Materials and Methods

Reagents and Chemicals
Necrostatin analogs were synthesized as previously described [23], [24]. The following reagents and final concentrations (unless otherwise specified in the text/figures) were used in the experiments: Akt inhibitor VIII (10 µM, Calbiochem), MK-2206 (10 µM, Selleck Chem), Triciribine (100 µM, National Cancer Institute), SP600125 (10 µM, Calbiochem), JNK inhibitor VIII (10 µM, Calbiochem), UO126 (10 mM, Cayman Chem), PD169316 (10 µM, Calbiochem), LiCl (10 mM, Sigma), SB216763 (10 µM, Calbiochem), BX912 (10 µM, Axon Med Chem), PF-4706871 (Sigma), rapamycin (100 nM, Santa Cruz), PI-103 (10 µM, Calbiochem), Torin-1 (500 nM, gift of Dr. Nathanael Grey (Harvard Medical School), LY249002 (10 µM, Cell Signaling), PD173074 (2 µM, Cayman Chem), PD166866 (20 µM, Calbiochem), 4EGI-1 (50 µM, Calbiochem). Pan-caspase inhibitor zVAD.fmk (20–30 µM) was purchased from Bachem. Human and mouse TNFα (10 ng/ml), human bFGF (25 ng/ml), EGF (50 ng/ml), PDGF-BB (20 ng/ml), and IGF-1 (50 ng/ml) were from Cell Sciences or Peprotech. All other reagents were from Sigma.

DNA
Cloning of Myr-Akt1, containing c-terminal FLAG tag, has been described [52]. Myr-Akt1-FLAG was amplified by PCR and subcloned into the BglII and EcoRI sites of pMSCV-puro retroviral vector (Invitrogen). Mutant versions of Myr-Akt1 were generated using the same strategy.

Antibodies
The following antibodies were used: phospho-Akt (Thr308) (clone C31E5E) rabbit mAb, phospho-Akt (Ser473) (clone D9E) XP rabbit mAb, Akt (pan) (clone C67E7) rabbit mAb, Akt1 (clone C73H10) rabbit mAb, Akt2 (clone D6G4) rabbit mAb, Akt3 (clone 62A8) rabbit mAb, phospho-JNK (Thr183/Tyr185) (81E11) rabbit mAb, SAPK/JNK rabbit pAb, phospho-c-Jun (Ser63) II rabbit pAb, c-Jun (60A8) rabbit mAb, α-tubulin (clone DM1A) mouse mAb, phospho-FoxO1 (Thr24)/FoxO3a (Thr32) rabbit pAb, FoxO1 (L27) rabbit pAb, phospho-FoxO4 (Ser193) rabbit pAb, FoxO4 rabbit pAb, phospho-MDM2 (Ser166) rabbit pAb, phospho-GSK-3α/β (Ser21/9) rabbit pAb, phospho-p70 S6 Kinase (Thr389) (clone 108D2) rabbit mAb, phospho-S6 Ribosomal Protein (Ser235/236) (clone D57.2.2E) XP rabbit mAb, S6 Ribosomal Protein (clone 54D2) mouse mAb, phospho-4E-BP1 (Thr37/46) rabbit pAb, mTOR (clone 7C10) rabbit mAb, PDK1 rabbit pAb (all Cell Signaling), MDM2 rabbit pAb (Bioworlde).

QPCR Primers
Mouse TNFα: forward 5′-CCCTCACACTCAGATCATCTTCT-3′, reverse 5′-GCTACGACGTGGGCTACAG-3′;mouse 18S: forward 5-′ ATAACAGGTCTGTGATGCCCTTAG-3, reverse 5′-CTAAACCATCCAATCGGTAGTAGC-3′;human TNFα: forward 5′- ATGAGCACTGAAAGCATGATCC-3′, human TNFα: reverse 5′-GAGGGCTGATTAGAGAGAGGTC-3′; human 18S: forward 5′- CAGCCACCCGAGATTGAGCA -3, human 18S: reverse 5′-TAGTAGCGACGGGCGGTGTG-3′.

Cell Lines
L929 and FADD-deficient Jurkat cells were obtained from ATCC. Lung fibroblasts were a generous gift of Dr. Philip Tsichlis (Tufts University) [53]. J774A.1 (ATCC) cells and RAW264.7 (ATCC) cells were generous gifts of Junying Yuan (Harvard University) and Alexander Poltorak (Tufts University), respectively. Cells were maintained in DMEM supplemented with 10% fetal bovine serum (FBS) and 1% antibiotic-antimycotic mixture (Invitrogen). The mouse lung fibroblast media was additionally supplemented with L-glutamine, non-essential amino acids, and sodium pyruvate. Jurkat cells were maintained in RPMI1640, supplemented with 10% FetalPlex (Gemini) and 1% antibiotic-antimycotic.

Cell Viability Experiments
Cells were seeded into white clear bottom 96 well plates at the density of 1×104 cells/well and treated as described for western blot experiments. Cell viability was determined using CellTiter-Glo Cell Viability Assay (Promega). Experiments were performed in duplicate or triplicate. Viability of the control untreated cells was set as 100%. Relative viability of cells, induced to undergo necroptosis and treated with the compound relative to the control compound-treated cells, was determined and plotted to exclude the possible effects of non-specific toxicity of the small molecules.

siRNA Knockdown
siRNAs were purchased from Dharmacon. Mouse ribosomal S6 protein (L-040893-00 and L-045791-00), mouse Akt1 (L-040709-00), mouse Akt2 (L-040782-00), mouse Akt3 (L-040891-00), mouse mTOR (L-065427-00), mouse PDK1 (L-040658-00), non-coding control (D-001810-10-05), mouse Mapk8 (J-040128-05), mouse Mapk9 (J-040134-05), mouse Jun (L-043776-00). siRNA were transfected using RNAiMAX reagent (Invitrogen), according to manufacturer’s recommendations. After 72 hr, cells were treated with zVAD.fmk or TNFα for 9 hr (RNA or Western blot) or 24 hr (cell viability).

Western Blot
For Western blot, 4×105 adherent cells (1×106 Jurkat cells) were seeded into 35 mm2 dishes. After 24–48 hr, cells were stimulated with 30 µM zVAD.fmk or 10 ng/ml mouse TNFα. For treatments under serum free conditions, cells were serum starved for 24 hr prior to the addition of growth factors, 20 µM zVAD.fmk or 10 ng/ml mouse TNFα. Cells were harvested in 1×RIPA buffer (Cell Signaling) supplemented with 50 µg/ml phenylmethanesulfonylfluoride. After brief sonication, cell lysates were spun down for 15 min at 14,000×rpm. Protein concentrations were measured using the Pierce 660 nm Assay Reagent (Pierce). Equal amounts of proteins were boiled for 5 min at 95°C. Western blotting was performed according to standard protocols. Briefly, SDS-PAGE gels were transferred to PVDF membrane, blocked in 3% milk or 5% bovine serum albumin (BSA) in TBST buffer for 30 min at room temperature. Primary antibodies were incubated in 5%BSA/TBST overnight at 4°C. Secondary antibodies were incubated in TBST for 30 min at room temperature. Luminata (Millipore) ECL reagents were used to develop the signals. In some cases, membranes were stripped using OneMinute stripping buffer (GM Biosciences) and reprobed with new antibodies.

qRT-PCR
Cells were treated as described for Western blots. Total RNA was isolated using ZR Miniprep kit (Zymo Research). 1 µg of RNA was converted to cDNA using random primers (M-MuLV cDNA kit, New England Biolabs). 1 µL of cDNA was used with 500 pM primers in qPCR reactions. Reactions were performs using SYBRGreen 2×Master mix (SABiosciences) in a LightCycler480 (Roche).

Stable Infection of Myr-Akt1
To generate MSCV retroviruses, HEK293FT cells (Invitrogen) were transfected with 2 µg of viral DNA and 1 µg of gal/pol and VSV-G accessory plasmids in 6 well plates using GenJet transfection reagent (Signagen Labs). Virus-containing media was collected 72 hr later, filtered through 0.45 µm filter and applied to L929 cells with 8 µg/ml polybrene. Cells were selected and maintained in 10 µg/ml puromycin.

ELISAOne Assay
ELISAOne assays (TGRBio, Hindmarsh, Australia) were performed according to manufacturer’s protocol with the following modifications. Cell lysates were prepared in RIPA buffer as described for Western blots. Five microliters of samples were diluted in 45 µL of ELISAOne lysis buffer prior to analysis. Primary antibodies to phopsho-Thr308 and phopsho-Ser473 were incubated with the samples for 2 hr at room temperature. Primary antibody to pan-Akt was incubated overnight at 4°C. Signals for phospho-antibodies were normalized based on pan-Akt values.

TNFα ELISA
Mouse TNFα Quantikine ELISA assays (R&D Systems) were performed according to manufacturer’s descriptions. Cell lysates were prepared from 3×106 cells plated and treated in a 10 cm2 dish.

In vitro Akt Kinase Assay
Akt kinase activity was measured using the Akt kinase assay kit (nonradioactive) from Cell Signaling Technology. In brief, Myr-Akt was immunoprecipitated from L929 cells using anti-FLAG M2 magnetic beads (Sigma). The in vitro assay was performed in the presence of a GSK fusion protein substrate. Phosphorylation of the GSK fusion protein was visualized by western blot.