PMC:2674207 / 14566-15125
Annnotations
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4622 | 0-7 | JJ | denotes | Reverse |
T4623 | 8-21 | NN | denotes | Transcription |
T4624 | 22-25 | NN | denotes | PCR |
T4625 | 26-31 | JJ | denotes | Total |
T4626 | 32-35 | NN | denotes | RNA |
T4627 | 36-39 | VB | denotes | was |
T4628 | 40-49 | VB | denotes | extracted |
T4629 | 50-55 | VB | denotes | using |
T4630 | 56-61 | NN | denotes | lysis |
T4631 | 62-68 | NN | denotes | buffer |
T4632 | 69-70 | -LRB- | denotes | ( |
T4633 | 70-76 | NN | denotes | RNeasy |
T4634 | 77-80 | NN | denotes | kit |
T4635 | 80-81 | -COLON- | denotes | ; |
T4636 | 82-88 | NNP | denotes | Qiagen |
T4637 | 88-89 | -COMMA- | denotes | , |
T4638 | 90-97 | NNP | denotes | Crawley |
T4639 | 97-98 | -COMMA- | denotes | , |
T4640 | 99-101 | NNP | denotes | UK |
T4641 | 101-102 | -RRB- | denotes | ) |
T4642 | 104-110 | IN | denotes | During |
T4643 | 111-114 | NN | denotes | RNA |
T4644 | 115-127 | NN | denotes | purification |
T4645 | 127-128 | -COMMA- | denotes | , |
T4646 | 129-136 | JJ | denotes | genomic |
T4647 | 137-140 | NN | denotes | DNA |
T4648 | 141-144 | VB | denotes | was |
T4649 | 145-153 | VB | denotes | digested |
T4650 | 154-158 | IN | denotes | with |
T4651 | 159-169 | JJ | denotes | RNase-free |
T4652 | 170-175 | NN | denotes | DNase |
T4653 | 176-177 | -LRB- | denotes | ( |
T4654 | 177-185 | NNP | denotes | Amersham |
T4655 | 186-197 | NNP | denotes | Biosciences |
T4656 | 197-198 | -RRB- | denotes | ) |
T4657 | 200-204 | RB | denotes | Next |
T4658 | 204-205 | -COMMA- | denotes | , |
T4659 | 206-209 | CD | denotes | 0.5 |
T4660 | 210-212 | NN | denotes | µg |
T4661 | 213-215 | IN | denotes | of |
T4662 | 216-221 | JJ | denotes | total |
T4663 | 222-225 | NN | denotes | RNA |
T4664 | 226-229 | VB | denotes | was |
T4665 | 230-238 | VB | denotes | reversed |
T4666 | 239-250 | VB | denotes | transcribed |
T4667 | 251-256 | VB | denotes | using |
T4668 | 257-260 | DT | denotes | the |
T4669 | 261-266 | JJ | denotes | avian |
T4670 | 267-281 | NN | denotes | myeloblastosis |
T4671 | 282-287 | NN | denotes | virus |
T4672 | 288-290 | NN | denotes | RT |
T4673 | 291-292 | -LRB- | denotes | ( |
T4674 | 292-299 | NNP | denotes | Promega |
T4675 | 299-300 | -COMMA- | denotes | , |
T4676 | 301-312 | NNP | denotes | Southampton |
T4677 | 312-313 | -COMMA- | denotes | , |
T4678 | 314-316 | NNP | denotes | UK |
T4679 | 316-317 | -RRB- | denotes | ) |
T4680 | 319-322 | IN | denotes | For |
T4681 | 323-331 | JJ | denotes | relative |
T4682 | 332-346 | NN | denotes | quantification |
T4683 | 346-347 | -COMMA- | denotes | , |
T4684 | 348-354 | NN | denotes | RT-PCR |
T4685 | 355-358 | VB | denotes | was |
T4686 | 359-366 | VB | denotes | carried |
T4687 | 367-370 | RP | denotes | out |
T4688 | 371-376 | VB | denotes | using |
T4689 | 377-381 | NN | denotes | cDNA |
T4690 | 382-388 | NN | denotes | probes |
T4691 | 390-397 | NN | denotes | Primers |
T4692 | 398-401 | IN | denotes | for |
T4693 | 402-406 | NN | denotes | IL-4 |
T4694 | 407-411 | VB | denotes | were |
T4695 | 412-416 | IN | denotes | from |
T4696 | 417-430 | NN | denotes | Sigma-Genosys |
T4697 | 431-432 | -LRB- | denotes | ( |
T4698 | 432-441 | NNP | denotes | Cambridge |
T4699 | 441-442 | -COMMA- | denotes | , |
T4700 | 443-445 | NNP | denotes | UK |
T4701 | 445-446 | -RRB- | denotes | ) |
T4702 | 448-457 | NN | denotes | Sequences |
T4703 | 458-460 | IN | denotes | of |
T4704 | 461-466 | NN | denotes | GADPH |
T4705 | 467-471 | VB | denotes | used |
T4706 | 472-475 | VB | denotes | are |
T4707 | 476-478 | IN | denotes | as |
T4708 | 479-486 | VB | denotes | follows |
T4709 | 486-487 | -COLON- | denotes | : |
T4710 | 488-495 | RB | denotes | forward |
T4711 | 496-522 | NN | denotes | 5′-CCACCCATGGCAAATTCCATGGC |
T4712 | 522-523 | -COMMA- | denotes | , |
T4713 | 524-531 | JJ | denotes | reverse |
T4714 | 532-558 | NN | denotes | 3′-TCTAGACGGCAGGTCAGGTCCAC |
R3969 | T4624 | T4622 | arg1Of | PCR,Reverse |
R3970 | T4624 | T4623 | arg1Of | PCR,Transcription |
R3971 | T4626 | T4625 | arg1Of | RNA,Total |
R3972 | T4626 | T4627 | arg1Of | RNA,was |
R3973 | T4626 | T4628 | arg2Of | RNA,extracted |
R3975 | T4628 | T4627 | arg2Of | extracted,was |
R3979 | T4634 | T4632 | arg2Of | kit,( |
R3980 | T4634 | T4633 | arg1Of | kit,RNeasy |
R3981 | T4634 | T4635 | arg1Of | kit,; |
R3982 | T4636 | T4635 | arg2Of | Qiagen,; |
R3983 | T4636 | T4637 | arg1Of | Qiagen,"," |
R3984 | T4638 | T4637 | arg2Of | Crawley,"," |
R3985 | T4638 | T4639 | arg1Of | Crawley,"," |
R3986 | T4640 | T4639 | arg2Of | UK,"," |
R3987 | T4641 | T4632 | arg3Of | ),( |
R3988 | T4644 | T4642 | arg2Of | purification,During |
R3989 | T4644 | T4643 | arg1Of | purification,RNA |
R3990 | T4647 | T4646 | arg1Of | DNA,genomic |
R3991 | T4647 | T4648 | arg1Of | DNA,was |
R3992 | T4647 | T4649 | arg2Of | DNA,digested |
R3993 | T4649 | T4642 | arg1Of | digested,During |
R3994 | T4649 | T4645 | arg1Of | digested,"," |
R3995 | T4649 | T4648 | arg2Of | digested,was |
R3996 | T4649 | T4650 | arg1Of | digested,with |
R3997 | T4652 | T4650 | arg2Of | DNase,with |
R3998 | T4652 | T4651 | arg1Of | DNase,RNase-free |
R3999 | T4652 | T4653 | arg1Of | DNase,( |
R4000 | T4655 | T4653 | arg2Of | Biosciences,( |
R4001 | T4655 | T4654 | arg1Of | Biosciences,Amersham |
R4002 | T4656 | T4653 | arg3Of | ),( |
R4003 | T4660 | T4659 | arg1Of | µg,0.5 |
R4004 | T4660 | T4661 | arg1Of | µg,of |
R4005 | T4660 | T4664 | arg1Of | µg,was |
R4006 | T4660 | T4665 | arg2Of | µg,reversed |
R4007 | T4663 | T4661 | arg2Of | RNA,of |
R4008 | T4663 | T4662 | arg1Of | RNA,total |
R4009 | T4665 | T4657 | arg1Of | reversed,Next |
R4010 | T4665 | T4658 | arg1Of | reversed,"," |
R4011 | T4665 | T4664 | arg2Of | reversed,was |
R4012 | T4665 | T4666 | modOf | reversed,transcribed |
R4013 | T4665 | T4667 | modOf | reversed,using |
R4014 | T4665 | T4673 | arg1Of | reversed,( |
R4015 | T4672 | T4667 | arg2Of | RT,using |
R4016 | T4672 | T4668 | arg1Of | RT,the |
R4017 | T4672 | T4669 | arg1Of | RT,avian |
R4018 | T4672 | T4670 | arg1Of | RT,myeloblastosis |
R4019 | T4672 | T4671 | arg1Of | RT,virus |
R4020 | T4674 | T4675 | arg1Of | Promega,"," |
R4021 | T4675 | T4673 | arg2Of | ",",( |
R4022 | T4675 | T4677 | arg1Of | ",","," |
R4023 | T4676 | T4675 | arg2Of | Southampton,"," |
R4024 | T4678 | T4677 | arg2Of | UK,"," |
R4025 | T4679 | T4673 | arg3Of | ),( |
R4026 | T4682 | T4680 | arg2Of | quantification,For |
R4027 | T4682 | T4681 | arg1Of | quantification,relative |
R4028 | T4684 | T4685 | arg1Of | RT-PCR,was |
R4029 | T4684 | T4686 | arg2Of | RT-PCR,carried |
R4030 | T4686 | T4680 | arg1Of | carried,For |
R4031 | T4686 | T4683 | arg1Of | carried,"," |
R4032 | T4686 | T4685 | arg2Of | carried,was |
R4033 | T4686 | T4687 | arg1Of | carried,out |
R4034 | T4686 | T4688 | modOf | carried,using |
R4035 | T4690 | T4688 | arg2Of | probes,using |
R4036 | T4690 | T4689 | arg1Of | probes,cDNA |
R4037 | T4691 | T4692 | arg1Of | Primers,for |
R4038 | T4691 | T4694 | arg1Of | Primers,were |
R4039 | T4691 | T4695 | arg1Of | Primers,from |
R4040 | T4693 | T4692 | arg2Of | IL-4,for |
R4041 | T4694 | T4697 | arg1Of | were,( |
R4042 | T4695 | T4694 | arg2Of | from,were |
R4043 | T4696 | T4695 | arg2Of | Sigma-Genosys,from |
R4044 | T4698 | T4697 | arg2Of | Cambridge,( |
R4045 | T4698 | T4699 | arg1Of | Cambridge,"," |
R4046 | T4698 | T4700 | arg1Of | Cambridge,UK |
R4047 | T4701 | T4697 | arg3Of | ),( |
R4048 | T4702 | T4703 | arg1Of | Sequences,of |
R4049 | T4702 | T4706 | arg1Of | Sequences,are |
R4050 | T4702 | T4708 | arg1Of | Sequences,follows |
R4051 | T4704 | T4703 | arg2Of | GADPH,of |
R4052 | T4704 | T4705 | arg2Of | GADPH,used |
R4053 | T4706 | T4707 | arg1Of | are,as |
R4054 | T4708 | T4707 | arg2Of | follows,as |
R4055 | T4708 | T4709 | arg1Of | follows,: |
R4056 | T4711 | T4708 | arg2Of | 5′-CCACCCATGGCAAATTCCATGGC,follows |
R4057 | T4711 | T4710 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,forward |
R4058 | T4711 | T4712 | arg1Of | 5′-CCACCCATGGCAAATTCCATGGC,"," |
R4059 | T4714 | T4712 | arg2Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,"," |
R4060 | T4714 | T4713 | arg1Of | 3′-TCTAGACGGCAGGTCAGGTCCAC,reverse |
R3974 | T4628 | T4629 | modOf | extracted,using |
R3976 | T4631 | T4629 | arg2Of | buffer,using |
R3977 | T4631 | T4630 | arg1Of | buffer,lysis |
R3978 | T4631 | T4632 | arg1Of | buffer,( |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4717 | 0-7 | VB | denotes | Reverse |
T4718 | 8-21 | NNP | denotes | Transcription |
T4719 | 22-25 | NNP | denotes | PCR |
T4720 | 26-31 | NNP | denotes | Total |
T4721 | 32-35 | NNP | denotes | RNA |
T4722 | 36-39 | VBD | denotes | was |
T4723 | 40-49 | VBN | denotes | extracted |
T4724 | 50-55 | VBG | denotes | using |
T4725 | 56-61 | NN | denotes | lysis |
T4726 | 62-68 | NN | denotes | buffer |
T4727 | 69-70 | -LRB- | denotes | ( |
T4728 | 70-76 | NNP | denotes | RNeasy |
T4729 | 77-80 | NN | denotes | kit |
T4730 | 80-81 | : | denotes | ; |
T4731 | 82-88 | NNP | denotes | Qiagen |
T4732 | 88-89 | , | denotes | , |
T4733 | 90-97 | NNP | denotes | Crawley |
T4734 | 97-98 | , | denotes | , |
T4735 | 99-101 | NNP | denotes | UK |
T4736 | 101-102 | -RRB- | denotes | ) |
T4737 | 102-103 | . | denotes | . |
T4738 | 104-110 | IN | denotes | During |
T4739 | 111-114 | NNP | denotes | RNA |
T4740 | 115-127 | NN | denotes | purification |
T4741 | 127-128 | , | denotes | , |
T4742 | 129-136 | JJ | denotes | genomic |
T4743 | 137-140 | NN | denotes | DNA |
T4744 | 141-144 | VBD | denotes | was |
T4745 | 145-153 | VBN | denotes | digested |
T4746 | 154-158 | IN | denotes | with |
T4747 | 159-169 | JJ | denotes | RNase-free |
T4748 | 170-175 | NNP | denotes | DNase |
T4749 | 176-177 | -LRB- | denotes | ( |
T4750 | 177-185 | NNP | denotes | Amersham |
T4751 | 186-197 | NNPS | denotes | Biosciences |
T4752 | 197-198 | -RRB- | denotes | ) |
T4753 | 198-199 | . | denotes | . |
T4754 | 200-204 | JJ | denotes | Next |
T4755 | 204-205 | , | denotes | , |
T4756 | 206-209 | CD | denotes | 0.5 |
T4757 | 210-212 | NN | denotes | µg |
T4758 | 213-215 | IN | denotes | of |
T4759 | 216-221 | JJ | denotes | total |
T4760 | 222-225 | NNP | denotes | RNA |
T4761 | 226-229 | VBD | denotes | was |
T4762 | 230-238 | JJ | denotes | reversed |
T4763 | 239-250 | VBN | denotes | transcribed |
T4764 | 251-256 | VBG | denotes | using |
T4765 | 257-260 | DT | denotes | the |
T4766 | 261-266 | JJ | denotes | avian |
T4767 | 267-281 | NN | denotes | myeloblastosis |
T4768 | 282-287 | NN | denotes | virus |
T4769 | 288-290 | NNP | denotes | RT |
T4770 | 291-292 | -LRB- | denotes | ( |
T4771 | 292-299 | NNP | denotes | Promega |
T4772 | 299-300 | , | denotes | , |
T4773 | 301-312 | NNP | denotes | Southampton |
T4774 | 312-313 | , | denotes | , |
T4775 | 314-316 | NNP | denotes | UK |
T4776 | 316-317 | -RRB- | denotes | ) |
T4777 | 317-318 | . | denotes | . |
T4778 | 319-322 | IN | denotes | For |
T4779 | 323-331 | JJ | denotes | relative |
T4780 | 332-346 | NN | denotes | quantification |
T4781 | 346-347 | , | denotes | , |
T4782 | 348-354 | NN | denotes | RT-PCR |
T4783 | 355-358 | VBD | denotes | was |
T4784 | 359-366 | VBN | denotes | carried |
T4785 | 367-370 | IN | denotes | out |
T4786 | 371-376 | VBG | denotes | using |
T4787 | 377-381 | NNP | denotes | cDNA |
T4788 | 382-388 | NNS | denotes | probes |
T4789 | 388-389 | . | denotes | . |
T4790 | 390-397 | NNS | denotes | Primers |
T4791 | 398-401 | IN | denotes | for |
T4792 | 402-406 | NN | denotes | IL-4 |
T4793 | 407-411 | VBD | denotes | were |
T4794 | 412-416 | IN | denotes | from |
T4795 | 417-430 | NNP | denotes | Sigma-Genosys |
T4796 | 431-432 | -LRB- | denotes | ( |
T4797 | 432-441 | NNP | denotes | Cambridge |
T4798 | 441-442 | , | denotes | , |
T4799 | 443-445 | NNP | denotes | UK |
T4800 | 445-446 | -RRB- | denotes | ) |
T4801 | 446-447 | . | denotes | . |
T4802 | 448-457 | NNS | denotes | Sequences |
T4803 | 458-460 | IN | denotes | of |
T4804 | 461-466 | NNP | denotes | GADPH |
T4805 | 467-471 | VBD | denotes | used |
T4806 | 472-475 | VBP | denotes | are |
T4807 | 476-478 | IN | denotes | as |
T4808 | 479-486 | VBZ | denotes | follows |
T4809 | 486-487 | : | denotes | : |
T4810 | 488-495 | RB | denotes | forward |
T4811 | 496-497 | CD | denotes | 5 |
T4812 | 497-498 | SYM | denotes | ′ |
T4813 | 498-499 | : | denotes | - |
T4814 | 499-522 | NNP | denotes | CCACCCATGGCAAATTCCATGGC |
T4815 | 522-523 | , | denotes | , |
T4816 | 524-531 | VB | denotes | reverse |
T4817 | 532-533 | CD | denotes | 3 |
T4818 | 533-534 | SYM | denotes | ′ |
T4819 | 534-535 | : | denotes | - |
T4820 | 535-558 | NNP | denotes | TCTAGACGGCAGGTCAGGTCCAC |
T4821 | 558-559 | . | denotes | . |
R4061 | T4717 | T4721 | amod | Reverse,RNA |
R4062 | T4718 | T4721 | compound | Transcription,RNA |
R4063 | T4719 | T4721 | compound | PCR,RNA |
R4064 | T4720 | T4721 | compound | Total,RNA |
R4065 | T4721 | T4723 | nsubjpass | RNA,extracted |
R4066 | T4722 | T4723 | auxpass | was,extracted |
R4067 | T4723 | T4723 | ROOT | extracted,extracted |
R4068 | T4724 | T4723 | advcl | using,extracted |
R4069 | T4725 | T4726 | compound | lysis,buffer |
R4070 | T4726 | T4724 | dobj | buffer,using |
R4071 | T4727 | T4726 | punct | (,buffer |
R4072 | T4728 | T4729 | compound | RNeasy,kit |
R4073 | T4729 | T4726 | appos | kit,buffer |
R4074 | T4730 | T4726 | punct | ;,buffer |
R4075 | T4731 | T4726 | conj | Qiagen,buffer |
R4076 | T4732 | T4731 | punct | ",",Qiagen |
R4077 | T4733 | T4731 | conj | Crawley,Qiagen |
R4078 | T4734 | T4733 | punct | ",",Crawley |
R4079 | T4735 | T4733 | conj | UK,Crawley |
R4080 | T4736 | T4731 | punct | ),Qiagen |
R4081 | T4737 | T4723 | punct | .,extracted |
R4082 | T4738 | T4745 | prep | During,digested |
R4083 | T4739 | T4740 | compound | RNA,purification |
R4084 | T4740 | T4738 | pobj | purification,During |
R4085 | T4741 | T4745 | punct | ",",digested |
R4086 | T4742 | T4743 | amod | genomic,DNA |
R4087 | T4743 | T4745 | nsubjpass | DNA,digested |
R4088 | T4744 | T4745 | auxpass | was,digested |
R4089 | T4745 | T4745 | ROOT | digested,digested |
R4090 | T4746 | T4745 | prep | with,digested |
R4091 | T4747 | T4748 | compound | RNase-free,DNase |
R4092 | T4748 | T4746 | pobj | DNase,with |
R4093 | T4749 | T4751 | punct | (,Biosciences |
R4094 | T4750 | T4751 | compound | Amersham,Biosciences |
R4095 | T4751 | T4748 | appos | Biosciences,DNase |
R4096 | T4752 | T4751 | punct | ),Biosciences |
R4097 | T4753 | T4745 | punct | .,digested |
R4098 | T4754 | T4757 | advmod | Next,µg |
R4099 | T4755 | T4757 | punct | ",",µg |
R4100 | T4756 | T4757 | nummod | 0.5,µg |
R4101 | T4757 | T4763 | nsubjpass | µg,transcribed |
R4102 | T4758 | T4757 | prep | of,µg |
R4103 | T4759 | T4760 | amod | total,RNA |
R4104 | T4760 | T4758 | pobj | RNA,of |
R4105 | T4761 | T4763 | auxpass | was,transcribed |
R4106 | T4762 | T4763 | advmod | reversed,transcribed |
R4107 | T4763 | T4763 | ROOT | transcribed,transcribed |
R4108 | T4764 | T4763 | advcl | using,transcribed |
R4109 | T4765 | T4768 | det | the,virus |
R4110 | T4766 | T4767 | amod | avian,myeloblastosis |
R4111 | T4767 | T4768 | compound | myeloblastosis,virus |
R4134 | T4790 | T4793 | nsubj | Primers,were |
R4135 | T4791 | T4790 | prep | for,Primers |
R4136 | T4792 | T4791 | pobj | IL-4,for |
R4137 | T4793 | T4793 | ROOT | were,were |
R4138 | T4794 | T4793 | prep | from,were |
R4139 | T4795 | T4794 | pobj | Sigma-Genosys,from |
R4140 | T4796 | T4795 | punct | (,Sigma-Genosys |
R4141 | T4797 | T4795 | appos | Cambridge,Sigma-Genosys |
R4142 | T4798 | T4797 | punct | ",",Cambridge |
R4143 | T4799 | T4797 | appos | UK,Cambridge |
R4144 | T4800 | T4797 | punct | ),Cambridge |
R4145 | T4801 | T4793 | punct | .,were |
R4146 | T4802 | T4806 | nsubj | Sequences,are |
R4147 | T4803 | T4802 | prep | of,Sequences |
R4148 | T4804 | T4803 | pobj | GADPH,of |
R4149 | T4805 | T4802 | acl | used,Sequences |
R4150 | T4806 | T4806 | ROOT | are,are |
R4151 | T4807 | T4808 | mark | as,follows |
R4152 | T4808 | T4806 | advcl | follows,are |
R4153 | T4809 | T4806 | punct | :,are |
R4154 | T4810 | T4816 | advmod | forward,reverse |
R4155 | T4811 | T4814 | nummod | 5,CCACCCATGGCAAATTCCATGGC |
R4156 | T4812 | T4814 | punct | ′,CCACCCATGGCAAATTCCATGGC |
R4157 | T4813 | T4814 | punct | -,CCACCCATGGCAAATTCCATGGC |
R4158 | T4814 | T4816 | npadvmod | CCACCCATGGCAAATTCCATGGC,reverse |
R4159 | T4815 | T4816 | punct | ",",reverse |
R4160 | T4816 | T4820 | dep | reverse,TCTAGACGGCAGGTCAGGTCCAC |
R4161 | T4817 | T4816 | dobj | 3,reverse |
R4162 | T4818 | T4820 | punct | ′,TCTAGACGGCAGGTCAGGTCCAC |
R4163 | T4819 | T4820 | punct | -,TCTAGACGGCAGGTCAGGTCCAC |
R4164 | T4820 | T4820 | ROOT | TCTAGACGGCAGGTCAGGTCCAC,TCTAGACGGCAGGTCAGGTCCAC |
R4165 | T4821 | T4820 | punct | .,TCTAGACGGCAGGTCAGGTCCAC |
R4112 | T4768 | T4764 | dobj | virus,using |
R4113 | T4769 | T4771 | nmod | RT,Promega |
R4114 | T4770 | T4771 | punct | (,Promega |
R4115 | T4771 | T4768 | appos | Promega,virus |
R4116 | T4772 | T4771 | punct | ",",Promega |
R4117 | T4773 | T4771 | conj | Southampton,Promega |
R4118 | T4774 | T4773 | punct | ",",Southampton |
R4119 | T4775 | T4773 | conj | UK,Southampton |
R4120 | T4776 | T4771 | punct | ),Promega |
R4121 | T4777 | T4763 | punct | .,transcribed |
R4122 | T4778 | T4784 | prep | For,carried |
R4123 | T4779 | T4780 | amod | relative,quantification |
R4124 | T4780 | T4778 | pobj | quantification,For |
R4125 | T4781 | T4784 | punct | ",",carried |
R4126 | T4782 | T4784 | nsubjpass | RT-PCR,carried |
R4127 | T4783 | T4784 | auxpass | was,carried |
R4128 | T4784 | T4784 | ROOT | carried,carried |
R4129 | T4785 | T4784 | prt | out,carried |
R4130 | T4786 | T4784 | advcl | using,carried |
R4131 | T4787 | T4788 | compound | cDNA,probes |
R4132 | T4788 | T4786 | dobj | probes,using |
R4133 | T4789 | T4784 | punct | .,carried |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4829 | 0-21 | http://purl.obolibrary.org/obo/GO_0001171 | denotes | Reverse Transcription |
T4830 | 8-21 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | Transcription |
T4831 | 56-61 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T4832 | 288-290 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4833 | 348-350 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4834 | 288-290 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4835 | 348-350 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T4836 | 402-406 | http://purl.obolibrary.org/obo/GO_0005136 | denotes | IL-4 |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4615 | 0-25 | Sentence | denotes | Reverse Transcription PCR |
T4616 | 26-103 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T4617 | 104-199 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T4618 | 200-318 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T4619 | 319-389 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T4620 | 390-447 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T4621 | 448-559 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
T95 | 0-25 | Sentence | denotes | Reverse Transcription PCR |
T96 | 26-103 | Sentence | denotes | Total RNA was extracted using lysis buffer (RNeasy kit; Qiagen, Crawley, UK). |
T97 | 104-199 | Sentence | denotes | During RNA purification, genomic DNA was digested with RNase-free DNase (Amersham Biosciences). |
T98 | 200-318 | Sentence | denotes | Next, 0.5 µg of total RNA was reversed transcribed using the avian myeloblastosis virus RT (Promega, Southampton, UK). |
T99 | 319-389 | Sentence | denotes | For relative quantification, RT-PCR was carried out using cDNA probes. |
T100 | 390-447 | Sentence | denotes | Primers for IL-4 were from Sigma-Genosys (Cambridge, UK). |
T101 | 448-559 | Sentence | denotes | Sequences of GADPH used are as follows: forward 5′-CCACCCATGGCAAATTCCATGGC, reverse 3′-TCTAGACGGCAGGTCAGGTCCAC. |
events-check-again
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4842 | 402-406 | Protein | denotes | IL-4 |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4839 | 159-164 | Protein | denotes | RNase |
T4840 | 402-406 | Protein | denotes | IL-4 |
T4841 | 461-466 | Protein | denotes | GADPH |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4614 | 402-406 | Protein | denotes | IL-4 |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4715 | 323-331 | Q04864 | denotes | relative |
T4716 | 402-406 | P05112 | denotes | IL-4 |
test2
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T4613 | 402-406 | Protein | denotes | IL-4 |