Id |
Subject |
Object |
Predicate |
Lexical cue |
T3329 |
0-3 |
DT |
denotes |
The |
T3330 |
4-12 |
NN |
denotes |
reporter |
T3331 |
13-21 |
NNS |
denotes |
plasmids |
T3332 |
22-34 |
JJ |
denotes |
pGL3-Control |
T3333 |
35-38 |
CC |
denotes |
and |
T3334 |
39-46 |
JJ |
denotes |
phRG-TK |
T3335 |
47-51 |
VBD |
denotes |
were |
T3336 |
52-61 |
VBN |
denotes |
purchased |
T3337 |
62-66 |
IN |
denotes |
from |
T3338 |
67-74 |
NNP |
denotes |
Promega |
T3339 |
74-75 |
. |
denotes |
. |
T3340 |
76-84 |
NN |
denotes |
pGL2-CVX |
T3341 |
85-93 |
VBZ |
denotes |
contains |
T3342 |
94-97 |
CD |
denotes |
two |
T3343 |
98-105 |
NNS |
denotes |
repeats |
T3344 |
106-108 |
IN |
denotes |
of |
T3345 |
109-112 |
DT |
denotes |
the |
T3346 |
113-127 |
JJ |
denotes |
IFN-responsive |
T3347 |
128-131 |
NNP |
denotes |
GAS |
T3348 |
132-133 |
-LRB- |
denotes |
( |
T3349 |
133-138 |
NN |
denotes |
gamma |
T3350 |
139-148 |
VBN |
denotes |
activated |
T3351 |
149-157 |
NN |
denotes |
sequence |
T3352 |
157-158 |
-RRB- |
denotes |
) |
T3353 |
159-167 |
NNS |
denotes |
elements |
T3354 |
168-169 |
-LRB- |
denotes |
( |
T3355 |
169-208 |
NNP |
denotes |
GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG |
T3356 |
208-209 |
-RRB- |
denotes |
) |
T3357 |
210-212 |
IN |
denotes |
of |
T3358 |
213-216 |
DT |
denotes |
the |
T3359 |
217-234 |
JJ |
denotes |
guanylate-binding |
T3360 |
235-242 |
NN |
denotes |
protein |
T3361 |
243-244 |
-LRB- |
denotes |
( |
T3362 |
244-247 |
NNP |
denotes |
GBP |
T3363 |
247-248 |
-RRB- |
denotes |
) |
T3364 |
249-253 |
NN |
denotes |
gene |
T3365 |
254-256 |
IN |
denotes |
in |
T3366 |
257-262 |
NN |
denotes |
front |
T3367 |
263-265 |
IN |
denotes |
of |
T3368 |
266-267 |
DT |
denotes |
a |
T3369 |
268-271 |
NNP |
denotes |
CMV |
T3370 |
272-279 |
JJ |
denotes |
minimal |
T3371 |
280-288 |
NN |
denotes |
promoter |
T3372 |
289-292 |
CC |
denotes |
and |
T3373 |
293-296 |
VBD |
denotes |
was |
T3374 |
297-303 |
RB |
denotes |
kindly |
T3375 |
304-312 |
VBN |
denotes |
provided |
T3376 |
313-315 |
IN |
denotes |
by |
T3377 |
316-319 |
NNP |
denotes |
Ute |
T3378 |
320-327 |
NNP |
denotes |
Pägelow |
T3379 |
328-331 |
CC |
denotes |
and |
T3380 |
332-337 |
NNP |
denotes |
Mario |
T3381 |
338-344 |
NNP |
denotes |
Köster |
T3382 |
345-349 |
IN |
denotes |
from |
T3383 |
350-353 |
DT |
denotes |
the |
T3384 |
354-371 |
NNP |
denotes |
Helmholtz-Zentrum |
T3385 |
372-375 |
NN |
denotes |
für |
T3386 |
376-395 |
NNP |
denotes |
Infektionsforschung |
T3387 |
395-396 |
. |
denotes |
. |
R2745 |
T3329 |
T3330 |
det |
The,reporter |
R2746 |
T3330 |
T3331 |
nsubj |
reporter,plasmids |
R2747 |
T3331 |
T3336 |
nsubjpass |
plasmids,purchased |
R2748 |
T3332 |
T3331 |
amod |
pGL3-Control,plasmids |
R2749 |
T3333 |
T3332 |
cc |
and,pGL3-Control |
R2750 |
T3334 |
T3332 |
conj |
phRG-TK,pGL3-Control |
R2751 |
T3335 |
T3336 |
auxpass |
were,purchased |
R2752 |
T3336 |
T3336 |
ROOT |
purchased,purchased |
R2753 |
T3337 |
T3336 |
prep |
from,purchased |
R2754 |
T3338 |
T3337 |
pobj |
Promega,from |
R2755 |
T3339 |
T3336 |
punct |
.,purchased |
R2756 |
T3340 |
T3341 |
nsubj |
pGL2-CVX,contains |
R2757 |
T3341 |
T3341 |
ROOT |
contains,contains |
R2758 |
T3342 |
T3343 |
nummod |
two,repeats |
R2759 |
T3343 |
T3341 |
dobj |
repeats,contains |
R2760 |
T3344 |
T3343 |
prep |
of,repeats |
R2761 |
T3345 |
T3347 |
det |
the,GAS |
R2762 |
T3346 |
T3347 |
compound |
IFN-responsive,GAS |
R2763 |
T3347 |
T3353 |
nmod |
GAS,elements |
R2764 |
T3348 |
T3347 |
punct |
(,GAS |
R2765 |
T3349 |
T3350 |
npadvmod |
gamma,activated |
R2766 |
T3350 |
T3351 |
amod |
activated,sequence |
R2767 |
T3351 |
T3347 |
appos |
sequence,GAS |
R2768 |
T3352 |
T3347 |
punct |
),GAS |
R2769 |
T3353 |
T3344 |
pobj |
elements,of |
R2770 |
T3354 |
T3355 |
punct |
(,GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG |
R2771 |
T3355 |
T3353 |
appos |
GATCTGGATTTAGAGTAATATGAAACTGAAAGTACTTCG,elements |
R2772 |
T3356 |
T3353 |
punct |
),elements |
R2773 |
T3357 |
T3353 |
prep |
of,elements |
R2774 |
T3358 |
T3360 |
det |
the,protein |
R2775 |
T3359 |
T3360 |
amod |
guanylate-binding,protein |
R2776 |
T3360 |
T3357 |
pobj |
protein,of |
R2777 |
T3361 |
T3360 |
punct |
(,protein |
R2778 |
T3362 |
T3360 |
appos |
GBP,protein |
R2779 |
T3363 |
T3360 |
punct |
),protein |
R2780 |
T3364 |
T3343 |
appos |
gene,repeats |
R2781 |
T3365 |
T3364 |
prep |
in,gene |
R2782 |
T3366 |
T3365 |
pobj |
front,in |
R2783 |
T3367 |
T3366 |
prep |
of,front |
R2784 |
T3368 |
T3371 |
det |
a,promoter |
R2785 |
T3369 |
T3371 |
nmod |
CMV,promoter |
R2786 |
T3370 |
T3371 |
amod |
minimal,promoter |
R2787 |
T3371 |
T3367 |
pobj |
promoter,of |
R2788 |
T3372 |
T3341 |
cc |
and,contains |
R2789 |
T3373 |
T3375 |
auxpass |
was,provided |
R2790 |
T3374 |
T3375 |
advmod |
kindly,provided |
R2791 |
T3375 |
T3341 |
conj |
provided,contains |
R2792 |
T3376 |
T3375 |
agent |
by,provided |
R2793 |
T3377 |
T3378 |
compound |
Ute,Pägelow |
R2794 |
T3378 |
T3376 |
pobj |
Pägelow,by |
R2795 |
T3379 |
T3378 |
cc |
and,Pägelow |
R2796 |
T3380 |
T3381 |
compound |
Mario,Köster |
R2797 |
T3381 |
T3378 |
conj |
Köster,Pägelow |
R2798 |
T3382 |
T3378 |
prep |
from,Pägelow |
R2799 |
T3383 |
T3385 |
det |
the,für |
R2800 |
T3384 |
T3385 |
compound |
Helmholtz-Zentrum,für |
R2801 |
T3385 |
T3382 |
pobj |
für,from |
R2802 |
T3386 |
T3385 |
appos |
Infektionsforschung,für |
R2803 |
T3387 |
T3341 |
punct |
.,contains |