> top > docs > PMC:1920263 > spans > 8508-8904 > annotations

PMC:1920263 / 8508-8904 JSONTXT

Annnotations TAB JSON ListView MergeView

test2

Id Subject Object Predicate Lexical cue
T2613 217-242 Protein denotes guanylate-binding protein
T2614 244-247 Protein denotes GBP
R2129 T2614 T2613 equivalentTo GBP,guanylate-binding protein

GO-MF

Id Subject Object Predicate Lexical cue
T3715 128-131 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS
T3716 227-234 http://purl.obolibrary.org/obo/GO_0005488 denotes binding
T3717 227-242 http://purl.obolibrary.org/obo/GO_0005515 denotes binding protein

GO-BP

Id Subject Object Predicate Lexical cue
T2671 128-131 http://purl.obolibrary.org/obo/GO_0034005 denotes GAS

bionlp-st-ge-2016-spacy-parsed

Id Subject Object Predicate Lexical cue
T3329 0-3 DT denotes The
T3330 4-12 NN denotes reporter
T3331 13-21 NNS denotes plasmids
T3332 22-34 JJ denotes pGL3-Control
T3333 35-38 CC denotes and
T3334 39-46 JJ denotes phRG-TK
T3335 47-51 VBD denotes were
T3336 52-61 VBN denotes purchased
T3337 62-66 IN denotes from
T3338 67-74 NNP denotes Promega
T3339 74-75 . denotes .
T3340 76-84 NN denotes pGL2-CVX
T3341 85-93 VBZ denotes contains
T3342 94-97 CD denotes two
T3343 98-105 NNS denotes repeats
T3344 106-108 IN denotes of
T3345 109-112 DT denotes the
T3346 113-127 JJ denotes IFN-responsive
T3347 128-131 NNP denotes GAS
T3348 132-133 -LRB- denotes (
T3349 133-138 NN denotes gamma
T3350 139-148 VBN denotes activated
T3351 149-157 NN denotes sequence
T3352 157-158 -RRB- denotes )
T3353 159-167 NNS denotes elements
T3354 168-169 -LRB- denotes (
T3355 169-208 NNP denotes GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
T3356 208-209 -RRB- denotes )
T3357 210-212 IN denotes of
T3358 213-216 DT denotes the
T3359 217-234 JJ denotes guanylate-binding
T3360 235-242 NN denotes protein
T3361 243-244 -LRB- denotes (
T3362 244-247 NNP denotes GBP
T3363 247-248 -RRB- denotes )
T3364 249-253 NN denotes gene
T3365 254-256 IN denotes in
T3366 257-262 NN denotes front
T3367 263-265 IN denotes of
T3368 266-267 DT denotes a
T3369 268-271 NNP denotes CMV
T3370 272-279 JJ denotes minimal
T3371 280-288 NN denotes promoter
T3372 289-292 CC denotes and
T3373 293-296 VBD denotes was
T3374 297-303 RB denotes kindly
T3375 304-312 VBN denotes provided
T3376 313-315 IN denotes by
T3377 316-319 NNP denotes Ute
T3378 320-327 NNP denotes Pägelow
T3379 328-331 CC denotes and
T3380 332-337 NNP denotes Mario
T3381 338-344 NNP denotes Köster
T3382 345-349 IN denotes from
T3383 350-353 DT denotes the
T3384 354-371 NNP denotes Helmholtz-Zentrum
T3385 372-375 NN denotes für
T3386 376-395 NNP denotes Infektionsforschung
T3387 395-396 . denotes .
R2745 T3329 T3330 det The,reporter
R2746 T3330 T3331 nsubj reporter,plasmids
R2747 T3331 T3336 nsubjpass plasmids,purchased
R2748 T3332 T3331 amod pGL3-Control,plasmids
R2749 T3333 T3332 cc and,pGL3-Control
R2750 T3334 T3332 conj phRG-TK,pGL3-Control
R2751 T3335 T3336 auxpass were,purchased
R2752 T3336 T3336 ROOT purchased,purchased
R2753 T3337 T3336 prep from,purchased
R2754 T3338 T3337 pobj Promega,from
R2755 T3339 T3336 punct .,purchased
R2756 T3340 T3341 nsubj pGL2-CVX,contains
R2757 T3341 T3341 ROOT contains,contains
R2758 T3342 T3343 nummod two,repeats
R2759 T3343 T3341 dobj repeats,contains
R2760 T3344 T3343 prep of,repeats
R2761 T3345 T3347 det the,GAS
R2762 T3346 T3347 compound IFN-responsive,GAS
R2763 T3347 T3353 nmod GAS,elements
R2764 T3348 T3347 punct (,GAS
R2765 T3349 T3350 npadvmod gamma,activated
R2766 T3350 T3351 amod activated,sequence
R2767 T3351 T3347 appos sequence,GAS
R2768 T3352 T3347 punct ),GAS
R2769 T3353 T3344 pobj elements,of
R2770 T3354 T3355 punct (,GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG
R2771 T3355 T3353 appos GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG,elements
R2772 T3356 T3353 punct ),elements
R2773 T3357 T3353 prep of,elements
R2774 T3358 T3360 det the,protein
R2775 T3359 T3360 amod guanylate-binding,protein
R2776 T3360 T3357 pobj protein,of
R2777 T3361 T3360 punct (,protein
R2778 T3362 T3360 appos GBP,protein
R2779 T3363 T3360 punct ),protein
R2780 T3364 T3343 appos gene,repeats
R2781 T3365 T3364 prep in,gene
R2782 T3366 T3365 pobj front,in
R2783 T3367 T3366 prep of,front
R2784 T3368 T3371 det a,promoter
R2785 T3369 T3371 nmod CMV,promoter
R2786 T3370 T3371 amod minimal,promoter
R2787 T3371 T3367 pobj promoter,of
R2788 T3372 T3341 cc and,contains
R2789 T3373 T3375 auxpass was,provided
R2790 T3374 T3375 advmod kindly,provided
R2791 T3375 T3341 conj provided,contains
R2792 T3376 T3375 agent by,provided
R2793 T3377 T3378 compound Ute,Pägelow
R2794 T3378 T3376 pobj Pägelow,by
R2795 T3379 T3378 cc and,Pägelow
R2796 T3380 T3381 compound Mario,Köster
R2797 T3381 T3378 conj Köster,Pägelow
R2798 T3382 T3378 prep from,Pägelow
R2799 T3383 T3385 det the,für
R2800 T3384 T3385 compound Helmholtz-Zentrum,für
R2801 T3385 T3382 pobj für,from
R2802 T3386 T3385 appos Infektionsforschung,für
R2803 T3387 T3341 punct .,contains

sentences

Id Subject Object Predicate Lexical cue
T57 0-396 Sentence denotes The reporter plasmids pGL3-Control and phRG-TK were purchased from Promega. pGL2-CVX contains two repeats of the IFN-responsive GAS (gamma activated sequence) elements (GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG) of the guanylate-binding protein (GBP) gene in front of a CMV minimal promoter and was kindly provided by Ute Pägelow and Mario Köster from the Helmholtz-Zentrum für Infektionsforschung.

events-check-again

Id Subject Object Predicate Lexical cue
T3812 217-242 Protein denotes guanylate-binding protein
T3813 244-247 Protein denotes GBP
R3135 T3813 T3812 equivalentTo GBP,guanylate-binding protein

bionlp-st-ge-2016-reference-tees

Id Subject Object Predicate Lexical cue
T3846 113-116 Protein denotes IFN
T3847 217-242 Protein denotes guanylate-binding protein
T3848 244-247 Protein denotes GBP

bionlp-st-ge-2016-reference

Id Subject Object Predicate Lexical cue
T2630 217-242 Protein denotes guanylate-binding protein
T2631 244-247 Protein denotes GBP
R2130 T2631 T2630 equivalentTo GBP,guanylate-binding protein