CD denotes 10
T7886 9788-9789 -COMMA- denotes ,
T7885 9785-9788 CD denotes 7.9
T7884 9782-9784 NN denotes pH
T7883 9776-9781 NN denotes HEPES
T7882 9773-9775 NN denotes mM
T7881 9770-9772 CD denotes 10
T7880 9759-9769 VB denotes containing
T7879 9757-9758 -RRB- denotes )
T7878 9755-9757 NN denotes µl
T7877 9752-9754 CD denotes 25
T7876 9751-9752 -LRB- denotes (
T7875 9741-9750 NN denotes reactions
T7874 9733-9740 NN denotes binding
T7873 9729-9732 NN denotes DNA
T7872 9726-9727 -RRB- denotes ]
T7871 9724-9726 CD denotes 41
T7870 9723-9724 -LRB- denotes [
T7869 9716-9722 NN denotes method
T7868 9710-9715 NN denotes lysis
T7867 9700-9709 JJ denotes detergent
T7866 9696-9699 DT denotes the
T7865 9693-9695 IN denotes by
T7864 9684-9692 VB denotes prepared
T7863 9679-9683 VB denotes were
T7862 9670-9678 NN denotes extracts
T7861 9662-9669 JJ denotes nuclear
T7860 9656-9661 CD denotes 264.7
T7859 9652-9655 NN denotes RAW
T7858 9646-9650 NN denotes -ATP
T7857 9645-9646 -RRB- denotes ]
T7856 9640-9645 NN denotes γ-32P
T7855 9639-9640 -LRB- denotes [
T7854 9635-9638 CC denotes and
T7853 9628-9634 NN denotes kinase
T7852 9613-9627 NN denotes polynucleotide
T7851 9610-9612 NN denotes T4
T7850 9604-9609 VB denotes using
T7849 9595-9603 VB denotes prepared
T7848 9590-9594 VB denotes were
T7847 9583-9589 NN denotes assays
T7846 9577-9582 NN denotes shift
T7845 9573-9576 NN denotes gel
T7844 9569-9572 IN denotes for
T7843 9562-9568 NN denotes probes
T7842 9546-9561 NN denotes oligonucleotide
T7841 9530-9545 JJ denotes double-stranded
T7840 9528-9529 -COMMA- denotes ,
T7839 9515-9528 VB denotes Radiolabelled
T7838 9508-9514 NN denotes Assays
T7837 9502-9507 NN denotes Shift
T7836 9493-9501 NN denotes Mobility
T7835 9477-9492 JJ denotes Electrophoretic
T7412 9179-9184 NNP denotes Assay
T7411 9168-9178 NNP denotes Luciferase
T7410 9164-9167 DT denotes the
T7409 9158-9163 VB denotes using
T7408 9156-9157 -RRB- denotes ]
T7407 9154-9156 CD denotes 38
T7406 9153-9154 -LRB- denotes [
T7405 9137-9152 NN denotes β-galactosidase
T7404 9134-9136 IN denotes of
T7403 9129-9133 DT denotes that
T7402 9126-9128 TO denotes to
T7401 9115-9125 VB denotes normalized
T7400 9111-9114 CC denotes and
T7399 9100-9110 VB denotes determined
T7398 9096-9099 VB denotes was
T7397 9087-9095 NN denotes activity
T7396 9076-9086 NN denotes Luciferase
T7395 9073-9074 -RRB- denotes )
T7394 9070-9073 NN denotes DNA
T7393 9064-9069 JJ denotes total
T7392 9061-9063 NN denotes µg
T7391 9053-9060 CD denotes 0.6–1.0
T7390 9052-9053 -LRB- denotes (
T7389 9037-9051 VB denotes co-transfected
T7388 9032-9036 VB denotes were
T7387 9025-9031 NN denotes vector
T6863 8421-8429 NN denotes analysis
T6862 8416-8420 NN denotes blot
T6861 8408-8415 JJ denotes western
T6860 8405-8407 IN denotes by
T6859 8395-8404 VB denotes confirmed
T6858 8391-8394 VB denotes was
T6857 8381-8390 NN denotes knockdown
T6856 8373-8380 NN denotes C/EBP-β
T6855 8362-8371 NN denotes knockdown
T6854 8357-8361 NN denotes gene
T6853 8347-8356 JJ denotes effective
T6852 8343-8346 IN denotes for
T6851 8337-8342 VB denotes allow
T6850 8334-8336 TO denotes to
T6849 8330-8333 NN denotes hrs
T6848 8327-8329 CD denotes 72
T6847 8323-8326 IN denotes for
T6846 8315-8322 RB denotes further
T6845 8305-8314 VB denotes incubated
T6844 8301-8304 CC denotes and
T6843 8295-8300 NN denotes media
T6842 8288-8294 NN denotes growth
T6841 8282-8287 JJ denotes fresh
T6840 8277-8281 IN denotes with
T6839 8268-8276 VB denotes replaced
T6838 8264-8267 VB denotes was
T6837 8252-8263 NN denotes supernatant
T6836 8241-8251 JJ denotes lentiviral
T6835 8237-8240 DT denotes The
T6834 8232-8235 NN denotes hrs
T6833 8229-8231 CD denotes 24
T6832 8225-8228 IN denotes for
T6831 8223-8224 -RRB- denotes )
T6830 8210-8223 NNP denotes Bioanalytical
T6829 8201-8209 NNP denotes American
T6828 8200-8201 -LRB- denotes (
T6827 8190-8199 NN denotes Polybrene
T6826 8184-8189 NN denotes µg/ml
T6825 8182-8183 CD denotes 8
T6824 8178-8181 CC denotes and
T6823 8166-8177 NN denotes supernatant
T6822 8155-8165 JJ denotes lentiviral
T6821 8151-8154 DT denotes the
T6820 8146-8150 IN denotes with
T6819 8138-8145 VB denotes treated
T6818 8133-8137 VB denotes were
T6817 8127-8132 NN denotes cells
T6816 8120-8126 NN denotes target
T6815 8116-8119 DT denotes The
T6814 8108-8114 NN denotes filter
T6813 8105-8107 NN denotes µm
T6812 8100-8104 CD denotes 0.45
T6811 8098-8099 DT denotes a
T6810 8090-8097 IN denotes through
T7386 9017-9024 NN denotes control
T7385 9014-9016 CC denotes or
T7384 9012-9013 -RRB- denotes ]
T7383 9010-9012 CD denotes 40
T7382 9009-9010 -LRB- denotes [
T7381 9008-9009 CD denotes –
T7380 9007-9008 -RRB- denotes ]
T7379 9005-9007 CD denotes 38
T7378 9004-9005 -LRB- denotes [
T7377 9002-9003 -RRB- denotes )
T7376 8998-9002 NN denotes S64A
T7375 8996-8997 -COMMA- denotes ,
T7374 8991-8996 NN denotes T217A
T7373 8989-8990 -COMMA- denotes ,
T7372 8984-8989 NN denotes T188A
T7371 8983-8984 -LRB- denotes (
T7370 8975-8982 NN denotes mutants
T7369 8958-8974 NN denotes phospho-acceptor
T7368 8950-8957 JJ denotes C/EBP-β
T7367 8947-8949 CC denotes or
T7366 8939-8946 NN denotes C/EBP-β
T7365 8930-8938 VB denotes encoding
T7364 8921-8929 NN denotes plasmids
T7363 8919-8920 -COMMA- denotes ,
T7362 8908-8919 NN denotes experiments
T7361 8903-8907 DT denotes some
T7360 8900-8902 IN denotes In
T7359 8889-8898 VB denotes indicated
T7358 8883-8888 WRB denotes where
T7357 8879-8882 NN denotes hrs
T7356 8877-8878 CD denotes 4
T7355 8873-8876 IN denotes for
T7354 8871-8872 -RRB- denotes )
T7353 8866-8871 NN denotes ng/ml
T7352 8862-8865 CD denotes 100
T7351 8861-8862 -LRB- denotes (
T7350 8857-8860 NN denotes LPS
T7349 8852-8856 IN denotes with
T7348 8841-8851 NN denotes incubation
T7347 8838-8840 TO denotes to
T7346 8832-8837 RB denotes prior
T7345 8828-8831 NN denotes hrs
T7344 8825-8827 CD denotes 48
T7343 8821-8824 IN denotes for
T7342 8811-8820 VB denotes incubated
T7341 8807-8810 CC denotes and
T7340 8800-8806 VB denotes plates
T7339 8795-8799 RB denotes well
T7338 8792-8794 CD denotes 24
T7337 8789-8791 IN denotes in
T7336 8783-8788 NN denotes media
T7335 8772-8782 JJ denotes pre-warmed
T7334 8769-8771 TO denotes to
T7333 8757-8768 VB denotes transferred
T7332 8752-8756 VB denotes were
T7331 8746-8751 NN denotes cells
T7330 8734-8745 VB denotes Transfected
T7329 8731-8732 -RRB- denotes )
T7328 8727-8731 NN denotes msec
T7327 8724-8726 CD denotes 30
T7326 8722-8723 -COMMA- denotes ,
T7325 8721-8722 NN denotes V
T7324 8716-8720 CD denotes 1350
T7323 8714-8715 -COMMA- denotes ,
T7322 8709-8714 NN denotes pulse
T7321 8707-8708 CD denotes 1
T7320 8706-8707 -LRB- denotes (
T7319 8699-8705 NN denotes system
T7318 8693-8698 NNP denotes Neon™
T7317 8682-8692 NNP denotes Invitrogen
T7316 8678-8681 DT denotes the
T7315 8672-8677 VB denotes using
T7314 8656-8671 NN denotes electroporation
T7313 8653-8655 IN denotes by
T7312 8651-8652 -RRB- denotes )
T7311 8649-8651 NN denotes ng
T7310 8645-8648 CD denotes 200
T7309 8644-8645 -LRB- denotes (
T7308 8636-8643 NN denotes plasmid
T7307 8627-8635 NN denotes reporter
T7306 8603-8626 JJ denotes β-actin-β-galactosidase
T7305 8601-8602 DT denotes a
T7304 8596-8600 IN denotes with
T7303 8590-8595 IN denotes along
T7302 8588-8589 -RRB- denotes )
T7301 8586-8588 NN denotes ng
T7300 8582-8585 CD denotes 400
T7299 8581-8582 -LRB- denotes (
T7298 8573-8580 NN denotes plasmid
T7297 8564-8572 NN denotes reporter
T7296 8553-8563 NN denotes luciferase
T7295 8543-8552 VB denotes indicated
T7294 8539-8542 DT denotes the
T7293 8534-8538 IN denotes with
T7292 8522-8533 VB denotes transfected
T7291 8517-8521 VB denotes were
T7290 8515-8516 -RRB- denotes ]
T7289 8513-8515 CD denotes 34
T7288 8512-8513 -LRB- denotes [
T7287 8510-8511 -RRB- denotes )
T7286 8505-8510 CD denotes 1×105
T7285 8504-8505 -LRB- denotes (
T7284 8499-8503 NN denotes MEFs
T7283 8489-8498 NN denotes Cebpb −/−
T7282 8487-8488 -RRB- denotes )
T7281 8482-8487 NN denotes Cells
T7280 8478-8481 NN denotes MEF
T7279 5958-5959 -LRB- denotes (
T7278 5951-5957 NN denotes Assays
T7277 5940-5950 NN denotes Luciferase
T7276 5936-5939 CC denotes and
T7275 5923-5935 NN denotes Transfection
T7274 5913-5922 JJ denotes Transient
T6809 8083-8089 VB denotes passed
T6808 8079-8082 CC denotes and
T6807 8074-8078 NN denotes mins
T6806 8071-8073 CD denotes 10
T6805 8067-8070 IN denotes for
T6804 8065-8066 NN denotes g
T6803 8059-8064 CD denotes 2,000
T6802 8056-8058 IN denotes at
T6801 8041-8055 NN denotes centrifugation
T6800 8038-8040 IN denotes by
T6799 8030-8037 VB denotes cleared
T6798 8028-8029 -COMMA- denotes ,
T6797 8016-8028 NN denotes transfection
T6796 8010-8015 IN denotes after
T6795 8006-8009 NN denotes hrs
T6794 8003-8005 CD denotes 48
T6793 7993-8002 VB denotes collected
T6792 7989-7992 VB denotes was
T6791 7977-7988 NN denotes supernatant
T6790 7966-7976 JJ denotes lentiviral
T6789 7962-7965 DT denotes The
T6788 7959-7960 -RRB- denotes )
T6787 7949-7959 NN denotes Invitrogen
T6786 7948-7949 -LRB- denotes (
T6785 7940-7947 NN denotes reagent
T6784 7935-7939 CD denotes 2000
T6686 7380-7385 NN denotes cebpb
T6685 7374-7379 NN denotes mouse
T6684 7370-7373 CC denotes and
T6683 7364-7369 JJ denotes human
T6682 7360-7363 IN denotes for
T6681 7351-7359 JJ denotes specific
T6680 7349-7350 -RRB- denotes )
T6679 7344-7349 NN denotes shRNA
T6678 7343-7344 -LRB- denotes (
T6677 7338-7342 NN denotes RNAs
T6676 7330-7337 NN denotes hairpin
T6675 7324-7329 JJ denotes short
T6674 7315-7323 VB denotes carrying
T6673 7307-7314 NN denotes vectors
T6672 7296-7306 NN denotes lentiviral
T6671 7284-7295 NN denotes pLKO.1-puro
T6670 7271-7283 NN denotes Transduction
T6669 7267-7270 CC denotes and
T6668 7257-7266 NN denotes Packaging
T6667 7255-7256 -COMMA- denotes ,
T6666 7249-7255 NN denotes shRNAs
T6665 7238-7248 JJ denotes Lentiviral
T6783 7921-7934 NN denotes Lipofectamine
T6782 7915-7920 VB denotes using
T6781 7913-7914 -RRB- denotes )
T6780 7911-7913 NN denotes µg
T6779 7906-7910 CD denotes 0.25
T6778 7905-7906 -LRB- denotes (
T6777 7897-7904 NN denotes plasmid
T6776 7888-7896 NN denotes envelope
T6775 7877-7887 NN denotes pCMV-VSV-G
T6774 7873-7876 CC denotes and
T6773 7871-7872 -COMMA- denotes ,
T6772 7870-7871 -RRB- denotes )
T6771 7868-7870 NN denotes µg
T6770 7863-7867 CD denotes 0.75
T6769 7862-7863 -LRB- denotes (
T6768 7854-7861 NN denotes plasmid
T6767 7844-7853 NN denotes packaging
T6766 7829-7843 NN denotes pCMV-ΔR8.2dvpr
T6765 7827-7828 -COMMA- denotes ,
T6764 7826-7827 -RRB- denotes )
T6763 7824-7826 NN denotes µg
T6762 7822-7823 CD denotes 1
T6761 7821-7822 -LRB- denotes (
T6760 7813-7820 NN denotes plasmid
T6759 7802-7812 NN denotes expression
T6758 7796-7801 NN denotes shRNA
T6757 7791-7795 DT denotes each
T6756 7789-7790 -COLON- denotes :
T6755 7781-7789 NN denotes plasmids
T6754 7778-7780 IN denotes of
T6753 7770-7777 NN denotes mixture
T6752 7768-7769 DT denotes a
T6751 7763-7767 IN denotes with
T6750 7751-7762 VB denotes transfected
T6749 7746-7750 VB denotes were
T6748 7740-7745 NN denotes cells
T6747 7731-7739 NN denotes HEK-293T
T6746 7729-7730 -COMMA- denotes ,
T6745 7720-7729 NN denotes particles
T6744 7709-7719 JJ denotes lentiviral
T6743 7701-7708 VB denotes produce
T6742 7698-7700 TO denotes To
T6741 7695-7696 -RRB- denotes ]
T6740 7693-7695 CD denotes 38
T6739 7692-7693 -LRB- denotes [
T6738 7689-7691 IN denotes in
T6737 7686-7688 IN denotes as
T6736 7674-7685 NN denotes experiments
T6735 7668-7673 DT denotes these
T6734 7665-7667 IN denotes in
T6733 7657-7664 NN denotes control
T6732 7655-7656 DT denotes a
T6731 7652-7654 IN denotes as
T6730 7646-7651 NN denotes shRNA
T6729 7640-7645 NN denotes CEBPB
T6728 7634-7639 JJ denotes human
T6727 7630-7633 DT denotes the
T6726 7625-7629 VB denotes used
T6725 7622-7624 PRP denotes we
T6724 7612-7621 RB denotes therefore
T6723 7610-7611 -COLON- denotes ;
T6722 7603-7610 NN denotes species
T6721 7597-7602 JJ denotes other
T6720 7593-7596 DT denotes the
T6719 7590-7592 IN denotes of
T6718 7584-7589 NN denotes cells
T6717 7581-7583 IN denotes on
T6716 7576-7580 VB denotes used
T6715 7571-7575 WRB denotes when
T6714 7563-7570 NN denotes C/EBP-β
T6713 7552-7562 JJ denotes endogenous
T6712 7549-7551 IN denotes of
T6711 7538-7548 NN denotes expression
T6710 7528-7537 VB denotes knockdown
T6709 7524-7527 RB denotes not
T6708 7521-7524 MD denotes can
T6707 7514-7520 NN denotes shRNAs
T6706 7497-7513 JJ denotes species-specific
T6705 7491-7496 DT denotes these
T6704 7489-7490 -COMMA- denotes ,
T6703 7480-7489 JJ denotes identical
T6702 7476-7479 RB denotes not
T6701 7472-7475 VB denotes are
T6700 7464-7471 NN denotes regions
T6699 7451-7463 JJ denotes untranslated
T6698 7448-7450 CD denotes 3′
T6697 7442-7447 NN denotes cebpb
T6696 7436-7441 NN denotes mouse
T6695 7432-7435 CC denotes and
T6694 7426-7431 JJ denotes human
T6693 7422-7425 DT denotes the
T6692 7414-7421 IN denotes Because
T6691 7405-7412 NN denotes studies
T6690 7399-7404 DT denotes these
T6689 7396-7398 IN denotes in
T6688 7391-7395 VB denotes used
T6687 7386-7390 VB denotes were
T6246 7228-7235 NN denotes reagent
T6245 7217-7227 NN denotes microassay
T6244 7209-7216 NN denotes protein
T6243 7201-7208 JJ denotes Bio-Rad
T6242 7197-7200 DT denotes the
T6241 7191-7196 VB denotes using
T6240 7180-7190 VB denotes determined
T6239 7176-7179 VB denotes was
T6238 7162-7175 NN denotes concentration
T6237 7154-7161 NN denotes Protein
T6236 7151-7152 -RRB- denotes )
T6225 7068-7075 NN denotes protein
T6224 7059-7067 JJ denotes cellular
T6223 7056-7058 TO denotes to
T6222 7053-7055 CC denotes or
T6221 7047-7052 NN denotes units
T6220 7041-7046 JJ denotes light
T6219 7030-7040 NN denotes luciferase
T6218 7022-7029 NN denotes renilla
T6217 7015-7021 NN denotes pRL-TK
T6216 7012-7014 TO denotes to
T6215 7005-7011 CC denotes either
T6214 6994-7004 VB denotes normalized
T6213 6988-6993 NN denotes units
T6212 6982-6987 JJ denotes light
T6211 6971-6981 NN denotes luciferase
T6210 6963-6970 JJ denotes firefly
T6209 6960-6962 IN denotes of
T6208 6953-6959 NN denotes number
T6207 6949-6952 DT denotes the
T6206 6946-6948 IN denotes as
T6205 6936-6945 VB denotes expressed
T6204 6933-6935 VB denotes is
T6203 6924-6932 NN denotes activity
T6202 6915-6923 NN denotes Promoter
T6201 6902-6913 NN denotes experiments
T6200 6890-6901 JJ denotes independent
T6199 6884-6889 CD denotes three
T6198 6878-6883 JJ denotes least
T6197 6875-6877 IN denotes at
T6196 6872-6874 IN denotes of
T6195 6864-6871 NN denotes results
T6194 6860-6863 DT denotes the
T6193 6850-6859 VB denotes represent
T6192 6837-6849 NN denotes Measurements
T6191 6834-6835 -RRB- denotes )
T6190 6827-6834 NN denotes Promega
T6189 6826-6827 -LRB- denotes (
T6188 6822-6825 NN denotes kit
T6187 6815-6821 NN denotes System
T6186 6809-6814 NNP denotes Assay
T6185 6800-6808 NNP denotes Reporter
T6184 6784-6799 NNP denotes Dual-Luciferase
T6183 6782-6783 DT denotes a
T6182 6776-6781 VB denotes using
T6181 6767-6775 VB denotes measured
T6180 6763-6766 VB denotes was
T6179 6754-6762 NN denotes activity
T6178 6743-6753 NN denotes Luciferase
T6177 6738-6741 NN denotes LPS
T6176 6732-6737 NN denotes ng/ml
T6175 6728-6731 CD denotes 100
T6174 6725-6727 IN denotes of
T6173 6717-6724 NN denotes absence
T6172 6714-6716 CC denotes or
T6171 6705-6713 NN denotes presence
T6170 6701-6704 DT denotes the
T6169 6698-6700 IN denotes in
T6168 6691-6697 CC denotes either
T6167 6686-6690 NN denotes 37°C
T6166 6683-6685 IN denotes at
T6165 6672-6682 NN denotes atmosphere
T6164 6668-6671 NN denotes air
T6163 6657-6667 VB denotes humidified
T6162 6655-6656 NN denotes %
T6161 6653-6655 CD denotes 95
T6160 6649-6652 CC denotes and
T6159 6645-6648 NN denotes CO2
T6158 6643-6644 NN denotes %
T6157 6642-6643 CD denotes 5
T6156 6640-6641 DT denotes a
T6155 6637-6639 IN denotes in
T6154 6633-6636 NN denotes hrs
T6153 6630-6632 CD denotes 16
T6152 6620-6629 VB denotes incubated
T6151 6616-6619 CC denotes and
T6150 6610-6615 NN denotes pools
T6149 6605-6609 NN denotes cell
T6148 6595-6604 JJ denotes identical
T6147 6591-6594 CD denotes two
T6146 6586-6590 IN denotes into
T6145 6578-6585 VB denotes divided
T6144 6576-6577 -COMMA- denotes ,
T6143 6570-6576 NN denotes plates
T6142 6562-6569 NN denotes culture
T6141 6555-6561 NN denotes tissue
T6140 6548-6554 JJ denotes 6-well
T6139 6545-6547 IN denotes in
T6138 6539-6544 NN denotes media
T6137 6528-6538 JJ denotes pre-warmed
T6136 6525-6527 IN denotes of
T6135 6522-6524 NN denotes ml
T6134 6519-6521 CD denotes 10
T6133 6516-6518 TO denotes to
T6132 6504-6515 VB denotes transferred
T6131 6499-6503 VB denotes were
T6130 6493-6498 NN denotes cells
T6129 6481-6492 VB denotes Transfected
T6128 6445-6455 NN denotes r promoter
T6127 6437-6445 NN denotes ndard fo
T6126 6434-6437 CC denotes sta
T6125 6425-6433 NN denotes internal
T6124 6422-6425 IN denotes an
T6123 6413-6421 NN denotes , and as
T6122 6405-6413 JJ denotes ficiency
T6121 6403-6405 DT denotes ef
T6120 6400-6402 IN denotes on
T6119 6397-6400 CC denotes cti
T6118 6396-6397 -COMMA- denotes e
T6117 6386-6396 NN denotes for transf
T6116 6374-6386 NN denotes ive control
T6115 6371-6374 IN denotes sit
T6114 6364-6371 NN denotes as a po
T6113 6355-6363 JJ denotes included
T6112 6353-6354 DT denotes s
T6111 6351-6353 IN denotes wa
T6110 6343-6351 VB denotes nhancer
T6109 6340-6343 VB denotes d e
T6108 6332-6340 NN denotes moter an
T6107 6329-6332 CC denotes pro
T6106 6320-6328 NN denotes the SV40
T6105 6316-6320 NN denotes des
T6104 6313-6316 DT denotes nco
T6103 6306-6313 VB denotes which e
T6102 6301-6306 WDT denotes smid
T6101 6294-6301 NN denotes rol pla
T6100 6287-6294 NN denotes L3 cont
T6099 6283-6287 NN denotes . pG
T6098 6282-6283 -RRB- denotes )
T6097 6279-6282 NNP denotes µFd
T6096 6275-6278 CD denotes 960
T6095 6273-6274 -COMMA- denotes ,
T6094 6271-6273 NN denotes kV
T6093 6266-6270 CD denotes 0.25
T6092 6265-6266 -LRB- denotes (
T6091 6256-6264 NNP denotes Extender
T6090 6244-6255 NNP denotes Capacitance
T6089 6242-6243 DT denotes a
T6088 6237-6241 IN denotes with
T6087 6230-6236 NNP denotes Pulser
T6086 6225-6229 NNP denotes Gene
T6085 6217-6224 NNP denotes Bio-Rad
T6084 6215-6216 DT denotes a
T6083 6209-6214 VB denotes using
T6082 6193-6208 NN denotes electroporation
T6081 6190-6192 IN denotes by
T6080 6188-6189 -RRB- denotes )
T6079 6186-6188 NN denotes µg
T6078 6184-6185 CD denotes 2
T6077 6183-6184 -LRB- denotes (
T6076 6175-6182 NN denotes plasmid
T6075 6166-6174 NN denotes reporter
T6074 6158-6165 NN denotes control
T6073 6149-6157 JJ denotes internal
T6072 6147-6148 -RRB- denotes )
T6071 6140-6147 NN denotes Promega
T6070 6139-6140 -LRB- denotes (
T6069 6137-6138 -RRB- denotes )
T6068 6135-6137 NN denotes TK
T6067 6134-6135 -LRB- denotes (
T6066 6127-6133 NN denotes kinase
T6065 6113-6126 NN denotes pRL-thymidine
T6064 6109-6112 DT denotes the
T6063 6104-6108 IN denotes with
T6062 6098-6103 IN denotes along
T6061 6096-6097 -RRB- denotes )
T6060 6094-6096 NN denotes µg
T6059 6091-6093 CD denotes 20
T6058 6090-6091 -LRB- denotes (
T6057 6082-6089 NN denotes plasmid
T6056 6073-6081 NN denotes reporter
T6055 6062-6072 NN denotes luciferase
T6054 6052-6061 VB denotes indicated
T6053 6048-6051 DT denotes the
T6052 6043-6047 IN denotes with
T6051 6031-6042 VB denotes transfected
T6050 6026-6030 VB denotes were
T6049 6020-6025 NN denotes phase
T6048 6016-6019 NN denotes log
T6047 6013-6015 IN denotes in
T6046 6005-6012 VB denotes growing
T6045 6003-6004 -RRB- denotes )
T6044 5998-6003 CD denotes 2×107
T6043 5997-5998 -LRB- denotes (
T6042 5991-5996 NN denotes cells
T6041 5985-5990 CD denotes 264.7
T6040 5981-5984 NN denotes RAW
T6039 5979-5980 -RRB- denotes )
T6038 5968-5979 NN denotes Macrophages
T6037 5959-5967 NN denotes RAW264.7
T6036 5958-5959 -LRB- denotes (
T6035 5951-5957 NN denotes Assays
T6034 5940-5950 NN denotes Luciferase
T6033 5936-5939 CC denotes and
T6032 5923-5935 NN denotes Transfection
T6031 5913-5922 JJ denotes Transient
T6235 7143-7151 NN denotes activity
T6234 7136-7142 NN denotes pRL-TK
T6233 7127-7135 VB denotes affected
T6232 7123-7126 NN denotes LPS
T6231 7120-7122 CC denotes or
T6230 7112-7119 NN denotes C/EBP-β
T6229 7097-7111 VB denotes co-transfected
T6228 7091-7096 WRB denotes where
T6227 7090-7091 -LRB- denotes (
T6226 7076-7089 NN denotes concentration
T5100 5288-5300 NN denotes mPAI2mOct-2a
T5099 5286-5287 -COLON- denotes :
T5098 5273-5286 NN denotes pGLmP-539mOct
T5097 5271-5272 -COLON- denotes ;
T5096 5260-5271 NN denotes mPAI2mPU.1b
T5095 5256-5259 CC denotes and
T5094 5244-5255 NN denotes mPAI2mPU.1a
T5093 5242-5243 -COLON- denotes :
T5092 5228-5242 NN denotes pGLmP-539mPU.1
T5091 5226-5227 -COLON- denotes ;
T5090 5215-5226 NN denotes mPAI2mEboxb
T5089 5211-5214 CC denotes and
T5088 5199-5210 NN denotes mPAI2mEboxa
T5087 5197-5198 -COLON- denotes :
T5086 5183-5197 NN denotes pGLmP-539mEbox
T5085 5181-5182 -COLON- denotes :
T5084 5174-5181 VB denotes follows
T5083 5171-5173 IN denotes as
T5082 5166-5170 VB denotes used
T5081 5161-5165 VB denotes were
T5080 5157-5160 CC denotes and
T5079 5155-5156 -COMMA- denotes ,
T5078 5153-5155 NN denotes S1
T5077 5148-5152 NNP denotes Fig.
T5076 5145-5147 IN denotes in
T5075 5136-5144 VB denotes provided
T5074 5132-5135 VB denotes are
T5073 5122-5131 NN denotes sequences
T5072 5115-5121 NN denotes primer
T5071 5111-5114 NN denotes PCR
T5070 5095-5110 NN denotes oligonucleotide
T5069 5088-5094 JJ denotes mutant
T5068 5084-5087 DT denotes The
T5067 5081-5082 -RRB- denotes ]
T5066 5079-5081 CD denotes 36
T5065 5078-5079 -LRB- denotes [
T5064 5068-5077 VB denotes described
T5063 5065-5067 IN denotes as
T5062 5055-5064 VB denotes generated
T5061 5050-5054 VB denotes were
T5060 5048-5049 -RRB- denotes )
T5059 5036-5048 RB denotes respectively
T5058 5020-5035 NN denotes pGLmP-539mC/EBP
T5057 5016-5019 CC denotes and
T5056 5002-5015 NN denotes pGLmP-539mOct
T5055 5000-5001 -COMMA- denotes ,
T5054 4986-5000 NN denotes pGLmP-539mPU.1
T5053 4984-4985 -COMMA- denotes ,
T5052 4970-4984 NN denotes pGLmP-539mEbox
T5051 4969-4970 -LRB- denotes (
T5050 4963-4968 NN denotes C/EBP
T5049 4959-4962 CC denotes and
T5048 4953-4958 NN denotes Oct-1
T5047 4951-4952 -COMMA- denotes ,
T5046 4947-4951 NN denotes PU.1
T5045 4945-4946 -COMMA- denotes ,
T5044 4942-4945 NN denotes box
T5043 4940-4941 NN denotes E
T5042 4932-4939 NN denotes regions
T5041 4917-4931 JJ denotes LPS-responsive
T5040 4908-4916 NN denotes promoter
T5039 4899-4907 NN denotes SerpinB2
T5038 4895-4898 DT denotes the
T5037 4892-4894 IN denotes in
T5036 4882-4891 NN denotes mutations
T5035 4871-4881 VB denotes containing
T5034 4860-4870 NN denotes constructs
T5033 4851-4859 NN denotes reporter
T5032 4840-4850 NN denotes Luciferase
T5031 4837-4838 -RRB- denotes )
T5030 4830-4837 NNP denotes Promega
T5029 4829-4830 -LRB- denotes (
T5028 4823-4828 JJ denotes Basic
T5027 4818-4822 NN denotes pGL3
T5026 4814-4817 VB denotes was
T5025 4807-4813 NN denotes vector
T5024 4801-4806 JJ denotes empty
T5023 4793-4800 NN denotes control
T5022 4789-4792 DT denotes The
T5021 4779-4787 NN denotes pGLmP-87
T5020 4771-4778 VB denotes produce
T5019 4768-4770 TO denotes to
T5018 4762-4767 JJ denotes Basic
T5017 4757-4761 NN denotes pGL3
T5016 4754-4756 IN denotes of
T5015 4748-4753 NN denotes sites
T5014 4736-4747 NN denotes restriction
T5013 4725-4735 NN denotes polylinker
T5012 4723-4724 NNP denotes I
T5011 4717-4722 NNP denotes I/Xho
T5010 4713-4716 NNP denotes Kpn
T5009 4709-4712 DT denotes the
T5008 4704-4708 IN denotes into
T5007 4700-4703 CD denotes +92
T5006 4697-4699 TO denotes to
T5005 4693-4696 CD denotes −87
T5004 4685-4692 NN denotes regions
T5003 4676-4684 NN denotes promoter
T5002 4667-4675 NN denotes SerpinB2
T5001 4660-4666 JJ denotes murine
T5000 4656-4659 DT denotes the
T4999 4647-4655 VB denotes subclone
T4998 4644-4646 TO denotes to
T4997 4639-4643 VB denotes used
T4996 4634-4638 VB denotes were
T4995 4626-4633 NN denotes DW3’LUC
T4994 4622-4625 CC denotes and
T4993 4615-4621 NN denotes BSPCR2
T4992 4607-4614 NN denotes primers
T4991 4603-4606 NN denotes PCR
T4990 4599-4602 DT denotes The
T4989 4591-4597 NN denotes ligase
T4988 4587-4590 NN denotes DNA
T4987 4584-4586 NN denotes T4
T4986 4579-4583 IN denotes with
T4985 4574-4578 VB denotes ends
T4984 4567-4573 NN denotes vector
T4983 4563-4566 DT denotes the
T4982 4551-4562 VB denotes re-ligating
T4981 4547-4550 CC denotes and
T4980 4545-4546 -RRB- denotes )
T4979 4542-4545 NN denotes NEB
T4978 4541-4542 -LRB- denotes (
T4977 4530-4540 NN denotes polymerase
T4976 4526-4529 NN denotes DNA
T4975 4523-4525 NN denotes T4
T4974 4518-4522 IN denotes with
T4973 4508-4517 NN denotes overhangs
T4972 4505-4507 CD denotes 3′
T4971 4502-4504 CC denotes or
T4970 4499-4501 CD denotes 5′
T4969 4489-4498 JJ denotes resultant
T4968 4485-4488 DT denotes the
T4967 4478-4484 VB denotes ending
T4966 4472-4477 NN denotes blunt
T4965 4470-4471 -COMMA- denotes ,
T4964 4469-4470 -RRB- denotes )
T4963 4457-4469 RB denotes respectively
T4962 4455-4456 PRP denotes I
T4961 4451-4454 NNP denotes Apo
T4960 4447-4450 CC denotes and
T4959 4443-4446 NNP denotes III
T4958 4439-4442 NNP denotes Hae
T4957 4437-4438 -COMMA- denotes ,
T4956 4436-4437 NNP denotes I
T4955 4432-4435 NNP denotes Pac
T4954 4430-4431 -COMMA- denotes ,
T4953 4429-4430 NNP denotes I
T4952 4423-4428 NN denotes Bsu36
T4951 4421-4422 -COMMA- denotes ,
T4950 4420-4421 NNP denotes I
T4949 4415-4419 NNP denotes BstX
T4948 4413-4414 -COMMA- denotes ,
T4947 4412-4413 NNP denotes I
T4946 4408-4411 NNP denotes Apa
T4945 4406-4407 -COMMA- denotes ,
T4944 4405-4406 NNP denotes I
T4943 4401-4404 NNP denotes Sfi
T4942 4400-4401 -LRB- denotes (
T4941 4393-4399 NN denotes enzyme
T4940 4381-4392 NN denotes restriction
T4939 4374-4380 JJ denotes second
T4938 4372-4373 DT denotes a
T4937 4368-4371 CC denotes and
T4936 4366-4367 CD denotes I
T4935 4361-4365 NN denotes EcoR
T4934 4356-4360 IN denotes with
T4933 4345-4355 NN denotes pGLmP-3261
T4932 4335-4344 VB denotes digesting
T4931 4332-4334 IN denotes by
T4930 4322-4331 VB denotes generated
T4929 4317-4321 VB denotes were
T4928 4315-4316 -RRB- denotes )
T4927 4306-4315 NN denotes pGLmP-189
T4926 4302-4305 CC denotes and
T4925 4292-4301 NN denotes pGLmP-539
T4924 4290-4291 -COMMA- denotes ,
T4923 4281-4290 NN denotes pGLmP-694
T4922 4279-4280 -COMMA- denotes ,
T4921 4269-4279 NN denotes pGLmP-1341
T4920 4267-4268 -COMMA- denotes ,
T4919 4257-4267 NN denotes pGLmP-1686
T4918 4255-4256 -COMMA- denotes ,
T4917 4245-4255 NN denotes pGLmP-2614
T4916 4243-4244 -COMMA- denotes ,
T4915 4233-4243 NN denotes pGLmP-2751
T4914 4232-4233 -LRB- denotes (
T4913 4221-4231 NN denotes constructs
T4912 4212-4220 NN denotes reporter
T4911 4201-4211 NN denotes luciferase
T4910 4192-4200 NN denotes SerpinB2
T4909 4185-4191 JJ denotes murine
T4908 4174-4184 JJ denotes Additional
T4907 4162-4172 NN denotes pGLmP-4480
T4906 4154-4161 VB denotes produce
T4905 4151-4153 TO denotes to
T4904 4140-4150 NN denotes pGLmP-3261
T4903 4137-4139 IN denotes of
T4902 4135-4136 -RRB- denotes )
T4901 4130-4135 NN denotes −3261
T4900 4129-4130 -LRB- denotes (
T4899 4124-4128 NN denotes site
T4898 4122-4123 NN denotes I
T4897 4117-4121 NN denotes EcoR
T4896 4108-4116 NN denotes promoter
T4895 4099-4107 NN denotes SerpinB2
T4894 4095-4098 DT denotes the
T4893 4092-4094 IN denotes of
T4892 4083-4091 JJ denotes upstream
T4891 4071-4082 RB denotes immediately
T4890 4060-4070 VB denotes sub-cloned
T4889 4056-4059 VB denotes was
T4888 4045-4055 NN denotes pDB9402-42
T4887 4042-4044 IN denotes of
T4886 4035-4041 NN denotes insert
T4885 4033-4034 CD denotes I
T4858 3890-3898 NN denotes promoter
T4857 3881-3889 NN denotes SerpinB2
T4856 3877-3880 DT denotes the
T4855 3871-3876 VB denotes clone
T4854 3867-3870 CC denotes and
T4853 3859-3866 VB denotes amplify
T4852 3855-3858 NN denotes PCR
T4851 3852-3854 TO denotes to
T4850 3847-3851 VB denotes used
T4849 3842-3846 VB denotes were
T4848 3840-3841 -COMMA- denotes ,
T4847 3836-3840 NN denotes site
T4846 3824-3835 NN denotes restriction
T4845 3822-3823 CD denotes I
T4844 3818-3821 NN denotes Xho
T4843 3815-3817 DT denotes an
T4842 3804-3814 VB denotes containing
T4841 3802-3803 -COMMA- denotes ,
T4840 3795-3802 NN denotes DW3’LUC
T4839 3791-3794 CC denotes and
T4838 3789-3790 -COMMA- denotes ,
T4837 3785-3789 NN denotes site
T4836 3773-3784 NN denotes restriction
T4835 3771-3772 NN denotes I
T4834 3767-3770 NN denotes Kpn
T4833 3765-3766 DT denotes a
T4832 3754-3764 VB denotes containing
T4831 3752-3753 -COMMA- denotes ,
T4830 3745-3752 NN denotes DW5’LUC
T4829 3737-3744 NN denotes primers
T4828 3733-3736 NN denotes PCR
T4827 3729-3732 DT denotes The
T4826 3720-3728 NN denotes Plasmids
T4825 3715-3719 NNP denotes Gene
T4824 3706-3714 NNP denotes Reporter
T4823 3697-3705 NN denotes SerpinB2
T4822 3694-3696 IN denotes of
T4821 3681-3693 NN denotes Construction
T5197 5899-5910 NN denotes experiments
T5196 5895-5898 DT denotes the
T5195 5892-5894 IN denotes in
T5194 5887-5891 VB denotes used
T5193 5882-5886 VB denotes were
T5192 5871-5881 NN denotes constructs
T5191 5862-5870 VB denotes verified
T5190 5853-5861 NN denotes Sequence
T5189 5843-5851 NN denotes promoter
T5188 5834-5842 NN denotes SerpinB2
T5187 5827-5833 JJ denotes murine
T5186 5817-5826 JJ denotes wild-type
T5185 5813-5816 DT denotes the
T5184 5810-5812 IN denotes of
T5183 5803-5809 NN denotes region
T5182 5794-5802 NN denotes −539/+92
T5181 5790-5793 DT denotes the
T5180 5787-5789 IN denotes of
T5179 5781-5786 NN denotes place
T5178 5778-5780 IN denotes in
T5177 5768-5777 NN denotes pGLmP-539
T5176 5765-5767 IN denotes of
T5175 5759-5764 NN denotes sites
T5174 5747-5758 NN denotes restriction
T5173 5745-5746 CD denotes I
T5172 5741-5744 NN denotes Xho
T5171 5737-5740 CC denotes and
T5170 5735-5736 CD denotes I
T5169 5730-5734 NN denotes EcoR
T5168 5726-5729 DT denotes the
T5167 5718-5725 IN denotes between
T5166 5711-5717 VB denotes cloned
T5165 5707-5710 CC denotes and
T5164 5705-5706 NNP denotes I
T5163 5701-5704 NNP denotes Xho
T5162 5697-5700 CC denotes and
T5161 5695-5696 CD denotes I
T5160 5690-5694 NN denotes EcoR
T5159 5685-5689 IN denotes with
T5158 5676-5684 VB denotes digested
T5157 5671-5675 VB denotes were
T5156 5662-5670 NN denotes products
T5155 5658-5661 NN denotes PCR
T5154 5646-5657 JJ denotes Recombinant
T5153 5630-5634 NN denotes e in
T5152 5626-5630 DT denotes plat
T5151 5624-5626 IN denotes em
T5150 5616-5624 NN denotes as the t
T5149 5613-5616 DT denotes ed
T5148 5611-5613 IN denotes us
T5147 5607-5611 VB denotes was
T5146 5604-5607 VB denotes 39
T5145 5595-5604 NN denotes . pGLmP-5
T5144 5594-5595 -RRB- denotes )
T5143 5587-5594 NN denotes Promega
T5142 5586-5587 -LRB- denotes (
T5141 5576-5585 NN denotes GLprimer2
T5140 5572-5575 CC denotes and
T5139 5570-5571 -RRB- denotes )
T5138 5563-5570 NN denotes Promega
T5137 5562-5563 -LRB- denotes (
T5136 5552-5561 NN denotes RVprimer3
T5135 5547-5551 VB denotes were
T5134 5539-5546 NN denotes primers
T5133 5535-5538 NN denotes PCR
T5132 5519-5534 NN denotes oligonucleotide
T5131 5510-5518 NN denotes flanking
T5130 5506-5509 DT denotes The
T5129 5503-5504 -RRB- denotes ]
T5128 5501-5503 CD denotes 37
T5127 5500-5501 -LRB- denotes [
T5126 5489-5499 RB denotes previously
T5125 5480-5488 VB denotes reported
T5124 5475-5479 VB denotes were
T5123 5459-5474 NN denotes pGLmP-539mAP-1b
T5122 5455-5458 CC denotes and
T5121 5453-5454 -COMMA- denotes ,
T5120 5438-5453 NN denotes pGLmP-539mAP-1a
T5119 5436-5437 -COMMA- denotes ,
T5118 5423-5436 NN denotes pGLmP-539mCRE
T5117 5421-5422 -COMMA- denotes ,
T5116 5414-5421 NN denotes mutants
T5115 5405-5413 VB denotes generate
T5114 5402-5404 TO denotes to
T5113 5397-5401 VB denotes used
T5112 5389-5396 NN denotes primers
T5111 5385-5388 NN denotes PCR
T5110 5369-5384 NN denotes oligonucleotide
T5109 5365-5368 DT denotes The
T5108 5352-5363 NN denotes mPAI2mCEBPb
T5107 5348-5351 CC denotes and
T5106 5336-5347 NN denotes mPAI2mCEBPa
T5105 5334-5335 -COLON- denotes :
T5104 5319-5334 NN denotes pGLmP-539mC/EBP
T5103 5317-5318 -COLON- denotes ;
T5102 5305-5317 NN denotes mPAI2mOct-2b
T5101 5301-5304 CC denotes and
T4435 3677-3678 -RRB- denotes )
T4434 3673-3677 NNP denotes Inc.
T4433 3671-3672 -COMMA- denotes ,
T4432 3661-3671 NNP denotes Technology
T4431 3651-3660 NNP denotes Signaling
T4430 3646-3650 NNP denotes Cell
T4429 3645-3646 -LRB- denotes (
T4428 3637-3644 NN denotes tubulin
T4427 3633-3636 NN denotes α/β
T4426 3629-3632 CC denotes and
T4425 3627-3628 -RRB- denotes )
T4424 3622-3627 NN denotes GAPDH
T4423 3621-3622 -LRB- denotes (
T4422 3607-3620 NN denotes dehydrogenase
T4421 3580-3606 NN denotes glyceraldehyde-3-phosphate
T4420 3578-3579 -COMMA- denotes ,
T4419 3577-3578 -RRB- denotes )
T4418 3562-3577 NNP denotes Biotechnologies
T4417 3557-3561 NNP denotes Cruz
T4416 3551-3556 NNP denotes Santa
T4415 3550-3551 -LRB- denotes (
T4414 3548-3549 -RRB- denotes )
T4413 3542-3548 NN denotes sc-150
T4412 3541-3542 -LRB- denotes (
T4411 3533-3540 NN denotes C/EBP-β
T4410 3531-3532 -COLON- denotes :
T4409 3524-3531 VB denotes include
T4408 3517-3523 NN denotes assays
T4407 3512-3516 NN denotes blot
T4406 3504-3511 JJ denotes western
T4405 3500-3503 IN denotes for
T4404 3495-3499 VB denotes used
T4403 3484-3494 NN denotes antibodies
T4402 3478-3483 JJ denotes Other
T4401 3475-3476 -RRB- denotes ]
T4400 3473-3475 CD denotes 35
T4399 3472-3473 -LRB- denotes [
T4398 3469-3471 IN denotes in
T4397 3466-3468 IN denotes as
T4396 3461-3465 FW denotes coli
T4395 3458-3460 FW denotes E.
T4394 3455-3457 IN denotes in
T4393 3446-3454 VB denotes produced
T4392 3438-3445 NN denotes protein
T4391 3431-3437 NN denotes fusion
T4390 3422-3430 NN denotes SerpinB2
T4389 3411-3421 NN denotes GST-murine
T4388 3399-3410 JJ denotes recombinant
T4387 3390-3398 VB denotes purified
T4386 3388-3389 DT denotes a
T4385 3383-3387 IN denotes with
T4384 3370-3382 NN denotes immunization
T4383 3364-3369 IN denotes after
T4382 3355-3363 VB denotes prepared
T4381 3350-3354 VB denotes were
T4380 3339-3349 NN denotes antibodies
T4379 3330-3338 NN denotes SerpinB2
T4378 3319-3329 JJ denotes anti-mouse
T4377 3312-3318 NN denotes rabbit
T4376 3303-3311 VB denotes purified
T4375 3294-3302 NN denotes Affinity
T4374 3283-3292 RB denotes overnight
T4373 3272-3282 NN denotes antibodies
T4372 3264-3271 JJ denotes primary
T4371 3259-3263 IN denotes with
T4370 3249-3258 VB denotes incubated
T4369 3245-3248 CC denotes and
T4368 3243-3244 -COMMA- denotes ,
T4367 3242-3243 -RRB- denotes )
T4366 3234-3242 CD denotes Tween-20
T4365 3232-3233 NN denotes %
T4364 3229-3232 CD denotes 0.1
T4363 3227-3228 -COMMA- denotes ,
T4362 3224-3227 NNP denotes PBS
T4884 4028-4032 NN denotes EcoR
T4883 4024-4027 DT denotes The
T4882 4012-4022 NN denotes pGLmP-3261
T4881 4004-4011 VB denotes produce
T4880 4001-4003 TO denotes to
T4879 3999-4000 -RRB- denotes )
T4878 3992-3999 NNP denotes Promega
T4877 3991-3992 -LRB- denotes (
T4876 3985-3990 JJ denotes Basic
T4875 3980-3984 NN denotes pGL3
T4874 3977-3979 IN denotes of
T4873 3971-3976 NN denotes sites
T4872 3959-3970 NN denotes restriction
T4871 3948-3958 NN denotes polylinker
T4870 3946-3947 NNP denotes I
T4869 3940-3945 NNP denotes I/Xho
T4868 3936-3939 NNP denotes Kpn
T4867 3932-3935 DT denotes the
T4866 3927-3931 IN denotes into
T4865 3919-3926 NN denotes pDB9406
T4864 3914-3918 IN denotes from
T4863 3912-3913 -RRB- denotes )
T4862 3909-3912 CD denotes +92
T4861 3906-3908 TO denotes to
T4860 3900-3905 CD denotes −3261
T4859 3899-3900 -LRB- denotes (
T4361 3221-3223 NN denotes 1X
T4360 3220-3221 -LRB- denotes (
T4359 3214-3219 NN denotes PBS-T
T4358 3211-3213 IN denotes in
T4357 3206-3210 NN denotes milk
T4356 3204-3205 NN denotes %
T4355 3203-3204 CD denotes 5
T4354 3198-3202 IN denotes with
T4353 3190-3197 VB denotes blocked
T4352 3177-3189 RB denotes subsequently
T4351 3172-3176 VB denotes were
T4350 3162-3171 NN denotes Membranes
T4349 3151-3160 NN denotes membranes
T4348 3146-3150 NN denotes PVDF
T4347 3143-3145 TO denotes to
T4346 3131-3142 VB denotes transferred
T4345 3127-3130 CC denotes and
T4344 3125-3126 -COMMA- denotes ,
T4343 3124-3125 -RRB- denotes )
T4342 3114-3124 NN denotes Invitrogen
T4341 3113-3114 -LRB- denotes (
T4340 3108-3112 NN denotes gels
T4339 3101-3107 NN denotes NuPAGE
T4338 3092-3100 JJ denotes Bis-Tris
T4337 3090-3091 NN denotes %
T4336 3086-3090 CD denotes 4–12
T4310 2988-2991 CD denotes 150
T4309 2986-2987 -COMMA- denotes ,
T4308 2982-2986 NNP denotes Tris
T4307 2979-2981 NN denotes mM
T4306 2976-2978 CD denotes 10
T4305 2975-2976 -LRB- denotes (
T4304 2968-2974 NN denotes buffer
T4303 2963-2967 NN denotes RIPA
T4302 2960-2962 IN denotes in
T4301 2951-2959 VB denotes prepared
T4300 2946-2950 VB denotes were
T4299 2938-2945 NN denotes lysates
T4298 2933-2937 NN denotes cell
T4297 2927-2932 JJ denotes Whole
T4296 2920-2926 NN denotes Assays
T4295 2915-2919 NNP denotes Blot
T4294 2907-2914 NNP denotes Western
T4008 2896-2904 NN denotes AF339731
T4007 2892-2895 NNP denotes No.
T4006 2882-2891 NNP denotes Accession
T4005 2877-2881 IN denotes with
T4004 2872-2876 NNP denotes Bank
T4003 2867-2871 NNP denotes Data
T4002 2849-2866 NNP denotes GenBank/EMBL/DDBJ
T4001 2846-2848 IN denotes in
T4000 2836-2845 VB denotes deposited
T3999 2832-2835 VB denotes was
T3998 2823-2831 NN denotes sequence
T3997 2818-2822 DT denotes This
T3996 2815-2816 -RRB- denotes )
T3995 2803-2815 NN denotes Perkin-Elmer
T3994 2802-2803 -LRB- denotes (
T3993 2792-2801 NN denotes sequencer
T3992 2787-2791 NN denotes 373A
T3991 2784-2786 NN denotes PE
T3990 2782-2783 DT denotes a
T3989 2778-2781 CC denotes and
T3988 2776-2777 -RRB- denotes )
T3987 2764-2776 NN denotes Perkin-Elmer
T3986 2763-2764 -LRB- denotes (
T3985 2759-2762 NN denotes kit
T3984 2750-2758 NN denotes reaction
T3983 2744-2749 JJ denotes ready
T3982 2733-2743 NN denotes sequencing
T3981 2727-2732 NN denotes cycle
T3980 2716-2726 NN denotes terminator
T3979 2712-2715 NN denotes dye
T3978 2706-2711 NNP denotes PRISM
T3977 2702-2705 NNP denotes ABI
T3976 2698-2701 DT denotes the
T3975 2692-2697 VB denotes using
T3974 2681-2691 VB denotes determined
T3973 2677-2680 VB denotes was
T3972 2670-2676 NN denotes region
T3971 2661-2669 NN denotes flanking
T3970 2658-2660 NN denotes 5′
T3969 2653-2657 NN denotes gene
T3968 2644-2652 NN denotes SerpinB2
T3967 2637-2643 JJ denotes murine
T3966 2634-2636 NN denotes bp
T3965 2629-2633 CD denotes 4480
T3964 2625-2628 DT denotes the
T3963 2622-2624 IN denotes of
T3962 2613-2621 NN denotes sequence
T3961 2602-2612 NN denotes nucleotide
T3960 2598-2601 DT denotes The
T3959 2586-2596 NN denotes sequencing
T3958 2582-2585 NN denotes DNA
T3957 2578-2581 CC denotes and
T3956 2568-2577 NN denotes digestion
T3955 2561-2567 NN denotes enzyme
T3954 2549-2560 NN denotes restriction
T3953 2546-2548 IN denotes by
T3952 2537-2545 VB denotes verified
T3951 2532-2536 VB denotes were
T3950 2524-2531 NN denotes inserts
T3949 2514-2523 VB denotes Subcloned
T3948 2500-2512 NN denotes orientations
T3947 2491-2499 JJ denotes opposite
T3946 2488-2490 IN denotes in
T3945 2481-2487 VB denotes cloned
T3944 2479-2480 -COMMA- denotes ,
T3943 2471-2479 NN denotes fragment
T3942 2465-2470 NN denotes EcoRI
T3941 2457-2464 NN denotes pDB9406
T3940 2453-2456 DT denotes the
T3939 2450-2452 IN denotes of
T3938 2441-2449 RB denotes upstream
T3937 2429-2440 RB denotes immediately
T3936 2421-2428 JJ denotes located
T3935 2419-2420 -COMMA- denotes ,
T3934 2411-2419 NN denotes fragment
T3933 2403-2410 JJ denotes genomic
T3932 2397-2402 NN denotes EcoRI
T3931 2394-2396 NN denotes kb
T3930 2390-2393 CD denotes 1.2
T3929 2388-2389 DT denotes a
T3928 2380-2387 VB denotes contain
T3927 2369-2379 NN denotes pDB9402-42
T3926 2365-2368 CC denotes and
T3925 2354-2364 NN denotes pDB9402-41
T3924 2352-2353 -COLON- denotes ;
T3923 2348-2352 NN denotes site
T3922 2337-2347 NN denotes initiation
T3921 2323-2336 NN denotes transcription
T3920 2319-2322 DT denotes the
T3919 2310-2318 VB denotes spanning
T3918 2301-2309 NN denotes fragment
T3917 2293-2300 JJ denotes genomic
T3916 2282-2292 NN denotes EcoRI/SpeI
T3915 2279-2281 NN denotes kb
T3914 2275-2278 CD denotes 4.4
T3913 2273-2274 DT denotes a
T3912 2264-2272 VB denotes contains
T3911 2256-2263 NN denotes pDB9406
T3910 2248-2255 NNP denotes Geneva.
T3909 2245-2247 IN denotes of
T3908 2234-2244 NNP denotes University
T3907 2232-2233 -COMMA- denotes ,
T3906 2227-2232 NNP denotes Belin
T3905 2217-2226 NNP denotes Dominique
T3904 2213-2216 NNP denotes Dr.
T3903 2210-2212 IN denotes by
T3902 2201-2209 VB denotes provided
T3901 2194-2200 RB denotes kindly
T3900 2189-2193 VB denotes were
T3899 2187-2188 -COMMA- denotes ,
T3898 2181-2187 NN denotes strain
T3897 2175-2180 NN denotes mouse
T3896 2171-2174 CD denotes 129
T3895 2169-2170 DT denotes a
T3894 2164-2168 IN denotes from
T3893 2155-2163 VB denotes prepared
T3892 2147-2154 NN denotes library
T3891 2139-2146 JJ denotes genomic
T3890 2137-2138 -RRB- denotes )
T3889 2127-2137 NN denotes Stratagene
T3888 2126-2127 -LRB- denotes (
T3887 2119-2125 NN denotes λFIXII
T3886 2117-2118 DT denotes a
T3885 2112-2116 IN denotes from
T3884 2103-2111 VB denotes isolated
T3883 2099-2102 NN denotes DNA
T3882 2091-2098 JJ denotes genomic
T3881 2080-2090 VB denotes containing
T3880 2069-2079 NN denotes pDB9402-42
T3879 2065-2068 CC denotes and
T3878 2054-2064 NN denotes pDB9402-41
T3877 2052-2053 -COMMA- denotes ,
T3876 2045-2052 NN denotes pDB9406
T3875 2036-2044 NN denotes Plasmids
T3874 2025-2034 NN denotes digestion
T4335 3083-3085 IN denotes on
T4334 3073-3082 VB denotes separated
T4333 3068-3072 VB denotes were
T4332 3059-3067 NN denotes proteins
T4331 3057-3058 -COMMA- denotes ,
T4330 3056-3057 -RRB- denotes )
T4329 3053-3056 NN denotes SDS
T4328 3051-3052 NN denotes %
T4327 3048-3051 CD denotes 0.1
T4326 3046-3047 -COMMA- denotes ,
T4325 3034-3046 NN denotes deoxycholate
T4324 3032-3033 NN denotes %
T4323 3029-3032 CD denotes 0.5
T4322 3027-3028 -COMMA- denotes ,
T4321 3022-3027 NN denotes NP-40
T4320 3020-3021 NN denotes %
T4319 3017-3020 CD denotes 0.5
T4318 3015-3016 -COMMA- denotes ,
T4317 3010-3015 NN denotes X-100
T4316 3003-3009 NN denotes Triton
T4315 3002-3003 NN denotes %
T4314 3001-3002 CD denotes 1
T4313 2999-3000 -COMMA- denotes ,
T4312 2995-2999 NN denotes NaCl
T4311 2992-2994 NN denotes mM
T3873 2021-2024 CD denotes III
T3872 2009-2020 NN denotes exonuclease
T3871 2006-2008 IN denotes by
T3870 1995-2005 VB denotes introduced
T3869 1985-1994 NN denotes deletions
T3868 1974-1984 VB denotes containing
T3867 1963-1973 NN denotes pDB9402-42
T3866 1959-1962 CC denotes and
T3865 1948-1958 NN denotes pDB9402-41
T3864 1943-1947 IN denotes from
T3863 1934-1942 VB denotes prepared
T3862 1925-1933 NN denotes plasmids
T3861 1922-1924 TO denotes to
T3860 1913-1921 NN denotes addition
T3859 1910-1912 IN denotes in
T3858 1908-1909 -COMMA- denotes ,
T3857 1898-1908 NN denotes pDB9402-42
T3856 1894-1897 CC denotes and
T3855 1883-1893 NN denotes pDB9402-41
T3854 1881-1882 -COMMA- denotes ,
T3853 1874-1881 NN denotes pDB9406
T3852 1865-1873 NN denotes plasmids
T3851 1855-1864 JJ denotes pUC-based
T3850 1851-1854 DT denotes the
T3849 1840-1850 VB denotes sequencing
T3848 1837-1839 IN denotes by
T3673 1729-1730 -RRB- denotes A
T3672 1719-1729 NNP denotes 7939_s1) (
T3671 1712-1719 NNP denotes (Mm0060
T3670 1710-1711 -LRB- denotes n
T3669 1709-1710 -RRB- denotes i
T3668 1696-1709 NN denotes s1) and β-act
T3667 1695-1696 -LRB- denotes _
T3666 1688-1695 NN denotes 0843434
T3665 1685-1688 CC denotes Mm0
T3664 1684-1685 -RRB- denotes (
T3663 1670-1683 NN denotes 05_m1), Cebpb
T3662 1669-1670 -LRB- denotes 9
T3661 1664-1669 NN denotes 00440
T3660 1663-1664 -COMMA- denotes m
T3659 1662-1663 -RRB- denotes M
T3658 1649-1662 NN denotes b2/SerpinB2 (
T3657 1648-1649 -LRB- denotes n
T3656 1631-1648 NN denotes primers for Serpi
T3655 1628-1631 IN denotes 0X
T3654 1621-1628 NN denotes ssion 2
T3653 1618-1621 NN denotes pre
T3652 1608-1618 NN denotes n® Gene Ex
T3651 1604-1608 NNP denotes aqMa
T3650 1597-1604 NNP denotes using T
T3649 1592-1597 VB denotes rmed
T3648 1583-1592 VB denotes was perfo
T3647 1580-1583 VB denotes CR
T3646 1576-1580 NN denotes . qP
T3645 1575-1576 -RRB- denotes )
T3644 1565-1575 NNP denotes Biosystems
T3643 1557-1564 NNP denotes Applied
T3642 1556-1557 -LRB- denotes (
T3641 1547-1555 NN denotes Reagents
T3640 1533-1546 NN denotes Transcription
T3639 1525-1532 NNP denotes Reverse
T3638 1517-1524 NNP denotes TaqMan®
T3637 1511-1516 VB denotes using
T3636 1499-1510 VB denotes transcribed
T3635 1491-1498 RB denotes reverse
T3634 1487-1490 VB denotes was
T3633 1483-1486 NN denotes RNA
T3632 1477-1482 JJ denotes total
T3631 1474-1476 IN denotes of
T3630 1471-1473 NN denotes µg
T3629 1469-1470 CD denotes 1
T3628 1467-1468 -COMMA- denotes ,
T3627 1458-1467 NN denotes synthesis
T3626 1453-1457 NN denotes cDNA
T3625 1449-1452 IN denotes For
T3624 1442-1447 NN denotes cells
T3623 1437-1441 IN denotes from
T3622 1433-1436 NN denotes RNA
T3621 1427-1432 JJ denotes total
T3620 1419-1426 VB denotes isolate
T3619 1416-1418 TO denotes to
T3618 1411-1415 VB denotes used
T3617 1407-1410 VB denotes was
T3616 1405-1406 -RRB- denotes )
T3615 1399-1405 NN denotes Qiagen
T3614 1398-1399 -LRB- denotes (
T3613 1394-1397 NNP denotes Kit
T3612 1389-1393 NNP denotes Mini
T3611 1382-1388 NNP denotes RNeasy
T3610 1378-1381 DT denotes The
T3609 1376-1377 -RRB- denotes )
T3608 1372-1376 NN denotes qPCR
T3607 1371-1372 -LRB- denotes (
T3606 1367-1370 NN denotes PCR
T3605 1354-1366 JJ denotes Quantitative
T3287 1336-1341 NNP denotes Sigma
T3286 1331-1335 IN denotes from
T3285 1322-1330 VB denotes obtained
T3284 1318-1321 VB denotes was
T3283 1316-1317 -RRB- denotes )
T3282 1311-1316 NN denotes Re595
T3281 1304-1310 NN denotes Strain
T3280 1294-1303 NN denotes minnesota
T3279 1283-1293 NN denotes Salmonella
T3278 1282-1283 -LRB- denotes (
T3277 1280-1281 -RRB- denotes )
T3276 1277-1280 NN denotes LPS
T3275 1276-1277 -LRB- denotes (
T3274 1257-1275 NN denotes lipopolysaccharide
T3273 1247-1256 JJ denotes Bacterial
T3272 1244-1245 -RRB- denotes )
T3271 1239-1244 NN denotes Lonza
T3270 1238-1239 -LRB- denotes (
T3269 1234-1237 NN denotes Kit
T3268 1224-1233 NNP denotes Detection
T3267 1214-1223 NNP denotes MycoAlert
T3266 1210-1213 DT denotes the
T3265 1206-1209 CC denotes and
T3264 1204-1205 -RRB- denotes )
T3263 1199-1204 NN denotes Sigma
T3262 1198-1199 -LRB- denotes (
T3261 1192-1197 CD denotes 33258
T3260 1186-1191 NN denotes stain
T3259 1178-1185 NNP denotes Hoechst
T3258 1172-1177 VB denotes using
T3257 1163-1171 NN denotes staining
T3256 1155-1162 JJ denotes nuclear
T3255 1152-1154 IN denotes by
T3254 1142-1151 NN denotes infection
T3253 1131-1141 NN denotes Mycoplasma
T3252 1123-1130 VB denotes exclude
T3251 1120-1122 TO denotes to
T3250 1112-1119 VB denotes checked
T3249 1102-1111 RB denotes routinely
T3248 1097-1101 VB denotes were
T3247 1088-1096 NN denotes cultures
T3246 1084-1087 DT denotes All
T3245 1076-1082 NN denotes method
T3244 1066-1075 NN denotes exclusion
T3243 1062-1065 NN denotes dye
T3242 1060-1061 -RRB- denotes )
T3241 1055-1060 NN denotes Sigma
T3240 1054-1055 -LRB- denotes (
T3239 1049-1053 JJ denotes blue
T3238 1042-1048 NN denotes trypan
T3237 1038-1041 DT denotes the
T3236 1032-1037 VB denotes using
T3235 1021-1031 VB denotes determined
T3234 1017-1020 VB denotes was
T3233 1007-1016 NN denotes viability
T3232 1002-1006 NN denotes Cell
T3231 995-1000 NN denotes serum
T3230 986-994 JJ denotes LPS-free
T3229 976-985 VB denotes certified
T3228 973-975 IN denotes of
T3227 969-972 NN denotes use
T3226 965-968 DT denotes the
T3225 957-964 IN denotes through
T3224 948-956 NN denotes cultures
T3223 943-947 NN denotes cell
T3222 939-942 DT denotes all
T3221 934-938 IN denotes from
T3220 920-933 NN denotes contamination
T3219 901-919 NN denotes lipopolysaccharide
T3218 891-900 JJ denotes bacterial
T3217 883-890 VB denotes exclude
T3216 880-882 TO denotes to
T3215 874-879 VB denotes taken
T3214 869-873 VB denotes were
T3213 857-868 NN denotes Precautions
T3212 854-855 -RRB- denotes )
T3211 851-854 NNP denotes BRL
T3210 845-850 NNP denotes Gibco
T3209 844-845 -LRB- denotes (
T3208 838-843 NN denotes media
T3207 829-837 NN denotes DMEM/F12
T3206 827-828 NN denotes %
T3205 825-827 CD denotes 50
T3204 822-824 IN denotes in
T3203 811-821 VB denotes maintained
T3202 807-810 CC denotes and
T3201 805-806 -COMMA- denotes ,
T3200 800-805 RB denotes later
T3199 795-799 NN denotes days
T3198 791-794 CD denotes 3–5
T3197 784-790 NN denotes lavage
T3196 773-783 JJ denotes peritoneal
T3195 770-772 IN denotes by
T3194 761-769 VB denotes followed
T3193 755-760 NN denotes broth
T3192 740-754 NN denotes thioglycollate
T3191 738-739 NN denotes %
T3190 737-738 CD denotes 3
T3189 732-736 IN denotes with
T3188 727-731 NN denotes mice
T3187 719-726 NN denotes C57BL/6
T3186 709-718 VB denotes injecting
T3185 706-708 IN denotes by
T3184 697-705 VB denotes obtained
T3183 692-696 VB denotes were
T3182 680-691 NN denotes macrophages
T3181 669-679 JJ denotes peritoneal
T3180 661-668 JJ denotes Primary
T3179 30-37 NNP denotes Culture
T3178 25-29 NNP denotes Cell
T3847 1826-1836 VB denotes determined
T3846 1822-1825 VB denotes was
T3845 1813-1821 NN denotes promoter
T3844 1804-1812 NN denotes SerpinB2
T3843 1797-1803 JJ denotes murine
T3842 1793-1796 DT denotes the
T3841 1790-1792 IN denotes of
T3840 1781-1789 NN denotes sequence
T3839 1777-1780 NN denotes DNA
T3838 1773-1776 DT denotes The
T3837 1764-1772 NN denotes Analysis
T3836 1755-1763 NN denotes Sequence
T3835 1751-1754 NN denotes DNA
T3604 1344-1353 JJ denotes Real-time
R2265 T3179 T3178 arg1Of Culture,Cell
R2266 T3182 T3180 arg1Of macrophages,Primary
R2267 T3182 T3181 arg1Of macrophages,peritoneal
R2268 T3182 T3183 arg1Of macrophages,were
R2269 T3182 T3184 arg2Of macrophages,obtained
R2270 T3182 T3203 arg1Of macrophages,maintained
R2271 T3184 T3183 arg2Of obtained,were
R2272 T3184 T3185 arg1Of obtained,by
R2273 T3184 T3202 arg1Of obtained,and
R2274 T3186 T3185 arg2Of injecting,by
R2275 T3188 T3186 arg2Of mice,injecting
R2276 T3188 T3187 arg1Of mice,C57BL/6
R2277 T3188 T3189 arg1Of mice,with
R2278 T3190 T3191 arg1Of 3,%
R2279 T3193 T3189 arg2Of broth,with
R2280 T3193 T3190 arg1Of broth,3
R2281 T3193 T3192 arg1Of broth,thioglycollate
R2282 T3193 T3194 arg2Of broth,followed
R2283 T3194 T3200 arg1Of followed,later
R2284 T3197 T3194 arg1Of lavage,followed
R2285 T3197 T3195 arg2Of lavage,by
R2286 T3197 T3196 arg1Of lavage,peritoneal
R2287 T3199 T3198 arg1Of days,3–5
R2288 T3200 T3199 arg1Of later,days
R2289 T3202 T3201 arg1Of and,","
R2290 T3203 T3202 arg2Of maintained,and
R2291 T3203 T3204 arg1Of maintained,in
R2292 T3205 T3206 arg1Of 50,%
R2293 T3208 T3204 arg2Of media,in
R2294 T3208 T3205 arg1Of media,50
R2295 T3208 T3207 arg1Of media,DMEM/F12
R2296 T3208 T3209 arg1Of media,(
R2297 T3211 T3209 arg2Of BRL,(
R2298 T3211 T3210 arg1Of BRL,Gibco
R2299 T3212 T3209 arg3Of ),(
R2300 T3213 T3214 arg1Of Precautions,were
R2301 T3213 T3215 arg2Of Precautions,taken
R2302 T3213 T3217 arg1Of Precautions,exclude
R2303 T3215 T3214 arg2Of taken,were
R2304 T3217 T3215 arg3Of exclude,taken
R2305 T3217 T3216 arg1Of exclude,to
R2306 T3217 T3225 arg1Of exclude,through
R2307 T3220 T3217 arg2Of contamination,exclude
R2308 T3220 T3218 arg1Of contamination,bacterial
R2309 T3220 T3219 arg1Of contamination,lipopolysaccharide
R2310 T3220 T3221 arg1Of contamination,from
R2311 T3224 T3221 arg2Of cultures,from
R2312 T3224 T3222 arg1Of cultures,all
R2313 T3224 T3223 arg1Of cultures,cell
R2314 T3227 T3225 arg2Of use,through
R2315 T3227 T3226 arg1Of use,the
R2316 T3227 T3228 arg1Of use,of
R2317 T3231 T3228 arg2Of serum,of
R2318 T3231 T3229 arg2Of serum,certified
R2319 T3231 T3230 arg1Of serum,LPS-free
R2320 T3233 T3232 arg1Of viability,Cell
R2321 T3233 T3234 arg1Of viability,was
R2322 T3233 T3235 arg2Of viability,determined
R2323 T3235 T3234 arg2Of determined,was
R2324 T3236 T3235 arg3Of using,determined
R2325 T3241 T3240 arg2Of Sigma,(
R2326 T3242 T3240 arg3Of ),(
R2327 T3245 T3236 arg2Of method,using
R2328 T3245 T3237 arg1Of method,the
R2329 T3245 T3238 arg1Of method,trypan
R2330 T3245 T3239 arg1Of method,blue
R2331 T3245 T3240 arg1Of method,(
R2332 T3245 T3243 arg1Of method,dye
R2333 T3245 T3244 arg1Of method,exclusion
R2334 T3247 T3246 arg1Of cultures,All
R2335 T3247 T3248 arg1Of cultures,were
R2336 T3247 T3250 arg2Of cultures,checked
R2337 T3250 T3248 arg2Of checked,were
R2338 T3250 T3249 arg1Of checked,routinely
R2339 T3250 T3251 modOf checked,to
R2340 T3252 T3251 arg1Of exclude,to
R2341 T3254 T3252 arg2Of infection,exclude
R2342 T3254 T3253 arg1Of infection,Mycoplasma
R2343 T3254 T3255 arg1Of infection,by
R2344 T3257 T3256 arg1Of staining,nuclear
R2345 T3257 T3258 arg1Of staining,using
R2346 T3257 T3265 arg1Of staining,and
R2347 T3260 T3258 arg2Of stain,using
R2348 T3260 T3259 arg1Of stain,Hoechst
R2349 T3260 T3261 arg1Of stain,33258
R2350 T3260 T3262 arg1Of stain,(
R2351 T3263 T3262 arg2Of Sigma,(
R2352 T3264 T3262 arg3Of ),(
R2353 T3265 T3255 arg2Of and,by
R2354 T3268 T3267 arg1Of Detection,MycoAlert
R2355 T3269 T3265 arg2Of Kit,and
R2356 T3269 T3266 arg1Of Kit,the
R2357 T3269 T3268 arg1Of Kit,Detection
R2358 T3269 T3270 arg1Of Kit,(
R2359 T3271 T3270 arg2Of Lonza,(
R2360 T3272 T3270 arg3Of ),(
R2361 T3274 T3273 arg1Of lipopolysaccharide,Bacterial
R2362 T3274 T3275 arg1Of lipopolysaccharide,(
R2363 T3274 T3278 arg1Of lipopolysaccharide,(
R2364 T3274 T3284 arg1Of lipopolysaccharide,was
R2365 T3274 T3285 arg2Of lipopolysaccharide,obtained
R2366 T3276 T3275 arg2Of LPS,(
R2367 T3277 T3275 arg3Of ),(
R2368 T3282 T3278 arg2Of Re595,(
R2369 T3282 T3279 arg1Of Re595,Salmonella
R2370 T3282 T3280 arg1Of Re595,minnesota
R2371 T3282 T3281 arg1Of Re595,Strain
R2372 T3283 T3278 arg3Of ),(
R2373 T3285 T3284 arg2Of obtained,was
R2374 T3285 T3286 arg1Of obtained,from
R2375 T3287 T3286 arg2Of Sigma,from
R2630 T3613 T3614 arg1Of Kit,(
R2632 T3613 T3618 arg2Of Kit,used
R2633 T3613 T3620 arg1Of Kit,isolate
R2634 T3615 T3614 arg2Of Qiagen,(
R2637 T3620 T3618 arg3Of isolate,used
R2638 T3620 T3619 arg1Of isolate,to
R2639 T3620 T3623 arg1Of isolate,from
R2640 T3622 T3620 arg2Of RNA,isolate
R2641 T3622 T3621 arg1Of RNA,total
R2642 T3624 T3623 arg2Of cells,from
R2643 T3627 T3625 arg2Of synthesis,For
R2644 T3627 T3626 arg1Of synthesis,cDNA
R2645 T3630 T3629 arg1Of µg,1
R2646 T3630 T3631 arg1Of µg,of
R2647 T3630 T3634 arg1Of µg,was
R2648 T3630 T3636 arg2Of µg,transcribed
R2649 T3630 T3637 arg1Of µg,using
R2650 T3633 T3631 arg2Of RNA,of
R2651 T3633 T3632 arg1Of RNA,total
R2652 T3636 T3625 arg1Of transcribed,For
R2653 T3636 T3628 arg1Of transcribed,","
R2654 T3636 T3634 arg2Of transcribed,was
R2655 T3636 T3635 arg1Of transcribed,reverse
R2656 T3636 T3637 modOf transcribed,using
R2657 T3639 T3638 arg1Of Reverse,TaqMan®
R2658 T3641 T3637 arg2Of Reagents,using
R2659 T3641 T3639 arg1Of Reagents,Reverse
R2660 T3641 T3640 arg1Of Reagents,Transcription
R2661 T3641 T3642 arg1Of Reagents,(
R2662 T3641 T3647 modOf Reagents,CR
R2663 T3644 T3642 arg2Of Biosystems,(
R2664 T3644 T3643 arg1Of Biosystems,Applied
R2665 T3645 T3642 arg3Of ),(
R2666 T3646 T3647 arg1Of . qP,CR
R2667 T3646 T3648 arg2Of . qP,was perfo
R2668 T3648 T3647 arg2Of was perfo,CR
R2669 T3649 T3648 arg3Of rmed ,was perfo
R2670 T3651 T3650 arg1Of aqMa,using T
R2671 T3654 T3649 arg2Of ssion 2,rmed
R2672 T3654 T3651 arg1Of ssion 2,aqMa
R2673 T3654 T3652 arg1Of ssion 2,n® Gene Ex
R2674 T3654 T3653 arg1Of ssion 2,pre
R2675 T3654 T3655 arg1Of ssion 2,0X
R2676 T3654 T3670 arg1Of ssion 2,n
R2677 T3656 T3657 arg1Of primers for Serpi,n
R2678 T3656 T3660 arg1Of primers for Serpi,m
R2679 T3658 T3657 arg2Of b2/SerpinB2 (,n
R2680 T3659 T3657 arg3Of M,n
R2681 T3660 T3665 arg1Of m,Mm0
R2682 T3661 T3660 arg2Of 00440,m
R2683 T3661 T3662 arg1Of 00440,9
R2684 T3663 T3662 arg2Of "05_m1), Cebpb",9
R2685 T3664 T3662 arg3Of (,9
R2686 T3665 T3655 arg2Of Mm0,0X
R2687 T3666 T3665 arg2Of 0843434,Mm0
R2688 T3666 T3667 arg1Of 0843434,_
R2689 T3668 T3667 arg2Of s1) and β-act,_
R2690 T3669 T3667 arg3Of i,_
R2691 T3672 T3670 arg2Of 7939_s1) (,n
R2692 T3672 T3671 arg1Of 7939_s1) (,(Mm0060
R2693 T3673 T3670 arg3Of A,n
R2778 T3837 T3835 arg1Of Analysis,DNA
R2779 T3837 T3836 arg1Of Analysis,Sequence
R2780 T3840 T3838 arg1Of sequence,The
R2781 T3840 T3839 arg1Of sequence,DNA
R2782 T3840 T3841 arg1Of sequence,of
R2783 T3840 T3846 arg1Of sequence,was
R2784 T3840 T3847 arg2Of sequence,determined
R2785 T3845 T3841 arg2Of promoter,of
R2786 T3845 T3842 arg1Of promoter,the
R2787 T3845 T3843 arg1Of promoter,murine
R2788 T3845 T3844 arg1Of promoter,SerpinB2
R2789 T3847 T3846 arg2Of determined,was
R2790 T3847 T3848 arg1Of determined,by
R2791 T3849 T3848 arg2Of sequencing,by
R2792 T3849 T3858 arg1Of sequencing,","
R2793 T3849 T3859 arg1Of sequencing,in
R2794 T3853 T3854 arg1Of pDB9406,","
R2795 T3854 T3856 arg1Of ",",and
R2796 T3855 T3854 arg2Of pDB9402-41,","
R2797 T3856 T3849 arg2Of and,sequencing
R2798 T3856 T3850 arg1Of and,the
R2799 T3856 T3851 arg1Of and,pUC-based
R2800 T3856 T3852 arg1Of and,plasmids
R2801 T3857 T3856 arg2Of pDB9402-42,and
R2803 T3860 T3861 arg1Of addition,to
R2804 T3862 T3861 arg2Of plasmids,to
R2805 T3862 T3863 arg2Of plasmids,prepared
R2806 T3863 T3864 arg1Of prepared,from
R2807 T3865 T3866 arg1Of pDB9402-41,and
R2808 T3866 T3864 arg2Of and,from
R2809 T3866 T3868 arg1Of and,containing
R2810 T3867 T3866 arg2Of pDB9402-42,and
R2811 T3869 T3868 arg2Of deletions,containing
R2812 T3869 T3870 arg2Of deletions,introduced
R2813 T3874 T3870 arg1Of digestion,introduced
R2814 T3874 T3871 arg2Of digestion,by
R2815 T3874 T3872 arg1Of digestion,exonuclease
R2816 T3874 T3873 arg1Of digestion,III
R2817 T3876 T3877 arg1Of pDB9406,","
R2818 T3877 T3879 arg1Of ",",and
R2819 T3878 T3877 arg2Of pDB9402-41,","
R2820 T3879 T3875 arg1Of and,Plasmids
R2821 T3879 T3881 arg1Of and,containing
R2822 T3879 T3900 arg1Of and,were
R2823 T3879 T3902 arg2Of and,provided
R2824 T3880 T3879 arg2Of pDB9402-42,and
R2825 T3883 T3881 arg2Of DNA,containing
R2826 T3883 T3882 arg1Of DNA,genomic
R2827 T3883 T3884 arg2Of DNA,isolated
R2828 T3884 T3885 arg1Of isolated,from
R2829 T3889 T3888 arg2Of Stratagene,(
R2830 T3890 T3888 arg3Of ),(
R2831 T3892 T3885 arg2Of library,from
R2832 T3892 T3886 arg1Of library,a
R2833 T3892 T3887 arg1Of library,λFIXII
R2834 T3892 T3888 arg1Of library,(
R2835 T3892 T3891 arg1Of library,genomic
R2836 T3892 T3893 arg2Of library,prepared
R2837 T3893 T3894 arg1Of prepared,from
R2838 T3898 T3894 arg2Of strain,from
R2839 T3898 T3895 arg1Of strain,a
R2840 T3898 T3896 arg1Of strain,129
R2841 T3898 T3897 arg1Of strain,mouse
R2842 T3902 T3899 arg1Of provided,","
R2843 T3902 T3900 arg2Of provided,were
R2844 T3902 T3901 arg1Of provided,kindly
R2845 T3902 T3907 arg1Of provided,","
R2846 T3906 T3902 arg1Of Belin,provided
R2847 T3906 T3903 arg2Of Belin,by
R2848 T3906 T3904 arg1Of Belin,Dr.
R2849 T3906 T3905 arg1Of Belin,Dominique
R2850 T3908 T3909 arg1Of University,of
R2851 T3910 T3909 arg2Of Geneva.,of
R2852 T3911 T3908 arg1Of pDB9406,University
R2853 T3911 T3912 arg1Of pDB9406,contains
R2854 T3912 T3907 arg2Of contains,","
R2855 T3912 T3924 arg1Of contains,;
R2856 T3918 T3912 arg2Of fragment,contains
R2857 T3918 T3913 arg1Of fragment,a
R2858 T3918 T3914 arg1Of fragment,4.4
R2859 T3918 T3915 arg1Of fragment,kb
R2860 T3918 T3916 arg1Of fragment,EcoRI/SpeI
R2861 T3918 T3917 arg1Of fragment,genomic
R2862 T3918 T3919 arg1Of fragment,spanning
R2863 T3923 T3919 arg2Of site,spanning
R2864 T3923 T3920 arg1Of site,the
R2865 T3923 T3921 arg1Of site,transcription
R2866 T3923 T3922 arg1Of site,initiation
R2867 T3925 T3926 arg1Of pDB9402-41,and
R2868 T3926 T3928 arg1Of and,contain
R2869 T3927 T3926 arg2Of pDB9402-42,and
R2870 T3928 T3924 arg2Of contain,;
R2871 T3934 T3928 arg2Of fragment,contain
R2872 T3934 T3929 arg1Of fragment,a
R2873 T3934 T3930 arg1Of fragment,1.2
R2874 T3934 T3931 arg1Of fragment,kb
R2875 T3934 T3932 arg1Of fragment,EcoRI
R2876 T3934 T3933 arg1Of fragment,genomic
R2877 T3934 T3935 arg1Of fragment,","
R2878 T3934 T3936 arg1Of fragment,located
R2879 T3934 T3944 arg1Of fragment,","
R2880 T3934 T3945 arg2Of fragment,cloned
R2881 T3936 T3938 arg1Of located,upstream
R2882 T3938 T3937 arg1Of upstream,immediately
R2883 T3938 T3939 arg1Of upstream,of
R2884 T3943 T3939 arg2Of fragment,of
R2885 T3943 T3940 arg1Of fragment,the
R2886 T3943 T3941 arg1Of fragment,pDB9406
R2887 T3943 T3942 arg1Of fragment,EcoRI
R2888 T3945 T3946 arg1Of cloned,in
R2889 T3948 T3946 arg2Of orientations,in
R2890 T3948 T3947 arg1Of orientations,opposite
R2891 T3950 T3949 arg2Of inserts,Subcloned
R2892 T3950 T3951 arg1Of inserts,were
R2893 T3950 T3952 arg2Of inserts,verified
R2894 T3952 T3951 arg2Of verified,were
R2895 T3956 T3954 arg1Of digestion,restriction
R2896 T3956 T3955 arg1Of digestion,enzyme
R2897 T3956 T3957 arg1Of digestion,and
R2898 T3957 T3952 arg1Of and,verified
R2899 T3957 T3953 arg2Of and,by
R2900 T3959 T3957 arg2Of sequencing,and
R2901 T3959 T3958 arg1Of sequencing,DNA
R2902 T3962 T3960 arg1Of sequence,The
R2903 T3962 T3961 arg1Of sequence,nucleotide
R2904 T3962 T3963 arg1Of sequence,of
R2905 T3962 T3973 arg1Of sequence,was
R2906 T3962 T3974 arg2Of sequence,determined
R2907 T3972 T3963 arg2Of region,of
R2908 T3972 T3964 arg1Of region,the
R2909 T3972 T3965 arg1Of region,4480
R2910 T3972 T3966 arg1Of region,bp
R2911 T3972 T3967 arg1Of region,murine
R2912 T3972 T3968 arg1Of region,SerpinB2
R2913 T3972 T3969 arg1Of region,gene
R2914 T3972 T3970 arg1Of region,5′
R2915 T3972 T3971 arg1Of region,flanking
R2916 T3974 T3973 arg2Of determined,was
R2917 T3975 T3974 arg3Of using,determined
R2918 T3978 T3977 arg1Of PRISM,ABI
R2919 T3985 T3976 arg1Of kit,the
R2920 T3985 T3978 arg1Of kit,PRISM
R2921 T3985 T3979 arg1Of kit,dye
R2922 T3985 T3980 arg1Of kit,terminator
R2923 T3985 T3981 arg1Of kit,cycle
R2924 T3985 T3982 arg1Of kit,sequencing
R2925 T3985 T3983 arg1Of kit,ready
R2926 T3985 T3984 arg1Of kit,reaction
R2927 T3985 T3986 arg1Of kit,(
R2928 T3985 T3989 arg1Of kit,and
R2929 T3987 T3986 arg2Of Perkin-Elmer,(
R2930 T3988 T3986 arg3Of ),(
R2931 T3989 T3975 arg2Of and,using
R2932 T3993 T3989 arg2Of sequencer,and
R2933 T3993 T3990 arg1Of sequencer,a
R2934 T3993 T3991 arg1Of sequencer,PE
R2935 T3993 T3992 arg1Of sequencer,373A
R2936 T3993 T3994 arg1Of sequencer,(
R2937 T3995 T3994 arg2Of Perkin-Elmer,(
R2938 T3996 T3994 arg3Of ),(
R2939 T3998 T3997 arg1Of sequence,This
R2940 T3998 T3999 arg1Of sequence,was
R2941 T3998 T4000 arg2Of sequence,deposited
R2942 T4000 T3999 arg2Of deposited,was
R2943 T4000 T4001 arg1Of deposited,in
R2944 T4007 T4002 arg1Of No.,GenBank/EMBL/DDBJ
R2945 T4007 T4003 arg1Of No.,Data
R2946 T4007 T4004 arg1Of No.,Bank
R2947 T4007 T4005 arg1Of No.,with
R2948 T4007 T4006 arg1Of No.,Accession
R2949 T4008 T4001 arg2Of AF339731,in
R2950 T4008 T4007 arg1Of AF339731,No.
R3138 T4295 T4294 arg1Of Blot,Western
R3139 T4296 T4295 arg1Of Assays,Blot
R3140 T4299 T4297 arg1Of lysates,Whole
R3141 T4299 T4298 arg1Of lysates,cell
R3142 T4299 T4300 arg1Of lysates,were
R3143 T4299 T4301 arg2Of lysates,prepared
R3144 T4301 T4300 arg2Of prepared,were
R3145 T4301 T4302 arg1Of prepared,in
R3146 T4301 T4305 arg1Of prepared,(
R3147 T4304 T4302 arg2Of buffer,in
R3148 T4304 T4303 arg1Of buffer,RIPA
R3149 T4308 T4305 arg2Of Tris,(
R3150 T4308 T4306 arg1Of Tris,10
R3151 T4308 T4307 arg1Of Tris,mM
R3152 T4308 T4309 arg1Of Tris,","
R3153 T4308 T4326 arg1Of Tris,","
R3154 T4310 T4311 arg1Of 150,mM
R3155 T4312 T4310 arg1Of NaCl,150
R3156 T4312 T4313 arg1Of NaCl,","
R3157 T4313 T4318 arg1Of ",",","
R3158 T4314 T4315 arg1Of 1,%
R3159 T4317 T4313 arg2Of X-100,","
R3160 T4317 T4314 arg1Of X-100,1
R3161 T4317 T4316 arg1Of X-100,Triton
R3162 T4318 T4322 arg1Of ",",","
R3163 T4319 T4320 arg1Of 0.5,%
R3164 T4321 T4318 arg2Of NP-40,","
R3165 T4321 T4319 arg1Of NP-40,0.5
R3166 T4322 T4309 arg2Of ",",","
R3167 T4323 T4324 arg1Of 0.5,%
R3168 T4325 T4322 arg2Of deoxycholate,","
R3169 T4325 T4323 arg1Of deoxycholate,0.5
R3170 T4327 T4328 arg1Of 0.1,%
R3171 T4329 T4326 arg2Of SDS,","
R3172 T4329 T4327 arg1Of SDS,0.1
R3173 T4330 T4305 arg3Of ),(
R3174 T4332 T4333 arg1Of proteins,were
R3175 T4332 T4334 arg2Of proteins,separated
R3176 T4332 T4346 arg2Of proteins,transferred
R3177 T4334 T4335 arg1Of separated,on
R3178 T4334 T4345 arg1Of separated,and
R3179 T4336 T4337 arg1Of 4–12,%
R3180 T4340 T4335 arg2Of gels,on
R3181 T4340 T4336 arg1Of gels,4–12
R3182 T4340 T4338 arg1Of gels,Bis-Tris
R3183 T4340 T4339 arg1Of gels,NuPAGE
R3184 T4340 T4341 arg1Of gels,(
R3185 T4342 T4341 arg2Of Invitrogen,(
R3186 T4343 T4341 arg3Of ),(
R3187 T4345 T4300 modOf and,were
R3188 T4345 T4331 arg1Of and,","
R3189 T4345 T4333 arg2Of and,were
R3190 T4345 T4344 arg1Of and,","
R3191 T4346 T4345 arg2Of transferred,and
R3192 T4346 T4347 arg1Of transferred,to
R3193 T4349 T4347 arg2Of membranes,to
R3194 T4349 T4348 arg1Of membranes,PVDF
R3195 T4350 T4351 arg1Of Membranes,were
R3196 T4350 T4353 arg2Of Membranes,blocked
R3197 T4350 T4370 arg2Of Membranes,incubated
R3198 T4353 T4354 arg1Of blocked,with
R3199 T4353 T4369 arg1Of blocked,and
R3200 T4355 T4356 arg1Of 5,%
R3201 T4357 T4354 arg2Of milk,with
R3202 T4357 T4355 arg1Of milk,5
R3203 T4357 T4358 arg1Of milk,in
R3204 T4359 T4358 arg2Of PBS-T,in
R3205 T4359 T4360 arg1Of PBS-T,(
R3206 T4362 T4360 arg2Of PBS,(
R3207 T4362 T4361 arg1Of PBS,1X
R3208 T4362 T4363 arg1Of PBS,","
R3209 T4365 T4364 arg1Of %,0.1
R3210 T4366 T4363 arg2Of Tween-20,","
R3211 T4366 T4365 arg1Of Tween-20,%
R3212 T4367 T4360 arg3Of ),(
R3213 T4369 T4351 arg2Of and,were
R3214 T4369 T4352 arg1Of and,subsequently
R3215 T4369 T4368 arg1Of and,","
R3216 T4370 T4369 arg2Of incubated,and
R3217 T4370 T4371 arg1Of incubated,with
R3218 T4370 T4374 arg1Of incubated,overnight
R3219 T4373 T4371 arg2Of antibodies,with
R3220 T4373 T4372 arg1Of antibodies,primary
R3221 T4380 T4375 arg1Of antibodies,Affinity
R3222 T4380 T4376 arg2Of antibodies,purified
R3223 T4380 T4377 arg1Of antibodies,rabbit
R3224 T4380 T4378 arg1Of antibodies,anti-mouse
R3225 T4380 T4379 arg1Of antibodies,SerpinB2
R3226 T4380 T4381 arg1Of antibodies,were
R3227 T4380 T4382 arg2Of antibodies,prepared
R3228 T4382 T4381 arg2Of prepared,were
R3229 T4382 T4383 arg1Of prepared,after
R3230 T4384 T4383 arg2Of immunization,after
R3231 T4384 T4385 arg1Of immunization,with
R3232 T4392 T4385 arg2Of protein,with
R3233 T4392 T4386 arg1Of protein,a
R3234 T4392 T4387 arg2Of protein,purified
R3235 T4392 T4388 arg1Of protein,recombinant
R3236 T4392 T4389 arg1Of protein,GST-murine
R3237 T4392 T4390 arg1Of protein,SerpinB2
R3238 T4392 T4391 arg1Of protein,fusion
R3239 T4392 T4393 arg2Of protein,produced
R3240 T4393 T4394 arg1Of produced,in
R3241 T4393 T4398 arg1Of produced,in
R3242 T4393 T4399 arg1Of produced,[
R3243 T4396 T4394 arg2Of coli,in
R3244 T4396 T4395 arg1Of coli,E.
R3245 T4398 T4397 arg1Of in,as
R3246 T4400 T4399 arg2Of 35,[
R3247 T4401 T4399 arg3Of ],[
R3248 T4403 T4402 arg1Of antibodies,Other
R3249 T4403 T4404 arg2Of antibodies,used
R3250 T4403 T4409 arg1Of antibodies,include
R3251 T4404 T4405 arg1Of used,for
R3252 T4408 T4405 arg2Of assays,for
R3253 T4408 T4406 arg1Of assays,western
R3254 T4408 T4407 arg1Of assays,blot
R3255 T4409 T4410 arg1Of include,:
R3256 T4411 T4412 arg1Of C/EBP-β,(
R3257 T4411 T4415 arg1Of C/EBP-β,(
R3258 T4411 T4420 arg1Of C/EBP-β,","
R3259 T4413 T4412 arg2Of sc-150,(
R3260 T4414 T4412 arg3Of ),(
R3261 T4418 T4415 arg2Of Biotechnologies,(
R3262 T4418 T4416 arg1Of Biotechnologies,Santa
R3263 T4418 T4417 arg1Of Biotechnologies,Cruz
R3264 T4419 T4415 arg3Of ),(
R3265 T4420 T4426 arg1Of ",",and
R3266 T4422 T4420 arg2Of dehydrogenase,","
R3267 T4422 T4421 arg1Of dehydrogenase,glyceraldehyde-3-phosphate
R3268 T4422 T4423 arg1Of dehydrogenase,(
R3269 T4424 T4423 arg2Of GAPDH,(
R3270 T4425 T4423 arg3Of ),(
R3271 T4426 T4409 arg2Of and,include
R3272 T4428 T4426 arg2Of tubulin,and
R3273 T4428 T4427 arg1Of tubulin,α/β
R3274 T4428 T4429 arg1Of tubulin,(
R3275 T4432 T4429 arg2Of Technology,(
R3276 T4432 T4430 arg1Of Technology,Cell
R3277 T4432 T4431 arg1Of Technology,Signaling
R3278 T4432 T4433 arg1Of Technology,","
R3279 T4434 T4433 arg2Of Inc.,","
R3280 T4435 T4429 arg3Of ),(
R3450 T4821 T4822 arg1Of Construction,of
R3451 T4825 T4824 arg1Of Gene,Reporter
R3452 T4826 T4822 arg2Of Plasmids,of
R3453 T4826 T4823 arg1Of Plasmids,SerpinB2
R3454 T4826 T4825 arg1Of Plasmids,Gene
R3455 T4829 T4827 arg1Of primers,The
R3456 T4829 T4828 arg1Of primers,PCR
R3457 T4829 T4853 arg1Of primers,amplify
R3458 T4829 T4855 arg1Of primers,clone
R3459 T4830 T4831 arg1Of DW5’LUC,","
R3460 T4830 T4832 arg1Of DW5’LUC,containing
R3461 T4830 T4839 arg1Of DW5’LUC,and
R3462 T4837 T4832 arg2Of site,containing
R3463 T4837 T4833 arg1Of site,a
R3464 T4837 T4834 arg1Of site,Kpn
R3465 T4837 T4835 arg1Of site,I
R3466 T4837 T4836 arg1Of site,restriction
R3467 T4839 T4838 arg1Of and,","
R3468 T4839 T4841 arg1Of and,","
R3469 T4839 T4842 arg1Of and,containing
R3470 T4839 T4849 arg1Of and,were
R3471 T4839 T4850 arg2Of and,used
R3472 T4840 T4839 arg2Of DW3’LUC,and
R3473 T4847 T4842 arg2Of site,containing
R3474 T4847 T4843 arg1Of site,an
R3475 T4847 T4844 arg1Of site,Xho
R3476 T4847 T4845 arg1Of site,I
R3477 T4847 T4846 arg1Of site,restriction
R3478 T4850 T4848 arg1Of used,","
R3479 T4850 T4849 arg2Of used,were
R3480 T4850 T4851 arg1Of used,to
R3481 T4852 T4851 arg2Of PCR,to
R3482 T4853 T4854 arg1Of amplify,and
R3483 T4854 T4849 modOf and,were
R3484 T4854 T4880 modOf and,to
R3485 T4855 T4854 arg2Of clone,and
R3486 T4858 T4853 arg2Of promoter,amplify
R3487 T4858 T4855 arg2Of promoter,clone
R3488 T4858 T4856 arg1Of promoter,the
R3489 T4858 T4857 arg1Of promoter,SerpinB2
R3490 T4858 T4859 arg1Of promoter,(
R3491 T4858 T4864 arg1Of promoter,from
R3492 T4858 T4866 arg1Of promoter,into
R3493 T4862 T4859 arg2Of +92,(
R3494 T4862 T4860 arg1Of +92,−3261
R3495 T4862 T4861 arg1Of +92,to
R3496 T4863 T4859 arg3Of ),(
R3497 T4865 T4864 arg2Of pDB9406,from
R3498 T4870 T4868 arg1Of I,Kpn
R3499 T4870 T4869 arg1Of I,I/Xho
R3500 T4873 T4866 arg2Of sites,into
R3501 T4873 T4867 arg1Of sites,the
R3502 T4873 T4870 arg1Of sites,I
R3503 T4873 T4871 arg1Of sites,polylinker
R3504 T4873 T4872 arg1Of sites,restriction
R3505 T4873 T4874 arg1Of sites,of
R3506 T4876 T4875 arg1Of Basic,pGL3
R3507 T4878 T4874 arg2Of Promega,of
R3508 T4878 T4876 arg1Of Promega,Basic
R3509 T4878 T4877 arg2Of Promega,(
R3510 T4879 T4877 arg3Of ),(
R3511 T4881 T4880 arg1Of produce,to
R3512 T4882 T4881 arg2Of pGLmP-3261,produce
R3513 T4886 T4883 arg1Of insert,The
R3514 T4886 T4884 arg1Of insert,EcoR
R3515 T4886 T4885 arg1Of insert,I
R3516 T4886 T4887 arg1Of insert,of
R3517 T4886 T4889 arg1Of insert,was
R3518 T4886 T4890 arg2Of insert,sub-cloned
R3519 T4886 T4892 arg1Of insert,upstream
R3520 T4888 T4887 arg2Of pDB9402-42,of
R3521 T4890 T4889 arg2Of sub-cloned,was
R3522 T4892 T4890 arg3Of upstream,sub-cloned
R3523 T4892 T4891 arg1Of upstream,immediately
R3524 T4892 T4893 arg1Of upstream,of
R3525 T4899 T4893 arg2Of site,of
R3526 T4899 T4894 arg1Of site,the
R3527 T4899 T4895 arg1Of site,SerpinB2
R3528 T4899 T4896 arg1Of site,promoter
R3529 T4899 T4897 arg1Of site,EcoR
R3530 T4899 T4898 arg1Of site,I
R3531 T4899 T4900 arg1Of site,(
R3532 T4899 T4903 arg1Of site,of
R3533 T4899 T4905 modOf site,to
R3534 T4901 T4900 arg2Of −3261,(
R3535 T4902 T4900 arg3Of ),(
R3536 T4904 T4903 arg2Of pGLmP-3261,of
R3537 T4906 T4905 arg1Of produce,to
R3538 T4907 T4906 arg2Of pGLmP-4480,produce
R3539 T4913 T4908 arg1Of constructs,Additional
R3540 T4913 T4909 arg1Of constructs,murine
R3541 T4913 T4910 arg1Of constructs,SerpinB2
R3542 T4913 T4911 arg1Of constructs,luciferase
R3543 T4913 T4912 arg1Of constructs,reporter
R3544 T4913 T4914 arg1Of constructs,(
R3545 T4913 T4929 arg1Of constructs,were
R3546 T4913 T4930 arg2Of constructs,generated
R3547 T4915 T4916 arg1Of pGLmP-2751,","
R3548 T4916 T4918 arg1Of ",",","
R3549 T4917 T4916 arg2Of pGLmP-2614,","
R3550 T4918 T4920 arg1Of ",",","
R3551 T4919 T4918 arg2Of pGLmP-1686,","
R3552 T4920 T4922 arg1Of ",",","
R3553 T4921 T4920 arg2Of pGLmP-1341,","
R3554 T4922 T4924 arg1Of ",",","
R3555 T4923 T4922 arg2Of pGLmP-694,","
R3556 T4924 T4926 arg1Of ",",and
R3557 T4925 T4924 arg2Of pGLmP-539,","
R3558 T4926 T4914 arg2Of and,(
R3559 T4927 T4926 arg2Of pGLmP-189,and
R3560 T4928 T4914 arg3Of ),(
R3561 T4930 T4929 arg2Of generated,were
R3562 T4930 T4931 arg1Of generated,by
R3563 T4930 T4965 arg1Of generated,","
R3564 T4932 T4931 arg2Of digesting,by
R3565 T4932 T4942 arg1Of digesting,(
R3566 T4933 T4934 arg1Of pGLmP-3261,with
R3567 T4933 T4937 arg1Of pGLmP-3261,and
R3568 T4935 T4934 arg2Of EcoR,with
R3569 T4935 T4936 arg1Of EcoR,I
R3570 T4937 T4932 arg2Of and,digesting
R3571 T4941 T4937 arg2Of enzyme,and
R3572 T4941 T4938 arg1Of enzyme,a
R3573 T4941 T4939 arg1Of enzyme,second
R3574 T4941 T4940 arg1Of enzyme,restriction
R3575 T4944 T4943 arg1Of I,Sfi
R3576 T4944 T4945 arg1Of I,","
R3577 T4945 T4948 arg1Of ",",","
R3578 T4947 T4945 arg2Of I,","
R3579 T4947 T4946 arg1Of I,Apa
R3580 T4948 T4951 arg1Of ",",","
R3581 T4950 T4948 arg2Of I,","
R3582 T4950 T4949 arg1Of I,BstX
R3583 T4951 T4954 arg1Of ",",","
R3584 T4953 T4951 arg2Of I,","
R3585 T4953 T4952 arg1Of I,Bsu36
R3586 T4954 T4957 arg1Of ",",","
R3587 T4956 T4954 arg2Of I,","
R3588 T4956 T4955 arg1Of I,Pac
R3589 T4957 T4960 arg1Of ",",and
R3590 T4959 T4957 arg2Of III,","
R3591 T4959 T4958 arg1Of III,Hae
R3592 T4960 T4942 arg2Of and,(
R3593 T4962 T4960 arg2Of I,and
R3594 T4962 T4961 arg1Of I,Apo
R3595 T4962 T4963 arg1Of I,respectively
R3596 T4964 T4942 arg3Of ),(
R3597 T4966 T4967 arg1Of blunt,ending
R3598 T4966 T4982 arg1Of blunt,re-ligating
R3599 T4966 T4985 arg1Of blunt,ends
R3600 T4967 T4981 arg1Of ending,and
R3601 T4970 T4971 arg1Of 5′,or
R3602 T4972 T4971 arg2Of 3′,or
R3603 T4973 T4967 arg2Of overhangs,ending
R3604 T4973 T4968 arg1Of overhangs,the
R3605 T4973 T4969 arg1Of overhangs,resultant
R3606 T4973 T4970 arg1Of overhangs,5′
R3607 T4973 T4972 arg1Of overhangs,3′
R3608 T4973 T4974 arg1Of overhangs,with
R3609 T4977 T4974 arg2Of polymerase,with
R3610 T4977 T4975 arg1Of polymerase,T4
R3611 T4977 T4976 arg1Of polymerase,DNA
R3612 T4977 T4978 arg1Of polymerase,(
R3613 T4979 T4978 arg2Of NEB,(
R3614 T4980 T4978 arg3Of ),(
R3615 T4982 T4981 arg2Of re-ligating,and
R3616 T4984 T4982 arg2Of vector,re-ligating
R3617 T4984 T4983 arg1Of vector,the
R3618 T4985 T4965 arg2Of ends,","
R3619 T4985 T4986 arg1Of ends,with
R3620 T4989 T4986 arg2Of ligase,with
R3621 T4989 T4987 arg1Of ligase,T4
R3622 T4989 T4988 arg1Of ligase,DNA
R3623 T4993 T4994 arg1Of BSPCR2,and
R3624 T4994 T4990 arg1Of and,The
R3625 T4994 T4991 arg1Of and,PCR
R3626 T4994 T4992 arg1Of and,primers
R3627 T4994 T4996 arg1Of and,were
R3628 T4994 T4997 arg2Of and,used
R3629 T4995 T4994 arg2Of DW3’LUC,and
R3630 T4997 T4996 arg2Of used,were
R3631 T4999 T4997 arg3Of subclone,used
R3632 T4999 T4998 arg1Of subclone,to
R3633 T4999 T5006 arg1Of subclone,to
R3634 T4999 T5008 arg1Of subclone,into
R3635 T5004 T4999 arg2Of regions,subclone
R3636 T5004 T5000 arg1Of regions,the
R3637 T5004 T5001 arg1Of regions,murine
R3638 T5004 T5002 arg1Of regions,SerpinB2
R3639 T5004 T5003 arg1Of regions,promoter
R3640 T5004 T5005 arg1Of regions,−87
R3641 T5007 T5006 arg2Of +92,to
R3642 T5012 T5010 arg1Of I,Kpn
R3643 T5012 T5011 arg1Of I,I/Xho
R3644 T5015 T5013 arg1Of sites,polylinker
R3645 T5015 T5014 arg1Of sites,restriction
R3646 T5015 T5016 arg1Of sites,of
R3647 T5015 T5020 arg2Of sites,produce
R3648 T5017 T5016 arg2Of pGL3,of
R3649 T5018 T5019 modOf Basic,to
R3650 T5020 T5019 arg1Of produce,to
R3651 T5021 T5008 arg2Of pGLmP-87,into
R3652 T5021 T5009 arg1Of pGLmP-87,the
R3653 T5021 T5012 arg1Of pGLmP-87,I
R3654 T5021 T5018 arg1Of pGLmP-87,Basic
R3655 T5025 T5022 arg1Of vector,The
R3656 T5025 T5023 arg1Of vector,control
R3657 T5025 T5024 arg1Of vector,empty
R3658 T5025 T5026 arg1Of vector,was
R3659 T5028 T5027 arg1Of Basic,pGL3
R3660 T5030 T5026 arg2Of Promega,was
R3661 T5030 T5028 arg1Of Promega,Basic
R3662 T5030 T5029 arg2Of Promega,(
R3663 T5031 T5029 arg3Of ),(
R3664 T5034 T5032 arg1Of constructs,Luciferase
R3665 T5034 T5033 arg1Of constructs,reporter
R3666 T5034 T5035 arg1Of constructs,containing
R3667 T5034 T5051 arg1Of constructs,(
R3668 T5034 T5061 arg1Of constructs,were
R3669 T5034 T5062 arg2Of constructs,generated
R3670 T5036 T5035 arg2Of mutations,containing
R3671 T5036 T5037 arg1Of mutations,in
R3672 T5036 T5045 arg1Of mutations,","
R3673 T5044 T5037 arg2Of box,in
R3674 T5044 T5038 arg1Of box,the
R3675 T5044 T5039 arg1Of box,SerpinB2
R3676 T5044 T5040 arg1Of box,promoter
R3677 T5044 T5041 arg1Of box,LPS-responsive
R3678 T5044 T5042 arg1Of box,regions
R3679 T5044 T5043 arg1Of box,E
R3680 T5046 T5047 arg1Of PU.1,","
R3681 T5047 T5049 arg1Of ",",and
R3682 T5048 T5047 arg2Of Oct-1,","
R3683 T5049 T5045 arg2Of and,","
R3684 T5050 T5049 arg2Of C/EBP,and
R3685 T5052 T5053 arg1Of pGLmP-539mEbox,","
R3686 T5053 T5055 arg1Of ",",","
R3687 T5054 T5053 arg2Of pGLmP-539mPU.1,","
R3688 T5055 T5057 arg1Of ",",and
R3689 T5056 T5055 arg2Of pGLmP-539mOct,","
R3690 T5057 T5051 arg2Of and,(
R3691 T5057 T5059 arg1Of and,respectively
R3692 T5058 T5057 arg2Of pGLmP-539mC/EBP,and
R3693 T5060 T5051 arg3Of ),(
R3694 T5062 T5061 arg2Of generated,were
R3695 T5062 T5063 arg1Of generated,as
R3696 T5064 T5063 arg2Of described,as
R3697 T5064 T5065 arg1Of described,[
R3698 T5066 T5065 arg2Of 36,[
R3699 T5067 T5065 arg3Of ],[
R3700 T5073 T5068 arg1Of sequences,The
R3701 T5073 T5069 arg1Of sequences,mutant
R3702 T5073 T5070 arg1Of sequences,oligonucleotide
R3703 T5073 T5071 arg1Of sequences,PCR
R3704 T5073 T5072 arg1Of sequences,primer
R3705 T5073 T5074 arg1Of sequences,are
R3706 T5073 T5075 arg2Of sequences,provided
R3707 T5073 T5081 arg1Of sequences,were
R3708 T5073 T5082 arg2Of sequences,used
R3709 T5075 T5074 arg2Of provided,are
R3710 T5075 T5076 arg1Of provided,in
R3711 T5075 T5080 arg1Of provided,and
R3712 T5078 T5076 arg2Of S1,in
R3713 T5078 T5077 arg1Of S1,Fig.
R3714 T5080 T5079 arg1Of and,","
R3715 T5082 T5080 arg2Of used,and
R3716 T5082 T5081 arg2Of used,were
R3717 T5083 T5082 arg3Of as,used
R3718 T5084 T5083 arg2Of follows,as
R3719 T5084 T5085 arg1Of follows,:
R3720 T5086 T5084 arg2Of pGLmP-539mEbox,follows
R3721 T5086 T5087 arg1Of pGLmP-539mEbox,:
R3722 T5086 T5093 arg1Of pGLmP-539mEbox,:
R3723 T5086 T5097 arg1Of pGLmP-539mEbox,;
R3724 T5086 T5099 arg1Of pGLmP-539mEbox,:
R3725 T5086 T5103 arg1Of pGLmP-539mEbox,;
R3726 T5086 T5105 arg1Of pGLmP-539mEbox,:
R3727 T5088 T5089 arg1Of mPAI2mEboxa,and
R3728 T5089 T5087 arg2Of and,:
R3729 T5089 T5091 arg1Of and,;
R3730 T5090 T5089 arg2Of mPAI2mEboxb,and
R3731 T5092 T5091 arg2Of pGLmP-539mPU.1,;
R3732 T5094 T5095 arg1Of mPAI2mPU.1a,and
R3733 T5095 T5093 arg2Of and,:
R3734 T5096 T5095 arg2Of mPAI2mPU.1b,and
R3735 T5098 T5097 arg2Of pGLmP-539mOct,;
R3736 T5100 T5101 arg1Of mPAI2mOct-2a,and
R3737 T5101 T5099 arg2Of and,:
R3738 T5102 T5101 arg2Of mPAI2mOct-2b,and
R3739 T5104 T5103 arg2Of pGLmP-539mC/EBP,;
R3740 T5106 T5107 arg1Of mPAI2mCEBPa,and
R3741 T5107 T5105 arg2Of and,:
R3742 T5108 T5107 arg2Of mPAI2mCEBPb,and
R3743 T5112 T5109 arg1Of primers,The
R3744 T5112 T5110 arg1Of primers,oligonucleotide
R3745 T5112 T5111 arg1Of primers,PCR
R3746 T5112 T5113 arg2Of primers,used
R3747 T5112 T5115 arg1Of primers,generate
R3748 T5112 T5117 arg1Of primers,","
R3749 T5112 T5124 arg1Of primers,were
R3750 T5112 T5125 arg2Of primers,reported
R3751 T5115 T5113 arg3Of generate,used
R3752 T5115 T5114 arg1Of generate,to
R3753 T5116 T5115 arg2Of mutants,generate
R3754 T5118 T5119 arg1Of pGLmP-539mCRE,","
R3755 T5119 T5122 arg1Of ",",and
R3756 T5120 T5119 arg2Of pGLmP-539mAP-1a,","
R3757 T5122 T5117 arg2Of and,","
R3758 T5122 T5121 arg1Of and,","
R3759 T5123 T5122 arg2Of pGLmP-539mAP-1b,and
R3760 T5125 T5124 arg2Of reported,were
R3761 T5125 T5126 arg1Of reported,previously
R3762 T5125 T5127 arg1Of reported,[
R3763 T5128 T5127 arg2Of 37,[
R3764 T5129 T5127 arg3Of ],[
R3765 T5134 T5130 arg1Of primers,The
R3766 T5134 T5131 arg1Of primers,flanking
R3767 T5134 T5132 arg1Of primers,oligonucleotide
R3768 T5134 T5133 arg1Of primers,PCR
R3769 T5134 T5135 arg1Of primers,were
R3770 T5136 T5137 arg1Of RVprimer3,(
R3771 T5136 T5140 arg1Of RVprimer3,and
R3772 T5138 T5137 arg2Of Promega,(
R3773 T5139 T5137 arg3Of ),(
R3774 T5140 T5135 arg2Of and,were
R3775 T5140 T5146 modOf and,39
R3776 T5141 T5140 arg2Of GLprimer2,and
R3777 T5141 T5142 arg1Of GLprimer2,(
R3778 T5143 T5142 arg2Of Promega,(
R3779 T5144 T5142 arg3Of ),(
R3780 T5145 T5146 arg1Of . pGLmP-5,39
R3781 T5145 T5147 arg2Of . pGLmP-5,was
R3782 T5147 T5146 arg2Of was ,39
R3783 T5147 T5148 arg1Of was ,us
R3784 T5150 T5148 arg2Of as the t,us
R3785 T5150 T5149 arg1Of as the t,ed
R3786 T5150 T5151 arg1Of as the t,em
R3787 T5153 T5151 arg2Of e in,em
R3788 T5153 T5152 arg1Of e in,plat
R3789 T5156 T5154 arg1Of products,Recombinant
R3790 T5156 T5155 arg1Of products,PCR
R3791 T5156 T5157 arg1Of products,were
R3792 T5156 T5158 arg2Of products,digested
R3793 T5156 T5166 arg2Of products,cloned
R3794 T5158 T5159 arg1Of digested,with
R3795 T5158 T5165 arg1Of digested,and
R3796 T5160 T5161 arg1Of EcoR,I
R3797 T5160 T5162 arg1Of EcoR,and
R3798 T5162 T5159 arg2Of and,with
R3799 T5164 T5162 arg2Of I,and
R3800 T5164 T5163 arg1Of I,Xho
R3801 T5165 T5157 arg2Of and,were
R3802 T5166 T5165 arg2Of cloned,and
R3803 T5166 T5167 arg1Of cloned,between
R3804 T5166 T5178 arg1Of cloned,in
R3805 T5170 T5171 arg1Of I,and
R3806 T5172 T5171 arg2Of Xho,and
R3807 T5175 T5167 arg2Of sites,between
R3808 T5175 T5168 arg1Of sites,the
R3809 T5175 T5169 arg1Of sites,EcoR
R3810 T5175 T5170 arg1Of sites,I
R3811 T5175 T5172 arg1Of sites,Xho
R3812 T5175 T5173 arg1Of sites,I
R3813 T5175 T5174 arg1Of sites,restriction
R3814 T5175 T5176 arg1Of sites,of
R3815 T5177 T5176 arg2Of pGLmP-539,of
R3816 T5179 T5178 arg2Of place,in
R3817 T5179 T5180 arg1Of place,of
R3818 T5183 T5180 arg2Of region,of
R3819 T5183 T5181 arg1Of region,the
R3820 T5183 T5182 arg1Of region,−539/+92
R3821 T5183 T5184 arg1Of region,of
R3822 T5189 T5184 arg2Of promoter,of
R3823 T5189 T5185 arg1Of promoter,the
R3824 T5189 T5186 arg1Of promoter,wild-type
R3825 T5189 T5187 arg1Of promoter,murine
R3826 T5189 T5188 arg1Of promoter,SerpinB2
R3827 T5190 T5191 arg1Of Sequence,verified
R3828 T5192 T5193 arg1Of constructs,were
R3829 T5192 T5194 arg2Of constructs,used
R3830 T5194 T5191 arg2Of used,verified
R3831 T5194 T5193 arg2Of used,were
R3832 T5194 T5195 arg1Of used,in
R3833 T5197 T5195 arg2Of experiments,in
R3834 T5197 T5196 arg1Of experiments,the
R4268 T6032 T6033 arg1Of Transfection,and
R4269 T6034 T6033 arg2Of Luciferase,and
R4270 T6035 T6031 arg1Of Assays,Transient
R4271 T6035 T6032 arg1Of Assays,Transfection
R4272 T6035 T6034 arg1Of Assays,Luciferase
R4273 T6035 T6036 arg1Of Assays,(
R4274 T6038 T6036 arg2Of Macrophages,(
R4275 T6038 T6037 arg1Of Macrophages,RAW264.7
R4276 T6039 T6036 arg3Of ),(
R4277 T6042 T6040 arg1Of cells,RAW
R4278 T6042 T6041 arg1Of cells,264.7
R4279 T6042 T6043 arg1Of cells,(
R4280 T6042 T6046 arg1Of cells,growing
R4281 T6042 T6050 arg1Of cells,were
R4282 T6042 T6051 arg2Of cells,transfected
R4283 T6044 T6043 arg2Of 2×107,(
R4284 T6045 T6043 arg3Of ),(
R4285 T6046 T6047 arg1Of growing,in
R4286 T6049 T6047 arg2Of phase,in
R4287 T6049 T6048 arg1Of phase,log
R4288 T6051 T6050 arg2Of transfected,were
R4289 T6051 T6052 arg1Of transfected,with
R4290 T6051 T6062 arg1Of transfected,along
R4291 T6051 T6107 arg1Of transfected,pro
R4292 T6057 T6052 arg2Of plasmid,with
R4293 T6057 T6053 arg1Of plasmid,the
R4294 T6057 T6054 arg2Of plasmid,indicated
R4295 T6057 T6055 arg1Of plasmid,luciferase
R4296 T6057 T6056 arg1Of plasmid,reporter
R4297 T6057 T6058 arg1Of plasmid,(
R4298 T6060 T6058 arg2Of µg,(
R4299 T6060 T6059 arg1Of µg,20
R4300 T6061 T6058 arg3Of ),(
R4301 T6062 T6063 arg1Of along,with
R4302 T6066 T6065 arg1Of kinase,pRL-thymidine
R4303 T6066 T6067 arg1Of kinase,(
R4304 T6068 T6067 arg2Of TK,(
R4305 T6069 T6067 arg3Of ),(
R4306 T6071 T6070 arg2Of Promega,(
R4307 T6072 T6070 arg3Of ),(
R4308 T6076 T6063 arg2Of plasmid,with
R4309 T6076 T6064 arg1Of plasmid,the
R4310 T6076 T6066 arg1Of plasmid,kinase
R4311 T6076 T6070 arg1Of plasmid,(
R4312 T6076 T6073 arg1Of plasmid,internal
R4313 T6076 T6074 arg1Of plasmid,control
R4314 T6076 T6075 arg1Of plasmid,reporter
R4315 T6076 T6077 arg1Of plasmid,(
R4316 T6076 T6081 arg1Of plasmid,by
R4317 T6079 T6077 arg2Of µg,(
R4318 T6079 T6078 arg1Of µg,2
R4319 T6080 T6077 arg3Of ),(
R4320 T6082 T6081 arg2Of electroporation,by
R4321 T6082 T6083 arg1Of electroporation,using
R4322 T6083 T6088 arg1Of using,with
R4323 T6087 T6083 arg2Of Pulser,using
R4324 T6087 T6084 arg1Of Pulser,a
R4325 T6087 T6085 arg1Of Pulser,Bio-Rad
R4326 T6087 T6086 arg1Of Pulser,Gene
R4327 T6091 T6090 arg1Of Extender,Capacitance
R4328 T6091 T6092 arg1Of Extender,(
R4329 T6094 T6092 arg2Of kV,(
R4330 T6094 T6093 arg1Of kV,0.25
R4331 T6094 T6095 arg1Of kV,","
R4332 T6094 T6097 arg1Of kV,µFd
R4333 T6096 T6095 arg2Of 960,","
R4334 T6098 T6092 arg3Of ),(
R4335 T6101 T6088 arg2Of rol pla,with
R4336 T6101 T6089 arg1Of rol pla,a
R4337 T6101 T6091 arg1Of rol pla,Extender
R4338 T6101 T6099 arg1Of rol pla,. pG
R4339 T6101 T6100 arg1Of rol pla,L3 cont
R4340 T6101 T6102 arg1Of rol pla,smid
R4341 T6101 T6103 arg1Of rol pla,which e
R4342 T6106 T6103 arg2Of the SV40,which e
R4343 T6106 T6104 arg1Of the SV40,nco
R4344 T6106 T6105 arg1Of the SV40,des
R4345 T6108 T6109 arg1Of moter an,d e
R4346 T6108 T6110 arg2Of moter an,nhancer
R4347 T6110 T6107 arg2Of nhancer ,pro
R4348 T6110 T6109 arg2Of nhancer ,d e
R4349 T6110 T6111 arg1Of nhancer ,wa
R4350 T6110 T6120 arg1Of nhancer ,on
R4351 T6111 T6119 arg1Of wa,cti
R4352 T6114 T6111 arg2Of as a po,wa
R4353 T6114 T6112 arg1Of as a po,s
R4354 T6114 T6113 arg1Of as a po,included
R4355 T6114 T6115 arg1Of as a po,sit
R4356 T6117 T6115 arg2Of for transf,sit
R4357 T6117 T6116 arg1Of for transf,ive control
R4358 T6119 T6118 arg1Of cti,e
R4359 T6120 T6119 arg2Of on,cti
R4360 T6123 T6120 arg2Of ", and as",on
R4361 T6123 T6121 arg1Of ", and as",ef
R4362 T6123 T6122 arg1Of ", and as",ficiency
R4363 T6123 T6124 arg1Of ", and as",an
R4364 T6125 T6126 arg1Of internal,sta
R4365 T6127 T6126 arg2Of ndard fo,sta
R4366 T6128 T6124 arg2Of r promoter,an
R4367 T6128 T6125 arg1Of r promoter,internal
R4368 T6128 T6127 arg1Of r promoter,ndard fo
R4369 T6130 T6129 arg2Of cells,Transfected
R4370 T6130 T6131 arg1Of cells,were
R4371 T6130 T6132 arg2Of cells,transferred
R4372 T6132 T6131 arg2Of transferred,were
R4373 T6132 T6133 arg1Of transferred,to
R4374 T6132 T6160 arg1Of transferred,and
R4375 T6135 T6133 arg2Of ml,to
R4376 T6135 T6134 arg1Of ml,10
R4377 T6135 T6136 arg1Of ml,of
R4378 T6135 T6139 arg1Of ml,in
R4379 T6135 T6144 arg1Of ml,","
R4380 T6135 T6145 arg2Of ml,divided
R4381 T6138 T6136 arg2Of media,of
R4382 T6138 T6137 arg1Of media,pre-warmed
R4383 T6143 T6139 arg2Of plates,in
R4384 T6143 T6140 arg1Of plates,6-well
R4385 T6143 T6141 arg1Of plates,tissue
R4386 T6143 T6142 arg1Of plates,culture
R4387 T6145 T6146 arg1Of divided,into
R4388 T6145 T6155 arg1Of divided,in
R4389 T6150 T6147 arg1Of pools,two
R4390 T6150 T6148 arg1Of pools,identical
R4391 T6150 T6149 arg1Of pools,cell
R4392 T6150 T6151 arg1Of pools,and
R4393 T6151 T6146 arg2Of and,into
R4394 T6154 T6151 arg2Of hrs,and
R4395 T6154 T6152 arg2Of hrs,incubated
R4396 T6154 T6153 arg1Of hrs,16
R4397 T6157 T6158 arg1Of 5,%
R4398 T6159 T6155 arg2Of CO2,in
R4399 T6159 T6156 arg1Of CO2,a
R4400 T6159 T6157 arg1Of CO2,5
R4401 T6162 T6161 arg1Of %,95
R4402 T6162 T6163 arg1Of %,humidified
R4403 T6163 T6160 arg2Of humidified,and
R4404 T6163 T6166 arg1Of humidified,at
R4405 T6163 T6169 arg1Of humidified,in
R4406 T6165 T6163 arg2Of atmosphere,humidified
R4407 T6165 T6164 arg1Of atmosphere,air
R4408 T6167 T6166 arg2Of 37°C,at
R4409 T6169 T6168 arg1Of in,either
R4410 T6171 T6172 arg1Of presence,or
R4411 T6172 T6169 arg2Of or,in
R4412 T6172 T6170 arg1Of or,the
R4413 T6172 T6174 arg1Of or,of
R4414 T6173 T6172 arg2Of absence,or
R4415 T6175 T6176 arg1Of 100,ng/ml
R4416 T6177 T6174 arg2Of LPS,of
R4417 T6177 T6175 arg1Of LPS,100
R4418 T6179 T6178 arg1Of activity,Luciferase
R4419 T6179 T6180 arg1Of activity,was
R4420 T6179 T6181 arg2Of activity,measured
R4421 T6181 T6180 arg2Of measured,was
R4422 T6182 T6181 arg3Of using,measured
R4423 T6186 T6184 arg1Of Assay,Dual-Luciferase
R4424 T6186 T6185 arg1Of Assay,Reporter
R4425 T6188 T6182 arg2Of kit,using
R4426 T6188 T6183 arg1Of kit,a
R4427 T6188 T6186 arg1Of kit,Assay
R4428 T6188 T6187 arg1Of kit,System
R4429 T6188 T6189 arg1Of kit,(
R4430 T6190 T6189 arg2Of Promega,(
R4431 T6191 T6189 arg3Of ),(
R4432 T6192 T6193 arg1Of Measurements,represent
R4433 T6195 T6193 arg2Of results,represent
R4434 T6195 T6194 arg1Of results,the
R4435 T6195 T6196 arg1Of results,of
R4436 T6199 T6197 arg1Of three,at
R4437 T6199 T6198 arg1Of three,least
R4438 T6201 T6196 arg2Of experiments,of
R4439 T6201 T6199 arg1Of experiments,three
R4440 T6201 T6200 arg1Of experiments,independent
R4441 T6203 T6202 arg1Of activity,Promoter
R4442 T6203 T6204 arg1Of activity,is
R4443 T6203 T6205 arg2Of activity,expressed
R4444 T6205 T6204 arg2Of expressed,is
R4445 T6205 T6206 arg1Of expressed,as
R4446 T6205 T6223 arg1Of expressed,to
R4447 T6206 T6222 arg1Of as,or
R4448 T6208 T6206 arg2Of number,as
R4449 T6208 T6207 arg1Of number,the
R4450 T6208 T6209 arg1Of number,of
R4451 T6213 T6209 arg2Of units,of
R4452 T6213 T6210 arg1Of units,firefly
R4453 T6213 T6211 arg1Of units,luciferase
R4454 T6213 T6212 arg1Of units,light
R4455 T6213 T6214 arg2Of units,normalized
R4456 T6214 T6216 arg1Of normalized,to
R4457 T6216 T6215 arg1Of to,either
R4458 T6221 T6216 arg2Of units,to
R4459 T6221 T6217 arg1Of units,pRL-TK
R4460 T6221 T6218 arg1Of units,renilla
R4461 T6221 T6219 arg1Of units,luciferase
R4462 T6221 T6220 arg1Of units,light
R4463 T6223 T6222 arg2Of to,or
R4464 T6226 T6223 arg2Of concentration,to
R4465 T6226 T6224 arg1Of concentration,cellular
R4466 T6226 T6225 arg1Of concentration,protein
R4467 T6226 T6227 arg1Of concentration,(
R4468 T6228 T6227 arg2Of where,(
R4469 T6230 T6231 arg1Of C/EBP-β,or
R4470 T6231 T6229 arg2Of or,co-transfected
R4471 T6231 T6233 arg1Of or,affected
R4472 T6232 T6231 arg2Of LPS,or
R4473 T6233 T6228 arg1Of affected,where
R4474 T6235 T6233 arg2Of activity,affected
R4475 T6235 T6234 arg1Of activity,pRL-TK
R4476 T6236 T6227 arg3Of ),(
R4477 T6238 T6237 arg1Of concentration,Protein
R4478 T6238 T6239 arg1Of concentration,was
R4479 T6238 T6240 arg2Of concentration,determined
R4480 T6240 T6239 arg2Of determined,was
R4481 T6241 T6240 arg3Of using,determined
R4482 T6246 T6241 arg2Of reagent,using
R4483 T6246 T6242 arg1Of reagent,the
R4484 T6246 T6243 arg1Of reagent,Bio-Rad
R4485 T6246 T6244 arg1Of reagent,protein
R4486 T6246 T6245 arg1Of reagent,microassay
R4745 T6666 T6665 arg1Of shRNAs,Lentiviral
R4746 T6666 T6667 arg1Of shRNAs,","
R4747 T6668 T6669 arg1Of Packaging,and
R4748 T6669 T6667 arg2Of and,","
R4749 T6670 T6669 arg2Of Transduction,and
R4750 T6673 T6671 arg1Of vectors,pLKO.1-puro
R4751 T6673 T6672 arg1Of vectors,lentiviral
R4752 T6673 T6674 arg1Of vectors,carrying
R4753 T6673 T6687 arg1Of vectors,were
R4754 T6673 T6688 arg2Of vectors,used
R4755 T6677 T6674 arg2Of RNAs,carrying
R4756 T6677 T6675 arg1Of RNAs,short
R4757 T6677 T6676 arg1Of RNAs,hairpin
R4758 T6677 T6678 arg1Of RNAs,(
R4759 T6677 T6681 arg1Of RNAs,specific
R4760 T6679 T6678 arg2Of shRNA,(
R4761 T6680 T6678 arg3Of ),(
R4762 T6681 T6682 arg1Of specific,for
R4763 T6686 T6682 arg2Of cebpb,for
R4764 T6686 T6683 arg1Of cebpb,human
R4765 T6686 T6684 arg1Of cebpb,and
R4766 T6686 T6685 arg1Of cebpb,mouse
R4767 T6688 T6687 arg2Of used,were
R4768 T6688 T6689 arg1Of used,in
R4769 T6691 T6689 arg2Of studies,in
R4770 T6691 T6690 arg1Of studies,these
R4771 T6700 T6693 arg1Of regions,the
R4772 T6700 T6694 arg1Of regions,human
R4773 T6700 T6695 arg1Of regions,and
R4774 T6700 T6696 arg1Of regions,mouse
R4775 T6700 T6697 arg1Of regions,cebpb
R4776 T6700 T6698 arg1Of regions,3′
R4777 T6700 T6699 arg1Of regions,untranslated
R4778 T6700 T6701 arg1Of regions,are
R4779 T6700 T6703 arg1Of regions,identical
R4780 T6701 T6692 arg2Of are,Because
R4781 T6701 T6702 arg1Of are,not
R4782 T6703 T6701 arg2Of identical,are
R4783 T6707 T6705 arg1Of shRNAs,these
R4784 T6707 T6706 arg1Of shRNAs,species-specific
R4785 T6707 T6708 arg1Of shRNAs,can
R4786 T6707 T6710 arg1Of shRNAs,knockdown
R4787 T6707 T6716 arg1Of shRNAs,used
R4788 T6710 T6692 arg1Of knockdown,Because
R4789 T6710 T6704 arg1Of knockdown,","
R4790 T6710 T6708 arg2Of knockdown,can
R4791 T6710 T6709 arg1Of knockdown,not
R4792 T6710 T6715 arg1Of knockdown,when
R4793 T6710 T6723 arg1Of knockdown,;
R4794 T6711 T6710 arg2Of expression,knockdown
R4795 T6711 T6712 arg1Of expression,of
R4796 T6714 T6712 arg2Of C/EBP-β,of
R4797 T6714 T6713 arg1Of C/EBP-β,endogenous
R4798 T6716 T6715 arg2Of used,when
R4799 T6716 T6717 arg1Of used,on
R4800 T6718 T6717 arg2Of cells,on
R4801 T6718 T6719 arg1Of cells,of
R4802 T6722 T6719 arg2Of species,of
R4803 T6722 T6720 arg1Of species,the
R4804 T6722 T6721 arg1Of species,other
R4805 T6725 T6726 arg1Of we,used
R4806 T6726 T6723 arg2Of used,;
R4807 T6726 T6724 arg1Of used,therefore
R4808 T6726 T6731 arg1Of used,as
R4809 T6730 T6726 arg2Of shRNA,used
R4810 T6730 T6727 arg1Of shRNA,the
R4811 T6730 T6728 arg1Of shRNA,human
R4812 T6730 T6729 arg1Of shRNA,CEBPB
R4813 T6733 T6731 arg2Of control,as
R4814 T6733 T6732 arg1Of control,a
R4815 T6733 T6734 arg1Of control,in
R4816 T6736 T6734 arg2Of experiments,in
R4817 T6736 T6735 arg1Of experiments,these
R4818 T6736 T6737 arg1Of experiments,as
R4819 T6737 T6738 arg1Of as,in
R4820 T6740 T6738 arg2Of 38,in
R4821 T6740 T6739 arg2Of 38,[
R4822 T6741 T6739 arg3Of ],[
R4823 T6743 T6742 arg1Of produce,To
R4824 T6745 T6743 arg2Of particles,produce
R4825 T6745 T6744 arg1Of particles,lentiviral
R4826 T6748 T6743 arg1Of cells,produce
R4827 T6748 T6747 arg1Of cells,HEK-293T
R4828 T6748 T6749 arg1Of cells,were
R4829 T6748 T6750 arg2Of cells,transfected
R4830 T6748 T6782 arg1Of cells,using
R4831 T6750 T6742 modOf transfected,To
R4832 T6750 T6746 arg1Of transfected,","
R4833 T6750 T6749 arg2Of transfected,were
R4834 T6750 T6751 arg1Of transfected,with
R4835 T6750 T6782 modOf transfected,using
R4836 T6753 T6751 arg2Of mixture,with
R4837 T6753 T6752 arg1Of mixture,a
R4838 T6753 T6754 arg1Of mixture,of
R4839 T6753 T6756 arg1Of mixture,:
R4840 T6755 T6754 arg2Of plasmids,of
R4841 T6760 T6758 arg1Of plasmid,shRNA
R4842 T6760 T6759 arg1Of plasmid,expression
R4843 T6760 T6761 arg1Of plasmid,(
R4844 T6760 T6765 arg1Of plasmid,","
R4845 T6763 T6761 arg2Of µg,(
R4846 T6763 T6762 arg1Of µg,1
R4847 T6764 T6761 arg3Of ),(
R4848 T6765 T6774 arg1Of ",",and
R4849 T6768 T6765 arg2Of plasmid,","
R4850 T6768 T6766 arg1Of plasmid,pCMV-ΔR8.2dvpr
R4851 T6768 T6767 arg1Of plasmid,packaging
R4852 T6768 T6769 arg1Of plasmid,(
R4853 T6771 T6769 arg2Of µg,(
R4854 T6771 T6770 arg1Of µg,0.75
R4855 T6772 T6769 arg3Of ),(
R4856 T6774 T6756 arg2Of and,:
R4857 T6774 T6757 arg1Of and,each
R4858 T6774 T6773 arg1Of and,","
R4859 T6777 T6774 arg2Of plasmid,and
R4860 T6777 T6775 arg1Of plasmid,pCMV-VSV-G
R4861 T6777 T6776 arg1Of plasmid,envelope
R4862 T6777 T6778 arg1Of plasmid,(
R4863 T6780 T6778 arg2Of µg,(
R4864 T6780 T6779 arg1Of µg,0.25
R4865 T6781 T6778 arg3Of ),(
R4866 T6785 T6782 arg2Of reagent,using
R4867 T6785 T6783 arg1Of reagent,Lipofectamine
R4868 T6785 T6784 arg1Of reagent,2000
R4869 T6785 T6786 arg1Of reagent,(
R4870 T6787 T6786 arg2Of Invitrogen,(
R4871 T6788 T6786 arg3Of ),(
R4872 T6791 T6789 arg1Of supernatant,The
R4873 T6791 T6790 arg1Of supernatant,lentiviral
R4874 T6791 T6792 arg1Of supernatant,was
R4875 T6795 T6792 arg2Of hrs,was
R4876 T6795 T6793 arg2Of hrs,collected
R4877 T6795 T6794 arg1Of hrs,48
R4878 T6795 T6796 arg1Of hrs,after
R4879 T6795 T6798 arg1Of hrs,","
R4880 T6795 T6799 arg2Of hrs,cleared
R4881 T6795 T6809 arg2Of hrs,passed
R4882 T6797 T6796 arg2Of transfection,after
R4883 T6799 T6802 arg1Of cleared,at
R4884 T6799 T6808 arg1Of cleared,and
R4885 T6801 T6799 arg1Of centrifugation,cleared
R4886 T6801 T6800 arg2Of centrifugation,by
R4887 T6804 T6802 arg2Of g,at
R4888 T6804 T6803 arg1Of g,"2,000"
R4889 T6804 T6805 arg1Of g,for
R4890 T6807 T6805 arg2Of mins,for
R4891 T6807 T6806 arg1Of mins,10
R4892 T6809 T6808 arg2Of passed,and
R4893 T6809 T6810 arg1Of passed,through
R4894 T6812 T6813 arg1Of 0.45,µm
R4895 T6814 T6810 arg2Of filter,through
R4896 T6814 T6811 arg1Of filter,a
R4897 T6814 T6812 arg1Of filter,0.45
R4898 T6817 T6815 arg1Of cells,The
R4899 T6817 T6816 arg1Of cells,target
R4900 T6817 T6818 arg1Of cells,were
R4901 T6817 T6819 arg2Of cells,treated
R4902 T6819 T6818 arg2Of treated,were
R4903 T6819 T6820 arg1Of treated,with
R4904 T6823 T6824 arg1Of supernatant,and
R4905 T6825 T6824 arg2Of 8,and
R4906 T6827 T6820 arg2Of Polybrene,with
R4907 T6827 T6821 arg1Of Polybrene,the
R4908 T6827 T6822 arg1Of Polybrene,lentiviral
R4909 T6827 T6823 arg1Of Polybrene,supernatant
R4910 T6827 T6825 arg1Of Polybrene,8
R4911 T6827 T6826 arg1Of Polybrene,µg/ml
R4912 T6827 T6828 arg1Of Polybrene,(
R4913 T6827 T6832 arg1Of Polybrene,for
R4914 T6830 T6828 arg2Of Bioanalytical,(
R4915 T6830 T6829 arg1Of Bioanalytical,American
R4916 T6831 T6828 arg3Of ),(
R4917 T6834 T6832 arg2Of hrs,for
R4918 T6834 T6833 arg1Of hrs,24
R4919 T6837 T6835 arg1Of supernatant,The
R4920 T6837 T6836 arg1Of supernatant,lentiviral
R4921 T6837 T6838 arg1Of supernatant,was
R4922 T6837 T6839 arg2Of supernatant,replaced
R4923 T6837 T6845 arg2Of supernatant,incubated
R4924 T6837 T6851 arg1Of supernatant,allow
R4925 T6839 T6840 arg1Of replaced,with
R4926 T6839 T6844 arg1Of replaced,and
R4927 T6843 T6840 arg2Of media,with
R4928 T6843 T6841 arg1Of media,fresh
R4929 T6843 T6842 arg1Of media,growth
R4930 T6844 T6838 arg2Of and,was
R4931 T6845 T6844 arg2Of incubated,and
R4932 T6845 T6846 arg1Of incubated,further
R4933 T6845 T6847 arg1Of incubated,for
R4934 T6845 T6850 modOf incubated,to
R4935 T6849 T6847 arg2Of hrs,for
R4936 T6849 T6848 arg1Of hrs,72
R4937 T6851 T6850 arg1Of allow,to
R4938 T6851 T6852 arg1Of allow,for
R4939 T6855 T6852 arg2Of knockdown,for
R4940 T6855 T6853 arg1Of knockdown,effective
R4941 T6855 T6854 arg1Of knockdown,gene
R4942 T6857 T6856 arg1Of knockdown,C/EBP-β
R4943 T6857 T6858 arg1Of knockdown,was
R4944 T6857 T6859 arg2Of knockdown,confirmed
R4945 T6859 T6858 arg2Of confirmed,was
R4946 T6863 T6859 arg1Of analysis,confirmed
R4947 T6863 T6860 arg2Of analysis,by
R4948 T6863 T6861 arg1Of analysis,western
R4949 T6863 T6862 arg1Of analysis,blot
R5191 T7275 T7276 arg1Of Transfection,and
R5192 T7277 T7276 arg2Of Luciferase,and
R5193 T7278 T7274 arg1Of Assays,Transient
R5194 T7278 T7275 arg1Of Assays,Transfection
R5195 T7278 T7277 arg1Of Assays,Luciferase
R5196 T7278 T7279 arg1Of Assays,(
R5197 T7281 T7279 arg2Of Cells,(
R5198 T7281 T7280 arg1Of Cells,MEF
R5199 T7282 T7279 arg3Of ),(
R5200 T7284 T7283 arg1Of MEFs,Cebpb −/−
R5201 T7284 T7285 arg1Of MEFs,(
R5202 T7284 T7288 arg1Of MEFs,[
R5203 T7284 T7291 arg1Of MEFs,were
R5204 T7284 T7292 arg2Of MEFs,transfected
R5205 T7286 T7285 arg2Of 1×105,(
R5206 T7287 T7285 arg3Of ),(
R5207 T7289 T7288 arg2Of 34,[
R5208 T7290 T7288 arg3Of ],[
R5209 T7292 T7291 arg2Of transfected,were
R5210 T7292 T7293 arg1Of transfected,with
R5211 T7298 T7293 arg2Of plasmid,with
R5212 T7298 T7294 arg1Of plasmid,the
R5213 T7298 T7295 arg2Of plasmid,indicated
R5214 T7298 T7296 arg1Of plasmid,luciferase
R5215 T7298 T7297 arg1Of plasmid,reporter
R5216 T7298 T7299 arg1Of plasmid,(
R5217 T7298 T7303 arg1Of plasmid,along
R5218 T7298 T7315 arg1Of plasmid,using
R5219 T7298 T7320 arg1Of plasmid,(
R5220 T7301 T7299 arg2Of ng,(
R5221 T7301 T7300 arg1Of ng,400
R5222 T7302 T7299 arg3Of ),(
R5223 T7303 T7304 arg1Of along,with
R5224 T7308 T7304 arg2Of plasmid,with
R5225 T7308 T7305 arg1Of plasmid,a
R5226 T7308 T7306 arg1Of plasmid,β-actin-β-galactosidase
R5227 T7308 T7307 arg1Of plasmid,reporter
R5228 T7308 T7309 arg1Of plasmid,(
R5229 T7308 T7313 arg1Of plasmid,by
R5230 T7311 T7309 arg2Of ng,(
R5231 T7311 T7310 arg1Of ng,200
R5232 T7312 T7309 arg3Of ),(
R5233 T7314 T7313 arg2Of electroporation,by
R5234 T7318 T7317 arg1Of Neon™,Invitrogen
R5235 T7319 T7315 arg2Of system,using
R5236 T7319 T7316 arg1Of system,the
R5237 T7319 T7318 arg1Of system,Neon™
R5238 T7322 T7320 arg2Of pulse,(
R5239 T7322 T7321 arg1Of pulse,1
R5240 T7322 T7323 arg1Of pulse,","
R5241 T7322 T7326 arg1Of pulse,","
R5242 T7325 T7323 arg2Of V,","
R5243 T7325 T7324 arg1Of V,1350
R5244 T7328 T7326 arg2Of msec,","
R5245 T7328 T7327 arg1Of msec,30
R5246 T7329 T7320 arg3Of ),(
R5247 T7331 T7330 arg2Of cells,Transfected
R5248 T7331 T7332 arg1Of cells,were
R5249 T7331 T7333 arg2Of cells,transferred
R5250 T7331 T7342 arg2Of cells,incubated
R5251 T7333 T7334 arg1Of transferred,to
R5252 T7333 T7341 arg1Of transferred,and
R5253 T7336 T7334 arg2Of media,to
R5254 T7336 T7335 arg1Of media,pre-warmed
R5255 T7336 T7337 arg1Of media,in
R5256 T7340 T7337 arg2Of plates,in
R5257 T7340 T7338 arg1Of plates,24
R5258 T7340 T7339 arg1Of plates,well
R5259 T7341 T7332 arg2Of and,were
R5260 T7341 T7355 arg1Of and,for
R5261 T7342 T7341 arg2Of incubated,and
R5262 T7342 T7343 arg1Of incubated,for
R5263 T7345 T7343 arg2Of hrs,for
R5264 T7345 T7344 arg1Of hrs,48
R5265 T7345 T7349 arg1Of hrs,with
R5266 T7346 T7347 arg1Of prior,to
R5267 T7348 T7347 arg2Of incubation,to
R5268 T7349 T7346 arg1Of with,prior
R5269 T7350 T7349 arg2Of LPS,with
R5270 T7350 T7351 arg1Of LPS,(
R5271 T7353 T7351 arg2Of ng/ml,(
R5272 T7353 T7352 arg1Of ng/ml,100
R5273 T7354 T7351 arg3Of ),(
R5274 T7357 T7355 arg2Of hrs,for
R5275 T7357 T7356 arg1Of hrs,4
R5276 T7357 T7359 arg2Of hrs,indicated
R5277 T7359 T7358 arg1Of indicated,where
R5278 T7362 T7360 arg2Of experiments,In
R5279 T7362 T7361 arg1Of experiments,some
R5280 T7364 T7365 arg1Of plasmids,encoding
R5281 T7364 T7381 arg1Of plasmids,–
R5282 T7364 T7382 arg1Of plasmids,[
R5283 T7364 T7385 arg1Of plasmids,or
R5284 T7365 T7378 arg1Of encoding,[
R5285 T7370 T7365 arg2Of mutants,encoding
R5286 T7370 T7366 arg1Of mutants,C/EBP-β
R5287 T7370 T7367 arg1Of mutants,or
R5288 T7370 T7368 arg1Of mutants,C/EBP-β
R5289 T7370 T7369 arg1Of mutants,phospho-acceptor
R5290 T7370 T7371 arg1Of mutants,(
R5291 T7372 T7371 arg2Of T188A,(
R5292 T7372 T7373 arg1Of T188A,","
R5293 T7372 T7375 arg1Of T188A,","
R5294 T7374 T7373 arg2Of T217A,","
R5295 T7376 T7375 arg2Of S64A,","
R5296 T7377 T7371 arg3Of ),(
R5297 T7379 T7378 arg2Of 38,[
R5298 T7380 T7378 arg3Of ],[
R5299 T7383 T7382 arg2Of 40,[
R5300 T7384 T7382 arg3Of ],[
R5301 T7385 T7388 arg1Of or,were
R5302 T7385 T7389 arg2Of or,co-transfected
R5303 T7387 T7385 arg2Of vector,or
R5304 T7387 T7386 arg1Of vector,control
R5305 T7389 T7360 arg1Of co-transfected,In
R5306 T7389 T7363 arg1Of co-transfected,","
R5307 T7389 T7388 arg2Of co-transfected,were
R5308 T7389 T7390 arg1Of co-transfected,(
R5309 T7394 T7390 arg2Of DNA,(
R5310 T7394 T7391 arg1Of DNA,0.6–1.0
R5311 T7394 T7392 arg1Of DNA,µg
R5312 T7394 T7393 arg1Of DNA,total
R5313 T7395 T7390 arg3Of ),(
R5314 T7397 T7396 arg1Of activity,Luciferase
R5315 T7397 T7398 arg1Of activity,was
R5316 T7397 T7399 arg2Of activity,determined
R5317 T7397 T7401 arg2Of activity,normalized
R5318 T7397 T7409 arg1Of activity,using
R5319 T7399 T7400 arg1Of determined,and
R5320 T7400 T7398 arg2Of and,was
R5321 T7400 T7420 arg1Of and,","
R5322 T7400 T7421 arg1Of and,respectively
R5323 T7400 T7422 arg1Of and,(
R5324 T7401 T7400 arg2Of normalized,and
R5325 T7401 T7402 arg1Of normalized,to
R5326 T7401 T7406 arg1Of normalized,[
R5327 T7401 T7409 modOf normalized,using
R5328 T7403 T7402 arg2Of that,to
R5329 T7403 T7404 arg1Of that,of
R5330 T7405 T7404 arg2Of β-galactosidase,of
R5331 T7407 T7406 arg2Of 38,[
R5332 T7408 T7406 arg3Of ],[
R5333 T7413 T7410 arg1Of System,the
R5334 T7413 T7411 arg1Of System,Luciferase
R5335 T7413 T7412 arg1Of System,Assay
R5336 T7413 T7414 arg1Of System,and
R5337 T7414 T7409 arg2Of and,using
R5338 T7419 T7414 arg2Of Kits,and
R5339 T7419 T7415 arg1Of Kits,β-Galactosidase
R5340 T7419 T7416 arg1Of Kits,Enzyme
R5341 T7419 T7417 arg1Of Kits,Assay
R5342 T7419 T7418 arg1Of Kits,System
R5343 T7423 T7422 arg2Of Promega,(
R5344 T7424 T7422 arg3Of ),(
R5345 T7426 T7425 arg1Of experiment,Each
R5346 T7426 T7427 arg1Of experiment,was
R5347 T7426 T7428 arg2Of experiment,repeated
R5348 T7428 T7427 arg2Of repeated,was
R5349 T7428 T7432 arg1Of repeated,times
R5350 T7428 T7434 arg1Of repeated,and
R5351 T7431 T7429 arg1Of three,at
R5352 T7431 T7430 arg1Of three,least
R5353 T7432 T7431 arg1Of times,three
R5354 T7434 T7433 arg1Of and,","
R5355 T7436 T7435 arg1Of samples,triplicate
R5356 T7436 T7437 arg1Of samples,were
R5357 T7436 T7438 arg2Of samples,employed
R5358 T7438 T7434 arg2Of employed,and
R5359 T7438 T7437 arg2Of employed,were
R5360 T7438 T7439 arg1Of employed,for
R5361 T7441 T7439 arg2Of sample,for
R5362 T7441 T7440 arg1Of sample,each
R5363 T7442 T7443 arg1Of Expression,of
R5364 T7442 T7449 arg1Of Expression,was
R5365 T7442 T7450 arg2Of Expression,checked
R5366 T7448 T7443 arg2Of proteins,of
R5367 T7448 T7444 arg1Of proteins,the
R5368 T7448 T7445 arg1Of proteins,C/EBP-β
R5369 T7448 T7446 arg1Of proteins,phospho-acceptor
R5370 T7448 T7447 arg1Of proteins,mutant
R5371 T7450 T7449 arg2Of checked,was
R5372 T7450 T7451 arg1Of checked,for
R5373 T7453 T7451 arg2Of expression,for
R5374 T7453 T7452 arg1Of expression,equal
R5375 T7456 T7450 arg1Of blot,checked
R5376 T7456 T7454 arg2Of blot,by
R5377 T7456 T7455 arg1Of blot,western
R5604 T7838 T7835 arg1Of Assays,Electrophoretic
R5605 T7838 T7836 arg1Of Assays,Mobility
R5606 T7838 T7837 arg1Of Assays,Shift
R5607 T7843 T7839 arg1Of probes,Radiolabelled
R5608 T7843 T7841 arg1Of probes,double-stranded
R5609 T7843 T7842 arg1Of probes,oligonucleotide
R5610 T7843 T7844 arg1Of probes,for
R5611 T7843 T7848 arg1Of probes,were
R5612 T7843 T7849 arg2Of probes,prepared
R5613 T7847 T7844 arg2Of assays,for
R5614 T7847 T7845 arg1Of assays,gel
R5615 T7847 T7846 arg1Of assays,shift
R5616 T7849 T7839 modOf prepared,Radiolabelled
R5617 T7849 T7840 arg1Of prepared,","
R5618 T7849 T7848 arg2Of prepared,were
R5619 T7849 T7850 modOf prepared,using
R5620 T7853 T7851 arg1Of kinase,T4
R5621 T7853 T7852 arg1Of kinase,polynucleotide
R5622 T7853 T7854 arg1Of kinase,and
R5623 T7854 T7850 arg2Of and,using
R5624 T7856 T7855 arg2Of γ-32P,[
R5625 T7857 T7855 arg3Of ],[
R5626 T7858 T7854 arg2Of -ATP,and
R5627 T7858 T7855 arg1Of -ATP,[
R5628 T7862 T7859 arg1Of extracts,RAW
R5629 T7862 T7860 arg1Of extracts,264.7
R5630 T7862 T7861 arg1Of extracts,nuclear
R5631 T7862 T7863 arg1Of extracts,were
R5632 T7862 T7864 arg2Of extracts,prepared
R5633 T7864 T7863 arg2Of prepared,were
R5634 T7864 T7870 arg1Of prepared,[
R5635 T7869 T7864 arg1Of method,prepared
R5636 T7869 T7865 arg2Of method,by
R5637 T7869 T7866 arg1Of method,the
R5638 T7869 T7867 arg1Of method,detergent
R5639 T7869 T7868 arg1Of method,lysis
R5640 T7871 T7870 arg2Of 41,[
R5641 T7872 T7870 arg3Of ],[
R5642 T7875 T7873 arg1Of reactions,DNA
R5643 T7875 T7874 arg1Of reactions,binding
R5644 T7875 T7876 arg1Of reactions,(
R5645 T7875 T7880 arg1Of reactions,containing
R5646 T7875 T7890 arg1Of reactions,","
R5647 T7875 T7909 arg1Of reactions,","
R5648 T7878 T7876 arg2Of µl,(
R5649 T7878 T7877 arg1Of µl,25
R5650 T7879 T7876 arg3Of ),(
R5651 T7881 T7882 arg1Of 10,mM
R5652 T7885 T7886 arg1Of 7.9,","
R5653 T7888 T7886 arg2Of µg/ml,","
R5654 T7888 T7887 arg1Of µg/ml,10
R5655 T7889 T7880 arg2Of BSA,containing
R5656 T7889 T7881 arg1Of BSA,10
R5657 T7889 T7883 arg1Of BSA,HEPES
R5658 T7889 T7884 arg1Of BSA,pH
R5659 T7889 T7885 arg1Of BSA,7.9
R5660 T7889 T7888 arg1Of BSA,µg/ml
R5661 T7891 T7892 arg1Of 2,mM
R5662 T7893 T7891 arg1Of DTT,2
R5663 T7893 T7894 arg1Of DTT,","
R5664 T7894 T7898 arg1Of ",",","
R5665 T7895 T7896 arg1Of 30,%
R5666 T7897 T7894 arg2Of glycerol,","
R5667 T7897 T7895 arg1Of glycerol,30
R5668 T7898 T7902 arg1Of ",",","
R5669 T7899 T7900 arg1Of 20,%
R5670 T7901 T7898 arg2Of Ficoll-400,","
R5671 T7901 T7899 arg1Of Ficoll-400,20
R5672 T7902 T7890 arg2Of ",",","
R5673 T7905 T7902 arg2Of poly,","
R5674 T7905 T7903 arg1Of poly,1
R5675 T7905 T7904 arg1Of poly,µg
R5676 T7905 T7906 arg1Of poly,(
R5677 T7907 T7906 arg2Of dI-dC,(
R5678 T7908 T7906 arg3Of ),(
R5679 T7909 T7929 arg1Of ",",were
R5680 T7909 T7930 arg2Of ",",performed
R5681 T7911 T7910 arg1Of µg,6
R5682 T7911 T7912 arg1Of µg,of
R5683 T7911 T7915 arg1Of µg,and
R5684 T7914 T7912 arg2Of extracts,of
R5685 T7914 T7913 arg1Of extracts,nuclear
R5686 T7915 T7909 arg2Of and,","
R5687 T7915 T7926 arg1Of and,of
R5688 T7916 T7917 arg1Of "10,000",to
R5689 T7918 T7917 arg2Of "20,000",to
R5690 T7919 T7915 arg2Of cpm,and
R5691 T7919 T7916 arg1Of cpm,"10,000"
R5692 T7919 T7920 arg1Of cpm,(
R5693 T7921 T7922 arg1Of 0.05,to
R5694 T7923 T7922 arg2Of 0.2,to
R5695 T7924 T7920 arg2Of ng,(
R5696 T7924 T7921 arg1Of ng,0.05
R5697 T7925 T7920 arg3Of ),(
R5698 T7928 T7926 arg2Of probe,of
R5699 T7928 T7927 arg2Of probe,radiolabelled
R5700 T7930 T7929 arg2Of performed,were
R5701 T7930 T7931 arg1Of performed,for
R5702 T7933 T7931 arg2Of minutes,for
R5703 T7933 T7932 arg1Of minutes,20
R5704 T7933 T7934 arg1Of minutes,at
R5705 T7936 T7934 arg2Of temperature,at
R5706 T7936 T7935 arg1Of temperature,room
R5707 T7939 T7937 arg1Of products,Binding
R5708 T7939 T7938 arg1Of products,reaction
R5709 T7939 T7940 arg1Of products,were
R5710 T7939 T7941 arg2Of products,resolved
R5711 T7941 T7940 arg2Of resolved,were
R5712 T7941 T7942 arg1Of resolved,by
R5713 T7943 T7942 arg2Of electrophoresis,by
R5714 T7943 T7944 arg1Of electrophoresis,at
R5715 T7946 T7944 arg2Of temperature,at
R5716 T7946 T7945 arg1Of temperature,room
R5717 T7946 T7947 arg1Of temperature,on
R5718 T7946 T7961 arg1Of temperature,in
R5719 T7948 T7949 arg1Of 5,%
R5720 T7951 T7947 arg2Of gels,on
R5721 T7951 T7948 arg1Of gels,5
R5722 T7951 T7950 arg1Of gels,polyacrylamide
R5723 T7951 T7952 arg1Of gels,(
R5724 T7954 T7953 arg1Of acrylamide,29∶1
R5725 T7954 T7955 arg1Of acrylamide,:
R5726 T7955 T7952 arg2Of :,(
R5727 T7956 T7955 arg2Of bis-acrylamide,:
R5728 T7956 T7957 arg1Of bis-acrylamide,(
R5729 T7958 T7957 arg2Of Bio-Rad,(
R5730 T7959 T7957 arg3Of ),(
R5731 T7960 T7952 arg3Of ),(
R5732 T7963 T7961 arg2Of TBE,in
R5733 T7963 T7962 arg1Of TBE,1x
R5734 T7963 T7964 arg1Of TBE,at
R5735 T7965 T7964 arg2Of 10V/cm,at
R5736 T7968 T7966 arg2Of assays,For
R5737 T7968 T7967 arg1Of assays,supershift
R5738 T7971 T7970 arg1Of extracts,nuclear
R5739 T7971 T7972 arg1Of extracts,were
R5740 T7972 T7966 arg1Of were,For
R5741 T7972 T7969 arg1Of were,","
R5742 T7974 T7973 arg1Of 2,pre-incubated
R5743 T7975 T7972 arg2Of hrs,were
R5744 T7975 T7974 arg1Of hrs,2
R5745 T7975 T7976 arg1Of hrs,on
R5746 T7977 T7976 arg2Of ice,on
R5747 T7977 T7978 arg1Of ice,with
R5748 T7980 T7978 arg2Of µg,with
R5749 T7980 T7979 arg1Of µg,4
R5750 T7980 T7981 arg1Of µg,of
R5751 T7984 T7981 arg2Of antibody,of
R5752 T7984 T7982 arg1Of antibody,specific
R5753 T7984 T7983 arg1Of antibody,C/EBP
R5754 T7985 T7986 arg1Of Antibodies,were
R5755 T7985 T7987 arg2Of Antibodies,purchased
R5756 T7987 T7986 arg2Of purchased,were
R5757 T7987 T7988 arg1Of purchased,from
R5758 T7990 T7988 arg2Of Cruz,from
R5759 T7990 T7989 arg1Of Cruz,Santa
R5760 T7990 T7991 arg1Of Cruz,:
R5761 T7992 T7993 arg1Of anti-C/EBP-α,(
R5762 T7992 T7996 arg1Of anti-C/EBP-α,","
R5763 T7994 T7993 arg2Of sc-61,(
R5764 T7995 T7993 arg3Of ),(
R5765 T7996 T8001 arg1Of ",",","
R5766 T7997 T7996 arg2Of anti-C/EBP-β,","
R5767 T7997 T7998 arg1Of anti-C/EBP-β,(
R5768 T7999 T7998 arg2Of sc-150,(
R5769 T8000 T7998 arg3Of ),(
R5770 T8001 T7991 arg2Of ",",:
R5771 T8002 T8003 arg1Of anti-C/EBP-δ,(
R5772 T8002 T8006 arg1Of anti-C/EBP-δ,and
R5773 T8004 T8003 arg2Of sc-151,(
R5774 T8005 T8003 arg3Of ),(
R5775 T8006 T8001 arg2Of and,","
R5776 T8007 T8006 arg2Of anti-C/EBP-ε,and
R5777 T8007 T8008 arg1Of anti-C/EBP-ε,(
R5778 T8009 T8008 arg2Of sc-158,(
R5779 T8010 T8008 arg3Of ),(
R5976 T8306 T8305 arg1Of Immunoprecipitation,Chromatin
R5977 T8306 T8307 arg1Of Immunoprecipitation,(
R5978 T8308 T8307 arg2Of ChIP,(
R5979 T8309 T8307 arg3Of ),(
R5980 T8310 T8306 arg1Of Assay,Immunoprecipitation
R5981 T8312 T8311 arg1Of assays,ChIP
R5982 T8312 T8313 arg1Of assays,were
R5983 T8312 T8314 arg2Of assays,performed
R5984 T8314 T8313 arg2Of performed,were
R5985 T8314 T8330 arg1Of performed,","
R5986 T8314 T8331 arg1Of performed,with
R5987 T8315 T8314 arg3Of using,performed
R5988 T8315 T8324 arg1Of using,","
R5989 T8315 T8325 arg1Of using,as
R5990 T8320 T8315 arg2Of kit,using
R5991 T8320 T8316 arg1Of kit,a
R5992 T8320 T8317 arg1Of kit,commercially
R5993 T8320 T8318 arg1Of kit,available
R5994 T8320 T8319 arg1Of kit,Magna-ChIP™
R5995 T8320 T8321 arg1Of kit,(
R5996 T8322 T8321 arg2Of Millipore,(
R5997 T8323 T8321 arg3Of ),(
R5998 T8326 T8325 arg2Of recommended,as
R5999 T8329 T8326 arg1Of manufacturer,recommended
R6000 T8329 T8327 arg2Of manufacturer,by
R6001 T8329 T8328 arg1Of manufacturer,the
R6002 T8333 T8331 arg2Of modifications,with
R6003 T8333 T8332 arg1Of modifications,minor
R6004 T8337 T8350 arg1Of crosslinking,and
R6005 T8339 T8337 arg2Of chromatin,crosslinking
R6006 T8339 T8338 arg1Of chromatin,the
R6007 T8339 T8340 arg1Of chromatin,with
R6008 T8339 T8347 arg1Of chromatin,for
R6009 T8341 T8342 arg1Of 1,%
R6010 T8343 T8340 arg2Of formaldehyde,with
R6011 T8343 T8341 arg1Of formaldehyde,1
R6012 T8343 T8344 arg1Of formaldehyde,at
R6013 T8346 T8344 arg2Of temperature,at
R6014 T8346 T8345 arg1Of temperature,room
R6015 T8349 T8347 arg2Of min,for
R6016 T8349 T8348 arg1Of min,10
R6017 T8350 T8336 arg2Of and,after
R6018 T8351 T8350 arg2Of neutralizing,and
R6019 T8351 T8352 arg1Of neutralizing,with
R6020 T8351 T8354 arg1Of neutralizing,for
R6021 T8353 T8352 arg2Of glycine,with
R6022 T8356 T8354 arg2Of min,for
R6023 T8356 T8355 arg1Of min,5
R6024 T8356 T8357 arg1Of min,at
R6025 T8359 T8357 arg2Of temperature,at
R6026 T8359 T8358 arg1Of temperature,room
R6027 T8361 T8337 arg1Of cells,crosslinking
R6028 T8361 T8351 arg1Of cells,neutralizing
R6029 T8361 T8362 arg1Of cells,were
R6030 T8361 T8363 arg2Of cells,washed
R6031 T8361 T8368 arg2Of cells,scraped
R6032 T8361 T8370 arg2Of cells,collected
R6033 T8363 T8364 arg1Of washed,with
R6034 T8363 T8367 arg1Of washed,","
R6035 T8366 T8364 arg2Of PBS,with
R6036 T8366 T8365 arg1Of PBS,cold
R6037 T8367 T8369 arg1Of ",",and
R6038 T8368 T8367 arg2Of scraped,","
R6039 T8369 T8334 arg1Of and,Briefly
R6040 T8369 T8335 arg1Of and,","
R6041 T8369 T8336 arg1Of and,after
R6042 T8369 T8360 arg1Of and,","
R6043 T8369 T8362 arg2Of and,were
R6044 T8370 T8369 arg2Of collected,and
R6045 T8370 T8371 arg1Of collected,on
R6046 T8372 T8371 arg2Of ice,on
R6047 T8374 T8373 arg1Of extracts,Cells
R6048 T8374 T8375 arg1Of extracts,were
R6049 T8374 T8376 arg2Of extracts,prepared
R6050 T8376 T8375 arg2Of prepared,were
R6051 T8376 T8377 modOf prepared,using
R6052 T8380 T8379 arg1Of available,commercially
R6053 T8381 T8377 arg2Of kit,using
R6054 T8381 T8378 arg1Of kit,a
R6055 T8381 T8380 arg1Of kit,available
R6056 T8381 T8382 arg1Of kit,(
R6057 T8383 T8382 arg2Of Millipore,(
R6058 T8384 T8382 arg3Of ),(
R6059 T8386 T8385 arg1Of lysates,Nuclear
R6060 T8386 T8387 arg1Of lysates,were
R6061 T8386 T8388 arg2Of lysates,sonicated
R6062 T8388 T8387 arg2Of sonicated,were
R6063 T8388 T8390 arg1Of sonicated,times
R6064 T8388 T8391 arg1Of sonicated,for
R6065 T8388 T8394 arg1Of sonicated,with
R6066 T8390 T8389 arg1Of times,5
R6067 T8393 T8391 arg2Of sec,for
R6068 T8393 T8392 arg1Of sec,15
R6069 T8397 T8394 arg2Of intervals,with
R6070 T8397 T8395 arg1Of intervals,1
R6071 T8397 T8396 arg1Of intervals,min
R6072 T8397 T8398 arg1Of intervals,on
R6073 T8397 T8400 arg1Of intervals,using
R6074 T8399 T8398 arg2Of ice,on
R6075 T8403 T8400 arg2Of Dismembrator,using
R6076 T8403 T8401 arg1Of Dismembrator,a
R6077 T8403 T8402 arg1Of Dismembrator,Sonic
R6078 T8403 T8404 arg1Of Dismembrator,(
R6079 T8405 T8404 arg2Of Fisher,(
R6080 T8406 T8404 arg3Of ),(
R6081 T8409 T8407 arg1Of amount,An
R6082 T8409 T8408 arg1Of amount,equal
R6083 T8409 T8410 arg1Of amount,of
R6084 T8409 T8412 arg1Of amount,was
R6085 T8409 T8413 arg2Of amount,immunoprecipitated
R6086 T8411 T8410 arg2Of chromatin,of
R6087 T8413 T8412 arg2Of immunoprecipitated,was
R6088 T8413 T8414 arg1Of immunoprecipitated,at
R6089 T8413 T8417 arg1Of immunoprecipitated,with
R6090 T8415 T8414 arg2Of 4°C,at
R6091 T8417 T8416 arg1Of with,overnight
R6092 T8420 T8418 arg1Of 1,at
R6093 T8420 T8419 arg1Of 1,least
R6094 T8421 T8417 arg2Of µg,with
R6095 T8421 T8420 arg1Of µg,1
R6096 T8421 T8422 arg1Of µg,of
R6097 T8421 T8426 arg1Of µg,:
R6098 T8425 T8422 arg2Of antibodies,of
R6099 T8425 T8423 arg1Of antibodies,the
R6100 T8425 T8424 arg1Of antibodies,following
R6101 T8427 T8426 arg2Of C/EBP-β,:
R6102 T8427 T8428 arg1Of C/EBP-β,(
R6103 T8427 T8431 arg1Of C/EBP-β,","
R6104 T8427 T8439 arg1Of C/EBP-β,","
R6105 T8429 T8428 arg2Of sc-150X,(
R6106 T8430 T8428 arg3Of ),(
R6107 T8432 T8431 arg2Of p-C/EBP-β,","
R6108 T8432 T8433 arg1Of p-C/EBP-β,(
R6109 T8432 T8436 arg1Of p-C/EBP-β,(
R6110 T8434 T8433 arg2Of T217,(
R6111 T8435 T8433 arg3Of ),(
R6112 T8437 T8436 arg2Of sc-16993X,(
R6113 T8438 T8436 arg3Of ),(
R6114 T8442 T8440 arg1Of IgG,normal
R6115 T8442 T8441 arg1Of IgG,rabbit
R6116 T8442 T8443 arg1Of IgG,(
R6117 T8442 T8446 arg1Of IgG,(
R6118 T8442 T8451 arg1Of IgG,and
R6119 T8444 T8443 arg2Of sc-2027,(
R6120 T8445 T8443 arg3Of ),(
R6121 T8449 T8446 arg2Of Biotechnologies,(
R6122 T8449 T8447 arg1Of Biotechnologies,Santa
R6123 T8449 T8448 arg1Of Biotechnologies,Cruz
R6124 T8450 T8446 arg3Of ),(
R6125 T8451 T8439 arg2Of and,","
R6126 T8451 T8459 arg1Of and,(
R6127 T8453 T8451 arg2Of polymerase,and
R6128 T8453 T8452 arg1Of polymerase,RNA
R6129 T8453 T8454 arg1Of polymerase,II
R6130 T8453 T8455 arg1Of polymerase,(
R6131 T8456 T8455 arg2Of Clone,(
R6132 T8456 T8457 arg1Of Clone,CTD4H8
R6133 T8458 T8455 arg3Of ),(
R6134 T8460 T8459 arg2Of Millipore,(
R6135 T8461 T8459 arg3Of ),(
R6136 T8463 T8462 arg2Of products,Immunoprecipitated
R6137 T8463 T8464 arg1Of products,were
R6138 T8463 T8465 arg2Of products,collected
R6139 T8465 T8464 arg2Of collected,were
R6140 T8465 T8466 arg1Of collected,after
R6141 T8467 T8466 arg2Of incubation,after
R6142 T8467 T8468 arg1Of incubation,with
R6143 T8471 T8470 arg1Of coated,G
R6144 T8473 T8468 arg2Of beads,with
R6145 T8473 T8469 arg1Of beads,Protein
R6146 T8473 T8471 arg1Of beads,coated
R6147 T8473 T8472 arg1Of beads,magnetic
R6148 T8473 T8474 arg1Of beads,(
R6149 T8475 T8474 arg2Of Millipore,(
R6150 T8476 T8474 arg3Of ),(
R6151 T8478 T8477 arg1Of beads,The
R6152 T8478 T8479 arg1Of beads,were
R6153 T8478 T8480 arg2Of beads,washed
R6154 T8480 T8479 arg2Of washed,were
R6155 T8484 T8482 arg1Of chromatin,the
R6156 T8484 T8483 arg2Of chromatin,bound
R6157 T8484 T8485 arg1Of chromatin,was
R6158 T8484 T8486 arg2Of chromatin,eluted
R6159 T8486 T8479 modOf eluted,were
R6160 T8486 T8481 arg1Of eluted,","
R6161 T8486 T8485 arg2Of eluted,was
R6162 T8486 T8487 arg1Of eluted,in
R6163 T8486 T8494 arg1Of eluted,and
R6164 T8490 T8487 arg2Of Buffer,in
R6165 T8490 T8488 arg1Of Buffer,ChIP
R6166 T8490 T8489 arg1Of Buffer,Elution
R6167 T8490 T8491 arg1Of Buffer,(
R6168 T8492 T8491 arg2Of Millipore,(
R6169 T8493 T8491 arg3Of ),(
R6170 T8496 T8495 arg1Of proteins,the
R6171 T8496 T8497 arg1Of proteins,were
R6172 T8496 T8498 arg2Of proteins,digested
R6173 T8498 T8497 arg2Of digested,were
R6174 T8498 T8499 arg1Of digested,with
R6175 T8501 T8499 arg2Of K,with
R6176 T8501 T8500 arg1Of K,Proteinase
R6177 T8501 T8502 arg1Of K,for
R6178 T8501 T8505 arg1Of K,at
R6179 T8504 T8502 arg2Of hrs,for
R6180 T8504 T8503 arg1Of hrs,2
R6181 T8506 T8505 arg2Of 62°C.,at
R6182 T8508 T8507 arg1Of DNA,The
R6183 T8508 T8509 arg1Of DNA,was
R6184 T8508 T8511 arg2Of DNA,purified
R6185 T8511 T8494 arg2Of purified,and
R6186 T8511 T8497 modOf purified,were
R6187 T8511 T8509 arg2Of purified,was
R6188 T8511 T8510 arg1Of purified,then
R6189 T8511 T8512 modOf purified,using
R6190 T8517 T8512 arg2Of Kit,using
R6191 T8517 T8513 arg1Of Kit,the
R6192 T8517 T8514 arg1Of Kit,QIAquick
R6193 T8517 T8515 arg1Of Kit,PCR
R6194 T8517 T8516 arg1Of Kit,Purification
R6195 T8517 T8518 arg1Of Kit,(
R6196 T8519 T8518 arg2Of Qiagen,(
R6197 T8520 T8518 arg3Of ),(
R6198 T8521 T8522 arg1Of DNA,was
R6199 T8521 T8523 arg2Of DNA,amplified
R6200 T8521 T8530 arg1Of DNA,using
R6201 T8523 T8522 arg2Of amplified,was
R6202 T8523 T8524 arg1Of amplified,by
R6203 T8523 T8528 arg1Of amplified,by
R6204 T8523 T8530 modOf amplified,using
R6205 T8524 T8527 arg1Of by,or
R6206 T8526 T8524 arg2Of PCR,by
R6207 T8526 T8525 arg1Of PCR,semi-quantitative
R6208 T8528 T8527 arg2Of by,or
R6209 T8529 T8528 arg2Of qPCR,by
R6210 T8534 T8535 arg1Of method,and
R6211 T8535 T8530 arg2Of and,using
R6212 T8535 T8531 arg1Of and,the
R6213 T8535 T8532 arg1Of and,SYBR
R6214 T8535 T8533 arg1Of and,green
R6215 T8535 T8537 arg1Of and,specific
R6216 T8535 T8543 arg1Of and,:
R6217 T8535 T8549 arg1Of and,;
R6218 T8536 T8535 arg2Of primers,and
R6219 T8537 T8538 arg1Of specific,for
R6220 T8542 T8538 arg2Of promoter,for
R6221 T8542 T8539 arg1Of promoter,the
R6222 T8542 T8540 arg1Of promoter,SerpinB2
R6223 T8542 T8541 arg1Of promoter,proximal
R6224 T8544 T8545 arg1Of forward,(
R6225 T8546 T8545 arg2Of −338/−315,(
R6226 T8547 T8545 arg3Of ),(
R6227 T8548 T8543 arg2Of 5′AAGACTCCCACAGATGGTGGCTGT3’,:
R6228 T8548 T8544 arg1Of 5′AAGACTCCCACAGATGGTGGCTGT3’,forward
R6229 T8550 T8551 arg1Of reverse,(
R6230 T8552 T8551 arg2Of −5/+19,(
R6231 T8553 T8551 arg3Of ),(
R6232 T8554 T8549 arg2Of 5′TTCTTGGAAAGCTGGCACTGTGTG3’,;
R6233 T8554 T8550 arg1Of 5′TTCTTGGAAAGCTGGCACTGTGTG3’,reverse
R6517 T8906 T8905 arg1Of Analysis,Statistical
R6518 T8907 T8908 arg1Of Data,are
R6519 T8907 T8909 arg2Of Data,presented
R6520 T8909 T8908 arg2Of presented,are
R6521 T8909 T8910 arg1Of presented,as
R6522 T8913 T8910 arg2Of SEM,as
R6523 T8913 T8911 arg1Of SEM,mean
R6524 T8913 T8912 arg1Of SEM,±
R6525 T8913 T8914 arg1Of SEM,per
R6526 T8915 T8914 arg2Of group,per
R6527 T8916 T8917 arg1Of Results,were
R6528 T8916 T8918 arg2Of Results,analyzed
R6529 T8918 T8917 arg2Of analyzed,were
R6530 T8919 T8918 arg3Of using,analyzed
R6531 T8921 T8919 arg2Of analysis,using
R6532 T8921 T8920 arg1Of analysis,the
R6533 T8921 T8922 arg1Of analysis,of
R6534 T8923 T8924 arg1Of variance,(
R6535 T8923 T8927 arg1Of variance,or
R6536 T8925 T8924 arg2Of ANOVA,(
R6537 T8926 T8924 arg3Of ),(
R6538 T8927 T8922 arg2Of or,of
R6539 T8932 T8927 arg2Of relevant,or
R6540 T8932 T8928 arg1Of relevant,Student’s
R6541 T8932 T8929 arg1Of relevant,t
R6542 T8932 T8930 arg1Of relevant,test
R6543 T8932 T8931 arg1Of relevant,where
R6544 T8933 T8936 arg1Of P-values,were
R6545 T8933 T8937 arg2Of P-values,considered
R6546 T8933 T8938 arg1Of P-values,significant
R6547 T8934 T8935 arg1Of <,0.05
R6548 T8937 T8934 arg1Of considered,<
R6549 T8937 T8936 arg2Of considered,were
R6550 T8938 T8937 arg3Of significant,considered
R2622 T3606 T3604 arg1Of PCR,Real-time
R2623 T3606 T3605 arg1Of PCR,Quantitative
R2624 T3606 T3607 arg1Of PCR,(
R2625 T3608 T3607 arg2Of qPCR,(
R2626 T3609 T3607 arg3Of ),(
R2627 T3613 T3610 arg1Of Kit,The
R2628 T3613 T3611 arg1Of Kit,RNeasy
R2629 T3613 T3612 arg1Of Kit,Mini
R2631 T3613 T3617 arg1Of Kit,was
R2635 T3616 T3614 arg3Of ),(
R2636 T3618 T3617 arg2Of used,was
R2802 T3860 T3859 arg2Of addition,in

bionlp-st-ge-2016-test-proteins

Id Subject Object Predicate Lexical cue
T7243 9076-9086 Protein denotes Luciferase
T7242 8998-9002 Protein denotes S64A
T7241 8991-8996 Protein denotes T217A
T7240 8984-8989 Protein denotes T188A
T7239 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7238 8939-8946 Protein denotes C/EBP-β
T7237 8611-8626 Protein denotes β-galactosidase
T7236 8603-8610 Protein denotes β-actin
T7235 8553-8563 Protein denotes luciferase
T7234 8489-8494 Protein denotes Cebpb
T7247 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7246 9196-9211 Protein denotes β-Galactosidase
T7245 9168-9178 Protein denotes Luciferase
T7244 9137-9152 Protein denotes β-galactosidase
T4782 3881-3889 Protein denotes SerpinB2
T4781 3697-3719 Protein denotes SerpinB2 Reporter Gene
T8281 11748-11756 Protein denotes SerpinB2
T8280 11529-11541 Protein denotes Proteinase K
T8279 11359-11368 Protein denotes Protein G
T4800 5834-5842 Protein denotes SerpinB2
T4799 5701-5706 Protein denotes Xho I
T4798 5690-5696 Protein denotes EcoR I
T4797 4899-4907 Protein denotes SerpinB2
T4796 4840-4859 Protein denotes Luciferase reporter
T4795 4667-4675 Protein denotes SerpinB2
T4794 4584-4597 Protein denotes T4 DNA ligase
T4793 4523-4540 Protein denotes T4 DNA polymerase
T4792 4451-4456 Protein denotes Apo I
T4791 4439-4446 Protein denotes Hae III
T4790 4432-4437 Protein denotes Pac I
T4789 4423-4430 Protein denotes Bsu36 I
T4788 4415-4421 Protein denotes BstX I
T4787 4408-4413 Protein denotes Apa I
T4786 4401-4406 Protein denotes Sfi I
T4785 4361-4367 Protein denotes EcoR I
T4784 4192-4220 Protein denotes SerpinB2 luciferase reporter
T4783 4099-4107 Protein denotes SerpinB2
T3590 1704-1711 Protein denotes β-actin
T3589 1678-1683 Protein denotes Cebpb
T3588 1652-1660 Protein denotes SerpinB2
T3587 1643-1651 Protein denotes Serpinb2
T3825 2644-2652 Protein denotes SerpinB2
T3824 2009-2024 Protein denotes exonuclease III
T3823 1804-1812 Protein denotes SerpinB2
T7825 9610-9634 Protein denotes T4 polynucleotide kinase
T6650 8373-8380 Protein denotes C/EBP-β
T6649 7563-7570 Protein denotes C/EBP-β
T6648 7442-7447 Protein denotes cebpb
T6647 7380-7385 Protein denotes cebpb
T4273 3622-3627 Protein denotes GAPDH
T4272 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4271 3533-3540 Protein denotes C/EBP-β
T4270 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T7233 5940-5950 Protein denotes Luciferase
T5987 6135-6137 Protein denotes TK
T5986 6117-6133 Protein denotes thymidine kinase
T5985 6062-6072 Protein denotes luciferase
T5984 5940-5950 Protein denotes Luciferase
T3170 447-452 Protein denotes Cebpb
T3169 423-428 Protein denotes Cebpb
T5994 7140-7142 Protein denotes TK
T5993 7112-7119 Protein denotes C/EBP-β
T5992 7030-7040 Protein denotes luciferase
T5991 7019-7021 Protein denotes TK
T5990 6971-6981 Protein denotes luciferase
T5989 6789-6799 Protein denotes Luciferase
T5988 6743-6753 Protein denotes Luciferase

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T8012 10353-10360 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T4445 3622-3627 http://www.uniprot.org/uniprot/P04406 denotes GAPDH
T4444 3595-3620 http://www.uniprot.org/uniprot/P04406 denotes 3-phosphate dehydrogenase
T4443 3533-3540 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T4442 3422-3430 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4441 3330-3338 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4013 2644-2652 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T4012 1804-1812 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T8560 11748-11756 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T8559 11161-11168 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T8558 11140-11147 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6874 8373-8380 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6873 7563-7570 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6872 7442-7447 http://www.uniprot.org/uniprot/P28033 denotes cebpb
T6871 7380-7385 http://www.uniprot.org/uniprot/P28033 denotes cebpb
T6265 7112-7119 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T6264 7030-7040 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T6263 6971-6981 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T6262 6789-6799 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T6261 6743-6753 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T6260 5940-5950 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T5247 4947-4951 http://www.uniprot.org/uniprot/P17947 denotes PU.1
T5246 4840-4850 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T5245 4201-4211 http://www.uniprot.org/uniprot/P08659 denotes luciferase
T5244 5834-5842 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5243 4899-4907 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5242 4667-4675 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5241 4192-4200 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5240 4099-4107 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5239 3881-3889 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T5238 3697-3705 http://www.uniprot.org/uniprot/P05120 denotes SerpinB2
T7497 8603-8610 http://www.uniprot.org/uniprot/P60709 denotes β-actin
T7496 9385-9392 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7495 8950-8957 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7494 8939-8946 http://www.uniprot.org/uniprot/P28033 denotes C/EBP-β
T7493 8489-8494 http://www.uniprot.org/uniprot/P28033 denotes Cebpb
T7492 9168-9178 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T7491 9076-9086 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T7490 5940-5950 http://www.uniprot.org/uniprot/P08659 denotes Luciferase
T3680 1704-1711 http://www.uniprot.org/uniprot/P60709 denotes β-actin
T3679 1678-1683 http://www.uniprot.org/uniprot/P28033 denotes Cebpb

UBERON-AE

Id Subject Object Predicate Lexical cue
T5964 6555-6561 http://purl.obolibrary.org/obo/UBERON_0000479 denotes tissue
T4259 3206-3210 http://purl.obolibrary.org/obo/UBERON_0001913 denotes milk
T3158 995-1000 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T3157 594-599 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum
T3156 186-191 http://purl.obolibrary.org/obo/UBERON_0001977 denotes serum

GO-BP

Id Subject Object Predicate Lexical cue
T6652 8288-8294 http://purl.obolibrary.org/obo/GO_0040007 denotes growth
T6651 7271-7283 http://purl.obolibrary.org/obo/GO_0009293 denotes Transduction
T6000 7059-7067 http://purl.obolibrary.org/obo/GO_0007349 denotes cellular
T5999 6743-6762 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T5998 6743-6762 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T5997 6743-6762 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T5996 6743-6762 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T5995 6743-6762 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T8286 11637-11654 http://purl.obolibrary.org/obo/GO_0006277 denotes DNA was amplified
T8285 11529-11539 http://purl.obolibrary.org/obo/GO_0004175 denotes Proteinase
T8284 11249-11266 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA polymerase II
T8283 11249-11266 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA polymerase II
T8282 11249-11266 http://purl.obolibrary.org/obo/GO_1990114 denotes RNA polymerase II
T7826 9710-9715 http://purl.obolibrary.org/obo/GO_0019835 denotes lysis
T7252 9076-9095 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T7251 9076-9095 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T7250 9076-9095 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T7249 9076-9095 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T7248 9076-9095 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T3828 2323-2336 http://purl.obolibrary.org/obo/GO_0006351 denotes transcription
T3827 2568-2577 http://purl.obolibrary.org/obo/GO_0007586 denotes digestion
T3826 2025-2034 http://purl.obolibrary.org/obo/GO_0007586 denotes digestion
T3594 1611-1626 http://purl.obolibrary.org/obo/GO_0010467 denotes Gene Expression
T3593 1533-1546 http://purl.obolibrary.org/obo/GO_0006351 denotes Transcription
T3592 1525-1546 http://purl.obolibrary.org/obo/GO_0001171 denotes Reverse Transcription
T3591 1458-1467 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis

GO-MF

Id Subject Object Predicate Lexical cue
T8290 11529-11539 http://purl.obolibrary.org/obo/GO_0004175 denotes Proteinase
T8289 11249-11266 http://purl.obolibrary.org/obo/GO_0003899 denotes RNA polymerase II
T8288 11249-11266 http://purl.obolibrary.org/obo/GO_0001055 denotes RNA polymerase II
T8287 11128-11138 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T7830 10273-10281 http://purl.obolibrary.org/obo/GO_0003823 denotes antibody
T7829 10004-10011 http://purl.obolibrary.org/obo/GO_0005488 denotes Binding
T7828 9733-9740 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T7827 9729-9740 http://purl.obolibrary.org/obo/GO_0003677 denotes DNA binding
T6001 6743-6762 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T6005 6743-6762 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T6004 6743-6762 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T6003 6743-6762 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T6002 6743-6762 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T7257 9076-9095 http://purl.obolibrary.org/obo/GO_0050397 denotes Luciferase activity
T7256 9076-9095 http://purl.obolibrary.org/obo/GO_0050248 denotes Luciferase activity
T7255 9076-9095 http://purl.obolibrary.org/obo/GO_0047712 denotes Luciferase activity
T7254 9076-9095 http://purl.obolibrary.org/obo/GO_0047077 denotes Luciferase activity
T7253 9076-9095 http://purl.obolibrary.org/obo/GO_0045289 denotes Luciferase activity
T4276 3484-3494 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T4275 3339-3349 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies
T4274 3272-3282 http://purl.obolibrary.org/obo/GO_0003823 denotes antibodies

GO-CC

Id Subject Object Predicate Lexical cue
T8298 11249-11266 http://purl.obolibrary.org/obo/GO_0005665 denotes RNA polymerase II
T8297 11128-11138 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T8296 11128-11138 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T8295 10768-10773 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T8294 11437-11446 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8293 11042-11051 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8292 10645-10654 http://purl.obolibrary.org/obo/GO_0000785 denotes chromatin
T8291 10421-10430 http://purl.obolibrary.org/obo/GO_0000785 denotes Chromatin
T7832 10273-10281 http://purl.obolibrary.org/obo/GO_0042571 denotes antibody
T7831 10273-10281 http://purl.obolibrary.org/obo/GO_0019815 denotes antibody
T7258 8746-8751 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6656 7888-7896 http://purl.obolibrary.org/obo/GO_0009274 denotes envelope
T6655 8127-8132 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6654 7740-7745 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6653 7584-7589 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6008 6605-6609 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T6007 6493-6498 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T6006 5991-5996 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T4285 3484-3494 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4284 3339-3349 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4283 3272-3282 http://purl.obolibrary.org/obo/GO_0042571 denotes antibodies
T4282 3484-3494 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4281 3339-3349 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4280 3272-3282 http://purl.obolibrary.org/obo/GO_0019815 denotes antibodies
T4279 3162-3171 http://purl.obolibrary.org/obo/GO_0016020 denotes Membranes
T4278 3151-3160 http://purl.obolibrary.org/obo/GO_0016020 denotes membranes
T4277 2933-2937 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T3595 1442-1447 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T3173 1002-1006 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T3172 25-29 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell

sentences

Id Subject Object Predicate Lexical cue
T8903 11939-12035 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T8902 11895-11938 Sentence denotes Data are presented as mean ± SEM per group.
T8901 11874-11894 Sentence denotes Statistical Analysis
T8275 11637-11872 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T8274 11404-11636 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C. The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T8273 11294-11403 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T8272 11023-11293 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T8271 10908-11022 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T8270 10831-10907 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T8269 10613-10830 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T8268 10464-10612 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T8267 10421-10463 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T7823 10283-10419 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T7822 10173-10282 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T7821 10004-10172 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T7820 9729-10003 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T7819 9652-9728 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T7818 9515-9651 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T7817 9477-9514 Sentence denotes Electrophoretic Mobility Shift Assays
T7216 9367-9475 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T7215 9262-9366 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T7214 9076-9261 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T7213 8900-9075 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T7212 8734-8899 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T7211 8489-8733 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T7210 5913-8488 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages) RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities. Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS. Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega). Measurements represent the results of at least three independent experiments. Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity). Protein concentration was determined using the Bio-Rad protein microassay reagent. Lentiviral shRNAs, Packaging and Transduction pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies. Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38]. To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen). The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter. The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs. The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown. C/EBP-β knockdown was confirmed by western blot analysis. Transient Transfection and Luciferase Assays (MEF Cells)
T6639 8373-8430 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T6638 8237-8372 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T6637 8116-8236 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T6636 7962-8115 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T6635 7698-7961 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T6634 7414-7697 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T6633 7284-7413 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T6632 7238-7283 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T5971 7154-7236 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T5970 6915-7153 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T5969 6837-6914 Sentence denotes Measurements represent the results of at least three independent experiments.
T5968 6743-6836 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T5967 6481-6742 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T5966 5981-6480 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T5965 5913-5980 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T4752 5853-5911 Sentence denotes Sequence verified constructs were used in the experiments.
T4751 5646-5852 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T4750 5506-5645 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T4749 5365-5505 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T4748 5084-5364 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T4747 4840-5083 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T4746 4789-4839 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T4745 4599-4788 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T4744 4174-4598 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T4743 4024-4173 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T4742 3729-4023 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T4741 3681-3728 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T4264 3478-3679 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T4263 3294-3477 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T4262 3162-3293 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T4261 2927-3161 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T4260 2907-2926 Sentence denotes Western Blot Assays
T3816 2818-2905 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No. AF339731.
T3815 2598-2817 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T3814 2514-2597 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T3813 2036-2513 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T3812 1773-2035 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T3811 1751-1772 Sentence denotes DNA Sequence Analysis
T3582 1449-1749 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T3581 1378-1448 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T3580 1344-1377 Sentence denotes Real-time Quantitative PCR (qPCR)
T8904 12036-12079 Sentence denotes P-values <0.05 were considered significant.
T3165 1247-1342 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T3164 1084-1246 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T3163 1002-1083 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T3162 857-1001 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T3161 661-856 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T3160 38-660 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C. Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T3159 25-37 Sentence denotes Cell Culture
T33 0-23 Sentence denotes Experimental Procedures
T34 25-37 Sentence denotes Cell Culture
T35 38-411 Sentence denotes Murine macrophage RAW 264.7 cells (ATCC TIB-71) were maintained in RPMI 1640 media (Gibco BRL), supplemented with 2 mM L-glutamine (Gibco BRL), 10% serum supreme (BioWhittaker), 200 µg/ml penicillin, 100 µg/ml streptomycin, 25 mM N-2-hydroxyethylpiperazine-N-2-ethane sulphonic acid (HEPES) and 25 mM sodium bicarbonate, in 5% CO2 and 95% humidified air atmosphere at 37°C.
T36 412-660 Sentence denotes Wild-type (Cebpb+/+) and knockout (Cebpb−/−) mouse embryonic fibroblasts (MEFs) [34] were grown in Dulbecco's modified Eagle's medium (Invitrogen) supplemented with 10% fetal bovine serum and 1% penicillin/streptomycin/glutamate solution (Cellgro).
T37 661-856 Sentence denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage 3–5 days later, and maintained in 50% DMEM/F12 media (Gibco BRL).
T38 857-1001 Sentence denotes Precautions were taken to exclude bacterial lipopolysaccharide contamination from all cell cultures through the use of certified LPS-free serum.
T39 1002-1083 Sentence denotes Cell viability was determined using the trypan blue (Sigma) dye exclusion method.
T40 1084-1246 Sentence denotes All cultures were routinely checked to exclude Mycoplasma infection by nuclear staining using Hoechst stain 33258 (Sigma) and the MycoAlert Detection Kit (Lonza).
T41 1247-1342 Sentence denotes Bacterial lipopolysaccharide (LPS) (Salmonella minnesota Strain Re595) was obtained from Sigma.
T42 1344-1377 Sentence denotes Real-time Quantitative PCR (qPCR)
T43 1378-1448 Sentence denotes The RNeasy Mini Kit (Qiagen) was used to isolate total RNA from cells.
T44 1449-1749 Sentence denotes For cDNA synthesis, 1 µg of total RNA was reverse transcribed using TaqMan® Reverse Transcription Reagents (Applied Biosystems). qPCR was performed using TaqMan® Gene Expression 20X primers for Serpinb2/SerpinB2 (Mm00440905_m1), Cebpb (Mm00843434_s1) and β-actin (Mm00607939_s1) (Applied Biosystems).
T45 1751-1772 Sentence denotes DNA Sequence Analysis
T46 1773-2035 Sentence denotes The DNA sequence of the murine SerpinB2 promoter was determined by sequencing the pUC-based plasmids pDB9406, pDB9402-41 and pDB9402-42, in addition to plasmids prepared from pDB9402-41 and pDB9402-42 containing deletions introduced by exonuclease III digestion.
T47 2036-2513 Sentence denotes Plasmids pDB9406, pDB9402-41 and pDB9402-42 containing genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain, were kindly provided by Dr. Dominique Belin, University of Geneva. pDB9406 contains a 4.4 kb EcoRI/SpeI genomic fragment spanning the transcription initiation site; pDB9402-41 and pDB9402-42 contain a 1.2 kb EcoRI genomic fragment, located immediately upstream of the pDB9406 EcoRI fragment, cloned in opposite orientations.
T48 2514-2597 Sentence denotes Subcloned inserts were verified by restriction enzyme digestion and DNA sequencing.
T49 2598-2817 Sentence denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′ flanking region was determined using the ABI PRISM dye terminator cycle sequencing ready reaction kit (Perkin-Elmer) and a PE 373A sequencer (Perkin-Elmer).
T50 2818-2895 Sentence denotes This sequence was deposited in GenBank/EMBL/DDBJ Data Bank with Accession No.
T51 2896-2905 Sentence denotes AF339731.
T52 2907-2926 Sentence denotes Western Blot Assays
T53 2927-3161 Sentence denotes Whole cell lysates were prepared in RIPA buffer (10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5% NP-40, 0.5% deoxycholate, 0.1% SDS), proteins were separated on 4–12% Bis-Tris NuPAGE gels (Invitrogen), and transferred to PVDF membranes.
T54 3162-3293 Sentence denotes Membranes were subsequently blocked with 5% milk in PBS-T (1X PBS, 0.1% Tween-20), and incubated with primary antibodies overnight.
T55 3294-3477 Sentence denotes Affinity purified rabbit anti-mouse SerpinB2 antibodies were prepared after immunization with a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli as in [35].
T56 3478-3679 Sentence denotes Other antibodies used for western blot assays include: C/EBP-β (sc-150) (Santa Cruz Biotechnologies), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and α/β tubulin (Cell Signaling Technology, Inc.).
T57 3681-3728 Sentence denotes Construction of SerpinB2 Reporter Gene Plasmids
T58 3729-4023 Sentence denotes The PCR primers DW5’LUC, containing a Kpn I restriction site, and DW3’LUC, containing an Xho I restriction site, were used to PCR amplify and clone the SerpinB2 promoter (−3261 to +92) from pDB9406 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic (Promega) to produce pGLmP-3261.
T59 4024-4173 Sentence denotes The EcoR I insert of pDB9402-42 was sub-cloned immediately upstream of the SerpinB2 promoter EcoR I site (−3261) of pGLmP-3261 to produce pGLmP-4480.
T60 4174-4598 Sentence denotes Additional murine SerpinB2 luciferase reporter constructs (pGLmP-2751, pGLmP-2614, pGLmP-1686, pGLmP-1341, pGLmP-694, pGLmP-539 and pGLmP-189) were generated by digesting pGLmP-3261 with EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I respectively), blunt ending the resultant 5′ or 3′ overhangs with T4 DNA polymerase (NEB) and re-ligating the vector ends with T4 DNA ligase.
T61 4599-4788 Sentence denotes The PCR primers BSPCR2 and DW3’LUC were used to subclone the murine SerpinB2 promoter regions −87 to +92 into the Kpn I/Xho I polylinker restriction sites of pGL3 Basic to produce pGLmP-87.
T62 4789-4839 Sentence denotes The control empty vector was pGL3 Basic (Promega).
T63 4840-5083 Sentence denotes Luciferase reporter constructs containing mutations in the SerpinB2 promoter LPS-responsive regions E box, PU.1, Oct-1 and C/EBP (pGLmP-539mEbox, pGLmP-539mPU.1, pGLmP-539mOct and pGLmP-539mC/EBP respectively) were generated as described [36].
T64 5084-5364 Sentence denotes The mutant oligonucleotide PCR primer sequences are provided in Fig. S1, and were used as follows: pGLmP-539mEbox: mPAI2mEboxa and mPAI2mEboxb; pGLmP-539mPU.1: mPAI2mPU.1a and mPAI2mPU.1b; pGLmP-539mOct: mPAI2mOct-2a and mPAI2mOct-2b; pGLmP-539mC/EBP: mPAI2mCEBPa and mPAI2mCEBPb.
T65 5365-5505 Sentence denotes The oligonucleotide PCR primers used to generate mutants, pGLmP-539mCRE, pGLmP-539mAP-1a, and pGLmP-539mAP-1b were reported previously [37].
T66 5506-5645 Sentence denotes The flanking oligonucleotide PCR primers were RVprimer3 (Promega) and GLprimer2 (Promega). pGLmP-539 was used as the template in each case.
T67 5646-5852 Sentence denotes Recombinant PCR products were digested with EcoR I and Xho I and cloned between the EcoR I and Xho I restriction sites of pGLmP-539 in place of the −539/+92 region of the wild-type murine SerpinB2 promoter.
T68 5853-5911 Sentence denotes Sequence verified constructs were used in the experiments.
T69 5913-5980 Sentence denotes Transient Transfection and Luciferase Assays (RAW264.7 Macrophages)
T70 5981-6480 Sentence denotes RAW 264.7 cells (2×107) growing in log phase were transfected with the indicated luciferase reporter plasmid (20 µg) along with the pRL-thymidine kinase (TK) (Promega) internal control reporter plasmid (2 µg) by electroporation using a Bio-Rad Gene Pulser with a Capacitance Extender (0.25 kV, 960 µFd). pGL3 control plasmid which encodes the SV40 promoter and enhancer was included as a positive control for transfection efficiency, and as an internal standard for promoter and enhancer activities.
T71 6481-6742 Sentence denotes Transfected cells were transferred to 10 ml of pre-warmed media in 6-well tissue culture plates, divided into two identical cell pools and incubated 16 hrs in a 5% CO2 and 95% humidified air atmosphere at 37°C either in the presence or absence of 100 ng/ml LPS.
T72 6743-6836 Sentence denotes Luciferase activity was measured using a Dual-Luciferase Reporter Assay System kit (Promega).
T73 6837-6914 Sentence denotes Measurements represent the results of at least three independent experiments.
T74 6915-7153 Sentence denotes Promoter activity is expressed as the number of firefly luciferase light units normalized either to pRL-TK renilla luciferase light units or to cellular protein concentration (where co-transfected C/EBP-β or LPS affected pRL-TK activity).
T75 7154-7236 Sentence denotes Protein concentration was determined using the Bio-Rad protein microassay reagent.
T76 7238-7283 Sentence denotes Lentiviral shRNAs, Packaging and Transduction
T77 7284-7413 Sentence denotes pLKO.1-puro lentiviral vectors carrying short hairpin RNAs (shRNA) specific for human and mouse cebpb were used in these studies.
T78 7414-7697 Sentence denotes Because the human and mouse cebpb 3′ untranslated regions are not identical, these species-specific shRNAs cannot knockdown expression of endogenous C/EBP-β when used on cells of the other species; therefore we used the human CEBPB shRNA as a control in these experiments as in [38].
T79 7698-7961 Sentence denotes To produce lentiviral particles, HEK-293T cells were transfected with a mixture of plasmids: each shRNA expression plasmid (1 µg), pCMV-ΔR8.2dvpr packaging plasmid (0.75 µg), and pCMV-VSV-G envelope plasmid (0.25 µg) using Lipofectamine 2000 reagent (Invitrogen).
T80 7962-8115 Sentence denotes The lentiviral supernatant was collected 48 hrs after transfection, cleared by centrifugation at 2,000 g for 10 mins and passed through a 0.45 µm filter.
T81 8116-8236 Sentence denotes The target cells were treated with the lentiviral supernatant and 8 µg/ml Polybrene (American Bioanalytical) for 24 hrs.
T82 8237-8372 Sentence denotes The lentiviral supernatant was replaced with fresh growth media and incubated further for 72 hrs to allow for effective gene knockdown.
T83 8373-8430 Sentence denotes C/EBP-β knockdown was confirmed by western blot analysis.
T84 8432-8488 Sentence denotes Transient Transfection and Luciferase Assays (MEF Cells)
T85 8489-8733 Sentence denotes Cebpb −/− MEFs (1×105) [34] were transfected with the indicated luciferase reporter plasmid (400 ng) along with a β-actin-β-galactosidase reporter plasmid (200 ng) by electroporation using the Invitrogen Neon™ system (1 pulse, 1350 V, 30 msec).
T86 8734-8899 Sentence denotes Transfected cells were transferred to pre-warmed media in 24 well plates and incubated for 48 hrs prior to incubation with LPS (100 ng/ml) for 4 hrs where indicated.
T87 8900-9075 Sentence denotes In some experiments, plasmids encoding C/EBP-β or C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A) [38]–[40] or control vector were co-transfected (0.6–1.0 µg total DNA).
T88 9076-9261 Sentence denotes Luciferase activity was determined and normalized to that of β-galactosidase [38] using the Luciferase Assay System and β-Galactosidase Enzyme Assay System Kits, respectively (Promega).
T89 9262-9366 Sentence denotes Each experiment was repeated at least three times, and triplicate samples were employed for each sample.
T90 9367-9475 Sentence denotes Expression of the C/EBP-β phospho-acceptor mutant proteins was checked for equal expression by western blot.
T91 9477-9514 Sentence denotes Electrophoretic Mobility Shift Assays
T92 9515-9651 Sentence denotes Radiolabelled, double-stranded oligonucleotide probes for gel shift assays were prepared using T4 polynucleotide kinase and [γ-32P]-ATP.
T93 9652-9728 Sentence denotes RAW 264.7 nuclear extracts were prepared by the detergent lysis method [41].
T94 9729-10003 Sentence denotes DNA binding reactions (25 µl) containing 10 mM HEPES pH 7.9, 10 µg/ml BSA, 2 mM DTT, 30% glycerol, 20% Ficoll-400, 1 µg poly (dI-dC), 6 µg of nuclear extracts and 10,000 to 20,000 cpm (0.05 to 0.2 ng) of radiolabelled probe were performed for 20 minutes at room temperature.
T95 10004-10172 Sentence denotes Binding reaction products were resolved by electrophoresis at room temperature on 5% polyacrylamide gels (29∶1 acrylamide:bis-acrylamide (Bio-Rad)) in 1x TBE at 10V/cm.
T96 10173-10282 Sentence denotes For supershift assays, nuclear extracts were pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody.
T97 10283-10419 Sentence denotes Antibodies were purchased from Santa Cruz: anti-C/EBP-α (sc-61), anti-C/EBP-β (sc-150), anti-C/EBP-δ (sc-151) and anti-C/EBP-ε (sc-158).
T98 10421-10463 Sentence denotes Chromatin Immunoprecipitation (ChIP) Assay
T99 10464-10612 Sentence denotes ChIP assays were performed using a commercially available Magna-ChIP™ kit (Millipore), as recommended by the manufacturer, with minor modifications.
T100 10613-10830 Sentence denotes Briefly, after crosslinking the chromatin with 1% formaldehyde at room temperature for 10 min and neutralizing with glycine for 5 min at room temperature, cells were washed with cold PBS, scraped and collected on ice.
T101 10831-10907 Sentence denotes Cells extracts were prepared using a commercially available kit (Millipore).
T102 10908-11022 Sentence denotes Nuclear lysates were sonicated 5 times for 15 sec with 1 min intervals on ice using a Sonic Dismembrator (Fisher).
T103 11023-11293 Sentence denotes An equal amount of chromatin was immunoprecipitated at 4°C overnight with at least 1 µg of the following antibodies: C/EBP-β (sc-150X), p-C/EBP-β (T217) (sc-16993X), normal rabbit IgG (sc-2027)(Santa Cruz Biotechnologies) and RNA polymerase II (Clone CTD4H8)(Millipore).
T104 11294-11403 Sentence denotes Immunoprecipitated products were collected after incubation with Protein G coated magnetic beads (Millipore).
T105 11404-11560 Sentence denotes The beads were washed, the bound chromatin was eluted in ChIP Elution Buffer (Millipore) and the proteins were digested with Proteinase K for 2 hrs at 62°C.
T106 11561-11636 Sentence denotes The DNA was then purified using the QIAquick PCR Purification Kit (Qiagen).
T107 11637-11872 Sentence denotes DNA was amplified by semi-quantitative PCR or by qPCR using the SYBR green method and primers specific for the SerpinB2 proximal promoter: forward (−338/−315) 5′AAGACTCCCACAGATGGTGGCTGT3’; reverse (−5/+19) 5′TTCTTGGAAAGCTGGCACTGTGTG3’.
T108 11874-11894 Sentence denotes Statistical Analysis
T109 11895-11938 Sentence denotes Data are presented as mean ± SEM per group.
T110 11939-12035 Sentence denotes Results were analyzed using the analysis of variance (ANOVA) or Student’s t test where relevant.
T111 12036-12079 Sentence denotes P-values <0.05 were considered significant.

ICD10

Id Subject Object Predicate Lexical cue
T3171 1131-1151 http://purl.bioontology.org/ontology/ICD10/A49.3 denotes Mycoplasma infection

simple1

Id Subject Object Predicate Lexical cue
T8304 11748-11756 Protein denotes SerpinB2
T8303 11529-11541 Protein denotes Proteinase K
T8302 11359-11368 Protein denotes Protein G
T7834 9610-9634 Protein denotes T4 polynucleotide kinase
T7273 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7272 9196-9211 Protein denotes β-Galactosidase
T7271 9168-9178 Protein denotes Luciferase
T7270 9137-9152 Protein denotes β-galactosidase
T7269 9076-9086 Protein denotes Luciferase
T7268 8998-9002 Protein denotes S64A
T7267 8991-8996 Protein denotes T217A
T7266 8984-8989 Protein denotes T188A
T7265 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7264 8939-8946 Protein denotes C/EBP-β
T7263 8611-8626 Protein denotes β-galactosidase
T7262 8603-8610 Protein denotes β-actin
T7261 8553-8563 Protein denotes luciferase
T7260 8489-8494 Protein denotes Cebpb
T7259 5940-5950 Protein denotes Luciferase
T6664 8373-8380 Protein denotes C/EBP-β
T6663 7563-7570 Protein denotes C/EBP-β
T6662 7442-7447 Protein denotes cebpb
T6661 7380-7385 Protein denotes cebpb
T6030 7140-7142 Protein denotes TK
T6029 7112-7119 Protein denotes C/EBP-β
T6028 7030-7040 Protein denotes luciferase
T6027 7019-7021 Protein denotes TK
T6026 6971-6981 Protein denotes luciferase
T6025 6789-6799 Protein denotes Luciferase
T6024 6743-6753 Protein denotes Luciferase
T6023 6135-6137 Protein denotes TK
T6022 6117-6133 Protein denotes thymidine kinase
T6021 6062-6072 Protein denotes luciferase
T6020 5940-5950 Protein denotes Luciferase
T4820 5834-5842 Protein denotes SerpinB2
T4819 5701-5706 Protein denotes Xho I
T4818 5690-5696 Protein denotes EcoR I
T4817 4899-4907 Protein denotes SerpinB2
T4816 4840-4859 Protein denotes Luciferase reporter
T4815 4667-4675 Protein denotes SerpinB2
T4814 4584-4597 Protein denotes T4 DNA ligase
T4813 4523-4540 Protein denotes T4 DNA polymerase
T4812 4451-4456 Protein denotes Apo I
T4811 4439-4446 Protein denotes Hae III
T4810 4432-4437 Protein denotes Pac I
T4809 4423-4430 Protein denotes Bsu36 I
T4808 4415-4421 Protein denotes BstX I
T4807 4408-4413 Protein denotes Apa I
T4806 4401-4406 Protein denotes Sfi I
T4805 4361-4367 Protein denotes EcoR I
T4804 4192-4220 Protein denotes SerpinB2 luciferase reporter
T4803 4099-4107 Protein denotes SerpinB2
T4802 3881-3889 Protein denotes SerpinB2
T4801 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4293 3622-3627 Protein denotes GAPDH
T4292 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4291 3533-3540 Protein denotes C/EBP-β
T4290 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T3603 1704-1711 Protein denotes β-actin
T3602 1678-1683 Protein denotes Cebpb
T3601 1652-1660 Protein denotes SerpinB2
T3600 1643-1651 Protein denotes Serpinb2
T3175 447-452 Protein denotes Cebpb
T3174 423-428 Protein denotes Cebpb
T3834 2644-2652 Protein denotes SerpinB2
T3833 2009-2024 Protein denotes exonuclease III
T3832 1804-1812 Protein denotes SerpinB2

BioNLP16_DUT

Id Subject Object Predicate Lexical cue
T8557 11748-11756 Protein denotes SerpinB2
T8556 11529-11541 Protein denotes Proteinase K
T8555 11359-11368 Protein denotes Protein G
T8011 9610-9634 Protein denotes T4 polynucleotide kinase
T7489 9367-9377 Gene_expression denotes Expression
T7488 9037-9051 Gene_expression denotes co-transfected
T7487 8522-8533 Gene_expression denotes transfected
T7486 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7485 9196-9211 Protein denotes β-Galactosidase
T7484 9168-9178 Protein denotes Luciferase
T7483 9137-9152 Protein denotes β-galactosidase
T7482 9076-9086 Protein denotes Luciferase
T7481 8991-8996 Protein denotes T217A
T7480 8984-8989 Protein denotes T188A
T7479 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7478 8939-8946 Protein denotes C/EBP-β
T7477 8998-9002 Protein denotes S64A
T7476 8611-8626 Protein denotes β-galactosidase
T7475 8603-8610 Protein denotes β-actin
T7474 8553-8563 Protein denotes luciferase
T7473 8489-8494 Protein denotes Cebpb
T7472 5940-5950 Protein denotes Luciferase
T6870 8381-8390 Negative_regulation denotes knockdown
T6869 7538-7548 Gene_expression denotes expression
T6868 7528-7537 Negative_regulation denotes knockdown
T6867 8373-8380 Protein denotes C/EBP-β
T6866 7563-7570 Protein denotes C/EBP-β
T6865 7442-7447 Protein denotes cebpb
T6864 7380-7385 Protein denotes cebpb
T6259 7127-7135 Regulation denotes affected
T6258 7097-7111 Gene_expression denotes co-transfected
T6257 7030-7040 Protein denotes luciferase
T6256 7019-7021 Protein denotes TK
T6255 6971-6981 Protein denotes luciferase
T6254 7140-7142 Protein denotes TK
T6253 7112-7119 Protein denotes C/EBP-β
T6252 6789-6799 Protein denotes Luciferase
T6251 6743-6753 Protein denotes Luciferase
T6250 6135-6137 Protein denotes TK
T6249 6117-6133 Protein denotes thymidine kinase
T6248 6062-6072 Protein denotes luciferase
T6247 5940-5950 Protein denotes Luciferase
T5237 5834-5842 Protein denotes SerpinB2
T5236 5701-5706 Protein denotes Xho I
T5235 5690-5696 Protein denotes EcoR I
T5234 4899-4907 Protein denotes SerpinB2
T5233 4840-4859 Protein denotes Luciferase reporter
T5232 4667-4675 Protein denotes SerpinB2
T5231 4423-4430 Protein denotes Bsu36 I
T5230 4415-4421 Protein denotes BstX I
T5229 4408-4413 Protein denotes Apa I
T5228 4401-4406 Protein denotes Sfi I
T5227 4361-4367 Protein denotes EcoR I
T5226 4192-4220 Protein denotes SerpinB2 luciferase reporter
T5225 4584-4597 Protein denotes T4 DNA ligase
T5224 4523-4540 Protein denotes T4 DNA polymerase
T5223 4451-4456 Protein denotes Apo I
T5222 4439-4446 Protein denotes Hae III
T5221 4432-4437 Protein denotes Pac I
T5220 4099-4107 Protein denotes SerpinB2
T5219 3881-3889 Protein denotes SerpinB2
T5218 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4440 3446-3454 Gene_expression denotes produced
T4439 3622-3627 Protein denotes GAPDH
T4438 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4437 3533-3540 Protein denotes C/EBP-β
T4436 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T4011 2644-2652 Protein denotes SerpinB2
T4010 2009-2024 Protein denotes exonuclease III
T4009 1804-1812 Protein denotes SerpinB2
T3678 1616-1626 Gene_expression denotes Expression
T3677 1704-1711 Protein denotes β-actin
T3676 1678-1683 Protein denotes Cebpb
T3675 1652-1660 Protein denotes SerpinB2
T3674 1643-1651 Protein denotes Serpinb2
T3289 447-452 Protein denotes Cebpb
T3288 423-428 Protein denotes Cebpb
R2694 T3674 T3678 themeOf Serpinb2,Expression
R2695 T3675 T3678 themeOf SerpinB2,Expression
R2696 T3676 T3678 themeOf Cebpb,Expression
R2697 T3677 T3678 themeOf β-actin,Expression
R3281 T4436 T4440 themeOf GST-murine SerpinB2 fusion protein,produced
R4487 T6253 T6258 themeOf C/EBP-β,co-transfected
R4488 T6253 T6259 causeOf C/EBP-β,affected
R4489 T6254 T6259 themeOf TK,affected
R4950 T6866 T6869 themeOf C/EBP-β,expression
R4951 T6867 T6870 themeOf C/EBP-β,knockdown
R4952 T6869 T6868 themeOf expression,knockdown
R5379 T7473 T7487 themeOf Cebpb,transfected
R5380 T7474 T7487 themeOf luciferase,transfected
R5381 T7476 T7487 themeOf β-galactosidase,transfected
R5382 T7477 T7488 themeOf S64A,co-transfected
R5383 T7481 T7488 themeOf T217A,co-transfected
R5384 T7486 T7489 themeOf C/EBP-β phospho-acceptor mutant,Expression

BioNLP16_Messiy

Id Subject Object Predicate Lexical cue
T7538 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7537 8939-8946 Protein denotes C/EBP-β
T7536 8998-9002 Protein denotes S64A
T7547 9037-9051 Gene_expression denotes co-transfected
T7546 8522-8533 Gene_expression denotes transfected
T7545 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7544 9196-9211 Protein denotes β-Galactosidase
T7543 9168-9178 Protein denotes Luciferase
T7542 9137-9152 Protein denotes β-galactosidase
T7541 9076-9086 Protein denotes Luciferase
T7540 8991-8996 Protein denotes T217A
T7539 8984-8989 Protein denotes T188A
T7535 8611-8626 Protein denotes β-galactosidase
T7534 8603-8610 Protein denotes β-actin
T7533 8553-8563 Protein denotes luciferase
T7532 8489-8494 Protein denotes Cebpb
T7531 5940-5950 Protein denotes Luciferase
T6893 8381-8390 Negative_regulation denotes knockdown
T6892 7538-7548 Gene_expression denotes expression
T6891 7528-7537 Negative_regulation denotes knockdown
T6890 8373-8380 Protein denotes C/EBP-β
T6889 7563-7570 Protein denotes C/EBP-β
T6888 7442-7447 Protein denotes cebpb
T6887 7380-7385 Protein denotes cebpb
T6300 7097-7111 Gene_expression denotes co-transfected
T6299 7030-7040 Protein denotes luciferase
T6298 7019-7021 Protein denotes TK
T6297 6971-6981 Protein denotes luciferase
T6296 7140-7142 Protein denotes TK
T6295 7112-7119 Protein denotes C/EBP-β
T6294 6789-6799 Protein denotes Luciferase
T6293 6743-6753 Protein denotes Luciferase
T6292 6135-6137 Protein denotes TK
T6291 6117-6133 Protein denotes thymidine kinase
T6290 6062-6072 Protein denotes luciferase
T6289 5940-5950 Protein denotes Luciferase
T5308 5834-5842 Protein denotes SerpinB2
T5307 5701-5706 Protein denotes Xho I
T5306 5690-5696 Protein denotes EcoR I
T5305 4899-4907 Protein denotes SerpinB2
T5304 4840-4859 Protein denotes Luciferase reporter
T5303 4667-4675 Protein denotes SerpinB2
T5302 4423-4430 Protein denotes Bsu36 I
T5301 4415-4421 Protein denotes BstX I
T5300 4408-4413 Protein denotes Apa I
T5299 4401-4406 Protein denotes Sfi I
T5298 4361-4367 Protein denotes EcoR I
T5297 4192-4220 Protein denotes SerpinB2 luciferase reporter
T5296 4584-4597 Protein denotes T4 DNA ligase
T5295 4523-4540 Protein denotes T4 DNA polymerase
T5294 4451-4456 Protein denotes Apo I
T5293 4439-4446 Protein denotes Hae III
T5292 4432-4437 Protein denotes Pac I
T5291 4099-4107 Protein denotes SerpinB2
T5290 3881-3889 Protein denotes SerpinB2
T5289 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4460 3446-3454 Gene_expression denotes produced
T4459 3622-3627 Protein denotes GAPDH
T4458 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4457 3533-3540 Protein denotes C/EBP-β
T4456 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T4022 2644-2652 Protein denotes SerpinB2
T4021 2009-2024 Protein denotes exonuclease III
T4020 1804-1812 Protein denotes SerpinB2
T3692 1704-1711 Protein denotes β-actin
T3691 1678-1683 Protein denotes Cebpb
T3690 1652-1660 Protein denotes SerpinB2
T3689 1643-1651 Protein denotes Serpinb2
T3295 447-452 Protein denotes Cebpb
T3294 423-428 Protein denotes Cebpb
T8569 11748-11756 Protein denotes SerpinB2
T8568 11529-11541 Protein denotes Proteinase K
T8567 11359-11368 Protein denotes Protein G
T8015 9610-9634 Protein denotes T4 polynucleotide kinase
T7548 9367-9377 Gene_expression denotes Expression
R3285 T4456 T4460 themeOf GST-murine SerpinB2 fusion protein,produced
R4493 T6295 T6300 themeOf C/EBP-β,co-transfected
R4957 T6889 T6891 themeOf C/EBP-β,knockdown
R4958 T6889 T6892 themeOf C/EBP-β,expression
R4959 T6890 T6893 themeOf C/EBP-β,knockdown
R4960 T6892 T6891 themeOf expression,knockdown
R5392 T7532 T7546 themeOf Cebpb,transfected
R5393 T7536 T7547 themeOf S64A,co-transfected
R5394 T7537 T7547 themeOf C/EBP-β,co-transfected
R5395 T7539 T7547 themeOf T188A,co-transfected
R5396 T7540 T7547 themeOf T217A,co-transfected
R5397 T7545 T7548 themeOf C/EBP-β phospho-acceptor mutant,Expression

DLUT931

Id Subject Object Predicate Lexical cue
T8563 11748-11756 Protein denotes SerpinB2
T8562 11529-11541 Protein denotes Proteinase K
T8561 11359-11368 Protein denotes Protein G
T8013 9610-9634 Protein denotes T4 polynucleotide kinase
T7514 9367-9377 Gene_expression denotes Expression
T7513 9037-9051 Gene_expression denotes co-transfected
T7512 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7511 9196-9211 Protein denotes β-Galactosidase
T7510 9168-9178 Protein denotes Luciferase
T7509 9137-9152 Protein denotes β-galactosidase
T7508 9076-9086 Protein denotes Luciferase
T7507 8991-8996 Protein denotes T217A
T7506 8984-8989 Protein denotes T188A
T7505 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7504 8939-8946 Protein denotes C/EBP-β
T7503 8998-9002 Protein denotes S64A
T7502 8611-8626 Protein denotes β-galactosidase
T7501 8603-8610 Protein denotes β-actin
T7500 8553-8563 Protein denotes luciferase
T7499 8489-8494 Protein denotes Cebpb
T7498 5940-5950 Protein denotes Luciferase
T6881 8381-8390 Negative_regulation denotes knockdown
T6880 7528-7537 Negative_regulation denotes knockdown
T6879 7538-7548 Gene_expression denotes expression
T6878 8373-8380 Protein denotes C/EBP-β
T6877 7563-7570 Protein denotes C/EBP-β
T6876 7442-7447 Protein denotes cebpb
T6875 7380-7385 Protein denotes cebpb
T6277 7097-7111 Gene_expression denotes co-transfected
T6276 7030-7040 Protein denotes luciferase
T6275 7019-7021 Protein denotes TK
T6274 6971-6981 Protein denotes luciferase
T6273 7140-7142 Protein denotes TK
T6272 7112-7119 Protein denotes C/EBP-β
T6271 6789-6799 Protein denotes Luciferase
T6270 6743-6753 Protein denotes Luciferase
T6269 6135-6137 Protein denotes TK
T6268 6117-6133 Protein denotes thymidine kinase
T6267 6062-6072 Protein denotes luciferase
T6266 5940-5950 Protein denotes Luciferase
T5268 3681-3693 Positive_regulation denotes Construction
T5267 5834-5842 Protein denotes SerpinB2
T5266 5701-5706 Protein denotes Xho I
T5265 5690-5696 Protein denotes EcoR I
T5264 4899-4907 Protein denotes SerpinB2
T5263 4840-4859 Protein denotes Luciferase reporter
T5262 4667-4675 Protein denotes SerpinB2
T5261 4423-4430 Protein denotes Bsu36 I
T5260 4415-4421 Protein denotes BstX I
T5259 4408-4413 Protein denotes Apa I
T5258 4401-4406 Protein denotes Sfi I
T5257 4361-4367 Protein denotes EcoR I
T5256 4192-4220 Protein denotes SerpinB2 luciferase reporter
T5255 4584-4597 Protein denotes T4 DNA ligase
T5254 4523-4540 Protein denotes T4 DNA polymerase
T5253 4451-4456 Protein denotes Apo I
T5252 4439-4446 Protein denotes Hae III
T5251 4432-4437 Protein denotes Pac I
T5250 4099-4107 Protein denotes SerpinB2
T5249 3881-3889 Protein denotes SerpinB2
T5248 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4455 3446-3454 Gene_expression denotes produced
T4454 3622-3627 Protein denotes GAPDH
T4453 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4452 3533-3540 Protein denotes C/EBP-β
T4451 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T4016 2644-2652 Protein denotes SerpinB2
T4015 2009-2024 Protein denotes exonuclease III
T4014 1804-1812 Protein denotes SerpinB2
T3684 1704-1711 Protein denotes β-actin
T3683 1678-1683 Protein denotes Cebpb
T3682 1652-1660 Protein denotes SerpinB2
T3681 1643-1651 Protein denotes Serpinb2
T3291 447-452 Protein denotes Cebpb
T3290 423-428 Protein denotes Cebpb
R3284 T4451 T4455 themeOf GST-murine SerpinB2 fusion protein,produced
R3836 T5248 T5268 themeOf SerpinB2 Reporter Gene,Construction
R4490 T6272 T6277 themeOf C/EBP-β,co-transfected
R4491 T6274 T6277 themeOf luciferase,co-transfected
R4953 T6877 T6879 themeOf C/EBP-β,expression
R4954 T6878 T6881 themeOf C/EBP-β,knockdown
R4955 T6879 T6880 themeOf expression,knockdown
R5385 T7503 T7513 themeOf S64A,co-transfected
R5386 T7504 T7513 themeOf C/EBP-β,co-transfected
R5387 T7505 T7513 themeOf C/EBP-β phospho-acceptor mutants,co-transfected
R5388 T7506 T7513 themeOf T188A,co-transfected
R5389 T7507 T7513 themeOf T217A,co-transfected
R5390 T7512 T7514 themeOf C/EBP-β phospho-acceptor mutant,Expression

bionlp-st-ge-2016-test-ihmc

Id Subject Object Predicate Lexical cue
T8940 11993-11998 Protein denotes ANOVA
T8939 12003-12014 Entity denotes Student’s t
T8618 11427-11446 Binding denotes the bound chromatin
T8617 11658-11679 Protein denotes semi-quantitative PCR
T8616 10768-10773 Entity denotes cells
T8615 11114-11138 Entity denotes the following antibodies
T8614 10831-10850 Entity denotes Cells extracts were
T8613 10837-10845 Entity denotes extracts
T8612 10729-10736 Entity denotes glycine
T8611 11249-11266 Protein denotes RNA polymerase II
T8610 11606-11609 Protein denotes PCR
T8609 11140-11175 Protein denotes C/EBP-β (sc-150X), p-C/EBP-β (T217)
T8608 10660-10675 Entity denotes 1% formaldehyde
T8607 10641-10706 Entity denotes the chromatin with 1% formaldehyde at room temperature for 10 min
T8606 11461-11492 Entity denotes ChIP Elution Buffer (Millipore)
T8605 10826-10829 Entity denotes ice
T8604 11359-11368 Protein denotes Protein G
T8603 11039-11051 Entity denotes of chromatin
T8602 11140-11158 Protein denotes C/EBP-β (sc-150X),
T8601 11744-11774 Entity denotes the SerpinB2 proximal promoter
T8600 11637-11640 Entity denotes DNA
T8599 11497-11509 Protein denotes the proteins
T8598 11686-11690 Protein denotes qPCR
T8597 11170-11174 Entity denotes T217
T8596 11427-11446 Entity denotes the bound chromatin
T8595 11546-11551 Protein denotes 2 hrs
T8594 11529-11541 Protein denotes Proteinase K
T8593 11623-11635 Protein denotes Kit (Qiagen)
T8592 11561-11568 Entity denotes The DNA
T8591 10982-10985 Entity denotes ice
T8590 11748-11756 Protein denotes SerpinB2
T8058 10283-10324 Binding denotes Antibodies were purchased from Santa Cruz
T8057 10241-10281 Entity denotes ice with 4 µg of specific C/EBP antibody
T8056 9652-9678 Entity denotes RAW 264.7 nuclear extracts
T8055 9909-9912 Protein denotes cpm
T8054 9814-9826 Entity denotes 30% glycerol
T8053 9871-9887 Entity denotes nuclear extracts
T8052 10130-10140 Entity denotes acrylamide
T8051 9770-9788 Entity denotes 10 mM HEPES pH 7.9
T8050 10218-10281 Protein denotes pre-incubated 2 hrs on ice with 4 µg of specific C/EBP antibody
T8049 10314-10319 Protein denotes Santa
T8048 9595-9634 Protein denotes prepared using T4 polynucleotide kinase
T8047 10371-10392 Protein denotes anti-C/EBP-δ (sc-151)
T8046 10196-10212 Entity denotes nuclear extracts
T8045 10267-10272 Protein denotes C/EBP
T8044 9530-9561 Entity denotes double-stranded oligonucleotide
T8043 10177-10194 Entity denotes supershift assays
T8042 10113-10125 Entity denotes 1 acrylamide
T8041 10283-10293 Entity denotes Antibodies
T8040 9844-9861 Entity denotes 1 µg poly (dI-dC)
T8039 10126-10140 Protein denotes bis-acrylamide
T8038 10089-10103 Entity denotes polyacrylamide
T8037 9610-9612 Entity denotes T4
T8036 10255-10281 Entity denotes of specific C/EBP antibody
T8035 9799-9827 Entity denotes BSA, 2 mM DTT, 30% glycerol,
T8034 10126-10140 Entity denotes bis-acrylamide
T8033 10086-10108 Entity denotes 5% polyacrylamide gels
T8032 10250-10281 Entity denotes 4 µg of specific C/EBP antibody
T8031 9646-9650 Entity denotes -ATP
T8030 9693-9727 Entity denotes by the detergent lysis method [41]
T7596 9367-9425 Gene_expression denotes Expression of the C/EBP-β phospho-acceptor mutant proteins
T7595 5940-5950 Protein denotes Luciferase
T7594 8601-8643 Protein denotes a β-actin-β-galactosidase reporter plasmid
T7593 9137-9157 Protein denotes β-galactosidase [38]
T7592 8553-8563 Protein denotes luciferase
T7591 8877-8882 Protein denotes 4 hrs
T7590 9168-9178 Protein denotes Luciferase
T7589 9070-9073 Entity denotes DNA
T7588 8601-8643 Protein denotes a β-actin-β-galactosidase reporter plasmid
T7587 8984-9002 Protein denotes T188A, T217A, S64A
T7586 8857-8860 Entity denotes LPS
T7585 9076-9099 Protein denotes Luciferase activity was
T7584 8499-8511 Protein denotes MEFs (1×105)
T7583 9196-9236 Protein denotes β-Galactosidase Enzyme Assay System Kits
T6350 6447-6455 Entity denotes promoter
T6349 5959-5979 Entity denotes RAW264.7 Macrophages
T6348 6717-6741 Entity denotes absence of 100 ng/ml LPS
T6347 7209-7235 Protein denotes protein microassay reagent
T6346 6062-6072 Protein denotes luciferase
T6345 6113-6126 Protein denotes pRL-thymidine
T6344 6320-6337 Entity denotes the SV40 promoter
T6343 5940-5950 Protein denotes Luciferase
T6342 6591-6615 Entity denotes two identical cell pools
T6341 7019-7021 Protein denotes TK
T6340 7209-7235 Entity denotes protein microassay reagent
T6339 7154-7175 Entity denotes Protein concentration
T6338 6113-6126 Entity denotes pRL-thymidine
T6337 7059-7075 Protein denotes cellular protein
T6336 6963-6981 Protein denotes firefly luciferase
T6335 6215-6229 Protein denotes a Bio-Rad Gene
T5482 4523-4546 Protein denotes T4 DNA polymerase (NEB)
T5481 4415-4421 Protein denotes BstX I
T5480 4451-4456 Protein denotes Apo I
T5479 4192-4231 Protein denotes SerpinB2 luciferase reporter constructs
T5478 4257-4260 Protein denotes pGL
T5477 4656-4692 Entity denotes the murine SerpinB2 promoter regions
T5476 4141-4145 Protein denotes GLmP
T5475 5184-5188 Protein denotes GLmP
T5474 5320-5324 Protein denotes GLmP
T5473 5726-5736 Protein denotes the EcoR I
T5472 4361-4367 Protein denotes EcoR I
T5471 5319-5334 Protein denotes pGLmP-539mC/EBP
T5470 5535-5538 Protein denotes PCR
T5469 4895-4931 Entity denotes the SerpinB2 promoter LPS-responsive
T5468 3855-3858 Protein denotes PCR
T5467 3985-4000 Protein denotes Basic (Promega)
T5466 4233-4234 Entity denotes p
T5465 5506-5546 Entity denotes The flanking oligonucleotide PCR primers
T5464 4028-4034 Protein denotes EcoR I
T5463 4246-4250 Protein denotes GLmP
T5462 4439-4446 Protein denotes Hae III
T5461 4899-4907 Protein denotes SerpinB2
T5460 5701-5706 Protein denotes Xho I
T5459 5148-5151 Protein denotes Fig
T5458 5353-5357 Protein denotes PAI2
T5457 5438-5453 Protein denotes pGLmP-539mAP-1a
T5456 4140-4172 Entity denotes pGLmP-3261 to produce pGLmP-4480
T5455 4281-4282 Entity denotes p
T5454 5274-5278 Protein denotes GLmP
T5453 4963-4968 Protein denotes C/EBP
T5452 5439-5443 Protein denotes GLmP
T5451 4013-4017 Protein denotes GLmP
T5450 3765-3789 Entity denotes a Kpn I restriction site
T5449 4423-4430 Protein denotes Bsu36 I
T5448 5834-5842 Protein denotes SerpinB2
T5447 5810-5851 Entity denotes of the wild-type murine SerpinB2 promoter
T5446 4292-4297 Protein denotes pGLmP
T5445 4095-4136 Entity denotes the SerpinB2 promoter EcoR I site (−3261)
T5444 4163-4167 Protein denotes GLmP
T5443 3881-3889 Protein denotes SerpinB2
T5442 5352-5363 Protein denotes mPAI2mCEBPb
T5441 5084-5131 Entity denotes The mutant oligonucleotide PCR primer sequences
T5440 4818-4822 Protein denotes pGL3
T5439 4095-4136 Entity denotes the SerpinB2 promoter EcoR I site (−3261)
T5438 5020-5035 Protein denotes pGLmP-539mC/EBP
T5437 4762-4787 Protein denotes Basic to produce pGLmP-87
T5436 5336-5347 Protein denotes mPAI2mCEBPa
T5435 4162-4172 Entity denotes pGLmP-4480
T5434 4245-4246 Entity denotes p
T5433 4117-4123 Protein denotes EcoR I
T5432 5337-5341 Protein denotes PAI2
T5431 3818-3823 Protein denotes Xho I
T5430 4584-4586 Entity denotes T4
T5429 5459-5474 Protein denotes pGLmP-539mAP-1b
T5428 5423-5433 Protein denotes pGLmP-539m
T5427 3733-3736 Protein denotes PCR
T5426 5365-5396 Entity denotes The oligonucleotide PCR primers
T5425 4345-4350 Protein denotes pGLmP
T5424 4099-4107 Protein denotes SerpinB2
T5423 4840-4850 Protein denotes Luciferase
T5422 4401-4406 Protein denotes Sfi I
T5421 4818-4838 Protein denotes pGL3 Basic (Promega)
T5420 4584-4597 Protein denotes T4 DNA ligase
T5419 5460-5464 Protein denotes GLmP
T5418 5658-5661 Protein denotes PCR
T5417 4603-4606 Protein denotes PCR
T5416 4667-4675 Protein denotes SerpinB2
T5415 4947-4951 Protein denotes PU.1
T5414 4393-4407 Protein denotes enzyme (Sfi I,
T5413 4282-4286 Protein denotes GLmP
T5412 4971-4975 Protein denotes GLmP
T5411 4432-4437 Protein denotes Pac I
T5410 5002-5015 Protein denotes pGLmP-539mOct
T5409 3694-3728 Protein denotes of SerpinB2 Reporter Gene Plasmids
T5408 5385-5388 Protein denotes PCR
T5407 3877-3913 Entity denotes the SerpinB2 promoter (−3261 to +92)
T5406 5769-5773 Protein denotes GLmP
T5405 4012-4022 Entity denotes pGLmP-3261
T5404 5741-5746 Protein denotes Xho I
T5403 4234-4238 Protein denotes GLmP
T5402 5646-5670 Entity denotes Recombinant PCR products
T5401 4306-4311 Protein denotes pGLmP
T5400 5273-5286 Protein denotes pGLmP-539mOct
T5399 4192-4200 Protein denotes SerpinB2
T5398 4932-4952 Entity denotes regions E box, PU.1,
T5397 4361-4456 Protein denotes EcoR I and a second restriction enzyme (Sfi I, Apa I, BstX I, Bsu36 I, Pac I, Hae III and Apo I
T5396 5003-5007 Protein denotes GLmP
T5395 4523-4525 Entity denotes T4
T5394 5768-5777 Entity denotes pGLmP-539
T5393 4261-4274 Protein denotes P-1686, pGLmP
T5392 5111-5114 Protein denotes PCR
T5391 5690-5696 Protein denotes EcoR I
T5390 4542-4545 Protein denotes NEB
T5389 5021-5025 Protein denotes GLmP
T4500 3388-3465 Gene_expression denotes a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
T4499 2988-2999 Entity denotes 150 mM NaCl
T4498 3622-3627 Protein denotes GAPDH
T4497 3073-3100 Entity denotes separated on 4–12% Bis-Tris
T4496 3633-3644 Protein denotes α/β tubulin
T4495 3048-3056 Protein denotes 0.1% SDS
T4494 3146-3160 Entity denotes PVDF membranes
T4493 3029-3057 Entity denotes 0.5% deoxycholate, 0.1% SDS)
T4492 3646-3650 Entity denotes Cell
T4491 3580-3628 Protein denotes glyceraldehyde-3-phosphate dehydrogenase (GAPDH)
T4490 2976-3021 Entity denotes 10 mM Tris, 150 mM NaCl, 1%Triton X-100, 0.5%
T4489 3504-3523 Entity denotes western blot assays
T4488 3214-3228 Entity denotes PBS-T (1X PBS,
T4487 3533-3549 Protein denotes C/EBP-β (sc-150)
T4486 3146-3150 Entity denotes PVDF
T4485 2982-3000 Entity denotes Tris, 150 mM NaCl,
T4484 3388-3465 Protein denotes a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
T4483 3162-3171 Entity denotes Membranes
T4482 3108-3125 Entity denotes gels (Invitrogen)
T4481 3059-3067 Protein denotes proteins
T4480 3330-3349 Entity denotes SerpinB2 antibodies
T4479 3330-3338 Protein denotes SerpinB2
T4478 3264-3282 Entity denotes primary antibodies
T4477 3478-3523 Entity denotes Other antibodies used for western blot assays
T4057 2644-2652 Protein denotes SerpinB2
T4056 1751-1754 Entity denotes DNA
T4055 2849-2891 Protein denotes GenBank/EMBL/DDBJ Data Bank with Accession
T4054 2091-2187 Entity denotes genomic DNA isolated from a λFIXII (Stratagene) genomic library prepared from a 129 mouse strain
T4053 2465-2480 Entity denotes EcoRI fragment,
T4052 2852-2856 Protein denotes Bank
T4051 2602-2612 Entity denotes nucleotide
T4050 2598-2660 Protein denotes The nucleotide sequence of the 4480 bp murine SerpinB2 gene 5′
T4049 1874-1877 Entity denotes pDB
T4048 1777-1780 Entity denotes DNA
T4047 2549-2577 Protein denotes restriction enzyme digestion
T4046 2698-2711 Protein denotes the ABI PRISM
T4045 2849-2891 Protein denotes GenBank/EMBL/DDBJ Data Bank with Accession
T4044 1804-1812 Protein denotes SerpinB2
T4043 2319-2352 Entity denotes the transcription initiation site
T4042 2782-2786 Protein denotes a PE
T4041 2397-2400 Protein denotes Eco
T4040 2282-2287 Entity denotes EcoRI
T4039 1790-1821 Entity denotes of the murine SerpinB2 promoter
T4038 1851-1856 Entity denotes the p
T4037 2009-2034 Protein denotes exonuclease III digestion
T3719 1603-1638 Gene_expression denotes TaqMan® Gene Expression 20X primers
T3718 1437-1447 Entity denotes from cells
T3717 1477-1486 Protein denotes total RNA
T3716 1427-1436 Protein denotes total RNA
T3715 1372-1376 Protein denotes qPCR
T3714 1344-1377 Protein denotes Real-time Quantitative PCR (qPCR)
T3713 1678-1699 Protein denotes Cebpb (Mm00843434_s1)
T3712 1389-1406 Protein denotes Mini Kit (Qiagen)
T3711 1704-1727 Protein denotes β-actin (Mm00607939_s1)
T3710 1603-1615 Protein denotes TaqMan® Gene
T3709 1517-1576 Entity denotes TaqMan® Reverse Transcription Reagents (Applied Biosystems)
T3708 1453-1467 Entity denotes cDNA synthesis
T3707 1643-1677 Protein denotes Serpinb2/SerpinB2 (Mm00440905_m1),
T3315 661-790 Binding denotes Primary peritoneal macrophages were obtained by injecting C57BL/6 mice with 3% thioglycollate broth followed by peritoneal lavage
T3314 1123-1171 Regulation denotes exclude Mycoplasma infection by nuclear staining
T3313 607-617 Entity denotes penicillin
T3312 1002-1016 Entity denotes Cell viability
T3311 1055-1060 Protein denotes Sigma
T3310 661-691 Entity denotes Primary peritoneal macrophages
T3309 1042-1061 Entity denotes trypan blue (Sigma)
T3308 618-630 Entity denotes streptomycin
T3307 1247-1281 Entity denotes Bacterial lipopolysaccharide (LPS)
T3306 986-994 Entity denotes LPS-free
T3305 834-837 Protein denotes F12
T3304 845-854 Protein denotes Gibco BRL
T3303 607-640 Entity denotes penicillin/streptomycin/glutamate
T3302 1277-1280 Entity denotes LPS
T3301 740-754 Entity denotes thioglycollate
T3300 1224-1245 Protein denotes Detection Kit (Lonza)
T3299 901-919 Entity denotes lipopolysaccharide
T3298 1336-1341 Protein denotes Sigma
T3297 607-640 Entity denotes penicillin/streptomycin/glutamate
T3296 1199-1204 Protein denotes Sigma
T6355 7123-7126 Entity denotes LPS
T6354 7030-7040 Protein denotes luciferase
T6353 7015-7021 Protein denotes pRL-TK
T6352 6117-6126 Entity denotes thymidine
T6351 7136-7142 Protein denotes pRL-TK
T7582 8991-8996 Protein denotes T217A
T7581 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7580 9196-9236 Protein denotes β-Galactosidase Enzyme Assay System Kits
T7579 9196-9211 Protein denotes β-Galactosidase
T7578 8984-8997 Protein denotes T188A, T217A,
T7577 8939-8946 Protein denotes C/EBP-β
T7576 8950-9003 Protein denotes C/EBP-β phospho-acceptor mutants (T188A, T217A, S64A)
T7575 9378-9425 Protein denotes of the C/EBP-β phospho-acceptor mutant proteins
T6926 8327-8371 Protein denotes 72 hrs to allow for effective gene knockdown
T6925 7442-7447 Protein denotes cebpb
T6924 7977-7988 Entity denotes supernatant
T6923 7921-7960 Entity denotes Lipofectamine 2000 reagent (Invitrogen)
T6922 8373-8380 Protein denotes C/EBP-β
T6921 8229-8235 Protein denotes 24 hrs
T6920 8003-8009 Protein denotes 48 hrs
T6919 7648-7651 Protein denotes RNA
T6918 7584-7610 Entity denotes cells of the other species
T6917 8116-8132 Entity denotes The target cells
T6916 8357-8361 Protein denotes gene
T6915 8151-8177 Entity denotes the lentiviral supernatant
T6914 7709-7730 Entity denotes lentiviral particles,
T6913 8237-8263 Entity denotes The lentiviral supernatant
T6912 8182-8224 Entity denotes 8 µg/ml Polybrene (American Bioanalytical)
T6911 7640-7645 Protein denotes CEBPB
T6910 7374-7385 Protein denotes mouse cebpb
T6909 7763-7789 Entity denotes with a mixture of plasmids
T6908 7549-7568 Protein denotes of endogenous C/EBP
T6367 7091-7151 Regulation denotes where co-transfected C/EBP-β or LPS affected pRL-TK activity
T6366 7091-7151 Regulation denotes where co-transfected C/EBP-β or LPS affected pRL-TK activity
T6365 7015-7021 Protein denotes pRL-TK
T6364 6481-6498 Entity denotes Transfected cells
T6363 6135-6137 Protein denotes TK
T6362 7097-7119 Protein denotes co-transfected C/EBP-β
T6361 6109-6138 Protein denotes the pRL-thymidine kinase (TK)
T6360 6620-6648 Protein denotes incubated 16 hrs in a 5% CO2
T6359 7136-7142 Protein denotes pRL-TK
T6358 6915-6923 Entity denotes Promoter
T6357 6743-6753 Protein denotes Luciferase
T6356 6782-6814 Protein denotes a Dual-Luciferase Reporter Assay
R5780 T8041 T8058 themeOf Antibodies,Antibodies were purchased from Santa Cruz
R6236 T8596 T8618 themeOf the bound chromatin,the bound chromatin
R6237 T8601 T8590 partOf the SerpinB2 proximal promoter,SerpinB2
R2698 T3710 T3719 themeOf TaqMan® Gene,TaqMan® Gene Expression 20X primers
R2951 T4039 T4044 partOf of the murine SerpinB2 promoter,SerpinB2
R3290 T4484 T4500 themeOf a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli,a purified recombinant GST-murine SerpinB2 fusion protein produced in E. coli
R3841 T5407 T5443 partOf the SerpinB2 promoter (−3261 to +92),SerpinB2
R3842 T5447 T5448 partOf of the wild-type murine SerpinB2 promoter,SerpinB2
R3843 T5469 T5461 partOf the SerpinB2 promoter LPS-responsive,SerpinB2
R4504 T6355 T6367 causeOf LPS,where co-transfected C/EBP-β or LPS affected pRL-TK activity
R4505 T6362 T6366 causeOf co-transfected C/EBP-β,where co-transfected C/EBP-β or LPS affected pRL-TK activity
R5402 T7575 T7596 themeOf of the C/EBP-β phospho-acceptor mutant proteins,Expression of the C/EBP-β phospho-acceptor mutant proteins

bionlp-st-ge-2016-test-tees

Id Subject Object Predicate Lexical cue
T8579 11748-11774 Protein denotes SerpinB2 proximal promoter
T8578 11529-11541 Protein denotes Proteinase K
T8577 11268-11280 Protein denotes Clone CTD4H8
T8576 11249-11266 Protein denotes RNA polymerase II
T8575 11203-11206 Protein denotes IgG
T8574 11170-11174 Protein denotes T217
T8573 11159-11168 Protein denotes p-C/EBP-β
T8572 11140-11147 Protein denotes C/EBP-β
T8571 10431-10450 Localization denotes Immunoprecipitation
T8570 10421-10430 Protein denotes Chromatin
T8022 10397-10409 Protein denotes anti-C/EBP-ε
T8021 10371-10383 Protein denotes anti-C/EBP-δ
T8020 10348-10360 Protein denotes anti-C/EBP-β
T8019 10326-10338 Protein denotes anti-C/EBP-α
T8018 10267-10281 Protein denotes C/EBP antibody
T8017 10146-10149 Protein denotes Rad
T8016 9610-9634 Protein denotes T4 polynucleotide kinase
T7561 9430-9437 Positive_regulation denotes checked
T7560 9367-9377 Gene_expression denotes Expression
T7559 9385-9425 Protein denotes C/EBP-β phospho-acceptor mutant proteins
T7558 9196-9218 Protein denotes β-Galactosidase Enzyme
T7557 9185-9191 Protein denotes System
T7556 9168-9178 Protein denotes Luciferase
T7555 9137-9152 Protein denotes β-galactosidase
T7554 9076-9086 Protein denotes Luciferase
T7553 8950-8957 Protein denotes C/EBP-β
T7552 8939-8946 Protein denotes C/EBP-β
T7551 8603-8635 Protein denotes β-actin-β-galactosidase reporter
T7550 8553-8563 Protein denotes luciferase
T7549 5940-5950 Protein denotes Luciferase
T6900 8381-8390 Negative_regulation denotes knockdown
T6899 8373-8380 Protein denotes C/EBP-β
T6898 7528-7537 Negative_regulation denotes knockdown
T6897 7657-7664 Regulation denotes control
T6896 7538-7548 Gene_expression denotes expression
T6895 7634-7651 Protein denotes human CEBPB shRNA
T6894 7563-7570 Protein denotes C/EBP-β
T6317 7205-7208 Protein denotes Rad
T6316 7127-7135 Regulation denotes affected
T6315 7127-7135 Regulation denotes affected
T6314 6936-6945 Gene_expression denotes expressed
T6313 7140-7142 Protein denotes TK
T6312 7136-7139 Protein denotes pRL
T6311 7112-7119 Protein denotes C/EBP-β
T6310 7019-7052 Protein denotes TK renilla luciferase light units
T6309 7015-7018 Protein denotes pRL
T6308 6971-6981 Protein denotes luciferase
T6307 6789-6799 Protein denotes Luciferase
T6306 6743-6753 Protein denotes Luciferase
T6305 6324-6337 Protein denotes SV40 promoter
T6304 6135-6137 Protein denotes TK
T6303 6113-6133 Protein denotes pRL-thymidine kinase
T6302 6062-6072 Protein denotes luciferase
T6301 5940-5950 Protein denotes Luciferase
T5348 5834-5851 Protein denotes SerpinB2 promoter
T5347 5741-5746 Protein denotes Xho I
T5346 5730-5736 Protein denotes EcoR I
T5345 5701-5706 Protein denotes Xho I
T5344 5690-5696 Protein denotes EcoR I
T5343 5646-5670 Protein denotes Recombinant PCR products
T5342 5352-5363 Protein denotes mPAI2mCEBPb
T5341 5336-5347 Protein denotes mPAI2mCEBPa
T5340 5319-5334 Protein denotes pGLmP-539mC/EBP
T5339 5305-5317 Protein denotes mPAI2mOct-2b
T5338 5288-5300 Protein denotes mPAI2mOct-2a
T5337 5273-5286 Protein denotes pGLmP-539mOct
T5336 5260-5271 Protein denotes mPAI2mPU.1b
T5335 5244-5255 Protein denotes mPAI2mPU.1a
T5334 5148-5151 Protein denotes Fig
T5333 4963-4968 Protein denotes C/EBP
T5332 4953-4958 Protein denotes Oct-1
T5331 4947-4951 Protein denotes PU.1
T5330 4840-4870 Protein denotes Luciferase reporter constructs
T5329 4771-4778 Gene_expression denotes produce
T5328 4757-4761 Protein denotes pGL3
T5327 4713-4724 Protein denotes Kpn I/Xho I
T5326 4584-4597 Protein denotes T4 DNA ligase
T5325 4542-4545 Protein denotes NEB
T5324 4523-4540 Protein denotes T4 DNA polymerase
T5323 4451-4456 Protein denotes Apo I
T5322 4439-4446 Protein denotes Hae III
T5321 4432-4437 Protein denotes Pac I
T5320 4423-4430 Protein denotes Bsu36 I
T5319 4415-4421 Protein denotes BstX I
T5318 4408-4413 Protein denotes Apa I
T5317 4401-4406 Protein denotes Sfi I
T5316 4361-4367 Protein denotes EcoR I
T5315 4185-4220 Protein denotes murine SerpinB2 luciferase reporter
T5314 4154-4161 Gene_expression denotes produce
T5313 4028-4034 Protein denotes EcoR I
T5312 3980-3984 Protein denotes pGL3
T5311 3936-3947 Protein denotes Kpn I/Xho I
T5310 3767-3772 Protein denotes Kpn I
T5309 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4468 3633-3644 Protein denotes α/β tubulin
T4467 3622-3627 Protein denotes GAPDH
T4466 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4465 3533-3540 Protein denotes C/EBP-β
T4464 3446-3454 Gene_expression denotes produced
T4463 3446-3454 Gene_expression denotes produced
T4462 3415-3445 Protein denotes murine SerpinB2 fusion protein
T4461 3411-3414 Protein denotes GST
T4029 2702-2711 Protein denotes ABI PRISM
T4028 2457-2479 Protein denotes pDB9406 EcoRI fragment
T4027 2397-2402 Protein denotes EcoRI
T4026 2288-2292 Protein denotes SpeI
T4025 2282-2287 Protein denotes EcoRI
T4024 2009-2024 Protein denotes exonuclease III
T4023 1797-1821 Protein denotes murine SerpinB2 promoter
T3699 1713-1726 Protein denotes Mm00607939_s1
T3698 1704-1711 Protein denotes β-actin
T3697 1685-1698 Protein denotes Mm00843434_s1
T3696 1678-1683 Protein denotes Cebpb
T3695 1662-1675 Protein denotes Mm00440905_m1
T3694 1652-1660 Protein denotes SerpinB2
T3693 1643-1651 Protein denotes Serpinb2
R3286 T4461 T4463 themeOf GST,produced
R3287 T4462 T4464 themeOf murine SerpinB2 fusion protein,produced
R3837 T5313 T5314 themeOf EcoR I,produce
R3838 T5328 T5329 themeOf pGL3,produce
R4494 T6308 T6314 themeOf luciferase,expressed
R4495 T6311 T6315 causeOf C/EBP-β,affected
R4496 T6311 T6316 causeOf C/EBP-β,affected
R4497 T6312 T6315 themeOf pRL,affected
R4498 T6313 T6316 themeOf TK,affected
R4961 T6894 T6896 themeOf C/EBP-β,expression
R4962 T6896 T6897 themeOf expression,control
R4963 T6896 T6898 themeOf expression,knockdown
R4964 T6899 T6900 themeOf C/EBP-β,knockdown
R5398 T7559 T7560 themeOf C/EBP-β phospho-acceptor mutant proteins,Expression
R5399 T7560 T7561 themeOf Expression,checked
R6234 T8570 T8571 themeOf Chromatin,Immunoprecipitation

testone

Id Subject Object Predicate Lexical cue
T8260 11748-11756 Protein denotes SerpinB2
T8259 11529-11541 Protein denotes Proteinase K
T8258 11359-11368 Protein denotes Protein G
T7814 9610-9634 Protein denotes T4 polynucleotide kinase
T7177 9448-9458 Gene_expression denotes expression
T7176 9367-9377 Gene_expression denotes Expression
T7175 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7174 9196-9211 Protein denotes β-Galactosidase
T7173 9168-9178 Protein denotes Luciferase
T7172 9137-9152 Protein denotes β-galactosidase
T7171 9076-9086 Protein denotes Luciferase
T7170 8998-9002 Protein denotes S64A
T7169 8991-8996 Protein denotes T217A
T7168 8984-8989 Protein denotes T188A
T7167 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7166 8939-8946 Protein denotes C/EBP-β
T7165 8611-8626 Protein denotes β-galactosidase
T7164 8603-8610 Protein denotes β-actin
T7163 8553-8563 Protein denotes luciferase
T7162 8489-8494 Protein denotes Cebpb
T7161 5940-5950 Protein denotes Luciferase
T6620 8381-8390 Negative_regulation denotes knockdown
T6619 7701-7708 Gene_expression denotes produce
T6618 7538-7548 Gene_expression denotes expression
T6617 7528-7537 Negative_regulation denotes knockdown
T6616 8373-8380 Protein denotes C/EBP-β
T6615 7563-7570 Protein denotes C/EBP-β
T6614 7442-7447 Protein denotes cebpb
T6613 7380-7385 Protein denotes cebpb
T5939 7127-7135 Regulation denotes affected
T5938 7097-7111 Gene_expression denotes co-transfected
T5937 6936-6945 Gene_expression denotes expressed
T5936 7140-7142 Protein denotes TK
T5935 7112-7119 Protein denotes C/EBP-β
T5934 7030-7040 Protein denotes luciferase
T5933 7019-7021 Protein denotes TK
T5932 6971-6981 Protein denotes luciferase
T5931 6789-6799 Protein denotes Luciferase
T5930 6743-6753 Protein denotes Luciferase
T5929 6135-6137 Protein denotes TK
T5928 6117-6133 Protein denotes thymidine kinase
T5927 6062-6072 Protein denotes luciferase
T5926 5940-5950 Protein denotes Luciferase
T4698 4771-4778 Gene_expression denotes produce
T4697 4154-4161 Gene_expression denotes produce
T4696 4004-4011 Gene_expression denotes produce
T4695 5834-5842 Protein denotes SerpinB2
T4694 5701-5706 Protein denotes Xho I
T4693 5690-5696 Protein denotes EcoR I
T4692 4899-4907 Protein denotes SerpinB2
T4691 4840-4859 Protein denotes Luciferase reporter
T4690 4667-4675 Protein denotes SerpinB2
T4689 4584-4597 Protein denotes T4 DNA ligase
T4688 4523-4540 Protein denotes T4 DNA polymerase
T4687 4451-4456 Protein denotes Apo I
T4686 4439-4446 Protein denotes Hae III
T4685 4432-4437 Protein denotes Pac I
T4684 4423-4430 Protein denotes Bsu36 I
T4683 4415-4421 Protein denotes BstX I
T4682 4408-4413 Protein denotes Apa I
T4681 4401-4406 Protein denotes Sfi I
T4680 4361-4367 Protein denotes EcoR I
T4679 4192-4220 Protein denotes SerpinB2 luciferase reporter
T4678 4099-4107 Protein denotes SerpinB2
T4677 3881-3889 Protein denotes SerpinB2
T4676 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4250 3622-3627 Protein denotes GAPDH
T4249 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4248 3533-3540 Protein denotes C/EBP-β
T4247 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T3803 2009-2024 Protein denotes exonuclease III
T3802 1804-1812 Protein denotes SerpinB2
T3151 447-452 Protein denotes Cebpb
T3150 423-428 Protein denotes Cebpb
T3804 2644-2652 Protein denotes SerpinB2
T3571 1704-1711 Protein denotes β-actin
T3570 1678-1683 Protein denotes Cebpb
T3569 1652-1660 Protein denotes SerpinB2
T3568 1643-1651 Protein denotes Serpinb2
R3134 T4250 T4249 equivalentTo GAPDH,glyceraldehyde-3-phosphate dehydrogenase
R4256 T5929 T5928 equivalentTo TK,thymidine kinase
R4257 T5932 T5938 themeOf luciferase,co-transfected
R4258 T5932 T5937 themeOf luciferase,expressed
R4259 T5934 T5938 themeOf luciferase,co-transfected
R4260 T5934 T5937 themeOf luciferase,expressed
R4261 T5935 T5938 themeOf C/EBP-β,co-transfected
R4262 T5938 T5939 themeOf co-transfected,affected
R4736 T6615 T6618 themeOf C/EBP-β,expression
R4737 T6616 T6620 themeOf C/EBP-β,knockdown
R5184 T7168 T7167 equivalentTo T188A,C/EBP-β phospho-acceptor mutants
R5185 T7175 T7177 themeOf C/EBP-β phospho-acceptor mutant,expression
R5186 T7175 T7176 themeOf C/EBP-β phospho-acceptor mutant,Expression

test3

Id Subject Object Predicate Lexical cue
T8266 11748-11756 Protein denotes SerpinB2
T8265 11529-11541 Protein denotes Proteinase K
T8264 11359-11368 Protein denotes Protein G
T8263 11748-11756 Protein denotes SerpinB2
T8262 11529-11541 Protein denotes Proteinase K
T8261 11359-11368 Protein denotes Protein G
T7816 9610-9634 Protein denotes T4 polynucleotide kinase
T7815 9610-9634 Protein denotes T4 polynucleotide kinase
T7209 9448-9458 Gene_expression denotes expression
T7208 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7207 9367-9377 Gene_expression denotes Expression
T7206 9196-9211 Protein denotes β-Galactosidase
T7205 9168-9178 Protein denotes Luciferase
T7204 9137-9152 Protein denotes β-galactosidase
T7203 9076-9086 Protein denotes Luciferase
T7202 8998-9002 Protein denotes S64A
T7201 8991-8996 Protein denotes T217A
T7200 8984-8989 Protein denotes T188A
T7199 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7198 8939-8946 Protein denotes C/EBP-β
T7197 8611-8626 Protein denotes β-galactosidase
T7196 8603-8610 Protein denotes β-actin
T7195 8553-8563 Protein denotes luciferase
T7194 8489-8494 Protein denotes Cebpb
T7193 5940-5950 Protein denotes Luciferase
T7192 9385-9416 Protein denotes C/EBP-β phospho-acceptor mutant
T7191 9196-9211 Protein denotes β-Galactosidase
T7190 9168-9178 Protein denotes Luciferase
T7189 9137-9152 Protein denotes β-galactosidase
T7188 9076-9086 Protein denotes Luciferase
T7187 8998-9002 Protein denotes S64A
T7186 8991-8996 Protein denotes T217A
T7185 8984-8989 Protein denotes T188A
T7184 8950-8982 Protein denotes C/EBP-β phospho-acceptor mutants
T7183 8939-8946 Protein denotes C/EBP-β
T7182 8611-8626 Protein denotes β-galactosidase
T7181 8603-8610 Protein denotes β-actin
T7180 8553-8563 Protein denotes luciferase
T7179 8489-8494 Protein denotes Cebpb
T7178 5940-5950 Protein denotes Luciferase
T6631 8381-8390 Negative_regulation denotes knockdown
T6630 8373-8380 Protein denotes C/EBP-β
T6629 7563-7570 Protein denotes C/EBP-β
T6628 7538-7548 Gene_expression denotes expression
T6627 7528-7537 Negative_regulation denotes knockdown
T6626 7442-7447 Protein denotes cebpb
T6625 7380-7385 Protein denotes cebpb
T6624 8373-8380 Protein denotes C/EBP-β
T6623 7563-7570 Protein denotes C/EBP-β
T6622 7442-7447 Protein denotes cebpb
T6621 7380-7385 Protein denotes cebpb
T5963 7140-7142 Protein denotes TK
T5962 7112-7119 Protein denotes C/EBP-β
T5961 7100-7111 Gene_expression denotes transfected
T5960 7030-7040 Protein denotes luciferase
T5959 7019-7021 Protein denotes TK
T5958 6971-6981 Protein denotes luciferase
T5957 6936-6945 Gene_expression denotes expressed
T5956 6789-6799 Protein denotes Luciferase
T5955 6743-6753 Protein denotes Luciferase
T5954 6135-6137 Protein denotes TK
T5953 6117-6133 Protein denotes thymidine kinase
T5952 6062-6072 Protein denotes luciferase
T5951 5940-5950 Protein denotes Luciferase
T5950 7140-7142 Protein denotes TK
T5949 7112-7119 Protein denotes C/EBP-β
T5948 7030-7040 Protein denotes luciferase
T5947 7019-7021 Protein denotes TK
T5946 6971-6981 Protein denotes luciferase
T5945 6789-6799 Protein denotes Luciferase
T5944 6743-6753 Protein denotes Luciferase
T5943 6135-6137 Protein denotes TK
T5942 6117-6133 Protein denotes thymidine kinase
T5941 6062-6072 Protein denotes luciferase
T5940 5940-5950 Protein denotes Luciferase
T4740 5834-5842 Protein denotes SerpinB2
T4739 5701-5706 Protein denotes Xho I
T4738 5690-5696 Protein denotes EcoR I
T4737 4899-4907 Protein denotes SerpinB2
T4736 4840-4859 Protein denotes Luciferase reporter
T4735 4667-4675 Protein denotes SerpinB2
T4734 4584-4597 Protein denotes T4 DNA ligase
T4733 4523-4540 Protein denotes T4 DNA polymerase
T4732 4451-4456 Protein denotes Apo I
T4731 4439-4446 Protein denotes Hae III
T4730 4432-4437 Protein denotes Pac I
T4729 4423-4430 Protein denotes Bsu36 I
T4728 4415-4421 Protein denotes BstX I
T4727 4408-4413 Protein denotes Apa I
T4726 4401-4406 Protein denotes Sfi I
T4725 4361-4367 Protein denotes EcoR I
T4724 4192-4220 Protein denotes SerpinB2 luciferase reporter
T4723 4154-4161 Gene_expression denotes produce
T4722 4099-4107 Protein denotes SerpinB2
T4721 4004-4011 Gene_expression denotes produce
T4720 3881-3889 Protein denotes SerpinB2
T4719 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4718 5834-5842 Protein denotes SerpinB2
T4717 5701-5706 Protein denotes Xho I
T4716 5690-5696 Protein denotes EcoR I
T4715 4899-4907 Protein denotes SerpinB2
T4714 4840-4859 Protein denotes Luciferase reporter
T4713 4667-4675 Protein denotes SerpinB2
T4712 4584-4597 Protein denotes T4 DNA ligase
T4711 4523-4540 Protein denotes T4 DNA polymerase
T4710 4451-4456 Protein denotes Apo I
T4709 4439-4446 Protein denotes Hae III
T4708 4432-4437 Protein denotes Pac I
T4707 4423-4430 Protein denotes Bsu36 I
T4706 4415-4421 Protein denotes BstX I
T4705 4408-4413 Protein denotes Apa I
T4704 4401-4406 Protein denotes Sfi I
T4703 4361-4367 Protein denotes EcoR I
T4702 4192-4220 Protein denotes SerpinB2 luciferase reporter
T4701 4099-4107 Protein denotes SerpinB2
T4700 3881-3889 Protein denotes SerpinB2
T4699 3697-3719 Protein denotes SerpinB2 Reporter Gene
T4258 3622-3627 Protein denotes GAPDH
T4257 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4256 3533-3540 Protein denotes C/EBP-β
T4255 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T4254 3622-3627 Protein denotes GAPDH
T4253 3580-3620 Protein denotes glyceraldehyde-3-phosphate dehydrogenase
T4252 3533-3540 Protein denotes C/EBP-β
T4251 3411-3445 Protein denotes GST-murine SerpinB2 fusion protein
T3155 447-452 Protein denotes Cebpb
T3154 423-428 Protein denotes Cebpb
T3153 447-452 Protein denotes Cebpb
T3152 423-428 Protein denotes Cebpb
T3810 2644-2652 Protein denotes SerpinB2
T3809 2009-2024 Protein denotes exonuclease III
T3808 1804-1812 Protein denotes SerpinB2
T3807 2644-2652 Protein denotes SerpinB2
T3806 2009-2024 Protein denotes exonuclease III
T3805 1804-1812 Protein denotes SerpinB2
T3579 1704-1711 Protein denotes β-actin
T3578 1678-1683 Protein denotes Cebpb
T3577 1652-1660 Protein denotes SerpinB2
T3576 1643-1651 Protein denotes Serpinb2
T3575 1704-1711 Protein denotes β-actin
T3574 1678-1683 Protein denotes Cebpb
T3573 1652-1660 Protein denotes SerpinB2
T3572 1643-1651 Protein denotes Serpinb2
R3135 T4258 T4257 equivalentTo GAPDH,glyceraldehyde-3-phosphate dehydrogenase
R4263 T5954 T5953 equivalentTo TK,thymidine kinase
R4264 T5958 T5957 themeOf luciferase,expressed
R4265 T5960 T5957 themeOf luciferase,expressed
R4266 T5962 T5961 themeOf C/EBP-β,transfected
R4738 T6626 T6627 causeOf cebpb,knockdown
R4739 T6628 T6627 themeOf expression,knockdown
R4740 T6629 T6628 themeOf C/EBP-β,expression
R4741 T6630 T6631 themeOf C/EBP-β,knockdown
R5187 T7200 T7199 equivalentTo T188A,C/EBP-β phospho-acceptor mutants
R5188 T7208 T7207 themeOf C/EBP-β phospho-acceptor mutant,Expression
R5189 T7208 T7209 themeOf C/EBP-β phospho-acceptor mutant,expression