PMC:1359074 / 33632-44136 JSON TXT

Annnotations TAB JSON ListView MergeView

2_test

{"project":"2_test","denotations":[{"id":"16462943-1737096-85761022","span":{"begin":428,"end":430},"obj":"1737096"},{"id":"16462943-2748594-85761023","span":{"begin":868,"end":870},"obj":"2748594"},{"id":"16462943-14530442-85761024","span":{"begin":1669,"end":1671},"obj":"14530442"},{"id":"16462943-12677004-85761025","span":{"begin":1846,"end":1848},"obj":"12677004"},{"id":"16462943-14654707-85761026","span":{"begin":2410,"end":2412},"obj":"14654707"},{"id":"16462943-8562047-85761027","span":{"begin":3958,"end":3960},"obj":"8562047"},{"id":"16462943-14530442-85761028","span":{"begin":6890,"end":6892},"obj":"14530442"},{"id":"16462943-11818535-85761029","span":{"begin":7265,"end":7266},"obj":"11818535"},{"id":"16462943-15302897-85761030","span":{"begin":9042,"end":9044},"obj":"15302897"},{"id":"T43787","span":{"begin":428,"end":430},"obj":"1737096"},{"id":"T59528","span":{"begin":868,"end":870},"obj":"2748594"},{"id":"T89386","span":{"begin":1669,"end":1671},"obj":"14530442"},{"id":"T39276","span":{"begin":1846,"end":1848},"obj":"12677004"},{"id":"T25296","span":{"begin":2410,"end":2412},"obj":"14654707"},{"id":"T83427","span":{"begin":3958,"end":3960},"obj":"8562047"},{"id":"T81428","span":{"begin":6890,"end":6892},"obj":"14530442"},{"id":"T70190","span":{"begin":7265,"end":7266},"obj":"11818535"},{"id":"T20377","span":{"begin":9042,"end":9044},"obj":"15302897"}],"text":"Materials and Methods\n\nPlasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).\n\nQuantitation of globin mRNA.\nRNA was first reverse transcribed to cDNA. Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51]. All primers were searched against the NCBI database to confirm specificity. For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′. For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′. For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′. For βmaj/min globin: MHB1674: 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′. Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility. All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix. GAPDH mRNA levels were used as control for input RNA. Standard curve analyses were performed to test the efficiency of the amplifications. Triplicates were done for each PCR reaction. Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).\n\nIn situ hybridization.\nAntisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927. Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States). Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P. Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States). Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5). Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins. Original images are available.\n\nHistology.\n18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice. The slides were Wright-stained and read by DAF. For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin. Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner. Images were obtained with Nikon Labophot-2 microscope. Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective). The camera was a Nikon Coolpix 4300. Original images are available.\n\nNorthern blot.\nA mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom). The hybridization was performed in phosphate buffered 7% SDS hybridization solution. Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.\n\nCell culture and transfection.\nGM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM). MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum). GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States). Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng). In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.\n\nNuclear protein extract and in vitro translation of Sox6.\nNuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States). The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15]. The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega). A vector without the Sox6 coding sequence was also translated as a negative control.\n\nAntibodies.\nSox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States). All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).\n\nEMSA.\nSingle-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase. EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer: 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2. For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe. Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel. Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography. Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above). The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed): For the 36-bp WT probe: 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1): 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2): 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3): 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).\n\nChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

pmc-enju-pas

bionlp-st-ge-2016-test-proteins

bionlp-st-ge-2016-uniprot

UBERON-AE

{"project":"UBERON-AE","denotations":[{"id":"T20340","span":{"begin":10475,"end":10484},"obj":"http://purl.obolibrary.org/obo/UBERON_2000106"},{"id":"T20339","span":{"begin":9097,"end":9102},"obj":"http://purl.obolibrary.org/obo/UBERON_0002107"},{"id":"T18703","span":{"begin":6190,"end":6195},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"},{"id":"T18702","span":{"begin":5973,"end":5978},"obj":"http://purl.obolibrary.org/obo/UBERON_0001977"},{"id":"T18451","span":{"begin":5252,"end":5258},"obj":"http://purl.obolibrary.org/obo/UBERON_0000479"},{"id":"T18450","span":{"begin":5242,"end":5258},"obj":"http://purl.obolibrary.org/obo/UBERON_0005291"},{"id":"T18175","span":{"begin":4601,"end":4606},"obj":"http://purl.obolibrary.org/obo/UBERON_0000178"},{"id":"T18174","span":{"begin":4755,"end":4762},"obj":"http://purl.obolibrary.org/obo/UBERON_0000922"},{"id":"T18173","span":{"begin":4559,"end":4566},"obj":"http://purl.obolibrary.org/obo/UBERON_0000922"},{"id":"T17742","span":{"begin":4160,"end":4167},"obj":"http://purl.obolibrary.org/obo/UBERON_0002544"}],"text":"Materials and Methods\n\nPlasmid construction.\nThe ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. Nucleotide numbering is relative to the transcription start site. The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. A series of deletion constructs of the ɛy promoter were generated similarly. Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20).\nSox6-pcDNA3.1 [15] was used to overexpress Sox6. A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18).\n\nQuantitation of globin mRNA.\nRNA was first reverse transcribed to cDNA. Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51]. All primers were searched against the NCBI database to confirm specificity. For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′. For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′. For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′. For βmaj/min globin: MHB1674: 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′. Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility. All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix. GAPDH mRNA levels were used as control for input RNA. Standard curve analyses were performed to test the efficiency of the amplifications. Triplicates were done for each PCR reaction. Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States).\n\nIn situ hybridization.\nAntisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927. Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States). Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P. Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States). Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5). Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins. Original images are available.\n\nHistology.\n18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice. The slides were Wright-stained and read by DAF. For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin. Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner. Images were obtained with Nikon Labophot-2 microscope. Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective). The camera was a Nikon Coolpix 4300. Original images are available.\n\nNorthern blot.\nA mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom). The hybridization was performed in phosphate buffered 7% SDS hybridization solution. Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d.\n\nCell culture and transfection.\nGM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM). MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum). GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States). Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng). In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency.\n\nNuclear protein extract and in vitro translation of Sox6.\nNuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States). The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15]. The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega). A vector without the Sox6 coding sequence was also translated as a negative control.\n\nAntibodies.\nSox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States). All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States).\n\nEMSA.\nSingle-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase. EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer: 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2. For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe. Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel. Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography. Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above). The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed): For the 36-bp WT probe: 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1): 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2): 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3): 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650).\n\nChIP assay.\nAs described by Nouzova [53], in brief: Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. DNA-protein complexes were sonicated to 200 and 600 bp. One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). PCR was performed under the following conditions: 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min."}

GO-BP

GO-MF

GO-CC

sentences

simple1

BioNLP16_DUT

BioNLP16_Messiy

DLUT931

bionlp-st-ge-2016-test-ihmc

bionlp-st-ge-2016-spacy-parsed

bionlp-st-ge-2016-test-tees

testone

test3

PMC:1359074 / 33632-44136 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:1359074 / 33632-44136 JSON TXT