
PMC:1359074 / 35286-35886
Annnotations
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
16462943-14530442-85761024 | 15-17 | 14530442 | denotes | 15 |
16462943-12677004-85761025 | 192-194 | 12677004 | denotes | 32 |
T89386 | 15-17 | 14530442 | denotes | 15 |
T39276 | 192-194 | 12677004 | denotes | 32 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16443 | 598-599 | -RRB- | denotes | ) |
T16442 | 595-598 | CD | denotes | −18 |
T16441 | 592-594 | TO | denotes | to |
T16440 | 588-591 | CD | denotes | −63 |
T16439 | 587-588 | -LRB- | denotes | ( |
T16438 | 584-586 | NN | denotes | 3′ |
T16437 | 535-583 | NN | denotes | 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
T16436 | 533-534 | -COMMA- | denotes | , |
T16435 | 526-533 | NN | denotes | MHB1663 |
T16434 | 522-525 | CC | denotes | and |
T16433 | 520-521 | -COLON- | denotes | ; |
T16432 | 519-520 | -RRB- | denotes | ) |
T16431 | 516-519 | CD | denotes | −16 |
T16430 | 513-515 | TO | denotes | to |
T16429 | 509-512 | CD | denotes | −63 |
T16428 | 508-509 | -LRB- | denotes | ( |
T16427 | 456-507 | NN | denotes | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ |
T16426 | 454-455 | -COMMA- | denotes | , |
T16425 | 447-454 | NN | denotes | MHB1662 |
T16424 | 445-446 | -COLON- | denotes | ; |
T16423 | 444-445 | -RRB- | denotes | ) |
T16422 | 441-444 | CD | denotes | −19 |
T16421 | 438-440 | TO | denotes | to |
T16420 | 434-437 | CD | denotes | −63 |
T16374 | 127-131 | WDT | denotes | that |
T16373 | 125-126 | -RRB- | denotes | ) |
T16372 | 107-125 | NN | denotes | Sox6-ΔHMG-pcDNA3.1 |
T16371 | 106-107 | -LRB- | denotes | ( |
T16370 | 96-105 | NN | denotes | construct |
T16369 | 81-95 | NN | denotes | overexpression |
T16368 | 76-80 | NN | denotes | Sox6 |
T16367 | 72-75 | DT | denotes | the |
T16366 | 69-71 | IN | denotes | of |
T16365 | 61-68 | NN | denotes | version |
T16364 | 51-60 | VB | denotes | truncated |
T16363 | 49-50 | DT | denotes | A |
T16362 | 43-47 | NN | denotes | Sox6 |
T16361 | 31-42 | VB | denotes | overexpress |
T16360 | 28-30 | TO | denotes | to |
T16359 | 23-27 | VB | denotes | used |
T16358 | 19-22 | VB | denotes | was |
T16357 | 17-18 | -RRB- | denotes | ] |
T16356 | 15-17 | CD | denotes | 15 |
T16355 | 14-15 | -LRB- | denotes | [ |
T16354 | 0-13 | NN | denotes | Sox6-pcDNA3.1 |
T16419 | 433-434 | -LRB- | denotes | ( |
T16418 | 383-432 | NN | denotes | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ |
T16417 | 381-382 | -COMMA- | denotes | , |
T16416 | 374-381 | NN | denotes | MHB1661 |
T16415 | 372-373 | -COLON- | denotes | : |
T16414 | 365-372 | VB | denotes | include |
T16413 | 354-364 | NN | denotes | constructs |
T16412 | 345-353 | NN | denotes | reporter |
T16411 | 336-344 | NN | denotes | promoter |
T16410 | 333-335 | NN | denotes | ɛy |
T16409 | 321-332 | VB | denotes | mutagenized |
T16408 | 315-320 | DT | denotes | these |
T16407 | 306-314 | VB | denotes | generate |
T16406 | 303-305 | TO | denotes | to |
T16405 | 298-302 | VB | denotes | used |
T16404 | 290-297 | NN | denotes | primers |
T16403 | 282-289 | JJ | denotes | Forward |
T16402 | 277-280 | NN | denotes | PCR |
T16401 | 274-276 | IN | denotes | by |
T16400 | 269-273 | VB | denotes | done |
T16399 | 264-268 | VB | denotes | were |
T16398 | 255-263 | NN | denotes | promoter |
T16397 | 252-254 | JJ | denotes | ɛy |
T16396 | 248-251 | DT | denotes | the |
T16395 | 245-247 | IN | denotes | of |
T16394 | 239-244 | NN | denotes | sites |
T16393 | 231-238 | NN | denotes | binding |
T16392 | 221-230 | NN | denotes | consensus |
T16391 | 212-220 | NN | denotes | Sox/Sox6 |
T16390 | 209-211 | IN | denotes | of |
T16389 | 197-208 | NN | denotes | Mutagenesis |
T16388 | 194-195 | -RRB- | denotes | ] |
T16387 | 192-194 | CD | denotes | 32 |
T16386 | 191-192 | -LRB- | denotes | [ |
T16385 | 184-190 | NN | denotes | others |
T16384 | 181-183 | IN | denotes | by |
T16383 | 171-180 | VB | denotes | described |
T16382 | 168-170 | IN | denotes | as |
T16381 | 166-167 | -COMMA- | denotes | , |
T16380 | 157-166 | VB | denotes | generated |
T16379 | 153-156 | VB | denotes | was |
T16378 | 146-152 | NN | denotes | domain |
T16377 | 142-145 | NN | denotes | HMG |
T16376 | 138-141 | DT | denotes | the |
T16375 | 132-137 | VB | denotes | lacks |
R11365 | T16354 | T16355 | arg1Of | Sox6-pcDNA3.1,[ |
R11366 | T16354 | T16358 | arg1Of | Sox6-pcDNA3.1,was |
R11367 | T16354 | T16359 | arg2Of | Sox6-pcDNA3.1,used |
R11368 | T16354 | T16361 | arg1Of | Sox6-pcDNA3.1,overexpress |
R11369 | T16356 | T16355 | arg2Of | 15,[ |
R11370 | T16357 | T16355 | arg3Of | ],[ |
R11371 | T16359 | T16358 | arg2Of | used,was |
R11372 | T16361 | T16359 | arg3Of | overexpress,used |
R11373 | T16361 | T16360 | arg1Of | overexpress,to |
R11374 | T16362 | T16361 | arg2Of | Sox6,overexpress |
R11375 | T16365 | T16363 | arg1Of | version,A |
R11376 | T16365 | T16364 | arg2Of | version,truncated |
R11377 | T16365 | T16366 | arg1Of | version,of |
R11378 | T16365 | T16379 | arg1Of | version,was |
R11379 | T16365 | T16380 | arg2Of | version,generated |
R11380 | T16370 | T16366 | arg2Of | construct,of |
R11381 | T16370 | T16367 | arg1Of | construct,the |
R11382 | T16370 | T16368 | arg1Of | construct,Sox6 |
R11383 | T16370 | T16369 | arg1Of | construct,overexpression |
R11384 | T16370 | T16371 | arg1Of | construct,( |
R11385 | T16370 | T16374 | arg1Of | construct,that |
R11386 | T16370 | T16375 | arg1Of | construct,lacks |
R11387 | T16372 | T16371 | arg2Of | Sox6-ΔHMG-pcDNA3.1,( |
R11388 | T16373 | T16371 | arg3Of | ),( |
R11389 | T16378 | T16375 | arg2Of | domain,lacks |
R11390 | T16378 | T16376 | arg1Of | domain,the |
R11391 | T16378 | T16377 | arg1Of | domain,HMG |
R11392 | T16380 | T16379 | arg2Of | generated,was |
R11393 | T16380 | T16381 | arg1Of | generated,"," |
R11394 | T16380 | T16382 | arg1Of | generated,as |
R11395 | T16383 | T16382 | arg2Of | described,as |
R11396 | T16385 | T16383 | arg1Of | others,described |
R11397 | T16385 | T16384 | arg2Of | others,by |
R11398 | T16385 | T16386 | arg1Of | others,[ |
R11399 | T16387 | T16386 | arg2Of | 32,[ |
R11400 | T16388 | T16386 | arg3Of | ],[ |
R11401 | T16389 | T16390 | arg1Of | Mutagenesis,of |
R11402 | T16389 | T16399 | arg1Of | Mutagenesis,were |
R11403 | T16389 | T16400 | arg2Of | Mutagenesis,done |
R11404 | T16394 | T16390 | arg2Of | sites,of |
R11405 | T16394 | T16391 | arg1Of | sites,Sox/Sox6 |
R11406 | T16394 | T16392 | arg1Of | sites,consensus |
R11407 | T16394 | T16393 | arg1Of | sites,binding |
R11408 | T16394 | T16395 | arg1Of | sites,of |
R11409 | T16398 | T16395 | arg2Of | promoter,of |
R11410 | T16398 | T16396 | arg1Of | promoter,the |
R11411 | T16398 | T16397 | arg1Of | promoter,ɛy |
R11412 | T16400 | T16399 | arg2Of | done,were |
R11413 | T16402 | T16400 | arg1Of | PCR,done |
R11414 | T16402 | T16401 | arg2Of | PCR,by |
R11415 | T16404 | T16403 | arg1Of | primers,Forward |
R11416 | T16404 | T16405 | arg2Of | primers,used |
R11417 | T16404 | T16414 | arg1Of | primers,include |
R11418 | T16407 | T16405 | arg3Of | generate,used |
R11419 | T16407 | T16406 | arg1Of | generate,to |
R11420 | T16413 | T16407 | arg2Of | constructs,generate |
R11421 | T16413 | T16408 | arg1Of | constructs,these |
R11422 | T16413 | T16409 | arg2Of | constructs,mutagenized |
R11423 | T16413 | T16410 | arg1Of | constructs,ɛy |
R11424 | T16413 | T16411 | arg1Of | constructs,promoter |
R11425 | T16413 | T16412 | arg1Of | constructs,reporter |
R11426 | T16414 | T16415 | arg1Of | include,: |
R11427 | T16416 | T16414 | arg2Of | MHB1661,include |
R11428 | T16416 | T16417 | arg1Of | MHB1661,"," |
R11429 | T16416 | T16424 | arg1Of | MHB1661,; |
R11430 | T16418 | T16417 | arg2Of | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,"," |
R11431 | T16418 | T16419 | arg1Of | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,( |
R11432 | T16422 | T16419 | arg2Of | −19,( |
R11433 | T16422 | T16420 | arg1Of | −19,−63 |
R11434 | T16422 | T16421 | arg1Of | −19,to |
R11435 | T16423 | T16419 | arg3Of | ),( |
R11436 | T16425 | T16426 | arg1Of | MHB1662,"," |
R11437 | T16425 | T16434 | arg1Of | MHB1662,and |
R11438 | T16427 | T16426 | arg2Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,"," |
R11439 | T16427 | T16428 | arg1Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,( |
R11440 | T16431 | T16428 | arg2Of | −16,( |
R11441 | T16431 | T16429 | arg1Of | −16,−63 |
R11442 | T16431 | T16430 | arg1Of | −16,to |
R11443 | T16432 | T16428 | arg3Of | ),( |
R11444 | T16434 | T16424 | arg2Of | and,; |
R11445 | T16434 | T16433 | arg1Of | and,; |
R11446 | T16435 | T16434 | arg2Of | MHB1663,and |
R11447 | T16435 | T16436 | arg1Of | MHB1663,"," |
R11448 | T16438 | T16436 | arg2Of | 3′,"," |
R11449 | T16438 | T16437 | arg1Of | 3′,5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11450 | T16438 | T16439 | arg1Of | 3′,( |
R11451 | T16442 | T16439 | arg2Of | −18,( |
R11452 | T16442 | T16440 | arg1Of | −18,−63 |
R11453 | T16442 | T16441 | arg1Of | −18,to |
R11454 | T16443 | T16439 | arg3Of | ),( |
bionlp-st-ge-2016-test-proteins
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16053 | 252-254 | Protein | denotes | ɛy |
T16052 | 107-111 | Protein | denotes | Sox6 |
T16051 | 76-80 | Protein | denotes | Sox6 |
T16050 | 43-47 | Protein | denotes | Sox6 |
T16049 | 0-4 | Protein | denotes | Sox6 |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16450 | 216-220 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16449 | 107-111 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16448 | 76-80 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16447 | 43-47 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16446 | 0-4 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16056 | 231-238 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16008 | 282-600 | Sentence | denotes | Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18). |
T16007 | 197-281 | Sentence | denotes | Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. |
T16006 | 49-196 | Sentence | denotes | A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. |
T16005 | 0-48 | Sentence | denotes | Sox6-pcDNA3.1 [15] was used to overexpress Sox6. |
T261 | 0-48 | Sentence | denotes | Sox6-pcDNA3.1 [15] was used to overexpress Sox6. |
T262 | 49-196 | Sentence | denotes | A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. |
T263 | 197-281 | Sentence | denotes | Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. |
T264 | 282-600 | Sentence | denotes | Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18). |
simple1
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16072 | 252-254 | Protein | denotes | ɛy |
T16071 | 107-111 | Protein | denotes | Sox6 |
T16070 | 76-80 | Protein | denotes | Sox6 |
T16069 | 43-47 | Protein | denotes | Sox6 |
T16068 | 0-4 | Protein | denotes | Sox6 |
BioNLP16_DUT
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T17096 | 31-42 | Gene_expression | denotes | overexpress |
T17095 | 31-42 | Positive_regulation | denotes | overexpress |
T17091 | 252-254 | Protein | denotes | ɛy |
T17090 | 107-111 | Protein | denotes | Sox6 |
T17089 | 76-80 | Protein | denotes | Sox6 |
T17088 | 43-47 | Protein | denotes | Sox6 |
T17087 | 0-4 | Protein | denotes | Sox6 |
R11934 | T17088 | T17096 | themeOf | Sox6,overexpress |
R11936 | T17096 | T17095 | themeOf | overexpress,overexpress |
BioNLP16_Messiy
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16472 | 81-95 | Positive_regulation | denotes | overexpression |
T16471 | 31-42 | Gene_expression | denotes | overexpress |
T16466 | 252-254 | Protein | denotes | ɛy |
T16465 | 107-111 | Protein | denotes | Sox6 |
T16464 | 76-80 | Protein | denotes | Sox6 |
T16463 | 43-47 | Protein | denotes | Sox6 |
T16462 | 0-4 | Protein | denotes | Sox6 |
R11458 | T16463 | T16471 | themeOf | Sox6,overexpress |
R11459 | T16464 | T16472 | themeOf | Sox6,overexpression |
DLUT931
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16542 | 81-95 | Positive_regulation | denotes | overexpression |
T16541 | 31-42 | Gene_expression | denotes | overexpress |
T16536 | 252-254 | Protein | denotes | ɛy |
T16535 | 107-111 | Protein | denotes | Sox6 |
T16534 | 76-80 | Protein | denotes | Sox6 |
T16533 | 43-47 | Protein | denotes | Sox6 |
T16532 | 0-4 | Protein | denotes | Sox6 |
R11472 | T16533 | T16541 | themeOf | Sox6,overexpress |
R11473 | T16534 | T16542 | themeOf | Sox6,overexpression |
bionlp-st-ge-2016-test-ihmc
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T17054 | 252-254 | Protein | denotes | ɛy |
T17049 | 138-152 | Entity | denotes | the HMG domain |
T17042 | 76-80 | Protein | denotes | Sox6 |
T17039 | 333-344 | Entity | denotes | ɛy promoter |
T17037 | 43-47 | Protein | denotes | Sox6 |
T17031 | 245-263 | Entity | denotes | of the ɛy promoter |
T17030 | 274-280 | Protein | denotes | by PCR |
T17075 | 31-47 | Gene_expression | denotes | overexpress Sox6 |
T17074 | 31-47 | Positive_regulation | denotes | overexpress Sox6 |
T17073 | 69-126 | Positive_regulation | denotes | of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
T17072 | 69-126 | Gene_expression | denotes | of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
T17060 | 333-335 | Protein | denotes | ɛy |
T17059 | 212-280 | Protein | denotes | Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR |
R11921 | T17031 | T17054 | partOf | of the ɛy promoter,ɛy |
R11922 | T17037 | T17074 | themeOf | Sox6,overexpress Sox6 |
R11923 | T17037 | T17075 | themeOf | Sox6,overexpress Sox6 |
R11925 | T17039 | T17060 | partOf | ɛy promoter,ɛy |
R11926 | T17042 | T17072 | themeOf | Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
R11927 | T17042 | T17073 | themeOf | Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16996 | 599-600 | . | denotes | . |
T16995 | 598-599 | -RRB- | denotes | ) |
T16994 | 596-598 | CD | denotes | 18 |
T16993 | 595-596 | CD | denotes | − |
T16992 | 592-594 | TO | denotes | to |
T16991 | 589-591 | CD | denotes | 63 |
T16990 | 588-589 | FW | denotes | − |
T16989 | 587-588 | -LRB- | denotes | ( |
T16988 | 585-586 | NN | denotes | ′ |
T16987 | 584-585 | CD | denotes | 3 |
T16986 | 537-583 | NNP | denotes | CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
T16985 | 536-537 | NN | denotes | ′ |
T16984 | 535-536 | CD | denotes | 5 |
T16983 | 533-534 | , | denotes | , |
T16982 | 526-533 | NNP | denotes | MHB1663 |
T16981 | 522-525 | CC | denotes | and |
T16980 | 520-521 | : | denotes | ; |
T16979 | 519-520 | -RRB- | denotes | ) |
T16978 | 517-519 | CD | denotes | 16 |
T16977 | 516-517 | CD | denotes | − |
T16976 | 513-515 | TO | denotes | to |
T16975 | 510-512 | CD | denotes | 63 |
T16974 | 509-510 | FW | denotes | − |
T16973 | 508-509 | -LRB- | denotes | ( |
T16972 | 506-507 | NN | denotes | ′ |
T16971 | 458-506 | CD | denotes | CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3 |
T16970 | 457-458 | NN | denotes | ′ |
T16969 | 456-457 | CD | denotes | 5 |
T16968 | 454-455 | , | denotes | , |
T16967 | 447-454 | NNP | denotes | MHB1662 |
T16966 | 445-446 | : | denotes | ; |
T16965 | 444-445 | -RRB- | denotes | ) |
T16964 | 442-444 | CD | denotes | 19 |
T16963 | 441-442 | CD | denotes | − |
T16962 | 438-440 | TO | denotes | to |
T16961 | 435-437 | CD | denotes | 63 |
T16960 | 434-435 | FW | denotes | − |
T16959 | 433-434 | -LRB- | denotes | ( |
T16958 | 431-432 | NN | denotes | ′ |
T16957 | 385-431 | CD | denotes | CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3 |
T16956 | 384-385 | NN | denotes | ′ |
T16955 | 383-384 | CD | denotes | 5 |
T16954 | 381-382 | , | denotes | , |
T16953 | 374-381 | CD | denotes | MHB1661 |
T16952 | 372-373 | : | denotes | : |
T16951 | 365-372 | VBP | denotes | include |
T16950 | 354-364 | NNS | denotes | constructs |
T16949 | 345-353 | NN | denotes | reporter |
T16948 | 336-344 | NN | denotes | promoter |
T16947 | 333-335 | NN | denotes | ɛy |
T16946 | 321-332 | VBN | denotes | mutagenized |
T16945 | 315-320 | DT | denotes | these |
T16944 | 306-314 | VB | denotes | generate |
T16943 | 303-305 | TO | denotes | to |
T16942 | 298-302 | VBN | denotes | used |
T16941 | 290-297 | NNS | denotes | primers |
T16940 | 282-289 | RB | denotes | Forward |
T16939 | 280-281 | . | denotes | . |
T16938 | 277-280 | NNP | denotes | PCR |
T16937 | 274-276 | IN | denotes | by |
T16936 | 269-273 | VBN | denotes | done |
T16935 | 264-268 | VBD | denotes | were |
T16934 | 255-263 | NN | denotes | promoter |
T16933 | 252-254 | JJ | denotes | ɛy |
T16932 | 248-251 | DT | denotes | the |
T16931 | 245-247 | IN | denotes | of |
T16930 | 239-244 | NNS | denotes | sites |
T16929 | 231-238 | JJ | denotes | binding |
T16928 | 221-230 | NN | denotes | consensus |
T16927 | 212-220 | NNP | denotes | Sox/Sox6 |
T16926 | 209-211 | IN | denotes | of |
T16925 | 197-208 | NNP | denotes | Mutagenesis |
T16924 | 195-196 | . | denotes | . |
T16923 | 194-195 | NNP | denotes | ] |
T16922 | 192-194 | CD | denotes | 32 |
T16921 | 191-192 | NNP | denotes | [ |
T16920 | 184-190 | NNS | denotes | others |
T16919 | 181-183 | IN | denotes | by |
T16918 | 171-180 | VBN | denotes | described |
T16917 | 168-170 | IN | denotes | as |
T16916 | 166-167 | , | denotes | , |
T16915 | 157-166 | VBN | denotes | generated |
T16914 | 153-156 | VBD | denotes | was |
T16913 | 146-152 | NN | denotes | domain |
T16912 | 142-145 | NNP | denotes | HMG |
T16911 | 138-141 | DT | denotes | the |
T16910 | 132-137 | VBZ | denotes | lacks |
T16909 | 127-131 | WDT | denotes | that |
T16908 | 125-126 | -RRB- | denotes | ) |
T16907 | 123-125 | CD | denotes | .1 |
T16906 | 107-123 | JJ | denotes | Sox6-ΔHMG-pcDNA3 |
T16905 | 106-107 | -LRB- | denotes | ( |
T16904 | 96-105 | VBP | denotes | construct |
T16903 | 81-95 | NN | denotes | overexpression |
T16902 | 76-80 | JJ | denotes | Sox6 |
T16901 | 72-75 | DT | denotes | the |
T16900 | 69-71 | IN | denotes | of |
T16899 | 61-68 | NN | denotes | version |
T16898 | 51-60 | VBN | denotes | truncated |
T16897 | 49-50 | DT | denotes | A |
T16896 | 47-48 | . | denotes | . |
T16895 | 43-47 | NNP | denotes | Sox6 |
T16894 | 31-42 | VB | denotes | overexpress |
T16893 | 28-30 | TO | denotes | to |
T16892 | 23-27 | VBN | denotes | used |
T16891 | 19-22 | VBD | denotes | was |
T16890 | 17-18 | NNP | denotes | ] |
T16889 | 15-17 | CD | denotes | 15 |
T16888 | 14-15 | NNP | denotes | [ |
T16887 | 11-13 | CD | denotes | .1 |
T16886 | 0-11 | JJ | denotes | Sox6-pcDNA3 |
R11802 | T16886 | T16890 | amod | Sox6-pcDNA3,] |
R11803 | T16887 | T16890 | nummod | .1,] |
R11804 | T16888 | T16890 | nmod | [,] |
R11805 | T16889 | T16890 | nummod | 15,] |
R11806 | T16890 | T16892 | nsubjpass | ],used |
R11807 | T16891 | T16892 | auxpass | was,used |
R11808 | T16892 | T16892 | ROOT | used,used |
R11809 | T16893 | T16894 | aux | to,overexpress |
R11810 | T16894 | T16892 | xcomp | overexpress,used |
R11811 | T16895 | T16894 | dobj | Sox6,overexpress |
R11812 | T16896 | T16892 | punct | .,used |
R11813 | T16897 | T16899 | det | A,version |
R11877 | T16961 | T16960 | nummod | 63,− |
R11878 | T16962 | T16961 | prep | to,63 |
R11879 | T16963 | T16962 | pobj | −,to |
R11880 | T16964 | T16963 | appos | 19,− |
R11881 | T16965 | T16963 | punct | ),− |
R11882 | T16966 | T16967 | punct | ;,MHB1662 |
R11883 | T16967 | T16951 | dobj | MHB1662,include |
R11884 | T16968 | T16967 | punct | ",",MHB1662 |
R11885 | T16969 | T16970 | nummod | 5,′ |
R11886 | T16970 | T16986 | nmod | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11887 | T16971 | T16972 | nummod | CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3,′ |
R11888 | T16972 | T16970 | appos | ′,′ |
R11889 | T16973 | T16974 | punct | (,− |
R11890 | T16974 | T16972 | appos | −,′ |
R11891 | T16975 | T16974 | nummod | 63,− |
R11892 | T16976 | T16975 | prep | to,63 |
R11893 | T16977 | T16976 | pobj | −,to |
R11894 | T16978 | T16977 | appos | 16,− |
R11895 | T16979 | T16977 | punct | ),− |
R11896 | T16980 | T16970 | punct | ;,′ |
R11897 | T16981 | T16970 | cc | and,′ |
R11898 | T16982 | T16970 | conj | MHB1663,′ |
R11899 | T16983 | T16982 | punct | ",",MHB1663 |
R11900 | T16984 | T16985 | nummod | 5,′ |
R11901 | T16985 | T16986 | compound | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11902 | T16986 | T16967 | conj | CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA,MHB1662 |
R11903 | T16987 | T16988 | nummod | 3,′ |
R11904 | T16988 | T16986 | appos | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11905 | T16989 | T16990 | punct | (,− |
R11906 | T16990 | T16988 | appos | −,′ |
R11907 | T16991 | T16990 | nummod | 63,− |
R11908 | T16992 | T16990 | prep | to,− |
R11909 | T16993 | T16992 | pobj | −,to |
R11910 | T16994 | T16993 | appos | 18,− |
R11911 | T16995 | T16993 | punct | ),− |
R11912 | T16996 | T16951 | punct | .,include |
R11814 | T16898 | T16899 | amod | truncated,version |
R11815 | T16899 | T16904 | nsubj | version,construct |
R11816 | T16900 | T16899 | prep | of,version |
R11817 | T16901 | T16903 | det | the,overexpression |
R11818 | T16902 | T16903 | amod | Sox6,overexpression |
R11819 | T16903 | T16900 | pobj | overexpression,of |
R11820 | T16904 | T16904 | ROOT | construct,construct |
R11821 | T16905 | T16908 | punct | (,) |
R11822 | T16906 | T16908 | nmod | Sox6-ΔHMG-pcDNA3,) |
R11823 | T16907 | T16906 | nummod | .1,Sox6-ΔHMG-pcDNA3 |
R11824 | T16908 | T16904 | punct | ),construct |
R11825 | T16909 | T16910 | nsubj | that,lacks |
R11826 | T16910 | T16904 | ccomp | lacks,construct |
R11827 | T16911 | T16913 | det | the,domain |
R11828 | T16912 | T16913 | compound | HMG,domain |
R11829 | T16913 | T16915 | nsubjpass | domain,generated |
R11830 | T16914 | T16915 | auxpass | was,generated |
R11831 | T16915 | T16910 | ccomp | generated,lacks |
R11832 | T16916 | T16915 | punct | ",",generated |
R11833 | T16917 | T16918 | mark | as,described |
R11834 | T16918 | T16915 | advcl | described,generated |
R11835 | T16919 | T16918 | agent | by,described |
R11836 | T16920 | T16919 | pobj | others,by |
R11837 | T16921 | T16923 | nmod | [,] |
R11838 | T16922 | T16923 | nummod | 32,] |
R11839 | T16923 | T16920 | appos | ],others |
R11840 | T16924 | T16904 | punct | .,construct |
R11841 | T16925 | T16936 | nsubjpass | Mutagenesis,done |
R11842 | T16926 | T16925 | prep | of,Mutagenesis |
R11843 | T16927 | T16928 | compound | Sox/Sox6,consensus |
R11844 | T16928 | T16930 | nmod | consensus,sites |
R11845 | T16929 | T16930 | amod | binding,sites |
R11846 | T16930 | T16926 | pobj | sites,of |
R11847 | T16931 | T16930 | prep | of,sites |
R11848 | T16932 | T16934 | det | the,promoter |
R11849 | T16933 | T16934 | amod | ɛy,promoter |
R11850 | T16934 | T16931 | pobj | promoter,of |
R11851 | T16935 | T16936 | auxpass | were,done |
R11852 | T16936 | T16936 | ROOT | done,done |
R11853 | T16937 | T16936 | agent | by,done |
R11854 | T16938 | T16937 | pobj | PCR,by |
R11855 | T16939 | T16936 | punct | .,done |
R11856 | T16940 | T16941 | amod | Forward,primers |
R11857 | T16941 | T16951 | nsubj | primers,include |
R11858 | T16942 | T16941 | acl | used,primers |
R11859 | T16943 | T16944 | aux | to,generate |
R11860 | T16944 | T16942 | xcomp | generate,used |
R11861 | T16945 | T16950 | det | these,constructs |
R11862 | T16946 | T16950 | amod | mutagenized,constructs |
R11863 | T16947 | T16950 | compound | ɛy,constructs |
R11864 | T16948 | T16949 | compound | promoter,reporter |
R11865 | T16949 | T16950 | compound | reporter,constructs |
R11866 | T16950 | T16951 | nsubj | constructs,include |
R11867 | T16951 | T16951 | ROOT | include,include |
R11868 | T16952 | T16951 | punct | :,include |
R11869 | T16953 | T16967 | nummod | MHB1661,MHB1662 |
R11870 | T16954 | T16956 | punct | ",",′ |
R11871 | T16955 | T16956 | nummod | 5,′ |
R11872 | T16956 | T16967 | nmod | ′,MHB1662 |
R11873 | T16957 | T16958 | nummod | CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R11874 | T16958 | T16956 | appos | ′,′ |
R11875 | T16959 | T16960 | punct | (,− |
R11876 | T16960 | T16958 | appos | −,′ |
bionlp-st-ge-2016-test-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T16520 | 321-364 | Protein | denotes | mutagenized ɛy promoter reporter constructs |
T16519 | 216-220 | Protein | denotes | Sox6 |
T16518 | 212-215 | Protein | denotes | Sox |
T16517 | 132-137 | Negative_regulation | denotes | lacks |
T16516 | 142-152 | Protein | denotes | HMG domain |
T16515 | 107-111 | Protein | denotes | Sox6 |
T16514 | 76-80 | Protein | denotes | Sox6 |
T16513 | 31-42 | Positive_regulation | denotes | overexpress |
T16512 | 31-42 | Positive_regulation | denotes | overexpress |
T16511 | 31-42 | Gene_expression | denotes | overexpress |
T16510 | 31-42 | Gene_expression | denotes | overexpress |
T16509 | 43-47 | Protein | denotes | Sox6 |
T16508 | 0-4 | Protein | denotes | Sox6 |
R11464 | T16508 | T16510 | themeOf | Sox6,overexpress |
R11465 | T16509 | T16511 | themeOf | Sox6,overexpress |
R11466 | T16510 | T16512 | themeOf | overexpress,overexpress |
R11467 | T16511 | T16513 | themeOf | overexpress,overexpress |
R11468 | T16516 | T16517 | themeOf | HMG domain,lacks |
testone
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T15957 | 252-254 | Protein | denotes | ɛy |
T15956 | 107-111 | Protein | denotes | Sox6 |
T15955 | 76-80 | Protein | denotes | Sox6 |
T15954 | 43-47 | Protein | denotes | Sox6 |
T15953 | 0-4 | Protein | denotes | Sox6 |
test3
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T15994 | 252-254 | Protein | denotes | ɛy |
T15993 | 107-111 | Protein | denotes | Sox6 |
T15992 | 76-80 | Protein | denotes | Sox6 |
T15991 | 43-47 | Protein | denotes | Sox6 |
T15990 | 0-4 | Protein | denotes | Sox6 |
T15976 | 252-254 | Protein | denotes | ɛy |
T15975 | 107-111 | Protein | denotes | Sox6 |
T15974 | 76-80 | Protein | denotes | Sox6 |
T15973 | 43-47 | Protein | denotes | Sox6 |
T15972 | 0-4 | Protein | denotes | Sox6 |