PMC:2889865 / 31744-32647
Annnotations
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14699 | 0-7 | JJ | denotes | Reverse |
T14700 | 8-21 | NN | denotes | transcription |
T14701 | 22-34 | JJ | denotes | quantitative |
T14702 | 35-38 | NN | denotes | PCR |
T14703 | 39-40 | -LRB- | denotes | ( |
T14704 | 40-47 | NN | denotes | RT-qPCR |
T14705 | 47-48 | -RRB- | denotes | ) |
T14706 | 49-56 | NN | denotes | RT-qPCR |
T14707 | 57-60 | VB | denotes | was |
T14708 | 61-65 | VB | denotes | used |
T14709 | 66-68 | TO | denotes | to |
T14710 | 69-78 | VB | denotes | determine |
T14711 | 79-83 | NN | denotes | gene |
T14712 | 84-94 | NN | denotes | expression |
T14713 | 95-101 | NN | denotes | levels |
T14714 | 102-104 | IN | denotes | of |
T14715 | 105-109 | NN | denotes | il-6 |
T14716 | 110-113 | CC | denotes | and |
T14717 | 114-119 | NN | denotes | cxcl8 |
T14718 | 120-122 | IN | denotes | in |
T14719 | 123-131 | NN | denotes | response |
T14720 | 132-134 | TO | denotes | to |
T14721 | 135-138 | NN | denotes | PMA |
T14722 | 139-148 | VB | denotes | following |
T14723 | 149-159 | NN | denotes | inhibition |
T14724 | 160-162 | IN | denotes | of |
T14725 | 163-168 | NN | denotes | NF-κB |
T14726 | 168-169 | -COMMA- | denotes | , |
T14727 | 170-173 | NN | denotes | JNK |
T14728 | 174-177 | CC | denotes | and |
T14729 | 178-181 | NN | denotes | PKC |
T14730 | 183-186 | DT | denotes | The |
T14731 | 187-196 | VB | denotes | following |
T14732 | 197-203 | NN | denotes | primer |
T14733 | 204-213 | NN | denotes | sequences |
T14734 | 214-218 | VB | denotes | were |
T14735 | 219-223 | VB | denotes | used |
T14736 | 223-224 | -COMMA- | denotes | , |
T14737 | 225-229 | NN | denotes | il-6 |
T14738 | 229-230 | -COLON- | denotes | : |
T14739 | 231-239 | JJ | denotes | forward- |
T14740 | 240-264 | NN | denotes | TGTGAAAGCAGCAAAGAGGCACTG |
T14741 | 264-265 | -COMMA- | denotes | , |
T14742 | 266-274 | NN | denotes | reverse- |
T14743 | 275-299 | NN | denotes | ACAGCTCTGGCTTGTTCCTCACTA |
T14744 | 299-300 | -COLON- | denotes | ; |
T14745 | 301-306 | NN | denotes | cxcl8 |
T14746 | 306-307 | -COLON- | denotes | : |
T14747 | 308-316 | JJ | denotes | forward- |
T14748 | 317-341 | NN | denotes | ACCACACTGCGCCAACACAGAAAT |
T14749 | 341-342 | -COMMA- | denotes | , |
T14750 | 343-351 | NN | denotes | reverse- |
T14751 | 352-376 | NN | denotes | AAACTTCTCCACAACCCTCTGCAC |
T14752 | 378-391 | VB | denotes | Thermocycling |
T14753 | 392-402 | NN | denotes | conditions |
T14754 | 403-406 | IN | denotes | for |
T14755 | 407-411 | NN | denotes | CYBR |
T14756 | 412-417 | NNP | denotes | Green |
T14757 | 418-419 | -LRB- | denotes | ( |
T14758 | 419-425 | NNP | denotes | Quanta |
T14759 | 425-426 | -COMMA- | denotes | , |
T14760 | 427-430 | NNP | denotes | USA |
T14761 | 430-431 | -RRB- | denotes | ) |
T14762 | 432-441 | VB | denotes | consisted |
T14763 | 442-444 | IN | denotes | of |
T14764 | 445-446 | DT | denotes | a |
T14765 | 447-459 | NN | denotes | denaturation |
T14766 | 460-464 | NN | denotes | step |
T14767 | 465-468 | IN | denotes | for |
T14768 | 469-471 | CD | denotes | 10 |
T14769 | 472-475 | NN | denotes | min |
T14770 | 476-478 | IN | denotes | at |
T14771 | 479-481 | CD | denotes | 95 |
T14772 | 482-484 | NN | denotes | °C |
T14773 | 485-493 | VB | denotes | followed |
T14774 | 494-496 | IN | denotes | by |
T14775 | 497-499 | CD | denotes | 60 |
T14776 | 500-506 | NN | denotes | cycles |
T14777 | 507-509 | IN | denotes | of |
T14778 | 510-514 | NN | denotes | 95°C |
T14779 | 515-518 | IN | denotes | for |
T14780 | 519-521 | NN | denotes | 1s |
T14781 | 522-525 | CC | denotes | and |
T14782 | 526-530 | NN | denotes | 60°C |
T14783 | 531-534 | IN | denotes | for |
T14784 | 535-538 | CD | denotes | 30s |
T14785 | 540-544 | NN | denotes | Gene |
T14786 | 545-555 | NN | denotes | expression |
T14787 | 556-559 | VB | denotes | was |
T14788 | 560-568 | VB | denotes | analysed |
T14789 | 569-574 | VB | denotes | using |
T14790 | 575-585 | NN | denotes | Stratagene |
T14791 | 586-587 | -LRB- | denotes | ( |
T14792 | 587-595 | NN | denotes | Mx3000p™ |
T14793 | 595-596 | -RRB- | denotes | ) |
T14794 | 597-598 | -LRB- | denotes | ( |
T14795 | 598-600 | NN | denotes | AH |
T14796 | 601-612 | NN | denotes | diagnostics |
T14797 | 612-613 | -RRB- | denotes | ) |
T14798 | 615-618 | DT | denotes | The |
T14799 | 619-627 | VB | denotes | obtained |
T14800 | 628-630 | NN | denotes | Ct |
T14801 | 631-637 | NN | denotes | values |
T14802 | 638-642 | VB | denotes | were |
T14803 | 643-653 | VB | denotes | normalized |
T14804 | 654-661 | IN | denotes | against |
T14805 | 662-665 | NN | denotes | 18S |
T14806 | 667-676 | RB | denotes | Initially |
T14807 | 676-677 | -COMMA- | denotes | , |
T14808 | 678-681 | DT | denotes | all |
T14809 | 682-690 | VB | denotes | measured |
T14810 | 691-694 | NN | denotes | 18S |
T14811 | 695-697 | NN | denotes | Ct |
T14812 | 698-704 | NN | denotes | values |
T14813 | 705-709 | VB | denotes | were |
T14814 | 710-714 | VB | denotes | used |
T14815 | 715-717 | TO | denotes | to |
T14816 | 718-727 | VB | denotes | calculate |
T14817 | 728-729 | DT | denotes | a |
T14818 | 730-734 | JJ | denotes | mean |
T14819 | 735-737 | NN | denotes | Ct |
T14820 | 738-743 | NN | denotes | value |
T14821 | 744-748 | WDT | denotes | that |
T14822 | 749-752 | VB | denotes | was |
T14823 | 753-757 | VB | denotes | used |
T14824 | 758-760 | TO | denotes | to |
T14825 | 761-770 | VB | denotes | determine |
T14826 | 771-774 | DT | denotes | the |
T14827 | 775-778 | NN | denotes | ΔCt |
T14828 | 779-785 | NN | denotes | values |
T14829 | 786-789 | IN | denotes | for |
T14830 | 790-794 | DT | denotes | each |
T14831 | 795-801 | NN | denotes | sample |
T14832 | 803-807 | NN | denotes | Gene |
T14833 | 808-818 | NN | denotes | expression |
T14834 | 819-827 | NN | denotes | patterns |
T14835 | 828-831 | IN | denotes | for |
T14836 | 832-836 | NN | denotes | il-6 |
T14837 | 837-840 | CC | denotes | and |
T14838 | 841-846 | NN | denotes | cxcl8 |
T14839 | 847-851 | VB | denotes | were |
T14840 | 852-856 | RB | denotes | then |
T14841 | 857-867 | VB | denotes | normalized |
T14842 | 868-872 | IN | denotes | with |
T14843 | 873-879 | NN | denotes | regard |
T14844 | 880-882 | TO | denotes | to |
T14845 | 883-886 | DT | denotes | the |
T14846 | 887-894 | NN | denotes | samples |
T14847 | 895-898 | NN | denotes | 18S |
T14848 | 899-902 | NNP | denotes | ΔCt |
R11930 | T14702 | T14699 | arg1Of | PCR,Reverse |
R11931 | T14702 | T14700 | arg1Of | PCR,transcription |
R11932 | T14702 | T14701 | arg1Of | PCR,quantitative |
R11933 | T14702 | T14703 | arg1Of | PCR,( |
R11934 | T14704 | T14703 | arg2Of | RT-qPCR,( |
R11935 | T14705 | T14703 | arg3Of | ),( |
R11936 | T14706 | T14707 | arg1Of | RT-qPCR,was |
R11937 | T14706 | T14708 | arg2Of | RT-qPCR,used |
R11938 | T14708 | T14707 | arg2Of | used,was |
R11939 | T14708 | T14718 | arg1Of | used,in |
R11940 | T14708 | T14722 | arg1Of | used,following |
R11941 | T14710 | T14708 | arg3Of | determine,used |
R11942 | T14710 | T14709 | arg1Of | determine,to |
R11943 | T14713 | T14710 | arg2Of | levels,determine |
R11944 | T14713 | T14711 | arg1Of | levels,gene |
R11945 | T14713 | T14712 | arg1Of | levels,expression |
R11946 | T14713 | T14714 | arg1Of | levels,of |
R11947 | T14715 | T14716 | arg1Of | il-6,and |
R11948 | T14716 | T14714 | arg2Of | and,of |
R11949 | T14717 | T14716 | arg2Of | cxcl8,and |
R11950 | T14718 | T14720 | arg1Of | in,to |
R11951 | T14719 | T14718 | arg2Of | response,in |
R11952 | T14721 | T14718 | arg3Of | PMA,in |
R11953 | T14723 | T14722 | arg2Of | inhibition,following |
R11954 | T14723 | T14724 | arg1Of | inhibition,of |
R11955 | T14725 | T14726 | arg1Of | NF-κB,"," |
R11956 | T14726 | T14728 | arg1Of | ",",and |
R11957 | T14727 | T14726 | arg2Of | JNK,"," |
R11958 | T14728 | T14724 | arg2Of | and,of |
R11959 | T14729 | T14728 | arg2Of | PKC,and |
R11960 | T14733 | T14730 | arg1Of | sequences,The |
R11961 | T14733 | T14731 | arg1Of | sequences,following |
R11962 | T14733 | T14732 | arg1Of | sequences,primer |
R11963 | T14733 | T14734 | arg1Of | sequences,were |
R11964 | T14733 | T14735 | arg2Of | sequences,used |
R11965 | T14735 | T14734 | arg2Of | used,were |
R11966 | T14735 | T14736 | arg1Of | used,"," |
R11967 | T14737 | T14735 | arg3Of | il-6,used |
R11968 | T14737 | T14738 | arg1Of | il-6,: |
R11969 | T14740 | T14738 | arg2Of | TGTGAAAGCAGCAAAGAGGCACTG,: |
R11970 | T14740 | T14739 | arg1Of | TGTGAAAGCAGCAAAGAGGCACTG,forward- |
R11971 | T14740 | T14741 | arg1Of | TGTGAAAGCAGCAAAGAGGCACTG,"," |
R11972 | T14740 | T14744 | arg1Of | TGTGAAAGCAGCAAAGAGGCACTG,; |
R11973 | T14743 | T14741 | arg2Of | ACAGCTCTGGCTTGTTCCTCACTA,"," |
R11974 | T14743 | T14742 | arg1Of | ACAGCTCTGGCTTGTTCCTCACTA,reverse- |
R11975 | T14745 | T14744 | arg2Of | cxcl8,; |
R11976 | T14745 | T14746 | arg1Of | cxcl8,: |
R11977 | T14748 | T14746 | arg2Of | ACCACACTGCGCCAACACAGAAAT,: |
R11978 | T14748 | T14747 | arg1Of | ACCACACTGCGCCAACACAGAAAT,forward- |
R11979 | T14748 | T14749 | arg1Of | ACCACACTGCGCCAACACAGAAAT,"," |
R11980 | T14751 | T14749 | arg2Of | AAACTTCTCCACAACCCTCTGCAC,"," |
R11981 | T14751 | T14750 | arg1Of | AAACTTCTCCACAACCCTCTGCAC,reverse- |
R11982 | T14753 | T14752 | arg1Of | conditions,Thermocycling |
R11983 | T14753 | T14754 | arg1Of | conditions,for |
R11984 | T14753 | T14762 | arg1Of | conditions,consisted |
R11985 | T14756 | T14754 | arg2Of | Green,for |
R11986 | T14756 | T14755 | arg1Of | Green,CYBR |
R11987 | T14756 | T14757 | arg1Of | Green,( |
R11988 | T14758 | T14757 | arg2Of | Quanta,( |
R11989 | T14758 | T14759 | arg1Of | Quanta,"," |
R11990 | T14758 | T14760 | arg1Of | Quanta,USA |
R11991 | T14761 | T14757 | arg3Of | ),( |
R11992 | T14762 | T14763 | arg1Of | consisted,of |
R11993 | T14762 | T14773 | modOf | consisted,followed |
R11994 | T14766 | T14763 | arg2Of | step,of |
R11995 | T14766 | T14764 | arg1Of | step,a |
R11996 | T14766 | T14765 | arg1Of | step,denaturation |
R11997 | T14766 | T14767 | arg1Of | step,for |
R11998 | T14769 | T14767 | arg2Of | min,for |
R11999 | T14769 | T14768 | arg1Of | min,10 |
R12000 | T14769 | T14770 | arg1Of | min,at |
R12001 | T14772 | T14770 | arg2Of | °C,at |
R12002 | T14772 | T14771 | arg1Of | °C,95 |
R12003 | T14776 | T14773 | arg1Of | cycles,followed |
R12004 | T14776 | T14774 | arg2Of | cycles,by |
R12005 | T14776 | T14775 | arg1Of | cycles,60 |
R12006 | T14776 | T14777 | arg1Of | cycles,of |
R12007 | T14778 | T14777 | arg2Of | 95°C,of |
R12008 | T14778 | T14779 | arg1Of | 95°C,for |
R12009 | T14780 | T14781 | arg1Of | 1s,and |
R12010 | T14781 | T14779 | arg2Of | and,for |
R12011 | T14782 | T14781 | arg2Of | 60°C,and |
R12012 | T14782 | T14783 | arg1Of | 60°C,for |
R12013 | T14784 | T14783 | arg2Of | 30s,for |
R12014 | T14786 | T14785 | arg1Of | expression,Gene |
R12015 | T14786 | T14787 | arg1Of | expression,was |
R12016 | T14786 | T14788 | arg2Of | expression,analysed |
R12017 | T14788 | T14787 | arg2Of | analysed,was |
R12018 | T14788 | T14789 | modOf | analysed,using |
R12019 | T14790 | T14789 | arg2Of | Stratagene,using |
R12020 | T14790 | T14791 | arg1Of | Stratagene,( |
R12021 | T14790 | T14794 | arg1Of | Stratagene,( |
R12022 | T14792 | T14791 | arg2Of | Mx3000p™,( |
R12023 | T14793 | T14791 | arg3Of | ),( |
R12024 | T14796 | T14794 | arg2Of | diagnostics,( |
R12025 | T14796 | T14795 | arg1Of | diagnostics,AH |
R12026 | T14797 | T14794 | arg3Of | ),( |
R12027 | T14801 | T14798 | arg1Of | values,The |
R12028 | T14801 | T14799 | arg2Of | values,obtained |
R12029 | T14801 | T14800 | arg1Of | values,Ct |
R12030 | T14801 | T14802 | arg1Of | values,were |
R12031 | T14801 | T14803 | arg2Of | values,normalized |
R12032 | T14803 | T14802 | arg2Of | normalized,were |
R12033 | T14803 | T14804 | arg1Of | normalized,against |
R12034 | T14805 | T14804 | arg2Of | 18S,against |
R12035 | T14812 | T14808 | arg1Of | values,all |
R12036 | T14812 | T14809 | arg2Of | values,measured |
R12037 | T14812 | T14810 | arg1Of | values,18S |
R12038 | T14812 | T14811 | arg1Of | values,Ct |
R12039 | T14812 | T14813 | arg1Of | values,were |
R12040 | T14812 | T14814 | arg2Of | values,used |
R12041 | T14814 | T14806 | arg1Of | used,Initially |
R12042 | T14814 | T14807 | arg1Of | used,"," |
R12043 | T14814 | T14813 | arg2Of | used,were |
R12044 | T14816 | T14814 | arg3Of | calculate,used |
R12045 | T14816 | T14815 | arg1Of | calculate,to |
R12046 | T14820 | T14816 | arg2Of | value,calculate |
R12047 | T14820 | T14817 | arg1Of | value,a |
R12048 | T14820 | T14818 | arg1Of | value,mean |
R12049 | T14820 | T14819 | arg1Of | value,Ct |
R12050 | T14820 | T14821 | arg1Of | value,that |
R12051 | T14820 | T14822 | arg1Of | value,was |
R12052 | T14820 | T14823 | arg2Of | value,used |
R12053 | T14823 | T14822 | arg2Of | used,was |
R12054 | T14823 | T14824 | modOf | used,to |
R12055 | T14825 | T14824 | arg1Of | determine,to |
R12056 | T14828 | T14825 | arg2Of | values,determine |
R12057 | T14828 | T14826 | arg1Of | values,the |
R12058 | T14828 | T14827 | arg1Of | values,ΔCt |
R12059 | T14828 | T14829 | arg1Of | values,for |
R12060 | T14831 | T14829 | arg2Of | sample,for |
R12061 | T14831 | T14830 | arg1Of | sample,each |
R12062 | T14834 | T14832 | arg1Of | patterns,Gene |
R12063 | T14834 | T14833 | arg1Of | patterns,expression |
R12064 | T14834 | T14835 | arg1Of | patterns,for |
R12065 | T14834 | T14839 | arg1Of | patterns,were |
R12066 | T14834 | T14841 | arg2Of | patterns,normalized |
R12067 | T14836 | T14837 | arg1Of | il-6,and |
R12068 | T14837 | T14835 | arg2Of | and,for |
R12069 | T14838 | T14837 | arg2Of | cxcl8,and |
R12070 | T14841 | T14839 | arg2Of | normalized,were |
R12071 | T14841 | T14840 | arg1Of | normalized,then |
R12072 | T14841 | T14842 | arg1Of | normalized,with |
R12073 | T14843 | T14842 | arg2Of | regard,with |
R12074 | T14843 | T14844 | arg1Of | regard,to |
R12075 | T14848 | T14844 | arg2Of | ΔCt,to |
R12076 | T14848 | T14845 | arg1Of | ΔCt,the |
R12077 | T14848 | T14846 | arg1Of | ΔCt,samples |
R12078 | T14848 | T14847 | arg1Of | ΔCt,18S |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14532 | 0-7 | VB | denotes | Reverse |
T14533 | 8-21 | NN | denotes | transcription |
T14534 | 22-34 | JJ | denotes | quantitative |
T14535 | 35-38 | NNP | denotes | PCR |
T14536 | 39-40 | -LRB- | denotes | ( |
T14537 | 40-47 | NNP | denotes | RT-qPCR |
T14538 | 47-48 | -RRB- | denotes | ) |
T14539 | 49-56 | NN | denotes | RT-qPCR |
T14540 | 57-60 | VBD | denotes | was |
T14541 | 61-65 | VBN | denotes | used |
T14542 | 66-68 | TO | denotes | to |
T14543 | 69-78 | VB | denotes | determine |
T14544 | 79-83 | NN | denotes | gene |
T14545 | 84-94 | NN | denotes | expression |
T14546 | 95-101 | NNS | denotes | levels |
T14547 | 102-104 | IN | denotes | of |
T14548 | 105-109 | JJ | denotes | il-6 |
T14549 | 110-113 | CC | denotes | and |
T14550 | 114-119 | CD | denotes | cxcl8 |
T14551 | 120-122 | IN | denotes | in |
T14552 | 123-131 | NN | denotes | response |
T14553 | 132-134 | TO | denotes | to |
T14554 | 135-138 | NNP | denotes | PMA |
T14555 | 139-148 | VBG | denotes | following |
T14556 | 149-159 | NN | denotes | inhibition |
T14557 | 160-162 | IN | denotes | of |
T14558 | 163-168 | NNP | denotes | NF-κB |
T14559 | 168-169 | , | denotes | , |
T14560 | 170-173 | NNP | denotes | JNK |
T14561 | 174-177 | CC | denotes | and |
T14562 | 178-181 | NNP | denotes | PKC |
T14563 | 181-182 | . | denotes | . |
T14564 | 183-186 | DT | denotes | The |
T14565 | 187-196 | JJ | denotes | following |
T14566 | 197-203 | NN | denotes | primer |
T14567 | 204-213 | NNS | denotes | sequences |
T14568 | 214-218 | VBD | denotes | were |
T14569 | 219-223 | VBN | denotes | used |
T14570 | 223-224 | , | denotes | , |
T14571 | 225-229 | JJ | denotes | il-6 |
T14572 | 229-230 | : | denotes | : |
T14573 | 231-238 | RB | denotes | forward |
T14574 | 238-239 | : | denotes | - |
T14575 | 240-264 | NNP | denotes | TGTGAAAGCAGCAAAGAGGCACTG |
T14576 | 264-265 | , | denotes | , |
T14577 | 266-273 | NN | denotes | reverse |
T14578 | 273-274 | : | denotes | - |
T14579 | 275-299 | NNP | denotes | ACAGCTCTGGCTTGTTCCTCACTA |
T14580 | 299-300 | : | denotes | ; |
T14581 | 301-306 | CD | denotes | cxcl8 |
T14582 | 306-307 | : | denotes | : |
T14583 | 308-315 | RB | denotes | forward |
T14584 | 315-316 | : | denotes | - |
T14585 | 317-341 | NNP | denotes | ACCACACTGCGCCAACACAGAAAT |
T14586 | 341-342 | , | denotes | , |
T14587 | 343-350 | NN | denotes | reverse |
T14588 | 350-351 | : | denotes | - |
T14589 | 352-376 | NNP | denotes | AAACTTCTCCACAACCCTCTGCAC |
T14590 | 376-377 | . | denotes | . |
T14591 | 378-391 | VBG | denotes | Thermocycling |
T14592 | 392-402 | NNS | denotes | conditions |
T14593 | 403-406 | IN | denotes | for |
T14594 | 407-411 | NNP | denotes | CYBR |
T14595 | 412-417 | NNP | denotes | Green |
T14596 | 418-419 | -LRB- | denotes | ( |
T14597 | 419-425 | NNP | denotes | Quanta |
T14598 | 425-426 | , | denotes | , |
T14599 | 427-430 | NNP | denotes | USA |
T14600 | 430-431 | -RRB- | denotes | ) |
T14601 | 432-441 | VBD | denotes | consisted |
T14602 | 442-444 | IN | denotes | of |
T14603 | 445-446 | DT | denotes | a |
T14604 | 447-459 | NN | denotes | denaturation |
T14605 | 460-464 | NN | denotes | step |
T14606 | 465-468 | IN | denotes | for |
T14607 | 469-471 | CD | denotes | 10 |
T14608 | 472-475 | NN | denotes | min |
T14609 | 476-478 | IN | denotes | at |
T14610 | 479-481 | CD | denotes | 95 |
T14611 | 482-483 | CD | denotes | ° |
T14612 | 483-484 | NNP | denotes | C |
T14613 | 485-493 | VBN | denotes | followed |
T14614 | 494-496 | IN | denotes | by |
T14615 | 497-499 | CD | denotes | 60 |
T14616 | 500-506 | NNS | denotes | cycles |
T14617 | 507-509 | IN | denotes | of |
T14618 | 510-512 | CD | denotes | 95 |
T14619 | 512-513 | CD | denotes | ° |
T14620 | 513-514 | NNP | denotes | C |
T14621 | 515-518 | IN | denotes | for |
T14622 | 519-521 | NNS | denotes | 1s |
T14623 | 522-525 | CC | denotes | and |
T14624 | 526-528 | CD | denotes | 60 |
T14625 | 528-529 | NN | denotes | ° |
T14626 | 529-530 | NNP | denotes | C |
T14627 | 531-534 | IN | denotes | for |
T14628 | 535-538 | CD | denotes | 30s |
T14629 | 538-539 | . | denotes | . |
T14630 | 540-544 | NNP | denotes | Gene |
T14631 | 545-555 | NN | denotes | expression |
T14632 | 556-559 | VBD | denotes | was |
T14633 | 560-568 | VBN | denotes | analysed |
T14634 | 569-574 | VBG | denotes | using |
T14635 | 575-585 | NNP | denotes | Stratagene |
T14636 | 586-587 | -LRB- | denotes | ( |
T14637 | 587-594 | NNP | denotes | Mx3000p |
T14638 | 594-595 | NNP | denotes | ™ |
T14639 | 595-596 | -RRB- | denotes | ) |
T14640 | 597-598 | -LRB- | denotes | ( |
T14641 | 598-600 | NNP | denotes | AH |
T14642 | 601-612 | NNS | denotes | diagnostics |
T14643 | 612-613 | -RRB- | denotes | ) |
T14644 | 613-614 | . | denotes | . |
T14645 | 615-618 | DT | denotes | The |
T14646 | 619-627 | VBN | denotes | obtained |
T14647 | 628-630 | NNP | denotes | Ct |
T14648 | 631-637 | NNS | denotes | values |
T14649 | 638-642 | VBD | denotes | were |
T14650 | 643-653 | VBN | denotes | normalized |
T14651 | 654-661 | IN | denotes | against |
T14652 | 662-665 | NNP | denotes | 18S |
T14653 | 665-666 | . | denotes | . |
T14654 | 667-676 | RB | denotes | Initially |
T14655 | 676-677 | , | denotes | , |
T14656 | 678-681 | DT | denotes | all |
T14657 | 682-690 | VBN | denotes | measured |
T14658 | 691-694 | NNP | denotes | 18S |
T14659 | 695-697 | NNP | denotes | Ct |
T14660 | 698-704 | NNS | denotes | values |
T14661 | 705-709 | VBD | denotes | were |
T14662 | 710-714 | VBN | denotes | used |
T14663 | 715-717 | TO | denotes | to |
T14664 | 718-727 | VB | denotes | calculate |
T14665 | 728-729 | DT | denotes | a |
T14666 | 730-734 | JJ | denotes | mean |
T14667 | 735-737 | JJ | denotes | Ct |
T14668 | 738-743 | NN | denotes | value |
T14669 | 744-748 | WDT | denotes | that |
T14670 | 749-752 | VBD | denotes | was |
T14671 | 753-757 | VBN | denotes | used |
T14672 | 758-760 | TO | denotes | to |
T14673 | 761-770 | VB | denotes | determine |
T14674 | 771-774 | DT | denotes | the |
T14675 | 775-778 | NNP | denotes | ΔCt |
T14676 | 779-785 | NNS | denotes | values |
T14677 | 786-789 | IN | denotes | for |
T14678 | 790-794 | DT | denotes | each |
T14679 | 795-801 | NN | denotes | sample |
T14680 | 801-802 | . | denotes | . |
T14681 | 803-807 | NNP | denotes | Gene |
T14682 | 808-818 | NN | denotes | expression |
T14683 | 819-827 | NNS | denotes | patterns |
T14684 | 828-831 | IN | denotes | for |
T14685 | 832-836 | JJ | denotes | il-6 |
T14686 | 837-840 | CC | denotes | and |
T14687 | 841-846 | CD | denotes | cxcl8 |
T14688 | 847-851 | VBD | denotes | were |
T14689 | 852-856 | RB | denotes | then |
T14690 | 857-867 | VBN | denotes | normalized |
T14691 | 868-872 | IN | denotes | with |
T14692 | 873-879 | NN | denotes | regard |
T14693 | 880-882 | TO | denotes | to |
T14694 | 883-886 | DT | denotes | the |
T14695 | 887-894 | NNS | denotes | samples |
T14696 | 895-898 | NNP | denotes | 18S |
T14697 | 899-902 | NNP | denotes | ΔCt |
T14698 | 902-903 | . | denotes | . |
R11763 | T14532 | T14541 | advcl | Reverse,used |
R11764 | T14533 | T14532 | dobj | transcription,Reverse |
R11765 | T14534 | T14535 | amod | quantitative,PCR |
R11766 | T14535 | T14539 | nmod | PCR,RT-qPCR |
R11767 | T14536 | T14535 | punct | (,PCR |
R11768 | T14537 | T14535 | appos | RT-qPCR,PCR |
R11769 | T14538 | T14535 | punct | ),PCR |
R11770 | T14539 | T14541 | nsubjpass | RT-qPCR,used |
R11771 | T14540 | T14541 | auxpass | was,used |
R11772 | T14541 | T14541 | ROOT | used,used |
R11773 | T14542 | T14543 | aux | to,determine |
R11774 | T14543 | T14541 | xcomp | determine,used |
R11775 | T14544 | T14545 | compound | gene,expression |
R11776 | T14545 | T14546 | compound | expression,levels |
R11777 | T14546 | T14543 | dobj | levels,determine |
R11778 | T14547 | T14546 | prep | of,levels |
R11779 | T14548 | T14547 | pobj | il-6,of |
R11780 | T14549 | T14548 | cc | and,il-6 |
R11781 | T14550 | T14548 | conj | cxcl8,il-6 |
R11782 | T14551 | T14543 | prep | in,determine |
R11783 | T14552 | T14551 | pobj | response,in |
R11784 | T14553 | T14552 | prep | to,response |
R11785 | T14554 | T14555 | neg | PMA,following |
R11786 | T14555 | T14541 | prep | following,used |
R11787 | T14556 | T14555 | dobj | inhibition,following |
R11788 | T14557 | T14556 | prep | of,inhibition |
R11789 | T14558 | T14557 | pobj | NF-κB,of |
R11790 | T14559 | T14558 | punct | ",",NF-κB |
R11791 | T14560 | T14558 | conj | JNK,NF-κB |
R11792 | T14561 | T14560 | cc | and,JNK |
R11793 | T14562 | T14560 | conj | PKC,JNK |
R11794 | T14563 | T14541 | punct | .,used |
R11795 | T14564 | T14567 | det | The,sequences |
R11796 | T14565 | T14567 | amod | following,sequences |
R11797 | T14566 | T14567 | compound | primer,sequences |
R11798 | T14567 | T14569 | nsubjpass | sequences,used |
R11799 | T14568 | T14569 | auxpass | were,used |
R11800 | T14569 | T14569 | ROOT | used,used |
R11801 | T14570 | T14579 | punct | ",",ACAGCTCTGGCTTGTTCCTCACTA |
R11802 | T14571 | T14579 | amod | il-6,ACAGCTCTGGCTTGTTCCTCACTA |
R11803 | T14572 | T14579 | punct | :,ACAGCTCTGGCTTGTTCCTCACTA |
R11804 | T14573 | T14579 | advmod | forward,ACAGCTCTGGCTTGTTCCTCACTA |
R11805 | T14574 | T14575 | punct | -,TGTGAAAGCAGCAAAGAGGCACTG |
R11806 | T14575 | T14579 | nmod | TGTGAAAGCAGCAAAGAGGCACTG,ACAGCTCTGGCTTGTTCCTCACTA |
R11807 | T14576 | T14577 | punct | ",",reverse |
R11808 | T14577 | T14579 | nmod | reverse,ACAGCTCTGGCTTGTTCCTCACTA |
R11809 | T14578 | T14579 | punct | -,ACAGCTCTGGCTTGTTCCTCACTA |
R11810 | T14579 | T14569 | dobj | ACAGCTCTGGCTTGTTCCTCACTA,used |
R11811 | T14580 | T14579 | punct | ;,ACAGCTCTGGCTTGTTCCTCACTA |
R11812 | T14581 | T14585 | nummod | cxcl8,ACCACACTGCGCCAACACAGAAAT |
R11813 | T14582 | T14585 | punct | :,ACCACACTGCGCCAACACAGAAAT |
R11814 | T14583 | T14585 | meta | forward,ACCACACTGCGCCAACACAGAAAT |
R11815 | T14584 | T14585 | punct | -,ACCACACTGCGCCAACACAGAAAT |
R11816 | T14585 | T14579 | appos | ACCACACTGCGCCAACACAGAAAT,ACAGCTCTGGCTTGTTCCTCACTA |
R11817 | T14586 | T14587 | punct | ",",reverse |
R11818 | T14587 | T14589 | nmod | reverse,AAACTTCTCCACAACCCTCTGCAC |
R11819 | T14588 | T14589 | punct | -,AAACTTCTCCACAACCCTCTGCAC |
R11820 | T14589 | T14585 | dobj | AAACTTCTCCACAACCCTCTGCAC,ACCACACTGCGCCAACACAGAAAT |
R11821 | T14590 | T14569 | punct | .,used |
R11822 | T14591 | T14601 | csubj | Thermocycling,consisted |
R11823 | T14592 | T14591 | dobj | conditions,Thermocycling |
R11824 | T14593 | T14601 | mark | for,consisted |
R11825 | T14594 | T14595 | compound | CYBR,Green |
R11826 | T14595 | T14593 | pobj | Green,for |
R11827 | T14596 | T14597 | punct | (,Quanta |
R11828 | T14597 | T14595 | appos | Quanta,Green |
R11829 | T14598 | T14597 | punct | ",",Quanta |
R11830 | T14599 | T14597 | appos | USA,Quanta |
R11831 | T14600 | T14597 | punct | ),Quanta |
R11832 | T14601 | T14601 | ROOT | consisted,consisted |
R11833 | T14602 | T14601 | prep | of,consisted |
R11834 | T14603 | T14605 | det | a,step |
R11835 | T14604 | T14605 | compound | denaturation,step |
R11836 | T14605 | T14602 | pobj | step,of |
R11837 | T14606 | T14605 | prep | for,step |
R11838 | T14607 | T14608 | nummod | 10,min |
R11839 | T14608 | T14606 | pobj | min,for |
R11840 | T14609 | T14601 | prep | at,consisted |
R11841 | T14610 | T14609 | pobj | 95,at |
R11842 | T14611 | T14612 | nummod | °,C |
R11843 | T14612 | T14601 | dobj | C,consisted |
R11844 | T14613 | T14601 | advcl | followed,consisted |
R11845 | T14614 | T14613 | agent | by,followed |
R11846 | T14615 | T14616 | nummod | 60,cycles |
R11847 | T14616 | T14614 | pobj | cycles,by |
R11848 | T14617 | T14616 | prep | of,cycles |
R11849 | T14618 | T14620 | nummod | 95,C |
R11850 | T14619 | T14620 | nummod | °,C |
R11851 | T14620 | T14617 | pobj | C,of |
R11852 | T14621 | T14613 | prep | for,followed |
R11853 | T14622 | T14621 | pobj | 1s,for |
R11854 | T14623 | T14622 | cc | and,1s |
R11855 | T14624 | T14625 | nummod | 60,° |
R11856 | T14625 | T14626 | compound | °,C |
R11857 | T14626 | T14622 | conj | C,1s |
R11858 | T14627 | T14613 | prep | for,followed |
R11859 | T14628 | T14627 | pobj | 30s,for |
R11860 | T14629 | T14601 | punct | .,consisted |
R11861 | T14630 | T14631 | compound | Gene,expression |
R11862 | T14631 | T14633 | nsubjpass | expression,analysed |
R11863 | T14632 | T14633 | auxpass | was,analysed |
R11864 | T14633 | T14633 | ROOT | analysed,analysed |
R11865 | T14634 | T14633 | advcl | using,analysed |
R11866 | T14635 | T14634 | dobj | Stratagene,using |
R11867 | T14636 | T14638 | punct | (,™ |
R11868 | T14637 | T14638 | compound | Mx3000p,™ |
R11869 | T14638 | T14635 | appos | ™,Stratagene |
R11870 | T14639 | T14638 | punct | ),™ |
R11871 | T14640 | T14642 | punct | (,diagnostics |
R11872 | T14641 | T14642 | compound | AH,diagnostics |
R11873 | T14642 | T14638 | appos | diagnostics,™ |
R11874 | T14643 | T14638 | punct | ),™ |
R11875 | T14644 | T14633 | punct | .,analysed |
R11876 | T14645 | T14648 | det | The,values |
R11877 | T14646 | T14648 | amod | obtained,values |
R11878 | T14647 | T14648 | amod | Ct,values |
R11879 | T14648 | T14649 | nsubj | values,were |
R11880 | T14649 | T14649 | ROOT | were,were |
R11881 | T14650 | T14649 | acomp | normalized,were |
R11882 | T14651 | T14650 | prep | against,normalized |
R11883 | T14652 | T14651 | pobj | 18S,against |
R11884 | T14653 | T14649 | punct | .,were |
R11885 | T14654 | T14662 | advmod | Initially,used |
R11886 | T14655 | T14662 | punct | ",",used |
R11887 | T14656 | T14660 | det | all,values |
R11888 | T14657 | T14660 | amod | measured,values |
R11889 | T14658 | T14660 | compound | 18S,values |
R11890 | T14659 | T14660 | compound | Ct,values |
R11891 | T14660 | T14662 | nsubjpass | values,used |
R11892 | T14661 | T14662 | auxpass | were,used |
R11893 | T14662 | T14662 | ROOT | used,used |
R11894 | T14663 | T14664 | aux | to,calculate |
R11895 | T14664 | T14662 | xcomp | calculate,used |
R11896 | T14665 | T14668 | det | a,value |
R11897 | T14666 | T14668 | amod | mean,value |
R11898 | T14667 | T14668 | amod | Ct,value |
R11899 | T14668 | T14664 | dobj | value,calculate |
R11900 | T14669 | T14671 | nsubjpass | that,used |
R11901 | T14670 | T14671 | auxpass | was,used |
R11902 | T14671 | T14668 | relcl | used,value |
R11903 | T14672 | T14673 | aux | to,determine |
R11904 | T14673 | T14671 | xcomp | determine,used |
R11905 | T14674 | T14676 | det | the,values |
R11906 | T14675 | T14676 | compound | ΔCt,values |
R11907 | T14676 | T14673 | dobj | values,determine |
R11908 | T14677 | T14676 | prep | for,values |
R11909 | T14678 | T14679 | det | each,sample |
R11910 | T14679 | T14677 | pobj | sample,for |
R11911 | T14680 | T14662 | punct | .,used |
R11912 | T14681 | T14683 | compound | Gene,patterns |
R11913 | T14682 | T14683 | compound | expression,patterns |
R11914 | T14683 | T14690 | nsubjpass | patterns,normalized |
R11915 | T14684 | T14683 | prep | for,patterns |
R11916 | T14685 | T14684 | pobj | il-6,for |
R11917 | T14686 | T14685 | cc | and,il-6 |
R11918 | T14687 | T14685 | nummod | cxcl8,il-6 |
R11919 | T14688 | T14690 | auxpass | were,normalized |
R11920 | T14689 | T14690 | advmod | then,normalized |
R11921 | T14690 | T14690 | ROOT | normalized,normalized |
R11922 | T14691 | T14690 | prep | with,normalized |
R11923 | T14692 | T14691 | pobj | regard,with |
R11924 | T14693 | T14692 | prep | to,regard |
R11925 | T14694 | T14695 | det | the,samples |
R11926 | T14695 | T14693 | pobj | samples,to |
R11927 | T14696 | T14697 | compound | 18S,ΔCt |
R11928 | T14697 | T14695 | appos | ΔCt,samples |
R11929 | T14698 | T14690 | punct | .,normalized |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14863 | 0-21 | http://purl.obolibrary.org/obo/GO_0001171 | denotes | Reverse transcription |
T14864 | 8-21 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T14865 | 40-42 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T14866 | 49-51 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T14867 | 79-94 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | gene expression |
T14868 | 540-555 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | Gene expression |
T14869 | 803-818 | http://purl.obolibrary.org/obo/GO_0010467 | denotes | Gene expression |
T14870 | 123-138 | http://purl.obolibrary.org/obo/GO_1904627 | denotes | response to PMA |
T14871 | 170-173 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T14872 | 178-181 | http://purl.obolibrary.org/obo/GO_0004697 | denotes | PKC |
T14873 | 598-600 | http://purl.obolibrary.org/obo/GO_0018818 | denotes | AH |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14874 | 40-42 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T14875 | 49-51 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T14876 | 170-173 | http://purl.obolibrary.org/obo/GO_0004705 | denotes | JNK |
T14877 | 178-181 | http://purl.obolibrary.org/obo/GO_0004697 | denotes | PKC |
T14878 | 598-600 | http://purl.obolibrary.org/obo/GO_0018818 | denotes | AH |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14524 | 0-48 | Sentence | denotes | Reverse transcription quantitative PCR (RT-qPCR) |
T14525 | 49-182 | Sentence | denotes | RT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC. |
T14526 | 183-377 | Sentence | denotes | The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. |
T14527 | 378-539 | Sentence | denotes | Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s. |
T14528 | 540-614 | Sentence | denotes | Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics). |
T14529 | 615-666 | Sentence | denotes | The obtained Ct values were normalized against 18S. |
T14530 | 667-802 | Sentence | denotes | Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample. |
T14531 | 803-903 | Sentence | denotes | Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt. |
T233 | 0-48 | Sentence | denotes | Reverse transcription quantitative PCR (RT-qPCR) |
T234 | 49-182 | Sentence | denotes | RT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC. |
T235 | 183-377 | Sentence | denotes | The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. |
T236 | 378-539 | Sentence | denotes | Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s. |
T237 | 540-614 | Sentence | denotes | Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics). |
T238 | 615-666 | Sentence | denotes | The obtained Ct values were normalized against 18S. |
T239 | 667-802 | Sentence | denotes | Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample. |
T240 | 803-903 | Sentence | denotes | Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt. |
events-check-again
Id | Subject | Object | Predicate | Lexical cue | Speculation |
---|---|---|---|---|---|
T14939 | 84-94 | Gene_expression | denotes | expression | |
T14940 | 84-94 | Gene_expression | denotes | expression | |
T14941 | 105-109 | Protein | denotes | il-6 | |
T14942 | 114-119 | Protein | denotes | cxcl8 | |
T14943 | 120-134 | Positive_regulation | denotes | in response to | |
T14944 | 120-134 | Positive_regulation | denotes | in response to | |
T14945 | 139-148 | Positive_regulation | denotes | following | true |
T14946 | 139-148 | Positive_regulation | denotes | following | true |
T14947 | 225-229 | Protein | denotes | il-6 | |
T14948 | 301-306 | Protein | denotes | cxcl8 | |
T14949 | 808-818 | Gene_expression | denotes | expression | true |
T14950 | 808-818 | Gene_expression | denotes | expression | true |
T14951 | 832-836 | Protein | denotes | il-6 | |
T14952 | 841-846 | Protein | denotes | cxcl8 | |
R12113 | T14939 | T14944 | themeOf | expression,in response to | |
R12114 | T14940 | T14943 | themeOf | expression,in response to | |
R12115 | T14941 | T14940 | themeOf | il-6,expression | |
R12116 | T14942 | T14939 | themeOf | cxcl8,expression | |
R12117 | T14943 | T14946 | themeOf | in response to,following | |
R12118 | T14944 | T14945 | themeOf | in response to,following | |
R12119 | T14951 | T14950 | themeOf | il-6,expression | |
R12120 | T14952 | T14949 | themeOf | cxcl8,expression |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14953 | 163-168 | Protein | denotes | NF-κB |
T14954 | 170-173 | Protein | denotes | JNK |
T14955 | 178-181 | Protein | denotes | PKC |
T14956 | 149-159 | Negative_regulation | denotes | inhibition |
T14957 | 149-159 | Negative_regulation | denotes | inhibition |
T14958 | 149-159 | Negative_regulation | denotes | inhibition |
T14959 | 407-411 | Protein | denotes | CYBR |
T14960 | 887-902 | Protein | denotes | samples 18S ΔCt |
R12121 | T14953 | T14956 | themeOf | NF-κB,inhibition |
R12122 | T14954 | T14957 | themeOf | JNK,inhibition |
R12123 | T14955 | T14958 | themeOf | PKC,inhibition |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue | Speculation |
---|---|---|---|---|---|
T14510 | 84-94 | Gene_expression | denotes | expression | |
T14511 | 84-94 | Gene_expression | denotes | expression | |
T14512 | 105-109 | Protein | denotes | il-6 | |
T14513 | 114-119 | Protein | denotes | cxcl8 | |
T14514 | 120-134 | Positive_regulation | denotes | in response to | |
T14515 | 120-134 | Positive_regulation | denotes | in response to | |
T14516 | 139-148 | Positive_regulation | denotes | following | true |
T14517 | 139-148 | Positive_regulation | denotes | following | true |
T14518 | 225-229 | Protein | denotes | il-6 | |
T14519 | 301-306 | Protein | denotes | cxcl8 | |
T14520 | 808-818 | Gene_expression | denotes | expression | true |
T14521 | 808-818 | Gene_expression | denotes | expression | true |
T14522 | 832-836 | Protein | denotes | il-6 | |
T14523 | 841-846 | Protein | denotes | cxcl8 | |
R11755 | T14510 | T14515 | themeOf | expression,in response to | |
R11756 | T14511 | T14514 | themeOf | expression,in response to | |
R11757 | T14512 | T14511 | themeOf | il-6,expression | |
R11758 | T14513 | T14510 | themeOf | cxcl8,expression | |
R11759 | T14514 | T14517 | themeOf | in response to,following | |
R11760 | T14515 | T14516 | themeOf | in response to,following | |
R11761 | T14522 | T14521 | themeOf | il-6,expression | |
R11762 | T14523 | T14520 | themeOf | cxcl8,expression |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T14849 | 105-109 | P05231 | denotes | il-6 |
T14850 | 114-119 | P10145 | denotes | cxcl8 |
T14851 | 225-229 | P05231 | denotes | il-6 |
T14852 | 301-306 | P10145 | denotes | cxcl8 |
T14853 | 832-836 | P05231 | denotes | il-6 |
T14854 | 841-846 | P10145 | denotes | cxcl8 |
test2
Id | Subject | Object | Predicate | Lexical cue | Speculation |
---|---|---|---|---|---|
T14501 | 84-94 | Gene_expression | denotes | expression | |
T14502 | 105-109 | Protein | denotes | il-6 | |
T14503 | 114-119 | Protein | denotes | cxcl8 | |
T14504 | 120-134 | Positive_regulation | denotes | in response to | |
T14505 | 225-229 | Protein | denotes | il-6 | true |
T14506 | 301-306 | Protein | denotes | cxcl8 | true |
T14507 | 808-818 | Gene_expression | denotes | expression | true |
T14508 | 832-836 | Protein | denotes | il-6 | true |
T14509 | 841-846 | Protein | denotes | cxcl8 | |
R11748 | T14501 | T14504 | themeOf | expression,in response to | |
R11749 | T14502 | T14501 | themeOf | il-6,expression | |
R11750 | T14502 | T14504 | themeOf | il-6,in response to | |
R11751 | T14503 | T14504 | themeOf | cxcl8,in response to | |
R11752 | T14503 | T14501 | themeOf | cxcl8,expression | |
R11753 | T14508 | T14507 | themeOf | il-6,expression | |
R11754 | T14509 | T14507 | themeOf | cxcl8,expression |