Reverse transcription quantitative PCR (RT-qPCR)
RT-qPCR was used to determine gene expression levels of il-6 and cxcl8 in response to PMA following inhibition of NF-κB, JNK and PKC. The following primer sequences were used, il-6: forward- TGTGAAAGCAGCAAAGAGGCACTG, reverse- ACAGCTCTGGCTTGTTCCTCACTA; cxcl8: forward- ACCACACTGCGCCAACACAGAAAT, reverse- AAACTTCTCCACAACCCTCTGCAC. Thermocycling conditions for CYBR Green (Quanta, USA) consisted of a denaturation step for 10 min at 95 °C followed by 60 cycles of 95°C for 1s and 60°C for 30s. Gene expression was analysed using Stratagene (Mx3000p™) (AH diagnostics). The obtained Ct values were normalized against 18S. Initially, all measured 18S Ct values were used to calculate a mean Ct value that was used to determine the ΔCt values for each sample. Gene expression patterns for il-6 and cxcl8 were then normalized with regard to the samples 18S ΔCt.