> top > docs > PMC:1920263 > spans > 8508-9243 > annotations

PMC:1920263 / 8508-9243 JSONTXT

Annnotations TAB JSON ListView MergeView

test2

Id Subject Object Predicate Lexical cue
T2613 217-242 Protein denotes guanylate-binding protein
T2614 244-247 Protein denotes GBP
T2615 636-639 Protein denotes Vif
R2129 T2614 T2613 equivalentTo GBP,guanylate-binding protein

GO-MF

Id Subject Object Predicate Lexical cue
T3715 128-131 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS
T3716 227-234 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T3717 227-242 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein

GO-BP

Id Subject Object Predicate Lexical cue
T2671 128-131 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T3329 0-3 DT denotes The
T3330 4-12 NN denotes reporter
T3331 13-21 NNS denotes plasmids
T3332 22-34 JJ denotes pGL3-Control
T3333 35-38 CC denotes and
T3334 39-46 JJ denotes phRG-TK
T3335 47-51 VBD denotes were
T3336 52-61 VBN denotes purchased
T3337 62-66 IN denotes from
T3338 67-74 NNP denotes Promega
T3339 74-75 . denotes .
T3340 76-84 NN denotes pGL2-CVX
T3341 85-93 VBZ denotes contains
T3342 94-97 CD denotes two
T3343 98-105 NNS denotes repeats
T3344 106-108 IN denotes of
T3345 109-112 DT denotes the
T3346 113-127 JJ denotes IFN-responsive
T3347 128-131 NNP denotes GAS
T3348 132-133 -LRB- denotes (
T3349 133-138 NN denotes gamma
T3350 139-148 VBN denotes activated
T3351 149-157 NN denotes sequence
T3352 157-158 -RRB- denotes )
T3353 159-167 NNS denotes elements
T3354 168-169 -LRB- denotes (
T3355 169-208 NNP denotes GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
T3356 208-209 -RRB- denotes )
T3357 210-212 IN denotes of
T3358 213-216 DT denotes the
T3359 217-234 JJ denotes guanylate-binding
T3360 235-242 NN denotes protein
T3361 243-244 -LRB- denotes (
T3362 244-247 NNP denotes GBP
T3363 247-248 -RRB- denotes )
T3364 249-253 NN denotes gene
T3365 254-256 IN denotes in
T3366 257-262 NN denotes front
T3367 263-265 IN denotes of
T3368 266-267 DT denotes a
T3369 268-271 NNP denotes CMV
T3370 272-279 JJ denotes minimal
T3371 280-288 NN denotes promoter
T3372 289-292 CC denotes and
T3373 293-296 VBD denotes was
T3374 297-303 RB denotes kindly
T3375 304-312 VBN denotes provided
T3376 313-315 IN denotes by
T3377 316-319 NNP denotes Ute
T3378 320-327 NNP denotes Pägelow
T3379 328-331 CC denotes and
T3380 332-337 NNP denotes Mario
T3381 338-344 NNP denotes Köster
T3382 345-349 IN denotes from
T3383 350-353 DT denotes the
T3384 354-371 NNP denotes Helmholtz-Zentrum
T3385 372-375 NN denotes für
T3386 376-395 NNP denotes Infektionsforschung
T3387 395-396 . denotes .
T3388 397-404 NNP denotes Plasmid
T3389 405-411 NNP denotes pNL4-3
T3390 412-413 -LRB- denotes (
T3391 413-418 NNP denotes NIBSC
T3392 418-419 , denotes ,
T3393 420-422 NNP denotes UK
T3394 422-423 -RRB- denotes )
T3395 424-432 VBZ denotes contains
T3396 433-436 DT denotes the
T3397 437-448 JJ denotes full-length
T3398 449-459 JJ denotes HIV-1NL4-3
T3399 460-466 NN denotes genome
T3400 467-470 CC denotes and
T3401 471-474 VBZ denotes has
T3402 475-479 VBN denotes been
T3403 480-489 VBN denotes described
T3404 490-500 RB denotes previously
T3405 501-502 -LRB- denotes (
T3406 502-504 CD denotes 34
T3407 504-505 -RRB- denotes )
T3408 505-506 . denotes .
T3409 507-513 JJ denotes pcDNA3
T3410 513-515 CD denotes .1
T3411 515-518 NNP denotes Vif
T3412 519-522 VBD denotes was
T3413 523-533 RB denotes generously
T3414 534-542 VBN denotes provided
T3415 543-545 IN denotes by
T3416 546-555 NNP denotes Nathaniel
T3417 556-558 NNP denotes R.
T3418 559-565 NNP denotes Landau
T3419 566-570 IN denotes from
T3420 571-574 DT denotes the
T3421 575-579 NNP denotes Salk
T3422 580-589 NNP denotes Institute
T3423 589-590 , denotes ,
T3424 591-593 NNP denotes La
T3425 594-599 NNP denotes Jolla
T3426 599-600 . denotes .
T3427 601-603 PRP denotes It
T3428 604-607 VBD denotes was
T3429 608-617 VBN denotes generated
T3430 618-620 IN denotes by
T3431 621-631 VBG denotes amplifying
T3432 632-635 DT denotes the
T3433 636-639 NNP denotes Vif
T3434 640-644 NN denotes gene
T3435 645-649 IN denotes from
T3436 650-656 JJ denotes pNL4-3
T3437 657-660 CC denotes and
T3438 661-669 VBG denotes ligating
T3439 670-672 PRP denotes it
T3440 673-677 IN denotes into
T3441 678-681 DT denotes the
T3442 682-688 NNP denotes pcDNA3
T3443 688-690 CD denotes .1
T3444 691-697 NN denotes vector
T3445 698-701 IN denotes via
T3446 702-707 NNP denotes BamHI
T3447 708-711 CC denotes and
T3448 712-716 NNP denotes XhoI
T3449 717-728 NN denotes restriction
T3450 729-734 NNS denotes sites
T3451 734-735 . denotes .
R2745 T3329 T3330 det The,reporter
R2746 T3330 T3331 nsubj reporter,plasmids
R2747 T3331 T3336 nsubjpass plasmids,purchased
R2748 T3332 T3331 amod pGL3-Control,plasmids
R2749 T3333 T3332 cc and,pGL3-Control
R2750 T3334 T3332 conj phRG-TK,pGL3-Control
R2751 T3335 T3336 auxpass were,purchased
R2752 T3336 T3336 ROOT purchased,purchased
R2753 T3337 T3336 prep from,purchased
R2754 T3338 T3337 pobj Promega,from
R2755 T3339 T3336 punct .,purchased
R2756 T3340 T3341 nsubj pGL2-CVX,contains
R2757 T3341 T3341 ROOT contains,contains
R2758 T3342 T3343 nummod two,repeats
R2759 T3343 T3341 dobj repeats,contains
R2760 T3344 T3343 prep of,repeats
R2761 T3345 T3347 det the,GAS
R2762 T3346 T3347 compound IFN-responsive,GAS
R2763 T3347 T3353 nmod GAS,elements
R2764 T3348 T3347 punct (,GAS
R2765 T3349 T3350 npadvmod gamma,activated
R2766 T3350 T3351 amod activated,sequence
R2767 T3351 T3347 appos sequence,GAS
R2768 T3352 T3347 punct ),GAS
R2769 T3353 T3344 pobj elements,of
R2770 T3354 T3355 punct (,GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
R2771 T3355 T3353 appos GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG,elements
R2772 T3356 T3353 punct ),elements
R2773 T3357 T3353 prep of,elements
R2774 T3358 T3360 det the,protein
R2775 T3359 T3360 amod guanylate-binding,protein
R2776 T3360 T3357 pobj protein,of
R2777 T3361 T3360 punct (,protein
R2778 T3362 T3360 appos GBP,protein
R2779 T3363 T3360 punct ),protein
R2780 T3364 T3343 appos gene,repeats
R2781 T3365 T3364 prep in,gene
R2782 T3366 T3365 pobj front,in
R2783 T3367 T3366 prep of,front
R2784 T3368 T3371 det a,promoter
R2785 T3369 T3371 nmod CMV,promoter
R2786 T3370 T3371 amod minimal,promoter
R2787 T3371 T3367 pobj promoter,of
R2788 T3372 T3341 cc and,contains
R2789 T3373 T3375 auxpass was,provided
R2790 T3374 T3375 advmod kindly,provided
R2791 T3375 T3341 conj provided,contains
R2792 T3376 T3375 agent by,provided
R2793 T3377 T3378 compound Ute,Pägelow
R2794 T3378 T3376 pobj Pägelow,by
R2795 T3379 T3378 cc and,Pägelow
R2796 T3380 T3381 compound Mario,Köster
R2797 T3381 T3378 conj Köster,Pägelow
R2798 T3382 T3378 prep from,Pägelow
R2799 T3383 T3385 det the,für
R2800 T3384 T3385 compound Helmholtz-Zentrum,für
R2801 T3385 T3382 pobj für,from
R2802 T3386 T3385 appos Infektionsforschung,für
R2803 T3387 T3341 punct .,contains
R2804 T3388 T3389 compound Plasmid,pNL4-3
R2805 T3389 T3395 nsubj pNL4-3,contains
R2806 T3390 T3391 punct (,NIBSC
R2807 T3391 T3389 appos NIBSC,pNL4-3
R2808 T3392 T3391 punct ",",NIBSC
R2809 T3393 T3391 appos UK,NIBSC
R2810 T3394 T3391 punct ),NIBSC
R2811 T3395 T3395 ROOT contains,contains
R2812 T3396 T3399 det the,genome
R2813 T3397 T3399 amod full-length,genome
R2814 T3398 T3399 amod HIV-1NL4-3,genome
R2815 T3399 T3395 dobj genome,contains
R2816 T3400 T3395 cc and,contains
R2817 T3401 T3403 aux has,described
R2818 T3402 T3403 auxpass been,described
R2819 T3403 T3395 conj described,contains
R2820 T3404 T3403 advmod previously,described
R2821 T3405 T3403 punct (,described
R2822 T3406 T3403 npadvmod 34,described
R2823 T3407 T3403 punct ),described
R2824 T3408 T3395 punct .,contains
R2825 T3409 T3409 ROOT pcDNA3,pcDNA3
R2826 T3410 T3409 nummod .1,pcDNA3
R2827 T3411 T3414 nsubjpass Vif,provided
R2828 T3412 T3414 auxpass was,provided
R2829 T3413 T3414 advmod generously,provided
R2830 T3414 T3414 ROOT provided,provided
R2831 T3415 T3414 agent by,provided
R2832 T3416 T3418 compound Nathaniel,Landau
R2833 T3417 T3418 compound R.,Landau
R2834 T3418 T3415 pobj Landau,by
R2835 T3419 T3414 prep from,provided
R2836 T3420 T3422 det the,Institute
R2837 T3421 T3422 compound Salk,Institute
R2838 T3422 T3419 pobj Institute,from
R2839 T3423 T3422 punct ",",Institute
R2840 T3424 T3425 compound La,Jolla
R2841 T3425 T3422 appos Jolla,Institute
R2842 T3426 T3414 punct .,provided
R2843 T3427 T3429 nsubjpass It,generated
R2844 T3428 T3429 auxpass was,generated
R2845 T3429 T3429 ROOT generated,generated
R2846 T3430 T3429 prep by,generated
R2847 T3431 T3430 pcomp amplifying,by
R2848 T3432 T3434 det the,gene
R2849 T3433 T3434 compound Vif,gene
R2850 T3434 T3431 dobj gene,amplifying
R2851 T3435 T3431 prep from,amplifying
R2852 T3436 T3435 pobj pNL4-3,from
R2853 T3437 T3436 cc and,pNL4-3
R2854 T3438 T3436 conj ligating,pNL4-3
R2855 T3439 T3438 dobj it,ligating
R2856 T3440 T3438 prep into,ligating
R2857 T3441 T3444 det the,vector
R2858 T3442 T3444 nmod pcDNA3,vector
R2859 T3443 T3442 nummod .1,pcDNA3
R2860 T3444 T3440 pobj vector,into
R2861 T3445 T3431 prep via,amplifying
R2862 T3446 T3450 nmod BamHI,sites
R2863 T3447 T3446 cc and,BamHI
R2864 T3448 T3446 conj XhoI,BamHI
R2865 T3449 T3450 compound restriction,sites
R2866 T3450 T3445 pobj sites,via
R2867 T3451 T3429 punct .,generated

sentences

Id Subject Object Predicate Lexical cue
T2661 0-735 Sentence denotes The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites.
T57 0-396 Sentence denotes The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung.
T58 397-558 Sentence denotes Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R.
T59 559-600 Sentence denotes Landau from the Salk Institute, La Jolla.
T60 601-735 Sentence denotes It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites.

2_test

Id Subject Object Predicate Lexical cue
17517765-3016298-77155599 502-504 3016298 denotes 34

events-check-again

Id Subject Object Predicate Lexical cue
T3812 217-242 Protein denotes guanylate-binding protein
T3813 244-247 Protein denotes GBP
T3814 636-639 Protein denotes Vif
R3135 T3813 T3812 equivalentTo GBP,guanylate-binding protein

bionlp-st-ge-2016-reference-tees

Id Subject Object Predicate Lexical cue
T3846 113-116 Protein denotes IFN
T3847 217-242 Protein denotes guanylate-binding protein
T3848 244-247 Protein denotes GBP
T3849 702-707 Protein denotes BamHI
T3850 712-734 Protein denotes XhoI restriction sites

bionlp-st-ge-2016-reference

Id Subject Object Predicate Lexical cue
T2630 217-242 Protein denotes guanylate-binding protein
T2631 244-247 Protein denotes GBP
T2632 636-639 Protein denotes Vif
R2130 T2631 T2630 equivalentTo GBP,guanylate-binding protein

bionlp-st-ge-2016-uniprot

Id Subject Object Predicate Lexical cue
T2680 636-639 P12504 denotes Vif