PMC:1359074 / 33655-35886 JSON TXT

Annnotations TAB JSON ListView MergeView

2_test

{"project":"2_test","denotations":[{"id":"16462943-1737096-85761022","span":{"begin":405,"end":407},"obj":"1737096"},{"id":"16462943-2748594-85761023","span":{"begin":845,"end":847},"obj":"2748594"},{"id":"16462943-14530442-85761024","span":{"begin":1646,"end":1648},"obj":"14530442"},{"id":"16462943-12677004-85761025","span":{"begin":1823,"end":1825},"obj":"12677004"},{"id":"T43787","span":{"begin":405,"end":407},"obj":"1737096"},{"id":"T59528","span":{"begin":845,"end":847},"obj":"2748594"},{"id":"T89386","span":{"begin":1646,"end":1648},"obj":"14530442"},{"id":"T39276","span":{"begin":1823,"end":1825},"obj":"12677004"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

pmc-enju-pas

bionlp-st-ge-2016-test-proteins

{"project":"bionlp-st-ge-2016-test-proteins","denotations":[{"id":"T16053","span":{"begin":1883,"end":1885},"obj":"Protein"},{"id":"T16052","span":{"begin":1738,"end":1742},"obj":"Protein"},{"id":"T16051","span":{"begin":1707,"end":1711},"obj":"Protein"},{"id":"T16050","span":{"begin":1674,"end":1678},"obj":"Protein"},{"id":"T16049","span":{"begin":1631,"end":1635},"obj":"Protein"},{"id":"T16048","span":{"begin":1063,"end":1065},"obj":"Protein"},{"id":"T16047","span":{"begin":1011,"end":1013},"obj":"Protein"},{"id":"T16046","span":{"begin":972,"end":982},"obj":"Protein"},{"id":"T16045","span":{"begin":884,"end":886},"obj":"Protein"},{"id":"T16044","span":{"begin":715,"end":725},"obj":"Protein"},{"id":"T16043","span":{"begin":670,"end":672},"obj":"Protein"},{"id":"T16042","span":{"begin":381,"end":389},"obj":"Protein"},{"id":"T16041","span":{"begin":271,"end":272},"obj":"Protein"},{"id":"T16040","span":{"begin":170,"end":179},"obj":"Protein"},{"id":"T16039","span":{"begin":114,"end":116},"obj":"Protein"},{"id":"T16038","span":{"begin":26,"end":28},"obj":"Protein"}],"namespaces":[{"prefix":"_base","uri":"http://bionlp.dbcls.jp/ontology/ge.owl#"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

bionlp-st-ge-2016-uniprot

{"project":"bionlp-st-ge-2016-uniprot","denotations":[{"id":"T16450","span":{"begin":1847,"end":1851},"obj":"http://www.uniprot.org/uniprot/P35712"},{"id":"T16449","span":{"begin":1738,"end":1742},"obj":"http://www.uniprot.org/uniprot/P35712"},{"id":"T16448","span":{"begin":1707,"end":1711},"obj":"http://www.uniprot.org/uniprot/P35712"},{"id":"T16447","span":{"begin":1674,"end":1678},"obj":"http://www.uniprot.org/uniprot/P35712"},{"id":"T16446","span":{"begin":1631,"end":1635},"obj":"http://www.uniprot.org/uniprot/P35712"},{"id":"T16445","span":{"begin":972,"end":982},"obj":"http://www.uniprot.org/uniprot/P08659"},{"id":"T16444","span":{"begin":715,"end":725},"obj":"http://www.uniprot.org/uniprot/P08659"}],"namespaces":[{"prefix":"_base","uri":"http://www.uniprot.org/uniprot/"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

GO-BP

{"project":"GO-BP","denotations":[{"id":"T16013","span":{"begin":480,"end":495},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T16012","span":{"begin":450,"end":463},"obj":"http://purl.obolibrary.org/obo/GO_0006351"},{"id":"T16011","span":{"begin":273,"end":287},"obj":"http://purl.obolibrary.org/obo/GO_0016458"},{"id":"T16010","span":{"begin":383,"end":389},"obj":"http://purl.obolibrary.org/obo/GO_0005344"},{"id":"T16009","span":{"begin":173,"end":179},"obj":"http://purl.obolibrary.org/obo/GO_0005344"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

GO-MF

{"project":"GO-MF","denotations":[{"id":"T16056","span":{"begin":1862,"end":1869},"obj":"http://purl.obolibrary.org/obo/GO_0005488"},{"id":"T16055","span":{"begin":383,"end":389},"obj":"http://purl.obolibrary.org/obo/GO_0005344"},{"id":"T16054","span":{"begin":173,"end":179},"obj":"http://purl.obolibrary.org/obo/GO_0005344"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

sentences

simple1

{"project":"simple1","denotations":[{"id":"T16072","span":{"begin":1883,"end":1885},"obj":"Protein"},{"id":"T16071","span":{"begin":1738,"end":1742},"obj":"Protein"},{"id":"T16070","span":{"begin":1707,"end":1711},"obj":"Protein"},{"id":"T16069","span":{"begin":1674,"end":1678},"obj":"Protein"},{"id":"T16068","span":{"begin":1631,"end":1635},"obj":"Protein"},{"id":"T16067","span":{"begin":1063,"end":1065},"obj":"Protein"},{"id":"T16066","span":{"begin":1011,"end":1013},"obj":"Protein"},{"id":"T16065","span":{"begin":972,"end":982},"obj":"Protein"},{"id":"T16064","span":{"begin":884,"end":886},"obj":"Protein"},{"id":"T16063","span":{"begin":715,"end":725},"obj":"Protein"},{"id":"T16062","span":{"begin":670,"end":672},"obj":"Protein"},{"id":"T16061","span":{"begin":381,"end":389},"obj":"Protein"},{"id":"T16060","span":{"begin":271,"end":272},"obj":"Protein"},{"id":"T16059","span":{"begin":170,"end":179},"obj":"Protein"},{"id":"T16058","span":{"begin":114,"end":116},"obj":"Protein"},{"id":"T16057","span":{"begin":26,"end":28},"obj":"Protein"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

BioNLP16_DUT

{"project":"BioNLP16_DUT","denotations":[{"id":"T17096","span":{"begin":1662,"end":1673},"obj":"Gene_expression"},{"id":"T17095","span":{"begin":1662,"end":1673},"obj":"Positive_regulation"},{"id":"T17094","span":{"begin":997,"end":1003},"obj":"Positive_regulation"},{"id":"T17093","span":{"begin":983,"end":993},"obj":"Gene_expression"},{"id":"T17092","span":{"begin":278,"end":287},"obj":"Negative_regulation"},{"id":"T17091","span":{"begin":1883,"end":1885},"obj":"Protein"},{"id":"T17090","span":{"begin":1738,"end":1742},"obj":"Protein"},{"id":"T17089","span":{"begin":1707,"end":1711},"obj":"Protein"},{"id":"T17088","span":{"begin":1674,"end":1678},"obj":"Protein"},{"id":"T17087","span":{"begin":1631,"end":1635},"obj":"Protein"},{"id":"T17086","span":{"begin":1063,"end":1065},"obj":"Protein"},{"id":"T17085","span":{"begin":972,"end":982},"obj":"Protein"},{"id":"T17084","span":{"begin":884,"end":886},"obj":"Protein"},{"id":"T17083","span":{"begin":1011,"end":1013},"obj":"Protein"},{"id":"T17082","span":{"begin":715,"end":725},"obj":"Protein"},{"id":"T17081","span":{"begin":670,"end":672},"obj":"Protein"},{"id":"T17080","span":{"begin":381,"end":389},"obj":"Protein"},{"id":"T17079","span":{"begin":271,"end":272},"obj":"Protein"},{"id":"T17078","span":{"begin":170,"end":179},"obj":"Protein"},{"id":"T17077","span":{"begin":114,"end":116},"obj":"Protein"},{"id":"T17076","span":{"begin":26,"end":28},"obj":"Protein"}],"relations":[{"id":"R11932","pred":"themeOf","subj":"T17079","obj":"T17092"},{"id":"R11933","pred":"themeOf","subj":"T17085","obj":"T17093"},{"id":"R11934","pred":"themeOf","subj":"T17088","obj":"T17096"},{"id":"R11935","pred":"themeOf","subj":"T17093","obj":"T17094"},{"id":"R11936","pred":"themeOf","subj":"T17096","obj":"T17095"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

BioNLP16_Messiy

DLUT931

bionlp-st-ge-2016-test-ihmc

bionlp-st-ge-2016-spacy-parsed

bionlp-st-ge-2016-test-tees

testone

{"project":"testone","denotations":[{"id":"T15960","span":{"begin":997,"end":1003},"obj":"Positive_regulation"},{"id":"T15959","span":{"begin":983,"end":993},"obj":"Gene_expression"},{"id":"T15958","span":{"begin":278,"end":287},"obj":"Negative_regulation"},{"id":"T15957","span":{"begin":1883,"end":1885},"obj":"Protein"},{"id":"T15956","span":{"begin":1738,"end":1742},"obj":"Protein"},{"id":"T15955","span":{"begin":1707,"end":1711},"obj":"Protein"},{"id":"T15954","span":{"begin":1674,"end":1678},"obj":"Protein"},{"id":"T15953","span":{"begin":1631,"end":1635},"obj":"Protein"},{"id":"T15952","span":{"begin":1063,"end":1065},"obj":"Protein"},{"id":"T15951","span":{"begin":1011,"end":1013},"obj":"Protein"},{"id":"T15950","span":{"begin":972,"end":982},"obj":"Protein"},{"id":"T15949","span":{"begin":884,"end":886},"obj":"Protein"},{"id":"T15948","span":{"begin":715,"end":725},"obj":"Protein"},{"id":"T15947","span":{"begin":670,"end":672},"obj":"Protein"},{"id":"T15946","span":{"begin":381,"end":389},"obj":"Protein"},{"id":"T15945","span":{"begin":271,"end":272},"obj":"Protein"},{"id":"T15944","span":{"begin":170,"end":179},"obj":"Protein"},{"id":"T15943","span":{"begin":114,"end":116},"obj":"Protein"},{"id":"T15942","span":{"begin":26,"end":28},"obj":"Protein"}],"relations":[{"id":"R11066","pred":"themeOf","subj":"T15945","obj":"T15958"},{"id":"R11067","pred":"themeOf","subj":"T15950","obj":"T15959"},{"id":"R11068","pred":"themeOf","subj":"T15959","obj":"T15960"}],"text":"Plasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18)."}

test3

PMC:1359074 / 33655-35886 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:1359074 / 33655-35886 JSON TXT