PMC:1920263 / 8508-9243
Annnotations
test2
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T2613 | 217-242 | Protein | denotes | guanylate-binding protein |
T2614 | 244-247 | Protein | denotes | GBP |
T2615 | 636-639 | Protein | denotes | Vif |
R2129 | T2614 | T2613 | equivalentTo | GBP,guanylate-binding protein |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3715 | 128-131 | http://purl.obolibrary.org/obo/GO_0034005 | denotes | GAS |
T3716 | 227-234 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T3717 | 227-242 | http://purl.obolibrary.org/obo/GO_0005515 | denotes | binding protein |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T2671 | 128-131 | http://purl.obolibrary.org/obo/GO_0034005 | denotes | GAS |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3329 | 0-3 | DT | denotes | The |
T3330 | 4-12 | NN | denotes | reporter |
T3331 | 13-21 | NNS | denotes | plasmids |
T3332 | 22-34 | JJ | denotes | pGL3-Control |
T3333 | 35-38 | CC | denotes | and |
T3334 | 39-46 | JJ | denotes | phRG-TK |
T3335 | 47-51 | VBD | denotes | were |
T3336 | 52-61 | VBN | denotes | purchased |
T3337 | 62-66 | IN | denotes | from |
T3338 | 67-74 | NNP | denotes | Promega |
T3339 | 74-75 | . | denotes | . |
T3340 | 76-84 | NN | denotes | pGL2-CVX |
T3341 | 85-93 | VBZ | denotes | contains |
T3342 | 94-97 | CD | denotes | two |
T3343 | 98-105 | NNS | denotes | repeats |
T3344 | 106-108 | IN | denotes | of |
T3345 | 109-112 | DT | denotes | the |
T3346 | 113-127 | JJ | denotes | IFN-responsive |
T3347 | 128-131 | NNP | denotes | GAS |
T3348 | 132-133 | -LRB- | denotes | ( |
T3349 | 133-138 | NN | denotes | gamma |
T3350 | 139-148 | VBN | denotes | activated |
T3351 | 149-157 | NN | denotes | sequence |
T3352 | 157-158 | -RRB- | denotes | ) |
T3353 | 159-167 | NNS | denotes | elements |
T3354 | 168-169 | -LRB- | denotes | ( |
T3355 | 169-208 | NNP | denotes | GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG |
T3356 | 208-209 | -RRB- | denotes | ) |
T3357 | 210-212 | IN | denotes | of |
T3358 | 213-216 | DT | denotes | the |
T3359 | 217-234 | JJ | denotes | guanylate-binding |
T3360 | 235-242 | NN | denotes | protein |
T3361 | 243-244 | -LRB- | denotes | ( |
T3362 | 244-247 | NNP | denotes | GBP |
T3363 | 247-248 | -RRB- | denotes | ) |
T3364 | 249-253 | NN | denotes | gene |
T3365 | 254-256 | IN | denotes | in |
T3366 | 257-262 | NN | denotes | front |
T3367 | 263-265 | IN | denotes | of |
T3368 | 266-267 | DT | denotes | a |
T3369 | 268-271 | NNP | denotes | CMV |
T3370 | 272-279 | JJ | denotes | minimal |
T3371 | 280-288 | NN | denotes | promoter |
T3372 | 289-292 | CC | denotes | and |
T3373 | 293-296 | VBD | denotes | was |
T3374 | 297-303 | RB | denotes | kindly |
T3375 | 304-312 | VBN | denotes | provided |
T3376 | 313-315 | IN | denotes | by |
T3377 | 316-319 | NNP | denotes | Ute |
T3378 | 320-327 | NNP | denotes | Pägelow |
T3379 | 328-331 | CC | denotes | and |
T3380 | 332-337 | NNP | denotes | Mario |
T3381 | 338-344 | NNP | denotes | Köster |
T3382 | 345-349 | IN | denotes | from |
T3383 | 350-353 | DT | denotes | the |
T3384 | 354-371 | NNP | denotes | Helmholtz-Zentrum |
T3385 | 372-375 | NN | denotes | für |
T3386 | 376-395 | NNP | denotes | Infektionsforschung |
T3387 | 395-396 | . | denotes | . |
T3388 | 397-404 | NNP | denotes | Plasmid |
T3389 | 405-411 | NNP | denotes | pNL4-3 |
T3390 | 412-413 | -LRB- | denotes | ( |
T3391 | 413-418 | NNP | denotes | NIBSC |
T3392 | 418-419 | , | denotes | , |
T3393 | 420-422 | NNP | denotes | UK |
T3394 | 422-423 | -RRB- | denotes | ) |
T3395 | 424-432 | VBZ | denotes | contains |
T3396 | 433-436 | DT | denotes | the |
T3397 | 437-448 | JJ | denotes | full-length |
T3398 | 449-459 | JJ | denotes | HIV-1NL4-3 |
T3399 | 460-466 | NN | denotes | genome |
T3400 | 467-470 | CC | denotes | and |
T3401 | 471-474 | VBZ | denotes | has |
T3402 | 475-479 | VBN | denotes | been |
T3403 | 480-489 | VBN | denotes | described |
T3404 | 490-500 | RB | denotes | previously |
T3405 | 501-502 | -LRB- | denotes | ( |
T3406 | 502-504 | CD | denotes | 34 |
T3407 | 504-505 | -RRB- | denotes | ) |
T3408 | 505-506 | . | denotes | . |
T3409 | 507-513 | JJ | denotes | pcDNA3 |
T3410 | 513-515 | CD | denotes | .1 |
T3411 | 515-518 | NNP | denotes | Vif |
T3412 | 519-522 | VBD | denotes | was |
T3413 | 523-533 | RB | denotes | generously |
T3414 | 534-542 | VBN | denotes | provided |
T3415 | 543-545 | IN | denotes | by |
T3416 | 546-555 | NNP | denotes | Nathaniel |
T3417 | 556-558 | NNP | denotes | R. |
T3418 | 559-565 | NNP | denotes | Landau |
T3419 | 566-570 | IN | denotes | from |
T3420 | 571-574 | DT | denotes | the |
T3421 | 575-579 | NNP | denotes | Salk |
T3422 | 580-589 | NNP | denotes | Institute |
T3423 | 589-590 | , | denotes | , |
T3424 | 591-593 | NNP | denotes | La |
T3425 | 594-599 | NNP | denotes | Jolla |
T3426 | 599-600 | . | denotes | . |
T3427 | 601-603 | PRP | denotes | It |
T3428 | 604-607 | VBD | denotes | was |
T3429 | 608-617 | VBN | denotes | generated |
T3430 | 618-620 | IN | denotes | by |
T3431 | 621-631 | VBG | denotes | amplifying |
T3432 | 632-635 | DT | denotes | the |
T3433 | 636-639 | NNP | denotes | Vif |
T3434 | 640-644 | NN | denotes | gene |
T3435 | 645-649 | IN | denotes | from |
T3436 | 650-656 | JJ | denotes | pNL4-3 |
T3437 | 657-660 | CC | denotes | and |
T3438 | 661-669 | VBG | denotes | ligating |
T3439 | 670-672 | PRP | denotes | it |
T3440 | 673-677 | IN | denotes | into |
T3441 | 678-681 | DT | denotes | the |
T3442 | 682-688 | NNP | denotes | pcDNA3 |
T3443 | 688-690 | CD | denotes | .1 |
T3444 | 691-697 | NN | denotes | vector |
T3445 | 698-701 | IN | denotes | via |
T3446 | 702-707 | NNP | denotes | BamHI |
T3447 | 708-711 | CC | denotes | and |
T3448 | 712-716 | NNP | denotes | XhoI |
T3449 | 717-728 | NN | denotes | restriction |
T3450 | 729-734 | NNS | denotes | sites |
T3451 | 734-735 | . | denotes | . |
R2745 | T3329 | T3330 | det | The,reporter |
R2746 | T3330 | T3331 | nsubj | reporter,plasmids |
R2747 | T3331 | T3336 | nsubjpass | plasmids,purchased |
R2748 | T3332 | T3331 | amod | pGL3-Control,plasmids |
R2749 | T3333 | T3332 | cc | and,pGL3-Control |
R2750 | T3334 | T3332 | conj | phRG-TK,pGL3-Control |
R2751 | T3335 | T3336 | auxpass | were,purchased |
R2752 | T3336 | T3336 | ROOT | purchased,purchased |
R2753 | T3337 | T3336 | prep | from,purchased |
R2754 | T3338 | T3337 | pobj | Promega,from |
R2755 | T3339 | T3336 | punct | .,purchased |
R2756 | T3340 | T3341 | nsubj | pGL2-CVX,contains |
R2757 | T3341 | T3341 | ROOT | contains,contains |
R2758 | T3342 | T3343 | nummod | two,repeats |
R2759 | T3343 | T3341 | dobj | repeats,contains |
R2760 | T3344 | T3343 | prep | of,repeats |
R2761 | T3345 | T3347 | det | the,GAS |
R2762 | T3346 | T3347 | compound | IFN-responsive,GAS |
R2763 | T3347 | T3353 | nmod | GAS,elements |
R2764 | T3348 | T3347 | punct | (,GAS |
R2765 | T3349 | T3350 | npadvmod | gamma,activated |
R2766 | T3350 | T3351 | amod | activated,sequence |
R2767 | T3351 | T3347 | appos | sequence,GAS |
R2768 | T3352 | T3347 | punct | ),GAS |
R2769 | T3353 | T3344 | pobj | elements,of |
R2770 | T3354 | T3355 | punct | (,GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG |
R2771 | T3355 | T3353 | appos | GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG,elements |
R2772 | T3356 | T3353 | punct | ),elements |
R2773 | T3357 | T3353 | prep | of,elements |
R2774 | T3358 | T3360 | det | the,protein |
R2775 | T3359 | T3360 | amod | guanylate-binding,protein |
R2776 | T3360 | T3357 | pobj | protein,of |
R2777 | T3361 | T3360 | punct | (,protein |
R2778 | T3362 | T3360 | appos | GBP,protein |
R2779 | T3363 | T3360 | punct | ),protein |
R2780 | T3364 | T3343 | appos | gene,repeats |
R2781 | T3365 | T3364 | prep | in,gene |
R2782 | T3366 | T3365 | pobj | front,in |
R2783 | T3367 | T3366 | prep | of,front |
R2784 | T3368 | T3371 | det | a,promoter |
R2785 | T3369 | T3371 | nmod | CMV,promoter |
R2786 | T3370 | T3371 | amod | minimal,promoter |
R2787 | T3371 | T3367 | pobj | promoter,of |
R2788 | T3372 | T3341 | cc | and,contains |
R2789 | T3373 | T3375 | auxpass | was,provided |
R2790 | T3374 | T3375 | advmod | kindly,provided |
R2791 | T3375 | T3341 | conj | provided,contains |
R2792 | T3376 | T3375 | agent | by,provided |
R2793 | T3377 | T3378 | compound | Ute,Pägelow |
R2794 | T3378 | T3376 | pobj | Pägelow,by |
R2795 | T3379 | T3378 | cc | and,Pägelow |
R2796 | T3380 | T3381 | compound | Mario,Köster |
R2797 | T3381 | T3378 | conj | Köster,Pägelow |
R2798 | T3382 | T3378 | prep | from,Pägelow |
R2799 | T3383 | T3385 | det | the,für |
R2800 | T3384 | T3385 | compound | Helmholtz-Zentrum,für |
R2801 | T3385 | T3382 | pobj | für,from |
R2802 | T3386 | T3385 | appos | Infektionsforschung,für |
R2803 | T3387 | T3341 | punct | .,contains |
R2804 | T3388 | T3389 | compound | Plasmid,pNL4-3 |
R2805 | T3389 | T3395 | nsubj | pNL4-3,contains |
R2806 | T3390 | T3391 | punct | (,NIBSC |
R2807 | T3391 | T3389 | appos | NIBSC,pNL4-3 |
R2808 | T3392 | T3391 | punct | ",",NIBSC |
R2809 | T3393 | T3391 | appos | UK,NIBSC |
R2810 | T3394 | T3391 | punct | ),NIBSC |
R2811 | T3395 | T3395 | ROOT | contains,contains |
R2812 | T3396 | T3399 | det | the,genome |
R2813 | T3397 | T3399 | amod | full-length,genome |
R2814 | T3398 | T3399 | amod | HIV-1NL4-3,genome |
R2815 | T3399 | T3395 | dobj | genome,contains |
R2816 | T3400 | T3395 | cc | and,contains |
R2817 | T3401 | T3403 | aux | has,described |
R2818 | T3402 | T3403 | auxpass | been,described |
R2819 | T3403 | T3395 | conj | described,contains |
R2820 | T3404 | T3403 | advmod | previously,described |
R2821 | T3405 | T3403 | punct | (,described |
R2822 | T3406 | T3403 | npadvmod | 34,described |
R2823 | T3407 | T3403 | punct | ),described |
R2824 | T3408 | T3395 | punct | .,contains |
R2825 | T3409 | T3409 | ROOT | pcDNA3,pcDNA3 |
R2826 | T3410 | T3409 | nummod | .1,pcDNA3 |
R2827 | T3411 | T3414 | nsubjpass | Vif,provided |
R2828 | T3412 | T3414 | auxpass | was,provided |
R2829 | T3413 | T3414 | advmod | generously,provided |
R2830 | T3414 | T3414 | ROOT | provided,provided |
R2831 | T3415 | T3414 | agent | by,provided |
R2832 | T3416 | T3418 | compound | Nathaniel,Landau |
R2833 | T3417 | T3418 | compound | R.,Landau |
R2834 | T3418 | T3415 | pobj | Landau,by |
R2835 | T3419 | T3414 | prep | from,provided |
R2836 | T3420 | T3422 | det | the,Institute |
R2837 | T3421 | T3422 | compound | Salk,Institute |
R2838 | T3422 | T3419 | pobj | Institute,from |
R2839 | T3423 | T3422 | punct | ",",Institute |
R2840 | T3424 | T3425 | compound | La,Jolla |
R2841 | T3425 | T3422 | appos | Jolla,Institute |
R2842 | T3426 | T3414 | punct | .,provided |
R2843 | T3427 | T3429 | nsubjpass | It,generated |
R2844 | T3428 | T3429 | auxpass | was,generated |
R2845 | T3429 | T3429 | ROOT | generated,generated |
R2846 | T3430 | T3429 | prep | by,generated |
R2847 | T3431 | T3430 | pcomp | amplifying,by |
R2848 | T3432 | T3434 | det | the,gene |
R2849 | T3433 | T3434 | compound | Vif,gene |
R2850 | T3434 | T3431 | dobj | gene,amplifying |
R2851 | T3435 | T3431 | prep | from,amplifying |
R2852 | T3436 | T3435 | pobj | pNL4-3,from |
R2853 | T3437 | T3436 | cc | and,pNL4-3 |
R2854 | T3438 | T3436 | conj | ligating,pNL4-3 |
R2855 | T3439 | T3438 | dobj | it,ligating |
R2856 | T3440 | T3438 | prep | into,ligating |
R2857 | T3441 | T3444 | det | the,vector |
R2858 | T3442 | T3444 | nmod | pcDNA3,vector |
R2859 | T3443 | T3442 | nummod | .1,pcDNA3 |
R2860 | T3444 | T3440 | pobj | vector,into |
R2861 | T3445 | T3431 | prep | via,amplifying |
R2862 | T3446 | T3450 | nmod | BamHI,sites |
R2863 | T3447 | T3446 | cc | and,BamHI |
R2864 | T3448 | T3446 | conj | XhoI,BamHI |
R2865 | T3449 | T3450 | compound | restriction,sites |
R2866 | T3450 | T3445 | pobj | sites,via |
R2867 | T3451 | T3429 | punct | .,generated |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T2661 | 0-735 | Sentence | denotes | The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. Landau from the Salk Institute, La Jolla. It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites. |
T57 | 0-396 | Sentence | denotes | The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung. |
T58 | 397-558 | Sentence | denotes | Plasmid pNL4-3 (NIBSC, UK) contains the full-length HIV-1NL4-3 genome and has been described previously (34). pcDNA3.1Vif was generously provided by Nathaniel R. |
T59 | 559-600 | Sentence | denotes | Landau from the Salk Institute, La Jolla. |
T60 | 601-735 | Sentence | denotes | It was generated by amplifying the Vif gene from pNL4-3 and ligating it into the pcDNA3.1 vector via BamHI and XhoI restriction sites. |
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
17517765-3016298-77155599 | 502-504 | 3016298 | denotes | 34 |
events-check-again
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3812 | 217-242 | Protein | denotes | guanylate-binding protein |
T3813 | 244-247 | Protein | denotes | GBP |
T3814 | 636-639 | Protein | denotes | Vif |
R3135 | T3813 | T3812 | equivalentTo | GBP,guanylate-binding protein |
bionlp-st-ge-2016-reference-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T3846 | 113-116 | Protein | denotes | IFN |
T3847 | 217-242 | Protein | denotes | guanylate-binding protein |
T3848 | 244-247 | Protein | denotes | GBP |
T3849 | 702-707 | Protein | denotes | BamHI |
T3850 | 712-734 | Protein | denotes | XhoI restriction sites |
bionlp-st-ge-2016-reference
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T2630 | 217-242 | Protein | denotes | guanylate-binding protein |
T2631 | 244-247 | Protein | denotes | GBP |
T2632 | 636-639 | Protein | denotes | Vif |
R2130 | T2631 | T2630 | equivalentTo | GBP,guanylate-binding protein |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T2680 | 636-639 | P12504 | denotes | Vif |