PMC:3585731 / 49870-57674
Annnotations
testone
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28164 | 7226-7230 | Protein | denotes | TNFα |
T28163 | 7209-7213 | Protein | denotes | TNFα |
T28276 | 7731-7746 | Phosphorylation | denotes | Phosphorylation |
T28275 | 7557-7564 | Protein | denotes | Myr-Akt |
T27772 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27054 | 4936-4940 | Protein | denotes | TNFα |
T27053 | 4777-4781 | Protein | denotes | TNFα |
T26705 | 4532-4536 | Protein | denotes | TNFα |
T26704 | 4333-4338 | Protein | denotes | Mapk9 |
T26703 | 4306-4311 | Protein | denotes | Mapk8 |
T26702 | 4243-4247 | Protein | denotes | PDK1 |
T26701 | 4191-4195 | Protein | denotes | Akt3 |
T26700 | 4165-4169 | Protein | denotes | Akt2 |
T26699 | 4139-4143 | Protein | denotes | Akt1 |
T26184 | 2738-2747 | Negative_regulation | denotes | deficient |
T26183 | 2733-2737 | Protein | denotes | FADD |
T25976 | 2671-2674 | Protein | denotes | 18S |
T25975 | 2623-2626 | Protein | denotes | 18S |
T25974 | 2573-2577 | Protein | denotes | TNFα |
T25973 | 2522-2526 | Protein | denotes | TNFα |
T25972 | 2432-2435 | Protein | denotes | 18S |
T25971 | 2347-2351 | Protein | denotes | TNFα |
T25579 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25578 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25577 | 1119-1127 | Protein | denotes | Myr-Akt1 |
T25119 | 250-259 | Negative_regulation | denotes | inhibitor |
T25118 | 1012-1017 | Protein | denotes | IGF-1 |
T25117 | 972-975 | Protein | denotes | EGF |
T25116 | 955-959 | Protein | denotes | bFGF |
T25115 | 932-936 | Protein | denotes | TNFα |
R17901 | T26183 | T26184 | themeOf | FADD,deficient |
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
23469174-18408713-90505484 | 108-110 | 18408713 | denotes | 23 |
23469174-16153840-90505485 | 114-116 | 16153840 | denotes | 24 |
23469174-21041639-90505486 | 1181-1183 | 21041639 | denotes | 52 |
23469174-19825827-90505487 | 2867-2869 | 19825827 | denotes | 53 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28361 | 7799-7803 | NN | denotes | blot |
T28360 | 7791-7798 | JJ | denotes | western |
T28359 | 7788-7790 | IN | denotes | by |
T28358 | 7777-7787 | VB | denotes | visualized |
T28357 | 7773-7776 | VB | denotes | was |
T28356 | 7765-7772 | NN | denotes | protein |
T28355 | 7758-7764 | NN | denotes | fusion |
T28354 | 7754-7757 | NN | denotes | GSK |
T28353 | 7750-7753 | DT | denotes | the |
T28352 | 7747-7749 | IN | denotes | of |
T28351 | 7731-7746 | NN | denotes | Phosphorylation |
T28350 | 7720-7729 | NN | denotes | substrate |
T28349 | 7712-7719 | NN | denotes | protein |
T28348 | 7705-7711 | NN | denotes | fusion |
T28347 | 7701-7704 | NN | denotes | GSK |
T28346 | 7699-7700 | DT | denotes | a |
T28345 | 7696-7698 | IN | denotes | of |
T28344 | 7687-7695 | NN | denotes | presence |
T28343 | 7683-7686 | DT | denotes | the |
T28342 | 7680-7682 | IN | denotes | in |
T28341 | 7670-7679 | VB | denotes | performed |
T28340 | 7666-7669 | VB | denotes | was |
T28339 | 7660-7665 | NN | denotes | assay |
T28216 | 7401-7405 | NN | denotes | dish |
T28215 | 7397-7400 | NN | denotes | cm2 |
T28214 | 7394-7396 | CD | denotes | 10 |
T28213 | 7392-7393 | DT | denotes | a |
T28212 | 7389-7391 | IN | denotes | in |
T28211 | 7381-7388 | VB | denotes | treated |
T28210 | 7377-7380 | CC | denotes | and |
T28209 | 7370-7376 | VB | denotes | plated |
T28208 | 7364-7369 | NN | denotes | cells |
T28207 | 7358-7363 | CD | denotes | 3×106 |
T28206 | 7353-7357 | IN | denotes | from |
T28205 | 7344-7352 | VB | denotes | prepared |
T28204 | 7339-7343 | VB | denotes | were |
T28203 | 7331-7338 | NN | denotes | lysates |
T28202 | 7326-7330 | NN | denotes | Cell |
T28201 | 7312-7324 | NN | denotes | descriptions |
T28200 | 7297-7311 | NN | denotes | manufacturer’s |
T28199 | 7294-7296 | TO | denotes | to |
T28198 | 7284-7293 | VB | denotes | according |
T28197 | 7274-7283 | VB | denotes | performed |
T28196 | 7269-7273 | VB | denotes | were |
T28195 | 7267-7268 | -RRB- | denotes | ) |
T28194 | 7260-7267 | NNP | denotes | Systems |
T28193 | 7258-7259 | NNP | denotes | D |
T28192 | 7257-7258 | CC | denotes | & |
T28191 | 7256-7257 | NN | denotes | R |
T28190 | 7255-7256 | -LRB- | denotes | ( |
T28189 | 7248-7254 | NN | denotes | assays |
T28188 | 7242-7247 | NN | denotes | ELISA |
T28187 | 7231-7241 | NN | denotes | Quantikine |
T28186 | 7226-7230 | NN | denotes | TNFα |
T28185 | 7220-7225 | NN | denotes | Mouse |
T28184 | 7214-7219 | NN | denotes | ELISA |
T28183 | 7209-7213 | NN | denotes | TNFα |
T28058 | 7200-7206 | NN | denotes | values |
T28057 | 7192-7199 | NN | denotes | pan-Akt |
T28056 | 7189-7191 | IN | denotes | on |
T28055 | 7183-7188 | VB | denotes | based |
T28054 | 7172-7182 | VB | denotes | normalized |
T28053 | 7167-7171 | VB | denotes | were |
T28052 | 7148-7166 | NN | denotes | phospho-antibodies |
T28051 | 7144-7147 | IN | denotes | for |
T28050 | 7136-7143 | NNP | denotes | Signals |
T28049 | 7131-7135 | NNP | denotes | 4°C. |
T28048 | 7128-7130 | IN | denotes | at |
T28047 | 7118-7127 | RB | denotes | overnight |
T28046 | 7108-7117 | VB | denotes | incubated |
T28045 | 7104-7107 | VB | denotes | was |
T28044 | 7096-7103 | NN | denotes | pan-Akt |
T28043 | 7093-7095 | TO | denotes | to |
T28042 | 7084-7092 | NN | denotes | antibody |
T28041 | 7076-7083 | JJ | denotes | Primary |
T28040 | 7063-7074 | NN | denotes | temperature |
T28039 | 7058-7062 | NN | denotes | room |
T28038 | 7055-7057 | IN | denotes | at |
T28037 | 7052-7054 | NN | denotes | hr |
T28036 | 7050-7051 | CD | denotes | 2 |
T28035 | 7046-7049 | IN | denotes | for |
T28034 | 7038-7045 | NN | denotes | samples |
T28033 | 7034-7037 | DT | denotes | the |
T28032 | 7029-7033 | IN | denotes | with |
T28031 | 7019-7028 | VB | denotes | incubated |
T28030 | 7014-7018 | VB | denotes | were |
T28029 | 6999-7013 | NN | denotes | phopsho-Ser473 |
T28010 | 6881-6883 | IN | denotes | of |
T28009 | 6869-6880 | NN | denotes | microliters |
T28008 | 6864-6868 | CD | denotes | Five |
T28007 | 6857-6862 | NN | denotes | blots |
T28006 | 6849-6856 | JJ | denotes | Western |
T28005 | 6845-6848 | IN | denotes | for |
T28004 | 6835-6844 | VB | denotes | described |
T28003 | 6832-6834 | IN | denotes | as |
T28002 | 6825-6831 | NN | denotes | buffer |
T28001 | 6820-6824 | NN | denotes | RIPA |
T28000 | 6817-6819 | IN | denotes | in |
T27999 | 6808-6816 | VB | denotes | prepared |
T27998 | 6803-6807 | VB | denotes | were |
T27997 | 6795-6802 | NN | denotes | lysates |
T27996 | 6790-6794 | NN | denotes | Cell |
T27995 | 6775-6788 | NN | denotes | modifications |
T27994 | 6765-6774 | VB | denotes | following |
T27993 | 6761-6764 | DT | denotes | the |
T27992 | 6756-6760 | IN | denotes | with |
T27991 | 6747-6755 | NN | denotes | protocol |
T27990 | 6732-6746 | NN | denotes | manufacturer’s |
T27989 | 6729-6731 | TO | denotes | to |
T27988 | 6719-6728 | VB | denotes | according |
T27987 | 6709-6718 | VB | denotes | performed |
T27986 | 6704-6708 | VB | denotes | were |
T27985 | 6702-6703 | -RRB- | denotes | ) |
T27984 | 6693-6702 | NNP | denotes | Australia |
T27983 | 6691-6692 | -COMMA- | denotes | , |
T27982 | 6682-6691 | NNP | denotes | Hindmarsh |
T27981 | 6680-6681 | -COMMA- | denotes | , |
T27980 | 6674-6680 | NNP | denotes | TGRBio |
T27979 | 6673-6674 | -LRB- | denotes | ( |
T27978 | 6666-6672 | NN | denotes | assays |
T27977 | 6657-6665 | NN | denotes | ELISAOne |
T27976 | 6651-6656 | NN | denotes | Assay |
T27857 | 6630-6639 | NN | denotes | puromycin |
T27856 | 6624-6629 | NN | denotes | µg/ml |
T27855 | 6621-6623 | CD | denotes | 10 |
T27854 | 6618-6620 | IN | denotes | in |
T27853 | 6607-6617 | VB | denotes | maintained |
T27852 | 6603-6606 | CC | denotes | and |
T27851 | 6594-6602 | VB | denotes | selected |
T27850 | 6589-6593 | VB | denotes | were |
T27849 | 6583-6588 | NN | denotes | Cells |
T27848 | 6572-6581 | NN | denotes | polybrene |
T27847 | 6566-6571 | NN | denotes | µg/ml |
T27846 | 6564-6565 | CD | denotes | 8 |
T27845 | 6559-6563 | IN | denotes | with |
T27844 | 6553-6558 | NN | denotes | cells |
T27843 | 6548-6552 | NN | denotes | L929 |
T27842 | 6545-6547 | TO | denotes | to |
T27841 | 6537-6544 | VB | denotes | applied |
T27840 | 6533-6536 | CC | denotes | and |
T27839 | 6526-6532 | NN | denotes | filter |
T27838 | 6523-6525 | NN | denotes | µm |
T27837 | 6518-6522 | CD | denotes | 0.45 |
T27836 | 6510-6517 | IN | denotes | through |
T27835 | 6501-6509 | VB | denotes | filtered |
T27834 | 6499-6500 | -COMMA- | denotes | , |
T27833 | 6494-6499 | RB | denotes | later |
T27832 | 6491-6493 | NN | denotes | hr |
T27831 | 6488-6490 | CD | denotes | 72 |
T27830 | 6478-6487 | VB | denotes | collected |
T27829 | 6474-6477 | VB | denotes | was |
T27828 | 6468-6473 | NN | denotes | media |
T27827 | 6451-6467 | JJ | denotes | Virus-containing |
T27826 | 6448-6449 | -RRB- | denotes | ) |
T27825 | 6444-6448 | NN | denotes | Labs |
T27824 | 6435-6443 | NN | denotes | Signagen |
T27823 | 6434-6435 | -LRB- | denotes | ( |
T27822 | 6426-6433 | NN | denotes | reagent |
T27821 | 6413-6425 | NN | denotes | transfection |
T28338 | 7654-7659 | FW | denotes | vitro |
T28337 | 7651-7653 | FW | denotes | in |
T28336 | 7647-7650 | DT | denotes | The |
T28335 | 7644-7645 | -RRB- | denotes | ) |
T28334 | 7639-7644 | NNP | denotes | Sigma |
T28333 | 7638-7639 | -LRB- | denotes | ( |
T28332 | 7632-7637 | NN | denotes | beads |
T28331 | 7623-7631 | JJ | denotes | magnetic |
T28330 | 7620-7622 | NN | denotes | M2 |
T28329 | 7610-7619 | JJ | denotes | anti-FLAG |
T28328 | 7604-7609 | VB | denotes | using |
T28327 | 7598-7603 | NN | denotes | cells |
T28326 | 7593-7597 | NN | denotes | L929 |
T28325 | 7588-7592 | IN | denotes | from |
T28324 | 7569-7587 | VB | denotes | immunoprecipitated |
T28323 | 7565-7568 | VB | denotes | was |
T28322 | 7557-7564 | NN | denotes | Myr-Akt |
T28321 | 7555-7556 | -COMMA- | denotes | , |
T28320 | 7550-7555 | NN | denotes | brief |
T28319 | 7547-7549 | IN | denotes | In |
T28318 | 7535-7546 | NNP | denotes | Technology. |
T28317 | 7525-7534 | NNP | denotes | Signaling |
T28316 | 7520-7524 | NNP | denotes | Cell |
T28315 | 7515-7519 | IN | denotes | from |
T28314 | 7513-7514 | -RRB- | denotes | ) |
T28313 | 7499-7513 | JJ | denotes | nonradioactive |
T28312 | 7498-7499 | -LRB- | denotes | ( |
T28311 | 7494-7497 | NN | denotes | kit |
T28310 | 7488-7493 | NN | denotes | assay |
T28309 | 7481-7487 | NN | denotes | kinase |
T28308 | 7477-7480 | NN | denotes | Akt |
T28307 | 7473-7476 | DT | denotes | the |
T28306 | 7467-7472 | VB | denotes | using |
T28305 | 7458-7466 | VB | denotes | measured |
T28304 | 7454-7457 | VB | denotes | was |
T28303 | 7445-7453 | NN | denotes | activity |
T28302 | 7438-7444 | NN | denotes | kinase |
T28301 | 7434-7437 | NN | denotes | Akt |
T28300 | 7428-7433 | NNP | denotes | Assay |
T28299 | 7421-7427 | NNP | denotes | Kinase |
T28298 | 7417-7420 | NNP | denotes | Akt |
T28297 | 7411-7416 | FW | denotes | vitro |
T28296 | 7408-7410 | FW | denotes | In |
T27820 | 6406-6412 | NN | denotes | GenJet |
T27819 | 6400-6405 | VB | denotes | using |
T27818 | 6393-6399 | VB | denotes | plates |
T27817 | 6388-6392 | RB | denotes | well |
T27816 | 6386-6387 | CD | denotes | 6 |
T27815 | 6383-6385 | IN | denotes | in |
T27814 | 6374-6382 | NN | denotes | plasmids |
T27813 | 6364-6373 | JJ | denotes | accessory |
T27812 | 6358-6363 | JJ | denotes | VSV-G |
T27811 | 6354-6357 | CC | denotes | and |
T27810 | 6346-6353 | NN | denotes | gal/pol |
T27809 | 6343-6345 | IN | denotes | of |
T27808 | 6340-6342 | NN | denotes | µg |
T27807 | 6338-6339 | CD | denotes | 1 |
T27806 | 6334-6337 | CC | denotes | and |
T27805 | 6330-6333 | NN | denotes | DNA |
T27804 | 6324-6329 | JJ | denotes | viral |
T27803 | 6321-6323 | IN | denotes | of |
T27802 | 6318-6320 | NN | denotes | µg |
T27801 | 6316-6317 | CD | denotes | 2 |
T27800 | 6311-6315 | IN | denotes | with |
T27799 | 6299-6310 | VB | denotes | transfected |
T27798 | 6294-6298 | VB | denotes | were |
T27797 | 6292-6293 | -RRB- | denotes | ) |
T27796 | 6282-6292 | NN | denotes | Invitrogen |
T27795 | 6281-6282 | -LRB- | denotes | ( |
T27675 | 6137-6146 | NN | denotes | SYBRGreen |
T27674 | 6131-6136 | VB | denotes | using |
T27673 | 6122-6130 | NN | denotes | performs |
T27672 | 6117-6121 | VB | denotes | were |
T27671 | 6107-6116 | NN | denotes | Reactions |
T27670 | 6096-6105 | NN | denotes | reactions |
T27669 | 6091-6095 | NN | denotes | qPCR |
T27668 | 6088-6090 | IN | denotes | in |
T27667 | 6080-6087 | NN | denotes | primers |
T27666 | 6077-6079 | NN | denotes | pM |
T27665 | 6073-6076 | CD | denotes | 500 |
T27664 | 6068-6072 | IN | denotes | with |
T27663 | 6063-6067 | VB | denotes | used |
T27662 | 6059-6062 | VB | denotes | was |
T27661 | 6054-6058 | NN | denotes | cDNA |
T27660 | 6051-6053 | IN | denotes | of |
T27659 | 6048-6050 | NN | denotes | µL |
T27658 | 6046-6047 | CD | denotes | 1 |
T27657 | 6043-6044 | -RRB- | denotes | ) |
T27656 | 6036-6043 | NNP | denotes | Biolabs |
T27655 | 6028-6035 | NNP | denotes | England |
T27654 | 6024-6027 | NNP | denotes | New |
T27653 | 6022-6023 | -COMMA- | denotes | , |
T27652 | 6019-6022 | NN | denotes | kit |
T27651 | 6014-6018 | NN | denotes | cDNA |
T27650 | 6007-6013 | NN | denotes | M-MuLV |
T27649 | 6006-6007 | -LRB- | denotes | ( |
T27648 | 5998-6005 | NN | denotes | primers |
T27647 | 5991-5997 | JJ | denotes | random |
T27646 | 5985-5990 | VB | denotes | using |
T27645 | 5980-5984 | NN | denotes | cDNA |
T27644 | 5977-5979 | TO | denotes | to |
T27643 | 5967-5976 | VB | denotes | converted |
T27642 | 5963-5966 | VB | denotes | was |
T27641 | 5959-5962 | NN | denotes | RNA |
T27640 | 5956-5958 | IN | denotes | of |
T27639 | 5953-5955 | NN | denotes | µg |
T27638 | 5951-5952 | CD | denotes | 1 |
T27637 | 5948-5949 | -RRB- | denotes | ) |
T27636 | 5940-5948 | NNP | denotes | Research |
T27635 | 5935-5939 | NNP | denotes | Zymo |
T27634 | 5934-5935 | -LRB- | denotes | ( |
T27633 | 5930-5933 | NN | denotes | kit |
T27632 | 5921-5929 | NN | denotes | Miniprep |
T27631 | 5918-5920 | NN | denotes | ZR |
T27630 | 5912-5917 | VB | denotes | using |
T27629 | 5903-5911 | VB | denotes | isolated |
T27628 | 5899-5902 | VB | denotes | was |
T27627 | 5895-5898 | NN | denotes | RNA |
T27626 | 5889-5894 | JJ | denotes | Total |
T27625 | 5882-5887 | NN | denotes | blots |
T27624 | 5874-5881 | JJ | denotes | Western |
T27623 | 5870-5873 | IN | denotes | for |
T27622 | 5860-5869 | VB | denotes | described |
T27621 | 5857-5859 | IN | denotes | as |
T27620 | 5849-5856 | VB | denotes | treated |
T27619 | 5844-5848 | VB | denotes | were |
T27618 | 5838-5843 | NN | denotes | Cells |
T27617 | 5830-5837 | NN | denotes | qRT-PCR |
T28028 | 6995-6998 | CC | denotes | and |
T28027 | 6980-6994 | NN | denotes | phopsho-Thr308 |
T28026 | 6977-6979 | TO | denotes | to |
T28025 | 6966-6976 | NN | denotes | antibodies |
T28024 | 6958-6965 | JJ | denotes | Primary |
T28023 | 6948-6956 | NN | denotes | analysis |
T28022 | 6945-6947 | TO | denotes | to |
T28021 | 6939-6944 | JJ | denotes | prior |
T28020 | 6932-6938 | NN | denotes | buffer |
T28019 | 6926-6931 | NN | denotes | lysis |
T28018 | 6917-6925 | NN | denotes | ELISAOne |
T28017 | 6914-6916 | IN | denotes | of |
T28016 | 6911-6913 | NN | denotes | µL |
T28015 | 6908-6910 | CD | denotes | 45 |
T28014 | 6905-6907 | IN | denotes | in |
T28013 | 6897-6904 | VB | denotes | diluted |
T28012 | 6892-6896 | VB | denotes | were |
T28011 | 6884-6891 | NN | denotes | samples |
T27316 | 5817-5827 | NN | denotes | antibodies |
T27315 | 5813-5816 | JJ | denotes | new |
T27314 | 5808-5812 | IN | denotes | with |
T27313 | 5799-5807 | VB | denotes | reprobed |
T27312 | 5795-5798 | CC | denotes | and |
T27311 | 5793-5794 | -RRB- | denotes | ) |
T27310 | 5782-5793 | NNP | denotes | Biosciences |
T27309 | 5779-5781 | NNP | denotes | GM |
T27308 | 5778-5779 | -LRB- | denotes | ( |
T27307 | 5771-5777 | NN | denotes | buffer |
T27306 | 5761-5770 | VB | denotes | stripping |
T27305 | 5751-5760 | NN | denotes | OneMinute |
T27304 | 5745-5750 | VB | denotes | using |
T27303 | 5736-5744 | VB | denotes | stripped |
T27302 | 5731-5735 | VB | denotes | were |
T27301 | 5721-5730 | NN | denotes | membranes |
T27300 | 5719-5720 | -COMMA- | denotes | , |
T27299 | 5714-5719 | NN | denotes | cases |
T27298 | 5709-5713 | DT | denotes | some |
T27297 | 5706-5708 | IN | denotes | In |
T27296 | 5697-5704 | NN | denotes | signals |
T27295 | 5693-5696 | DT | denotes | the |
T27294 | 5685-5692 | VB | denotes | develop |
T27293 | 5682-5684 | TO | denotes | to |
T27292 | 5677-5681 | VB | denotes | used |
T27291 | 5672-5676 | VB | denotes | were |
T27290 | 5663-5671 | NN | denotes | reagents |
T27289 | 5659-5662 | NN | denotes | ECL |
T27288 | 5657-5658 | -RRB- | denotes | ) |
T27287 | 5648-5657 | NNP | denotes | Millipore |
T27286 | 5647-5648 | -LRB- | denotes | ( |
T27285 | 5638-5646 | NNP | denotes | Luminata |
T27284 | 5625-5636 | NN | denotes | temperature |
T27283 | 5620-5624 | NN | denotes | room |
T27282 | 5617-5619 | IN | denotes | at |
T27281 | 5613-5616 | NN | denotes | min |
T27280 | 5610-5612 | CD | denotes | 30 |
T27279 | 5606-5609 | IN | denotes | for |
T27278 | 5601-5605 | NN | denotes | TBST |
T27277 | 5598-5600 | IN | denotes | in |
T27276 | 5588-5597 | VB | denotes | incubated |
T27275 | 5583-5587 | VB | denotes | were |
T27274 | 5572-5582 | NN | denotes | antibodies |
T27273 | 5562-5571 | NNP | denotes | Secondary |
T27272 | 5557-5561 | NNP | denotes | 4°C. |
T27271 | 5554-5556 | IN | denotes | at |
T27270 | 5544-5553 | RB | denotes | overnight |
T27269 | 5535-5543 | NN | denotes | BSA/TBST |
T27268 | 5534-5535 | NN | denotes | % |
T27267 | 5533-5534 | CD | denotes | 5 |
T27266 | 5530-5532 | IN | denotes | in |
T27265 | 5520-5529 | VB | denotes | incubated |
T27264 | 5515-5519 | VB | denotes | were |
T27263 | 5504-5514 | NN | denotes | antibodies |
T27262 | 5496-5503 | JJ | denotes | Primary |
T27261 | 5483-5494 | NN | denotes | temperature |
T27260 | 5478-5482 | NN | denotes | room |
T27259 | 5475-5477 | IN | denotes | at |
T27258 | 5471-5474 | NN | denotes | min |
T27257 | 5468-5470 | CD | denotes | 30 |
T27256 | 5464-5467 | IN | denotes | for |
T27255 | 5457-5463 | NN | denotes | buffer |
T27254 | 5452-5456 | NN | denotes | TBST |
T27253 | 5449-5451 | IN | denotes | in |
T27252 | 5447-5448 | -RRB- | denotes | ) |
T27251 | 5444-5447 | NN | denotes | BSA |
T27250 | 5443-5444 | -LRB- | denotes | ( |
T27249 | 5435-5442 | NN | denotes | albumin |
T27248 | 5429-5434 | NN | denotes | serum |
T27247 | 5422-5428 | JJ | denotes | bovine |
T27246 | 5420-5421 | NN | denotes | % |
T27245 | 5419-5420 | CD | denotes | 5 |
T27244 | 5416-5418 | CC | denotes | or |
T27243 | 5411-5415 | NN | denotes | milk |
T27242 | 5409-5410 | NN | denotes | % |
T27241 | 5408-5409 | CD | denotes | 3 |
T27240 | 5405-5407 | IN | denotes | in |
T27239 | 5397-5404 | VB | denotes | blocked |
T27238 | 5395-5396 | -COMMA- | denotes | , |
T27237 | 5387-5395 | NN | denotes | membrane |
T27236 | 5382-5386 | NN | denotes | PVDF |
T27235 | 5379-5381 | TO | denotes | to |
T27234 | 5367-5378 | VB | denotes | transferred |
T27233 | 5362-5366 | VB | denotes | were |
T27232 | 5357-5361 | NN | denotes | gels |
T27231 | 5348-5356 | NN | denotes | SDS-PAGE |
T27230 | 5346-5347 | -COMMA- | denotes | , |
T27229 | 5339-5346 | RB | denotes | Briefly |
T27228 | 5328-5337 | NN | denotes | protocols |
T27227 | 5319-5327 | JJ | denotes | standard |
T27226 | 5316-5318 | TO | denotes | to |
T27225 | 5306-5315 | VB | denotes | according |
T27224 | 5296-5305 | VB | denotes | performed |
T27223 | 5292-5295 | VB | denotes | was |
T27222 | 5283-5291 | NN | denotes | blotting |
T27221 | 5275-5282 | NNP | denotes | Western |
T27220 | 5269-5274 | NNP | denotes | 95°C. |
T27219 | 5266-5268 | IN | denotes | at |
T27218 | 5262-5265 | NN | denotes | min |
T27217 | 5260-5261 | CD | denotes | 5 |
T27216 | 5256-5259 | IN | denotes | for |
T27215 | 5249-5255 | VB | denotes | boiled |
T27214 | 5244-5248 | VB | denotes | were |
T27213 | 5235-5243 | NN | denotes | proteins |
T27212 | 5232-5234 | IN | denotes | of |
T27211 | 5224-5231 | NN | denotes | amounts |
T27210 | 5218-5223 | JJ | denotes | Equal |
T27209 | 5215-5216 | -RRB- | denotes | ) |
T27208 | 5209-5215 | NNP | denotes | Pierce |
T27207 | 5208-5209 | -LRB- | denotes | ( |
T27206 | 5200-5207 | NN | denotes | Reagent |
T27205 | 5194-5199 | NN | denotes | Assay |
T27204 | 5191-5193 | NN | denotes | nm |
T27203 | 5187-5190 | CD | denotes | 660 |
T27202 | 5180-5186 | NNP | denotes | Pierce |
T27201 | 5176-5179 | DT | denotes | the |
T27200 | 5170-5175 | VB | denotes | using |
T27199 | 5161-5169 | VB | denotes | measured |
T27198 | 5156-5160 | VB | denotes | were |
T27197 | 5141-5155 | NN | denotes | concentrations |
T27196 | 5133-5140 | NN | denotes | Protein |
T27195 | 5121-5131 | NN | denotes | 14,000×rpm |
T27194 | 5118-5120 | IN | denotes | at |
T27193 | 5114-5117 | NN | denotes | min |
T27192 | 5111-5113 | CD | denotes | 15 |
T27191 | 5107-5110 | IN | denotes | for |
T27190 | 5102-5106 | RP | denotes | down |
T27189 | 5097-5101 | VB | denotes | spun |
T27188 | 5092-5096 | VB | denotes | were |
T27187 | 5084-5091 | NN | denotes | lysates |
T27186 | 5079-5083 | NN | denotes | cell |
T27185 | 5077-5078 | -COMMA- | denotes | , |
T27184 | 5067-5077 | NN | denotes | sonication |
T27183 | 5061-5066 | JJ | denotes | brief |
T27182 | 5055-5060 | IN | denotes | After |
T27181 | 5024-5053 | NN | denotes | phenylmethanesulfonylfluoride |
T27180 | 5018-5023 | NN | denotes | µg/ml |
T27179 | 5015-5017 | CD | denotes | 50 |
T27178 | 5010-5014 | IN | denotes | with |
T27177 | 4997-5009 | VB | denotes | supplemented |
T27176 | 4995-4996 | -RRB- | denotes | ) |
T27175 | 4986-4995 | NN | denotes | Signaling |
T27174 | 4981-4985 | NN | denotes | Cell |
T27173 | 4980-4981 | -LRB- | denotes | ( |
T27172 | 4973-4979 | NN | denotes | buffer |
T27171 | 4966-4972 | NN | denotes | 1×RIPA |
T27170 | 4963-4965 | IN | denotes | in |
T27169 | 4953-4962 | VB | denotes | harvested |
T27168 | 4948-4952 | VB | denotes | were |
T27167 | 4942-4947 | NN | denotes | Cells |
T27166 | 4936-4940 | NN | denotes | TNFα |
T27165 | 4930-4935 | NN | denotes | mouse |
T27164 | 4924-4929 | NN | denotes | ng/ml |
T27163 | 4921-4923 | CD | denotes | 10 |
T27162 | 4918-4920 | CC | denotes | or |
T27161 | 4909-4917 | NN | denotes | zVAD.fmk |
T27160 | 4906-4908 | NN | denotes | µM |
T27159 | 4903-4905 | CD | denotes | 20 |
T27158 | 4901-4902 | -COMMA- | denotes | , |
T27157 | 4894-4901 | NN | denotes | factors |
T27156 | 4887-4893 | NN | denotes | growth |
T27794 | 6275-6280 | NN | denotes | cells |
T27793 | 6266-6274 | NN | denotes | HEK293FT |
T27792 | 6264-6265 | -COMMA- | denotes | , |
T27791 | 6252-6264 | NN | denotes | retroviruses |
T27790 | 6247-6251 | NN | denotes | MSCV |
T27789 | 6238-6246 | VB | denotes | generate |
T27788 | 6235-6237 | TO | denotes | To |
T27787 | 6226-6234 | NN | denotes | Myr-Akt1 |
T27786 | 6223-6225 | IN | denotes | of |
T27785 | 6213-6222 | NN | denotes | Infection |
T27784 | 6206-6212 | JJ | denotes | Stable |
T27686 | 6202-6203 | -RRB- | denotes | ) |
T27685 | 6197-6202 | NN | denotes | Roche |
T27684 | 6196-6197 | -LRB- | denotes | ( |
T27683 | 6181-6195 | NN | denotes | LightCycler480 |
T27682 | 6179-6180 | DT | denotes | a |
T27681 | 6176-6178 | IN | denotes | in |
T27680 | 6174-6175 | -RRB- | denotes | ) |
T27679 | 6161-6174 | NN | denotes | SABiosciences |
T27678 | 6160-6161 | -LRB- | denotes | ( |
T27677 | 6156-6159 | NN | denotes | mix |
T27676 | 6147-6155 | NN | denotes | 2×Master |
T27155 | 4884-4886 | IN | denotes | of |
T27154 | 4875-4883 | NN | denotes | addition |
T27153 | 4871-4874 | DT | denotes | the |
T27152 | 4868-4870 | TO | denotes | to |
T27151 | 4862-4867 | JJ | denotes | prior |
T27150 | 4859-4861 | NN | denotes | hr |
T27149 | 4856-4858 | CD | denotes | 24 |
T27148 | 4852-4855 | IN | denotes | for |
T27147 | 4844-4851 | VB | denotes | starved |
T27146 | 4838-4843 | NN | denotes | serum |
T27145 | 4833-4837 | VB | denotes | were |
T27144 | 4827-4832 | NN | denotes | cells |
T27143 | 4825-4826 | -COMMA- | denotes | , |
T27142 | 4815-4825 | NN | denotes | conditions |
T27141 | 4810-4814 | JJ | denotes | free |
T27140 | 4804-4809 | NN | denotes | serum |
T27139 | 4798-4803 | IN | denotes | under |
T27138 | 4787-4797 | NN | denotes | treatments |
T27137 | 4783-4786 | IN | denotes | For |
T27136 | 4777-4781 | NN | denotes | TNFα |
T27135 | 4771-4776 | NN | denotes | mouse |
T27134 | 4765-4770 | NN | denotes | ng/ml |
T27133 | 4762-4764 | CD | denotes | 10 |
T27132 | 4759-4761 | CC | denotes | or |
T27131 | 4750-4758 | NN | denotes | zVAD.fmk |
T27130 | 4747-4749 | NN | denotes | µM |
T27123 | 4713-4715 | NN | denotes | hr |
T27122 | 4707-4712 | CD | denotes | 24–48 |
T27121 | 4701-4706 | IN | denotes | After |
T27120 | 4693-4699 | NN | denotes | dishes |
T27119 | 4689-4692 | NN | denotes | mm2 |
T27118 | 4686-4688 | CD | denotes | 35 |
T27117 | 4681-4685 | IN | denotes | into |
T27116 | 4674-4680 | VB | denotes | seeded |
T27115 | 4669-4673 | VB | denotes | were |
T27114 | 4667-4668 | -RRB- | denotes | ) |
T27113 | 4662-4667 | NN | denotes | cells |
T27112 | 4655-4661 | NN | denotes | Jurkat |
T27111 | 4649-4654 | CD | denotes | 1×106 |
T27110 | 4648-4649 | -LRB- | denotes | ( |
T27109 | 4642-4647 | NN | denotes | cells |
T27108 | 4633-4641 | JJ | denotes | adherent |
T27107 | 4627-4632 | CD | denotes | 4×105 |
T27106 | 4625-4626 | -COMMA- | denotes | , |
T27105 | 4621-4625 | NN | denotes | blot |
T27104 | 4613-4620 | JJ | denotes | Western |
T27103 | 4609-4612 | IN | denotes | For |
T27102 | 4604-4608 | NNP | denotes | Blot |
T27101 | 4596-4603 | NNP | denotes | Western |
T26858 | 4592-4593 | -RRB- | denotes | ) |
T26857 | 4583-4592 | NN | denotes | viability |
T26856 | 4578-4582 | NN | denotes | cell |
T26855 | 4577-4578 | -LRB- | denotes | ( |
T26854 | 4574-4576 | NN | denotes | hr |
T26853 | 4571-4573 | CD | denotes | 24 |
T26852 | 4568-4570 | CC | denotes | or |
T26851 | 4566-4567 | -RRB- | denotes | ) |
T26850 | 4562-4566 | NN | denotes | blot |
T26849 | 4554-4561 | JJ | denotes | Western |
T26848 | 4551-4553 | CC | denotes | or |
T26847 | 4547-4550 | NN | denotes | RNA |
T26846 | 4546-4547 | -LRB- | denotes | ( |
T26845 | 4543-4545 | NN | denotes | hr |
T26844 | 4541-4542 | CD | denotes | 9 |
T26843 | 4537-4540 | IN | denotes | for |
T26842 | 4532-4536 | NN | denotes | TNFα |
T26841 | 4529-4531 | CC | denotes | or |
T26840 | 4520-4528 | NN | denotes | zVAD.fmk |
T26839 | 4515-4519 | IN | denotes | with |
T26838 | 4507-4514 | VB | denotes | treated |
T26837 | 4502-4506 | VB | denotes | were |
T26836 | 4496-4501 | NN | denotes | cells |
T26835 | 4494-4495 | -COMMA- | denotes | , |
T26834 | 4492-4494 | NN | denotes | hr |
T26833 | 4489-4491 | CD | denotes | 72 |
T26832 | 4483-4488 | IN | denotes | After |
T26831 | 4454-4469 | NN | denotes | ufacturer’s rec |
T26830 | 4440-4454 | NN | denotes | cording to man |
T26829 | 4438-4440 | TO | denotes | ac |
T26828 | 4429-4438 | VB | denotes | trogen), |
T26827 | 4428-4429 | -COMMA- | denotes | i |
T26826 | 4427-4428 | -RRB- | denotes | v |
T26825 | 4417-4427 | NN | denotes | eagent (In |
T26824 | 4416-4417 | -LRB- | denotes | r |
T26823 | 4409-4416 | NN | denotes | NAiMAX |
T26822 | 4402-4409 | NN | denotes | using R |
T26821 | 4397-4402 | VB | denotes | cted |
T26820 | 4386-4397 | VB | denotes | ere transfe |
T26819 | 4382-4386 | VB | denotes | NA w |
T26818 | 4377-4382 | NN | denotes | . siR |
T26817 | 4376-4377 | -RRB- | denotes | ) |
T26816 | 4365-4376 | NN | denotes | L-043776-00 |
T26815 | 4364-4365 | -LRB- | denotes | ( |
T26814 | 4360-4363 | NN | denotes | Jun |
T26813 | 4354-4359 | NN | denotes | mouse |
T26812 | 4352-4353 | -COMMA- | denotes | , |
T26811 | 4351-4352 | -RRB- | denotes | ) |
T26810 | 4340-4351 | NN | denotes | J-040134-05 |
T26809 | 4339-4340 | -LRB- | denotes | ( |
T26808 | 4333-4338 | NN | denotes | Mapk9 |
T26807 | 4327-4332 | NN | denotes | mouse |
T26806 | 4325-4326 | -COMMA- | denotes | , |
T26805 | 4324-4325 | -RRB- | denotes | ) |
T26804 | 4313-4324 | NN | denotes | J-040128-05 |
T26803 | 4312-4313 | -LRB- | denotes | ( |
T26802 | 4306-4311 | NN | denotes | Mapk8 |
T26801 | 4300-4305 | NN | denotes | mouse |
T26800 | 4298-4299 | -COMMA- | denotes | , |
T26799 | 4297-4298 | -RRB- | denotes | ) |
T26798 | 4283-4297 | NN | denotes | D-001810-10-05 |
T26797 | 4282-4283 | -LRB- | denotes | ( |
T26796 | 4274-4281 | NN | denotes | control |
T26795 | 4263-4273 | JJ | denotes | non-coding |
T26794 | 4261-4262 | -COMMA- | denotes | , |
T26793 | 4260-4261 | -RRB- | denotes | ) |
T26792 | 4249-4260 | NN | denotes | L-040658-00 |
T26791 | 4248-4249 | -LRB- | denotes | ( |
T26790 | 4243-4247 | NN | denotes | PDK1 |
T26789 | 4237-4242 | NN | denotes | mouse |
T26788 | 4235-4236 | -COMMA- | denotes | , |
T26787 | 4234-4235 | -RRB- | denotes | ) |
T26786 | 4223-4234 | NN | denotes | L-065427-00 |
T26785 | 4222-4223 | -LRB- | denotes | ( |
T26784 | 4217-4221 | NN | denotes | mTOR |
T26783 | 4211-4216 | NN | denotes | mouse |
T26782 | 4209-4210 | -COMMA- | denotes | , |
T26781 | 4208-4209 | -RRB- | denotes | ) |
T26780 | 4197-4208 | NN | denotes | L-040891-00 |
T26779 | 4196-4197 | -LRB- | denotes | ( |
T26778 | 4191-4195 | NN | denotes | Akt3 |
T26777 | 4185-4190 | NN | denotes | mouse |
T26776 | 4183-4184 | -COMMA- | denotes | , |
T26775 | 4182-4183 | -RRB- | denotes | ) |
T26774 | 4171-4182 | NN | denotes | L-040782-00 |
T26773 | 4170-4171 | -LRB- | denotes | ( |
T26772 | 4165-4169 | NN | denotes | Akt2 |
T26771 | 4159-4164 | NN | denotes | mouse |
T26770 | 4157-4158 | -COMMA- | denotes | , |
T26769 | 4156-4157 | -RRB- | denotes | ) |
T26768 | 4145-4156 | NN | denotes | L-040709-00 |
T26767 | 4144-4145 | -LRB- | denotes | ( |
T26766 | 4139-4143 | NN | denotes | Akt1 |
T26765 | 4133-4138 | NN | denotes | mouse |
T26764 | 4131-4132 | -COMMA- | denotes | , |
T26763 | 4130-4131 | -RRB- | denotes | ) |
T26762 | 4119-4130 | NN | denotes | L-045791-00 |
T26761 | 4115-4118 | CC | denotes | and |
T26760 | 4103-4114 | NN | denotes | L-040893-00 |
T26759 | 4102-4103 | -LRB- | denotes | ( |
T26758 | 4094-4101 | NN | denotes | protein |
T26757 | 4091-4093 | NN | denotes | S6 |
T26756 | 4081-4090 | JJ | denotes | ribosomal |
T26755 | 4075-4080 | NNP | denotes | Mouse |
T26754 | 4064-4074 | NNP | denotes | Dharmacon. |
T26753 | 4059-4063 | IN | denotes | from |
T26752 | 4049-4058 | VB | denotes | purchased |
T26751 | 4044-4048 | VB | denotes | were |
T26750 | 4037-4043 | NN | denotes | siRNAs |
T26749 | 4027-4036 | NN | denotes | Knockdown |
T26748 | 4021-4026 | NN | denotes | siRNA |
T27129 | 4744-4746 | CD | denotes | 30 |
T27128 | 4739-4743 | IN | denotes | with |
T27127 | 4728-4738 | VB | denotes | stimulated |
T27126 | 4723-4727 | VB | denotes | were |
T27125 | 4717-4722 | NN | denotes | cells |
T27124 | 4715-4716 | -COMMA- | denotes | , |
T26061 | 2684-2710 | NN | denotes | 5′-TAGTAGCGACGGGCGGTGTG-3′ |
T26060 | 2676-2683 | JJ | denotes | reverse |
T26059 | 2674-2675 | -COLON- | denotes | : |
T26058 | 2671-2674 | NN | denotes | 18S |
T26057 | 2665-2670 | JJ | denotes | human |
T26056 | 2663-2664 | -COMMA- | denotes | , |
T26055 | 2661-2663 | CD | denotes | -3 |
T26054 | 2640-2660 | NN | denotes | CAGCCACCCGAGATTGAGCA |
T26053 | 2636-2639 | CD | denotes | 5′- |
T26052 | 2628-2635 | RB | denotes | forward |
T26051 | 2626-2627 | -COLON- | denotes | : |
T26050 | 2623-2626 | NN | denotes | 18S |
T26049 | 2617-2622 | JJ | denotes | human |
T26048 | 2615-2616 | -COLON- | denotes | ; |
T26047 | 2587-2615 | NN | denotes | 5′-GAGGGCTGATTAGAGAGAGGTC-3′ |
T26046 | 2579-2586 | JJ | denotes | reverse |
T26045 | 2577-2578 | -COLON- | denotes | : |
T26044 | 2573-2577 | NN | denotes | TNFα |
T26043 | 2567-2572 | JJ | denotes | human |
T26042 | 2565-2566 | -COMMA- | denotes | , |
T26041 | 2540-2565 | NN | denotes | ATGAGCACTGAAAGCATGATCC-3′ |
T26040 | 2536-2539 | CD | denotes | 5′- |
T26039 | 2528-2535 | RB | denotes | forward |
T26038 | 2526-2527 | -COLON- | denotes | : |
T26037 | 2522-2526 | NN | denotes | TNFα |
T26036 | 2516-2521 | JJ | denotes | human |
T26035 | 2515-2516 | -COLON- | denotes | ; |
T26034 | 2485-2515 | NN | denotes | 5′-CTAAACCATCCAATCGGTAGTAGC-3′ |
T26033 | 2477-2484 | JJ | denotes | reverse |
T26032 | 2475-2476 | -COMMA- | denotes | , |
T26031 | 2449-2475 | NN | denotes | ATAACAGGTCTGTGATGCCCTTAG-3 |
T26030 | 2445-2448 | JJ | denotes | 5-′ |
T26029 | 2437-2444 | RB | denotes | forward |
T26028 | 2435-2436 | -COLON- | denotes | : |
T26027 | 2432-2435 | NN | denotes | 18S |
T26026 | 2426-2431 | NN | denotes | mouse |
T26025 | 2425-2426 | -COLON- | denotes | ; |
T26024 | 2400-2425 | NN | denotes | 5′-GCTACGACGTGGGCTACAG-3′ |
T26023 | 2392-2399 | JJ | denotes | reverse |
T26022 | 2390-2391 | -COMMA- | denotes | , |
T26021 | 2361-2390 | JJ | denotes | 5′-CCCTCACACTCAGATCATCTTCT-3′ |
T26020 | 2353-2360 | RB | denotes | forward |
T26019 | 2351-2352 | -COLON- | denotes | : |
T26018 | 2347-2351 | NN | denotes | TNFα |
T26017 | 2341-2346 | NN | denotes | Mouse |
T26016 | 2333-2340 | NN | denotes | Primers |
T26015 | 2328-2332 | NN | denotes | QPCR |
T25741 | 1381-1391 | NN | denotes | Antibodies |
T26582 | 4009-4018 | NN | denotes | molecules |
T26581 | 4003-4008 | JJ | denotes | small |
T26580 | 3999-4002 | DT | denotes | the |
T26579 | 3996-3998 | IN | denotes | of |
T26578 | 3987-3995 | NN | denotes | toxicity |
T26577 | 3974-3986 | JJ | denotes | non-specific |
T26576 | 3971-3973 | IN | denotes | of |
T26575 | 3963-3970 | NN | denotes | effects |
T26574 | 3954-3962 | JJ | denotes | possible |
T26573 | 3950-3953 | DT | denotes | the |
T26572 | 3942-3949 | VB | denotes | exclude |
T26571 | 3939-3941 | TO | denotes | to |
T26570 | 3931-3938 | VB | denotes | plotted |
T26569 | 3927-3930 | CC | denotes | and |
T26568 | 3916-3926 | VB | denotes | determined |
T26567 | 3912-3915 | VB | denotes | was |
T26566 | 3910-3911 | -COMMA- | denotes | , |
T26565 | 3905-3910 | NN | denotes | cells |
T26564 | 3888-3904 | JJ | denotes | compound-treated |
T26563 | 3880-3887 | NN | denotes | control |
T26562 | 3876-3879 | DT | denotes | the |
T26561 | 3873-3875 | TO | denotes | to |
T26560 | 3864-3872 | JJ | denotes | relative |
T26559 | 3855-3863 | NN | denotes | compound |
T26558 | 3851-3854 | DT | denotes | the |
T26557 | 3846-3850 | IN | denotes | with |
T26556 | 3838-3845 | VB | denotes | treated |
T26555 | 3834-3837 | CC | denotes | and |
T26554 | 3822-3833 | NN | denotes | necroptosis |
T26553 | 3814-3821 | VB | denotes | undergo |
T26552 | 3811-3813 | TO | denotes | to |
T26551 | 3803-3810 | VB | denotes | induced |
T26550 | 3801-3802 | -COMMA- | denotes | , |
T26549 | 3796-3801 | NN | denotes | cells |
T26548 | 3793-3795 | IN | denotes | of |
T26547 | 3783-3792 | NN | denotes | viability |
T26546 | 3774-3782 | JJ | denotes | Relative |
T26545 | 3771-3772 | NN | denotes | % |
T26544 | 3768-3771 | CD | denotes | 100 |
T26543 | 3765-3767 | IN | denotes | as |
T26542 | 3761-3764 | VB | denotes | set |
T26541 | 3757-3760 | VB | denotes | was |
T26540 | 3751-3756 | NN | denotes | cells |
T26539 | 3741-3750 | JJ | denotes | untreated |
T26538 | 3733-3740 | NN | denotes | control |
T26537 | 3729-3732 | DT | denotes | the |
T26536 | 3726-3728 | IN | denotes | of |
T26535 | 3716-3725 | NN | denotes | Viability |
T26534 | 3704-3714 | VB | denotes | triplicate |
T26533 | 3701-3703 | CC | denotes | or |
T26532 | 3691-3700 | NN | denotes | duplicate |
T26531 | 3688-3690 | IN | denotes | in |
T26530 | 3678-3687 | VB | denotes | performed |
T26529 | 3673-3677 | VB | denotes | were |
T26528 | 3661-3672 | NN | denotes | Experiments |
T26527 | 3658-3659 | -RRB- | denotes | ) |
T26526 | 3651-3658 | NNP | denotes | Promega |
T26525 | 3650-3651 | -LRB- | denotes | ( |
T26524 | 3644-3649 | NNP | denotes | Assay |
T26523 | 3634-3643 | NNP | denotes | Viability |
T26522 | 3629-3633 | NNP | denotes | Cell |
T26521 | 3615-3628 | NNP | denotes | CellTiter-Glo |
T26520 | 3609-3614 | VB | denotes | using |
T26519 | 3598-3608 | VB | denotes | determined |
T26518 | 3594-3597 | VB | denotes | was |
T26517 | 3584-3593 | NN | denotes | viability |
T26516 | 3579-3583 | NN | denotes | Cell |
T26515 | 3566-3577 | NN | denotes | experiments |
T26514 | 3561-3565 | NN | denotes | blot |
T26513 | 3553-3560 | JJ | denotes | western |
T26512 | 3549-3552 | IN | denotes | for |
T26511 | 3539-3548 | VB | denotes | described |
T26510 | 3536-3538 | IN | denotes | as |
T26509 | 3528-3535 | VB | denotes | treated |
T26508 | 3524-3527 | CC | denotes | and |
T26507 | 3513-3523 | NN | denotes | cells/well |
T26506 | 3507-3512 | CD | denotes | 1×104 |
T26505 | 3504-3506 | IN | denotes | of |
T26504 | 3496-3503 | NN | denotes | density |
T26503 | 3492-3495 | DT | denotes | the |
T26502 | 3489-3491 | IN | denotes | at |
T26501 | 3482-3488 | VB | denotes | plates |
T26500 | 3477-3481 | RB | denotes | well |
T26499 | 3474-3476 | CD | denotes | 96 |
T26498 | 3467-3473 | NN | denotes | bottom |
T26497 | 3461-3466 | JJ | denotes | clear |
T26496 | 3455-3460 | JJ | denotes | white |
T26495 | 3450-3454 | IN | denotes | into |
T26494 | 3443-3449 | VB | denotes | seeded |
T26493 | 3438-3442 | VB | denotes | were |
T26492 | 3432-3437 | NN | denotes | Cells |
T26491 | 3420-3431 | NN | denotes | Experiments |
T26490 | 3410-3419 | NN | denotes | Viability |
T26489 | 3405-3409 | NN | denotes | Cell |
T26325 | 3380-3402 | JJ | denotes | antibiotic-antimycotic |
T26324 | 3378-3379 | NN | denotes | % |
T26323 | 3377-3378 | CD | denotes | 1 |
T26322 | 3373-3376 | CC | denotes | and |
T26321 | 3371-3372 | -RRB- | denotes | ) |
T26320 | 3365-3371 | NNP | denotes | Gemini |
T26319 | 3364-3365 | -LRB- | denotes | ( |
T26318 | 3354-3363 | NN | denotes | FetalPlex |
T26317 | 3352-3353 | NN | denotes | % |
T26316 | 3350-3352 | CD | denotes | 10 |
T26315 | 3345-3349 | IN | denotes | with |
T26314 | 3332-3344 | VB | denotes | supplemented |
T26313 | 3330-3331 | -COMMA- | denotes | , |
T26312 | 3322-3330 | NN | denotes | RPMI1640 |
T26311 | 3319-3321 | IN | denotes | in |
T26310 | 3308-3318 | VB | denotes | maintained |
T26309 | 3303-3307 | VB | denotes | were |
T26308 | 3297-3302 | NN | denotes | cells |
T26307 | 3290-3296 | NN | denotes | Jurkat |
T26306 | 3280-3288 | NN | denotes | pyruvate |
T26305 | 3273-3279 | NN | denotes | sodium |
T26304 | 3269-3272 | CC | denotes | and |
T26303 | 3267-3268 | -COMMA- | denotes | , |
T26302 | 3262-3267 | NN | denotes | acids |
T26301 | 3256-3261 | NN | denotes | amino |
T26300 | 3242-3255 | JJ | denotes | non-essential |
T26299 | 3240-3241 | -COMMA- | denotes | , |
T26298 | 3229-3240 | NN | denotes | L-glutamine |
T26297 | 3224-3228 | IN | denotes | with |
T26296 | 3211-3223 | VB | denotes | supplemented |
T26295 | 3198-3210 | RB | denotes | additionally |
T26294 | 3194-3197 | VB | denotes | was |
T26293 | 3188-3193 | NN | denotes | media |
T26292 | 3177-3187 | NN | denotes | fibroblast |
T26291 | 3172-3176 | NN | denotes | lung |
T26290 | 3166-3171 | NN | denotes | mouse |
T26289 | 3162-3165 | DT | denotes | The |
T26288 | 3159-3160 | -RRB- | denotes | ) |
T26287 | 3149-3159 | NN | denotes | Invitrogen |
T26286 | 3148-3149 | -LRB- | denotes | ( |
T26285 | 3140-3147 | NN | denotes | mixture |
T26284 | 3117-3139 | JJ | denotes | antibiotic-antimycotic |
T26283 | 3115-3116 | NN | denotes | % |
T26282 | 3114-3115 | CD | denotes | 1 |
T26281 | 3110-3113 | CC | denotes | and |
T26280 | 3108-3109 | -RRB- | denotes | ) |
T26279 | 3105-3108 | NN | denotes | FBS |
T26278 | 3104-3105 | -LRB- | denotes | ( |
T26277 | 3098-3103 | NN | denotes | serum |
T26276 | 3091-3097 | JJ | denotes | bovine |
T26275 | 3085-3090 | JJ | denotes | fetal |
T26274 | 3083-3084 | NN | denotes | % |
T26273 | 3081-3083 | CD | denotes | 10 |
T26272 | 3076-3080 | IN | denotes | with |
T26271 | 3063-3075 | VB | denotes | supplemented |
T26270 | 3058-3062 | NN | denotes | DMEM |
T26269 | 3055-3057 | IN | denotes | in |
T26268 | 3044-3054 | VB | denotes | maintained |
T26267 | 3039-3043 | VB | denotes | were |
T26266 | 3033-3038 | NN | denotes | Cells |
T26265 | 3019-3031 | RB | denotes | respectively |
T26264 | 3017-3018 | -COMMA- | denotes | , |
T26263 | 3016-3017 | -RRB- | denotes | ) |
T26262 | 3006-3016 | NNP | denotes | University |
T26261 | 3000-3005 | NNP | denotes | Tufts |
T26260 | 2999-3000 | -LRB- | denotes | ( |
T26259 | 2990-2998 | NNP | denotes | Poltorak |
T26258 | 2980-2989 | NNP | denotes | Alexander |
T26257 | 2976-2979 | CC | denotes | and |
T26256 | 2974-2975 | -RRB- | denotes | ) |
T26255 | 2964-2974 | NNP | denotes | University |
T26254 | 2956-2963 | NNP | denotes | Harvard |
T26253 | 2955-2956 | -LRB- | denotes | ( |
T26252 | 2950-2954 | NNP | denotes | Yuan |
T26251 | 2942-2949 | NNP | denotes | Junying |
T26250 | 2939-2941 | IN | denotes | of |
T26249 | 2933-2938 | NN | denotes | gifts |
T26248 | 2924-2932 | JJ | denotes | generous |
T26247 | 2919-2923 | VB | denotes | were |
T26246 | 2913-2918 | NN | denotes | cells |
T26245 | 2911-2912 | -RRB- | denotes | ) |
T26244 | 2907-2911 | NN | denotes | ATCC |
T26243 | 2906-2907 | -LRB- | denotes | ( |
T26242 | 2897-2905 | NN | denotes | RAW264.7 |
T26241 | 2893-2896 | CC | denotes | and |
T26240 | 2887-2892 | NN | denotes | cells |
T26239 | 2885-2886 | -RRB- | denotes | ) |
T26238 | 2881-2885 | NN | denotes | ATCC |
T26237 | 2880-2881 | -LRB- | denotes | ( |
T26236 | 2872-2879 | NN | denotes | J774A.1 |
T26235 | 2869-2870 | -RRB- | denotes | ] |
T26234 | 2867-2869 | CD | denotes | 53 |
T26233 | 2866-2867 | -LRB- | denotes | [ |
T26232 | 2864-2865 | -RRB- | denotes | ) |
T26231 | 2854-2864 | NNP | denotes | University |
T26230 | 2848-2853 | NNP | denotes | Tufts |
T26229 | 2847-2848 | -LRB- | denotes | ( |
T26228 | 2838-2846 | NNP | denotes | Tsichlis |
T26227 | 2831-2837 | NNP | denotes | Philip |
T26226 | 2827-2830 | NNP | denotes | Dr. |
T26225 | 2824-2826 | IN | denotes | of |
T26224 | 2819-2823 | NN | denotes | gift |
T26223 | 2810-2818 | JJ | denotes | generous |
T26222 | 2808-2809 | DT | denotes | a |
T26221 | 2803-2807 | VB | denotes | were |
T26220 | 2791-2802 | NN | denotes | fibroblasts |
T26219 | 2786-2790 | NN | denotes | Lung |
T26218 | 2780-2784 | NN | denotes | ATCC |
T26217 | 2775-2779 | IN | denotes | from |
T26216 | 2766-2774 | VB | denotes | obtained |
T26215 | 2761-2765 | VB | denotes | were |
T26214 | 2755-2760 | NN | denotes | cells |
T26213 | 2748-2754 | NN | denotes | Jurkat |
T26212 | 2733-2747 | JJ | denotes | FADD-deficient |
T26211 | 2729-2732 | CC | denotes | and |
T26210 | 2724-2728 | NN | denotes | L929 |
T26209 | 2718-2723 | NN | denotes | Lines |
T26208 | 2713-2717 | NN | denotes | Cell |
T25245 | 1096-1101 | NNP | denotes | Sigma |
T25244 | 1091-1095 | IN | denotes | from |
T25243 | 1086-1090 | VB | denotes | were |
T25242 | 1077-1085 | NN | denotes | reagents |
T25241 | 1071-1076 | JJ | denotes | other |
T25240 | 1067-1070 | DT | denotes | All |
T25239 | 1056-1066 | NNP | denotes | Peprotech. |
T25238 | 1053-1055 | CC | denotes | or |
T25237 | 1044-1052 | NNP | denotes | Sciences |
T25236 | 1039-1043 | NNP | denotes | Cell |
T25235 | 1034-1038 | IN | denotes | from |
T25234 | 1029-1033 | VB | denotes | were |
T25233 | 1027-1028 | -RRB- | denotes | ) |
T25232 | 1022-1027 | NN | denotes | ng/ml |
T25231 | 1019-1021 | CD | denotes | 50 |
T25230 | 1018-1019 | -LRB- | denotes | ( |
T25229 | 1012-1017 | NN | denotes | IGF-1 |
T25228 | 1008-1011 | CC | denotes | and |
T25227 | 1006-1007 | -COMMA- | denotes | , |
T25226 | 1005-1006 | -RRB- | denotes | ) |
T25225 | 1000-1005 | NN | denotes | ng/ml |
T25224 | 997-999 | CD | denotes | 20 |
T25223 | 996-997 | -LRB- | denotes | ( |
T25222 | 988-995 | NN | denotes | PDGF-BB |
T25221 | 986-987 | -COMMA- | denotes | , |
T25220 | 985-986 | -RRB- | denotes | ) |
T25219 | 980-985 | NN | denotes | ng/ml |
T25218 | 977-979 | CD | denotes | 50 |
T25217 | 976-977 | -LRB- | denotes | ( |
T25216 | 972-975 | NN | denotes | EGF |
T25215 | 970-971 | -COMMA- | denotes | , |
T25214 | 969-970 | -RRB- | denotes | ) |
T25213 | 964-969 | NN | denotes | ng/ml |
T25212 | 961-963 | CD | denotes | 25 |
T25211 | 960-961 | -LRB- | denotes | ( |
T25210 | 955-959 | NN | denotes | bFGF |
T25209 | 949-954 | JJ | denotes | human |
T25208 | 947-948 | -COMMA- | denotes | , |
T25207 | 946-947 | -RRB- | denotes | ) |
T25206 | 941-946 | NN | denotes | ng/ml |
T25205 | 938-940 | CD | denotes | 10 |
T25204 | 937-938 | -LRB- | denotes | ( |
T25203 | 932-936 | NN | denotes | TNFα |
T25202 | 926-931 | NN | denotes | mouse |
T25201 | 922-925 | CC | denotes | and |
T25200 | 916-921 | NNP | denotes | Human |
T25199 | 908-915 | NNP | denotes | Bachem. |
T25198 | 903-907 | IN | denotes | from |
T25197 | 893-902 | VB | denotes | purchased |
T25196 | 889-892 | VB | denotes | was |
T25195 | 887-888 | -RRB- | denotes | ) |
T25194 | 885-887 | NN | denotes | µM |
T25193 | 879-884 | CD | denotes | 20–30 |
T25192 | 878-879 | -LRB- | denotes | ( |
T25191 | 869-877 | NN | denotes | zVAD.fmk |
T25190 | 859-868 | NN | denotes | inhibitor |
T25189 | 847-858 | NN | denotes | Pan-caspase |
T25188 | 244-245 | -COLON- | denotes | : |
T25187 | 233-244 | NN | denotes | experiments |
T25186 | 229-232 | DT | denotes | the |
T25185 | 226-228 | IN | denotes | in |
T25184 | 221-225 | VB | denotes | used |
T25183 | 216-220 | VB | denotes | were |
T25182 | 214-215 | -RRB- | denotes | ) |
T25181 | 202-214 | NN | denotes | text/figures |
T25180 | 198-201 | DT | denotes | the |
T25179 | 195-197 | IN | denotes | in |
T25178 | 185-194 | VB | denotes | specified |
T25177 | 175-184 | RB | denotes | otherwise |
T25176 | 168-174 | IN | denotes | unless |
T25175 | 167-168 | -LRB- | denotes | ( |
T25174 | 152-166 | NN | denotes | concentrations |
T25173 | 146-151 | JJ | denotes | final |
T25172 | 142-145 | CC | denotes | and |
T25171 | 133-141 | NN | denotes | reagents |
T25170 | 123-132 | VB | denotes | following |
T25169 | 119-122 | DT | denotes | The |
T25168 | 116-117 | -RRB- | denotes | ] |
T25167 | 114-116 | CD | denotes | 24 |
T25166 | 113-114 | -LRB- | denotes | [ |
T25165 | 111-112 | -COMMA- | denotes | , |
T25164 | 110-111 | -RRB- | denotes | ] |
T25163 | 108-110 | CD | denotes | 23 |
T25162 | 107-108 | -LRB- | denotes | [ |
T25161 | 97-106 | VB | denotes | described |
T25160 | 86-96 | RB | denotes | previously |
T25159 | 83-85 | IN | denotes | as |
T25158 | 71-82 | VB | denotes | synthesized |
T25157 | 66-70 | VB | denotes | were |
T25156 | 58-65 | NN | denotes | analogs |
T25155 | 46-57 | NN | denotes | Necrostatin |
T25154 | 36-45 | NN | denotes | Chemicals |
T25153 | 32-35 | CC | denotes | and |
T25152 | 23-31 | NN | denotes | Reagents |
T25647 | 1370-1378 | NN | denotes | strategy |
T25646 | 1365-1369 | JJ | denotes | same |
T25645 | 1361-1364 | DT | denotes | the |
T25644 | 1355-1360 | VB | denotes | using |
T25643 | 1345-1354 | VB | denotes | generated |
T25642 | 1340-1344 | VB | denotes | were |
T25641 | 1331-1339 | NN | denotes | Myr-Akt1 |
T25640 | 1328-1330 | IN | denotes | of |
T25639 | 1319-1327 | NN | denotes | versions |
T25638 | 1312-1318 | JJ | denotes | Mutant |
T25637 | 1309-1310 | -RRB- | denotes | ) |
T25636 | 1299-1309 | NN | denotes | Invitrogen |
T25635 | 1298-1299 | -LRB- | denotes | ( |
T25634 | 1291-1297 | NN | denotes | vector |
T25633 | 1280-1290 | JJ | denotes | retroviral |
T25632 | 1269-1279 | NN | denotes | pMSCV-puro |
T25631 | 1266-1268 | IN | denotes | of |
T25630 | 1260-1265 | NN | denotes | sites |
T25629 | 1254-1259 | NN | denotes | EcoRI |
T25628 | 1250-1253 | CC | denotes | and |
T25627 | 1244-1249 | NN | denotes | BglII |
T25626 | 1240-1243 | DT | denotes | the |
T25625 | 1235-1239 | IN | denotes | into |
T25624 | 1225-1234 | VB | denotes | subcloned |
T25623 | 1221-1224 | CC | denotes | and |
T25622 | 1217-1220 | NN | denotes | PCR |
T25621 | 1214-1216 | IN | denotes | by |
T25620 | 1204-1213 | VB | denotes | amplified |
T25619 | 1200-1203 | VB | denotes | was |
T25618 | 1186-1199 | NN | denotes | Myr-Akt1-FLAG |
T25617 | 1183-1184 | -RRB- | denotes | ] |
T25616 | 1181-1183 | CD | denotes | 52 |
T25615 | 1180-1181 | -LRB- | denotes | [ |
T25614 | 1170-1179 | VB | denotes | described |
T25613 | 1165-1169 | VB | denotes | been |
T25612 | 1161-1164 | VB | denotes | has |
T25611 | 1159-1160 | -COMMA- | denotes | , |
T25610 | 1156-1159 | NN | denotes | tag |
T25609 | 1151-1155 | NN | denotes | FLAG |
T25608 | 1140-1150 | JJ | denotes | c-terminal |
T25607 | 1129-1139 | VB | denotes | containing |
T25606 | 1127-1128 | -COMMA- | denotes | , |
T25605 | 1119-1127 | NN | denotes | Myr-Akt1 |
T25604 | 1116-1118 | IN | denotes | of |
T25603 | 1108-1115 | NN | denotes | Cloning |
T25602 | 1104-1107 | NN | denotes | DNA |
T27975 | 6642-6650 | NN | denotes | ELISAOne |
R17099 | T25152 | T25153 | arg1Of | Reagents,and |
R17100 | T25154 | T25153 | arg2Of | Chemicals,and |
R17101 | T25156 | T25155 | arg1Of | analogs,Necrostatin |
R17102 | T25156 | T25157 | arg1Of | analogs,were |
R17103 | T25156 | T25158 | arg2Of | analogs,synthesized |
R17104 | T25158 | T25157 | arg2Of | synthesized,were |
R17105 | T25158 | T25159 | arg1Of | synthesized,as |
R17106 | T25158 | T25165 | arg1Of | synthesized,"," |
R17107 | T25158 | T25166 | arg1Of | synthesized,[ |
R17108 | T25161 | T25160 | arg1Of | described,previously |
R17109 | T25163 | T25159 | arg2Of | 23,as |
R17110 | T25163 | T25161 | arg1Of | 23,described |
R17111 | T25163 | T25162 | arg2Of | 23,[ |
R17112 | T25164 | T25162 | arg3Of | ],[ |
R17113 | T25167 | T25166 | arg2Of | 24,[ |
R17114 | T25168 | T25166 | arg3Of | ],[ |
R17115 | T25171 | T25170 | arg1Of | reagents,following |
R17116 | T25171 | T25172 | arg1Of | reagents,and |
R17117 | T25172 | T25169 | arg1Of | and,The |
R17118 | T25172 | T25175 | arg1Of | and,( |
R17119 | T25174 | T25172 | arg2Of | concentrations,and |
R17120 | T25174 | T25173 | arg1Of | concentrations,final |
R17121 | T25178 | T25176 | arg2Of | specified,unless |
R17122 | T25178 | T25177 | arg1Of | specified,otherwise |
R17123 | T25178 | T25179 | arg1Of | specified,in |
R17124 | T25181 | T25180 | arg1Of | text/figures,the |
R17125 | T25181 | T25182 | arg1Of | text/figures,) |
R17126 | T25181 | T25183 | arg1Of | text/figures,were |
R17127 | T25181 | T25184 | arg2Of | text/figures,used |
R17128 | T25184 | T25175 | arg2Of | used,( |
R17129 | T25184 | T25176 | arg1Of | used,unless |
R17130 | T25184 | T25183 | arg2Of | used,were |
R17131 | T25184 | T25185 | arg1Of | used,in |
R17132 | T25187 | T25185 | arg2Of | experiments,in |
R17133 | T25187 | T25186 | arg1Of | experiments,the |
R17134 | T25188 | T25175 | arg3Of | :,( |
R17135 | T25191 | T25189 | arg1Of | zVAD.fmk,Pan-caspase |
R17136 | T25191 | T25190 | arg1Of | zVAD.fmk,inhibitor |
R17137 | T25191 | T25192 | arg1Of | zVAD.fmk,( |
R17138 | T25191 | T25196 | arg1Of | zVAD.fmk,was |
R17139 | T25191 | T25197 | arg2Of | zVAD.fmk,purchased |
R17140 | T25194 | T25192 | arg2Of | µM,( |
R17141 | T25194 | T25193 | arg1Of | µM,20–30 |
R17142 | T25195 | T25192 | arg3Of | ),( |
R17143 | T25197 | T25196 | arg2Of | purchased,was |
R17144 | T25197 | T25198 | arg1Of | purchased,from |
R17145 | T25200 | T25198 | arg2Of | Human,from |
R17146 | T25200 | T25199 | arg1Of | Human,Bachem. |
R17147 | T25203 | T25201 | arg1Of | TNFα,and |
R17148 | T25203 | T25202 | arg1Of | TNFα,mouse |
R17149 | T25203 | T25204 | arg1Of | TNFα,( |
R17150 | T25203 | T25208 | arg1Of | TNFα,"," |
R17151 | T25203 | T25238 | arg1Of | TNFα,or |
R17152 | T25206 | T25204 | arg2Of | ng/ml,( |
R17153 | T25206 | T25205 | arg1Of | ng/ml,10 |
R17154 | T25207 | T25204 | arg3Of | ),( |
R17155 | T25210 | T25209 | arg1Of | bFGF,human |
R17156 | T25210 | T25211 | arg1Of | bFGF,( |
R17157 | T25210 | T25215 | arg1Of | bFGF,"," |
R17158 | T25213 | T25211 | arg2Of | ng/ml,( |
R17159 | T25213 | T25212 | arg1Of | ng/ml,25 |
R17160 | T25214 | T25211 | arg3Of | ),( |
R17161 | T25215 | T25221 | arg1Of | ",","," |
R17162 | T25216 | T25215 | arg2Of | EGF,"," |
R17163 | T25216 | T25217 | arg1Of | EGF,( |
R17164 | T25219 | T25217 | arg2Of | ng/ml,( |
R17165 | T25219 | T25218 | arg1Of | ng/ml,50 |
R17166 | T25220 | T25217 | arg3Of | ),( |
R17167 | T25221 | T25228 | arg1Of | ",",and |
R17168 | T25222 | T25221 | arg2Of | PDGF-BB,"," |
R17169 | T25222 | T25223 | arg1Of | PDGF-BB,( |
R17170 | T25225 | T25223 | arg2Of | ng/ml,( |
R17171 | T25225 | T25224 | arg1Of | ng/ml,20 |
R17172 | T25226 | T25223 | arg3Of | ),( |
R17173 | T25228 | T25227 | arg1Of | and,"," |
R17174 | T25228 | T25234 | arg1Of | and,were |
R17175 | T25228 | T25235 | arg1Of | and,from |
R17176 | T25229 | T25228 | arg2Of | IGF-1,and |
R17177 | T25229 | T25230 | arg1Of | IGF-1,( |
R17178 | T25232 | T25230 | arg2Of | ng/ml,( |
R17179 | T25232 | T25231 | arg1Of | ng/ml,50 |
R17180 | T25233 | T25230 | arg3Of | ),( |
R17181 | T25234 | T25208 | arg2Of | were,"," |
R17182 | T25235 | T25234 | arg2Of | from,were |
R17183 | T25237 | T25235 | arg2Of | Sciences,from |
R17184 | T25237 | T25236 | arg1Of | Sciences,Cell |
R17185 | T25238 | T25243 | arg1Of | or,were |
R17186 | T25238 | T25244 | arg1Of | or,from |
R17187 | T25242 | T25238 | arg2Of | reagents,or |
R17188 | T25242 | T25239 | arg1Of | reagents,Peprotech. |
R17189 | T25242 | T25240 | arg1Of | reagents,All |
R17190 | T25242 | T25241 | arg1Of | reagents,other |
R17191 | T25243 | T25196 | modOf | were,was |
R17192 | T25244 | T25243 | arg2Of | from,were |
R17193 | T25245 | T25244 | arg2Of | Sigma,from |
R17465 | T25603 | T25604 | arg1Of | Cloning,of |
R17466 | T25603 | T25606 | arg1Of | Cloning,"," |
R17467 | T25603 | T25607 | arg1Of | Cloning,containing |
R17468 | T25603 | T25612 | arg1Of | Cloning,has |
R17469 | T25603 | T25613 | arg1Of | Cloning,been |
R17470 | T25603 | T25614 | arg2Of | Cloning,described |
R17471 | T25605 | T25604 | arg2Of | Myr-Akt1,of |
R17472 | T25610 | T25607 | arg2Of | tag,containing |
R17473 | T25610 | T25608 | arg1Of | tag,c-terminal |
R17474 | T25610 | T25609 | arg1Of | tag,FLAG |
R17475 | T25614 | T25611 | arg1Of | described,"," |
R17476 | T25614 | T25612 | arg2Of | described,has |
R17477 | T25614 | T25613 | arg2Of | described,been |
R17478 | T25614 | T25615 | arg1Of | described,[ |
R17479 | T25616 | T25615 | arg2Of | 52,[ |
R17480 | T25617 | T25615 | arg3Of | ],[ |
R17481 | T25618 | T25619 | arg1Of | Myr-Akt1-FLAG,was |
R17482 | T25618 | T25620 | arg2Of | Myr-Akt1-FLAG,amplified |
R17483 | T25618 | T25624 | arg2Of | Myr-Akt1-FLAG,subcloned |
R17484 | T25620 | T25623 | arg1Of | amplified,and |
R17485 | T25622 | T25620 | arg1Of | PCR,amplified |
R17486 | T25622 | T25621 | arg2Of | PCR,by |
R17487 | T25623 | T25619 | arg2Of | and,was |
R17488 | T25624 | T25623 | arg2Of | subcloned,and |
R17489 | T25624 | T25625 | arg1Of | subcloned,into |
R17490 | T25627 | T25628 | arg1Of | BglII,and |
R17491 | T25629 | T25628 | arg2Of | EcoRI,and |
R17492 | T25630 | T25625 | arg2Of | sites,into |
R17493 | T25630 | T25626 | arg1Of | sites,the |
R17494 | T25630 | T25627 | arg1Of | sites,BglII |
R17495 | T25630 | T25629 | arg1Of | sites,EcoRI |
R17496 | T25630 | T25631 | arg1Of | sites,of |
R17497 | T25634 | T25631 | arg2Of | vector,of |
R17498 | T25634 | T25632 | arg1Of | vector,pMSCV-puro |
R17499 | T25634 | T25633 | arg1Of | vector,retroviral |
R17500 | T25634 | T25635 | arg1Of | vector,( |
R17501 | T25636 | T25635 | arg2Of | Invitrogen,( |
R17502 | T25637 | T25635 | arg3Of | ),( |
R17503 | T25639 | T25638 | arg1Of | versions,Mutant |
R17504 | T25639 | T25640 | arg1Of | versions,of |
R17505 | T25639 | T25642 | arg1Of | versions,were |
R17506 | T25639 | T25643 | arg2Of | versions,generated |
R17507 | T25641 | T25640 | arg2Of | Myr-Akt1,of |
R17508 | T25643 | T25642 | arg2Of | generated,were |
R17509 | T25644 | T25643 | arg3Of | using,generated |
R17510 | T25647 | T25644 | arg2Of | strategy,using |
R17511 | T25647 | T25645 | arg1Of | strategy,the |
R17512 | T25647 | T25646 | arg1Of | strategy,same |
R17780 | T26016 | T26015 | arg1Of | Primers,QPCR |
R17781 | T26018 | T26017 | arg1Of | TNFα,Mouse |
R17782 | T26018 | T26019 | arg1Of | TNFα,: |
R17783 | T26021 | T26020 | arg1Of | 5′-CCCTCACACTCAGATCATCTTCT-3′,forward |
R17784 | T26021 | T26022 | arg1Of | 5′-CCCTCACACTCAGATCATCTTCT-3′,"," |
R17785 | T26023 | T26022 | arg2Of | reverse,"," |
R17786 | T26024 | T26021 | arg1Of | 5′-GCTACGACGTGGGCTACAG-3′,5′-CCCTCACACTCAGATCATCTTCT-3′ |
R17787 | T26024 | T26023 | arg1Of | 5′-GCTACGACGTGGGCTACAG-3′,reverse |
R17788 | T26024 | T26025 | arg1Of | 5′-GCTACGACGTGGGCTACAG-3′,; |
R17789 | T26025 | T26019 | arg2Of | ;,: |
R17790 | T26025 | T26028 | arg1Of | ;,: |
R17791 | T26027 | T26025 | arg2Of | 18S,; |
R17792 | T26027 | T26026 | arg1Of | 18S,mouse |
R17793 | T26030 | T26029 | arg1Of | 5-′,forward |
R17794 | T26031 | T26028 | arg2Of | ATAACAGGTCTGTGATGCCCTTAG-3,: |
R17795 | T26031 | T26030 | arg1Of | ATAACAGGTCTGTGATGCCCTTAG-3,5-′ |
R17796 | T26031 | T26032 | arg1Of | ATAACAGGTCTGTGATGCCCTTAG-3,"," |
R17797 | T26031 | T26035 | arg1Of | ATAACAGGTCTGTGATGCCCTTAG-3,; |
R17798 | T26034 | T26032 | arg2Of | 5′-CTAAACCATCCAATCGGTAGTAGC-3′,"," |
R17799 | T26034 | T26033 | arg1Of | 5′-CTAAACCATCCAATCGGTAGTAGC-3′,reverse |
R17800 | T26037 | T26035 | arg2Of | TNFα,; |
R17801 | T26037 | T26036 | arg1Of | TNFα,human |
R17802 | T26037 | T26038 | arg1Of | TNFα,: |
R17803 | T26040 | T26039 | arg1Of | 5′-,forward |
R17804 | T26041 | T26038 | arg2Of | ATGAGCACTGAAAGCATGATCC-3′,: |
R17805 | T26041 | T26040 | arg1Of | ATGAGCACTGAAAGCATGATCC-3′,5′- |
R17806 | T26041 | T26042 | arg1Of | ATGAGCACTGAAAGCATGATCC-3′,"," |
R17807 | T26041 | T26045 | arg1Of | ATGAGCACTGAAAGCATGATCC-3′,: |
R17808 | T26044 | T26042 | arg2Of | TNFα,"," |
R17809 | T26044 | T26043 | arg1Of | TNFα,human |
R17810 | T26047 | T26045 | arg2Of | 5′-GAGGGCTGATTAGAGAGAGGTC-3′,: |
R17811 | T26047 | T26046 | arg1Of | 5′-GAGGGCTGATTAGAGAGAGGTC-3′,reverse |
R17812 | T26047 | T26048 | arg1Of | 5′-GAGGGCTGATTAGAGAGAGGTC-3′,; |
R17813 | T26050 | T26048 | arg2Of | 18S,; |
R17814 | T26050 | T26049 | arg1Of | 18S,human |
R17815 | T26050 | T26051 | arg1Of | 18S,: |
R17816 | T26053 | T26052 | arg1Of | 5′-,forward |
R17817 | T26054 | T26053 | arg1Of | CAGCCACCCGAGATTGAGCA,5′- |
R17818 | T26054 | T26055 | arg1Of | CAGCCACCCGAGATTGAGCA,-3 |
R17819 | T26054 | T26056 | arg1Of | CAGCCACCCGAGATTGAGCA,"," |
R17820 | T26056 | T26051 | arg2Of | ",",: |
R17821 | T26056 | T26059 | arg1Of | ",",: |
R17822 | T26058 | T26056 | arg2Of | 18S,"," |
R17823 | T26058 | T26057 | arg1Of | 18S,human |
R17824 | T26061 | T26059 | arg2Of | 5′-TAGTAGCGACGGGCGGTGTG-3′,: |
R17825 | T26061 | T26060 | arg1Of | 5′-TAGTAGCGACGGGCGGTGTG-3′,reverse |
R17916 | T26221 | T26233 | arg1Of | were,[ |
R17926 | T26231 | T26230 | arg1Of | University,Tufts |
R17927 | T26232 | T26229 | arg3Of | ),( |
R17928 | T26234 | T26233 | arg2Of | 53,[ |
R17929 | T26235 | T26233 | arg3Of | ],[ |
R17930 | T26236 | T26237 | arg1Of | J774A.1,( |
R17931 | T26238 | T26237 | arg2Of | ATCC,( |
R17932 | T26239 | T26237 | arg3Of | ),( |
R17933 | T26240 | T26236 | arg1Of | cells,J774A.1 |
R17934 | T26240 | T26241 | arg1Of | cells,and |
R17935 | T26241 | T26247 | arg1Of | and,were |
R17936 | T26244 | T26243 | arg2Of | ATCC,( |
R17937 | T26245 | T26243 | arg3Of | ),( |
R17938 | T26246 | T26241 | arg2Of | cells,and |
R17939 | T26246 | T26242 | arg1Of | cells,RAW264.7 |
R17940 | T26246 | T26243 | arg1Of | cells,( |
R17941 | T26249 | T26247 | arg2Of | gifts,were |
R17942 | T26249 | T26248 | arg1Of | gifts,generous |
R17943 | T26249 | T26250 | arg1Of | gifts,of |
R17944 | T26252 | T26251 | arg1Of | Yuan,Junying |
R17945 | T26252 | T26253 | arg1Of | Yuan,( |
R17946 | T26252 | T26257 | arg1Of | Yuan,and |
R17947 | T26255 | T26253 | arg2Of | University,( |
R17948 | T26255 | T26254 | arg1Of | University,Harvard |
R17949 | T26256 | T26253 | arg3Of | ),( |
R17950 | T26257 | T26250 | arg2Of | and,of |
R17951 | T26259 | T26257 | arg2Of | Poltorak,and |
R17952 | T26259 | T26258 | arg1Of | Poltorak,Alexander |
R17953 | T26259 | T26260 | arg1Of | Poltorak,( |
R17954 | T26259 | T26264 | arg1Of | Poltorak,"," |
R17955 | T26259 | T26265 | arg1Of | Poltorak,respectively |
R17956 | T26262 | T26260 | arg2Of | University,( |
R17957 | T26262 | T26261 | arg1Of | University,Tufts |
R17958 | T26263 | T26260 | arg3Of | ),( |
R17959 | T26266 | T26267 | arg1Of | Cells,were |
R17960 | T26266 | T26268 | arg2Of | Cells,maintained |
R17961 | T26268 | T26267 | arg2Of | maintained,were |
R17962 | T26268 | T26269 | arg1Of | maintained,in |
R17963 | T26270 | T26269 | arg2Of | DMEM,in |
R17964 | T26270 | T26271 | arg2Of | DMEM,supplemented |
R17965 | T26271 | T26272 | arg1Of | supplemented,with |
R17966 | T26273 | T26274 | arg1Of | 10,% |
R17967 | T26277 | T26273 | arg1Of | serum,10 |
R17968 | T26277 | T26275 | arg1Of | serum,fetal |
R17969 | T26277 | T26276 | arg1Of | serum,bovine |
R17970 | T26277 | T26278 | arg1Of | serum,( |
R17971 | T26277 | T26281 | arg1Of | serum,and |
R17972 | T26279 | T26278 | arg2Of | FBS,( |
R17973 | T26280 | T26278 | arg3Of | ),( |
R17974 | T26281 | T26272 | arg2Of | and,with |
R17975 | T26282 | T26283 | arg1Of | 1,% |
R17976 | T26285 | T26281 | arg2Of | mixture,and |
R17977 | T26285 | T26282 | arg1Of | mixture,1 |
R17978 | T26285 | T26284 | arg1Of | mixture,antibiotic-antimycotic |
R17979 | T26285 | T26286 | arg1Of | mixture,( |
R17980 | T26287 | T26286 | arg2Of | Invitrogen,( |
R17981 | T26288 | T26286 | arg3Of | ),( |
R17982 | T26293 | T26289 | arg1Of | media,The |
R17983 | T26293 | T26290 | arg1Of | media,mouse |
R17984 | T26293 | T26291 | arg1Of | media,lung |
R17985 | T26293 | T26292 | arg1Of | media,fibroblast |
R17986 | T26293 | T26294 | arg1Of | media,was |
R17987 | T26293 | T26296 | arg2Of | media,supplemented |
R17988 | T26296 | T26294 | arg2Of | supplemented,was |
R17989 | T26296 | T26295 | arg1Of | supplemented,additionally |
R17990 | T26296 | T26297 | arg1Of | supplemented,with |
R17991 | T26298 | T26299 | arg1Of | L-glutamine,"," |
R17992 | T26299 | T26304 | arg1Of | ",",and |
R17993 | T26302 | T26299 | arg2Of | acids,"," |
R17994 | T26302 | T26300 | arg1Of | acids,non-essential |
R17995 | T26302 | T26301 | arg1Of | acids,amino |
R17996 | T26304 | T26297 | arg2Of | and,with |
R17997 | T26304 | T26303 | arg1Of | and,"," |
R17998 | T26306 | T26304 | arg2Of | pyruvate,and |
R17999 | T26306 | T26305 | arg1Of | pyruvate,sodium |
R18000 | T26308 | T26307 | arg1Of | cells,Jurkat |
R18001 | T26308 | T26309 | arg1Of | cells,were |
R18002 | T26308 | T26310 | arg2Of | cells,maintained |
R18003 | T26310 | T26309 | arg2Of | maintained,were |
R18004 | T26310 | T26311 | arg1Of | maintained,in |
R18005 | T26312 | T26313 | arg1Of | RPMI1640,"," |
R18006 | T26312 | T26314 | arg2Of | RPMI1640,supplemented |
R18007 | T26312 | T26322 | arg1Of | RPMI1640,and |
R18008 | T26314 | T26315 | arg1Of | supplemented,with |
R18009 | T26314 | T26319 | arg1Of | supplemented,( |
R18010 | T26316 | T26317 | arg1Of | 10,% |
R18011 | T26318 | T26315 | arg2Of | FetalPlex,with |
R18012 | T26318 | T26316 | arg1Of | FetalPlex,10 |
R18013 | T26320 | T26319 | arg2Of | Gemini,( |
R18014 | T26321 | T26319 | arg3Of | ),( |
R18015 | T26322 | T26311 | arg2Of | and,in |
R18016 | T26322 | T26325 | arg1Of | and,antibiotic-antimycotic |
R18017 | T26324 | T26322 | arg2Of | %,and |
R18018 | T26324 | T26323 | arg1Of | %,1 |
R18149 | T26491 | T26489 | arg1Of | Experiments,Cell |
R18150 | T26491 | T26490 | arg1Of | Experiments,Viability |
R18151 | T26492 | T26493 | arg1Of | Cells,were |
R18152 | T26492 | T26494 | arg2Of | Cells,seeded |
R18153 | T26492 | T26509 | arg2Of | Cells,treated |
R18154 | T26494 | T26495 | arg1Of | seeded,into |
R18155 | T26494 | T26502 | arg1Of | seeded,at |
R18156 | T26494 | T26508 | arg1Of | seeded,and |
R18157 | T26498 | T26495 | arg2Of | bottom,into |
R18158 | T26498 | T26496 | arg1Of | bottom,white |
R18159 | T26498 | T26497 | arg1Of | bottom,clear |
R18160 | T26498 | T26501 | arg2Of | bottom,plates |
R18161 | T26499 | T26501 | arg1Of | 96,plates |
R18162 | T26501 | T26500 | arg1Of | plates,well |
R18163 | T26504 | T26502 | arg2Of | density,at |
R18164 | T26504 | T26503 | arg1Of | density,the |
R18165 | T26504 | T26505 | arg1Of | density,of |
R18166 | T26507 | T26505 | arg2Of | cells/well,of |
R18167 | T26507 | T26506 | arg1Of | cells/well,1×104 |
R18168 | T26508 | T26493 | arg2Of | and,were |
R18169 | T26509 | T26508 | arg2Of | treated,and |
R18170 | T26509 | T26510 | arg1Of | treated,as |
R18171 | T26511 | T26510 | arg2Of | described,as |
R18172 | T26511 | T26512 | arg1Of | described,for |
R18173 | T26515 | T26512 | arg2Of | experiments,for |
R18174 | T26515 | T26513 | arg1Of | experiments,western |
R18175 | T26515 | T26514 | arg1Of | experiments,blot |
R18176 | T26517 | T26516 | arg1Of | viability,Cell |
R18177 | T26517 | T26518 | arg1Of | viability,was |
R18178 | T26517 | T26519 | arg2Of | viability,determined |
R18179 | T26519 | T26518 | arg2Of | determined,was |
R18180 | T26520 | T26519 | arg3Of | using,determined |
R18181 | T26524 | T26520 | arg2Of | Assay,using |
R18182 | T26524 | T26521 | arg1Of | Assay,CellTiter-Glo |
R18183 | T26524 | T26522 | arg1Of | Assay,Cell |
R18184 | T26524 | T26523 | arg1Of | Assay,Viability |
R18185 | T26524 | T26525 | arg1Of | Assay,( |
R18186 | T26526 | T26525 | arg2Of | Promega,( |
R18187 | T26527 | T26525 | arg3Of | ),( |
R18188 | T26528 | T26529 | arg1Of | Experiments,were |
R18189 | T26528 | T26530 | arg2Of | Experiments,performed |
R18190 | T26528 | T26534 | arg1Of | Experiments,triplicate |
R18191 | T26530 | T26529 | arg2Of | performed,were |
R18192 | T26530 | T26531 | arg1Of | performed,in |
R18193 | T26530 | T26533 | arg1Of | performed,or |
R18194 | T26532 | T26531 | arg2Of | duplicate,in |
R18195 | T26534 | T26533 | arg2Of | triplicate,or |
R18196 | T26535 | T26536 | arg1Of | Viability,of |
R18197 | T26535 | T26541 | arg1Of | Viability,was |
R18198 | T26535 | T26542 | arg2Of | Viability,set |
R18199 | T26540 | T26536 | arg2Of | cells,of |
R18200 | T26540 | T26537 | arg1Of | cells,the |
R18201 | T26540 | T26538 | arg1Of | cells,control |
R18202 | T26540 | T26539 | arg1Of | cells,untreated |
R18203 | T26542 | T26541 | arg2Of | set,was |
R18204 | T26542 | T26543 | arg1Of | set,as |
R18205 | T26545 | T26543 | arg2Of | %,as |
R18206 | T26545 | T26544 | arg1Of | %,100 |
R18207 | T26547 | T26546 | arg1Of | viability,Relative |
R18208 | T26547 | T26548 | arg1Of | viability,of |
R18209 | T26547 | T26551 | arg1Of | viability,induced |
R18210 | T26547 | T26553 | arg1Of | viability,undergo |
R18211 | T26547 | T26556 | arg2Of | viability,treated |
R18212 | T26547 | T26567 | arg1Of | viability,was |
R18213 | T26547 | T26568 | arg2Of | viability,determined |
R18214 | T26547 | T26570 | arg2Of | viability,plotted |
R18215 | T26547 | T26572 | arg1Of | viability,exclude |
R18216 | T26549 | T26548 | arg2Of | cells,of |
R18217 | T26551 | T26552 | modOf | induced,to |
R18218 | T26551 | T26566 | arg1Of | induced,"," |
R18219 | T26553 | T26555 | arg1Of | undergo,and |
R18220 | T26554 | T26553 | arg2Of | necroptosis,undergo |
R18221 | T26555 | T26552 | arg1Of | and,to |
R18222 | T26556 | T26555 | arg2Of | treated,and |
R18223 | T26556 | T26557 | arg1Of | treated,with |
R18224 | T26559 | T26557 | arg2Of | compound,with |
R18225 | T26559 | T26558 | arg1Of | compound,the |
R18226 | T26559 | T26560 | arg1Of | compound,relative |
R18227 | T26560 | T26561 | arg1Of | relative,to |
R18228 | T26565 | T26561 | arg2Of | cells,to |
R18229 | T26565 | T26562 | arg1Of | cells,the |
R18230 | T26565 | T26563 | arg1Of | cells,control |
R18231 | T26565 | T26564 | arg1Of | cells,compound-treated |
R18232 | T26566 | T26550 | arg1Of | ",","," |
R18233 | T26568 | T26569 | arg1Of | determined,and |
R18234 | T26569 | T26566 | arg2Of | and,"," |
R18235 | T26569 | T26567 | arg2Of | and,was |
R18236 | T26570 | T26569 | arg2Of | plotted,and |
R18237 | T26572 | T26570 | arg3Of | exclude,plotted |
R18238 | T26572 | T26571 | arg1Of | exclude,to |
R18239 | T26575 | T26572 | arg2Of | effects,exclude |
R18240 | T26575 | T26573 | arg1Of | effects,the |
R18241 | T26575 | T26574 | arg1Of | effects,possible |
R18242 | T26575 | T26576 | arg1Of | effects,of |
R18243 | T26578 | T26576 | arg2Of | toxicity,of |
R18244 | T26578 | T26577 | arg1Of | toxicity,non-specific |
R18245 | T26578 | T26579 | arg1Of | toxicity,of |
R18246 | T26582 | T26579 | arg2Of | molecules,of |
R18247 | T26582 | T26580 | arg1Of | molecules,the |
R18248 | T26582 | T26581 | arg1Of | molecules,small |
R18350 | T26749 | T26748 | arg1Of | Knockdown,siRNA |
R18351 | T26750 | T26751 | arg1Of | siRNAs,were |
R18352 | T26750 | T26752 | arg2Of | siRNAs,purchased |
R18353 | T26752 | T26751 | arg2Of | purchased,were |
R18354 | T26752 | T26753 | arg1Of | purchased,from |
R18355 | T26755 | T26754 | arg1Of | Mouse,Dharmacon. |
R18356 | T26758 | T26755 | arg1Of | protein,Mouse |
R18357 | T26758 | T26756 | arg1Of | protein,ribosomal |
R18358 | T26758 | T26757 | arg1Of | protein,S6 |
R18359 | T26758 | T26759 | arg1Of | protein,( |
R18360 | T26758 | T26764 | arg1Of | protein,"," |
R18361 | T26760 | T26761 | arg1Of | L-040893-00,and |
R18362 | T26761 | T26759 | arg2Of | and,( |
R18363 | T26762 | T26761 | arg2Of | L-045791-00,and |
R18364 | T26763 | T26759 | arg3Of | ),( |
R18365 | T26764 | T26770 | arg1Of | ",","," |
R18366 | T26766 | T26764 | arg2Of | Akt1,"," |
R18367 | T26766 | T26765 | arg1Of | Akt1,mouse |
R18368 | T26766 | T26767 | arg1Of | Akt1,( |
R18369 | T26768 | T26767 | arg2Of | L-040709-00,( |
R18370 | T26769 | T26767 | arg3Of | ),( |
R18371 | T26770 | T26788 | arg1Of | ",","," |
R18372 | T26772 | T26771 | arg1Of | Akt2,mouse |
R18373 | T26772 | T26773 | arg1Of | Akt2,( |
R18374 | T26772 | T26776 | arg1Of | Akt2,"," |
R18375 | T26774 | T26773 | arg2Of | L-040782-00,( |
R18376 | T26775 | T26773 | arg3Of | ),( |
R18377 | T26776 | T26782 | arg1Of | ",","," |
R18378 | T26778 | T26776 | arg2Of | Akt3,"," |
R18379 | T26778 | T26777 | arg1Of | Akt3,mouse |
R18380 | T26778 | T26779 | arg1Of | Akt3,( |
R18381 | T26780 | T26779 | arg2Of | L-040891-00,( |
R18382 | T26781 | T26779 | arg3Of | ),( |
R18383 | T26782 | T26770 | arg2Of | ",","," |
R18384 | T26784 | T26782 | arg2Of | mTOR,"," |
R18385 | T26784 | T26783 | arg1Of | mTOR,mouse |
R18386 | T26784 | T26785 | arg1Of | mTOR,( |
R18387 | T26786 | T26785 | arg2Of | L-065427-00,( |
R18388 | T26787 | T26785 | arg3Of | ),( |
R18389 | T26788 | T26753 | arg2Of | ",",from |
R18390 | T26788 | T26794 | arg1Of | ",","," |
R18391 | T26790 | T26788 | arg2Of | PDK1,"," |
R18392 | T26790 | T26789 | arg1Of | PDK1,mouse |
R18393 | T26790 | T26791 | arg1Of | PDK1,( |
R18394 | T26792 | T26791 | arg2Of | L-040658-00,( |
R18395 | T26793 | T26791 | arg3Of | ),( |
R18396 | T26796 | T26795 | arg1Of | control,non-coding |
R18397 | T26796 | T26797 | arg1Of | control,( |
R18398 | T26796 | T26800 | arg1Of | control,"," |
R18399 | T26798 | T26797 | arg2Of | D-001810-10-05,( |
R18400 | T26799 | T26797 | arg3Of | ),( |
R18401 | T26800 | T26806 | arg1Of | ",","," |
R18402 | T26802 | T26800 | arg2Of | Mapk8,"," |
R18403 | T26802 | T26801 | arg1Of | Mapk8,mouse |
R18404 | T26802 | T26803 | arg1Of | Mapk8,( |
R18405 | T26804 | T26803 | arg2Of | J-040128-05,( |
R18406 | T26805 | T26803 | arg3Of | ),( |
R18407 | T26806 | T26794 | arg2Of | ",","," |
R18408 | T26806 | T26819 | modOf | ",",NA w |
R18409 | T26808 | T26806 | arg2Of | Mapk9,"," |
R18410 | T26808 | T26807 | arg1Of | Mapk9,mouse |
R18411 | T26808 | T26809 | arg1Of | Mapk9,( |
R18412 | T26810 | T26809 | arg2Of | J-040134-05,( |
R18413 | T26811 | T26809 | arg3Of | ),( |
R18414 | T26816 | T26815 | arg2Of | L-043776-00,( |
R18415 | T26817 | T26815 | arg3Of | ),( |
R18416 | T26818 | T26813 | arg1Of | . siR,mouse |
R18417 | T26818 | T26814 | arg1Of | . siR,Jun |
R18418 | T26818 | T26815 | arg1Of | . siR,( |
R18419 | T26818 | T26819 | arg1Of | . siR,NA w |
R18420 | T26818 | T26820 | arg2Of | . siR,ere transfe |
R18421 | T26820 | T26812 | arg1Of | ere transfe,"," |
R18422 | T26820 | T26819 | arg2Of | ere transfe,NA w |
R18423 | T26820 | T26821 | modOf | ere transfe,cted |
R18424 | T26820 | T26827 | arg1Of | ere transfe,i |
R18425 | T26820 | T26828 | arg1Of | ere transfe,"trogen), " |
R18426 | T26823 | T26821 | arg2Of | NAiMAX ,cted |
R18427 | T26823 | T26822 | arg1Of | NAiMAX ,using R |
R18428 | T26823 | T26824 | arg1Of | NAiMAX ,r |
R18429 | T26825 | T26824 | arg2Of | eagent (In,r |
R18430 | T26826 | T26824 | arg3Of | v,r |
R18431 | T26829 | T26828 | arg2Of | ac,"trogen), " |
R18432 | T26831 | T26829 | arg2Of | ufacturer’s rec,ac |
R18433 | T26831 | T26830 | arg1Of | ufacturer’s rec,cording to man |
R18434 | T26834 | T26832 | arg2Of | hr,After |
R18435 | T26834 | T26833 | arg1Of | hr,72 |
R18436 | T26836 | T26837 | arg1Of | cells,were |
R18437 | T26836 | T26838 | arg2Of | cells,treated |
R18438 | T26838 | T26832 | arg1Of | treated,After |
R18439 | T26838 | T26835 | arg1Of | treated,"," |
R18440 | T26838 | T26837 | arg2Of | treated,were |
R18441 | T26838 | T26839 | arg1Of | treated,with |
R18442 | T26838 | T26843 | arg1Of | treated,for |
R18443 | T26840 | T26841 | arg1Of | zVAD.fmk,or |
R18444 | T26841 | T26839 | arg2Of | or,with |
R18445 | T26842 | T26841 | arg2Of | TNFα,or |
R18446 | T26845 | T26844 | arg1Of | hr,9 |
R18447 | T26845 | T26846 | arg1Of | hr,( |
R18448 | T26845 | T26852 | arg1Of | hr,or |
R18449 | T26847 | T26848 | arg1Of | RNA,or |
R18450 | T26848 | T26846 | arg2Of | or,( |
R18451 | T26850 | T26848 | arg2Of | blot,or |
R18452 | T26850 | T26849 | arg1Of | blot,Western |
R18453 | T26851 | T26846 | arg3Of | ),( |
R18454 | T26852 | T26843 | arg2Of | or,for |
R18455 | T26854 | T26852 | arg2Of | hr,or |
R18456 | T26854 | T26853 | arg1Of | hr,24 |
R18457 | T26854 | T26855 | arg1Of | hr,( |
R18458 | T26857 | T26855 | arg2Of | viability,( |
R18459 | T26857 | T26856 | arg1Of | viability,cell |
R18460 | T26858 | T26855 | arg3Of | ),( |
R18601 | T27102 | T27101 | arg1Of | Blot,Western |
R18602 | T27105 | T27103 | arg2Of | blot,For |
R18603 | T27105 | T27104 | arg1Of | blot,Western |
R18604 | T27109 | T27107 | arg1Of | cells,4×105 |
R18605 | T27109 | T27108 | arg1Of | cells,adherent |
R18606 | T27109 | T27110 | arg1Of | cells,( |
R18607 | T27109 | T27115 | arg1Of | cells,were |
R18608 | T27109 | T27116 | arg2Of | cells,seeded |
R18609 | T27113 | T27110 | arg2Of | cells,( |
R18610 | T27113 | T27111 | arg1Of | cells,1×106 |
R18611 | T27113 | T27112 | arg1Of | cells,Jurkat |
R18612 | T27114 | T27110 | arg3Of | ),( |
R18613 | T27116 | T27103 | arg1Of | seeded,For |
R18614 | T27116 | T27106 | arg1Of | seeded,"," |
R18615 | T27116 | T27115 | arg2Of | seeded,were |
R18616 | T27116 | T27117 | arg1Of | seeded,into |
R18617 | T27120 | T27117 | arg2Of | dishes,into |
R18618 | T27120 | T27118 | arg1Of | dishes,35 |
R18619 | T27120 | T27119 | arg1Of | dishes,mm2 |
R18620 | T27123 | T27121 | arg2Of | hr,After |
R18621 | T27123 | T27122 | arg1Of | hr,24–48 |
R18622 | T27125 | T27126 | arg1Of | cells,were |
R18623 | T27125 | T27127 | arg2Of | cells,stimulated |
R18624 | T27127 | T27121 | arg1Of | stimulated,After |
R18625 | T27127 | T27124 | arg1Of | stimulated,"," |
R18626 | T27127 | T27126 | arg2Of | stimulated,were |
R18627 | T27127 | T27128 | arg1Of | stimulated,with |
R18628 | T27129 | T27130 | arg1Of | 30,µM |
R18629 | T27131 | T27129 | arg1Of | zVAD.fmk,30 |
R18630 | T27131 | T27132 | arg1Of | zVAD.fmk,or |
R18631 | T27132 | T27128 | arg2Of | or,with |
R18632 | T27136 | T27132 | arg2Of | TNFα,or |
R18633 | T27136 | T27133 | arg1Of | TNFα,10 |
R18634 | T27136 | T27134 | arg1Of | TNFα,ng/ml |
R18635 | T27136 | T27135 | arg1Of | TNFα,mouse |
R18636 | T27138 | T27137 | arg2Of | treatments,For |
R18637 | T27138 | T27139 | arg1Of | treatments,under |
R18638 | T27142 | T27139 | arg2Of | conditions,under |
R18639 | T27142 | T27140 | arg1Of | conditions,serum |
R18640 | T27142 | T27141 | arg1Of | conditions,free |
R18641 | T27144 | T27145 | arg1Of | cells,were |
R18642 | T27145 | T27137 | arg1Of | were,For |
R18643 | T27145 | T27143 | arg1Of | were,"," |
R18644 | T27146 | T27145 | arg2Of | serum,were |
R18645 | T27146 | T27147 | arg2Of | serum,starved |
R18646 | T27147 | T27148 | arg1Of | starved,for |
R18647 | T27150 | T27148 | arg2Of | hr,for |
R18648 | T27150 | T27149 | arg1Of | hr,24 |
R18649 | T27150 | T27151 | arg1Of | hr,prior |
R18650 | T27151 | T27152 | arg1Of | prior,to |
R18651 | T27154 | T27152 | arg2Of | addition,to |
R18652 | T27154 | T27153 | arg1Of | addition,the |
R18653 | T27154 | T27155 | arg1Of | addition,of |
R18654 | T27154 | T27158 | arg1Of | addition,"," |
R18655 | T27157 | T27155 | arg2Of | factors,of |
R18656 | T27157 | T27156 | arg1Of | factors,growth |
R18657 | T27159 | T27160 | arg1Of | 20,µM |
R18658 | T27161 | T27159 | arg1Of | zVAD.fmk,20 |
R18659 | T27161 | T27162 | arg1Of | zVAD.fmk,or |
R18660 | T27162 | T27158 | arg2Of | or,"," |
R18661 | T27166 | T27162 | arg2Of | TNFα,or |
R18662 | T27166 | T27163 | arg1Of | TNFα,10 |
R18663 | T27166 | T27164 | arg1Of | TNFα,ng/ml |
R18664 | T27166 | T27165 | arg1Of | TNFα,mouse |
R18665 | T27167 | T27168 | arg1Of | Cells,were |
R18666 | T27167 | T27169 | arg2Of | Cells,harvested |
R18667 | T27169 | T27168 | arg2Of | harvested,were |
R18668 | T27169 | T27170 | arg1Of | harvested,in |
R18669 | T27172 | T27170 | arg2Of | buffer,in |
R18670 | T27172 | T27171 | arg1Of | buffer,1×RIPA |
R18671 | T27172 | T27173 | arg1Of | buffer,( |
R18672 | T27172 | T27177 | arg2Of | buffer,supplemented |
R18673 | T27175 | T27173 | arg2Of | Signaling,( |
R18674 | T27175 | T27174 | arg1Of | Signaling,Cell |
R18675 | T27176 | T27173 | arg3Of | ),( |
R18676 | T27177 | T27178 | arg1Of | supplemented,with |
R18677 | T27181 | T27178 | arg2Of | phenylmethanesulfonylfluoride,with |
R18678 | T27181 | T27179 | arg1Of | phenylmethanesulfonylfluoride,50 |
R18679 | T27181 | T27180 | arg1Of | phenylmethanesulfonylfluoride,µg/ml |
R18680 | T27184 | T27182 | arg2Of | sonication,After |
R18681 | T27184 | T27183 | arg1Of | sonication,brief |
R18682 | T27187 | T27186 | arg1Of | lysates,cell |
R18683 | T27187 | T27188 | arg1Of | lysates,were |
R18684 | T27187 | T27189 | arg2Of | lysates,spun |
R18685 | T27189 | T27182 | arg1Of | spun,After |
R18686 | T27189 | T27185 | arg1Of | spun,"," |
R18687 | T27189 | T27188 | arg2Of | spun,were |
R18688 | T27189 | T27190 | arg1Of | spun,down |
R18689 | T27189 | T27191 | arg1Of | spun,for |
R18690 | T27189 | T27194 | arg1Of | spun,at |
R18691 | T27193 | T27191 | arg2Of | min,for |
R18692 | T27193 | T27192 | arg1Of | min,15 |
R18693 | T27195 | T27194 | arg2Of | "14,000×rpm",at |
R18694 | T27197 | T27196 | arg1Of | concentrations,Protein |
R18695 | T27197 | T27198 | arg1Of | concentrations,were |
R18696 | T27197 | T27199 | arg2Of | concentrations,measured |
R18697 | T27199 | T27198 | arg2Of | measured,were |
R18698 | T27200 | T27199 | arg3Of | using,measured |
R18699 | T27200 | T27207 | arg1Of | using,( |
R18700 | T27202 | T27203 | arg1Of | Pierce,660 |
R18701 | T27206 | T27200 | arg2Of | Reagent,using |
R18702 | T27206 | T27201 | arg1Of | Reagent,the |
R18703 | T27206 | T27202 | arg1Of | Reagent,Pierce |
R18704 | T27206 | T27204 | arg1Of | Reagent,nm |
R18705 | T27206 | T27205 | arg1Of | Reagent,Assay |
R18706 | T27208 | T27207 | arg2Of | Pierce,( |
R18707 | T27209 | T27207 | arg3Of | ),( |
R18708 | T27211 | T27210 | arg1Of | amounts,Equal |
R18709 | T27211 | T27212 | arg1Of | amounts,of |
R18710 | T27211 | T27214 | arg1Of | amounts,were |
R18711 | T27211 | T27215 | arg2Of | amounts,boiled |
R18712 | T27213 | T27212 | arg2Of | proteins,of |
R18713 | T27215 | T27214 | arg2Of | boiled,were |
R18714 | T27215 | T27216 | arg1Of | boiled,for |
R18715 | T27218 | T27216 | arg2Of | min,for |
R18716 | T27218 | T27217 | arg1Of | min,5 |
R18717 | T27218 | T27219 | arg1Of | min,at |
R18718 | T27221 | T27219 | arg2Of | Western,at |
R18719 | T27221 | T27220 | arg1Of | Western,95°C. |
R18720 | T27222 | T27223 | arg1Of | blotting,was |
R18721 | T27222 | T27224 | arg2Of | blotting,performed |
R18722 | T27224 | T27214 | modOf | performed,were |
R18723 | T27224 | T27223 | arg2Of | performed,was |
R18724 | T27224 | T27225 | arg1Of | performed,according |
R18725 | T27226 | T27225 | arg2Of | to,according |
R18726 | T27228 | T27226 | arg2Of | protocols,to |
R18727 | T27228 | T27227 | arg1Of | protocols,standard |
R18728 | T27232 | T27231 | arg1Of | gels,SDS-PAGE |
R18729 | T27232 | T27233 | arg1Of | gels,were |
R18730 | T27232 | T27234 | arg2Of | gels,transferred |
R18731 | T27232 | T27239 | arg1Of | gels,blocked |
R18732 | T27234 | T27233 | arg2Of | transferred,were |
R18733 | T27234 | T27235 | arg1Of | transferred,to |
R18734 | T27234 | T27238 | arg1Of | transferred,"," |
R18735 | T27237 | T27235 | arg2Of | membrane,to |
R18736 | T27237 | T27236 | arg1Of | membrane,PVDF |
R18737 | T27238 | T27229 | arg1Of | ",",Briefly |
R18738 | T27238 | T27230 | arg1Of | ",","," |
R18739 | T27238 | T27256 | arg1Of | ",",for |
R18740 | T27239 | T27238 | arg2Of | blocked,"," |
R18741 | T27239 | T27240 | arg1Of | blocked,in |
R18742 | T27242 | T27240 | arg2Of | %,in |
R18743 | T27242 | T27241 | arg1Of | %,3 |
R18744 | T27243 | T27244 | arg1Of | milk,or |
R18745 | T27244 | T27239 | arg2Of | or,blocked |
R18746 | T27245 | T27246 | arg1Of | 5,% |
R18747 | T27249 | T27244 | arg2Of | albumin,or |
R18748 | T27249 | T27245 | arg1Of | albumin,5 |
R18749 | T27249 | T27247 | arg1Of | albumin,bovine |
R18750 | T27249 | T27248 | arg1Of | albumin,serum |
R18751 | T27249 | T27250 | arg1Of | albumin,( |
R18752 | T27249 | T27253 | arg1Of | albumin,in |
R18753 | T27251 | T27250 | arg2Of | BSA,( |
R18754 | T27252 | T27250 | arg3Of | ),( |
R18755 | T27255 | T27253 | arg2Of | buffer,in |
R18756 | T27255 | T27254 | arg1Of | buffer,TBST |
R18757 | T27258 | T27256 | arg2Of | min,for |
R18758 | T27258 | T27257 | arg1Of | min,30 |
R18759 | T27258 | T27259 | arg1Of | min,at |
R18760 | T27261 | T27259 | arg2Of | temperature,at |
R18761 | T27261 | T27260 | arg1Of | temperature,room |
R18762 | T27263 | T27262 | arg1Of | antibodies,Primary |
R18763 | T27263 | T27264 | arg1Of | antibodies,were |
R18764 | T27263 | T27265 | arg2Of | antibodies,incubated |
R18765 | T27265 | T27264 | arg2Of | incubated,were |
R18766 | T27265 | T27266 | arg1Of | incubated,in |
R18767 | T27265 | T27270 | arg1Of | incubated,overnight |
R18768 | T27267 | T27268 | arg1Of | 5,% |
R18769 | T27269 | T27266 | arg2Of | BSA/TBST,in |
R18770 | T27269 | T27267 | arg1Of | BSA/TBST,5 |
R18771 | T27270 | T27275 | modOf | overnight,were |
R18772 | T27273 | T27272 | arg1Of | Secondary,4°C. |
R18773 | T27274 | T27273 | arg1Of | antibodies,Secondary |
R18774 | T27274 | T27275 | arg1Of | antibodies,were |
R18775 | T27274 | T27276 | arg2Of | antibodies,incubated |
R18776 | T27276 | T27271 | arg1Of | incubated,at |
R18777 | T27276 | T27275 | arg2Of | incubated,were |
R18778 | T27276 | T27277 | arg1Of | incubated,in |
R18779 | T27276 | T27279 | arg1Of | incubated,for |
R18780 | T27276 | T27282 | arg1Of | incubated,at |
R18781 | T27278 | T27277 | arg2Of | TBST,in |
R18782 | T27281 | T27279 | arg2Of | min,for |
R18783 | T27281 | T27280 | arg1Of | min,30 |
R18784 | T27284 | T27282 | arg2Of | temperature,at |
R18785 | T27284 | T27283 | arg1Of | temperature,room |
R18786 | T27287 | T27286 | arg2Of | Millipore,( |
R18787 | T27288 | T27286 | arg3Of | ),( |
R18788 | T27290 | T27285 | arg1Of | reagents,Luminata |
R18789 | T27290 | T27286 | arg1Of | reagents,( |
R18790 | T27290 | T27289 | arg1Of | reagents,ECL |
R18791 | T27290 | T27291 | arg1Of | reagents,were |
R18792 | T27290 | T27292 | arg2Of | reagents,used |
R18793 | T27292 | T27291 | arg2Of | used,were |
R18794 | T27294 | T27292 | arg3Of | develop,used |
R18795 | T27294 | T27293 | arg1Of | develop,to |
R18796 | T27296 | T27294 | arg2Of | signals,develop |
R18797 | T27296 | T27295 | arg1Of | signals,the |
R18798 | T27299 | T27297 | arg2Of | cases,In |
R18799 | T27299 | T27298 | arg1Of | cases,some |
R18800 | T27301 | T27302 | arg1Of | membranes,were |
R18801 | T27301 | T27303 | arg2Of | membranes,stripped |
R18802 | T27301 | T27313 | arg2Of | membranes,reprobed |
R18803 | T27303 | T27312 | arg1Of | stripped,and |
R18804 | T27304 | T27303 | arg3Of | using,stripped |
R18805 | T27305 | T27304 | arg2Of | OneMinute,using |
R18806 | T27305 | T27306 | arg1Of | OneMinute,stripping |
R18807 | T27307 | T27306 | arg2Of | buffer,stripping |
R18808 | T27307 | T27308 | arg1Of | buffer,( |
R18809 | T27310 | T27308 | arg2Of | Biosciences,( |
R18810 | T27310 | T27309 | arg1Of | Biosciences,GM |
R18811 | T27311 | T27308 | arg3Of | ),( |
R18812 | T27312 | T27297 | arg1Of | and,In |
R18813 | T27312 | T27300 | arg1Of | and,"," |
R18814 | T27312 | T27302 | arg2Of | and,were |
R18815 | T27313 | T27312 | arg2Of | reprobed,and |
R18816 | T27313 | T27314 | arg1Of | reprobed,with |
R18817 | T27316 | T27314 | arg2Of | antibodies,with |
R18818 | T27316 | T27315 | arg1Of | antibodies,new |
R19061 | T27618 | T27619 | arg1Of | Cells,were |
R19062 | T27618 | T27620 | arg2Of | Cells,treated |
R19063 | T27620 | T27619 | arg2Of | treated,were |
R19064 | T27620 | T27621 | arg1Of | treated,as |
R19065 | T27622 | T27621 | arg2Of | described,as |
R19066 | T27622 | T27623 | arg1Of | described,for |
R19067 | T27625 | T27623 | arg2Of | blots,for |
R19068 | T27625 | T27624 | arg1Of | blots,Western |
R19069 | T27627 | T27626 | arg1Of | RNA,Total |
R19070 | T27627 | T27628 | arg1Of | RNA,was |
R19071 | T27627 | T27629 | arg2Of | RNA,isolated |
R19072 | T27629 | T27628 | arg2Of | isolated,was |
R19073 | T27630 | T27629 | arg3Of | using,isolated |
R19074 | T27633 | T27630 | arg2Of | kit,using |
R19075 | T27633 | T27631 | arg1Of | kit,ZR |
R19076 | T27633 | T27632 | arg1Of | kit,Miniprep |
R19077 | T27633 | T27634 | arg1Of | kit,( |
R19078 | T27636 | T27634 | arg2Of | Research,( |
R19079 | T27636 | T27635 | arg1Of | Research,Zymo |
R19080 | T27637 | T27634 | arg3Of | ),( |
R19081 | T27639 | T27638 | arg1Of | µg,1 |
R19082 | T27639 | T27640 | arg1Of | µg,of |
R19083 | T27639 | T27642 | arg1Of | µg,was |
R19084 | T27639 | T27643 | arg2Of | µg,converted |
R19085 | T27641 | T27640 | arg2Of | RNA,of |
R19086 | T27643 | T27642 | arg2Of | converted,was |
R19087 | T27643 | T27644 | arg1Of | converted,to |
R19088 | T27645 | T27644 | arg2Of | cDNA,to |
R19089 | T27645 | T27646 | arg1Of | cDNA,using |
R19090 | T27648 | T27646 | arg2Of | primers,using |
R19091 | T27648 | T27647 | arg1Of | primers,random |
R19092 | T27648 | T27649 | arg1Of | primers,( |
R19093 | T27652 | T27649 | arg2Of | kit,( |
R19094 | T27652 | T27650 | arg1Of | kit,M-MuLV |
R19095 | T27652 | T27651 | arg1Of | kit,cDNA |
R19096 | T27652 | T27653 | arg1Of | kit,"," |
R19097 | T27656 | T27653 | arg2Of | Biolabs,"," |
R19098 | T27656 | T27654 | arg1Of | Biolabs,New |
R19099 | T27656 | T27655 | arg1Of | Biolabs,England |
R19100 | T27657 | T27649 | arg3Of | ),( |
R19101 | T27659 | T27658 | arg1Of | µL,1 |
R19102 | T27659 | T27660 | arg1Of | µL,of |
R19103 | T27659 | T27662 | arg1Of | µL,was |
R19104 | T27659 | T27663 | arg2Of | µL,used |
R19105 | T27661 | T27660 | arg2Of | cDNA,of |
R19106 | T27663 | T27662 | arg2Of | used,was |
R19107 | T27663 | T27664 | arg1Of | used,with |
R19108 | T27667 | T27664 | arg2Of | primers,with |
R19109 | T27667 | T27665 | arg1Of | primers,500 |
R19110 | T27667 | T27666 | arg1Of | primers,pM |
R19111 | T27667 | T27668 | arg1Of | primers,in |
R19112 | T27670 | T27668 | arg2Of | reactions,in |
R19113 | T27670 | T27669 | arg1Of | reactions,qPCR |
R19114 | T27671 | T27672 | arg1Of | Reactions,were |
R19115 | T27673 | T27672 | arg2Of | performs,were |
R19116 | T27673 | T27674 | arg1Of | performs,using |
R19117 | T27677 | T27674 | arg2Of | mix,using |
R19118 | T27677 | T27675 | arg1Of | mix,SYBRGreen |
R19119 | T27677 | T27676 | arg1Of | mix,2×Master |
R19120 | T27677 | T27678 | arg1Of | mix,( |
R19121 | T27677 | T27681 | arg1Of | mix,in |
R19122 | T27679 | T27678 | arg2Of | SABiosciences,( |
R19123 | T27680 | T27678 | arg3Of | ),( |
R19124 | T27683 | T27681 | arg2Of | LightCycler480,in |
R19125 | T27683 | T27682 | arg1Of | LightCycler480,a |
R19126 | T27683 | T27684 | arg1Of | LightCycler480,( |
R19127 | T27685 | T27684 | arg2Of | Roche,( |
R19128 | T27686 | T27684 | arg3Of | ),( |
R19206 | T27785 | T27784 | arg1Of | Infection,Stable |
R19207 | T27785 | T27786 | arg1Of | Infection,of |
R19208 | T27787 | T27786 | arg2Of | Myr-Akt1,of |
R19209 | T27789 | T27788 | arg1Of | generate,To |
R19210 | T27791 | T27789 | arg2Of | retroviruses,generate |
R19211 | T27791 | T27790 | arg1Of | retroviruses,MSCV |
R19212 | T27794 | T27789 | arg1Of | cells,generate |
R19213 | T27794 | T27793 | arg1Of | cells,HEK293FT |
R19214 | T27794 | T27795 | arg1Of | cells,( |
R19215 | T27794 | T27798 | arg1Of | cells,were |
R19216 | T27794 | T27799 | arg2Of | cells,transfected |
R19217 | T27796 | T27795 | arg2Of | Invitrogen,( |
R19218 | T27797 | T27795 | arg3Of | ),( |
R19219 | T27799 | T27798 | arg2Of | transfected,were |
R19220 | T27799 | T27800 | arg1Of | transfected,with |
R19221 | T27799 | T27806 | arg1Of | transfected,and |
R19222 | T27802 | T27800 | arg2Of | µg,with |
R19223 | T27802 | T27801 | arg1Of | µg,2 |
R19224 | T27802 | T27803 | arg1Of | µg,of |
R19225 | T27805 | T27803 | arg2Of | DNA,of |
R19226 | T27805 | T27804 | arg1Of | DNA,viral |
R19227 | T27806 | T27788 | modOf | and,To |
R19228 | T27806 | T27792 | arg1Of | and,"," |
R19229 | T27808 | T27807 | arg1Of | µg,1 |
R19230 | T27808 | T27809 | arg1Of | µg,of |
R19231 | T27808 | T27815 | arg1Of | µg,in |
R19232 | T27808 | T27818 | arg1Of | µg,plates |
R19233 | T27808 | T27819 | arg1Of | µg,using |
R19234 | T27810 | T27811 | arg1Of | gal/pol,and |
R19235 | T27813 | T27811 | arg2Of | accessory,and |
R19236 | T27813 | T27812 | arg1Of | accessory,VSV-G |
R19237 | T27814 | T27809 | arg2Of | plasmids,of |
R19238 | T27814 | T27810 | arg1Of | plasmids,gal/pol |
R19239 | T27814 | T27813 | arg1Of | plasmids,accessory |
R19240 | T27816 | T27815 | arg2Of | 6,in |
R19241 | T27818 | T27806 | arg2Of | plates,and |
R19242 | T27818 | T27817 | arg1Of | plates,well |
R19243 | T27819 | T27818 | arg2Of | using,plates |
R19244 | T27822 | T27819 | arg2Of | reagent,using |
R19245 | T27822 | T27820 | arg1Of | reagent,GenJet |
R19246 | T27822 | T27821 | arg1Of | reagent,transfection |
R19247 | T27822 | T27823 | arg1Of | reagent,( |
R19248 | T27825 | T27823 | arg2Of | Labs,( |
R19249 | T27825 | T27824 | arg1Of | Labs,Signagen |
R19250 | T27826 | T27823 | arg3Of | ),( |
R19251 | T27828 | T27827 | arg1Of | media,Virus-containing |
R19252 | T27828 | T27829 | arg1Of | media,was |
R19253 | T27828 | T27830 | arg2Of | media,collected |
R19254 | T27828 | T27835 | arg2Of | media,filtered |
R19255 | T27828 | T27841 | arg2Of | media,applied |
R19256 | T27830 | T27832 | arg1Of | collected,hr |
R19257 | T27830 | T27833 | arg1Of | collected,later |
R19258 | T27830 | T27834 | arg1Of | collected,"," |
R19259 | T27832 | T27831 | arg1Of | hr,72 |
R19260 | T27834 | T27840 | arg1Of | ",",and |
R19261 | T27835 | T27834 | arg2Of | filtered,"," |
R19262 | T27835 | T27836 | arg1Of | filtered,through |
R19263 | T27837 | T27838 | arg1Of | 0.45,µm |
R19264 | T27839 | T27836 | arg2Of | filter,through |
R19265 | T27839 | T27837 | arg1Of | filter,0.45 |
R19266 | T27840 | T27829 | arg2Of | and,was |
R19267 | T27841 | T27840 | arg2Of | applied,and |
R19268 | T27841 | T27842 | arg1Of | applied,to |
R19269 | T27844 | T27842 | arg2Of | cells,to |
R19270 | T27844 | T27843 | arg1Of | cells,L929 |
R19271 | T27844 | T27845 | arg1Of | cells,with |
R19272 | T27848 | T27845 | arg2Of | polybrene,with |
R19273 | T27848 | T27846 | arg1Of | polybrene,8 |
R19274 | T27848 | T27847 | arg1Of | polybrene,µg/ml |
R19275 | T27849 | T27850 | arg1Of | Cells,were |
R19276 | T27849 | T27851 | arg2Of | Cells,selected |
R19277 | T27849 | T27853 | arg2Of | Cells,maintained |
R19278 | T27851 | T27852 | arg1Of | selected,and |
R19279 | T27852 | T27850 | arg2Of | and,were |
R19280 | T27852 | T27854 | arg1Of | and,in |
R19281 | T27853 | T27852 | arg2Of | maintained,and |
R19282 | T27857 | T27854 | arg2Of | puromycin,in |
R19283 | T27857 | T27855 | arg1Of | puromycin,10 |
R19284 | T27857 | T27856 | arg1Of | puromycin,µg/ml |
R19367 | T27976 | T27975 | arg1Of | Assay,ELISAOne |
R19368 | T27978 | T27977 | arg1Of | assays,ELISAOne |
R19369 | T27978 | T27979 | arg1Of | assays,( |
R19370 | T27978 | T27986 | arg1Of | assays,were |
R19371 | T27978 | T27987 | arg2Of | assays,performed |
R19372 | T27980 | T27981 | arg1Of | TGRBio,"," |
R19373 | T27981 | T27979 | arg2Of | ",",( |
R19374 | T27981 | T27983 | arg1Of | ",","," |
R19375 | T27982 | T27981 | arg2Of | Hindmarsh,"," |
R19376 | T27984 | T27983 | arg2Of | Australia,"," |
R19377 | T27985 | T27979 | arg3Of | ),( |
R19378 | T27987 | T27986 | arg2Of | performed,were |
R19379 | T27987 | T27988 | arg1Of | performed,according |
R19380 | T27989 | T27988 | arg2Of | to,according |
R19381 | T27991 | T27989 | arg2Of | protocol,to |
R19382 | T27991 | T27990 | arg1Of | protocol,manufacturer’s |
R19383 | T27991 | T27992 | arg1Of | protocol,with |
R19384 | T27995 | T27992 | arg2Of | modifications,with |
R19385 | T27995 | T27993 | arg1Of | modifications,the |
R19386 | T27995 | T27994 | arg1Of | modifications,following |
R19387 | T27997 | T27996 | arg1Of | lysates,Cell |
R19388 | T27997 | T27998 | arg1Of | lysates,were |
R19389 | T27997 | T27999 | arg2Of | lysates,prepared |
R19390 | T27999 | T27998 | arg2Of | prepared,were |
R19391 | T27999 | T28000 | arg1Of | prepared,in |
R19392 | T27999 | T28003 | arg1Of | prepared,as |
R19393 | T28002 | T28000 | arg2Of | buffer,in |
R19394 | T28002 | T28001 | arg1Of | buffer,RIPA |
R19395 | T28004 | T28003 | arg2Of | described,as |
R19396 | T28004 | T28005 | arg1Of | described,for |
R19397 | T28007 | T28005 | arg2Of | blots,for |
R19398 | T28007 | T28006 | arg1Of | blots,Western |
R19399 | T28009 | T28008 | arg1Of | microliters,Five |
R19400 | T28009 | T28010 | arg1Of | microliters,of |
R19401 | T28009 | T28012 | arg1Of | microliters,were |
R19402 | T28009 | T28013 | arg2Of | microliters,diluted |
R19403 | T28011 | T28010 | arg2Of | samples,of |
R19404 | T28013 | T28012 | arg2Of | diluted,were |
R19405 | T28013 | T28014 | arg1Of | diluted,in |
R19406 | T28016 | T28014 | arg2Of | µL,in |
R19407 | T28016 | T28015 | arg1Of | µL,45 |
R19408 | T28016 | T28017 | arg1Of | µL,of |
R19409 | T28020 | T28017 | arg2Of | buffer,of |
R19410 | T28020 | T28018 | arg1Of | buffer,ELISAOne |
R19411 | T28020 | T28019 | arg1Of | buffer,lysis |
R19412 | T28020 | T28021 | arg1Of | buffer,prior |
R19413 | T28021 | T28022 | arg1Of | prior,to |
R19414 | T28023 | T28022 | arg2Of | analysis,to |
R19415 | T28025 | T28024 | arg1Of | antibodies,Primary |
R19416 | T28025 | T28026 | arg1Of | antibodies,to |
R19417 | T28025 | T28030 | arg1Of | antibodies,were |
R19418 | T28025 | T28031 | arg2Of | antibodies,incubated |
R19419 | T28027 | T28028 | arg1Of | phopsho-Thr308,and |
R19420 | T28028 | T28026 | arg2Of | and,to |
R19421 | T28029 | T28028 | arg2Of | phopsho-Ser473,and |
R19422 | T28031 | T28030 | arg2Of | incubated,were |
R19423 | T28031 | T28032 | arg1Of | incubated,with |
R19424 | T28034 | T28032 | arg2Of | samples,with |
R19425 | T28034 | T28033 | arg1Of | samples,the |
R19426 | T28034 | T28035 | arg1Of | samples,for |
R19427 | T28037 | T28035 | arg2Of | hr,for |
R19428 | T28037 | T28036 | arg1Of | hr,2 |
R19429 | T28037 | T28038 | arg1Of | hr,at |
R19430 | T28040 | T28038 | arg2Of | temperature,at |
R19431 | T28040 | T28039 | arg1Of | temperature,room |
R19432 | T28042 | T28041 | arg1Of | antibody,Primary |
R19433 | T28042 | T28043 | arg1Of | antibody,to |
R19434 | T28042 | T28045 | arg1Of | antibody,was |
R19435 | T28042 | T28046 | arg2Of | antibody,incubated |
R19436 | T28044 | T28043 | arg2Of | pan-Akt,to |
R19437 | T28046 | T28045 | arg2Of | incubated,was |
R19438 | T28046 | T28047 | arg1Of | incubated,overnight |
R19439 | T28046 | T28048 | arg1Of | incubated,at |
R19440 | T28046 | T28051 | arg1Of | incubated,for |
R19441 | T28050 | T28048 | arg2Of | Signals,at |
R19442 | T28050 | T28049 | arg1Of | Signals,4°C. |
R19443 | T28052 | T28053 | arg1Of | phospho-antibodies,were |
R19444 | T28052 | T28054 | arg2Of | phospho-antibodies,normalized |
R19445 | T28054 | T28051 | arg2Of | normalized,for |
R19446 | T28054 | T28053 | arg2Of | normalized,were |
R19447 | T28054 | T28055 | arg1Of | normalized,based |
R19448 | T28056 | T28055 | arg2Of | on,based |
R19449 | T28058 | T28056 | arg2Of | values,on |
R19450 | T28058 | T28057 | arg1Of | values,pan-Akt |
R19542 | T28184 | T28183 | arg1Of | ELISA,TNFα |
R19543 | T28189 | T28185 | arg1Of | assays,Mouse |
R19544 | T28189 | T28186 | arg1Of | assays,TNFα |
R19545 | T28189 | T28187 | arg1Of | assays,Quantikine |
R19546 | T28189 | T28188 | arg1Of | assays,ELISA |
R19547 | T28189 | T28190 | arg1Of | assays,( |
R19548 | T28189 | T28196 | arg1Of | assays,were |
R19549 | T28189 | T28197 | arg2Of | assays,performed |
R19550 | T28194 | T28190 | arg2Of | Systems,( |
R19551 | T28194 | T28191 | arg1Of | Systems,R |
R19552 | T28194 | T28192 | arg1Of | Systems,& |
R19553 | T28194 | T28193 | arg1Of | Systems,D |
R19554 | T28195 | T28190 | arg3Of | ),( |
R19555 | T28197 | T28196 | arg2Of | performed,were |
R19556 | T28197 | T28198 | arg1Of | performed,according |
R19557 | T28199 | T28198 | arg2Of | to,according |
R19558 | T28201 | T28199 | arg2Of | descriptions,to |
R19559 | T28201 | T28200 | arg1Of | descriptions,manufacturer’s |
R19560 | T28203 | T28202 | arg1Of | lysates,Cell |
R19561 | T28203 | T28204 | arg1Of | lysates,were |
R19562 | T28203 | T28205 | arg2Of | lysates,prepared |
R19563 | T28203 | T28211 | arg2Of | lysates,treated |
R19564 | T28205 | T28206 | arg1Of | prepared,from |
R19565 | T28205 | T28210 | arg1Of | prepared,and |
R19566 | T28208 | T28206 | arg2Of | cells,from |
R19567 | T28208 | T28207 | arg1Of | cells,3×106 |
R19568 | T28208 | T28209 | arg2Of | cells,plated |
R19569 | T28210 | T28204 | arg2Of | and,were |
R19570 | T28211 | T28210 | arg2Of | treated,and |
R19571 | T28211 | T28212 | arg1Of | treated,in |
R19572 | T28216 | T28212 | arg2Of | dish,in |
R19573 | T28216 | T28213 | arg1Of | dish,a |
R19574 | T28216 | T28214 | arg1Of | dish,10 |
R19575 | T28216 | T28215 | arg1Of | dish,cm2 |
R19612 | T28297 | T28296 | arg1Of | vitro,In |
R19613 | T28300 | T28297 | arg1Of | Assay,vitro |
R19614 | T28300 | T28298 | arg1Of | Assay,Akt |
R19615 | T28300 | T28299 | arg1Of | Assay,Kinase |
R19616 | T28303 | T28301 | arg1Of | activity,Akt |
R19617 | T28303 | T28302 | arg1Of | activity,kinase |
R19618 | T28303 | T28304 | arg1Of | activity,was |
R19619 | T28303 | T28305 | arg2Of | activity,measured |
R19620 | T28305 | T28304 | arg2Of | measured,was |
R19621 | T28306 | T28305 | arg3Of | using,measured |
R19622 | T28311 | T28306 | arg2Of | kit,using |
R19623 | T28311 | T28307 | arg1Of | kit,the |
R19624 | T28311 | T28308 | arg1Of | kit,Akt |
R19625 | T28311 | T28309 | arg1Of | kit,kinase |
R19626 | T28311 | T28310 | arg1Of | kit,assay |
R19627 | T28311 | T28312 | arg1Of | kit,( |
R19628 | T28311 | T28315 | arg1Of | kit,from |
R19629 | T28313 | T28312 | arg2Of | nonradioactive,( |
R19630 | T28314 | T28312 | arg3Of | ),( |
R19631 | T28318 | T28315 | arg2Of | Technology.,from |
R19632 | T28318 | T28316 | arg1Of | Technology.,Cell |
R19633 | T28318 | T28317 | arg1Of | Technology.,Signaling |
R19634 | T28318 | T28319 | arg1Of | Technology.,In |
R19635 | T28320 | T28319 | arg2Of | brief,In |
R19636 | T28322 | T28323 | arg1Of | Myr-Akt,was |
R19637 | T28322 | T28324 | arg2Of | Myr-Akt,immunoprecipitated |
R19638 | T28324 | T28304 | modOf | immunoprecipitated,was |
R19639 | T28324 | T28321 | arg1Of | immunoprecipitated,"," |
R19640 | T28324 | T28323 | arg2Of | immunoprecipitated,was |
R19641 | T28324 | T28325 | arg1Of | immunoprecipitated,from |
R19642 | T28327 | T28325 | arg2Of | cells,from |
R19643 | T28327 | T28326 | arg1Of | cells,L929 |
R19644 | T28327 | T28328 | arg1Of | cells,using |
R19645 | T28332 | T28328 | arg2Of | beads,using |
R19646 | T28332 | T28329 | arg1Of | beads,anti-FLAG |
R19647 | T28332 | T28330 | arg1Of | beads,M2 |
R19648 | T28332 | T28331 | arg1Of | beads,magnetic |
R19649 | T28332 | T28333 | arg1Of | beads,( |
R19650 | T28334 | T28333 | arg2Of | Sigma,( |
R19651 | T28335 | T28333 | arg3Of | ),( |
R19652 | T28338 | T28337 | arg1Of | vitro,in |
R19653 | T28339 | T28336 | arg1Of | assay,The |
R19654 | T28339 | T28338 | arg1Of | assay,vitro |
R19655 | T28339 | T28340 | arg1Of | assay,was |
R19656 | T28339 | T28341 | arg2Of | assay,performed |
R19657 | T28341 | T28340 | arg2Of | performed,was |
R19658 | T28341 | T28342 | arg1Of | performed,in |
R19659 | T28344 | T28342 | arg2Of | presence,in |
R19660 | T28344 | T28343 | arg1Of | presence,the |
R19661 | T28344 | T28345 | arg1Of | presence,of |
R19662 | T28350 | T28345 | arg2Of | substrate,of |
R19663 | T28350 | T28346 | arg1Of | substrate,a |
R19664 | T28350 | T28347 | arg1Of | substrate,GSK |
R19665 | T28350 | T28348 | arg1Of | substrate,fusion |
R19666 | T28350 | T28349 | arg1Of | substrate,protein |
R19667 | T28351 | T28352 | arg1Of | Phosphorylation,of |
R19668 | T28351 | T28357 | arg1Of | Phosphorylation,was |
R19669 | T28351 | T28358 | arg2Of | Phosphorylation,visualized |
R19670 | T28356 | T28352 | arg2Of | protein,of |
R19671 | T28356 | T28353 | arg1Of | protein,the |
R19672 | T28356 | T28354 | arg1Of | protein,GSK |
R19673 | T28356 | T28355 | arg1Of | protein,fusion |
R19674 | T28358 | T28357 | arg2Of | visualized,was |
R19675 | T28361 | T28358 | arg1Of | blot,visualized |
R19676 | T28361 | T28359 | arg2Of | blot,by |
R19677 | T28361 | T28360 | arg1Of | blot,western |
R17904 | T26209 | T26208 | arg1Of | Lines,Cell |
R17905 | T26214 | T26210 | arg1Of | cells,L929 |
R17906 | T26214 | T26211 | arg1Of | cells,and |
R17907 | T26214 | T26212 | arg1Of | cells,FADD-deficient |
R17908 | T26214 | T26213 | arg1Of | cells,Jurkat |
R17909 | T26214 | T26215 | arg1Of | cells,were |
R17910 | T26214 | T26216 | arg2Of | cells,obtained |
R17911 | T26216 | T26215 | arg2Of | obtained,were |
R17912 | T26216 | T26217 | arg1Of | obtained,from |
R17913 | T26218 | T26217 | arg2Of | ATCC,from |
R17914 | T26220 | T26219 | arg1Of | fibroblasts,Lung |
R17915 | T26220 | T26221 | arg1Of | fibroblasts,were |
R17917 | T26224 | T26221 | arg2Of | gift,were |
R17918 | T26224 | T26222 | arg1Of | gift,a |
R17919 | T26224 | T26223 | arg1Of | gift,generous |
R17920 | T26224 | T26225 | arg1Of | gift,of |
R17921 | T26228 | T26225 | arg2Of | Tsichlis,of |
R17922 | T26228 | T26226 | arg1Of | Tsichlis,Dr. |
R17923 | T26228 | T26227 | arg1Of | Tsichlis,Philip |
R17924 | T26228 | T26229 | arg1Of | Tsichlis,( |
R17925 | T26231 | T26229 | arg2Of | University,( |
bionlp-st-ge-2016-test-proteins
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T26736 | 4532-4536 | Protein | denotes | TNFα |
T26735 | 4333-4338 | Protein | denotes | Mapk9 |
T26734 | 4306-4311 | Protein | denotes | Mapk8 |
T26733 | 4243-4247 | Protein | denotes | PDK1 |
T26732 | 4191-4195 | Protein | denotes | Akt3 |
T26731 | 4165-4169 | Protein | denotes | Akt2 |
T26730 | 4139-4143 | Protein | denotes | Akt1 |
T25594 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25593 | 1119-1127 | Protein | denotes | Myr-Akt1 |
T26002 | 2671-2674 | Protein | denotes | 18S |
T26001 | 2623-2626 | Protein | denotes | 18S |
T26000 | 2573-2577 | Protein | denotes | TNFα |
T25999 | 2522-2526 | Protein | denotes | TNFα |
T25998 | 2432-2435 | Protein | denotes | 18S |
T25997 | 2347-2351 | Protein | denotes | TNFα |
T28175 | 7226-7230 | Protein | denotes | TNFα |
T28174 | 7209-7213 | Protein | denotes | TNFα |
T28284 | 7557-7564 | Protein | denotes | Myr-Akt |
T27078 | 4936-4940 | Protein | denotes | TNFα |
T27077 | 4777-4781 | Protein | denotes | TNFα |
T26200 | 2733-2737 | Protein | denotes | FADD |
T25141 | 1012-1017 | Protein | denotes | IGF-1 |
T25140 | 972-975 | Protein | denotes | EGF |
T25139 | 955-959 | Protein | denotes | bFGF |
T25138 | 932-936 | Protein | denotes | TNFα |
T27779 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T25595 | 1331-1339 | Protein | denotes | Myr-Akt1 |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28375 | 7561-7564 | http://www.uniprot.org/uniprot/Q9Y243 | denotes | Akt |
T28374 | 7477-7480 | http://www.uniprot.org/uniprot/Q9Y243 | denotes | Akt |
T28373 | 7434-7437 | http://www.uniprot.org/uniprot/Q9Y243 | denotes | Akt |
T28372 | 7417-7420 | http://www.uniprot.org/uniprot/Q9Y243 | denotes | Akt |
T28371 | 7561-7564 | http://www.uniprot.org/uniprot/P31751 | denotes | Akt |
T28370 | 7477-7480 | http://www.uniprot.org/uniprot/P31751 | denotes | Akt |
T28369 | 7434-7437 | http://www.uniprot.org/uniprot/P31751 | denotes | Akt |
T28368 | 7417-7420 | http://www.uniprot.org/uniprot/P31751 | denotes | Akt |
T28367 | 7561-7564 | http://www.uniprot.org/uniprot/P31749 | denotes | Akt |
T28366 | 7477-7480 | http://www.uniprot.org/uniprot/P31749 | denotes | Akt |
T28365 | 7434-7437 | http://www.uniprot.org/uniprot/P31749 | denotes | Akt |
T28364 | 7417-7420 | http://www.uniprot.org/uniprot/P31749 | denotes | Akt |
T28220 | 7226-7230 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T28219 | 7209-7213 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T27320 | 4936-4940 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T27319 | 4777-4781 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T26070 | 2573-2577 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T26069 | 2522-2526 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T26068 | 2347-2351 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T26874 | 4532-4536 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T26873 | 4217-4221 | http://www.uniprot.org/uniprot/P42345 | denotes | mTOR |
T25742 | 1729-1734 | http://www.uniprot.org/uniprot/P05412 | denotes | c-Jun |
T25258 | 955-959 | http://www.uniprot.org/uniprot/Q788Q8 | denotes | bFGF |
T25257 | 932-936 | http://www.uniprot.org/uniprot/P01375 | denotes | TNFα |
T25256 | 246-249 | http://www.uniprot.org/uniprot/Q9Y243 | denotes | Akt |
T25255 | 246-249 | http://www.uniprot.org/uniprot/P31751 | denotes | Akt |
T25254 | 246-249 | http://www.uniprot.org/uniprot/P31749 | denotes | Akt |
T25745 | 2230-2234 | http://www.uniprot.org/uniprot/P42345 | denotes | mTOR |
T25744 | 2200-2206 | http://www.uniprot.org/uniprot/Q13541 | denotes | 4E-BP1 |
T25743 | 1758-1763 | http://www.uniprot.org/uniprot/P05412 | denotes | c-Jun |
UBERON-AE
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T27062 | 5411-5415 | http://purl.obolibrary.org/obo/UBERON_0001913 | denotes | milk |
T27061 | 5429-5434 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T27060 | 4838-4843 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T27059 | 4804-4809 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T26190 | 3098-3103 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T26189 | 3172-3176 | http://purl.obolibrary.org/obo/UBERON_0002048 | denotes | lung |
T26188 | 2786-2790 | http://purl.obolibrary.org/obo/UBERON_0002048 | denotes | Lung |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T27967 | 7136-7143 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | Signals |
T27966 | 6926-6931 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T28288 | 7731-7746 | http://purl.obolibrary.org/obo/GO_0016310 | denotes | Phosphorylation |
T28287 | 7754-7757 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T28286 | 7701-7704 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T28285 | 7438-7453 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
T27080 | 5697-5704 | http://purl.obolibrary.org/obo/GO_0023052 | denotes | signals |
T27079 | 4887-4893 | http://purl.obolibrary.org/obo/GO_0040007 | denotes | growth |
T26737 | 4243-4247 | http://purl.obolibrary.org/obo/GO_0004740 | denotes | PDK1 |
T25729 | 2260-2264 | http://purl.obolibrary.org/obo/GO_0004740 | denotes | PDK1 |
T25728 | 1985-1988 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T25727 | 1700-1704 | http://purl.obolibrary.org/obo/GO_0016909 | denotes | SAPK |
T25726 | 1705-1708 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T25725 | 1660-1663 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T26482 | 3822-3833 | http://purl.obolibrary.org/obo/GO_0097528 | denotes | necroptosis |
T26481 | 3822-3833 | http://purl.obolibrary.org/obo/GO_0070266 | denotes | necroptosis |
T25142 | 396-399 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T27969 | 7156-7166 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T27968 | 6966-6976 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T28291 | 7754-7757 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T28290 | 7701-7704 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T28289 | 7438-7453 | http://purl.obolibrary.org/obo/GO_0016301 | denotes | kinase activity |
T27083 | 5817-5827 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T27082 | 5572-5582 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T27081 | 5504-5514 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T26738 | 4243-4247 | http://purl.obolibrary.org/obo/GO_0004740 | denotes | PDK1 |
T25737 | 2260-2264 | http://purl.obolibrary.org/obo/GO_0004740 | denotes | PDK1 |
T25736 | 2150-2167 | http://purl.obolibrary.org/obo/GO_0003735 | denotes | Ribosomal Protein |
T25735 | 2084-2101 | http://purl.obolibrary.org/obo/GO_0003735 | denotes | Ribosomal Protein |
T25734 | 1985-1988 | http://purl.obolibrary.org/obo/GO_0050321 | denotes | GSK |
T25733 | 1700-1704 | http://purl.obolibrary.org/obo/GO_0016909 | denotes | SAPK |
T25732 | 1705-1708 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T25731 | 1660-1663 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T25730 | 1406-1416 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T25145 | 988-992 | http://purl.obolibrary.org/obo/GO_0005161 | denotes | PDGF |
T25144 | 972-975 | http://purl.obolibrary.org/obo/GO_0005154 | denotes | EGF |
T25143 | 396-399 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
GO-CC
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28293 | 7598-7603 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T28292 | 7520-7524 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T27781 | 6553-6558 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T27780 | 6275-6280 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T27096 | 5817-5827 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T27095 | 5572-5582 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T27094 | 5504-5514 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T27093 | 5817-5827 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T27092 | 5572-5582 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T27091 | 5504-5514 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T27090 | 5721-5730 | http://purl.obolibrary.org/obo/GO_0016020 | denotes | membranes |
T27089 | 5387-5395 | http://purl.obolibrary.org/obo/GO_0016020 | denotes | membrane |
T27088 | 5079-5083 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T27087 | 4827-4832 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T27086 | 4717-4722 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T27085 | 4662-4667 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T27084 | 4642-4647 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T25740 | 2281-2285 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T25739 | 1406-1416 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T25738 | 1406-1416 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T28178 | 7364-7376 | http://purl.obolibrary.org/obo/GO_0009504 | denotes | cells plated |
T28177 | 7364-7369 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T28176 | 7326-7330 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T27974 | 7156-7166 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T27973 | 6966-6976 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T27972 | 7156-7166 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T27971 | 6966-6976 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T27970 | 6790-6794 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T26740 | 4578-4582 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cell |
T26739 | 4496-4501 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26488 | 3905-3910 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26487 | 3796-3801 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26486 | 3751-3756 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26485 | 3629-3633 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T26484 | 3579-3583 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T26483 | 3405-3409 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T26205 | 3297-3302 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26204 | 2913-2918 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26203 | 2887-2892 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26202 | 2755-2760 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T26201 | 2713-2717 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T25147 | 1039-1043 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T25146 | 742-746 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T27965 | 7076-7207 | Sentence | denotes | Primary antibody to pan-Akt was incubated overnight at 4°C. Signals for phospho-antibodies were normalized based on pan-Akt values. |
T27964 | 6958-7075 | Sentence | denotes | Primary antibodies to phopsho-Thr308 and phopsho-Ser473 were incubated with the samples for 2 hr at room temperature. |
T27963 | 6864-6957 | Sentence | denotes | Five microliters of samples were diluted in 45 µL of ELISAOne lysis buffer prior to analysis. |
T27962 | 6790-6863 | Sentence | denotes | Cell lysates were prepared in RIPA buffer as described for Western blots. |
T27961 | 6657-6789 | Sentence | denotes | ELISAOne assays (TGRBio, Hindmarsh, Australia) were performed according to manufacturer’s protocol with the following modifications. |
T27960 | 6642-6656 | Sentence | denotes | ELISAOne Assay |
T28282 | 7731-7804 | Sentence | denotes | Phosphorylation of the GSK fusion protein was visualized by western blot. |
T28281 | 7647-7730 | Sentence | denotes | The in vitro assay was performed in the presence of a GSK fusion protein substrate. |
T28280 | 7434-7646 | Sentence | denotes | Akt kinase activity was measured using the Akt kinase assay kit (nonradioactive) from Cell Signaling Technology. In brief, Myr-Akt was immunoprecipitated from L929 cells using anti-FLAG M2 magnetic beads (Sigma). |
T28279 | 7408-7433 | Sentence | denotes | In vitro Akt Kinase Assay |
T27616 | 6107-6204 | Sentence | denotes | Reactions were performs using SYBRGreen 2×Master mix (SABiosciences) in a LightCycler480 (Roche). |
T27615 | 6046-6106 | Sentence | denotes | 1 µL of cDNA was used with 500 pM primers in qPCR reactions. |
T27614 | 5951-6045 | Sentence | denotes | 1 µg of RNA was converted to cDNA using random primers (M-MuLV cDNA kit, New England Biolabs). |
T27613 | 5889-5950 | Sentence | denotes | Total RNA was isolated using ZR Miniprep kit (Zymo Research). |
T27612 | 5838-5888 | Sentence | denotes | Cells were treated as described for Western blots. |
T27611 | 5830-5837 | Sentence | denotes | qRT-PCR |
T27777 | 6583-6640 | Sentence | denotes | Cells were selected and maintained in 10 µg/ml puromycin. |
T27776 | 6451-6582 | Sentence | denotes | Virus-containing media was collected 72 hr later, filtered through 0.45 µm filter and applied to L929 cells with 8 µg/ml polybrene. |
T27775 | 6235-6450 | Sentence | denotes | To generate MSCV retroviruses, HEK293FT cells (Invitrogen) were transfected with 2 µg of viral DNA and 1 µg of gal/pol and VSV-G accessory plasmids in 6 well plates using GenJet transfection reagent (Signagen Labs). |
T27774 | 6206-6234 | Sentence | denotes | Stable Infection of Myr-Akt1 |
T27074 | 5706-5828 | Sentence | denotes | In some cases, membranes were stripped using OneMinute stripping buffer (GM Biosciences) and reprobed with new antibodies. |
T27073 | 5638-5705 | Sentence | denotes | Luminata (Millipore) ECL reagents were used to develop the signals. |
T27072 | 5496-5637 | Sentence | denotes | Primary antibodies were incubated in 5%BSA/TBST overnight at 4°C. Secondary antibodies were incubated in TBST for 30 min at room temperature. |
T27071 | 5339-5495 | Sentence | denotes | Briefly, SDS-PAGE gels were transferred to PVDF membrane, blocked in 3% milk or 5% bovine serum albumin (BSA) in TBST buffer for 30 min at room temperature. |
T27070 | 5218-5338 | Sentence | denotes | Equal amounts of proteins were boiled for 5 min at 95°C. Western blotting was performed according to standard protocols. |
T27069 | 5133-5217 | Sentence | denotes | Protein concentrations were measured using the Pierce 660 nm Assay Reagent (Pierce). |
T27068 | 5055-5132 | Sentence | denotes | After brief sonication, cell lysates were spun down for 15 min at 14,000×rpm. |
T27067 | 4942-5054 | Sentence | denotes | Cells were harvested in 1×RIPA buffer (Cell Signaling) supplemented with 50 µg/ml phenylmethanesulfonylfluoride. |
T27066 | 4783-4941 | Sentence | denotes | For treatments under serum free conditions, cells were serum starved for 24 hr prior to the addition of growth factors, 20 µM zVAD.fmk or 10 ng/ml mouse TNFα. |
T27065 | 4701-4782 | Sentence | denotes | After 24–48 hr, cells were stimulated with 30 µM zVAD.fmk or 10 ng/ml mouse TNFα. |
T27064 | 4609-4700 | Sentence | denotes | For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes. |
T27063 | 4596-4608 | Sentence | denotes | Western Blot |
T26722 | 4483-4594 | Sentence | denotes | After 72 hr, cells were treated with zVAD.fmk or TNFα for 9 hr (RNA or Western blot) or 24 hr (cell viability). |
T26721 | 4037-4482 | Sentence | denotes | siRNAs were purchased from Dharmacon. Mouse ribosomal S6 protein (L-040893-00 and L-045791-00), mouse Akt1 (L-040709-00), mouse Akt2 (L-040782-00), mouse Akt3 (L-040891-00), mouse mTOR (L-065427-00), mouse PDK1 (L-040658-00), non-coding control (D-001810-10-05), mouse Mapk8 (J-040128-05), mouse Mapk9 (J-040134-05), mouse Jun (L-043776-00). siRNA were transfected using RNAiMAX reagent (Invitrogen), according to manufacturer’s recommendations. |
T26720 | 4021-4036 | Sentence | denotes | siRNA Knockdown |
T26193 | 2786-2871 | Sentence | denotes | Lung fibroblasts were a generous gift of Dr. Philip Tsichlis (Tufts University) [53]. |
T26192 | 2724-2785 | Sentence | denotes | L929 and FADD-deficient Jurkat cells were obtained from ATCC. |
T26191 | 2713-2723 | Sentence | denotes | Cell Lines |
T25990 | 2341-2711 | Sentence | denotes | Mouse TNFα: forward 5′-CCCTCACACTCAGATCATCTTCT-3′, reverse 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S: forward 5-′ ATAACAGGTCTGTGATGCCCTTAG-3, reverse 5′-CTAAACCATCCAATCGGTAGTAGC-3′;human TNFα: forward 5′- ATGAGCACTGAAAGCATGATCC-3′, human TNFα: reverse 5′-GAGGGCTGATTAGAGAGAGGTC-3′; human 18S: forward 5′- CAGCCACCCGAGATTGAGCA -3, human 18S: reverse 5′-TAGTAGCGACGGGCGGTGTG-3′. |
T25989 | 2328-2340 | Sentence | denotes | QPCR Primers |
T25724 | 1392-2326 | Sentence | denotes | The following antibodies were used: phospho-Akt (Thr308) (clone C31E5E) rabbit mAb, phospho-Akt (Ser473) (clone D9E) XP rabbit mAb, Akt (pan) (clone C67E7) rabbit mAb, Akt1 (clone C73H10) rabbit mAb, Akt2 (clone D6G4) rabbit mAb, Akt3 (clone 62A8) rabbit mAb, phospho-JNK (Thr183/Tyr185) (81E11) rabbit mAb, SAPK/JNK rabbit pAb, phospho-c-Jun (Ser63) II rabbit pAb, c-Jun (60A8) rabbit mAb, α-tubulin (clone DM1A) mouse mAb, phospho-FoxO1 (Thr24)/FoxO3a (Thr32) rabbit pAb, FoxO1 (L27) rabbit pAb, phospho-FoxO4 (Ser193) rabbit pAb, FoxO4 rabbit pAb, phospho-MDM2 (Ser166) rabbit pAb, phospho-GSK-3α/β (Ser21/9) rabbit pAb, phospho-p70 S6 Kinase (Thr389) (clone 108D2) rabbit mAb, phospho-S6 Ribosomal Protein (Ser235/236) (clone D57.2.2E) XP rabbit mAb, S6 Ribosomal Protein (clone 54D2) mouse mAb, phospho-4E-BP1 (Thr37/46) rabbit pAb, mTOR (clone 7C10) rabbit mAb, PDK1 rabbit pAb (all Cell Signaling), MDM2 rabbit pAb (Bioworlde). |
T25723 | 1381-1391 | Sentence | denotes | Antibodies |
T26480 | 3774-4019 | Sentence | denotes | Relative viability of cells, induced to undergo necroptosis and treated with the compound relative to the control compound-treated cells, was determined and plotted to exclude the possible effects of non-specific toxicity of the small molecules. |
T26479 | 3716-3773 | Sentence | denotes | Viability of the control untreated cells was set as 100%. |
T26478 | 3661-3715 | Sentence | denotes | Experiments were performed in duplicate or triplicate. |
T26477 | 3579-3660 | Sentence | denotes | Cell viability was determined using CellTiter-Glo Cell Viability Assay (Promega). |
T26476 | 3432-3578 | Sentence | denotes | Cells were seeded into white clear bottom 96 well plates at the density of 1×104 cells/well and treated as described for western blot experiments. |
T26475 | 3405-3431 | Sentence | denotes | Cell Viability Experiments |
T26197 | 3290-3403 | Sentence | denotes | Jurkat cells were maintained in RPMI1640, supplemented with 10% FetalPlex (Gemini) and 1% antibiotic-antimycotic. |
T26196 | 3162-3289 | Sentence | denotes | The mouse lung fibroblast media was additionally supplemented with L-glutamine, non-essential amino acids, and sodium pyruvate. |
T26195 | 3033-3161 | Sentence | denotes | Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture (Invitrogen). |
T26194 | 2872-3032 | Sentence | denotes | J774A.1 (ATCC) cells and RAW264.7 (ATCC) cells were generous gifts of Junying Yuan (Harvard University) and Alexander Poltorak (Tufts University), respectively. |
T25133 | 847-1102 | Sentence | denotes | Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem. Human and mouse TNFα (10 ng/ml), human bFGF (25 ng/ml), EGF (50 ng/ml), PDGF-BB (20 ng/ml), and IGF-1 (50 ng/ml) were from Cell Sciences or Peprotech. All other reagents were from Sigma. |
T25132 | 246-846 | Sentence | denotes | Akt inhibitor VIII (10 µM, Calbiochem), MK-2206 (10 µM, Selleck Chem), Triciribine (100 µM, National Cancer Institute), SP600125 (10 µM, Calbiochem), JNK inhibitor VIII (10 µM, Calbiochem), UO126 (10 mM, Cayman Chem), PD169316 (10 µM, Calbiochem), LiCl (10 mM, Sigma), SB216763 (10 µM, Calbiochem), BX912 (10 µM, Axon Med Chem), PF-4706871 (Sigma), rapamycin (100 nM, Santa Cruz), PI-103 (10 µM, Calbiochem), Torin-1 (500 nM, gift of Dr. Nathanael Grey (Harvard Medical School), LY249002 (10 µM, Cell Signaling), PD173074 (2 µM, Cayman Chem), PD166866 (20 µM, Calbiochem), 4EGI-1 (50 µM, Calbiochem). |
T25131 | 119-245 | Sentence | denotes | The following reagents and final concentrations (unless otherwise specified in the text/figures) were used in the experiments: |
T25130 | 46-118 | Sentence | denotes | Necrostatin analogs were synthesized as previously described [23], [24]. |
T25129 | 23-45 | Sentence | denotes | Reagents and Chemicals |
T28171 | 7326-7406 | Sentence | denotes | Cell lysates were prepared from 3×106 cells plated and treated in a 10 cm2 dish. |
T28170 | 7220-7325 | Sentence | denotes | Mouse TNFα Quantikine ELISA assays (R&D Systems) were performed according to manufacturer’s descriptions. |
T28169 | 7209-7219 | Sentence | denotes | TNFα ELISA |
T25589 | 1312-1379 | Sentence | denotes | Mutant versions of Myr-Akt1 were generated using the same strategy. |
T25588 | 1186-1311 | Sentence | denotes | Myr-Akt1-FLAG was amplified by PCR and subcloned into the BglII and EcoRI sites of pMSCV-puro retroviral vector (Invitrogen). |
T25587 | 1108-1185 | Sentence | denotes | Cloning of Myr-Akt1, containing c-terminal FLAG tag, has been described [52]. |
T25586 | 1104-1107 | Sentence | denotes | DNA |
T308 | 0-21 | Sentence | denotes | Materials and Methods |
T309 | 23-45 | Sentence | denotes | Reagents and Chemicals |
T310 | 46-118 | Sentence | denotes | Necrostatin analogs were synthesized as previously described [23], [24]. |
T311 | 119-245 | Sentence | denotes | The following reagents and final concentrations (unless otherwise specified in the text/figures) were used in the experiments: |
T312 | 246-846 | Sentence | denotes | Akt inhibitor VIII (10 µM, Calbiochem), MK-2206 (10 µM, Selleck Chem), Triciribine (100 µM, National Cancer Institute), SP600125 (10 µM, Calbiochem), JNK inhibitor VIII (10 µM, Calbiochem), UO126 (10 mM, Cayman Chem), PD169316 (10 µM, Calbiochem), LiCl (10 mM, Sigma), SB216763 (10 µM, Calbiochem), BX912 (10 µM, Axon Med Chem), PF-4706871 (Sigma), rapamycin (100 nM, Santa Cruz), PI-103 (10 µM, Calbiochem), Torin-1 (500 nM, gift of Dr. Nathanael Grey (Harvard Medical School), LY249002 (10 µM, Cell Signaling), PD173074 (2 µM, Cayman Chem), PD166866 (20 µM, Calbiochem), 4EGI-1 (50 µM, Calbiochem). |
T313 | 847-915 | Sentence | denotes | Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem. |
T314 | 916-1066 | Sentence | denotes | Human and mouse TNFα (10 ng/ml), human bFGF (25 ng/ml), EGF (50 ng/ml), PDGF-BB (20 ng/ml), and IGF-1 (50 ng/ml) were from Cell Sciences or Peprotech. |
T315 | 1067-1102 | Sentence | denotes | All other reagents were from Sigma. |
T316 | 1104-1107 | Sentence | denotes | DNA |
T317 | 1108-1185 | Sentence | denotes | Cloning of Myr-Akt1, containing c-terminal FLAG tag, has been described [52]. |
T318 | 1186-1311 | Sentence | denotes | Myr-Akt1-FLAG was amplified by PCR and subcloned into the BglII and EcoRI sites of pMSCV-puro retroviral vector (Invitrogen). |
T319 | 1312-1379 | Sentence | denotes | Mutant versions of Myr-Akt1 were generated using the same strategy. |
T320 | 1381-1391 | Sentence | denotes | Antibodies |
T321 | 1392-2326 | Sentence | denotes | The following antibodies were used: phospho-Akt (Thr308) (clone C31E5E) rabbit mAb, phospho-Akt (Ser473) (clone D9E) XP rabbit mAb, Akt (pan) (clone C67E7) rabbit mAb, Akt1 (clone C73H10) rabbit mAb, Akt2 (clone D6G4) rabbit mAb, Akt3 (clone 62A8) rabbit mAb, phospho-JNK (Thr183/Tyr185) (81E11) rabbit mAb, SAPK/JNK rabbit pAb, phospho-c-Jun (Ser63) II rabbit pAb, c-Jun (60A8) rabbit mAb, α-tubulin (clone DM1A) mouse mAb, phospho-FoxO1 (Thr24)/FoxO3a (Thr32) rabbit pAb, FoxO1 (L27) rabbit pAb, phospho-FoxO4 (Ser193) rabbit pAb, FoxO4 rabbit pAb, phospho-MDM2 (Ser166) rabbit pAb, phospho-GSK-3α/β (Ser21/9) rabbit pAb, phospho-p70 S6 Kinase (Thr389) (clone 108D2) rabbit mAb, phospho-S6 Ribosomal Protein (Ser235/236) (clone D57.2.2E) XP rabbit mAb, S6 Ribosomal Protein (clone 54D2) mouse mAb, phospho-4E-BP1 (Thr37/46) rabbit pAb, mTOR (clone 7C10) rabbit mAb, PDK1 rabbit pAb (all Cell Signaling), MDM2 rabbit pAb (Bioworlde). |
T322 | 2328-2340 | Sentence | denotes | QPCR Primers |
T323 | 2341-2711 | Sentence | denotes | Mouse TNFα: forward 5′-CCCTCACACTCAGATCATCTTCT-3′, reverse 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S: forward 5-′ ATAACAGGTCTGTGATGCCCTTAG-3, reverse 5′-CTAAACCATCCAATCGGTAGTAGC-3′;human TNFα: forward 5′- ATGAGCACTGAAAGCATGATCC-3′, human TNFα: reverse 5′-GAGGGCTGATTAGAGAGAGGTC-3′; human 18S: forward 5′- CAGCCACCCGAGATTGAGCA -3, human 18S: reverse 5′-TAGTAGCGACGGGCGGTGTG-3′. |
T324 | 2713-2723 | Sentence | denotes | Cell Lines |
T325 | 2724-2785 | Sentence | denotes | L929 and FADD-deficient Jurkat cells were obtained from ATCC. |
T326 | 2786-2871 | Sentence | denotes | Lung fibroblasts were a generous gift of Dr. Philip Tsichlis (Tufts University) [53]. |
T327 | 2872-3032 | Sentence | denotes | J774A.1 (ATCC) cells and RAW264.7 (ATCC) cells were generous gifts of Junying Yuan (Harvard University) and Alexander Poltorak (Tufts University), respectively. |
T328 | 3033-3161 | Sentence | denotes | Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture (Invitrogen). |
T329 | 3162-3289 | Sentence | denotes | The mouse lung fibroblast media was additionally supplemented with L-glutamine, non-essential amino acids, and sodium pyruvate. |
T330 | 3290-3403 | Sentence | denotes | Jurkat cells were maintained in RPMI1640, supplemented with 10% FetalPlex (Gemini) and 1% antibiotic-antimycotic. |
T331 | 3405-3431 | Sentence | denotes | Cell Viability Experiments |
T332 | 3432-3578 | Sentence | denotes | Cells were seeded into white clear bottom 96 well plates at the density of 1×104 cells/well and treated as described for western blot experiments. |
T333 | 3579-3660 | Sentence | denotes | Cell viability was determined using CellTiter-Glo Cell Viability Assay (Promega). |
T334 | 3661-3715 | Sentence | denotes | Experiments were performed in duplicate or triplicate. |
T335 | 3716-3773 | Sentence | denotes | Viability of the control untreated cells was set as 100%. |
T336 | 3774-4019 | Sentence | denotes | Relative viability of cells, induced to undergo necroptosis and treated with the compound relative to the control compound-treated cells, was determined and plotted to exclude the possible effects of non-specific toxicity of the small molecules. |
T337 | 4021-4036 | Sentence | denotes | siRNA Knockdown |
T338 | 4037-4074 | Sentence | denotes | siRNAs were purchased from Dharmacon. |
T339 | 4075-4482 | Sentence | denotes | Mouse ribosomal S6 protein (L-040893-00 and L-045791-00), mouse Akt1 (L-040709-00), mouse Akt2 (L-040782-00), mouse Akt3 (L-040891-00), mouse mTOR (L-065427-00), mouse PDK1 (L-040658-00), non-coding control (D-001810-10-05), mouse Mapk8 (J-040128-05), mouse Mapk9 (J-040134-05), mouse Jun (L-043776-00). siRNA were transfected using RNAiMAX reagent (Invitrogen), according to manufacturer’s recommendations. |
T340 | 4483-4594 | Sentence | denotes | After 72 hr, cells were treated with zVAD.fmk or TNFα for 9 hr (RNA or Western blot) or 24 hr (cell viability). |
T341 | 4596-4608 | Sentence | denotes | Western Blot |
T342 | 4609-4700 | Sentence | denotes | For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes. |
T343 | 4701-4782 | Sentence | denotes | After 24–48 hr, cells were stimulated with 30 µM zVAD.fmk or 10 ng/ml mouse TNFα. |
T344 | 4783-4941 | Sentence | denotes | For treatments under serum free conditions, cells were serum starved for 24 hr prior to the addition of growth factors, 20 µM zVAD.fmk or 10 ng/ml mouse TNFα. |
T345 | 4942-5054 | Sentence | denotes | Cells were harvested in 1×RIPA buffer (Cell Signaling) supplemented with 50 µg/ml phenylmethanesulfonylfluoride. |
T346 | 5055-5132 | Sentence | denotes | After brief sonication, cell lysates were spun down for 15 min at 14,000×rpm. |
T347 | 5133-5217 | Sentence | denotes | Protein concentrations were measured using the Pierce 660 nm Assay Reagent (Pierce). |
T348 | 5218-5274 | Sentence | denotes | Equal amounts of proteins were boiled for 5 min at 95°C. |
T349 | 5275-5338 | Sentence | denotes | Western blotting was performed according to standard protocols. |
T350 | 5339-5495 | Sentence | denotes | Briefly, SDS-PAGE gels were transferred to PVDF membrane, blocked in 3% milk or 5% bovine serum albumin (BSA) in TBST buffer for 30 min at room temperature. |
T351 | 5496-5561 | Sentence | denotes | Primary antibodies were incubated in 5%BSA/TBST overnight at 4°C. |
T352 | 5562-5637 | Sentence | denotes | Secondary antibodies were incubated in TBST for 30 min at room temperature. |
T353 | 5638-5705 | Sentence | denotes | Luminata (Millipore) ECL reagents were used to develop the signals. |
T354 | 5706-5828 | Sentence | denotes | In some cases, membranes were stripped using OneMinute stripping buffer (GM Biosciences) and reprobed with new antibodies. |
T355 | 5830-5837 | Sentence | denotes | qRT-PCR |
T356 | 5838-5888 | Sentence | denotes | Cells were treated as described for Western blots. |
T357 | 5889-5950 | Sentence | denotes | Total RNA was isolated using ZR Miniprep kit (Zymo Research). |
T358 | 5951-6045 | Sentence | denotes | 1 µg of RNA was converted to cDNA using random primers (M-MuLV cDNA kit, New England Biolabs). |
T359 | 6046-6106 | Sentence | denotes | 1 µL of cDNA was used with 500 pM primers in qPCR reactions. |
T360 | 6107-6204 | Sentence | denotes | Reactions were performs using SYBRGreen 2×Master mix (SABiosciences) in a LightCycler480 (Roche). |
T361 | 6206-6234 | Sentence | denotes | Stable Infection of Myr-Akt1 |
T362 | 6235-6450 | Sentence | denotes | To generate MSCV retroviruses, HEK293FT cells (Invitrogen) were transfected with 2 µg of viral DNA and 1 µg of gal/pol and VSV-G accessory plasmids in 6 well plates using GenJet transfection reagent (Signagen Labs). |
T363 | 6451-6582 | Sentence | denotes | Virus-containing media was collected 72 hr later, filtered through 0.45 µm filter and applied to L929 cells with 8 µg/ml polybrene. |
T364 | 6583-6640 | Sentence | denotes | Cells were selected and maintained in 10 µg/ml puromycin. |
T365 | 6642-6656 | Sentence | denotes | ELISAOne Assay |
T366 | 6657-6789 | Sentence | denotes | ELISAOne assays (TGRBio, Hindmarsh, Australia) were performed according to manufacturer’s protocol with the following modifications. |
T367 | 6790-6863 | Sentence | denotes | Cell lysates were prepared in RIPA buffer as described for Western blots. |
T368 | 6864-6957 | Sentence | denotes | Five microliters of samples were diluted in 45 µL of ELISAOne lysis buffer prior to analysis. |
T369 | 6958-7075 | Sentence | denotes | Primary antibodies to phopsho-Thr308 and phopsho-Ser473 were incubated with the samples for 2 hr at room temperature. |
T370 | 7076-7135 | Sentence | denotes | Primary antibody to pan-Akt was incubated overnight at 4°C. |
T371 | 7136-7207 | Sentence | denotes | Signals for phospho-antibodies were normalized based on pan-Akt values. |
T372 | 7209-7219 | Sentence | denotes | TNFα ELISA |
T373 | 7220-7325 | Sentence | denotes | Mouse TNFα Quantikine ELISA assays (R&D Systems) were performed according to manufacturer’s descriptions. |
T374 | 7326-7406 | Sentence | denotes | Cell lysates were prepared from 3×106 cells plated and treated in a 10 cm2 dish. |
T375 | 7408-7433 | Sentence | denotes | In vitro Akt Kinase Assay |
T376 | 7434-7546 | Sentence | denotes | Akt kinase activity was measured using the Akt kinase assay kit (nonradioactive) from Cell Signaling Technology. |
T377 | 7547-7646 | Sentence | denotes | In brief, Myr-Akt was immunoprecipitated from L929 cells using anti-FLAG M2 magnetic beads (Sigma). |
T378 | 7647-7730 | Sentence | denotes | The in vitro assay was performed in the presence of a GSK fusion protein substrate. |
T379 | 7731-7804 | Sentence | denotes | Phosphorylation of the GSK fusion protein was visualized by western blot. |
simple1
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28182 | 7226-7230 | Protein | denotes | TNFα |
T28181 | 7209-7213 | Protein | denotes | TNFα |
T28295 | 7557-7564 | Protein | denotes | Myr-Akt |
T27783 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27100 | 4936-4940 | Protein | denotes | TNFα |
T27099 | 4777-4781 | Protein | denotes | TNFα |
T26747 | 4532-4536 | Protein | denotes | TNFα |
T26746 | 4333-4338 | Protein | denotes | Mapk9 |
T26745 | 4306-4311 | Protein | denotes | Mapk8 |
T26744 | 4243-4247 | Protein | denotes | PDK1 |
T26743 | 4191-4195 | Protein | denotes | Akt3 |
T26742 | 4165-4169 | Protein | denotes | Akt2 |
T26741 | 4139-4143 | Protein | denotes | Akt1 |
T26014 | 2671-2674 | Protein | denotes | 18S |
T26013 | 2623-2626 | Protein | denotes | 18S |
T26012 | 2573-2577 | Protein | denotes | TNFα |
T26011 | 2522-2526 | Protein | denotes | TNFα |
T26010 | 2432-2435 | Protein | denotes | 18S |
T26009 | 2347-2351 | Protein | denotes | TNFα |
T26207 | 2733-2737 | Protein | denotes | FADD |
T25151 | 1012-1017 | Protein | denotes | IGF-1 |
T25150 | 972-975 | Protein | denotes | EGF |
T25149 | 955-959 | Protein | denotes | bFGF |
T25148 | 932-936 | Protein | denotes | TNFα |
T25601 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25600 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25599 | 1119-1127 | Protein | denotes | Myr-Akt1 |
BioNLP16_DUT
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28363 | 7569-7587 | Binding | denotes | immunoprecipitated |
T28362 | 7557-7564 | Protein | denotes | Myr-Akt |
T28218 | 7226-7230 | Protein | denotes | TNFα |
T28217 | 7209-7213 | Protein | denotes | TNFα |
T27858 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27318 | 4936-4940 | Protein | denotes | TNFα |
T27317 | 4777-4781 | Protein | denotes | TNFα |
T26067 | 2671-2674 | Protein | denotes | 18S |
T26066 | 2623-2626 | Protein | denotes | 18S |
T26065 | 2573-2577 | Protein | denotes | TNFα |
T26064 | 2522-2526 | Protein | denotes | TNFα |
T26063 | 2432-2435 | Protein | denotes | 18S |
T26062 | 2347-2351 | Protein | denotes | TNFα |
T26872 | 4532-4536 | Protein | denotes | TNFα |
T26871 | 4333-4338 | Protein | denotes | Mapk9 |
T26870 | 4306-4311 | Protein | denotes | Mapk8 |
T26869 | 4243-4247 | Protein | denotes | PDK1 |
T26868 | 4191-4195 | Protein | denotes | Akt3 |
T26867 | 4165-4169 | Protein | denotes | Akt2 |
T26866 | 4139-4143 | Protein | denotes | Akt1 |
T26327 | 2738-2747 | Negative_regulation | denotes | deficient |
T26326 | 2733-2737 | Protein | denotes | FADD |
T25253 | 1012-1017 | Protein | denotes | IGF-1 |
T25252 | 972-975 | Protein | denotes | EGF |
T25251 | 955-959 | Protein | denotes | bFGF |
T25250 | 932-936 | Protein | denotes | TNFα |
T25650 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25649 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25648 | 1119-1127 | Protein | denotes | Myr-Akt1 |
R18019 | T26326 | T26327 | themeOf | FADD,deficient |
R19678 | T28362 | T28363 | themeOf | Myr-Akt,immunoprecipitated |
BioNLP16_Messiy
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T26086 | 2573-2577 | Protein | denotes | TNFα |
T26085 | 2522-2526 | Protein | denotes | TNFα |
T26084 | 2432-2435 | Protein | denotes | 18S |
T26083 | 2347-2351 | Protein | denotes | TNFα |
T25659 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25658 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25531 | 1012-1017 | Protein | denotes | IGF-1 |
T25530 | 972-975 | Protein | denotes | EGF |
T25529 | 955-959 | Protein | denotes | bFGF |
T25528 | 932-936 | Protein | denotes | TNFα |
T25657 | 1119-1127 | Protein | denotes | Myr-Akt1 |
T26333 | 2738-2747 | Negative_regulation | denotes | deficient |
T26332 | 2733-2737 | Protein | denotes | FADD |
T26088 | 2671-2674 | Protein | denotes | 18S |
T26087 | 2623-2626 | Protein | denotes | 18S |
T26893 | 4306-4311 | Protein | denotes | Mapk8 |
T26892 | 4243-4247 | Protein | denotes | PDK1 |
T26891 | 4191-4195 | Protein | denotes | Akt3 |
T26890 | 4165-4169 | Protein | denotes | Akt2 |
T26889 | 4139-4143 | Protein | denotes | Akt1 |
T28380 | 7569-7587 | Binding | denotes | immunoprecipitated |
T28379 | 7557-7564 | Protein | denotes | Myr-Akt |
T28226 | 7226-7230 | Protein | denotes | TNFα |
T28225 | 7209-7213 | Protein | denotes | TNFα |
T27861 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27326 | 4936-4940 | Protein | denotes | TNFα |
T27325 | 4777-4781 | Protein | denotes | TNFα |
T26895 | 4532-4536 | Protein | denotes | TNFα |
T26894 | 4333-4338 | Protein | denotes | Mapk9 |
R18022 | T26332 | T26333 | themeOf | FADD,deficient |
R19680 | T28379 | T28380 | themeOf | Myr-Akt,immunoprecipitated |
DLUT931
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28377 | 7569-7587 | Binding | denotes | immunoprecipitated |
T28376 | 7557-7564 | Protein | denotes | Myr-Akt |
T28224 | 7226-7230 | Protein | denotes | TNFα |
T28223 | 7209-7213 | Protein | denotes | TNFα |
T27859 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27322 | 4936-4940 | Protein | denotes | TNFα |
T27321 | 4777-4781 | Protein | denotes | TNFα |
T26076 | 2671-2674 | Protein | denotes | 18S |
T26075 | 2623-2626 | Protein | denotes | 18S |
T26074 | 2573-2577 | Protein | denotes | TNFα |
T26073 | 2522-2526 | Protein | denotes | TNFα |
T26072 | 2432-2435 | Protein | denotes | 18S |
T26071 | 2347-2351 | Protein | denotes | TNFα |
T26881 | 4532-4536 | Protein | denotes | TNFα |
T26880 | 4333-4338 | Protein | denotes | Mapk9 |
T26879 | 4306-4311 | Protein | denotes | Mapk8 |
T26878 | 4243-4247 | Protein | denotes | PDK1 |
T26877 | 4191-4195 | Protein | denotes | Akt3 |
T26876 | 4165-4169 | Protein | denotes | Akt2 |
T26875 | 4139-4143 | Protein | denotes | Akt1 |
T26329 | 2738-2747 | Negative_regulation | denotes | deficient |
T26328 | 2733-2737 | Protein | denotes | FADD |
T25262 | 1012-1017 | Protein | denotes | IGF-1 |
T25261 | 972-975 | Protein | denotes | EGF |
T25260 | 955-959 | Protein | denotes | bFGF |
T25259 | 932-936 | Protein | denotes | TNFα |
T25653 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25652 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25651 | 1119-1127 | Protein | denotes | Myr-Akt1 |
R18020 | T26328 | T26329 | themeOf | FADD,deficient |
R19679 | T28376 | T28377 | themeOf | Myr-Akt,immunoprecipitated |
bionlp-st-ge-2016-test-ihmc
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28409 | 7712-7729 | Protein | denotes | protein substrate |
T28408 | 7477-7480 | Protein | denotes | Akt |
T28407 | 7417-7420 | Protein | denotes | Akt |
T28406 | 7557-7564 | Protein | denotes | Myr-Akt |
T28405 | 7620-7622 | Entity | denotes | M2 |
T28404 | 7747-7772 | Protein | denotes | of the GSK fusion protein |
T28403 | 7408-7433 | Protein | denotes | In vitro Akt Kinase Assay |
T28402 | 7434-7437 | Protein | denotes | Akt |
T28401 | 7520-7545 | Entity | denotes | Cell Signaling Technology |
T28400 | 7481-7487 | Protein | denotes | kinase |
T28399 | 7639-7644 | Protein | denotes | Sigma |
T28398 | 7434-7444 | Protein | denotes | Akt kinase |
T28397 | 7712-7729 | Entity | denotes | protein substrate |
T28069 | 6790-6862 | Entity | denotes | Cell lysates were prepared in RIPA buffer as described for Western blots |
T28068 | 7136-7143 | Entity | denotes | Signals |
T28067 | 6999-7013 | Entity | denotes | phopsho-Ser473 |
T28066 | 7192-7206 | Protein | denotes | pan-Akt values |
T28065 | 7096-7103 | Protein | denotes | pan-Akt |
T28064 | 7076-7092 | Entity | denotes | Primary antibody |
T28063 | 7148-7166 | Entity | denotes | phospho-antibodies |
T28062 | 6674-6677 | Protein | denotes | TGR |
T28061 | 6657-6703 | Entity | denotes | ELISAOne assays (TGRBio, Hindmarsh, Australia) |
T28060 | 6980-6994 | Entity | denotes | phopsho-Thr308 |
T28059 | 6958-7013 | Entity | denotes | Primary antibodies to phopsho-Thr308 and phopsho-Ser473 |
T27877 | 6206-6234 | Regulation | denotes | Stable Infection of Myr-Akt1 |
T27876 | 6316-6333 | Entity | denotes | 2 µg of viral DNA |
T27875 | 6621-6639 | Entity | denotes | 10 µg/ml puromycin |
T27874 | 6266-6293 | Entity | denotes | HEK293FT cells (Invitrogen) |
T27873 | 6583-6588 | Entity | denotes | Cells |
T27872 | 6406-6449 | Entity | denotes | GenJet transfection reagent (Signagen Labs) |
T27871 | 6223-6234 | Protein | denotes | of Myr-Akt1 |
T27870 | 6321-6333 | Entity | denotes | of viral DNA |
T27869 | 6564-6581 | Entity | denotes | 8 µg/ml polybrene |
T27868 | 6406-6409 | Protein | denotes | Gen |
T28271 | 7392-7405 | Protein | denotes | a 10 cm2 dish |
T28270 | 7326-7338 | Entity | denotes | Cell lysates |
T28269 | 7209-7213 | Protein | denotes | TNFα |
T28268 | 7220-7241 | Protein | denotes | Mouse TNFα Quantikine |
T28267 | 7358-7405 | Entity | denotes | 3×106 cells plated and treated in a 10 cm2 dish |
T27345 | 4649-4667 | Entity | denotes | 1×106 Jurkat cells |
T27344 | 5133-5155 | Entity | denotes | Protein concentrations |
T27343 | 5496-5514 | Entity | denotes | Primary antibodies |
T27342 | 4744-4758 | Entity | denotes | 30 µM zVAD.fmk |
T27341 | 5382-5386 | Entity | denotes | PVDF |
T27340 | 5419-5448 | Protein | denotes | 5% bovine serum albumin (BSA) |
T27339 | 5232-5243 | Protein | denotes | of proteins |
T27693 | 5830-5837 | Protein | denotes | qRT-PCR |
T27692 | 5889-5898 | Protein | denotes | Total RNA |
T27691 | 6091-6105 | Protein | denotes | qPCR reactions |
T27690 | 5959-5962 | Protein | denotes | RNA |
T27689 | 5838-5843 | Entity | denotes | Cells |
T27366 | 4942-4972 | Binding | denotes | Cells were harvested in 1×RIPA |
T27365 | 4609-4699 | Binding | denotes | For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes |
T27364 | 5191-5216 | Entity | denotes | nm Assay Reagent (Pierce) |
T27363 | 4827-4832 | Entity | denotes | cells |
T27362 | 5659-5671 | Entity | denotes | ECL reagents |
T27361 | 5382-5395 | Entity | denotes | PVDF membrane |
T27360 | 5562-5582 | Entity | denotes | Secondary antibodies |
T27359 | 4627-4668 | Entity | denotes | 4×105 adherent cells (1×106 Jurkat cells) |
T27358 | 4717-4722 | Entity | denotes | cells |
T27357 | 5779-5781 | Entity | denotes | GM |
T27356 | 4942-4947 | Entity | denotes | Cells |
T27355 | 5813-5827 | Entity | denotes | new antibodies |
T27354 | 4981-4985 | Entity | denotes | Cell |
T27353 | 4909-4917 | Entity | denotes | zVAD.fmk |
T27352 | 5079-5091 | Entity | denotes | cell lysates |
T27351 | 5659-5662 | Protein | denotes | ECL |
T27350 | 5721-5730 | Entity | denotes | membranes |
T27349 | 4762-4781 | Protein | denotes | 10 ng/ml mouse TNFα |
T27348 | 4903-4940 | Protein | denotes | 20 µM zVAD.fmk or 10 ng/ml mouse TNFα |
T27347 | 5348-5361 | Entity | denotes | SDS-PAGE gels |
T27346 | 5444-5447 | Protein | denotes | BSA |
T26928 | 4133-4157 | Protein | denotes | mouse Akt1 (L-040709-00) |
T26927 | 4091-4093 | Entity | denotes | S6 |
T26926 | 4496-4501 | Entity | denotes | cells |
T26925 | 4408-4437 | Entity | denotes | RNAiMAX reagent (Invitrogen), |
T26924 | 4075-4131 | Protein | denotes | Mouse ribosomal S6 protein (L-040893-00 and L-045791-00) |
T26923 | 4532-4567 | Protein | denotes | TNFα for 9 hr (RNA or Western blot) |
T26922 | 4408-4437 | Protein | denotes | RNAiMAX reagent (Invitrogen), |
T26921 | 4578-4592 | Entity | denotes | cell viability |
T26920 | 4520-4528 | Entity | denotes | zVAD.fmk |
T26691 | 3999-4018 | Entity | denotes | the small molecules |
T26690 | 3579-3593 | Entity | denotes | Cell viability |
T26689 | 3615-3659 | Entity | denotes | CellTiter-Glo Cell Viability Assay (Promega) |
T26688 | 3905-3910 | Entity | denotes | cells |
T26687 | 3793-3801 | Entity | denotes | of cells |
T26686 | 3726-3756 | Entity | denotes | of the control untreated cells |
T26685 | 3405-3431 | Entity | denotes | Cell Viability Experiments |
T26684 | 3974-4018 | Entity | denotes | non-specific toxicity of the small molecules |
T26175 | 2567-2577 | Protein | denotes | human TNFα |
T26174 | 2400-2435 | Protein | denotes | 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S |
T26173 | 2341-2351 | Protein | denotes | Mouse TNFα |
T26172 | 2636-2674 | Protein | denotes | 5′- CAGCCACCCGAGATTGAGCA -3, human 18S |
T26171 | 2617-2626 | Protein | denotes | human 18S |
T26170 | 2516-2526 | Protein | denotes | human TNFα |
T25746 | 1381-1391 | Entity | denotes | Antibodies |
T26473 | 2786-2802 | Entity | denotes | Lung fibroblasts |
T26472 | 3242-3267 | Entity | denotes | non-essential amino acids |
T26471 | 3273-3288 | Entity | denotes | sodium pyruvate |
T26470 | 3290-3302 | Entity | denotes | Jurkat cells |
T26469 | 2872-2892 | Entity | denotes | J774A.1 (ATCC) cells |
T26468 | 2733-2760 | Entity | denotes | FADD-deficient Jurkat cells |
T26467 | 2897-2918 | Entity | denotes | RAW264.7 (ATCC) cells |
T26466 | 2724-2728 | Entity | denotes | L929 |
T26465 | 3177-3187 | Entity | denotes | fibroblast |
T26464 | 3377-3402 | Entity | denotes | 1% antibiotic-antimycotic |
T26463 | 3229-3240 | Entity | denotes | L-glutamine |
T26462 | 3105-3108 | Protein | denotes | FBS |
T26461 | 3033-3038 | Entity | denotes | Cells |
T26460 | 3114-3160 | Entity | denotes | 1% antibiotic-antimycotic mixture (Invitrogen) |
T25670 | 1254-1259 | Entity | denotes | EcoRI |
T25669 | 1244-1249 | Entity | denotes | BglII |
T25668 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25667 | 1214-1220 | Protein | denotes | by PCR |
T25666 | 1123-1127 | Protein | denotes | Akt1 |
T25665 | 1104-1107 | Entity | denotes | DNA |
T25664 | 1328-1339 | Protein | denotes | of Myr-Akt1 |
T25663 | 1151-1184 | Protein | denotes | FLAG tag, has been described [52] |
T25662 | 1119-1122 | Entity | denotes | Myr |
T25661 | 1116-1150 | Entity | denotes | of Myr-Akt1, containing c-terminal |
T25660 | 1116-1150 | Entity | denotes | of Myr-Akt1, containing c-terminal |
T25569 | 847-914 | Binding | denotes | Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem |
T25568 | 859-868 | Entity | denotes | inhibitor |
T25567 | 926-936 | Protein | denotes | mouse TNFα |
T25566 | 972-975 | Protein | denotes | EGF |
T25565 | 119-141 | Entity | denotes | The following reagents |
T25564 | 949-959 | Protein | denotes | human bFGF |
T25563 | 847-888 | Protein | denotes | Pan-caspase inhibitor zVAD.fmk (20–30 µM) |
T25562 | 847-888 | Entity | denotes | Pan-caspase inhibitor zVAD.fmk (20–30 µM) |
T25561 | 988-995 | Entity | denotes | PDGF-BB |
T25560 | 23-31 | Entity | denotes | Reagents |
T25559 | 1067-1085 | Entity | denotes | All other reagents |
T25558 | 1039-1043 | Entity | denotes | Cell |
T25557 | 1012-1017 | Protein | denotes | IGF-1 |
T25556 | 1096-1101 | Protein | denotes | Sigma |
R17464 | T25562 | T25569 | themeOf | Pan-caspase inhibitor zVAD.fmk (20–30 µM),Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem |
R19285 | T27871 | T27877 | themeOf | of Myr-Akt1,Stable Infection of Myr-Akt1 |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T26683 | 4018-4019 | . | denotes | . |
T27575 | 5638-5646 | NNP | denotes | Luminata |
T28423 | 7481-7487 | NN | denotes | kinase |
T28479 | 7803-7804 | . | denotes | . |
T28478 | 7799-7803 | NN | denotes | blot |
T28477 | 7791-7798 | JJ | denotes | western |
T28476 | 7788-7790 | IN | denotes | by |
T28475 | 7777-7787 | VBN | denotes | visualized |
T28474 | 7773-7776 | VBD | denotes | was |
T28473 | 7765-7772 | NN | denotes | protein |
T28472 | 7758-7764 | NN | denotes | fusion |
T28471 | 7754-7757 | NNP | denotes | GSK |
T28470 | 7750-7753 | DT | denotes | the |
T28469 | 7747-7749 | IN | denotes | of |
T28468 | 7731-7746 | NNP | denotes | Phosphorylation |
T28467 | 7729-7730 | . | denotes | . |
T28466 | 7720-7729 | NN | denotes | substrate |
T28465 | 7712-7719 | NN | denotes | protein |
T28464 | 7705-7711 | NN | denotes | fusion |
T28463 | 7701-7704 | NNP | denotes | GSK |
T28462 | 7699-7700 | DT | denotes | a |
T28461 | 7696-7698 | IN | denotes | of |
T28460 | 7687-7695 | NN | denotes | presence |
T28459 | 7683-7686 | DT | denotes | the |
T28458 | 7680-7682 | IN | denotes | in |
T28457 | 7670-7679 | VBN | denotes | performed |
T28456 | 7666-7669 | VBD | denotes | was |
T28455 | 7660-7665 | NN | denotes | assay |
T28454 | 7654-7659 | NN | denotes | vitro |
T28453 | 7651-7653 | IN | denotes | in |
T28452 | 7647-7650 | DT | denotes | The |
T28451 | 7645-7646 | . | denotes | . |
T28450 | 7644-7645 | -RRB- | denotes | ) |
T28449 | 7639-7644 | NNP | denotes | Sigma |
T28448 | 7638-7639 | -LRB- | denotes | ( |
T28447 | 7632-7637 | NNS | denotes | beads |
T28446 | 7623-7631 | JJ | denotes | magnetic |
T28445 | 7620-7622 | NN | denotes | M2 |
T28444 | 7610-7619 | JJ | denotes | anti-FLAG |
T28443 | 7604-7609 | VBG | denotes | using |
T28442 | 7598-7603 | NNS | denotes | cells |
T28441 | 7593-7597 | CD | denotes | L929 |
T28440 | 7588-7592 | IN | denotes | from |
T28439 | 7569-7587 | VBN | denotes | immunoprecipitated |
T28438 | 7565-7568 | VBD | denotes | was |
T28437 | 7557-7564 | NNP | denotes | Myr-Akt |
T28436 | 7555-7556 | , | denotes | , |
T28435 | 7550-7555 | NN | denotes | brief |
T28434 | 7547-7549 | IN | denotes | In |
T28433 | 7545-7546 | . | denotes | . |
T28432 | 7535-7545 | NNP | denotes | Technology |
T28431 | 7525-7534 | NNP | denotes | Signaling |
T28430 | 7520-7524 | NNP | denotes | Cell |
T28429 | 7515-7519 | IN | denotes | from |
T28428 | 7513-7514 | -RRB- | denotes | ) |
T28427 | 7499-7513 | JJ | denotes | nonradioactive |
T28426 | 7498-7499 | -LRB- | denotes | ( |
T28425 | 7494-7497 | NN | denotes | kit |
T28424 | 7488-7493 | NN | denotes | assay |
T28422 | 7477-7480 | NNP | denotes | Akt |
T28421 | 7473-7476 | DT | denotes | the |
T28420 | 7467-7472 | VBG | denotes | using |
T28419 | 7458-7466 | VBN | denotes | measured |
T28418 | 7454-7457 | VBD | denotes | was |
T28417 | 7445-7453 | NN | denotes | activity |
T28416 | 7438-7444 | NN | denotes | kinase |
T28415 | 7434-7437 | NNP | denotes | Akt |
T28414 | 7428-7433 | NNP | denotes | Assay |
T28413 | 7421-7427 | NNP | denotes | Kinase |
T28412 | 7417-7420 | NNP | denotes | Akt |
T28411 | 7411-7416 | NN | denotes | vitro |
T28410 | 7408-7410 | IN | denotes | In |
T28244 | 7297-7309 | NN | denotes | manufacturer |
T28243 | 7294-7296 | TO | denotes | to |
T28242 | 7284-7293 | VBG | denotes | according |
T28241 | 7274-7283 | VBN | denotes | performed |
T28240 | 7269-7273 | VBD | denotes | were |
T28239 | 7267-7268 | -RRB- | denotes | ) |
T28238 | 7260-7267 | NNPS | denotes | Systems |
T28237 | 7256-7259 | NNP | denotes | R&D |
T28236 | 7255-7256 | -LRB- | denotes | ( |
T28235 | 7248-7254 | NNS | denotes | assays |
T28234 | 7242-7247 | NNP | denotes | ELISA |
T28233 | 7231-7241 | NNP | denotes | Quantikine |
T28232 | 7226-7230 | NNP | denotes | TNFα |
T28231 | 7220-7225 | NNP | denotes | Mouse |
T28230 | 7214-7219 | NNP | denotes | ELISA |
T28229 | 7209-7213 | NNP | denotes | TNFα |
T28160 | 7206-7207 | . | denotes | . |
T28159 | 7200-7206 | NNS | denotes | values |
T28158 | 7192-7199 | JJ | denotes | pan-Akt |
T28157 | 7189-7191 | IN | denotes | on |
T28156 | 7183-7188 | VBN | denotes | based |
T28155 | 7172-7182 | VBN | denotes | normalized |
T28154 | 7167-7171 | VBD | denotes | were |
T28153 | 7148-7166 | NNS | denotes | phospho-antibodies |
T28152 | 7144-7147 | IN | denotes | for |
T28151 | 7136-7143 | NNP | denotes | Signals |
T28150 | 7133-7135 | NNP | denotes | C. |
T28149 | 7132-7133 | CD | denotes | ° |
T28148 | 7131-7132 | CD | denotes | 4 |
T28147 | 7128-7130 | IN | denotes | at |
T28146 | 7118-7127 | RB | denotes | overnight |
T28145 | 7108-7117 | VBN | denotes | incubated |
T28144 | 7104-7107 | VBD | denotes | was |
T28143 | 7096-7103 | NN | denotes | pan-Akt |
T28142 | 7093-7095 | TO | denotes | to |
T28141 | 7084-7092 | NN | denotes | antibody |
T28140 | 7076-7083 | JJ | denotes | Primary |
T28139 | 7074-7075 | . | denotes | . |
T28138 | 7063-7074 | NN | denotes | temperature |
T28137 | 7058-7062 | NN | denotes | room |
T28136 | 7055-7057 | IN | denotes | at |
T28135 | 7052-7054 | NN | denotes | hr |
T28134 | 7050-7051 | CD | denotes | 2 |
T28133 | 7046-7049 | IN | denotes | for |
T28132 | 7038-7045 | NNS | denotes | samples |
T28131 | 7034-7037 | DT | denotes | the |
T28130 | 7029-7033 | IN | denotes | with |
T28129 | 7019-7028 | VBN | denotes | incubated |
T28128 | 7014-7018 | VBD | denotes | were |
T28127 | 6999-7013 | JJ | denotes | phopsho-Ser473 |
T28126 | 6995-6998 | CC | denotes | and |
T28125 | 6980-6994 | JJ | denotes | phopsho-Thr308 |
T28124 | 6977-6979 | TO | denotes | to |
T28123 | 6966-6976 | NNS | denotes | antibodies |
T28122 | 6958-6965 | JJ | denotes | Primary |
T28121 | 6956-6957 | . | denotes | . |
T28120 | 6948-6956 | NN | denotes | analysis |
T28119 | 6945-6947 | TO | denotes | to |
T28118 | 6939-6944 | RB | denotes | prior |
T28117 | 6932-6938 | NN | denotes | buffer |
T28116 | 6926-6931 | VBZ | denotes | lysis |
T28107 | 6881-6883 | IN | denotes | of |
T28106 | 6869-6880 | NNS | denotes | microliters |
T28105 | 6864-6868 | CD | denotes | Five |
T28104 | 6862-6863 | . | denotes | . |
T28103 | 6857-6862 | NNS | denotes | blots |
T28102 | 6849-6856 | JJ | denotes | Western |
T28101 | 6845-6848 | IN | denotes | for |
T28100 | 6835-6844 | VBN | denotes | described |
T28099 | 6832-6834 | IN | denotes | as |
T28098 | 6825-6831 | NN | denotes | buffer |
T28097 | 6820-6824 | NNP | denotes | RIPA |
T28096 | 6817-6819 | IN | denotes | in |
T28095 | 6808-6816 | VBN | denotes | prepared |
T28094 | 6803-6807 | VBD | denotes | were |
T28093 | 6795-6802 | NNS | denotes | lysates |
T28092 | 6790-6794 | NN | denotes | Cell |
T28091 | 6788-6789 | . | denotes | . |
T28090 | 6775-6788 | NNS | denotes | modifications |
T28089 | 6765-6774 | VBG | denotes | following |
T28088 | 6761-6764 | DT | denotes | the |
T28087 | 6756-6760 | IN | denotes | with |
T28086 | 6747-6755 | NN | denotes | protocol |
T28085 | 6732-6744 | NN | denotes | manufacturer |
T28084 | 6729-6731 | TO | denotes | to |
T28083 | 6719-6728 | VBG | denotes | according |
T28082 | 6709-6718 | VBN | denotes | performed |
T28081 | 6704-6708 | VBD | denotes | were |
T28080 | 6702-6703 | -RRB- | denotes | ) |
T28079 | 6693-6702 | NNP | denotes | Australia |
T28078 | 6691-6692 | , | denotes | , |
T28077 | 6682-6691 | NNP | denotes | Hindmarsh |
T28076 | 6680-6681 | , | denotes | , |
T28075 | 6674-6680 | NNP | denotes | TGRBio |
T28074 | 6673-6674 | -LRB- | denotes | ( |
T28073 | 6666-6672 | NNS | denotes | assays |
T28072 | 6657-6665 | NNP | denotes | ELISAOne |
T28071 | 6651-6656 | NNP | denotes | Assay |
T28070 | 6642-6650 | NNP | denotes | ELISAOne |
T27958 | 6639-6640 | . | denotes | . |
T27957 | 6630-6639 | NN | denotes | puromycin |
T27956 | 6627-6629 | NN | denotes | ml |
T27955 | 6626-6627 | NN | denotes | / |
T27954 | 6624-6626 | NN | denotes | µg |
T27953 | 6621-6623 | CD | denotes | 10 |
T27952 | 6618-6620 | IN | denotes | in |
T27951 | 6607-6617 | VBN | denotes | maintained |
T27950 | 6603-6606 | CC | denotes | and |
T27949 | 6594-6602 | VBN | denotes | selected |
T27948 | 6589-6593 | VBD | denotes | were |
T27947 | 6583-6588 | NNS | denotes | Cells |
T27946 | 6581-6582 | . | denotes | . |
T27945 | 6572-6581 | NN | denotes | polybrene |
T27944 | 6569-6571 | NN | denotes | ml |
T27943 | 6568-6569 | NN | denotes | / |
T27942 | 6566-6568 | NN | denotes | µg |
T27941 | 6564-6565 | CD | denotes | 8 |
T27940 | 6559-6563 | IN | denotes | with |
T27939 | 6553-6558 | NNS | denotes | cells |
T27938 | 6548-6552 | CD | denotes | L929 |
T27937 | 6545-6547 | TO | denotes | to |
T27936 | 6537-6544 | VBD | denotes | applied |
T27935 | 6533-6536 | CC | denotes | and |
T27934 | 6526-6532 | NN | denotes | filter |
T27933 | 6523-6525 | NN | denotes | µm |
T27932 | 6518-6522 | CD | denotes | 0.45 |
T27931 | 6510-6517 | IN | denotes | through |
T27930 | 6501-6509 | VBN | denotes | filtered |
T27929 | 6499-6500 | , | denotes | , |
T27928 | 6494-6499 | RB | denotes | later |
T27927 | 6491-6493 | NN | denotes | hr |
T27926 | 6488-6490 | CD | denotes | 72 |
T27925 | 6478-6487 | VBN | denotes | collected |
T27924 | 6474-6477 | VBD | denotes | was |
T27923 | 6468-6473 | NNS | denotes | media |
T27922 | 6451-6467 | VBG | denotes | Virus-containing |
T27921 | 6449-6450 | . | denotes | . |
T27920 | 6448-6449 | -RRB- | denotes | ) |
T27919 | 6444-6448 | NNPS | denotes | Labs |
T27918 | 6435-6443 | NNP | denotes | Signagen |
T27917 | 6434-6435 | -LRB- | denotes | ( |
T27916 | 6426-6433 | NN | denotes | reagent |
T27915 | 6413-6425 | NN | denotes | transfection |
T27914 | 6406-6412 | NNP | denotes | GenJet |
T27913 | 6400-6405 | VBG | denotes | using |
T27912 | 6393-6399 | VBZ | denotes | plates |
T27911 | 6388-6392 | RB | denotes | well |
T27910 | 6386-6387 | CD | denotes | 6 |
T27909 | 6383-6385 | IN | denotes | in |
T27908 | 6374-6382 | NNS | denotes | plasmids |
T27907 | 6364-6373 | JJ | denotes | accessory |
T27906 | 6358-6363 | NNP | denotes | VSV-G |
T27905 | 6354-6357 | CC | denotes | and |
T27904 | 6346-6353 | NN | denotes | gal/pol |
T27903 | 6343-6345 | IN | denotes | of |
T27902 | 6340-6342 | NN | denotes | µg |
T27901 | 6338-6339 | CD | denotes | 1 |
T27900 | 6334-6337 | CC | denotes | and |
T27899 | 6330-6333 | NN | denotes | DNA |
T27898 | 6324-6329 | JJ | denotes | viral |
T27897 | 6321-6323 | IN | denotes | of |
T27896 | 6318-6320 | NN | denotes | µg |
T27895 | 6316-6317 | CD | denotes | 2 |
T27894 | 6311-6315 | IN | denotes | with |
T27893 | 6299-6310 | VBN | denotes | transfected |
T27892 | 6294-6298 | VBD | denotes | were |
T27891 | 6292-6293 | -RRB- | denotes | ) |
T27890 | 6282-6292 | NNP | denotes | Invitrogen |
T27889 | 6281-6282 | -LRB- | denotes | ( |
T27888 | 6275-6280 | NNS | denotes | cells |
T27887 | 6266-6274 | JJ | denotes | HEK293FT |
T27886 | 6264-6265 | , | denotes | , |
T27885 | 6252-6264 | NNS | denotes | retroviruses |
T27884 | 6247-6251 | NNP | denotes | MSCV |
T27883 | 6238-6246 | VB | denotes | generate |
T27882 | 6235-6237 | TO | denotes | To |
T27881 | 6226-6234 | NNP | denotes | Myr-Akt1 |
T27880 | 6223-6225 | IN | denotes | of |
T27879 | 6213-6222 | NN | denotes | Infection |
T27878 | 6206-6212 | JJ | denotes | Stable |
T28264 | 7405-7406 | . | denotes | . |
T28263 | 7401-7405 | NN | denotes | dish |
T28262 | 7397-7400 | NN | denotes | cm2 |
T28261 | 7394-7396 | CD | denotes | 10 |
T28260 | 7392-7393 | DT | denotes | a |
T28259 | 7389-7391 | IN | denotes | in |
T28258 | 7381-7388 | VBN | denotes | treated |
T28257 | 7377-7380 | CC | denotes | and |
T28256 | 7370-7376 | VBN | denotes | plated |
T28255 | 7364-7369 | NNS | denotes | cells |
T28254 | 7360-7363 | CD | denotes | 106 |
T28253 | 7359-7360 | CD | denotes | × |
T28252 | 7358-7359 | CD | denotes | 3 |
T28251 | 7353-7357 | IN | denotes | from |
T28250 | 7344-7352 | VBN | denotes | prepared |
T28249 | 7339-7343 | VBD | denotes | were |
T28248 | 7331-7338 | NNS | denotes | lysates |
T28247 | 7326-7330 | NN | denotes | Cell |
T28246 | 7324-7325 | . | denotes | . |
T28245 | 7312-7324 | NNS | denotes | descriptions |
T27608 | 5827-5828 | . | denotes | . |
T27607 | 5817-5827 | NNS | denotes | antibodies |
T27606 | 5813-5816 | JJ | denotes | new |
T27605 | 5808-5812 | IN | denotes | with |
T27604 | 5799-5807 | VBN | denotes | reprobed |
T27603 | 5795-5798 | CC | denotes | and |
T27602 | 5793-5794 | -RRB- | denotes | ) |
T27601 | 5782-5793 | NNPS | denotes | Biosciences |
T27600 | 5779-5781 | NNP | denotes | GM |
T27599 | 5778-5779 | -LRB- | denotes | ( |
T27598 | 5771-5777 | NN | denotes | buffer |
T27597 | 5761-5770 | VBG | denotes | stripping |
T27596 | 5751-5760 | NNP | denotes | OneMinute |
T27595 | 5745-5750 | VBG | denotes | using |
T27594 | 5736-5744 | VBN | denotes | stripped |
T27593 | 5731-5735 | VBD | denotes | were |
T27592 | 5721-5730 | NNS | denotes | membranes |
T27591 | 5719-5720 | , | denotes | , |
T27590 | 5714-5719 | NNS | denotes | cases |
T27589 | 5709-5713 | DT | denotes | some |
T27588 | 5706-5708 | IN | denotes | In |
T27587 | 5704-5705 | . | denotes | . |
T27586 | 5697-5704 | NNS | denotes | signals |
T27585 | 5693-5696 | DT | denotes | the |
T27584 | 5685-5692 | VB | denotes | develop |
T27583 | 5682-5684 | TO | denotes | to |
T27582 | 5677-5681 | VBN | denotes | used |
T27581 | 5672-5676 | VBD | denotes | were |
T27580 | 5663-5671 | NNS | denotes | reagents |
T27579 | 5659-5662 | NNP | denotes | ECL |
T27578 | 5657-5658 | -RRB- | denotes | ) |
T27577 | 5648-5657 | NNP | denotes | Millipore |
T27576 | 5647-5648 | -LRB- | denotes | ( |
T27574 | 5636-5637 | . | denotes | . |
T27573 | 5625-5636 | NN | denotes | temperature |
T27572 | 5620-5624 | NN | denotes | room |
T27571 | 5617-5619 | IN | denotes | at |
T27570 | 5613-5616 | NN | denotes | min |
T27569 | 5610-5612 | CD | denotes | 30 |
T27568 | 5606-5609 | IN | denotes | for |
T27567 | 5601-5605 | NNP | denotes | TBST |
T27566 | 5598-5600 | IN | denotes | in |
T27565 | 5588-5597 | VBN | denotes | incubated |
T27564 | 5583-5587 | VBD | denotes | were |
T27563 | 5572-5582 | NNS | denotes | antibodies |
T27562 | 5562-5571 | JJ | denotes | Secondary |
T27561 | 5559-5561 | NNP | denotes | C. |
T27560 | 5558-5559 | CD | denotes | ° |
T27559 | 5557-5558 | CD | denotes | 4 |
T27558 | 5554-5556 | IN | denotes | at |
T27557 | 5544-5553 | JJ | denotes | overnight |
T27556 | 5535-5543 | NNP | denotes | BSA/TBST |
T27555 | 5534-5535 | NN | denotes | % |
T27554 | 5533-5534 | CD | denotes | 5 |
T27553 | 5530-5532 | IN | denotes | in |
T27552 | 5520-5529 | VBN | denotes | incubated |
T27551 | 5515-5519 | VBD | denotes | were |
T27550 | 5504-5514 | NNS | denotes | antibodies |
T27549 | 5496-5503 | JJ | denotes | Primary |
T27548 | 5494-5495 | . | denotes | . |
T27547 | 5483-5494 | NN | denotes | temperature |
T27546 | 5478-5482 | NN | denotes | room |
T27545 | 5475-5477 | IN | denotes | at |
T27544 | 5471-5474 | NN | denotes | min |
T27543 | 5468-5470 | CD | denotes | 30 |
T27542 | 5464-5467 | IN | denotes | for |
T27541 | 5457-5463 | NN | denotes | buffer |
T27540 | 5452-5456 | NNP | denotes | TBST |
T27539 | 5449-5451 | IN | denotes | in |
T27538 | 5447-5448 | -RRB- | denotes | ) |
T27537 | 5444-5447 | NNP | denotes | BSA |
T27536 | 5443-5444 | -LRB- | denotes | ( |
T27535 | 5435-5442 | NN | denotes | albumin |
T27534 | 5429-5434 | NN | denotes | serum |
T27533 | 5422-5428 | JJ | denotes | bovine |
T27532 | 5420-5421 | NN | denotes | % |
T27531 | 5419-5420 | CD | denotes | 5 |
T27530 | 5416-5418 | CC | denotes | or |
T27529 | 5411-5415 | NN | denotes | milk |
T27528 | 5409-5410 | NN | denotes | % |
T27527 | 5408-5409 | CD | denotes | 3 |
T27526 | 5405-5407 | IN | denotes | in |
T27525 | 5397-5404 | VBN | denotes | blocked |
T27524 | 5395-5396 | , | denotes | , |
T27523 | 5387-5395 | NN | denotes | membrane |
T27522 | 5382-5386 | NNP | denotes | PVDF |
T27521 | 5379-5381 | TO | denotes | to |
T27520 | 5367-5378 | VBN | denotes | transferred |
T27519 | 5362-5366 | VBD | denotes | were |
T27518 | 5357-5361 | NNS | denotes | gels |
T27517 | 5348-5356 | NNP | denotes | SDS-PAGE |
T27516 | 5346-5347 | , | denotes | , |
T27515 | 5339-5346 | RB | denotes | Briefly |
T27514 | 5337-5338 | . | denotes | . |
T27513 | 5328-5337 | NNS | denotes | protocols |
T27512 | 5319-5327 | JJ | denotes | standard |
T27511 | 5316-5318 | TO | denotes | to |
T27510 | 5306-5315 | VBG | denotes | according |
T27509 | 5296-5305 | VBN | denotes | performed |
T27508 | 5292-5295 | VBD | denotes | was |
T27507 | 5283-5291 | VBG | denotes | blotting |
T27506 | 5275-5282 | NNP | denotes | Western |
T27505 | 5272-5274 | NNP | denotes | C. |
T27504 | 5271-5272 | CD | denotes | ° |
T27503 | 5269-5271 | CD | denotes | 95 |
T27502 | 5266-5268 | IN | denotes | at |
T27501 | 5262-5265 | NN | denotes | min |
T27500 | 5260-5261 | CD | denotes | 5 |
T27499 | 5256-5259 | IN | denotes | for |
T27498 | 5249-5255 | VBN | denotes | boiled |
T27497 | 5244-5248 | VBD | denotes | were |
T27496 | 5235-5243 | NNS | denotes | proteins |
T27495 | 5232-5234 | IN | denotes | of |
T27494 | 5224-5231 | NNS | denotes | amounts |
T27493 | 5218-5223 | NNP | denotes | Equal |
T27492 | 5216-5217 | . | denotes | . |
T27491 | 5215-5216 | -RRB- | denotes | ) |
T27490 | 5209-5215 | NNP | denotes | Pierce |
T27489 | 5208-5209 | -LRB- | denotes | ( |
T27488 | 5200-5207 | NNP | denotes | Reagent |
T27487 | 5194-5199 | NNP | denotes | Assay |
T27486 | 5191-5193 | NN | denotes | nm |
T27485 | 5187-5190 | CD | denotes | 660 |
T27484 | 5180-5186 | NNP | denotes | Pierce |
T27483 | 5176-5179 | DT | denotes | the |
T27482 | 5170-5175 | VBG | denotes | using |
T27481 | 5161-5169 | VBN | denotes | measured |
T27480 | 5156-5160 | VBD | denotes | were |
T27479 | 5141-5155 | NNS | denotes | concentrations |
T27478 | 5133-5140 | NN | denotes | Protein |
T27477 | 5131-5132 | . | denotes | . |
T27476 | 5128-5131 | NN | denotes | rpm |
T27475 | 5127-5128 | CD | denotes | × |
T27474 | 5121-5127 | CD | denotes | 14,000 |
T27473 | 5118-5120 | IN | denotes | at |
T27472 | 5114-5117 | NN | denotes | min |
T27471 | 5111-5113 | CD | denotes | 15 |
T27470 | 5107-5110 | IN | denotes | for |
T27469 | 5102-5106 | RP | denotes | down |
T27468 | 5097-5101 | VBN | denotes | spun |
T27467 | 5092-5096 | VBD | denotes | were |
T27466 | 5084-5091 | NNS | denotes | lysates |
T27465 | 5079-5083 | NN | denotes | cell |
T27464 | 5077-5078 | , | denotes | , |
T27463 | 5067-5077 | NN | denotes | sonication |
T27462 | 5061-5066 | JJ | denotes | brief |
T27461 | 5055-5060 | IN | denotes | After |
T27460 | 5053-5054 | . | denotes | . |
T27770 | 6203-6204 | . | denotes | . |
T27769 | 6202-6203 | -RRB- | denotes | ) |
T27768 | 6197-6202 | NNP | denotes | Roche |
T27767 | 6196-6197 | -LRB- | denotes | ( |
T27766 | 6181-6195 | NNP | denotes | LightCycler480 |
T27765 | 6179-6180 | DT | denotes | a |
T27764 | 6176-6178 | IN | denotes | in |
T27763 | 6174-6175 | -RRB- | denotes | ) |
T27762 | 6161-6174 | NNS | denotes | SABiosciences |
T27761 | 6160-6161 | -LRB- | denotes | ( |
T27760 | 6156-6159 | NN | denotes | mix |
T27759 | 6149-6155 | NNP | denotes | Master |
T27758 | 6148-6149 | CD | denotes | × |
T27757 | 6147-6148 | CD | denotes | 2 |
T27756 | 6137-6146 | NNP | denotes | SYBRGreen |
T27755 | 6131-6136 | VBG | denotes | using |
T27754 | 6122-6130 | VBZ | denotes | performs |
T27753 | 6117-6121 | VBD | denotes | were |
T27752 | 6107-6116 | NNS | denotes | Reactions |
T27751 | 6105-6106 | . | denotes | . |
T27750 | 6096-6105 | NNS | denotes | reactions |
T27749 | 6091-6095 | NNP | denotes | qPCR |
T27748 | 6088-6090 | IN | denotes | in |
T27747 | 6080-6087 | NNS | denotes | primers |
T27746 | 6077-6079 | NN | denotes | pM |
T27745 | 6073-6076 | CD | denotes | 500 |
T27744 | 6068-6072 | IN | denotes | with |
T27743 | 6063-6067 | VBN | denotes | used |
T27742 | 6059-6062 | VBD | denotes | was |
T27741 | 6054-6058 | NNP | denotes | cDNA |
T27740 | 6051-6053 | IN | denotes | of |
T27739 | 6048-6050 | NN | denotes | µL |
T27738 | 6046-6047 | CD | denotes | 1 |
T27737 | 6044-6045 | . | denotes | . |
T27736 | 6043-6044 | -RRB- | denotes | ) |
T27735 | 6036-6043 | NNPS | denotes | Biolabs |
T27734 | 6028-6035 | NNP | denotes | England |
T27733 | 6024-6027 | NNP | denotes | New |
T27732 | 6022-6023 | , | denotes | , |
T27731 | 6019-6022 | NN | denotes | kit |
T27730 | 6014-6018 | NNP | denotes | cDNA |
T27729 | 6007-6013 | NNP | denotes | M-MuLV |
T27728 | 6006-6007 | -LRB- | denotes | ( |
T27727 | 5998-6005 | NNS | denotes | primers |
T27726 | 5991-5997 | JJ | denotes | random |
T27725 | 5985-5990 | VBG | denotes | using |
T27724 | 5980-5984 | NNP | denotes | cDNA |
T27723 | 5977-5979 | TO | denotes | to |
T27722 | 5967-5976 | VBN | denotes | converted |
T27721 | 5963-5966 | VBD | denotes | was |
T27720 | 5959-5962 | NNP | denotes | RNA |
T27719 | 5956-5958 | IN | denotes | of |
T27718 | 5953-5955 | NN | denotes | µg |
T27717 | 5951-5952 | CD | denotes | 1 |
T27716 | 5949-5950 | . | denotes | . |
T27715 | 5948-5949 | -RRB- | denotes | ) |
T27714 | 5940-5948 | NNP | denotes | Research |
T27713 | 5935-5939 | NNP | denotes | Zymo |
T27712 | 5934-5935 | -LRB- | denotes | ( |
T27711 | 5930-5933 | NN | denotes | kit |
T27710 | 5921-5929 | NNP | denotes | Miniprep |
T27709 | 5918-5920 | NNP | denotes | ZR |
T27708 | 5912-5917 | VBG | denotes | using |
T27707 | 5903-5911 | VBN | denotes | isolated |
T27706 | 5899-5902 | VBD | denotes | was |
T27705 | 5895-5898 | NNP | denotes | RNA |
T27704 | 5889-5894 | JJ | denotes | Total |
T27703 | 5887-5888 | . | denotes | . |
T27702 | 5882-5887 | NNS | denotes | blots |
T27701 | 5874-5881 | JJ | denotes | Western |
T27700 | 5870-5873 | IN | denotes | for |
T27699 | 5860-5869 | VBN | denotes | described |
T27698 | 5857-5859 | IN | denotes | as |
T27697 | 5849-5856 | VBN | denotes | treated |
T27696 | 5844-5848 | VBD | denotes | were |
T27695 | 5838-5843 | NNPS | denotes | Cells |
T27694 | 5830-5837 | NNP | denotes | qRT-PCR |
T27043 | 4593-4594 | . | denotes | . |
T27042 | 4592-4593 | -RRB- | denotes | ) |
T27041 | 4583-4592 | NN | denotes | viability |
T27040 | 4578-4582 | NN | denotes | cell |
T27039 | 4577-4578 | -LRB- | denotes | ( |
T27038 | 4574-4576 | NN | denotes | hr |
T27037 | 4571-4573 | CD | denotes | 24 |
T27036 | 4568-4570 | CC | denotes | or |
T27035 | 4566-4567 | -RRB- | denotes | ) |
T27034 | 4562-4566 | NN | denotes | blot |
T27033 | 4554-4561 | NNP | denotes | Western |
T27032 | 4551-4553 | CC | denotes | or |
T27031 | 4547-4550 | NNP | denotes | RNA |
T27030 | 4546-4547 | -LRB- | denotes | ( |
T27029 | 4543-4545 | NN | denotes | hr |
T27028 | 4541-4542 | CD | denotes | 9 |
T27027 | 4537-4540 | IN | denotes | for |
T27026 | 4532-4536 | NNP | denotes | TNFα |
T27025 | 4529-4531 | CC | denotes | or |
T27024 | 4520-4528 | NNP | denotes | zVAD.fmk |
T27023 | 4515-4519 | IN | denotes | with |
T27022 | 4507-4514 | VBN | denotes | treated |
T27021 | 4502-4506 | VBD | denotes | were |
T27020 | 4496-4501 | NNS | denotes | cells |
T27019 | 4494-4495 | , | denotes | , |
T27018 | 4492-4494 | NN | denotes | hr |
T27017 | 4489-4491 | CD | denotes | 72 |
T27016 | 4483-4488 | IN | denotes | After |
T27015 | 4481-4482 | . | denotes | . |
T27014 | 4466-4481 | NNS | denotes | recommendations |
T27013 | 4451-4463 | NN | denotes | manufacturer |
T27012 | 4448-4450 | TO | denotes | to |
T27011 | 4438-4447 | VBG | denotes | according |
T27010 | 4436-4437 | , | denotes | , |
T27009 | 4435-4436 | -RRB- | denotes | ) |
T27008 | 4425-4435 | NNP | denotes | Invitrogen |
T27007 | 4424-4425 | -LRB- | denotes | ( |
T27006 | 4416-4423 | NN | denotes | reagent |
T27005 | 4408-4415 | NNP | denotes | RNAiMAX |
T27004 | 4402-4407 | VBG | denotes | using |
T27003 | 4390-4401 | VBN | denotes | transfected |
T27002 | 4385-4389 | VBD | denotes | were |
T27001 | 4379-4384 | NN | denotes | siRNA |
T27000 | 4377-4378 | . | denotes | . |
T26999 | 4376-4377 | -RRB- | denotes | ) |
T26998 | 4365-4376 | NN | denotes | L-043776-00 |
T26997 | 4364-4365 | -LRB- | denotes | ( |
T26996 | 4360-4363 | NN | denotes | Jun |
T26995 | 4354-4359 | NN | denotes | mouse |
T26994 | 4352-4353 | , | denotes | , |
T26993 | 4351-4352 | -RRB- | denotes | ) |
T26992 | 4340-4351 | NNP | denotes | J-040134-05 |
T26991 | 4339-4340 | -LRB- | denotes | ( |
T26990 | 4333-4338 | NNP | denotes | Mapk9 |
T26989 | 4327-4332 | NN | denotes | mouse |
T26988 | 4325-4326 | , | denotes | , |
T26987 | 4324-4325 | -RRB- | denotes | ) |
T26986 | 4313-4324 | NNP | denotes | J-040128-05 |
T26985 | 4312-4313 | -LRB- | denotes | ( |
T26984 | 4306-4311 | NNP | denotes | Mapk8 |
T26983 | 4300-4305 | NN | denotes | mouse |
T26982 | 4298-4299 | , | denotes | , |
T26981 | 4297-4298 | -RRB- | denotes | ) |
T26980 | 4283-4297 | NNP | denotes | D-001810-10-05 |
T26979 | 4282-4283 | -LRB- | denotes | ( |
T26978 | 4274-4281 | NN | denotes | control |
T26977 | 4263-4273 | JJ | denotes | non-coding |
T26976 | 4261-4262 | , | denotes | , |
T26975 | 4260-4261 | -RRB- | denotes | ) |
T26974 | 4249-4260 | NNP | denotes | L-040658-00 |
T26973 | 4248-4249 | -LRB- | denotes | ( |
T26972 | 4243-4247 | NNP | denotes | PDK1 |
T26971 | 4237-4242 | NN | denotes | mouse |
T26970 | 4235-4236 | , | denotes | , |
T26969 | 4234-4235 | -RRB- | denotes | ) |
T26968 | 4223-4234 | NNP | denotes | L-065427-00 |
T26967 | 4222-4223 | -LRB- | denotes | ( |
T26966 | 4217-4221 | NNP | denotes | mTOR |
T26965 | 4211-4216 | NN | denotes | mouse |
T26964 | 4209-4210 | , | denotes | , |
T26963 | 4208-4209 | -RRB- | denotes | ) |
T26962 | 4197-4208 | NNP | denotes | L-040891-00 |
T26961 | 4196-4197 | -LRB- | denotes | ( |
T26960 | 4191-4195 | NNP | denotes | Akt3 |
T26959 | 4185-4190 | NN | denotes | mouse |
T26958 | 4183-4184 | , | denotes | , |
T26957 | 4182-4183 | -RRB- | denotes | ) |
T26956 | 4171-4182 | NNP | denotes | L-040782-00 |
T26955 | 4170-4171 | -LRB- | denotes | ( |
T26954 | 4165-4169 | NNP | denotes | Akt2 |
T26953 | 4159-4164 | NN | denotes | mouse |
T26952 | 4157-4158 | , | denotes | , |
T26951 | 4156-4157 | -RRB- | denotes | ) |
T26950 | 4145-4156 | NNP | denotes | L-040709-00 |
T26949 | 4144-4145 | -LRB- | denotes | ( |
T26948 | 4139-4143 | NNP | denotes | Akt1 |
T26947 | 4133-4138 | NN | denotes | mouse |
T26946 | 4131-4132 | , | denotes | , |
T26945 | 4130-4131 | -RRB- | denotes | ) |
T26944 | 4119-4130 | NN | denotes | L-045791-00 |
T26943 | 4115-4118 | CC | denotes | and |
T26942 | 4103-4114 | NN | denotes | L-040893-00 |
T26941 | 4102-4103 | -LRB- | denotes | ( |
T26940 | 4094-4101 | NN | denotes | protein |
T26939 | 4091-4093 | NNP | denotes | S6 |
T26938 | 4081-4090 | JJ | denotes | ribosomal |
T26937 | 4075-4080 | NNP | denotes | Mouse |
T26936 | 4073-4074 | . | denotes | . |
T26935 | 4064-4073 | NNP | denotes | Dharmacon |
T26934 | 4059-4063 | IN | denotes | from |
T27459 | 5024-5053 | NN | denotes | phenylmethanesulfonylfluoride |
T27458 | 5021-5023 | NN | denotes | ml |
T27457 | 5020-5021 | NN | denotes | / |
T27456 | 5018-5020 | NN | denotes | µg |
T27455 | 5015-5017 | CD | denotes | 50 |
T27454 | 5010-5014 | IN | denotes | with |
T27453 | 4997-5009 | VBN | denotes | supplemented |
T27452 | 4995-4996 | -RRB- | denotes | ) |
T27451 | 4986-4995 | NNP | denotes | Signaling |
T27450 | 4981-4985 | NNP | denotes | Cell |
T27449 | 4980-4981 | -LRB- | denotes | ( |
T27448 | 4973-4979 | NN | denotes | buffer |
T27447 | 4968-4972 | NNP | denotes | RIPA |
T27446 | 4967-4968 | CD | denotes | × |
T27445 | 4966-4967 | CD | denotes | 1 |
T27444 | 4963-4965 | IN | denotes | in |
T27443 | 4953-4962 | VBN | denotes | harvested |
T27442 | 4948-4952 | VBD | denotes | were |
T27441 | 4942-4947 | NNS | denotes | Cells |
T27440 | 4940-4941 | . | denotes | . |
T27439 | 4936-4940 | NNP | denotes | TNFα |
T27438 | 4930-4935 | NN | denotes | mouse |
T27437 | 4924-4929 | JJ | denotes | ng/ml |
T27436 | 4921-4923 | CD | denotes | 10 |
T27435 | 4918-4920 | CC | denotes | or |
T27434 | 4909-4917 | NNP | denotes | zVAD.fmk |
T27433 | 4906-4908 | NNP | denotes | µM |
T27432 | 4903-4905 | CD | denotes | 20 |
T27431 | 4901-4902 | , | denotes | , |
T27430 | 4894-4901 | NNS | denotes | factors |
T27429 | 4887-4893 | NN | denotes | growth |
T27428 | 4884-4886 | IN | denotes | of |
T27427 | 4875-4883 | NN | denotes | addition |
T27426 | 4871-4874 | DT | denotes | the |
T27425 | 4868-4870 | TO | denotes | to |
T27424 | 4862-4867 | RB | denotes | prior |
T27423 | 4859-4861 | NN | denotes | hr |
T27422 | 4856-4858 | CD | denotes | 24 |
T27421 | 4852-4855 | IN | denotes | for |
T27420 | 4844-4851 | VBN | denotes | starved |
T27419 | 4838-4843 | JJ | denotes | serum |
T27418 | 4833-4837 | VBD | denotes | were |
T27417 | 4827-4832 | NNS | denotes | cells |
T27416 | 4825-4826 | , | denotes | , |
T27415 | 4815-4825 | NNS | denotes | conditions |
T27414 | 4810-4814 | JJ | denotes | free |
T27413 | 4804-4809 | NN | denotes | serum |
T27412 | 4798-4803 | IN | denotes | under |
T27411 | 4787-4797 | NNS | denotes | treatments |
T27410 | 4783-4786 | IN | denotes | For |
T27409 | 4781-4782 | . | denotes | . |
T27408 | 4777-4781 | NNP | denotes | TNFα |
T27407 | 4771-4776 | NN | denotes | mouse |
T27406 | 4765-4770 | JJ | denotes | ng/ml |
T27405 | 4762-4764 | CD | denotes | 10 |
T27404 | 4759-4761 | CC | denotes | or |
T27403 | 4750-4758 | NNP | denotes | zVAD.fmk |
T27402 | 4747-4749 | NNP | denotes | µM |
T27401 | 4744-4746 | CD | denotes | 30 |
T27400 | 4739-4743 | IN | denotes | with |
T27399 | 4728-4738 | VBN | denotes | stimulated |
T27398 | 4723-4727 | VBD | denotes | were |
T27397 | 4717-4722 | NNS | denotes | cells |
T27396 | 4715-4716 | , | denotes | , |
T27395 | 4713-4715 | NN | denotes | hr |
T27394 | 4710-4712 | CD | denotes | 48 |
T27393 | 4707-4709 | CD | denotes | 24 |
T27392 | 4701-4706 | IN | denotes | After |
T27391 | 4699-4700 | . | denotes | . |
T27390 | 4693-4699 | NNS | denotes | dishes |
T27389 | 4689-4692 | CD | denotes | mm2 |
T27388 | 4686-4688 | CD | denotes | 35 |
T27387 | 4681-4685 | IN | denotes | into |
T27386 | 4674-4680 | VBN | denotes | seeded |
T27385 | 4669-4673 | VBD | denotes | were |
T27384 | 4667-4668 | -RRB- | denotes | ) |
T27383 | 4662-4667 | NNS | denotes | cells |
T27382 | 4655-4661 | NN | denotes | Jurkat |
T27381 | 4651-4654 | CD | denotes | 106 |
T27380 | 4650-4651 | CD | denotes | × |
T27379 | 4649-4650 | CD | denotes | 1 |
T27378 | 4648-4649 | -LRB- | denotes | ( |
T27377 | 4642-4647 | NNS | denotes | cells |
T27376 | 4633-4641 | JJ | denotes | adherent |
T27375 | 4629-4632 | CD | denotes | 105 |
T27374 | 4628-4629 | CD | denotes | × |
T27373 | 4627-4628 | CD | denotes | 4 |
T27372 | 4625-4626 | , | denotes | , |
T27371 | 4621-4625 | NN | denotes | blot |
T27370 | 4613-4620 | JJ | denotes | Western |
T27369 | 4609-4612 | IN | denotes | For |
T27368 | 4604-4608 | NN | denotes | Blot |
T27367 | 4596-4603 | JJ | denotes | Western |
T26933 | 4049-4058 | VBN | denotes | purchased |
T26932 | 4044-4048 | VBD | denotes | were |
T26931 | 4037-4043 | NNPS | denotes | siRNAs |
T26930 | 4027-4036 | NNP | denotes | Knockdown |
T26929 | 4021-4026 | NNP | denotes | siRNA |
T26682 | 4009-4018 | NNS | denotes | molecules |
T26681 | 4003-4008 | JJ | denotes | small |
T26680 | 3999-4002 | DT | denotes | the |
T26679 | 3996-3998 | IN | denotes | of |
T26678 | 3987-3995 | NN | denotes | toxicity |
T26677 | 3974-3986 | JJ | denotes | non-specific |
T26676 | 3971-3973 | IN | denotes | of |
T26675 | 3963-3970 | NNS | denotes | effects |
T26674 | 3954-3962 | JJ | denotes | possible |
T26673 | 3950-3953 | DT | denotes | the |
T26672 | 3942-3949 | VB | denotes | exclude |
T26671 | 3939-3941 | TO | denotes | to |
T26670 | 3931-3938 | VBN | denotes | plotted |
T26669 | 3927-3930 | CC | denotes | and |
T26668 | 3916-3926 | VBN | denotes | determined |
T26667 | 3912-3915 | VBD | denotes | was |
T26666 | 3910-3911 | , | denotes | , |
T26665 | 3905-3910 | NNS | denotes | cells |
T26664 | 3888-3904 | JJ | denotes | compound-treated |
T26663 | 3880-3887 | NN | denotes | control |
T26662 | 3876-3879 | DT | denotes | the |
T26661 | 3873-3875 | TO | denotes | to |
T26660 | 3864-3872 | JJ | denotes | relative |
T26659 | 3855-3863 | NN | denotes | compound |
T26658 | 3851-3854 | DT | denotes | the |
T26657 | 3846-3850 | IN | denotes | with |
T26656 | 3838-3845 | VBN | denotes | treated |
T26655 | 3834-3837 | CC | denotes | and |
T26654 | 3822-3833 | NN | denotes | necroptosis |
T26653 | 3814-3821 | VB | denotes | undergo |
T26652 | 3811-3813 | TO | denotes | to |
T26651 | 3803-3810 | VBD | denotes | induced |
T26650 | 3801-3802 | , | denotes | , |
T26649 | 3796-3801 | NNS | denotes | cells |
T26648 | 3793-3795 | IN | denotes | of |
T26647 | 3783-3792 | NN | denotes | viability |
T26646 | 3774-3782 | JJ | denotes | Relative |
T26645 | 3772-3773 | . | denotes | . |
T26644 | 3771-3772 | NN | denotes | % |
T26643 | 3768-3771 | CD | denotes | 100 |
T26166 | 2710-2711 | . | denotes | . |
T26165 | 2709-2710 | NN | denotes | ′ |
T26164 | 2687-2709 | NN | denotes | TAGTAGCGACGGGCGGTGTG-3 |
T26163 | 2686-2687 | : | denotes | - |
T26162 | 2685-2686 | SYM | denotes | ′ |
T26161 | 2684-2685 | CD | denotes | 5 |
T26160 | 2676-2683 | VB | denotes | reverse |
T26159 | 2674-2675 | : | denotes | : |
T26158 | 2671-2674 | NNS | denotes | 18S |
T26157 | 2665-2670 | JJ | denotes | human |
T26156 | 2663-2664 | , | denotes | , |
T26155 | 2661-2663 | CD | denotes | -3 |
T26154 | 2640-2660 | NNP | denotes | CAGCCACCCGAGATTGAGCA |
T26153 | 2638-2639 | : | denotes | - |
T26152 | 2637-2638 | SYM | denotes | ′ |
T26151 | 2636-2637 | CD | denotes | 5 |
T26150 | 2628-2635 | RB | denotes | forward |
T26149 | 2626-2627 | : | denotes | : |
T26148 | 2623-2626 | NNS | denotes | 18S |
T26147 | 2617-2622 | JJ | denotes | human |
T26146 | 2615-2616 | : | denotes | ; |
T26145 | 2614-2615 | NN | denotes | ′ |
T26144 | 2590-2614 | NN | denotes | GAGGGCTGATTAGAGAGAGGTC-3 |
T26143 | 2589-2590 | : | denotes | - |
T26142 | 2588-2589 | SYM | denotes | ′ |
T26141 | 2587-2588 | CD | denotes | 5 |
T26140 | 2579-2586 | VB | denotes | reverse |
T26139 | 2577-2578 | : | denotes | : |
T26138 | 2573-2577 | NNP | denotes | TNFα |
T26137 | 2567-2572 | JJ | denotes | human |
T26136 | 2565-2566 | , | denotes | , |
T26135 | 2564-2565 | NN | denotes | ′ |
T26134 | 2540-2564 | NN | denotes | ATGAGCACTGAAAGCATGATCC-3 |
T26133 | 2538-2539 | : | denotes | - |
T26132 | 2537-2538 | SYM | denotes | ′ |
T26131 | 2536-2537 | CD | denotes | 5 |
T26130 | 2528-2535 | RB | denotes | forward |
T26129 | 2526-2527 | : | denotes | : |
T26128 | 2522-2526 | NNP | denotes | TNFα |
T26127 | 2516-2521 | JJ | denotes | human |
T26126 | 2515-2516 | : | denotes | ; |
T26125 | 2514-2515 | NN | denotes | ′ |
T26124 | 2488-2514 | NN | denotes | CTAAACCATCCAATCGGTAGTAGC-3 |
T26123 | 2487-2488 | : | denotes | - |
T26122 | 2486-2487 | SYM | denotes | ′ |
T26121 | 2485-2486 | CD | denotes | 5 |
T26120 | 2477-2484 | VB | denotes | reverse |
T26119 | 2475-2476 | , | denotes | , |
T26118 | 2449-2475 | NN | denotes | ATAACAGGTCTGTGATGCCCTTAG-3 |
T26117 | 2447-2448 | NN | denotes | ′ |
T26116 | 2446-2447 | : | denotes | - |
T26115 | 2445-2446 | LS | denotes | 5 |
T26114 | 2437-2444 | RB | denotes | forward |
T26113 | 2435-2436 | : | denotes | : |
T26112 | 2432-2435 | NNS | denotes | 18S |
T26111 | 2426-2431 | NN | denotes | mouse |
T26110 | 2425-2426 | : | denotes | ; |
T26109 | 2424-2425 | NN | denotes | ′ |
T26108 | 2403-2424 | NN | denotes | GCTACGACGTGGGCTACAG-3 |
T26107 | 2402-2403 | : | denotes | - |
T26106 | 2401-2402 | SYM | denotes | ′ |
T26105 | 2400-2401 | CD | denotes | 5 |
T26104 | 2392-2399 | VB | denotes | reverse |
T26103 | 2390-2391 | , | denotes | , |
T26102 | 2389-2390 | NN | denotes | ′ |
T26101 | 2364-2389 | NN | denotes | CCCTCACACTCAGATCATCTTCT-3 |
T26100 | 2363-2364 | : | denotes | - |
T26099 | 2362-2363 | SYM | denotes | ′ |
T26098 | 2361-2362 | CD | denotes | 5 |
T26097 | 2353-2360 | RB | denotes | forward |
T26096 | 2351-2352 | : | denotes | : |
T26095 | 2347-2351 | NNP | denotes | TNFα |
T26094 | 2341-2346 | NNP | denotes | Mouse |
T26093 | 2333-2340 | NNPS | denotes | Primers |
T26092 | 2328-2332 | NNP | denotes | QPCR |
T25873 | 1920-1923 | NNP | denotes | pAb |
T25872 | 1913-1919 | NN | denotes | rabbit |
T25871 | 1911-1912 | -RRB- | denotes | ) |
T25870 | 1905-1911 | NNP | denotes | Ser193 |
T25869 | 1904-1905 | -LRB- | denotes | ( |
T25868 | 1890-1903 | NNP | denotes | phospho-FoxO4 |
T25867 | 1888-1889 | , | denotes | , |
T25866 | 1885-1888 | NNP | denotes | pAb |
T25865 | 1878-1884 | NN | denotes | rabbit |
T25864 | 1876-1877 | -RRB- | denotes | ) |
T25863 | 1873-1876 | NNP | denotes | L27 |
T25862 | 1872-1873 | -LRB- | denotes | ( |
T25861 | 1866-1871 | NNP | denotes | FoxO1 |
T25860 | 1864-1865 | , | denotes | , |
T25859 | 1861-1864 | NNP | denotes | pAb |
T25858 | 1854-1860 | NN | denotes | rabbit |
T25857 | 1852-1853 | -RRB- | denotes | ) |
T25856 | 1847-1852 | CD | denotes | Thr32 |
T25855 | 1846-1847 | -LRB- | denotes | ( |
T25854 | 1839-1845 | NNS | denotes | FoxO3a |
T25853 | 1838-1839 | VBP | denotes | / |
T25852 | 1837-1838 | -RRB- | denotes | ) |
T25851 | 1832-1837 | NNP | denotes | Thr24 |
T25850 | 1831-1832 | -LRB- | denotes | ( |
T25849 | 1817-1830 | NNP | denotes | phospho-FoxO1 |
T25848 | 1815-1816 | , | denotes | , |
T25847 | 1812-1815 | NNP | denotes | mAb |
T25846 | 1806-1811 | NN | denotes | mouse |
T25845 | 1804-1805 | -RRB- | denotes | ) |
T25844 | 1800-1804 | NNP | denotes | DM1A |
T25843 | 1794-1799 | JJ | denotes | clone |
T25842 | 1793-1794 | -LRB- | denotes | ( |
T25841 | 1783-1792 | JJ | denotes | α-tubulin |
T25840 | 1781-1782 | , | denotes | , |
T25839 | 1778-1781 | NNP | denotes | mAb |
T25838 | 1771-1777 | NN | denotes | rabbit |
T25837 | 1769-1770 | -RRB- | denotes | ) |
T25836 | 1765-1769 | NNP | denotes | 60A8 |
T25835 | 1764-1765 | -LRB- | denotes | ( |
T25834 | 1758-1763 | NNP | denotes | c-Jun |
T25833 | 1756-1757 | , | denotes | , |
T25832 | 1753-1756 | NNP | denotes | pAb |
T25831 | 1746-1752 | NN | denotes | rabbit |
T25830 | 1743-1745 | NNP | denotes | II |
T25829 | 1741-1742 | -RRB- | denotes | ) |
T25828 | 1736-1741 | NNP | denotes | Ser63 |
T25827 | 1735-1736 | -LRB- | denotes | ( |
T25826 | 1721-1734 | NNP | denotes | phospho-c-Jun |
T25825 | 1719-1720 | , | denotes | , |
T25824 | 1716-1719 | NNP | denotes | pAb |
T25823 | 1709-1715 | NN | denotes | rabbit |
T25822 | 1700-1708 | NNP | denotes | SAPK/JNK |
T25821 | 1698-1699 | , | denotes | , |
T25820 | 1695-1698 | NNP | denotes | mAb |
T25819 | 1688-1694 | NN | denotes | rabbit |
T25818 | 1686-1687 | -RRB- | denotes | ) |
T25817 | 1681-1686 | CD | denotes | 81E11 |
T25816 | 1680-1681 | -LRB- | denotes | ( |
T25815 | 1678-1679 | -RRB- | denotes | ) |
T25814 | 1665-1678 | NNP | denotes | Thr183/Tyr185 |
T25813 | 1664-1665 | -LRB- | denotes | ( |
T25812 | 1652-1663 | NNP | denotes | phospho-JNK |
T25811 | 1650-1651 | , | denotes | , |
T25810 | 1647-1650 | NNP | denotes | mAb |
T25809 | 1640-1646 | NN | denotes | rabbit |
T25808 | 1638-1639 | -RRB- | denotes | ) |
T25807 | 1634-1638 | NNP | denotes | 62A8 |
T25806 | 1628-1633 | VBN | denotes | clone |
T25805 | 1627-1628 | -LRB- | denotes | ( |
T25804 | 1622-1626 | NNP | denotes | Akt3 |
T25803 | 1620-1621 | , | denotes | , |
T25802 | 1617-1620 | NNP | denotes | mAb |
T25801 | 1610-1616 | NN | denotes | rabbit |
T25800 | 1608-1609 | -RRB- | denotes | ) |
T25799 | 1604-1608 | NNP | denotes | D6G4 |
T25798 | 1598-1603 | VBN | denotes | clone |
T25797 | 1597-1598 | -LRB- | denotes | ( |
T25796 | 1592-1596 | NNP | denotes | Akt2 |
T25795 | 1590-1591 | , | denotes | , |
T25794 | 1587-1590 | NNP | denotes | mAb |
T25793 | 1580-1586 | NN | denotes | rabbit |
T25792 | 1578-1579 | -RRB- | denotes | ) |
T25791 | 1572-1578 | NNP | denotes | C73H10 |
T25790 | 1566-1571 | VBP | denotes | clone |
T25789 | 1565-1566 | -LRB- | denotes | ( |
T25788 | 1560-1564 | NNP | denotes | Akt1 |
T25787 | 1558-1559 | , | denotes | , |
T25786 | 1555-1558 | NNP | denotes | mAb |
T25785 | 1548-1554 | NN | denotes | rabbit |
T25784 | 1546-1547 | -RRB- | denotes | ) |
T25783 | 1541-1546 | NNP | denotes | C67E7 |
T25782 | 1535-1540 | JJ | denotes | clone |
T25781 | 1534-1535 | -LRB- | denotes | ( |
T25780 | 1532-1533 | -RRB- | denotes | ) |
T25779 | 1529-1532 | VB | denotes | pan |
T25778 | 1528-1529 | -LRB- | denotes | ( |
T25777 | 1524-1527 | NNP | denotes | Akt |
T25776 | 1522-1523 | , | denotes | , |
T25775 | 1519-1522 | NNP | denotes | mAb |
T25774 | 1512-1518 | NN | denotes | rabbit |
T25773 | 1509-1511 | NNP | denotes | XP |
T25772 | 1507-1508 | -RRB- | denotes | ) |
T25771 | 1504-1507 | NNP | denotes | D9E |
T25770 | 1498-1503 | JJ | denotes | clone |
T25769 | 1497-1498 | -LRB- | denotes | ( |
T25768 | 1495-1496 | -RRB- | denotes | ) |
T25767 | 1489-1495 | NNP | denotes | Ser473 |
T25766 | 1488-1489 | -LRB- | denotes | ( |
T25765 | 1476-1487 | NNP | denotes | phospho-Akt |
T25764 | 1474-1475 | , | denotes | , |
T25763 | 1471-1474 | NNP | denotes | mAb |
T25762 | 1464-1470 | NN | denotes | rabbit |
T25761 | 1462-1463 | -RRB- | denotes | ) |
T25760 | 1456-1462 | NNP | denotes | C31E5E |
T25759 | 1450-1455 | JJ | denotes | clone |
T25758 | 1449-1450 | -LRB- | denotes | ( |
T25757 | 1447-1448 | -RRB- | denotes | ) |
T25756 | 1441-1447 | CD | denotes | Thr308 |
T25755 | 1440-1441 | -LRB- | denotes | ( |
T25754 | 1428-1439 | JJ | denotes | phospho-Akt |
T25753 | 1426-1427 | : | denotes | : |
T25752 | 1422-1426 | VBN | denotes | used |
T25751 | 1417-1421 | VBD | denotes | were |
T25750 | 1406-1416 | NNS | denotes | antibodies |
T25749 | 1396-1405 | VBG | denotes | following |
T25748 | 1392-1395 | DT | denotes | The |
T25747 | 1381-1391 | NNPS | denotes | Antibodies |
T25719 | 1378-1379 | . | denotes | . |
T25718 | 1370-1378 | NN | denotes | strategy |
T25717 | 1365-1369 | JJ | denotes | same |
T25716 | 1361-1364 | DT | denotes | the |
T25715 | 1355-1360 | VBG | denotes | using |
T25714 | 1345-1354 | VBN | denotes | generated |
T25713 | 1340-1344 | VBD | denotes | were |
T25712 | 1331-1339 | NN | denotes | Myr-Akt1 |
T25711 | 1328-1330 | IN | denotes | of |
T25710 | 1319-1327 | NNS | denotes | versions |
T25709 | 1312-1318 | JJ | denotes | Mutant |
T25708 | 1310-1311 | . | denotes | . |
T25707 | 1309-1310 | -RRB- | denotes | ) |
T25706 | 1299-1309 | NNP | denotes | Invitrogen |
T25705 | 1298-1299 | -LRB- | denotes | ( |
T25704 | 1291-1297 | NN | denotes | vector |
T25703 | 1280-1290 | NN | denotes | retroviral |
T25702 | 1269-1279 | NN | denotes | pMSCV-puro |
T25701 | 1266-1268 | IN | denotes | of |
T25700 | 1260-1265 | NNS | denotes | sites |
T25699 | 1254-1259 | NNP | denotes | EcoRI |
T25698 | 1250-1253 | CC | denotes | and |
T25697 | 1244-1249 | NNP | denotes | BglII |
T25696 | 1240-1243 | DT | denotes | the |
T25695 | 1235-1239 | IN | denotes | into |
T25694 | 1225-1234 | VBN | denotes | subcloned |
T25693 | 1221-1224 | CC | denotes | and |
T25692 | 1217-1220 | NNP | denotes | PCR |
T25691 | 1214-1216 | IN | denotes | by |
T25690 | 1204-1213 | VBN | denotes | amplified |
T25689 | 1200-1203 | VBD | denotes | was |
T25688 | 1186-1199 | NN | denotes | Myr-Akt1-FLAG |
T25687 | 1184-1185 | . | denotes | . |
T25686 | 1183-1184 | NNP | denotes | ] |
T25685 | 1181-1183 | CD | denotes | 52 |
T25684 | 1180-1181 | NNP | denotes | [ |
T26630 | 3691-3700 | VBP | denotes | duplicate |
T26629 | 3688-3690 | IN | denotes | in |
T26628 | 3678-3687 | VBN | denotes | performed |
T26627 | 3673-3677 | VBD | denotes | were |
T26626 | 3661-3672 | NNS | denotes | Experiments |
T26625 | 3659-3660 | . | denotes | . |
T26624 | 3658-3659 | -RRB- | denotes | ) |
T26623 | 3651-3658 | NNP | denotes | Promega |
T26622 | 3650-3651 | -LRB- | denotes | ( |
T26621 | 3644-3649 | NNP | denotes | Assay |
T26620 | 3634-3643 | NNP | denotes | Viability |
T26619 | 3629-3633 | NNP | denotes | Cell |
T26618 | 3615-3628 | NNP | denotes | CellTiter-Glo |
T26617 | 3609-3614 | VBG | denotes | using |
T26616 | 3598-3608 | VBN | denotes | determined |
T26615 | 3594-3597 | VBD | denotes | was |
T26614 | 3584-3593 | NN | denotes | viability |
T26613 | 3579-3583 | NNP | denotes | Cell |
T26612 | 3577-3578 | . | denotes | . |
T26611 | 3566-3577 | NNS | denotes | experiments |
T26610 | 3561-3565 | NN | denotes | blot |
T26609 | 3553-3560 | JJ | denotes | western |
T26608 | 3549-3552 | IN | denotes | for |
T26607 | 3539-3548 | VBN | denotes | described |
T26606 | 3536-3538 | IN | denotes | as |
T26605 | 3528-3535 | VBN | denotes | treated |
T26604 | 3524-3527 | CC | denotes | and |
T26603 | 3513-3523 | NN | denotes | cells/well |
T26602 | 3509-3512 | CD | denotes | 104 |
T26601 | 3508-3509 | CD | denotes | × |
T26600 | 3507-3508 | CD | denotes | 1 |
T26599 | 3504-3506 | IN | denotes | of |
T26598 | 3496-3503 | NN | denotes | density |
T26597 | 3492-3495 | DT | denotes | the |
T26596 | 3489-3491 | IN | denotes | at |
T26595 | 3482-3488 | VBZ | denotes | plates |
T26594 | 3477-3481 | RB | denotes | well |
T26593 | 3474-3476 | CD | denotes | 96 |
T26592 | 3467-3473 | NN | denotes | bottom |
T26591 | 3461-3466 | JJ | denotes | clear |
T26590 | 3455-3460 | JJ | denotes | white |
T26589 | 3450-3454 | IN | denotes | into |
T26588 | 3443-3449 | VBN | denotes | seeded |
T26587 | 3438-3442 | VBD | denotes | were |
T26586 | 3432-3437 | NNS | denotes | Cells |
T26585 | 3420-3431 | NNS | denotes | Experiments |
T26584 | 3410-3419 | NNP | denotes | Viability |
T26583 | 3405-3409 | NNP | denotes | Cell |
T26434 | 3262-3267 | NNS | denotes | acids |
T26433 | 3256-3261 | JJ | denotes | amino |
T26432 | 3242-3255 | JJ | denotes | non-essential |
T26431 | 3240-3241 | , | denotes | , |
T26430 | 3229-3240 | NN | denotes | L-glutamine |
T26429 | 3224-3228 | IN | denotes | with |
T26428 | 3211-3223 | VBN | denotes | supplemented |
T26427 | 3198-3210 | RB | denotes | additionally |
T26426 | 3194-3197 | VBD | denotes | was |
T26425 | 3188-3193 | NNS | denotes | media |
T26424 | 3177-3187 | NN | denotes | fibroblast |
T26423 | 3172-3176 | NN | denotes | lung |
T26422 | 3166-3171 | NN | denotes | mouse |
T26421 | 3162-3165 | DT | denotes | The |
T26420 | 3160-3161 | . | denotes | . |
T26419 | 3159-3160 | -RRB- | denotes | ) |
T26418 | 3149-3159 | NNP | denotes | Invitrogen |
T26417 | 3148-3149 | -LRB- | denotes | ( |
T26416 | 3140-3147 | NN | denotes | mixture |
T26415 | 3117-3139 | JJ | denotes | antibiotic-antimycotic |
T26383 | 2955-2956 | -LRB- | denotes | ( |
T26382 | 2950-2954 | NNP | denotes | Yuan |
T26381 | 2942-2949 | NNP | denotes | Junying |
T26380 | 2939-2941 | IN | denotes | of |
T26379 | 2933-2938 | NNS | denotes | gifts |
T26378 | 2924-2932 | JJ | denotes | generous |
T26377 | 2919-2923 | VBD | denotes | were |
T26376 | 2913-2918 | NNS | denotes | cells |
T26375 | 2911-2912 | -RRB- | denotes | ) |
T26374 | 2907-2911 | NNP | denotes | ATCC |
T26373 | 2906-2907 | -LRB- | denotes | ( |
T26354 | 2831-2837 | NNP | denotes | Philip |
T26353 | 2827-2830 | NNP | denotes | Dr. |
T26352 | 2824-2826 | IN | denotes | of |
T26351 | 2819-2823 | NN | denotes | gift |
T26350 | 2810-2818 | JJ | denotes | generous |
T26349 | 2808-2809 | DT | denotes | a |
T26348 | 2803-2807 | VBD | denotes | were |
T26347 | 2791-2802 | NNS | denotes | fibroblasts |
T26346 | 2786-2790 | NNP | denotes | Lung |
T26345 | 2784-2785 | . | denotes | . |
T26344 | 2780-2784 | NNP | denotes | ATCC |
T26343 | 2775-2779 | IN | denotes | from |
T26342 | 2766-2774 | VBN | denotes | obtained |
T26341 | 2761-2765 | VBD | denotes | were |
T26340 | 2755-2760 | NNS | denotes | cells |
T26339 | 2748-2754 | NNP | denotes | Jurkat |
T26338 | 2733-2747 | NNP | denotes | FADD-deficient |
T26337 | 2729-2732 | CC | denotes | and |
T26336 | 2724-2728 | NNP | denotes | L929 |
T26335 | 2718-2723 | NNP | denotes | Lines |
T26334 | 2713-2717 | NNP | denotes | Cell |
T26642 | 3765-3767 | IN | denotes | as |
T26641 | 3761-3764 | VBN | denotes | set |
T26640 | 3757-3760 | VBD | denotes | was |
T26639 | 3751-3756 | NNS | denotes | cells |
T26638 | 3741-3750 | JJ | denotes | untreated |
T26637 | 3733-3740 | NN | denotes | control |
T26636 | 3729-3732 | DT | denotes | the |
T26635 | 3726-3728 | IN | denotes | of |
T26634 | 3716-3725 | NN | denotes | Viability |
T26633 | 3714-3715 | . | denotes | . |
T26632 | 3704-3714 | VBP | denotes | triplicate |
T26631 | 3701-3703 | CC | denotes | or |
T25683 | 1170-1179 | VBN | denotes | described |
T25682 | 1165-1169 | VBN | denotes | been |
T25681 | 1161-1164 | VBZ | denotes | has |
T25680 | 1159-1160 | , | denotes | , |
T25679 | 1156-1159 | NN | denotes | tag |
T25678 | 1151-1155 | NNP | denotes | FLAG |
T25677 | 1140-1150 | JJ | denotes | c-terminal |
T25485 | 949-954 | JJ | denotes | human |
T25484 | 947-948 | , | denotes | , |
T25483 | 946-947 | -RRB- | denotes | ) |
T25482 | 941-946 | NN | denotes | ng/ml |
T25481 | 938-940 | CD | denotes | 10 |
T25480 | 937-938 | -LRB- | denotes | ( |
T25479 | 932-936 | NNP | denotes | TNFα |
T25478 | 926-931 | NN | denotes | mouse |
T25477 | 922-925 | CC | denotes | and |
T25476 | 916-921 | NNP | denotes | Human |
T25475 | 914-915 | . | denotes | . |
T25474 | 908-914 | NNP | denotes | Bachem |
T25473 | 903-907 | IN | denotes | from |
T25472 | 893-902 | VBN | denotes | purchased |
T25471 | 889-892 | VBD | denotes | was |
T25470 | 887-888 | -RRB- | denotes | ) |
T25469 | 885-887 | NNP | denotes | µM |
T25468 | 882-884 | CD | denotes | 30 |
T25467 | 879-881 | CD | denotes | 20 |
T25466 | 878-879 | -LRB- | denotes | ( |
T25465 | 869-877 | NNP | denotes | zVAD.fmk |
T25464 | 859-868 | NN | denotes | inhibitor |
T25463 | 847-858 | NN | denotes | Pan-caspase |
T25462 | 845-846 | . | denotes | . |
T25461 | 844-845 | -RRB- | denotes | ) |
T25460 | 834-844 | NNP | denotes | Calbiochem |
T25459 | 832-833 | , | denotes | , |
T25458 | 830-832 | NNP | denotes | µM |
T25457 | 827-829 | CD | denotes | 50 |
T25456 | 826-827 | -LRB- | denotes | ( |
T25455 | 819-825 | NNP | denotes | 4EGI-1 |
T25454 | 817-818 | , | denotes | , |
T25453 | 816-817 | -RRB- | denotes | ) |
T25452 | 806-816 | NNP | denotes | Calbiochem |
T25451 | 804-805 | , | denotes | , |
T25450 | 802-804 | NNP | denotes | µM |
T25449 | 799-801 | CD | denotes | 20 |
T25448 | 798-799 | -LRB- | denotes | ( |
T25447 | 789-797 | NNP | denotes | PD166866 |
T25446 | 787-788 | , | denotes | , |
T25445 | 786-787 | -RRB- | denotes | ) |
T25444 | 782-786 | NNP | denotes | Chem |
T25443 | 775-781 | NNP | denotes | Cayman |
T25442 | 773-774 | , | denotes | , |
T25441 | 771-773 | NNP | denotes | µM |
T25440 | 769-770 | CD | denotes | 2 |
T25439 | 768-769 | -LRB- | denotes | ( |
T25438 | 759-767 | NNP | denotes | PD173074 |
T25437 | 757-758 | , | denotes | , |
T25436 | 756-757 | -RRB- | denotes | ) |
T25435 | 747-756 | NNP | denotes | Signaling |
T25434 | 742-746 | NNP | denotes | Cell |
T25433 | 740-741 | , | denotes | , |
T25432 | 738-740 | NNP | denotes | µM |
T25431 | 735-737 | CD | denotes | 10 |
T25430 | 734-735 | -LRB- | denotes | ( |
T25429 | 725-733 | NNP | denotes | LY249002 |
T25428 | 723-724 | , | denotes | , |
T25427 | 722-723 | -RRB- | denotes | ) |
T25426 | 716-722 | NNP | denotes | School |
T25425 | 708-715 | NNP | denotes | Medical |
T25424 | 700-707 | NNP | denotes | Harvard |
T25423 | 699-700 | -LRB- | denotes | ( |
T25422 | 694-698 | NNP | denotes | Grey |
T25421 | 684-693 | NNP | denotes | Nathanael |
T25420 | 680-683 | NNP | denotes | Dr. |
T25419 | 677-679 | IN | denotes | of |
T25418 | 672-676 | NN | denotes | gift |
T25417 | 670-671 | , | denotes | , |
T25416 | 668-670 | NNP | denotes | nM |
T25415 | 664-667 | CD | denotes | 500 |
T25414 | 663-664 | -LRB- | denotes | ( |
T25413 | 655-662 | NNP | denotes | Torin-1 |
T25412 | 653-654 | , | denotes | , |
T25411 | 652-653 | -RRB- | denotes | ) |
T25410 | 642-652 | NNP | denotes | Calbiochem |
T25409 | 640-641 | , | denotes | , |
T25408 | 638-640 | NNP | denotes | µM |
T25407 | 635-637 | CD | denotes | 10 |
T25406 | 634-635 | -LRB- | denotes | ( |
T25405 | 627-633 | NN | denotes | PI-103 |
T25404 | 625-626 | , | denotes | , |
T25403 | 624-625 | -RRB- | denotes | ) |
T25402 | 620-624 | NNP | denotes | Cruz |
T25401 | 614-619 | NNP | denotes | Santa |
T25400 | 612-613 | , | denotes | , |
T25399 | 610-612 | NNP | denotes | nM |
T25398 | 606-609 | CD | denotes | 100 |
T25397 | 605-606 | -LRB- | denotes | ( |
T25396 | 595-604 | NN | denotes | rapamycin |
T25395 | 593-594 | , | denotes | , |
T25394 | 592-593 | -RRB- | denotes | ) |
T25393 | 587-592 | NNP | denotes | Sigma |
T25392 | 586-587 | -LRB- | denotes | ( |
T25391 | 575-585 | NNP | denotes | PF-4706871 |
T25390 | 573-574 | , | denotes | , |
T25389 | 572-573 | -RRB- | denotes | ) |
T25388 | 568-572 | NNP | denotes | Chem |
T25387 | 564-567 | NNP | denotes | Med |
T25386 | 559-563 | NNP | denotes | Axon |
T25385 | 557-558 | , | denotes | , |
T25384 | 555-557 | NNP | denotes | µM |
T26414 | 3115-3116 | NN | denotes | % |
T26413 | 3114-3115 | CD | denotes | 1 |
T26412 | 3110-3113 | CC | denotes | and |
T26411 | 3108-3109 | -RRB- | denotes | ) |
T26410 | 3105-3108 | NNP | denotes | FBS |
T26409 | 3104-3105 | -LRB- | denotes | ( |
T26408 | 3098-3103 | NN | denotes | serum |
T26407 | 3091-3097 | JJ | denotes | bovine |
T26406 | 3085-3090 | JJ | denotes | fetal |
T26405 | 3083-3084 | NN | denotes | % |
T26404 | 3081-3083 | CD | denotes | 10 |
T26403 | 3076-3080 | IN | denotes | with |
T26402 | 3063-3075 | VBN | denotes | supplemented |
T26401 | 3058-3062 | NNP | denotes | DMEM |
T26400 | 3055-3057 | IN | denotes | in |
T26399 | 3044-3054 | VBN | denotes | maintained |
T26398 | 3039-3043 | VBD | denotes | were |
T26397 | 3033-3038 | NNS | denotes | Cells |
T26396 | 3031-3032 | . | denotes | . |
T26395 | 3019-3031 | RB | denotes | respectively |
T26394 | 3017-3018 | , | denotes | , |
T26393 | 3016-3017 | -RRB- | denotes | ) |
T26392 | 3006-3016 | NNP | denotes | University |
T26391 | 3000-3005 | NNP | denotes | Tufts |
T26390 | 2999-3000 | -LRB- | denotes | ( |
T26389 | 2990-2998 | NNP | denotes | Poltorak |
T26388 | 2980-2989 | NNP | denotes | Alexander |
T26387 | 2976-2979 | CC | denotes | and |
T26386 | 2974-2975 | -RRB- | denotes | ) |
T26385 | 2964-2974 | NNP | denotes | University |
T26384 | 2956-2963 | NNP | denotes | Harvard |
T25964 | 2325-2326 | . | denotes | . |
T25963 | 2324-2325 | -RRB- | denotes | ) |
T25962 | 2315-2324 | NNP | denotes | Bioworlde |
T25961 | 2314-2315 | -LRB- | denotes | ( |
T25960 | 2310-2313 | NNP | denotes | pAb |
T25959 | 2303-2309 | NN | denotes | rabbit |
T25958 | 2298-2302 | NNP | denotes | MDM2 |
T25957 | 2296-2297 | , | denotes | , |
T25956 | 2295-2296 | -RRB- | denotes | ) |
T25955 | 2286-2295 | NNP | denotes | Signaling |
T25954 | 2281-2285 | NNP | denotes | Cell |
T25953 | 2277-2280 | DT | denotes | all |
T25952 | 2276-2277 | -LRB- | denotes | ( |
T25951 | 2272-2275 | NNP | denotes | pAb |
T25950 | 2265-2271 | NN | denotes | rabbit |
T25949 | 2260-2264 | NNP | denotes | PDK1 |
T25948 | 2258-2259 | , | denotes | , |
T25947 | 2255-2258 | NNP | denotes | mAb |
T25946 | 2248-2254 | NN | denotes | rabbit |
T25945 | 2246-2247 | -RRB- | denotes | ) |
T25944 | 2242-2246 | NNP | denotes | 7C10 |
T25943 | 2236-2241 | VBP | denotes | clone |
T25942 | 2235-2236 | -LRB- | denotes | ( |
T25941 | 2230-2234 | NNP | denotes | mTOR |
T25940 | 2228-2229 | , | denotes | , |
T25939 | 2225-2228 | NNP | denotes | pAb |
T25938 | 2218-2224 | NN | denotes | rabbit |
T25937 | 2216-2217 | -RRB- | denotes | ) |
T25936 | 2208-2216 | NNP | denotes | Thr37/46 |
T25935 | 2207-2208 | -LRB- | denotes | ( |
T25934 | 2192-2206 | NNP | denotes | phospho-4E-BP1 |
T25933 | 2190-2191 | , | denotes | , |
T25932 | 2187-2190 | NNP | denotes | mAb |
T25931 | 2181-2186 | NN | denotes | mouse |
T25930 | 2179-2180 | -RRB- | denotes | ) |
T25929 | 2175-2179 | NNP | denotes | 54D2 |
T25928 | 2169-2174 | VBN | denotes | clone |
T25927 | 2168-2169 | -LRB- | denotes | ( |
T25926 | 2160-2167 | NNP | denotes | Protein |
T25925 | 2150-2159 | NNP | denotes | Ribosomal |
T25924 | 2147-2149 | NNP | denotes | S6 |
T25923 | 2145-2146 | , | denotes | , |
T25922 | 2142-2145 | NNP | denotes | mAb |
T25921 | 2135-2141 | NN | denotes | rabbit |
T25920 | 2132-2134 | NNP | denotes | XP |
T25919 | 2130-2131 | -RRB- | denotes | ) |
T25918 | 2129-2130 | NNP | denotes | E |
T25917 | 2125-2129 | CD | denotes | .2.2 |
T25916 | 2122-2125 | NNP | denotes | D57 |
T25915 | 2116-2121 | JJ | denotes | clone |
T25914 | 2115-2116 | -LRB- | denotes | ( |
T25913 | 2113-2114 | -RRB- | denotes | ) |
T25912 | 2103-2113 | NNP | denotes | Ser235/236 |
T25911 | 2102-2103 | -LRB- | denotes | ( |
T25910 | 2094-2101 | NNP | denotes | Protein |
T25909 | 2084-2093 | NNP | denotes | Ribosomal |
T25908 | 2073-2083 | NNP | denotes | phospho-S6 |
T25907 | 2071-2072 | , | denotes | , |
T25906 | 2068-2071 | NNP | denotes | mAb |
T25905 | 2061-2067 | NN | denotes | rabbit |
T25904 | 2059-2060 | -RRB- | denotes | ) |
T25903 | 2054-2059 | NNP | denotes | 108D2 |
T25902 | 2048-2053 | JJ | denotes | clone |
T25901 | 2047-2048 | -LRB- | denotes | ( |
T25900 | 2045-2046 | -RRB- | denotes | ) |
T25899 | 2039-2045 | NNP | denotes | Thr389 |
T25898 | 2038-2039 | -LRB- | denotes | ( |
T25897 | 2031-2037 | NNP | denotes | Kinase |
T25896 | 2028-2030 | NNP | denotes | S6 |
T25895 | 2016-2027 | JJ | denotes | phospho-p70 |
T25894 | 2014-2015 | , | denotes | , |
T25893 | 2011-2014 | NNP | denotes | pAb |
T25892 | 2004-2010 | NN | denotes | rabbit |
T25891 | 2002-2003 | -RRB- | denotes | ) |
T25890 | 1995-2002 | NNP | denotes | Ser21/9 |
T25889 | 1994-1995 | -LRB- | denotes | ( |
T25888 | 1992-1993 | NNP | denotes | β |
T25887 | 1991-1992 | NNP | denotes | / |
T25886 | 1977-1991 | NNP | denotes | phospho-GSK-3α |
T25885 | 1975-1976 | , | denotes | , |
T25884 | 1972-1975 | NNP | denotes | pAb |
T25883 | 1965-1971 | NN | denotes | rabbit |
T25882 | 1963-1964 | -RRB- | denotes | ) |
T25881 | 1957-1963 | NNP | denotes | Ser166 |
T25880 | 1956-1957 | -LRB- | denotes | ( |
T25879 | 1943-1955 | NNP | denotes | phospho-MDM2 |
T25878 | 1941-1942 | , | denotes | , |
T25877 | 1938-1941 | NNP | denotes | pAb |
T25876 | 1931-1937 | NN | denotes | rabbit |
T25875 | 1925-1930 | NNP | denotes | FoxO4 |
T25874 | 1923-1924 | , | denotes | , |
T25383 | 552-554 | CD | denotes | 10 |
T25382 | 551-552 | -LRB- | denotes | ( |
T25381 | 545-550 | NNP | denotes | BX912 |
T25380 | 543-544 | , | denotes | , |
T25379 | 542-543 | -RRB- | denotes | ) |
T25378 | 532-542 | NNP | denotes | Calbiochem |
T25377 | 530-531 | , | denotes | , |
T25376 | 528-530 | NNP | denotes | µM |
T25375 | 525-527 | CD | denotes | 10 |
T25374 | 524-525 | -LRB- | denotes | ( |
T25373 | 515-523 | NNP | denotes | SB216763 |
T25372 | 513-514 | , | denotes | , |
T25371 | 512-513 | -RRB- | denotes | ) |
T25370 | 507-512 | NNP | denotes | Sigma |
T25369 | 505-506 | , | denotes | , |
T25368 | 503-505 | NNP | denotes | mM |
T25367 | 500-502 | CD | denotes | 10 |
T25366 | 499-500 | -LRB- | denotes | ( |
T25365 | 494-498 | NNP | denotes | LiCl |
T25364 | 492-493 | , | denotes | , |
T25363 | 491-492 | -RRB- | denotes | ) |
T25362 | 481-491 | NNP | denotes | Calbiochem |
T25361 | 479-480 | , | denotes | , |
T25360 | 477-479 | NNP | denotes | µM |
T25359 | 474-476 | CD | denotes | 10 |
T25337 | 394-395 | , | denotes | , |
T25336 | 393-394 | -RRB- | denotes | ) |
T25335 | 383-393 | NNP | denotes | Calbiochem |
T25334 | 381-382 | , | denotes | , |
T25333 | 379-381 | NNP | denotes | µM |
T25332 | 376-378 | CD | denotes | 10 |
T25331 | 375-376 | -LRB- | denotes | ( |
T25330 | 366-374 | NNP | denotes | SP600125 |
T25329 | 364-365 | , | denotes | , |
T25328 | 363-364 | -RRB- | denotes | ) |
T25327 | 354-363 | NNP | denotes | Institute |
T25326 | 347-353 | NNP | denotes | Cancer |
T25325 | 338-346 | NNP | denotes | National |
T25324 | 336-337 | , | denotes | , |
T25323 | 334-336 | NNP | denotes | µM |
T25322 | 330-333 | CD | denotes | 100 |
T25321 | 329-330 | -LRB- | denotes | ( |
T25320 | 317-328 | NNP | denotes | Triciribine |
T25319 | 315-316 | , | denotes | , |
T25318 | 314-315 | -RRB- | denotes | ) |
T25317 | 310-314 | NNP | denotes | Chem |
T25316 | 302-309 | NNP | denotes | Selleck |
T25315 | 300-301 | , | denotes | , |
T25314 | 298-300 | NNP | denotes | µM |
T25313 | 295-297 | CD | denotes | 10 |
T25312 | 294-295 | -LRB- | denotes | ( |
T25311 | 286-293 | NNP | denotes | MK-2206 |
T25310 | 284-285 | , | denotes | , |
T25309 | 283-284 | -RRB- | denotes | ) |
T25308 | 273-283 | NNP | denotes | Calbiochem |
T25280 | 117-118 | . | denotes | . |
T25279 | 116-117 | NNP | denotes | ] |
T25278 | 114-116 | CD | denotes | 24 |
T25277 | 113-114 | NNP | denotes | [ |
T25276 | 111-112 | , | denotes | , |
T25275 | 110-111 | NNP | denotes | ] |
T25274 | 108-110 | CD | denotes | 23 |
T25273 | 107-108 | NNP | denotes | [ |
T25272 | 97-106 | VBN | denotes | described |
T25271 | 86-96 | RB | denotes | previously |
T25270 | 83-85 | IN | denotes | as |
T25269 | 71-82 | VBN | denotes | synthesized |
T25268 | 66-70 | VBD | denotes | were |
T25267 | 58-65 | NNS | denotes | analogs |
T25266 | 46-57 | NNP | denotes | Necrostatin |
T25265 | 36-45 | NNPS | denotes | Chemicals |
T25264 | 32-35 | CC | denotes | and |
T25263 | 23-31 | NNS | denotes | Reagents |
T25344 | 421-422 | , | denotes | , |
T25343 | 419-421 | NNP | denotes | µM |
T25342 | 416-418 | CD | denotes | 10 |
T25341 | 415-416 | -LRB- | denotes | ( |
T25340 | 410-414 | NNP | denotes | VIII |
T25339 | 400-409 | NN | denotes | inhibitor |
T25338 | 396-399 | NNP | denotes | JNK |
T25307 | 271-272 | , | denotes | , |
T25306 | 269-271 | NNP | denotes | µM |
T25305 | 266-268 | CD | denotes | 10 |
T25304 | 265-266 | -LRB- | denotes | ( |
T25303 | 260-264 | NNP | denotes | VIII |
T25302 | 250-259 | NN | denotes | inhibitor |
T25301 | 246-249 | JJ | denotes | Akt |
T25300 | 244-245 | : | denotes | : |
T25299 | 233-244 | NNS | denotes | experiments |
T25298 | 229-232 | DT | denotes | the |
T25297 | 226-228 | IN | denotes | in |
T25296 | 221-225 | VBN | denotes | used |
T25295 | 216-220 | VBD | denotes | were |
T25294 | 214-215 | -RRB- | denotes | ) |
T25293 | 202-214 | NNS | denotes | text/figures |
T25292 | 198-201 | DT | denotes | the |
T25291 | 195-197 | IN | denotes | in |
T25290 | 185-194 | VBN | denotes | specified |
T25289 | 175-184 | RB | denotes | otherwise |
T25288 | 168-174 | IN | denotes | unless |
T25287 | 167-168 | -LRB- | denotes | ( |
T25286 | 152-166 | NNS | denotes | concentrations |
T25285 | 146-151 | JJ | denotes | final |
T25284 | 142-145 | CC | denotes | and |
T25283 | 133-141 | NNS | denotes | reagents |
T25282 | 123-132 | VBG | denotes | following |
T25281 | 119-122 | DT | denotes | The |
T25358 | 473-474 | -LRB- | denotes | ( |
T25357 | 464-472 | NNP | denotes | PD169316 |
T25356 | 462-463 | , | denotes | , |
T25355 | 461-462 | -RRB- | denotes | ) |
T25354 | 457-461 | NNP | denotes | Chem |
T25353 | 450-456 | NNP | denotes | Cayman |
T25352 | 448-449 | , | denotes | , |
T25351 | 446-448 | NNP | denotes | mM |
T25350 | 443-445 | CD | denotes | 10 |
T25349 | 442-443 | -LRB- | denotes | ( |
T25348 | 436-441 | NNP | denotes | UO126 |
T25347 | 434-435 | , | denotes | , |
T25346 | 433-434 | -RRB- | denotes | ) |
T25345 | 423-433 | NNP | denotes | Calbiochem |
T25523 | 1101-1102 | . | denotes | . |
T25522 | 1096-1101 | NNP | denotes | Sigma |
T25521 | 1091-1095 | IN | denotes | from |
T25520 | 1086-1090 | VBD | denotes | were |
T25519 | 1077-1085 | NNS | denotes | reagents |
T25518 | 1071-1076 | JJ | denotes | other |
T25517 | 1067-1070 | DT | denotes | All |
T25516 | 1065-1066 | . | denotes | . |
T25515 | 1056-1065 | NNP | denotes | Peprotech |
T25514 | 1053-1055 | CC | denotes | or |
T25513 | 1044-1052 | NNPS | denotes | Sciences |
T25512 | 1039-1043 | NNP | denotes | Cell |
T25511 | 1034-1038 | IN | denotes | from |
T25510 | 1029-1033 | VBD | denotes | were |
T25509 | 1027-1028 | -RRB- | denotes | ) |
T25508 | 1022-1027 | NN | denotes | ng/ml |
T25507 | 1019-1021 | CD | denotes | 50 |
T25506 | 1018-1019 | -LRB- | denotes | ( |
T25505 | 1012-1017 | NNP | denotes | IGF-1 |
T25504 | 1008-1011 | CC | denotes | and |
T25503 | 1006-1007 | , | denotes | , |
T25502 | 1005-1006 | -RRB- | denotes | ) |
T25501 | 1000-1005 | NN | denotes | ng/ml |
T25500 | 997-999 | CD | denotes | 20 |
T25499 | 996-997 | -LRB- | denotes | ( |
T25498 | 988-995 | NNP | denotes | PDGF-BB |
T25497 | 986-987 | , | denotes | , |
T25496 | 985-986 | -RRB- | denotes | ) |
T25495 | 980-985 | NN | denotes | ng/ml |
T25494 | 977-979 | CD | denotes | 50 |
T25493 | 976-977 | -LRB- | denotes | ( |
T25492 | 972-975 | NNP | denotes | EGF |
T25491 | 970-971 | , | denotes | , |
T25490 | 969-970 | -RRB- | denotes | ) |
T25489 | 964-969 | NN | denotes | ng/ml |
T25488 | 961-963 | CD | denotes | 25 |
T25487 | 960-961 | -LRB- | denotes | ( |
T25486 | 955-959 | NNP | denotes | bFGF |
T26372 | 2903-2905 | CD | denotes | .7 |
T26371 | 2897-2903 | NNP | denotes | RAW264 |
T26370 | 2893-2896 | CC | denotes | and |
T26369 | 2887-2892 | NNS | denotes | cells |
T26368 | 2885-2886 | -RRB- | denotes | ) |
T26367 | 2881-2885 | NNP | denotes | ATCC |
T26366 | 2880-2881 | -LRB- | denotes | ( |
T26365 | 2877-2879 | CD | denotes | .1 |
T26364 | 2872-2877 | CD | denotes | J774A |
T26363 | 2870-2871 | . | denotes | . |
T26362 | 2869-2870 | NNP | denotes | ] |
T26361 | 2867-2869 | CD | denotes | 53 |
T26360 | 2866-2867 | NNP | denotes | [ |
T26359 | 2864-2865 | -RRB- | denotes | ) |
T26358 | 2854-2864 | NNP | denotes | University |
T26357 | 2848-2853 | NNP | denotes | Tufts |
T26356 | 2847-2848 | -LRB- | denotes | ( |
T26355 | 2838-2846 | NNP | denotes | Tsichlis |
T26459 | 3402-3403 | . | denotes | . |
T26458 | 3380-3402 | JJ | denotes | antibiotic-antimycotic |
T26457 | 3378-3379 | NN | denotes | % |
T26456 | 3377-3378 | CD | denotes | 1 |
T26455 | 3373-3376 | CC | denotes | and |
T26454 | 3371-3372 | -RRB- | denotes | ) |
T26453 | 3365-3371 | NNP | denotes | Gemini |
T26452 | 3364-3365 | -LRB- | denotes | ( |
T26451 | 3354-3363 | NNP | denotes | FetalPlex |
T26450 | 3352-3353 | NN | denotes | % |
T26449 | 3350-3352 | CD | denotes | 10 |
T26448 | 3345-3349 | IN | denotes | with |
T26447 | 3332-3344 | VBN | denotes | supplemented |
T26446 | 3330-3331 | , | denotes | , |
T26445 | 3322-3330 | NNP | denotes | RPMI1640 |
T26444 | 3319-3321 | IN | denotes | in |
T26443 | 3308-3318 | VBN | denotes | maintained |
T26442 | 3303-3307 | VBD | denotes | were |
T26441 | 3297-3302 | NNS | denotes | cells |
T26440 | 3290-3296 | NNP | denotes | Jurkat |
T26439 | 3288-3289 | . | denotes | . |
T26438 | 3280-3288 | NN | denotes | pyruvate |
T26437 | 3273-3279 | NN | denotes | sodium |
T26436 | 3269-3272 | CC | denotes | and |
T26435 | 3267-3268 | , | denotes | , |
T25676 | 1129-1139 | VBG | denotes | containing |
T25675 | 1127-1128 | , | denotes | , |
T25674 | 1119-1127 | NNP | denotes | Myr-Akt1 |
T25673 | 1116-1118 | IN | denotes | of |
T25672 | 1108-1115 | NNP | denotes | Cloning |
T25671 | 1104-1107 | NNP | denotes | DNA |
T28115 | 6917-6925 | NNP | denotes | ELISAOne |
T28114 | 6914-6916 | IN | denotes | of |
T28113 | 6911-6913 | NN | denotes | µL |
T28112 | 6908-6910 | CD | denotes | 45 |
T28111 | 6905-6907 | IN | denotes | in |
T28110 | 6897-6904 | VBN | denotes | diluted |
T28109 | 6892-6896 | VBD | denotes | were |
T28108 | 6884-6891 | NNS | denotes | samples |
R17874 | T26140 | T26160 | ccomp | reverse,reverse |
R17875 | T26141 | T26140 | nummod | 5,reverse |
R17881 | T26147 | T26148 | amod | human,18S |
R17826 | T26092 | T26095 | compound | QPCR,TNFα |
R17197 | T25263 | T25269 | nsubjpass | Reagents,synthesized |
R17198 | T25264 | T25263 | cc | and,Reagents |
R17199 | T25265 | T25266 | compound | Chemicals,Necrostatin |
R17200 | T25266 | T25267 | compound | Necrostatin,analogs |
R17201 | T25267 | T25263 | conj | analogs,Reagents |
R17202 | T25268 | T25269 | auxpass | were,synthesized |
R17203 | T25269 | T25269 | ROOT | synthesized,synthesized |
R17204 | T25270 | T25272 | mark | as,described |
R17205 | T25271 | T25272 | advmod | previously,described |
R17206 | T25272 | T25269 | advcl | described,synthesized |
R17207 | T25273 | T25275 | compound | [,] |
R17208 | T25274 | T25275 | compound | 23,] |
R17209 | T25275 | T25272 | dobj | ],described |
R17210 | T25276 | T25275 | punct | ",",] |
R17211 | T25277 | T25279 | nmod | [,] |
R17212 | T25278 | T25279 | nummod | 24,] |
R17213 | T25279 | T25275 | appos | ],] |
R17214 | T25280 | T25269 | punct | .,synthesized |
R17215 | T25281 | T25283 | det | The,reagents |
R17216 | T25282 | T25283 | amod | following,reagents |
R17217 | T25283 | T25296 | nsubjpass | reagents,used |
R17218 | T25284 | T25283 | cc | and,reagents |
R17219 | T25285 | T25286 | amod | final,concentrations |
R17220 | T25286 | T25283 | conj | concentrations,reagents |
R17221 | T25287 | T25290 | punct | (,specified |
R17222 | T25288 | T25290 | mark | unless,specified |
R17223 | T25289 | T25290 | advmod | otherwise,specified |
R17224 | T25290 | T25283 | acl | specified,reagents |
R17225 | T25291 | T25290 | prep | in,specified |
R17226 | T25292 | T25293 | det | the,text/figures |
R17227 | T25293 | T25291 | pobj | text/figures,in |
R17228 | T25294 | T25283 | punct | ),reagents |
R17229 | T25295 | T25296 | auxpass | were,used |
R17230 | T25296 | T25296 | ROOT | used,used |
R17231 | T25297 | T25296 | prep | in,used |
R17232 | T25298 | T25299 | det | the,experiments |
R17233 | T25299 | T25297 | pobj | experiments,in |
R17234 | T25300 | T25303 | punct | :,VIII |
R17235 | T25301 | T25303 | amod | Akt,VIII |
R17236 | T25302 | T25303 | compound | inhibitor,VIII |
R17237 | T25303 | T25296 | npadvmod | VIII,used |
R17238 | T25304 | T25303 | punct | (,VIII |
R17239 | T25305 | T25306 | nummod | 10,µM |
R17240 | T25306 | T25303 | appos | µM,VIII |
R17241 | T25307 | T25306 | punct | ",",µM |
R17242 | T25308 | T25306 | appos | Calbiochem,µM |
R17243 | T25309 | T25306 | punct | ),µM |
R17244 | T25310 | T25303 | punct | ",",VIII |
R17245 | T25311 | T25314 | nmod | MK-2206,µM |
R17246 | T25312 | T25314 | punct | (,µM |
R17247 | T25313 | T25314 | nummod | 10,µM |
R17248 | T25314 | T25303 | appos | µM,VIII |
R17249 | T25315 | T25314 | punct | ",",µM |
R17250 | T25316 | T25317 | compound | Selleck,Chem |
R17251 | T25317 | T25314 | appos | Chem,µM |
R17252 | T25318 | T25314 | punct | ),µM |
R17253 | T25319 | T25314 | punct | ",",µM |
R17254 | T25320 | T25314 | conj | Triciribine,µM |
R17255 | T25321 | T25323 | punct | (,µM |
R17256 | T25322 | T25323 | nummod | 100,µM |
R17257 | T25323 | T25314 | conj | µM,µM |
R17258 | T25324 | T25323 | punct | ",",µM |
R17259 | T25325 | T25327 | compound | National,Institute |
R17260 | T25326 | T25327 | compound | Cancer,Institute |
R17261 | T25327 | T25323 | appos | Institute,µM |
R17262 | T25328 | T25323 | punct | ),µM |
R17263 | T25329 | T25323 | punct | ",",µM |
R17264 | T25330 | T25323 | conj | SP600125,µM |
R17265 | T25331 | T25333 | punct | (,µM |
R17266 | T25332 | T25333 | nummod | 10,µM |
R17267 | T25333 | T25323 | conj | µM,µM |
R17268 | T25334 | T25333 | punct | ",",µM |
R17269 | T25335 | T25333 | conj | Calbiochem,µM |
R17270 | T25336 | T25335 | punct | ),Calbiochem |
R17271 | T25337 | T25333 | punct | ",",µM |
R17272 | T25338 | T25340 | compound | JNK,VIII |
R17273 | T25339 | T25340 | compound | inhibitor,VIII |
R17274 | T25340 | T25333 | npadvmod | VIII,µM |
R17275 | T25341 | T25340 | punct | (,VIII |
R17276 | T25342 | T25343 | nummod | 10,µM |
R17277 | T25343 | T25340 | appos | µM,VIII |
R17278 | T25344 | T25340 | punct | ",",VIII |
R17279 | T25345 | T25340 | appos | Calbiochem,VIII |
R17280 | T25346 | T25340 | punct | ),VIII |
R17281 | T25347 | T25340 | punct | ",",VIII |
R17282 | T25348 | T25340 | appos | UO126,VIII |
R17283 | T25349 | T25351 | punct | (,mM |
R17284 | T25350 | T25351 | nummod | 10,mM |
R17285 | T25351 | T25340 | appos | mM,VIII |
R17286 | T25352 | T25351 | punct | ",",mM |
R17287 | T25353 | T25354 | compound | Cayman,Chem |
R17288 | T25354 | T25351 | npadvmod | Chem,mM |
R17289 | T25355 | T25351 | punct | ),mM |
R17290 | T25356 | T25340 | punct | ",",VIII |
R17291 | T25357 | T25340 | appos | PD169316,VIII |
R17292 | T25358 | T25360 | punct | (,µM |
R17293 | T25359 | T25360 | nummod | 10,µM |
R17294 | T25360 | T25340 | appos | µM,VIII |
R17295 | T25361 | T25360 | punct | ",",µM |
R17296 | T25362 | T25360 | appos | Calbiochem,µM |
R17297 | T25363 | T25360 | punct | ),µM |
R17298 | T25364 | T25360 | punct | ",",µM |
R17299 | T25365 | T25360 | conj | LiCl,µM |
R17300 | T25366 | T25368 | punct | (,mM |
R17301 | T25367 | T25368 | nummod | 10,mM |
R17302 | T25368 | T25340 | appos | mM,VIII |
R17303 | T25369 | T25368 | punct | ",",mM |
R17304 | T25370 | T25368 | npadvmod | Sigma,mM |
R17305 | T25371 | T25368 | punct | ),mM |
R17306 | T25372 | T25340 | punct | ",",VIII |
R17307 | T25373 | T25340 | appos | SB216763,VIII |
R17308 | T25374 | T25376 | punct | (,µM |
R17309 | T25375 | T25376 | nummod | 10,µM |
R17310 | T25376 | T25340 | appos | µM,VIII |
R17311 | T25377 | T25376 | punct | ",",µM |
R17312 | T25378 | T25376 | appos | Calbiochem,µM |
R17313 | T25379 | T25376 | punct | ),µM |
R17314 | T25380 | T25376 | punct | ",",µM |
R17315 | T25381 | T25376 | conj | BX912,µM |
R17316 | T25382 | T25384 | punct | (,µM |
R17317 | T25383 | T25384 | nummod | 10,µM |
R17318 | T25384 | T25388 | npadvmod | µM,Chem |
R17319 | T25385 | T25384 | punct | ",",µM |
R17320 | T25386 | T25388 | compound | Axon,Chem |
R17321 | T25387 | T25388 | compound | Med,Chem |
R17322 | T25388 | T25340 | appos | Chem,VIII |
R17323 | T25389 | T25340 | punct | ),VIII |
R17324 | T25390 | T25340 | punct | ",",VIII |
R17325 | T25391 | T25340 | appos | PF-4706871,VIII |
R17326 | T25392 | T25393 | punct | (,Sigma |
R17327 | T25393 | T25391 | parataxis | Sigma,PF-4706871 |
R17328 | T25394 | T25393 | punct | ),Sigma |
R17329 | T25395 | T25340 | punct | ",",VIII |
R17330 | T25396 | T25399 | nmod | rapamycin,nM |
R17331 | T25397 | T25399 | punct | (,nM |
R17332 | T25398 | T25399 | nummod | 100,nM |
R17333 | T25399 | T25340 | appos | nM,VIII |
R17334 | T25400 | T25399 | punct | ",",nM |
R17335 | T25401 | T25402 | compound | Santa,Cruz |
R17336 | T25402 | T25399 | appos | Cruz,nM |
R17337 | T25403 | T25399 | punct | ),nM |
R17338 | T25404 | T25399 | punct | ",",nM |
R17339 | T25405 | T25408 | nmod | PI-103,µM |
R17340 | T25406 | T25408 | punct | (,µM |
R17341 | T25407 | T25408 | nummod | 10,µM |
R17342 | T25408 | T25399 | conj | µM,nM |
R17343 | T25409 | T25408 | punct | ",",µM |
R17344 | T25410 | T25408 | conj | Calbiochem,µM |
R17345 | T25411 | T25410 | punct | ),Calbiochem |
R17346 | T25412 | T25408 | punct | ",",µM |
R17347 | T25413 | T25408 | conj | Torin-1,µM |
R17348 | T25414 | T25416 | punct | (,nM |
R17349 | T25415 | T25416 | nummod | 500,nM |
R17350 | T25416 | T25408 | conj | nM,µM |
R17351 | T25417 | T25416 | punct | ",",nM |
R17352 | T25418 | T25340 | appos | gift,VIII |
R17353 | T25419 | T25418 | prep | of,gift |
R17354 | T25420 | T25422 | compound | Dr.,Grey |
R17355 | T25421 | T25422 | compound | Nathanael,Grey |
R17356 | T25422 | T25419 | pobj | Grey,of |
R17357 | T25423 | T25426 | punct | (,School |
R17358 | T25424 | T25426 | compound | Harvard,School |
R17359 | T25425 | T25426 | compound | Medical,School |
R17360 | T25426 | T25422 | appos | School,Grey |
R17361 | T25427 | T25426 | punct | ),School |
R17362 | T25428 | T25422 | punct | ",",Grey |
R17363 | T25429 | T25432 | nmod | LY249002,µM |
R17364 | T25430 | T25432 | punct | (,µM |
R17365 | T25431 | T25432 | nummod | 10,µM |
R17366 | T25432 | T25422 | appos | µM,Grey |
R17367 | T25433 | T25432 | punct | ",",µM |
R17368 | T25434 | T25435 | compound | Cell,Signaling |
R17369 | T25435 | T25432 | conj | Signaling,µM |
R17370 | T25436 | T25432 | punct | ),µM |
R17371 | T25437 | T25432 | punct | ",",µM |
R17372 | T25438 | T25432 | conj | PD173074,µM |
R17373 | T25439 | T25441 | punct | (,µM |
R17374 | T25440 | T25441 | nummod | 2,µM |
R17375 | T25441 | T25432 | conj | µM,µM |
R17376 | T25442 | T25441 | punct | ",",µM |
R17377 | T25443 | T25444 | compound | Cayman,Chem |
R17378 | T25444 | T25441 | npadvmod | Chem,µM |
R17379 | T25445 | T25441 | punct | ),µM |
R17380 | T25446 | T25441 | punct | ",",µM |
R17381 | T25447 | T25441 | conj | PD166866,µM |
R17382 | T25448 | T25450 | punct | (,µM |
R17383 | T25449 | T25450 | nummod | 20,µM |
R17384 | T25450 | T25441 | conj | µM,µM |
R17385 | T25451 | T25450 | punct | ",",µM |
R17386 | T25452 | T25450 | conj | Calbiochem,µM |
R17387 | T25453 | T25452 | punct | ),Calbiochem |
R17388 | T25454 | T25450 | punct | ",",µM |
R17389 | T25455 | T25450 | conj | 4EGI-1,µM |
R17390 | T25456 | T25458 | punct | (,µM |
R17391 | T25457 | T25458 | nummod | 50,µM |
R17392 | T25458 | T25450 | conj | µM,µM |
R17393 | T25459 | T25458 | punct | ",",µM |
R17394 | T25460 | T25458 | conj | Calbiochem,µM |
R17395 | T25461 | T25458 | punct | ),µM |
R17396 | T25462 | T25303 | punct | .,VIII |
R17397 | T25463 | T25465 | compound | Pan-caspase,zVAD.fmk |
R17398 | T25464 | T25465 | compound | inhibitor,zVAD.fmk |
R17399 | T25465 | T25472 | nsubjpass | zVAD.fmk,purchased |
R17400 | T25466 | T25465 | punct | (,zVAD.fmk |
R17401 | T25467 | T25465 | appos | 20,zVAD.fmk |
R17402 | T25468 | T25469 | nummod | 30,µM |
R17403 | T25469 | T25465 | appos | µM,zVAD.fmk |
R17404 | T25470 | T25465 | punct | ),zVAD.fmk |
R17405 | T25471 | T25472 | auxpass | was,purchased |
R17406 | T25472 | T25472 | ROOT | purchased,purchased |
R17407 | T25473 | T25472 | prep | from,purchased |
R17408 | T25474 | T25473 | pobj | Bachem,from |
R17409 | T25475 | T25472 | punct | .,purchased |
R17410 | T25476 | T25510 | nsubj | Human,were |
R17411 | T25477 | T25476 | cc | and,Human |
R17412 | T25478 | T25476 | conj | mouse,Human |
R17413 | T25479 | T25478 | appos | TNFα,mouse |
R17414 | T25480 | T25482 | punct | (,ng/ml |
R17415 | T25481 | T25482 | nummod | 10,ng/ml |
R17416 | T25482 | T25479 | appos | ng/ml,TNFα |
R17417 | T25483 | T25482 | punct | ),ng/ml |
R17418 | T25484 | T25479 | punct | ",",TNFα |
R17419 | T25485 | T25486 | compound | human,bFGF |
R17420 | T25486 | T25479 | conj | bFGF,TNFα |
R17421 | T25487 | T25489 | punct | (,ng/ml |
R17422 | T25488 | T25489 | nummod | 25,ng/ml |
R17423 | T25489 | T25486 | appos | ng/ml,bFGF |
R17424 | T25490 | T25489 | punct | ),ng/ml |
R17425 | T25491 | T25486 | punct | ",",bFGF |
R17426 | T25492 | T25486 | conj | EGF,bFGF |
R17427 | T25493 | T25495 | punct | (,ng/ml |
R17428 | T25494 | T25495 | nummod | 50,ng/ml |
R17429 | T25495 | T25492 | parataxis | ng/ml,EGF |
R17430 | T25496 | T25495 | punct | ),ng/ml |
R17431 | T25497 | T25492 | punct | ",",EGF |
R17432 | T25498 | T25492 | conj | PDGF-BB,EGF |
R17433 | T25499 | T25501 | punct | (,ng/ml |
R17434 | T25500 | T25501 | nummod | 20,ng/ml |
R17435 | T25501 | T25498 | parataxis | ng/ml,PDGF-BB |
R17436 | T25502 | T25501 | punct | ),ng/ml |
R17437 | T25503 | T25498 | punct | ",",PDGF-BB |
R17438 | T25504 | T25498 | cc | and,PDGF-BB |
R17439 | T25505 | T25498 | conj | IGF-1,PDGF-BB |
R17440 | T25506 | T25508 | punct | (,ng/ml |
R17441 | T25507 | T25508 | nummod | 50,ng/ml |
R17442 | T25508 | T25505 | appos | ng/ml,IGF-1 |
R17443 | T25509 | T25505 | punct | ),IGF-1 |
R17444 | T25510 | T25510 | ROOT | were,were |
R17445 | T25511 | T25510 | prep | from,were |
R17446 | T25512 | T25513 | compound | Cell,Sciences |
R17447 | T25513 | T25511 | pobj | Sciences,from |
R17448 | T25514 | T25513 | cc | or,Sciences |
R17449 | T25515 | T25513 | conj | Peprotech,Sciences |
R17450 | T25516 | T25510 | punct | .,were |
R17451 | T25517 | T25519 | det | All,reagents |
R17452 | T25518 | T25519 | amod | other,reagents |
R17453 | T25519 | T25520 | nsubj | reagents,were |
R17454 | T25520 | T25520 | ROOT | were,were |
R17455 | T25521 | T25520 | prep | from,were |
R17456 | T25522 | T25521 | pobj | Sigma,from |
R17457 | T25523 | T25520 | punct | .,were |
R17533 | T25691 | T25690 | agent | by,amplified |
R17534 | T25692 | T25691 | pobj | PCR,by |
R17535 | T25693 | T25690 | cc | and,amplified |
R17536 | T25694 | T25690 | conj | subcloned,amplified |
R17537 | T25695 | T25694 | prep | into,subcloned |
R17538 | T25696 | T25697 | det | the,BglII |
R17539 | T25697 | T25700 | nmod | BglII,sites |
R17540 | T25698 | T25697 | cc | and,BglII |
R17541 | T25699 | T25697 | conj | EcoRI,BglII |
R17542 | T25700 | T25695 | pobj | sites,into |
R17543 | T25701 | T25700 | prep | of,sites |
R17544 | T25702 | T25704 | compound | pMSCV-puro,vector |
R17545 | T25703 | T25704 | compound | retroviral,vector |
R17546 | T25704 | T25701 | pobj | vector,of |
R17547 | T25705 | T25704 | punct | (,vector |
R17548 | T25706 | T25704 | appos | Invitrogen,vector |
R17549 | T25707 | T25704 | punct | ),vector |
R17550 | T25708 | T25690 | punct | .,amplified |
R17551 | T25709 | T25710 | amod | Mutant,versions |
R17552 | T25710 | T25714 | nsubjpass | versions,generated |
R17553 | T25711 | T25710 | prep | of,versions |
R17554 | T25712 | T25711 | pobj | Myr-Akt1,of |
R17555 | T25713 | T25714 | auxpass | were,generated |
R17556 | T25714 | T25714 | ROOT | generated,generated |
R17557 | T25715 | T25714 | advcl | using,generated |
R17558 | T25716 | T25718 | det | the,strategy |
R17559 | T25717 | T25718 | amod | same,strategy |
R17560 | T25718 | T25715 | dobj | strategy,using |
R17561 | T25719 | T25714 | punct | .,generated |
R17562 | T25747 | T25752 | nsubjpass | Antibodies,used |
R17563 | T25748 | T25750 | det | The,antibodies |
R17564 | T25749 | T25750 | amod | following,antibodies |
R17565 | T25750 | T25752 | nsubjpass | antibodies,used |
R17566 | T25751 | T25752 | auxpass | were,used |
R17567 | T25752 | T25752 | ROOT | used,used |
R17568 | T25753 | T25775 | punct | :,mAb |
R17569 | T25754 | T25774 | meta | phospho-Akt,rabbit |
R17570 | T25755 | T25754 | punct | (,phospho-Akt |
R17571 | T25756 | T25754 | dep | Thr308,phospho-Akt |
R17572 | T25757 | T25754 | punct | ),phospho-Akt |
R17573 | T25758 | T25760 | punct | (,C31E5E |
R17574 | T25759 | T25760 | compound | clone,C31E5E |
R17575 | T25760 | T25754 | appos | C31E5E,phospho-Akt |
R17576 | T25761 | T25760 | punct | ),C31E5E |
R17577 | T25762 | T25763 | compound | rabbit,mAb |
R17578 | T25763 | T25754 | conj | mAb,phospho-Akt |
R17579 | T25764 | T25763 | punct | ",",mAb |
R17580 | T25765 | T25763 | conj | phospho-Akt,mAb |
R17581 | T25766 | T25765 | punct | (,phospho-Akt |
R17582 | T25767 | T25765 | appos | Ser473,phospho-Akt |
R17583 | T25768 | T25765 | punct | ),phospho-Akt |
R17584 | T25769 | T25771 | punct | (,D9E |
R17585 | T25770 | T25771 | compound | clone,D9E |
R17586 | T25771 | T25765 | appos | D9E,phospho-Akt |
R17587 | T25772 | T25771 | punct | ),D9E |
R17588 | T25773 | T25774 | compound | XP,rabbit |
R17589 | T25774 | T25775 | compound | rabbit,mAb |
R17590 | T25775 | T25752 | dobj | mAb,used |
R17591 | T25776 | T25775 | punct | ",",mAb |
R17592 | T25777 | T25775 | conj | Akt,mAb |
R17593 | T25778 | T25779 | punct | (,pan |
R17594 | T25779 | T25777 | parataxis | pan,Akt |
R17595 | T25780 | T25779 | punct | ),pan |
R17596 | T25781 | T25783 | punct | (,C67E7 |
R17597 | T25782 | T25783 | compound | clone,C67E7 |
R17598 | T25783 | T25777 | appos | C67E7,Akt |
R17599 | T25784 | T25783 | punct | ),C67E7 |
R17600 | T25785 | T25786 | compound | rabbit,mAb |
R17601 | T25786 | T25775 | conj | mAb,mAb |
R17602 | T25787 | T25786 | punct | ",",mAb |
R17603 | T25788 | T25791 | compound | Akt1,C73H10 |
R17604 | T25789 | T25790 | punct | (,clone |
R17605 | T25790 | T25791 | compound | clone,C73H10 |
R17606 | T25791 | T25786 | appos | C73H10,mAb |
R17607 | T25792 | T25786 | punct | ),mAb |
R17608 | T25793 | T25794 | compound | rabbit,mAb |
R17609 | T25794 | T25786 | conj | mAb,mAb |
R17610 | T25795 | T25794 | punct | ",",mAb |
R17611 | T25796 | T25799 | compound | Akt2,D6G4 |
R17612 | T25797 | T25798 | punct | (,clone |
R17613 | T25798 | T25799 | compound | clone,D6G4 |
R17614 | T25799 | T25794 | appos | D6G4,mAb |
R17615 | T25800 | T25794 | punct | ),mAb |
R17616 | T25801 | T25802 | compound | rabbit,mAb |
R17617 | T25802 | T25794 | conj | mAb,mAb |
R17618 | T25803 | T25802 | punct | ",",mAb |
R17619 | T25804 | T25807 | compound | Akt3,62A8 |
R17620 | T25805 | T25806 | punct | (,clone |
R17621 | T25806 | T25807 | compound | clone,62A8 |
R17622 | T25807 | T25802 | appos | 62A8,mAb |
R17623 | T25808 | T25802 | punct | ),mAb |
R17624 | T25809 | T25810 | compound | rabbit,mAb |
R17625 | T25810 | T25802 | conj | mAb,mAb |
R17626 | T25811 | T25810 | punct | ",",mAb |
R17627 | T25812 | T25810 | conj | phospho-JNK,mAb |
R17628 | T25813 | T25812 | punct | (,phospho-JNK |
R17629 | T25814 | T25812 | appos | Thr183/Tyr185,phospho-JNK |
R17630 | T25815 | T25812 | punct | ),phospho-JNK |
R17631 | T25816 | T25812 | punct | (,phospho-JNK |
R17632 | T25817 | T25812 | appos | 81E11,phospho-JNK |
R17633 | T25818 | T25812 | punct | ),phospho-JNK |
R17634 | T25819 | T25820 | compound | rabbit,mAb |
R17635 | T25820 | T25810 | conj | mAb,mAb |
R17636 | T25821 | T25820 | punct | ",",mAb |
R17637 | T25822 | T25823 | compound | SAPK/JNK,rabbit |
R17638 | T25823 | T25824 | compound | rabbit,pAb |
R17639 | T25824 | T25820 | conj | pAb,mAb |
R17640 | T25825 | T25824 | punct | ",",pAb |
R17641 | T25826 | T25831 | nmod | phospho-c-Jun,rabbit |
R17642 | T25827 | T25828 | punct | (,Ser63 |
R17643 | T25828 | T25826 | appos | Ser63,phospho-c-Jun |
R17644 | T25829 | T25828 | punct | ),Ser63 |
R17645 | T25830 | T25831 | compound | II,rabbit |
R17646 | T25831 | T25832 | compound | rabbit,pAb |
R17647 | T25832 | T25824 | conj | pAb,pAb |
R17648 | T25833 | T25832 | punct | ",",pAb |
R17649 | T25834 | T25832 | conj | c-Jun,pAb |
R17650 | T25835 | T25836 | punct | (,60A8 |
R17651 | T25836 | T25834 | appos | 60A8,c-Jun |
R17652 | T25837 | T25834 | punct | ),c-Jun |
R17653 | T25838 | T25839 | compound | rabbit,mAb |
R17654 | T25839 | T25832 | conj | mAb,pAb |
R17655 | T25840 | T25839 | punct | ",",mAb |
R17656 | T25841 | T25839 | conj | α-tubulin,mAb |
R17657 | T25842 | T25841 | punct | (,α-tubulin |
R17658 | T25843 | T25844 | compound | clone,DM1A |
R17659 | T25844 | T25841 | appos | DM1A,α-tubulin |
R17660 | T25845 | T25841 | punct | ),α-tubulin |
R17661 | T25846 | T25847 | compound | mouse,mAb |
R17662 | T25847 | T25839 | conj | mAb,mAb |
R17663 | T25848 | T25847 | punct | ",",mAb |
R17664 | T25849 | T25847 | conj | phospho-FoxO1,mAb |
R17665 | T25850 | T25849 | punct | (,phospho-FoxO1 |
R17666 | T25851 | T25849 | appos | Thr24,phospho-FoxO1 |
R17667 | T25852 | T25853 | dep | ),/ |
R17668 | T25853 | T25854 | compound | /,FoxO3a |
R17669 | T25854 | T25849 | conj | FoxO3a,phospho-FoxO1 |
R17670 | T25855 | T25854 | punct | (,FoxO3a |
R17671 | T25856 | T25854 | appos | Thr32,FoxO3a |
R17672 | T25857 | T25854 | punct | ),FoxO3a |
R17673 | T25858 | T25859 | compound | rabbit,pAb |
R17674 | T25859 | T25849 | conj | pAb,phospho-FoxO1 |
R17675 | T25860 | T25859 | punct | ",",pAb |
R17676 | T25861 | T25859 | conj | FoxO1,pAb |
R17677 | T25862 | T25861 | punct | (,FoxO1 |
R17678 | T25863 | T25861 | appos | L27,FoxO1 |
R17679 | T25864 | T25861 | punct | ),FoxO1 |
R17680 | T25865 | T25866 | compound | rabbit,pAb |
R17681 | T25866 | T25859 | conj | pAb,pAb |
R17682 | T25867 | T25866 | punct | ",",pAb |
R17683 | T25868 | T25866 | conj | phospho-FoxO4,pAb |
R17684 | T25869 | T25870 | punct | (,Ser193 |
R17685 | T25870 | T25868 | appos | Ser193,phospho-FoxO4 |
R17686 | T25871 | T25868 | punct | ),phospho-FoxO4 |
R17687 | T25872 | T25873 | compound | rabbit,pAb |
R17688 | T25873 | T25866 | conj | pAb,pAb |
R17689 | T25874 | T25873 | punct | ",",pAb |
R17690 | T25875 | T25876 | compound | FoxO4,rabbit |
R17691 | T25876 | T25877 | compound | rabbit,pAb |
R17692 | T25877 | T25873 | conj | pAb,pAb |
R17693 | T25878 | T25877 | punct | ",",pAb |
R17694 | T25879 | T25877 | conj | phospho-MDM2,pAb |
R17695 | T25880 | T25881 | punct | (,Ser166 |
R17696 | T25881 | T25879 | appos | Ser166,phospho-MDM2 |
R17697 | T25882 | T25879 | punct | ),phospho-MDM2 |
R17698 | T25883 | T25884 | compound | rabbit,pAb |
R17699 | T25884 | T25877 | conj | pAb,pAb |
R17700 | T25885 | T25884 | punct | ",",pAb |
R17701 | T25886 | T25888 | compound | phospho-GSK-3α,β |
R17702 | T25887 | T25888 | compound | /,β |
R17703 | T25888 | T25884 | conj | β,pAb |
R17704 | T25889 | T25890 | punct | (,Ser21/9 |
R17705 | T25890 | T25888 | appos | Ser21/9,β |
R17706 | T25891 | T25888 | punct | ),β |
R17707 | T25892 | T25893 | compound | rabbit,pAb |
R17708 | T25893 | T25888 | conj | pAb,β |
R17709 | T25894 | T25893 | punct | ",",pAb |
R17710 | T25895 | T25897 | compound | phospho-p70,Kinase |
R17711 | T25896 | T25897 | compound | S6,Kinase |
R17712 | T25897 | T25893 | conj | Kinase,pAb |
R17713 | T25898 | T25899 | punct | (,Thr389 |
R17714 | T25899 | T25897 | appos | Thr389,Kinase |
R17715 | T25900 | T25897 | punct | ),Kinase |
R17716 | T25901 | T25903 | punct | (,108D2 |
R17717 | T25902 | T25903 | compound | clone,108D2 |
R17718 | T25903 | T25897 | appos | 108D2,Kinase |
R17719 | T25904 | T25903 | punct | ),108D2 |
R17720 | T25905 | T25906 | compound | rabbit,mAb |
R17721 | T25906 | T25897 | conj | mAb,Kinase |
R17722 | T25907 | T25906 | punct | ",",mAb |
R17723 | T25908 | T25910 | compound | phospho-S6,Protein |
R17724 | T25909 | T25910 | compound | Ribosomal,Protein |
R17725 | T25910 | T25906 | conj | Protein,mAb |
R17726 | T25911 | T25912 | punct | (,Ser235/236 |
R17727 | T25912 | T25910 | appos | Ser235/236,Protein |
R17728 | T25913 | T25910 | punct | ),Protein |
R17729 | T25914 | T25922 | punct | (,mAb |
R17730 | T25915 | T25918 | nmod | clone,E |
R17731 | T25916 | T25918 | nmod | D57,E |
R17732 | T25917 | T25918 | nummod | .2.2,E |
R17733 | T25918 | T25921 | nmod | E,rabbit |
R17734 | T25919 | T25918 | punct | ),E |
R17735 | T25920 | T25921 | compound | XP,rabbit |
R17736 | T25921 | T25922 | compound | rabbit,mAb |
R17737 | T25922 | T25910 | conj | mAb,Protein |
R17738 | T25923 | T25922 | punct | ",",mAb |
R17739 | T25924 | T25926 | compound | S6,Protein |
R17740 | T25925 | T25926 | compound | Ribosomal,Protein |
R17741 | T25926 | T25922 | appos | Protein,mAb |
R17742 | T25927 | T25928 | punct | (,clone |
R17743 | T25928 | T25929 | compound | clone,54D2 |
R17744 | T25929 | T25926 | appos | 54D2,Protein |
R17745 | T25930 | T25926 | punct | ),Protein |
R17746 | T25931 | T25932 | compound | mouse,mAb |
R17747 | T25932 | T25922 | conj | mAb,mAb |
R17748 | T25933 | T25932 | punct | ",",mAb |
R17749 | T25934 | T25932 | conj | phospho-4E-BP1,mAb |
R17750 | T25935 | T25936 | punct | (,Thr37/46 |
R17751 | T25936 | T25934 | appos | Thr37/46,phospho-4E-BP1 |
R17752 | T25937 | T25934 | punct | ),phospho-4E-BP1 |
R17753 | T25938 | T25939 | compound | rabbit,pAb |
R17754 | T25939 | T25932 | conj | pAb,mAb |
R17755 | T25940 | T25939 | punct | ",",pAb |
R17756 | T25941 | T25944 | compound | mTOR,7C10 |
R17757 | T25942 | T25943 | punct | (,clone |
R17758 | T25943 | T25944 | compound | clone,7C10 |
R17759 | T25944 | T25939 | appos | 7C10,pAb |
R17760 | T25945 | T25939 | punct | ),pAb |
R17761 | T25946 | T25947 | compound | rabbit,mAb |
R17762 | T25947 | T25939 | conj | mAb,pAb |
R17763 | T25948 | T25947 | punct | ",",mAb |
R17764 | T25949 | T25951 | compound | PDK1,pAb |
R17765 | T25950 | T25951 | compound | rabbit,pAb |
R17766 | T25951 | T25947 | conj | pAb,mAb |
R17767 | T25952 | T25955 | punct | (,Signaling |
R17768 | T25953 | T25955 | det | all,Signaling |
R17769 | T25954 | T25955 | compound | Cell,Signaling |
R17770 | T25955 | T25951 | parataxis | Signaling,pAb |
R17771 | T25956 | T25955 | punct | ),Signaling |
R17772 | T25957 | T25951 | punct | ",",pAb |
R17773 | T25958 | T25960 | compound | MDM2,pAb |
R17774 | T25959 | T25960 | compound | rabbit,pAb |
R17775 | T25960 | T25951 | conj | pAb,pAb |
R17776 | T25961 | T25962 | punct | (,Bioworlde |
R17777 | T25962 | T25960 | appos | Bioworlde,pAb |
R17778 | T25963 | T25960 | punct | ),pAb |
R17779 | T25964 | T25752 | punct | .,used |
R17827 | T26093 | T26095 | compound | Primers,TNFα |
R17828 | T26094 | T26095 | compound | Mouse,TNFα |
R17829 | T26095 | T26095 | ROOT | TNFα,TNFα |
R17830 | T26096 | T26102 | punct | :,′ |
R17831 | T26097 | T26102 | advmod | forward,′ |
R17832 | T26098 | T26102 | nummod | 5,′ |
R17833 | T26099 | T26101 | punct | ′,CCCTCACACTCAGATCATCTTCT-3 |
R17834 | T26100 | T26101 | punct | -,CCCTCACACTCAGATCATCTTCT-3 |
R17835 | T26101 | T26102 | compound | CCCTCACACTCAGATCATCTTCT-3,′ |
R17836 | T26102 | T26095 | appos | ′,TNFα |
R17837 | T26103 | T26102 | punct | ",",′ |
R17838 | T26104 | T26120 | ccomp | reverse,reverse |
R17839 | T26105 | T26109 | nummod | 5,′ |
R17840 | T26106 | T26108 | punct | ′,GCTACGACGTGGGCTACAG-3 |
R17841 | T26107 | T26108 | punct | -,GCTACGACGTGGGCTACAG-3 |
R17842 | T26108 | T26109 | compound | GCTACGACGTGGGCTACAG-3,′ |
R17843 | T26109 | T26104 | dobj | ′,reverse |
R17844 | T26110 | T26120 | punct | ;,reverse |
R17845 | T26111 | T26112 | compound | mouse,18S |
R17846 | T26112 | T26120 | nsubj | 18S,reverse |
R17847 | T26113 | T26112 | punct | :,18S |
R17848 | T26114 | T26118 | advmod | forward,ATAACAGGTCTGTGATGCCCTTAG-3 |
R17849 | T26115 | T26117 | meta | 5,′ |
R17850 | T26116 | T26117 | punct | -,′ |
R17851 | T26117 | T26118 | compound | ′,ATAACAGGTCTGTGATGCCCTTAG-3 |
R17852 | T26118 | T26112 | appos | ATAACAGGTCTGTGATGCCCTTAG-3,18S |
R17853 | T26119 | T26118 | punct | ",",ATAACAGGTCTGTGATGCCCTTAG-3 |
R17854 | T26120 | T26160 | ccomp | reverse,reverse |
R17855 | T26121 | T26125 | nummod | 5,′ |
R17856 | T26122 | T26124 | punct | ′,CTAAACCATCCAATCGGTAGTAGC-3 |
R17857 | T26123 | T26124 | punct | -,CTAAACCATCCAATCGGTAGTAGC-3 |
R17858 | T26124 | T26125 | compound | CTAAACCATCCAATCGGTAGTAGC-3,′ |
R17859 | T26125 | T26120 | dobj | ′,reverse |
R17860 | T26126 | T26160 | punct | ;,reverse |
R17861 | T26127 | T26128 | amod | human,TNFα |
R17862 | T26128 | T26160 | nsubj | TNFα,reverse |
R17863 | T26129 | T26135 | punct | :,′ |
R17864 | T26130 | T26135 | advmod | forward,′ |
R17865 | T26131 | T26134 | nummod | 5,ATGAGCACTGAAAGCATGATCC-3 |
R17866 | T26132 | T26134 | punct | ′,ATGAGCACTGAAAGCATGATCC-3 |
R17867 | T26133 | T26134 | punct | -,ATGAGCACTGAAAGCATGATCC-3 |
R17868 | T26134 | T26135 | compound | ATGAGCACTGAAAGCATGATCC-3,′ |
R17869 | T26135 | T26128 | appos | ′,TNFα |
R17872 | T26138 | T26128 | conj | TNFα,TNFα |
R17882 | T26148 | T26160 | nsubj | 18S,reverse |
R17883 | T26149 | T26148 | punct | :,18S |
R17884 | T26150 | T26158 | advmod | forward,18S |
R17885 | T26151 | T26158 | nummod | 5,18S |
R17886 | T26152 | T26154 | punct | ′,CAGCCACCCGAGATTGAGCA |
R17887 | T26153 | T26154 | punct | -,CAGCCACCCGAGATTGAGCA |
R17888 | T26154 | T26158 | nmod | CAGCCACCCGAGATTGAGCA,18S |
R17889 | T26155 | T26154 | nummod | -3,CAGCCACCCGAGATTGAGCA |
R17890 | T26156 | T26158 | punct | ",",18S |
R18023 | T26334 | T26336 | compound | Cell,L929 |
R18024 | T26335 | T26336 | compound | Lines,L929 |
R18025 | T26336 | T26342 | nsubjpass | L929,obtained |
R18026 | T26337 | T26336 | cc | and,L929 |
R18027 | T26338 | T26339 | compound | FADD-deficient,Jurkat |
R18028 | T26339 | T26336 | conj | Jurkat,L929 |
R18029 | T26340 | T26342 | nsubjpass | cells,obtained |
R18030 | T26341 | T26342 | auxpass | were,obtained |
R18031 | T26342 | T26342 | ROOT | obtained,obtained |
R18032 | T26343 | T26342 | prep | from,obtained |
R18033 | T26344 | T26343 | pobj | ATCC,from |
R18034 | T26345 | T26342 | punct | .,obtained |
R18035 | T26346 | T26347 | compound | Lung,fibroblasts |
R18036 | T26347 | T26348 | nsubj | fibroblasts,were |
R18037 | T26348 | T26348 | ROOT | were,were |
R18038 | T26349 | T26351 | det | a,gift |
R18039 | T26350 | T26351 | amod | generous,gift |
R18040 | T26351 | T26348 | attr | gift,were |
R18041 | T26352 | T26351 | prep | of,gift |
R18042 | T26353 | T26355 | compound | Dr.,Tsichlis |
R18043 | T26354 | T26355 | compound | Philip,Tsichlis |
R18044 | T26355 | T26352 | pobj | Tsichlis,of |
R18045 | T26356 | T26355 | punct | (,Tsichlis |
R18046 | T26357 | T26358 | compound | Tufts,University |
R18047 | T26358 | T26355 | appos | University,Tsichlis |
R18048 | T26359 | T26355 | punct | ),Tsichlis |
R18049 | T26360 | T26362 | nmod | [,] |
R18050 | T26361 | T26362 | nummod | 53,] |
R18051 | T26362 | T26351 | appos | ],gift |
R18052 | T26363 | T26348 | punct | .,were |
R18053 | T26364 | T26365 | nummod | J774A,.1 |
R18054 | T26365 | T26369 | nummod | .1,cells |
R18055 | T26366 | T26367 | punct | (,ATCC |
R18056 | T26367 | T26367 | ROOT | ATCC,ATCC |
R18057 | T26368 | T26367 | punct | ),ATCC |
R18058 | T26369 | T26377 | nsubj | cells,were |
R18059 | T26370 | T26369 | cc | and,cells |
R18060 | T26371 | T26376 | nmod | RAW264,cells |
R18061 | T26372 | T26371 | nummod | .7,RAW264 |
R18062 | T26373 | T26374 | punct | (,ATCC |
R18063 | T26374 | T26371 | appos | ATCC,RAW264 |
R18064 | T26375 | T26371 | punct | ),RAW264 |
R18065 | T26376 | T26369 | conj | cells,cells |
R18066 | T26377 | T26377 | ROOT | were,were |
R18067 | T26378 | T26379 | amod | generous,gifts |
R18068 | T26379 | T26377 | attr | gifts,were |
R18069 | T26380 | T26379 | prep | of,gifts |
R18070 | T26381 | T26382 | compound | Junying,Yuan |
R18071 | T26382 | T26380 | pobj | Yuan,of |
R18072 | T26383 | T26385 | punct | (,University |
R18073 | T26384 | T26385 | compound | Harvard,University |
R18074 | T26385 | T26382 | appos | University,Yuan |
R18075 | T26386 | T26385 | punct | ),University |
R18076 | T26387 | T26382 | cc | and,Yuan |
R18077 | T26388 | T26389 | compound | Alexander,Poltorak |
R18078 | T26389 | T26382 | conj | Poltorak,Yuan |
R18079 | T26390 | T26392 | punct | (,University |
R18080 | T26391 | T26392 | compound | Tufts,University |
R18081 | T26392 | T26389 | appos | University,Poltorak |
R18082 | T26393 | T26389 | punct | ),Poltorak |
R18083 | T26394 | T26379 | punct | ",",gifts |
R18084 | T26395 | T26377 | advmod | respectively,were |
R18085 | T26396 | T26377 | punct | .,were |
R18086 | T26397 | T26399 | nsubjpass | Cells,maintained |
R18087 | T26398 | T26399 | auxpass | were,maintained |
R18088 | T26399 | T26399 | ROOT | maintained,maintained |
R18089 | T26400 | T26399 | prep | in,maintained |
R18090 | T26401 | T26400 | pobj | DMEM,in |
R18091 | T26402 | T26399 | conj | supplemented,maintained |
R18092 | T26403 | T26402 | prep | with,supplemented |
R18093 | T26404 | T26405 | nummod | 10,% |
R18094 | T26405 | T26408 | nmod | %,serum |
R18095 | T26406 | T26408 | amod | fetal,serum |
R18096 | T26407 | T26408 | amod | bovine,serum |
R18097 | T26408 | T26403 | pobj | serum,with |
R18098 | T26409 | T26410 | punct | (,FBS |
R18099 | T26410 | T26408 | appos | FBS,serum |
R18100 | T26411 | T26410 | punct | ),FBS |
R18101 | T26412 | T26408 | cc | and,serum |
R18102 | T26413 | T26414 | nummod | 1,% |
R18103 | T26414 | T26416 | nmod | %,mixture |
R18104 | T26415 | T26416 | amod | antibiotic-antimycotic,mixture |
R18105 | T26416 | T26408 | conj | mixture,serum |
R18106 | T26417 | T26418 | punct | (,Invitrogen |
R18107 | T26418 | T26416 | appos | Invitrogen,mixture |
R18108 | T26419 | T26408 | punct | ),serum |
R18109 | T26420 | T26399 | punct | .,maintained |
R18110 | T26421 | T26425 | det | The,media |
R18111 | T26422 | T26425 | compound | mouse,media |
R18112 | T26423 | T26425 | compound | lung,media |
R18113 | T26424 | T26425 | compound | fibroblast,media |
R18114 | T26425 | T26428 | nsubjpass | media,supplemented |
R18115 | T26426 | T26428 | auxpass | was,supplemented |
R18116 | T26427 | T26428 | advmod | additionally,supplemented |
R18117 | T26428 | T26428 | ROOT | supplemented,supplemented |
R18118 | T26429 | T26428 | prep | with,supplemented |
R18119 | T26430 | T26429 | pobj | L-glutamine,with |
R18120 | T26431 | T26430 | punct | ",",L-glutamine |
R18121 | T26432 | T26434 | amod | non-essential,acids |
R18122 | T26433 | T26434 | amod | amino,acids |
R18123 | T26434 | T26430 | conj | acids,L-glutamine |
R18124 | T26435 | T26434 | punct | ",",acids |
R18125 | T26436 | T26434 | cc | and,acids |
R18126 | T26437 | T26438 | compound | sodium,pyruvate |
R18127 | T26438 | T26434 | conj | pyruvate,acids |
R18128 | T26439 | T26428 | punct | .,supplemented |
R18129 | T26440 | T26441 | compound | Jurkat,cells |
R18130 | T26441 | T26443 | nsubjpass | cells,maintained |
R18131 | T26442 | T26443 | auxpass | were,maintained |
R18132 | T26443 | T26443 | ROOT | maintained,maintained |
R18133 | T26444 | T26443 | prep | in,maintained |
R18134 | T26445 | T26444 | pobj | RPMI1640,in |
R18135 | T26446 | T26443 | punct | ",",maintained |
R18136 | T26447 | T26443 | conj | supplemented,maintained |
R18137 | T26448 | T26447 | prep | with,supplemented |
R18138 | T26449 | T26450 | nummod | 10,% |
R18139 | T26450 | T26451 | compound | %,FetalPlex |
R18140 | T26451 | T26448 | pobj | FetalPlex,with |
R18141 | T26452 | T26451 | punct | (,FetalPlex |
R18142 | T26453 | T26451 | appos | Gemini,FetalPlex |
R18143 | T26454 | T26451 | punct | ),FetalPlex |
R18144 | T26455 | T26447 | cc | and,supplemented |
R18145 | T26456 | T26457 | nummod | 1,% |
R18146 | T26457 | T26458 | compound | %,antibiotic-antimycotic |
R18147 | T26458 | T26447 | conj | antibiotic-antimycotic,supplemented |
R18148 | T26459 | T26443 | punct | .,maintained |
R18252 | T26586 | T26588 | nsubjpass | Cells,seeded |
R18253 | T26587 | T26588 | auxpass | were,seeded |
R18254 | T26588 | T26588 | ROOT | seeded,seeded |
R18255 | T26589 | T26588 | prep | into,seeded |
R18256 | T26590 | T26592 | amod | white,bottom |
R18257 | T26591 | T26592 | amod | clear,bottom |
R18258 | T26592 | T26589 | pobj | bottom,into |
R18259 | T26593 | T26592 | nummod | 96,bottom |
R18260 | T26594 | T26595 | intj | well,plates |
R18261 | T26595 | T26588 | conj | plates,seeded |
R18262 | T26596 | T26595 | prep | at,plates |
R18263 | T26597 | T26598 | det | the,density |
R18264 | T26598 | T26596 | pobj | density,at |
R18265 | T26599 | T26598 | prep | of,density |
R18266 | T26600 | T26603 | nummod | 1,cells/well |
R18267 | T26601 | T26603 | nummod | ×,cells/well |
R18268 | T26602 | T26603 | nummod | 104,cells/well |
R18269 | T26603 | T26599 | pobj | cells/well,of |
R18270 | T26604 | T26595 | cc | and,plates |
R18271 | T26605 | T26595 | conj | treated,plates |
R18272 | T26606 | T26607 | mark | as,described |
R18273 | T26607 | T26595 | advcl | described,plates |
R18274 | T26608 | T26607 | prep | for,described |
R18275 | T26609 | T26611 | amod | western,experiments |
R18276 | T26610 | T26611 | compound | blot,experiments |
R18277 | T26611 | T26608 | pobj | experiments,for |
R18278 | T26612 | T26588 | punct | .,seeded |
R18279 | T26613 | T26614 | compound | Cell,viability |
R18280 | T26614 | T26616 | nsubjpass | viability,determined |
R18281 | T26615 | T26616 | auxpass | was,determined |
R18282 | T26616 | T26616 | ROOT | determined,determined |
R18283 | T26617 | T26616 | advcl | using,determined |
R18284 | T26618 | T26621 | compound | CellTiter-Glo,Assay |
R18285 | T26619 | T26621 | compound | Cell,Assay |
R18286 | T26620 | T26621 | compound | Viability,Assay |
R18287 | T26621 | T26617 | dobj | Assay,using |
R18288 | T26622 | T26621 | punct | (,Assay |
R18289 | T26623 | T26621 | appos | Promega,Assay |
R18290 | T26624 | T26621 | punct | ),Assay |
R18291 | T26625 | T26616 | punct | .,determined |
R18293 | T26627 | T26628 | auxpass | were,performed |
R18294 | T26628 | T26628 | ROOT | performed,performed |
R18295 | T26629 | T26628 | prep | in,performed |
R18296 | T26630 | T26629 | pobj | duplicate,in |
R18297 | T26631 | T26630 | cc | or,duplicate |
R18298 | T26632 | T26630 | conj | triplicate,duplicate |
R18299 | T26633 | T26628 | punct | .,performed |
R18300 | T26634 | T26641 | nsubjpass | Viability,set |
R18301 | T26635 | T26634 | prep | of,Viability |
R18302 | T26636 | T26637 | det | the,control |
R18303 | T26637 | T26639 | amod | control,cells |
R18304 | T26638 | T26639 | amod | untreated,cells |
R18305 | T26639 | T26635 | pobj | cells,of |
R18306 | T26640 | T26641 | auxpass | was,set |
R18307 | T26641 | T26641 | ROOT | set,set |
R18308 | T26642 | T26641 | prep | as,set |
R18309 | T26643 | T26644 | nummod | 100,% |
R18310 | T26644 | T26642 | pobj | %,as |
R18311 | T26645 | T26641 | punct | .,set |
R18312 | T26646 | T26647 | amod | Relative,viability |
R18313 | T26647 | T26651 | nsubj | viability,induced |
R18314 | T26648 | T26647 | prep | of,viability |
R18315 | T26649 | T26648 | pobj | cells,of |
R18316 | T26650 | T26651 | punct | ",",induced |
R18317 | T26651 | T26651 | ROOT | induced,induced |
R18318 | T26652 | T26653 | aux | to,undergo |
R18319 | T26653 | T26651 | xcomp | undergo,induced |
R18320 | T26654 | T26653 | dobj | necroptosis,undergo |
R18321 | T26655 | T26651 | cc | and,induced |
R18322 | T26656 | T26651 | conj | treated,induced |
R18323 | T26657 | T26656 | prep | with,treated |
R18324 | T26658 | T26659 | det | the,compound |
R18325 | T26659 | T26657 | pobj | compound,with |
R18326 | T26660 | T26659 | amod | relative,compound |
R18327 | T26661 | T26660 | prep | to,relative |
R18328 | T26662 | T26663 | det | the,control |
R18329 | T26663 | T26661 | pobj | control,to |
R18330 | T26664 | T26665 | amod | compound-treated,cells |
R18331 | T26665 | T26659 | appos | cells,compound |
R18332 | T26666 | T26668 | punct | ",",determined |
R18333 | T26667 | T26668 | auxpass | was,determined |
R18334 | T26668 | T26651 | conj | determined,induced |
R18335 | T26669 | T26668 | cc | and,determined |
R18336 | T26670 | T26668 | conj | plotted,determined |
R18337 | T26671 | T26672 | aux | to,exclude |
R18338 | T26672 | T26670 | xcomp | exclude,plotted |
R18339 | T26673 | T26675 | det | the,effects |
R18340 | T26674 | T26675 | amod | possible,effects |
R18341 | T26675 | T26672 | dobj | effects,exclude |
R18342 | T26676 | T26675 | prep | of,effects |
R18343 | T26677 | T26678 | amod | non-specific,toxicity |
R18344 | T26678 | T26676 | pobj | toxicity,of |
R18345 | T26679 | T26678 | prep | of,toxicity |
R18346 | T26680 | T26682 | det | the,molecules |
R18347 | T26681 | T26682 | amod | small,molecules |
R18348 | T26682 | T26679 | pobj | molecules,of |
R18349 | T26683 | T26651 | punct | .,induced |
R18486 | T26929 | T26931 | compound | siRNA,siRNAs |
R18487 | T26930 | T26931 | compound | Knockdown,siRNAs |
R18488 | T26931 | T26933 | nsubjpass | siRNAs,purchased |
R18489 | T26932 | T26933 | auxpass | were,purchased |
R18490 | T26933 | T26933 | ROOT | purchased,purchased |
R18491 | T26934 | T26933 | prep | from,purchased |
R18492 | T26935 | T26934 | pobj | Dharmacon,from |
R18493 | T26936 | T26933 | punct | .,purchased |
R18494 | T26937 | T26940 | nmod | Mouse,protein |
R18495 | T26938 | T26940 | amod | ribosomal,protein |
R18496 | T26939 | T26940 | compound | S6,protein |
R18497 | T26940 | T26940 | ROOT | protein,protein |
R18498 | T26941 | T26942 | punct | (,L-040893-00 |
R18499 | T26942 | T26940 | appos | L-040893-00,protein |
R18500 | T26943 | T26942 | cc | and,L-040893-00 |
R18501 | T26944 | T26942 | conj | L-045791-00,L-040893-00 |
R18502 | T26945 | T26944 | punct | ),L-045791-00 |
R18503 | T26946 | T26942 | punct | ",",L-040893-00 |
R18504 | T26947 | T26948 | compound | mouse,Akt1 |
R18505 | T26948 | T26942 | appos | Akt1,L-040893-00 |
R18506 | T26949 | T26950 | punct | (,L-040709-00 |
R18507 | T26950 | T26948 | appos | L-040709-00,Akt1 |
R18508 | T26951 | T26950 | punct | ),L-040709-00 |
R18509 | T26952 | T26948 | punct | ",",Akt1 |
R18510 | T26953 | T26954 | compound | mouse,Akt2 |
R18511 | T26954 | T26948 | appos | Akt2,Akt1 |
R18512 | T26955 | T26956 | punct | (,L-040782-00 |
R18513 | T26956 | T26954 | appos | L-040782-00,Akt2 |
R18514 | T26957 | T26956 | punct | ),L-040782-00 |
R18515 | T26958 | T26954 | punct | ",",Akt2 |
R18516 | T26959 | T26960 | compound | mouse,Akt3 |
R18517 | T26960 | T26954 | conj | Akt3,Akt2 |
R18518 | T26961 | T26962 | punct | (,L-040891-00 |
R18519 | T26962 | T26960 | appos | L-040891-00,Akt3 |
R18520 | T26963 | T26962 | punct | ),L-040891-00 |
R18521 | T26964 | T26960 | punct | ",",Akt3 |
R18522 | T26965 | T26966 | compound | mouse,mTOR |
R18523 | T26966 | T26960 | conj | mTOR,Akt3 |
R18524 | T26967 | T26968 | punct | (,L-065427-00 |
R18525 | T26968 | T26966 | appos | L-065427-00,mTOR |
R18526 | T26969 | T26966 | punct | ),mTOR |
R18527 | T26970 | T26966 | punct | ",",mTOR |
R18528 | T26971 | T26972 | compound | mouse,PDK1 |
R18529 | T26972 | T26966 | conj | PDK1,mTOR |
R18530 | T26973 | T26974 | punct | (,L-040658-00 |
R18531 | T26974 | T26972 | appos | L-040658-00,PDK1 |
R18532 | T26975 | T26972 | punct | ),PDK1 |
R18533 | T26976 | T26972 | punct | ",",PDK1 |
R18534 | T26977 | T26978 | amod | non-coding,control |
R18535 | T26978 | T26972 | appos | control,PDK1 |
R18536 | T26979 | T26980 | punct | (,D-001810-10-05 |
R18537 | T26980 | T26972 | appos | D-001810-10-05,PDK1 |
R18538 | T26981 | T26980 | punct | ),D-001810-10-05 |
R18539 | T26982 | T26972 | punct | ",",PDK1 |
R18540 | T26983 | T26984 | compound | mouse,Mapk8 |
R18541 | T26984 | T26972 | conj | Mapk8,PDK1 |
R18570 | T27013 | T27014 | poss | manufacturer,recommendations |
R18571 | T27014 | T27012 | pobj | recommendations,to |
R18572 | T27015 | T27003 | punct | .,transfected |
R18573 | T27016 | T27022 | prep | After,treated |
R18574 | T27017 | T27018 | nummod | 72,hr |
R18575 | T27018 | T27016 | pobj | hr,After |
R18576 | T27019 | T27022 | punct | ",",treated |
R18577 | T27020 | T27022 | nsubjpass | cells,treated |
R18578 | T27021 | T27022 | auxpass | were,treated |
R18579 | T27022 | T27022 | ROOT | treated,treated |
R18580 | T27023 | T27022 | prep | with,treated |
R18581 | T27024 | T27023 | pobj | zVAD.fmk,with |
R18582 | T27025 | T27024 | cc | or,zVAD.fmk |
R18583 | T27026 | T27024 | conj | TNFα,zVAD.fmk |
R18584 | T27027 | T27022 | prep | for,treated |
R18585 | T27028 | T27029 | nummod | 9,hr |
R18586 | T27029 | T27027 | pobj | hr,for |
R18587 | T27030 | T27029 | punct | (,hr |
R18588 | T27031 | T27029 | appos | RNA,hr |
R18589 | T27032 | T27031 | cc | or,RNA |
R18590 | T27033 | T27034 | compound | Western,blot |
R18591 | T27034 | T27031 | conj | blot,RNA |
R18592 | T27035 | T27034 | punct | ),blot |
R18593 | T27036 | T27034 | cc | or,blot |
R18594 | T27037 | T27038 | nummod | 24,hr |
R18595 | T27038 | T27034 | conj | hr,blot |
R18596 | T27039 | T27041 | punct | (,viability |
R18597 | T27040 | T27041 | compound | cell,viability |
R18598 | T27041 | T27038 | appos | viability,hr |
R18599 | T27042 | T27038 | punct | ),hr |
R18600 | T27043 | T27022 | punct | .,treated |
R18819 | T27367 | T27368 | amod | Western,Blot |
R18820 | T27368 | T27386 | nsubjpass | Blot,seeded |
R18821 | T27369 | T27386 | prep | For,seeded |
R18822 | T27370 | T27371 | amod | Western,blot |
R18823 | T27371 | T27369 | pobj | blot,For |
R18824 | T27372 | T27386 | punct | ",",seeded |
R18825 | T27373 | T27377 | nummod | 4,cells |
R18826 | T27374 | T27377 | nummod | ×,cells |
R18827 | T27375 | T27377 | nummod | 105,cells |
R18828 | T27376 | T27377 | amod | adherent,cells |
R18829 | T27377 | T27386 | nsubjpass | cells,seeded |
R18830 | T27378 | T27377 | punct | (,cells |
R18831 | T27379 | T27383 | nummod | 1,cells |
R18832 | T27380 | T27383 | nummod | ×,cells |
R18833 | T27381 | T27383 | nummod | 106,cells |
R18834 | T27382 | T27383 | compound | Jurkat,cells |
R18835 | T27383 | T27377 | appos | cells,cells |
R18836 | T27384 | T27377 | punct | ),cells |
R18837 | T27385 | T27386 | auxpass | were,seeded |
R18838 | T27386 | T27386 | ROOT | seeded,seeded |
R18839 | T27387 | T27386 | prep | into,seeded |
R18840 | T27388 | T27390 | nummod | 35,dishes |
R18841 | T27389 | T27390 | nummod | mm2,dishes |
R18842 | T27390 | T27387 | pobj | dishes,into |
R18843 | T27391 | T27386 | punct | .,seeded |
R18844 | T27392 | T27399 | prep | After,stimulated |
R18845 | T27393 | T27392 | pobj | 24,After |
R18846 | T27394 | T27395 | nummod | 48,hr |
R18847 | T27395 | T27393 | appos | hr,24 |
R18848 | T27396 | T27399 | punct | ",",stimulated |
R18849 | T27397 | T27399 | nsubjpass | cells,stimulated |
R18850 | T27398 | T27399 | auxpass | were,stimulated |
R18851 | T27399 | T27399 | ROOT | stimulated,stimulated |
R18852 | T27400 | T27399 | prep | with,stimulated |
R18853 | T27401 | T27403 | nummod | 30,zVAD.fmk |
R18854 | T27402 | T27403 | compound | µM,zVAD.fmk |
R18855 | T27403 | T27400 | pobj | zVAD.fmk,with |
R18856 | T27404 | T27403 | cc | or,zVAD.fmk |
R18857 | T27405 | T27407 | nummod | 10,mouse |
R18858 | T27406 | T27407 | amod | ng/ml,mouse |
R18859 | T27407 | T27408 | compound | mouse,TNFα |
R18860 | T27408 | T27403 | conj | TNFα,zVAD.fmk |
R18861 | T27409 | T27399 | punct | .,stimulated |
R18862 | T27410 | T27420 | prep | For,starved |
R18863 | T27411 | T27410 | pobj | treatments,For |
R18864 | T27412 | T27411 | prep | under,treatments |
R18865 | T27413 | T27415 | nmod | serum,conditions |
R18866 | T27414 | T27415 | amod | free,conditions |
R18867 | T27415 | T27412 | pobj | conditions,under |
R18868 | T27416 | T27420 | punct | ",",starved |
R18869 | T27417 | T27420 | nsubjpass | cells,starved |
R18870 | T27418 | T27420 | auxpass | were,starved |
R18871 | T27419 | T27420 | advmod | serum,starved |
R18872 | T27420 | T27420 | ROOT | starved,starved |
R18873 | T27421 | T27420 | prep | for,starved |
R18874 | T27422 | T27423 | nummod | 24,hr |
R18875 | T27423 | T27421 | pobj | hr,for |
R18876 | T27424 | T27420 | advmod | prior,starved |
R18877 | T27425 | T27424 | prep | to,prior |
R18878 | T27426 | T27427 | det | the,addition |
R18879 | T27427 | T27425 | pobj | addition,to |
R18880 | T27428 | T27427 | prep | of,addition |
R18881 | T27429 | T27430 | compound | growth,factors |
R18882 | T27430 | T27428 | pobj | factors,of |
R18883 | T27431 | T27430 | punct | ",",factors |
R18884 | T27432 | T27434 | nummod | 20,zVAD.fmk |
R18885 | T27433 | T27434 | compound | µM,zVAD.fmk |
R18886 | T27434 | T27430 | appos | zVAD.fmk,factors |
R18887 | T27435 | T27434 | cc | or,zVAD.fmk |
R18888 | T27436 | T27439 | nummod | 10,TNFα |
R18889 | T27437 | T27438 | amod | ng/ml,mouse |
R18890 | T27438 | T27439 | compound | mouse,TNFα |
R18891 | T27439 | T27434 | conj | TNFα,zVAD.fmk |
R18892 | T27440 | T27420 | punct | .,starved |
R18893 | T27441 | T27443 | nsubjpass | Cells,harvested |
R18894 | T27442 | T27443 | auxpass | were,harvested |
R18895 | T27443 | T27443 | ROOT | harvested,harvested |
R18896 | T27444 | T27443 | prep | in,harvested |
R18897 | T27445 | T27446 | nummod | 1,× |
R18898 | T27446 | T27448 | nummod | ×,buffer |
R18899 | T27447 | T27448 | compound | RIPA,buffer |
R18900 | T27448 | T27444 | pobj | buffer,in |
R18901 | T27449 | T27448 | punct | (,buffer |
R18902 | T27450 | T27451 | compound | Cell,Signaling |
R18903 | T27451 | T27448 | appos | Signaling,buffer |
R18904 | T27452 | T27448 | punct | ),buffer |
R18905 | T27453 | T27443 | conj | supplemented,harvested |
R18906 | T27454 | T27453 | prep | with,supplemented |
R18907 | T27455 | T27456 | nummod | 50,µg |
R18908 | T27456 | T27459 | nmod | µg,phenylmethanesulfonylfluoride |
R18909 | T27457 | T27459 | nmod | /,phenylmethanesulfonylfluoride |
R18910 | T27458 | T27459 | compound | ml,phenylmethanesulfonylfluoride |
R18911 | T27459 | T27454 | pobj | phenylmethanesulfonylfluoride,with |
R18912 | T27460 | T27443 | punct | .,harvested |
R18913 | T27461 | T27468 | prep | After,spun |
R18914 | T27462 | T27463 | amod | brief,sonication |
R18915 | T27463 | T27468 | advcl | sonication,spun |
R18916 | T27464 | T27468 | punct | ",",spun |
R18917 | T27465 | T27466 | compound | cell,lysates |
R18918 | T27466 | T27468 | nsubjpass | lysates,spun |
R18919 | T27467 | T27468 | auxpass | were,spun |
R18920 | T27468 | T27468 | ROOT | spun,spun |
R18921 | T27469 | T27468 | prt | down,spun |
R18922 | T27470 | T27468 | prep | for,spun |
R18923 | T27471 | T27472 | nummod | 15,min |
R18924 | T27472 | T27470 | pobj | min,for |
R18925 | T27473 | T27472 | prep | at,min |
R18926 | T27474 | T27475 | nummod | "14,000",× |
R18927 | T27475 | T27476 | nummod | ×,rpm |
R18928 | T27476 | T27473 | pobj | rpm,at |
R18929 | T27477 | T27468 | punct | .,spun |
R18930 | T27478 | T27479 | compound | Protein,concentrations |
R18931 | T27479 | T27481 | nsubjpass | concentrations,measured |
R18932 | T27480 | T27481 | auxpass | were,measured |
R18933 | T27481 | T27481 | ROOT | measured,measured |
R18934 | T27482 | T27481 | advcl | using,measured |
R18935 | T27483 | T27484 | det | the,Pierce |
R18936 | T27484 | T27482 | dobj | Pierce,using |
R18937 | T27485 | T27484 | nummod | 660,Pierce |
R18938 | T27486 | T27488 | compound | nm,Reagent |
R18939 | T27487 | T27488 | compound | Assay,Reagent |
R18940 | T27488 | T27484 | conj | Reagent,Pierce |
R18941 | T27489 | T27490 | punct | (,Pierce |
R18942 | T27490 | T27488 | appos | Pierce,Reagent |
R18943 | T27491 | T27488 | punct | ),Reagent |
R18944 | T27492 | T27481 | punct | .,measured |
R18945 | T27493 | T27494 | compound | Equal,amounts |
R18946 | T27494 | T27498 | nsubjpass | amounts,boiled |
R18947 | T27495 | T27494 | prep | of,amounts |
R18948 | T27496 | T27495 | pobj | proteins,of |
R18949 | T27497 | T27498 | auxpass | were,boiled |
R18950 | T27498 | T27498 | ROOT | boiled,boiled |
R18951 | T27499 | T27498 | prep | for,boiled |
R18952 | T27500 | T27501 | nummod | 5,min |
R18953 | T27501 | T27499 | pobj | min,for |
R18954 | T27502 | T27498 | prep | at,boiled |
R18955 | T27503 | T27504 | nummod | 95,° |
R18956 | T27504 | T27507 | nummod | °,blotting |
R18957 | T27505 | T27506 | compound | C.,Western |
R18958 | T27506 | T27507 | compound | Western,blotting |
R18959 | T27507 | T27502 | pobj | blotting,at |
R18960 | T27508 | T27509 | auxpass | was,performed |
R18961 | T27509 | T27498 | conj | performed,boiled |
R18962 | T27510 | T27509 | prep | according,performed |
R18963 | T27511 | T27510 | prep | to,according |
R18964 | T27512 | T27513 | amod | standard,protocols |
R18965 | T27513 | T27511 | pobj | protocols,to |
R18966 | T27514 | T27498 | punct | .,boiled |
R18967 | T27515 | T27520 | advmod | Briefly,transferred |
R18968 | T27516 | T27520 | punct | ",",transferred |
R18969 | T27517 | T27518 | compound | SDS-PAGE,gels |
R18970 | T27518 | T27520 | nsubjpass | gels,transferred |
R18971 | T27519 | T27520 | auxpass | were,transferred |
R18972 | T27520 | T27520 | ROOT | transferred,transferred |
R18973 | T27521 | T27520 | prep | to,transferred |
R18974 | T27522 | T27523 | compound | PVDF,membrane |
R18975 | T27523 | T27521 | pobj | membrane,to |
R18976 | T27524 | T27523 | punct | ",",membrane |
R18977 | T27525 | T27520 | conj | blocked,transferred |
R18978 | T27526 | T27525 | prep | in,blocked |
R18979 | T27527 | T27528 | nummod | 3,% |
R18980 | T27528 | T27529 | compound | %,milk |
R18981 | T27529 | T27526 | pobj | milk,in |
R18983 | T27531 | T27532 | nummod | 5,% |
R18984 | T27532 | T27535 | compound | %,albumin |
R18985 | T27533 | T27534 | amod | bovine,serum |
R18986 | T27534 | T27535 | compound | serum,albumin |
R18987 | T27535 | T27529 | conj | albumin,milk |
R18988 | T27536 | T27537 | punct | (,BSA |
R18989 | T27537 | T27535 | appos | BSA,albumin |
R18990 | T27538 | T27525 | punct | ),blocked |
R18991 | T27539 | T27525 | prep | in,blocked |
R18992 | T27540 | T27541 | compound | TBST,buffer |
R18993 | T27541 | T27539 | pobj | buffer,in |
R18994 | T27542 | T27525 | prep | for,blocked |
R18995 | T27543 | T27544 | nummod | 30,min |
R18996 | T27544 | T27542 | pobj | min,for |
R18997 | T27545 | T27544 | prep | at,min |
R18998 | T27546 | T27547 | compound | room,temperature |
R18999 | T27547 | T27545 | pobj | temperature,at |
R19000 | T27548 | T27520 | punct | .,transferred |
R19001 | T27549 | T27550 | amod | Primary,antibodies |
R19002 | T27550 | T27552 | nsubjpass | antibodies,incubated |
R19003 | T27551 | T27552 | auxpass | were,incubated |
R19004 | T27552 | T27552 | ROOT | incubated,incubated |
R19005 | T27553 | T27552 | prep | in,incubated |
R19006 | T27554 | T27555 | nummod | 5,% |
R19007 | T27555 | T27556 | compound | %,BSA/TBST |
R19008 | T27556 | T27557 | compound | BSA/TBST,overnight |
R19009 | T27557 | T27553 | pobj | overnight,in |
R19010 | T27558 | T27552 | prep | at,incubated |
R19011 | T27559 | T27560 | nummod | 4,° |
R19012 | T27560 | T27563 | nummod | °,antibodies |
R19013 | T27561 | T27563 | nmod | C.,antibodies |
R19014 | T27562 | T27563 | amod | Secondary,antibodies |
R19015 | T27563 | T27558 | pobj | antibodies,at |
R19016 | T27564 | T27565 | auxpass | were,incubated |
R19017 | T27565 | T27552 | conj | incubated,incubated |
R19018 | T27566 | T27565 | prep | in,incubated |
R19019 | T27567 | T27566 | pobj | TBST,in |
R19020 | T27568 | T27565 | prep | for,incubated |
R19021 | T27569 | T27570 | nummod | 30,min |
R19022 | T27570 | T27568 | pobj | min,for |
R19023 | T27571 | T27570 | prep | at,min |
R19024 | T27572 | T27573 | compound | room,temperature |
R19025 | T27573 | T27571 | pobj | temperature,at |
R19026 | T27574 | T27552 | punct | .,incubated |
R19027 | T27575 | T27575 | ROOT | Luminata,Luminata |
R19028 | T27576 | T27577 | punct | (,Millipore |
R19029 | T27577 | T27575 | appos | Millipore,Luminata |
R19030 | T27578 | T27577 | punct | ),Millipore |
R19031 | T27579 | T27580 | compound | ECL,reagents |
R19032 | T27580 | T27582 | nsubjpass | reagents,used |
R19033 | T27581 | T27582 | auxpass | were,used |
R19034 | T27582 | T27582 | ROOT | used,used |
R19035 | T27583 | T27584 | aux | to,develop |
R19036 | T27584 | T27582 | xcomp | develop,used |
R19037 | T27585 | T27586 | det | the,signals |
R19038 | T27586 | T27584 | dobj | signals,develop |
R19039 | T27587 | T27582 | punct | .,used |
R19040 | T27588 | T27594 | prep | In,stripped |
R19041 | T27589 | T27590 | det | some,cases |
R19042 | T27590 | T27588 | pobj | cases,In |
R19043 | T27591 | T27594 | punct | ",",stripped |
R19044 | T27592 | T27594 | nsubjpass | membranes,stripped |
R19045 | T27593 | T27594 | auxpass | were,stripped |
R19046 | T27594 | T27594 | ROOT | stripped,stripped |
R19047 | T27595 | T27594 | advcl | using,stripped |
R19048 | T27596 | T27595 | dobj | OneMinute,using |
R19049 | T27597 | T27595 | conj | stripping,using |
R19050 | T27598 | T27597 | dobj | buffer,stripping |
R19051 | T27599 | T27601 | punct | (,Biosciences |
R19052 | T27600 | T27601 | compound | GM,Biosciences |
R19053 | T27601 | T27598 | appos | Biosciences,buffer |
R19054 | T27602 | T27601 | punct | ),Biosciences |
R19055 | T27603 | T27597 | cc | and,stripping |
R19056 | T27604 | T27597 | conj | reprobed,stripping |
R19057 | T27605 | T27604 | prep | with,reprobed |
R19058 | T27606 | T27607 | amod | new,antibodies |
R19059 | T27607 | T27605 | pobj | antibodies,with |
R19060 | T27608 | T27594 | punct | .,stripped |
R19129 | T27694 | T27695 | compound | qRT-PCR,Cells |
R19130 | T27695 | T27697 | nsubjpass | Cells,treated |
R19131 | T27696 | T27697 | auxpass | were,treated |
R19132 | T27697 | T27697 | ROOT | treated,treated |
R19133 | T27698 | T27699 | mark | as,described |
R19134 | T27699 | T27697 | advcl | described,treated |
R19135 | T27700 | T27699 | prep | for,described |
R19136 | T27701 | T27702 | amod | Western,blots |
R19137 | T27702 | T27700 | pobj | blots,for |
R19138 | T27703 | T27697 | punct | .,treated |
R19139 | T27704 | T27705 | amod | Total,RNA |
R19140 | T27705 | T27707 | nsubjpass | RNA,isolated |
R19141 | T27706 | T27707 | auxpass | was,isolated |
R19142 | T27707 | T27707 | ROOT | isolated,isolated |
R19143 | T27708 | T27707 | advcl | using,isolated |
R19144 | T27709 | T27711 | compound | ZR,kit |
R19145 | T27710 | T27711 | compound | Miniprep,kit |
R19146 | T27711 | T27708 | dobj | kit,using |
R19147 | T27712 | T27711 | punct | (,kit |
R19148 | T27713 | T27714 | compound | Zymo,Research |
R19149 | T27714 | T27711 | appos | Research,kit |
R19150 | T27715 | T27711 | punct | ),kit |
R19151 | T27716 | T27717 | punct | .,1 |
R19152 | T27717 | T27718 | nummod | 1,µg |
R19153 | T27718 | T27722 | nsubjpass | µg,converted |
R19154 | T27719 | T27718 | prep | of,µg |
R19155 | T27720 | T27719 | pobj | RNA,of |
R19156 | T27721 | T27722 | auxpass | was,converted |
R19157 | T27722 | T27707 | conj | converted,isolated |
R19158 | T27723 | T27722 | prep | to,converted |
R19159 | T27724 | T27723 | pobj | cDNA,to |
R19160 | T27725 | T27722 | advcl | using,converted |
R19161 | T27726 | T27727 | amod | random,primers |
R19162 | T27727 | T27725 | dobj | primers,using |
R19163 | T27728 | T27727 | punct | (,primers |
R19164 | T27729 | T27730 | compound | M-MuLV,cDNA |
R19165 | T27730 | T27731 | compound | cDNA,kit |
R19166 | T27731 | T27727 | appos | kit,primers |
R19167 | T27732 | T27731 | punct | ",",kit |
R19168 | T27733 | T27734 | compound | New,England |
R19169 | T27734 | T27735 | compound | England,Biolabs |
R19170 | T27735 | T27731 | appos | Biolabs,kit |
R19171 | T27736 | T27727 | punct | ),primers |
R19172 | T27737 | T27722 | punct | .,converted |
R19173 | T27738 | T27739 | nummod | 1,µL |
R19174 | T27739 | T27743 | nsubjpass | µL,used |
R19175 | T27740 | T27739 | prep | of,µL |
R19176 | T27741 | T27740 | pobj | cDNA,of |
R19177 | T27742 | T27743 | auxpass | was,used |
R19178 | T27743 | T27743 | ROOT | used,used |
R19179 | T27744 | T27743 | prep | with,used |
R19180 | T27745 | T27746 | nummod | 500,pM |
R19181 | T27746 | T27747 | compound | pM,primers |
R19182 | T27747 | T27744 | pobj | primers,with |
R19183 | T27748 | T27747 | prep | in,primers |
R19184 | T27749 | T27750 | compound | qPCR,reactions |
R19185 | T27750 | T27748 | pobj | reactions,in |
R19186 | T27751 | T27743 | punct | .,used |
R19187 | T27752 | T27754 | nsubj | Reactions,performs |
R19188 | T27753 | T27754 | advmod | were,performs |
R19189 | T27754 | T27754 | ROOT | performs,performs |
R19190 | T27755 | T27754 | advcl | using,performs |
R19191 | T27756 | T27760 | nmod | SYBRGreen,mix |
R19192 | T27757 | T27756 | nummod | 2,SYBRGreen |
R19193 | T27758 | T27760 | nummod | ×,mix |
R19194 | T27759 | T27760 | compound | Master,mix |
R19195 | T27760 | T27755 | dobj | mix,using |
R19196 | T27761 | T27760 | punct | (,mix |
R19197 | T27762 | T27760 | appos | SABiosciences,mix |
R19198 | T27763 | T27760 | punct | ),mix |
R19199 | T27764 | T27755 | prep | in,using |
R19200 | T27765 | T27766 | det | a,LightCycler480 |
R19201 | T27766 | T27764 | pobj | LightCycler480,in |
R19202 | T27767 | T27766 | punct | (,LightCycler480 |
R19203 | T27768 | T27766 | appos | Roche,LightCycler480 |
R19204 | T27769 | T27766 | punct | ),LightCycler480 |
R19205 | T27770 | T27754 | punct | .,performs |
R19298 | T27890 | T27885 | appos | Invitrogen,retroviruses |
R19299 | T27891 | T27883 | punct | ),generate |
R19300 | T27892 | T27893 | auxpass | were,transfected |
R19301 | T27893 | T27883 | dep | transfected,generate |
R19302 | T27894 | T27893 | prep | with,transfected |
R19303 | T27895 | T27896 | nummod | 2,µg |
R19304 | T27896 | T27894 | pobj | µg,with |
R19305 | T27897 | T27896 | prep | of,µg |
R19306 | T27898 | T27899 | amod | viral,DNA |
R19307 | T27899 | T27897 | pobj | DNA,of |
R19308 | T27900 | T27896 | cc | and,µg |
R19309 | T27901 | T27902 | nummod | 1,µg |
R19310 | T27902 | T27896 | conj | µg,µg |
R19311 | T27903 | T27902 | prep | of,µg |
R19312 | T27904 | T27903 | pobj | gal/pol,of |
R19313 | T27905 | T27904 | cc | and,gal/pol |
R19314 | T27906 | T27908 | compound | VSV-G,plasmids |
R19315 | T27907 | T27908 | compound | accessory,plasmids |
R19316 | T27908 | T27902 | conj | plasmids,µg |
R19317 | T27909 | T27908 | prep | in,plasmids |
R19318 | T27910 | T27909 | pobj | 6,in |
R19319 | T27911 | T27912 | intj | well,plates |
R19320 | T27912 | T27893 | conj | plates,transfected |
R19321 | T27913 | T27912 | advcl | using,plates |
R19322 | T27914 | T27916 | nmod | GenJet,reagent |
R19323 | T27915 | T27916 | compound | transfection,reagent |
R19324 | T27916 | T27913 | dobj | reagent,using |
R19325 | T27917 | T27919 | punct | (,Labs |
R19326 | T27918 | T27919 | compound | Signagen,Labs |
R19327 | T27919 | T27916 | appos | Labs,reagent |
R19328 | T27920 | T27919 | punct | ),Labs |
R19329 | T27921 | T27883 | punct | .,generate |
R19330 | T27922 | T27923 | amod | Virus-containing,media |
R19331 | T27923 | T27925 | nsubjpass | media,collected |
R19332 | T27924 | T27925 | auxpass | was,collected |
R19333 | T27925 | T27925 | ROOT | collected,collected |
R19334 | T27926 | T27928 | npadvmod | 72,later |
R19335 | T27927 | T27928 | npadvmod | hr,later |
R19336 | T27928 | T27925 | advmod | later,collected |
R19337 | T27929 | T27930 | punct | ",",filtered |
R19338 | T27930 | T27925 | advcl | filtered,collected |
R19339 | T27931 | T27930 | prep | through,filtered |
R19340 | T27932 | T27934 | nummod | 0.45,filter |
R19341 | T27933 | T27934 | compound | µm,filter |
R19342 | T27934 | T27931 | pobj | filter,through |
R19343 | T27935 | T27930 | cc | and,filtered |
R19346 | T27938 | T27939 | nummod | L929,cells |
R19347 | T27939 | T27937 | pobj | cells,to |
R19348 | T27940 | T27936 | prep | with,applied |
R19349 | T27941 | T27942 | nummod | 8,µg |
R19350 | T27942 | T27945 | amod | µg,polybrene |
R19351 | T27943 | T27945 | nmod | /,polybrene |
R19352 | T27944 | T27945 | compound | ml,polybrene |
R19353 | T27945 | T27940 | pobj | polybrene,with |
R19354 | T27946 | T27925 | punct | .,collected |
R19355 | T27947 | T27949 | nsubjpass | Cells,selected |
R19356 | T27948 | T27949 | auxpass | were,selected |
R19357 | T27949 | T27949 | ROOT | selected,selected |
R19358 | T27950 | T27949 | cc | and,selected |
R19359 | T27951 | T27949 | conj | maintained,selected |
R19360 | T27952 | T27951 | prep | in,maintained |
R19361 | T27953 | T27954 | nummod | 10,µg |
R19362 | T27954 | T27957 | compound | µg,puromycin |
R19363 | T27955 | T27957 | compound | /,puromycin |
R19364 | T27956 | T27957 | compound | ml,puromycin |
R19365 | T27957 | T27952 | pobj | puromycin,in |
R19366 | T27958 | T27949 | punct | .,selected |
R19451 | T28070 | T28072 | compound | ELISAOne,ELISAOne |
R19452 | T28071 | T28072 | compound | Assay,ELISAOne |
R19453 | T28072 | T28073 | compound | ELISAOne,assays |
R19454 | T28073 | T28073 | ROOT | assays,assays |
R19455 | T28074 | T28082 | punct | (,performed |
R19456 | T28075 | T28082 | nsubjpass | TGRBio,performed |
R19457 | T28076 | T28075 | punct | ",",TGRBio |
R19458 | T28077 | T28075 | conj | Hindmarsh,TGRBio |
R19459 | T28078 | T28077 | punct | ",",Hindmarsh |
R19460 | T28079 | T28077 | appos | Australia,Hindmarsh |
R19461 | T28080 | T28077 | punct | ),Hindmarsh |
R19462 | T28081 | T28082 | auxpass | were,performed |
R19463 | T28082 | T28073 | relcl | performed,assays |
R19464 | T28083 | T28082 | prep | according,performed |
R19465 | T28084 | T28083 | prep | to,according |
R19466 | T28085 | T28086 | poss | manufacturer,protocol |
R19467 | T28086 | T28084 | pobj | protocol,to |
R19468 | T28087 | T28082 | prep | with,performed |
R19469 | T28088 | T28090 | det | the,modifications |
R19470 | T28089 | T28090 | amod | following,modifications |
R19471 | T28090 | T28087 | pobj | modifications,with |
R19472 | T28091 | T28082 | punct | .,performed |
R19473 | T28092 | T28093 | compound | Cell,lysates |
R19474 | T28093 | T28095 | nsubjpass | lysates,prepared |
R19475 | T28094 | T28095 | auxpass | were,prepared |
R19476 | T28095 | T28095 | ROOT | prepared,prepared |
R19477 | T28096 | T28095 | prep | in,prepared |
R19478 | T28097 | T28098 | compound | RIPA,buffer |
R19479 | T28098 | T28096 | pobj | buffer,in |
R19480 | T28099 | T28100 | mark | as,described |
R19481 | T28100 | T28095 | advcl | described,prepared |
R19482 | T28101 | T28100 | prep | for,described |
R19483 | T28102 | T28103 | amod | Western,blots |
R19484 | T28103 | T28101 | pobj | blots,for |
R19485 | T28104 | T28095 | punct | .,prepared |
R19486 | T28105 | T28106 | nummod | Five,microliters |
R19487 | T28106 | T28110 | nsubjpass | microliters,diluted |
R19488 | T28107 | T28106 | prep | of,microliters |
R19489 | T28108 | T28107 | pobj | samples,of |
R19490 | T28109 | T28110 | auxpass | were,diluted |
R19491 | T28110 | T28110 | ROOT | diluted,diluted |
R19492 | T28111 | T28110 | prep | in,diluted |
R19493 | T28112 | T28113 | nummod | 45,µL |
R19494 | T28113 | T28111 | pobj | µL,in |
R19495 | T28114 | T28113 | prep | of,µL |
R19496 | T28115 | T28116 | compound | ELISAOne,lysis |
R19497 | T28116 | T28117 | compound | lysis,buffer |
R19498 | T28117 | T28114 | pobj | buffer,of |
R19499 | T28118 | T28110 | advmod | prior,diluted |
R19500 | T28119 | T28118 | prep | to,prior |
R19501 | T28120 | T28119 | pobj | analysis,to |
R19502 | T28121 | T28110 | punct | .,diluted |
R19503 | T28122 | T28123 | amod | Primary,antibodies |
R19504 | T28123 | T28129 | nsubjpass | antibodies,incubated |
R19505 | T28124 | T28123 | prep | to,antibodies |
R19506 | T28125 | T28124 | pobj | phopsho-Thr308,to |
R19507 | T28126 | T28125 | cc | and,phopsho-Thr308 |
R19508 | T28127 | T28125 | conj | phopsho-Ser473,phopsho-Thr308 |
R19509 | T28128 | T28129 | auxpass | were,incubated |
R19510 | T28129 | T28129 | ROOT | incubated,incubated |
R19511 | T28130 | T28129 | prep | with,incubated |
R19512 | T28131 | T28132 | det | the,samples |
R19513 | T28132 | T28130 | pobj | samples,with |
R19514 | T28133 | T28132 | prep | for,samples |
R19515 | T28134 | T28135 | nummod | 2,hr |
R19516 | T28135 | T28133 | pobj | hr,for |
R19517 | T28136 | T28129 | prep | at,incubated |
R19518 | T28137 | T28138 | compound | room,temperature |
R19519 | T28138 | T28136 | pobj | temperature,at |
R19520 | T28139 | T28129 | punct | .,incubated |
R19521 | T28140 | T28141 | amod | Primary,antibody |
R19522 | T28141 | T28145 | nsubjpass | antibody,incubated |
R19523 | T28142 | T28145 | prep | to,incubated |
R19524 | T28143 | T28142 | pobj | pan-Akt,to |
R19525 | T28144 | T28145 | auxpass | was,incubated |
R19526 | T28145 | T28145 | ROOT | incubated,incubated |
R19527 | T28146 | T28145 | advmod | overnight,incubated |
R19528 | T28147 | T28145 | prep | at,incubated |
R19529 | T28148 | T28149 | nummod | 4,° |
R19530 | T28149 | T28151 | nummod | °,Signals |
R19531 | T28150 | T28151 | compound | C.,Signals |
R19532 | T28151 | T28147 | pobj | Signals,at |
R19533 | T28152 | T28145 | prep | for,incubated |
R19534 | T28153 | T28152 | pobj | phospho-antibodies,for |
R19535 | T28154 | T28145 | auxpass | were,incubated |
R19536 | T28155 | T28154 | acomp | normalized,were |
R19537 | T28156 | T28155 | prep | based,normalized |
R19538 | T28157 | T28156 | prep | on,based |
R19539 | T28158 | T28159 | amod | pan-Akt,values |
R19540 | T28159 | T28157 | pobj | values,on |
R19541 | T28160 | T28145 | punct | .,incubated |
R19576 | T28229 | T28234 | compound | TNFα,ELISA |
R19577 | T28230 | T28234 | compound | ELISA,ELISA |
R19578 | T28231 | T28234 | compound | Mouse,ELISA |
R19579 | T28232 | T28234 | compound | TNFα,ELISA |
R19580 | T28233 | T28234 | compound | Quantikine,ELISA |
R19581 | T28234 | T28235 | compound | ELISA,assays |
R19582 | T28235 | T28241 | nsubjpass | assays,performed |
R19583 | T28236 | T28238 | punct | (,Systems |
R19584 | T28237 | T28238 | compound | R&D,Systems |
R19585 | T28238 | T28235 | appos | Systems,assays |
R19586 | T28239 | T28235 | punct | ),assays |
R19587 | T28240 | T28241 | auxpass | were,performed |
R19588 | T28241 | T28241 | ROOT | performed,performed |
R19589 | T28242 | T28241 | prep | according,performed |
R19590 | T28243 | T28242 | prep | to,according |
R19591 | T28244 | T28245 | poss | manufacturer,descriptions |
R19592 | T28245 | T28243 | pobj | descriptions,to |
R19593 | T28246 | T28241 | punct | .,performed |
R19594 | T28247 | T28248 | compound | Cell,lysates |
R19595 | T28248 | T28250 | nsubjpass | lysates,prepared |
R19607 | T28260 | T28263 | det | a,dish |
R19608 | T28261 | T28263 | nummod | 10,dish |
R19609 | T28262 | T28263 | compound | cm2,dish |
R19610 | T28263 | T28259 | pobj | dish,in |
R19611 | T28264 | T28250 | punct | .,prepared |
R19683 | T28410 | T28419 | prep | In,measured |
R19684 | T28411 | T28417 | amod | vitro,activity |
R19685 | T28412 | T28417 | compound | Akt,activity |
R19686 | T28413 | T28417 | compound | Kinase,activity |
R19687 | T28414 | T28417 | compound | Assay,activity |
R19688 | T28415 | T28417 | compound | Akt,activity |
R19689 | T28416 | T28417 | compound | kinase,activity |
R19690 | T28417 | T28410 | pobj | activity,In |
R19691 | T28418 | T28419 | auxpass | was,measured |
R19692 | T28419 | T28419 | ROOT | measured,measured |
R19693 | T28420 | T28419 | advcl | using,measured |
R19694 | T28421 | T28425 | det | the,kit |
R19695 | T28422 | T28425 | compound | Akt,kit |
R19696 | T28423 | T28424 | compound | kinase,assay |
R19697 | T28424 | T28425 | compound | assay,kit |
R19698 | T28425 | T28420 | dobj | kit,using |
R19699 | T28426 | T28425 | punct | (,kit |
R19700 | T28427 | T28425 | appos | nonradioactive,kit |
R19701 | T28428 | T28425 | punct | ),kit |
R19702 | T28429 | T28420 | prep | from,using |
R19703 | T28430 | T28432 | compound | Cell,Technology |
R19704 | T28431 | T28432 | compound | Signaling,Technology |
R19705 | T28432 | T28429 | pobj | Technology,from |
R19706 | T28433 | T28419 | punct | .,measured |
R19707 | T28434 | T28439 | prep | In,immunoprecipitated |
R19708 | T28435 | T28434 | pobj | brief,In |
R19709 | T28436 | T28439 | punct | ",",immunoprecipitated |
R19710 | T28437 | T28439 | nsubjpass | Myr-Akt,immunoprecipitated |
R19711 | T28438 | T28439 | auxpass | was,immunoprecipitated |
R19712 | T28439 | T28439 | ROOT | immunoprecipitated,immunoprecipitated |
R19713 | T28440 | T28439 | prep | from,immunoprecipitated |
R19714 | T28441 | T28442 | nummod | L929,cells |
R19715 | T28442 | T28440 | pobj | cells,from |
R19716 | T28443 | T28439 | advcl | using,immunoprecipitated |
R19717 | T28444 | T28447 | amod | anti-FLAG,beads |
R19718 | T28445 | T28447 | nmod | M2,beads |
R19719 | T28446 | T28447 | amod | magnetic,beads |
R19720 | T28447 | T28443 | dobj | beads,using |
R19721 | T28448 | T28447 | punct | (,beads |
R19722 | T28449 | T28447 | appos | Sigma,beads |
R19723 | T28450 | T28447 | punct | ),beads |
R19724 | T28451 | T28439 | punct | .,immunoprecipitated |
R19725 | T28452 | T28455 | det | The,assay |
R19726 | T28453 | T28455 | nmod | in,assay |
R19727 | T28454 | T28455 | amod | vitro,assay |
R19728 | T28455 | T28457 | nsubjpass | assay,performed |
R19729 | T28456 | T28457 | auxpass | was,performed |
R19730 | T28457 | T28457 | ROOT | performed,performed |
R19731 | T28458 | T28457 | prep | in,performed |
R19732 | T28459 | T28460 | det | the,presence |
R19733 | T28460 | T28458 | pobj | presence,in |
R19734 | T28461 | T28460 | prep | of,presence |
R19735 | T28462 | T28466 | det | a,substrate |
R19736 | T28463 | T28465 | compound | GSK,protein |
R19737 | T28464 | T28465 | compound | fusion,protein |
R19738 | T28465 | T28466 | compound | protein,substrate |
R19739 | T28466 | T28461 | pobj | substrate,of |
R19740 | T28467 | T28457 | punct | .,performed |
R19741 | T28468 | T28475 | nsubjpass | Phosphorylation,visualized |
R19742 | T28469 | T28468 | prep | of,Phosphorylation |
R19743 | T28470 | T28473 | det | the,protein |
R19744 | T28471 | T28473 | compound | GSK,protein |
R19745 | T28472 | T28473 | compound | fusion,protein |
R19746 | T28473 | T28469 | pobj | protein,of |
R19747 | T28474 | T28475 | auxpass | was,visualized |
R19748 | T28475 | T28475 | ROOT | visualized,visualized |
R19749 | T28476 | T28475 | agent | by,visualized |
R19750 | T28477 | T28478 | amod | western,blot |
R19751 | T28478 | T28476 | pobj | blot,by |
R19752 | T28479 | T28475 | punct | .,visualized |
R17873 | T26139 | T26140 | punct | :,reverse |
R17876 | T26142 | T26144 | punct | ′,GAGGGCTGATTAGAGAGAGGTC-3 |
R17877 | T26143 | T26144 | punct | -,GAGGGCTGATTAGAGAGAGGTC-3 |
R17878 | T26144 | T26145 | compound | GAGGGCTGATTAGAGAGAGGTC-3,′ |
R17879 | T26145 | T26140 | dep | ′,reverse |
R17880 | T26146 | T26160 | punct | ;,reverse |
R17891 | T26157 | T26158 | amod | human,18S |
R17892 | T26158 | T26148 | appos | 18S,18S |
R17893 | T26159 | T26148 | punct | :,18S |
R17894 | T26160 | T26160 | ROOT | reverse,reverse |
R17895 | T26161 | T26165 | nummod | 5,′ |
R17896 | T26162 | T26164 | punct | ′,TAGTAGCGACGGGCGGTGTG-3 |
R17897 | T26163 | T26164 | punct | -,TAGTAGCGACGGGCGGTGTG-3 |
R17898 | T26164 | T26165 | compound | TAGTAGCGACGGGCGGTGTG-3,′ |
R17899 | T26165 | T26160 | dobj | ′,reverse |
R17900 | T26166 | T26160 | punct | .,reverse |
R18249 | T26583 | T26584 | compound | Cell,Viability |
R18250 | T26584 | T26588 | nsubjpass | Viability,seeded |
R18251 | T26585 | T26588 | nsubjpass | Experiments,seeded |
R18292 | T26626 | T26628 | nsubjpass | Experiments,performed |
R19596 | T28249 | T28250 | auxpass | were,prepared |
R19597 | T28250 | T28250 | ROOT | prepared,prepared |
R19598 | T28251 | T28250 | prep | from,prepared |
R19599 | T28252 | T28255 | nummod | 3,cells |
R19600 | T28253 | T28255 | nummod | ×,cells |
R19601 | T28254 | T28255 | nummod | 106,cells |
R19602 | T28255 | T28251 | pobj | cells,from |
R19603 | T28256 | T28255 | acl | plated,cells |
R19604 | T28257 | T28256 | cc | and,plated |
R19605 | T28258 | T28256 | conj | treated,plated |
R19606 | T28259 | T28258 | prep | in,treated |
R19286 | T27878 | T27879 | compound | Stable,Infection |
R19287 | T27879 | T27883 | nsubj | Infection,generate |
R19288 | T27880 | T27879 | prep | of,Infection |
R19289 | T27881 | T27880 | pobj | Myr-Akt1,of |
R19290 | T27882 | T27883 | aux | To,generate |
R19291 | T27883 | T27883 | ROOT | generate,generate |
R19292 | T27884 | T27885 | compound | MSCV,retroviruses |
R19293 | T27885 | T27883 | dobj | retroviruses,generate |
R19294 | T27886 | T27885 | punct | ",",retroviruses |
R19295 | T27887 | T27888 | amod | HEK293FT,cells |
R19296 | T27888 | T27885 | conj | cells,retroviruses |
R19297 | T27889 | T27890 | punct | (,Invitrogen |
R19344 | T27936 | T27930 | conj | applied,filtered |
R19345 | T27937 | T27936 | prep | to,applied |
R18567 | T27010 | T27003 | punct | ",",transfected |
R18568 | T27011 | T27003 | prep | according,transfected |
R17521 | T25679 | T25676 | dobj | tag,containing |
R17522 | T25680 | T25683 | punct | ",",described |
R17523 | T25681 | T25683 | aux | has,described |
R17524 | T25682 | T25683 | auxpass | been,described |
R17525 | T25683 | T25683 | ROOT | described,described |
R17526 | T25684 | T25683 | dobj | [,described |
R17527 | T25685 | T25686 | nummod | 52,] |
R17528 | T25686 | T25684 | appos | ],[ |
R17529 | T25687 | T25683 | punct | .,described |
R18569 | T27012 | T27011 | prep | to,according |
R18542 | T26985 | T26986 | punct | (,J-040128-05 |
R18543 | T26986 | T26984 | appos | J-040128-05,Mapk8 |
R18544 | T26987 | T26984 | punct | ),Mapk8 |
R18545 | T26988 | T26984 | punct | ",",Mapk8 |
R18546 | T26989 | T26990 | compound | mouse,Mapk9 |
R18547 | T26990 | T26984 | conj | Mapk9,Mapk8 |
R18548 | T26991 | T26992 | punct | (,J-040134-05 |
R18549 | T26992 | T26990 | appos | J-040134-05,Mapk9 |
R18550 | T26993 | T26992 | punct | ),J-040134-05 |
R18551 | T26994 | T26990 | punct | ",",Mapk9 |
R18552 | T26995 | T26996 | compound | mouse,Jun |
R18553 | T26996 | T26990 | appos | Jun,Mapk9 |
R18554 | T26997 | T26998 | punct | (,L-043776-00 |
R18555 | T26998 | T26996 | parataxis | L-043776-00,Jun |
R18556 | T26999 | T26998 | punct | ),L-043776-00 |
R18557 | T27000 | T26940 | punct | .,protein |
R18558 | T27001 | T27003 | nsubjpass | siRNA,transfected |
R18559 | T27002 | T27003 | auxpass | were,transfected |
R18560 | T27003 | T27003 | ROOT | transfected,transfected |
R18561 | T27004 | T27003 | advcl | using,transfected |
R18562 | T27005 | T27006 | compound | RNAiMAX,reagent |
R18563 | T27006 | T27004 | dobj | reagent,using |
R18564 | T27007 | T27006 | punct | (,reagent |
R18565 | T27008 | T27006 | appos | Invitrogen,reagent |
R18566 | T27009 | T27008 | punct | ),Invitrogen |
R18982 | T27530 | T27529 | cc | or,milk |
R17513 | T25671 | T25672 | compound | DNA,Cloning |
R17514 | T25672 | T25683 | nsubj | Cloning,described |
R17515 | T25673 | T25672 | prep | of,Cloning |
R17516 | T25674 | T25673 | pobj | Myr-Akt1,of |
R17517 | T25675 | T25683 | punct | ",",described |
R17518 | T25676 | T25683 | advcl | containing,described |
R17519 | T25677 | T25679 | amod | c-terminal,tag |
R17520 | T25678 | T25679 | compound | FLAG,tag |
R17530 | T25688 | T25690 | nsubjpass | Myr-Akt1-FLAG,amplified |
R17531 | T25689 | T25690 | auxpass | was,amplified |
R17532 | T25690 | T25690 | ROOT | amplified,amplified |
R17870 | T26136 | T26135 | punct | ",",′ |
R17871 | T26137 | T26138 | compound | human,TNFα |
bionlp-st-ge-2016-test-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28388 | 7731-7746 | Phosphorylation | denotes | Phosphorylation |
T28387 | 7754-7772 | Protein | denotes | GSK fusion protein |
T28386 | 7701-7719 | Protein | denotes | GSK fusion protein |
T28385 | 7561-7564 | Protein | denotes | Akt |
T28384 | 7557-7560 | Protein | denotes | Myr |
T28383 | 7477-7487 | Protein | denotes | Akt kinase |
T28382 | 7434-7444 | Protein | denotes | Akt kinase |
T28381 | 7417-7427 | Protein | denotes | Akt Kinase |
T28228 | 7220-7247 | Protein | denotes | Mouse TNFα Quantikine ELISA |
T28227 | 7209-7219 | Protein | denotes | TNFα ELISA |
T27864 | 6350-6353 | Protein | denotes | pol |
T27863 | 6346-6349 | Protein | denotes | gal |
T27862 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27332 | 5444-5447 | Protein | denotes | BSA |
T27331 | 5429-5442 | Protein | denotes | serum albumin |
T27330 | 4936-4940 | Protein | denotes | TNFα |
T27329 | 4906-4917 | Protein | denotes | µM zVAD.fmk |
T27328 | 4777-4781 | Protein | denotes | TNFα |
T27327 | 4747-4758 | Protein | denotes | µM zVAD.fmk |
T27687 | 6137-6159 | Protein | denotes | SYBRGreen 2×Master mix |
T26091 | 2567-2577 | Protein | denotes | human TNFα |
T26090 | 2522-2526 | Protein | denotes | TNFα |
T26089 | 2341-2351 | Protein | denotes | Mouse TNFα |
T26907 | 4520-4536 | Protein | denotes | zVAD.fmk or TNFα |
T26906 | 4365-4376 | Entity | denotes | L-043776-00 |
T26905 | 4274-4281 | Regulation | denotes | control |
T26904 | 4223-4234 | Entity | denotes | L-065427-00 |
T26903 | 4103-4114 | Entity | denotes | L-040893-00 |
T26902 | 4333-4338 | Protein | denotes | Mapk9 |
T26901 | 4306-4311 | Protein | denotes | Mapk8 |
T26900 | 4243-4247 | Protein | denotes | PDK1 |
T26899 | 4191-4195 | Protein | denotes | Akt3 |
T26898 | 4165-4169 | Protein | denotes | Akt2 |
T26897 | 4139-4143 | Protein | denotes | Akt1 |
T26896 | 4075-4101 | Protein | denotes | Mouse ribosomal S6 protein |
T25543 | 1012-1017 | Protein | denotes | IGF-1 |
T25542 | 988-995 | Protein | denotes | PDGF-BB |
T25541 | 972-975 | Protein | denotes | EGF |
T25540 | 949-959 | Protein | denotes | human bFGF |
T25539 | 932-936 | Protein | denotes | TNFα |
T25538 | 851-858 | Protein | denotes | caspase |
T25537 | 847-850 | Protein | denotes | Pan |
T25536 | 250-259 | Negative_regulation | denotes | inhibitor |
T25535 | 400-409 | Negative_regulation | denotes | inhibitor |
T25534 | 250-259 | Negative_regulation | denotes | inhibitor |
T25533 | 396-399 | Protein | denotes | JNK |
T25532 | 246-249 | Protein | denotes | Akt |
R17458 | T25532 | T25534 | themeOf | Akt,inhibitor |
R17459 | T25533 | T25535 | themeOf | JNK,inhibitor |
R17460 | T25535 | T25536 | themeOf | inhibitor,inhibitor |
R18476 | T26896 | T26903 | partOf | Mouse ribosomal S6 protein,L-040893-00 |
R18477 | T26897 | T26905 | themeOf | Akt1,control |
R18478 | T26897 | T26903 | partOf | Akt1,L-040893-00 |
R18479 | T26897 | T26904 | partOf | Akt1,L-065427-00 |
R18480 | T26897 | T26906 | partOf | Akt1,L-043776-00 |
R19681 | T28387 | T28388 | themeOf | GSK fusion protein,Phosphorylation |
test3
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T28168 | 7226-7230 | Protein | denotes | TNFα |
T28167 | 7209-7213 | Protein | denotes | TNFα |
T28166 | 7226-7230 | Protein | denotes | TNFα |
T28165 | 7209-7213 | Protein | denotes | TNFα |
T28278 | 7557-7564 | Protein | denotes | Myr-Akt |
T28277 | 7557-7564 | Protein | denotes | Myr-Akt |
T27773 | 6226-6234 | Protein | denotes | Myr-Akt1 |
T27058 | 4936-4940 | Protein | denotes | TNFα |
T27057 | 4777-4781 | Protein | denotes | TNFα |
T27056 | 4936-4940 | Protein | denotes | TNFα |
T27055 | 4777-4781 | Protein | denotes | TNFα |
T26719 | 4532-4536 | Protein | denotes | TNFα |
T26718 | 4333-4338 | Protein | denotes | Mapk9 |
T26717 | 4306-4311 | Protein | denotes | Mapk8 |
T26716 | 4243-4247 | Protein | denotes | PDK1 |
T26715 | 4191-4195 | Protein | denotes | Akt3 |
T26714 | 4165-4169 | Protein | denotes | Akt2 |
T26713 | 4139-4143 | Protein | denotes | Akt1 |
T26712 | 4532-4536 | Protein | denotes | TNFα |
T26711 | 4333-4338 | Protein | denotes | Mapk9 |
T26710 | 4306-4311 | Protein | denotes | Mapk8 |
T26709 | 4243-4247 | Protein | denotes | PDK1 |
T26708 | 4191-4195 | Protein | denotes | Akt3 |
T26707 | 4165-4169 | Protein | denotes | Akt2 |
T26706 | 4139-4143 | Protein | denotes | Akt1 |
T26187 | 2738-2747 | Negative_regulation | denotes | deficient |
T26186 | 2733-2737 | Protein | denotes | FADD |
T26185 | 2733-2737 | Protein | denotes | FADD |
T25988 | 2671-2674 | Protein | denotes | 18S |
T25987 | 2623-2626 | Protein | denotes | 18S |
T25986 | 2573-2577 | Protein | denotes | TNFα |
T25985 | 2522-2526 | Protein | denotes | TNFα |
T25984 | 2432-2435 | Protein | denotes | 18S |
T25983 | 2347-2351 | Protein | denotes | TNFα |
T25982 | 2671-2674 | Protein | denotes | 18S |
T25981 | 2623-2626 | Protein | denotes | 18S |
T25980 | 2573-2577 | Protein | denotes | TNFα |
T25979 | 2522-2526 | Protein | denotes | TNFα |
T25978 | 2432-2435 | Protein | denotes | 18S |
T25977 | 2347-2351 | Protein | denotes | TNFα |
T25585 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25584 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25583 | 1119-1127 | Protein | denotes | Myr-Akt1 |
T25582 | 1331-1339 | Protein | denotes | Myr-Akt1 |
T25581 | 1186-1199 | Protein | denotes | Myr-Akt1-FLAG |
T25580 | 1119-1127 | Protein | denotes | Myr-Akt1 |
T25128 | 1012-1017 | Protein | denotes | IGF-1 |
T25127 | 972-975 | Protein | denotes | EGF |
T25126 | 955-959 | Protein | denotes | bFGF |
T25125 | 932-936 | Protein | denotes | TNFα |
T25124 | 250-259 | Negative_regulation | denotes | inhibitor |
T25123 | 1012-1017 | Protein | denotes | IGF-1 |
T25122 | 972-975 | Protein | denotes | EGF |
T25121 | 955-959 | Protein | denotes | bFGF |
T25120 | 932-936 | Protein | denotes | TNFα |
R17902 | T26186 | T26187 | themeOf | FADD,deficient |