PMC:3333881 / 8642-8812
Annnotations
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5778 | 3-8 | NN | denotes | sense |
T5779 | 8-9 | -COMMA- | denotes | , |
T5780 | 10-22 | NN | denotes | CUGCUUGUCACA |
T5781 | 23-32 | NN | denotes | AUUGCUAUU |
T5782 | 33-36 | CC | denotes | and |
T5783 | 37-42 | NN | denotes | siRNA |
T5784 | 43-50 | NN | denotes | control |
T5785 | 51-60 | JJ | denotes | antisense |
T5786 | 60-61 | -COMMA- | denotes | , |
T5787 | 62-83 | NNP | denotes | UAGCAAUUGUGACAAGCAGUU |
T5788 | 85-88 | NN | denotes | RNA |
T5789 | 89-101 | NN | denotes | interference |
T5790 | 102-104 | IN | denotes | of |
T5791 | 105-108 | NN | denotes | p65 |
T5792 | 109-112 | CC | denotes | and |
T5793 | 113-118 | NN | denotes | IκB-α |
T5794 | 119-122 | VB | denotes | was |
T5795 | 123-132 | VB | denotes | performed |
T5796 | 133-137 | IN | denotes | with |
T5797 | 138-143 | NN | denotes | SMART |
T5798 | 144-148 | NN | denotes | pool |
T5799 | 149-154 | NN | denotes | siRNA |
T5800 | 155-158 | NN | denotes | p65 |
T5801 | 159-162 | CC | denotes | and |
T5802 | 163-168 | NN | denotes | IκB-α |
T5803 | 169-170 | -LRB- | denotes | ( |
R4996 | T5779 | T5782 | arg1Of | ",",and |
R4997 | T5781 | T5779 | arg2Of | AUUGCUAUU,"," |
R4998 | T5781 | T5780 | arg1Of | AUUGCUAUU,CUGCUUGUCACA |
R5000 | T5784 | T5782 | arg2Of | control,and |
R5001 | T5784 | T5783 | arg1Of | control,siRNA |
R5002 | T5785 | T5786 | arg1Of | antisense,"," |
R5003 | T5787 | T5785 | arg1Of | UAGCAAUUGUGACAAGCAGUU,antisense |
R5004 | T5789 | T5788 | arg1Of | interference,RNA |
R5005 | T5789 | T5790 | arg1Of | interference,of |
R5006 | T5789 | T5794 | arg1Of | interference,was |
R5007 | T5789 | T5795 | arg2Of | interference,performed |
R5008 | T5791 | T5792 | arg1Of | p65,and |
R5009 | T5792 | T5790 | arg2Of | and,of |
R5010 | T5793 | T5792 | arg2Of | IκB-α,and |
R5011 | T5795 | T5794 | arg2Of | performed,was |
R5012 | T5795 | T5796 | arg1Of | performed,with |
R5013 | T5800 | T5797 | arg1Of | p65,SMART |
R5014 | T5800 | T5798 | arg1Of | p65,pool |
R5015 | T5800 | T5799 | arg1Of | p65,siRNA |
R5016 | T5800 | T5801 | arg1Of | p65,and |
R5017 | T5801 | T5796 | arg2Of | and,with |
R5018 | T5802 | T5801 | arg2Of | IκB-α,and |
R5019 | T5802 | T5803 | arg1Of | IκB-α,( |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5928 | 3-8 | NN | denotes | sense |
T5929 | 8-9 | , | denotes | , |
T5930 | 10-22 | NNP | denotes | CUGCUUGUCACA |
T5931 | 23-32 | NNP | denotes | AUUGCUAUU |
T5932 | 33-36 | CC | denotes | and |
T5933 | 37-42 | NNP | denotes | siRNA |
T5934 | 43-50 | NN | denotes | control |
T5935 | 51-60 | NN | denotes | antisense |
T5936 | 60-61 | , | denotes | , |
T5937 | 62-83 | NNP | denotes | UAGCAAUUGUGACAAGCAGUU |
T5938 | 83-84 | . | denotes | . |
T5939 | 85-88 | NNP | denotes | RNA |
T5940 | 89-101 | NN | denotes | interference |
T5941 | 102-104 | IN | denotes | of |
T5942 | 105-108 | CD | denotes | p65 |
T5943 | 109-112 | CC | denotes | and |
T5944 | 113-118 | NNP | denotes | IκB-α |
T5945 | 119-122 | VBD | denotes | was |
T5946 | 123-132 | VBN | denotes | performed |
T5947 | 133-137 | IN | denotes | with |
T5948 | 138-143 | NNP | denotes | SMART |
T5949 | 144-148 | NN | denotes | pool |
T5950 | 149-154 | NNP | denotes | siRNA |
T5951 | 155-158 | CD | denotes | p65 |
T5952 | 159-162 | CC | denotes | and |
T5953 | 163-168 | NNP | denotes | IκB-α |
T5954 | 169-170 | -LRB- | denotes | ( |
R5133 | T5929 | T5928 | punct | ",",sense |
R5135 | T5931 | T5928 | appos | AUUGCUAUU,sense |
R5136 | T5932 | T5931 | cc | and,AUUGCUAUU |
R5137 | T5933 | T5931 | conj | siRNA,AUUGCUAUU |
R5138 | T5934 | T5935 | compound | control,antisense |
R5139 | T5935 | T5928 | conj | antisense,sense |
R5140 | T5936 | T5935 | punct | ",",antisense |
R5141 | T5937 | T5928 | appos | UAGCAAUUGUGACAAGCAGUU,sense |
R5143 | T5939 | T5940 | compound | RNA,interference |
R5144 | T5940 | T5946 | nsubjpass | interference,performed |
R5145 | T5941 | T5940 | prep | of,interference |
R5146 | T5942 | T5941 | pobj | p65,of |
R5147 | T5943 | T5940 | cc | and,interference |
R5148 | T5944 | T5940 | conj | IκB-α,interference |
R5149 | T5945 | T5946 | auxpass | was,performed |
R5150 | T5946 | T5946 | ROOT | performed,performed |
R5151 | T5947 | T5946 | prep | with,performed |
R5152 | T5948 | T5949 | compound | SMART,pool |
R5153 | T5949 | T5950 | compound | pool,siRNA |
R5154 | T5950 | T5947 | pobj | siRNA,with |
R5155 | T5951 | T5950 | nummod | p65,siRNA |
R5156 | T5952 | T5950 | cc | and,siRNA |
R5157 | T5953 | T5950 | conj | IκB-α,siRNA |
R5134 | T5930 | T5931 | compound | CUGCUUGUCACA,AUUGCUAUU |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5974 | 85-101 | http://purl.obolibrary.org/obo/GO_0016246 | denotes | RNA interference |
events-check-again
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T6016 | 89-101 | Negative_regulation | denotes | interference |
T6017 | 89-101 | Negative_regulation | denotes | interference |
T6018 | 105-108 | Protein | denotes | p65 |
T6019 | 113-118 | Protein | denotes | IκB-α |
T6020 | 149-158 | Protein | denotes | siRNA p65 |
T6021 | 163-168 | Protein | denotes | IκB-α |
R5176 | T6018 | T6016 | themeOf | p65,interference |
R5177 | T6019 | T6017 | themeOf | IκB-α,interference |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T6026 | 105-108 | Protein | denotes | p65 |
T6027 | 113-118 | Protein | denotes | IκB-α |
T6028 | 138-154 | Protein | denotes | SMART pool siRNA |
T6029 | 155-158 | Protein | denotes | p65 |
T6030 | 163-168 | Protein | denotes | IκB-α |
T6031 | 89-101 | Negative_regulation | denotes | interference |
T6032 | 89-101 | Negative_regulation | denotes | interference |
R5178 | T6026 | T6031 | themeOf | p65,interference |
R5179 | T6027 | T6032 | themeOf | IκB-α,interference |
test2
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5663 | 89-101 | Negative_regulation | denotes | interference |
T5664 | 105-108 | Protein | denotes | p65 |
T5665 | 113-118 | Protein | denotes | IκB-α |
T5666 | 149-158 | Protein | denotes | siRNA p65 |
T5667 | 163-168 | Protein | denotes | IκB-α |
R4889 | T5664 | T5663 | themeOf | p65,interference |
R4890 | T5665 | T5663 | themeOf | IκB-α,interference |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5671 | 89-101 | Negative_regulation | denotes | interference |
T5672 | 89-101 | Negative_regulation | denotes | interference |
T5673 | 105-108 | Protein | denotes | p65 |
T5674 | 113-118 | Protein | denotes | IκB-α |
T5675 | 149-158 | Protein | denotes | siRNA p65 |
T5676 | 163-168 | Protein | denotes | IκB-α |
R4891 | T5673 | T5671 | themeOf | p65,interference |
R4892 | T5674 | T5672 | themeOf | IκB-α,interference |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T5820 | 105-108 | Q04206 | denotes | p65 |
T5821 | 105-108 | P21579 | denotes | p65 |
T5822 | 155-158 | Q04206 | denotes | p65 |
T5823 | 155-158 | P21579 | denotes | p65 |