PMC:1359074 / 33632-44136
Annnotations
2_test
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
16462943-1737096-85761022 | 428-430 | 1737096 | denotes | 50 |
16462943-2748594-85761023 | 868-870 | 2748594 | denotes | 31 |
16462943-14530442-85761024 | 1669-1671 | 14530442 | denotes | 15 |
16462943-12677004-85761025 | 1846-1848 | 12677004 | denotes | 32 |
16462943-14654707-85761026 | 2410-2412 | 14654707 | denotes | 51 |
16462943-8562047-85761027 | 3958-3960 | 8562047 | denotes | 52 |
16462943-14530442-85761028 | 6890-6892 | 14530442 | denotes | 15 |
16462943-11818535-85761029 | 7265-7266 | 11818535 | denotes | 7 |
16462943-15302897-85761030 | 9042-9044 | 15302897 | denotes | 53 |
T43787 | 428-430 | 1737096 | denotes | 50 |
T59528 | 868-870 | 2748594 | denotes | 31 |
T89386 | 1669-1671 | 14530442 | denotes | 15 |
T39276 | 1846-1848 | 12677004 | denotes | 32 |
T25296 | 2410-2412 | 14654707 | denotes | 51 |
T83427 | 3958-3960 | 8562047 | denotes | 52 |
T81428 | 6890-6892 | 14530442 | denotes | 15 |
T70190 | 7265-7266 | 11818535 | denotes | 7 |
T20377 | 9042-9044 | 15302897 | denotes | 53 |
pmc-enju-pas
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T19941 | 8875-8915 | NN | denotes | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ |
T20665 | 10500-10503 | NN | denotes | min |
T20664 | 10498-10499 | CD | denotes | 5 |
T20663 | 10494-10497 | IN | denotes | for |
T20662 | 10491-10493 | NN | denotes | °C |
T20661 | 10488-10490 | CD | denotes | 72 |
T20660 | 10485-10487 | IN | denotes | at |
T20659 | 10475-10484 | NN | denotes | extension |
T20658 | 10469-10474 | JJ | denotes | final |
T20657 | 10467-10468 | DT | denotes | a |
T20656 | 10462-10466 | IN | denotes | with |
T20655 | 10455-10461 | VB | denotes | ending |
T20654 | 10453-10454 | -COMMA- | denotes | , |
T20653 | 10452-10453 | NN | denotes | s |
T20652 | 10449-10451 | CD | denotes | 45 |
T20651 | 10445-10448 | IN | denotes | for |
T20650 | 10442-10444 | NN | denotes | °C |
T20649 | 10439-10441 | CD | denotes | 72 |
T20648 | 10435-10438 | CC | denotes | and |
T20647 | 10433-10434 | -COMMA- | denotes | , |
T20646 | 10432-10433 | NN | denotes | s |
T20645 | 10429-10431 | CD | denotes | 30 |
T20644 | 10425-10428 | IN | denotes | for |
T20643 | 10422-10424 | NN | denotes | °C |
T20642 | 10419-10421 | CD | denotes | 60 |
T20641 | 10417-10418 | -COMMA- | denotes | , |
T20640 | 10416-10417 | NN | denotes | s |
T20639 | 10413-10415 | CD | denotes | 30 |
T20638 | 10409-10412 | IN | denotes | for |
T20637 | 10406-10408 | NN | denotes | °C |
T20636 | 10403-10405 | CD | denotes | 95 |
T20635 | 10400-10402 | IN | denotes | at |
T20634 | 10393-10399 | NN | denotes | cycles |
T20633 | 10390-10392 | CD | denotes | 30 |
T20632 | 10387-10389 | IN | denotes | by |
T20631 | 10378-10386 | VB | denotes | followed |
T20630 | 10374-10377 | NN | denotes | min |
T20629 | 10371-10373 | CD | denotes | 15 |
T20628 | 10367-10370 | IN | denotes | for |
T20627 | 10364-10366 | NN | denotes | °C |
T20626 | 10361-10363 | CD | denotes | 95 |
T20625 | 10359-10360 | -COLON- | denotes | : |
T20624 | 10349-10359 | NN | denotes | conditions |
T20623 | 10339-10348 | JJ | denotes | following |
T20622 | 10335-10338 | DT | denotes | the |
T20621 | 10329-10334 | IN | denotes | under |
T20620 | 10319-10328 | VB | denotes | performed |
T20619 | 10315-10318 | VB | denotes | was |
T20618 | 10311-10314 | NN | denotes | PCR |
T20617 | 10308-10309 | -RRB- | denotes | ) |
T20616 | 10284-10308 | NN | denotes | 5′GCTTCACCACCAACCTCTTC3′ |
T20615 | 10282-10283 | -COMMA- | denotes | , |
T20614 | 10275-10282 | NN | denotes | MHB1689 |
T20613 | 10271-10274 | CC | denotes | and |
T20612 | 10269-10270 | -COLON- | denotes | ; |
T20611 | 10245-10269 | NN | denotes | 5′CGAAGAATAAAAGGCCACCA3′ |
T20610 | 10243-10244 | -COMMA- | denotes | , |
T20609 | 10236-10243 | NN | denotes | MHB1688 |
T20608 | 10228-10235 | NN | denotes | primers |
T20607 | 10227-10228 | -LRB- | denotes | ( |
T20606 | 10218-10226 | NN | denotes | promoter |
T20605 | 10215-10217 | JJ | denotes | ɛy |
T20604 | 10211-10214 | DT | denotes | the |
T20603 | 10208-10210 | IN | denotes | of |
T20602 | 10203-10207 | CD | denotes | +140 |
T20601 | 10200-10202 | TO | denotes | to |
T20600 | 10196-10199 | CD | denotes | −31 |
T20599 | 10184-10195 | NN | denotes | nucleotides |
T20598 | 10181-10183 | TO | denotes | to |
T20597 | 10167-10180 | VB | denotes | corresponding |
T20596 | 10165-10166 | -COMMA- | denotes | , |
T20595 | 10157-10165 | NN | denotes | amplicon |
T20594 | 10150-10156 | JJ | denotes | 172-bp |
T20593 | 10148-10149 | DT | denotes | a |
T20592 | 10140-10147 | VB | denotes | yielded |
T20591 | 10136-10139 | CC | denotes | and |
T20590 | 10126-10135 | VB | denotes | performed |
T20589 | 10122-10125 | VB | denotes | was |
T20588 | 10113-10121 | NN | denotes | promoter |
T20587 | 10110-10112 | JJ | denotes | ɛy |
T20586 | 10106-10109 | DT | denotes | the |
T20585 | 10103-10105 | IN | denotes | of |
T20584 | 10089-10102 | NN | denotes | amplification |
T20583 | 10085-10088 | NN | denotes | PCR |
T20582 | 10075-10083 | NN | denotes | reaction |
T20581 | 10071-10074 | NN | denotes | PCR |
T20580 | 10067-10070 | DT | denotes | the |
T20579 | 10064-10066 | IN | denotes | in |
T20578 | 10055-10063 | NN | denotes | template |
T20577 | 10053-10054 | DT | denotes | a |
T20576 | 10050-10052 | IN | denotes | as |
T20575 | 10045-10049 | VB | denotes | used |
T20574 | 10041-10044 | VB | denotes | was |
T20573 | 10037-10040 | NN | denotes | DNA |
T20572 | 10018-10036 | VB | denotes | immunoprecipitated |
T20571 | 10015-10017 | CC | denotes | or |
T20570 | 10011-10014 | NN | denotes | DNA |
T20569 | 10005-10010 | NN | denotes | Input |
T20568 | 10002-10003 | NN | denotes | h |
T20567 | 10000-10001 | CD | denotes | 4 |
T20566 | 9996-9999 | IN | denotes | for |
T20565 | 9993-9995 | NN | denotes | °C |
T20564 | 9990-9992 | CD | denotes | 65 |
T20563 | 9987-9989 | IN | denotes | at |
T20562 | 9982-9986 | NN | denotes | NaCl |
T20561 | 9980-9981 | NN | denotes | M |
T20560 | 9978-9979 | CD | denotes | 5 |
T20559 | 9973-9977 | IN | denotes | with |
T20558 | 9964-9972 | VB | denotes | reversed |
T20557 | 9959-9963 | VB | denotes | were |
T20556 | 9947-9958 | NN | denotes | cross-links |
T20555 | 9939-9946 | NN | denotes | protein |
T20554 | 9935-9938 | NN | denotes | DNA |
T20553 | 9931-9934 | DT | denotes | the |
T20552 | 9927-9930 | CC | denotes | and |
T20551 | 9925-9926 | -COMMA- | denotes | , |
T20550 | 9919-9925 | VB | denotes | eluted |
T20549 | 9914-9918 | VB | denotes | were |
T20548 | 9904-9913 | NN | denotes | complexes |
T20547 | 9885-9903 | NN | denotes | chromatin-antibody |
T20546 | 9881-9884 | DT | denotes | The |
T20545 | 9871-9879 | NN | denotes | controls |
T20544 | 9862-9870 | JJ | denotes | negative |
T20543 | 9859-9861 | IN | denotes | as |
T20542 | 9854-9858 | VB | denotes | used |
T20541 | 9849-9853 | VB | denotes | were |
T20540 | 9845-9848 | CD | denotes | two |
T20539 | 9840-9844 | JJ | denotes | last |
T20538 | 9836-9839 | DT | denotes | The |
T20537 | 9832-9835 | NNP | denotes | Ab. |
T20536 | 9824-9831 | IN | denotes | without |
T20535 | 9817-9823 | NN | denotes | sample |
T20534 | 9811-9816 | JJ | denotes | third |
T20533 | 9807-9810 | DT | denotes | the |
T20532 | 9803-9806 | CC | denotes | and |
T20531 | 9801-9802 | -COMMA- | denotes | , |
T20530 | 9798-9801 | NN | denotes | IgG |
T20529 | 9791-9797 | NN | denotes | rabbit |
T20528 | 9784-9790 | JJ | denotes | normal |
T20527 | 9779-9783 | IN | denotes | with |
T20526 | 9771-9778 | VB | denotes | treated |
T20525 | 9764-9770 | JJ | denotes | second |
T20524 | 9762-9763 | DT | denotes | a |
T20523 | 9760-9761 | -COMMA- | denotes | , |
T20522 | 9751-9760 | NN | denotes | anti-Sox6 |
T20521 | 9746-9750 | IN | denotes | with |
T20520 | 9738-9745 | VB | denotes | treated |
T20519 | 9731-9737 | NN | denotes | sample |
T20518 | 9727-9730 | CD | denotes | one |
T20517 | 9725-9726 | -COLON- | denotes | : |
T20516 | 9719-9725 | NN | denotes | thirds |
T20515 | 9714-9718 | IN | denotes | into |
T20514 | 9708-9713 | VB | denotes | split |
T20513 | 9703-9707 | VB | denotes | were |
T20512 | 9695-9702 | NN | denotes | samples |
T20511 | 9691-9694 | DT | denotes | the |
T20510 | 9689-9690 | -COMMA- | denotes | , |
T20509 | 9678-9689 | NN | denotes | preclearing |
T20508 | 9668-9677 | VB | denotes | Following |
T20507 | 9665-9666 | -RRB- | denotes | ) |
T20506 | 9659-9665 | NNP | denotes | States |
T20505 | 9652-9658 | NNP | denotes | United |
T20504 | 9650-9651 | -COMMA- | denotes | , |
T20503 | 9644-9650 | NNP | denotes | Jersey |
T20502 | 9640-9643 | NNP | denotes | New |
T20501 | 9638-9639 | -COMMA- | denotes | , |
T20500 | 9628-9638 | NNP | denotes | Piscataway |
T20499 | 9626-9627 | -COMMA- | denotes | , |
T20498 | 9615-9626 | NNP | denotes | Biosciences |
T20497 | 9606-9614 | NNP | denotes | Amersham |
T20496 | 9605-9606 | -LRB- | denotes | ( |
T20495 | 9593-9604 | NN | denotes | A-Sepharose |
T20494 | 9585-9592 | NN | denotes | protein |
T20493 | 9580-9584 | IN | denotes | with |
T20492 | 9569-9579 | VB | denotes | precleared |
T20491 | 9565-9568 | VB | denotes | was |
T20490 | 9558-9564 | NN | denotes | sample |
T20489 | 9548-9557 | VB | denotes | remaining |
T20488 | 9544-9547 | DT | denotes | the |
T20487 | 9540-9543 | CC | denotes | and |
T20486 | 9538-9539 | -COMMA- | denotes | , |
T20485 | 9531-9538 | NN | denotes | control |
T20484 | 9525-9530 | NN | denotes | input |
T20483 | 9521-9524 | IN | denotes | for |
T20482 | 9515-9520 | RB | denotes | aside |
T20481 | 9511-9514 | VB | denotes | set |
T20480 | 9507-9510 | VB | denotes | was |
T20479 | 9500-9506 | NN | denotes | sample |
T20478 | 9496-9499 | DT | denotes | the |
T20477 | 9493-9495 | IN | denotes | of |
T20476 | 9483-9492 | NN | denotes | One-tenth |
T20475 | 9479-9481 | NN | denotes | bp |
T20474 | 9475-9478 | CD | denotes | 600 |
T20473 | 9471-9474 | CC | denotes | and |
T20472 | 9467-9470 | CD | denotes | 200 |
T20471 | 9464-9466 | TO | denotes | to |
T20470 | 9454-9463 | VB | denotes | sonicated |
T20469 | 9449-9453 | VB | denotes | were |
T20468 | 9439-9448 | NN | denotes | complexes |
T20467 | 9427-9438 | JJ | denotes | DNA-protein |
T20466 | 9422-9425 | NN | denotes | min |
T20465 | 9419-9421 | CD | denotes | 10 |
T20464 | 9415-9418 | IN | denotes | for |
T20463 | 9411-9414 | NN | denotes | ice |
T20462 | 9408-9410 | IN | denotes | on |
T20461 | 9398-9407 | VB | denotes | incubated |
T20460 | 9394-9397 | CC | denotes | and |
T20459 | 9392-9393 | -COMMA- | denotes | , |
T20458 | 9382-9392 | NN | denotes | inhibitors |
T20457 | 9373-9381 | NN | denotes | protease |
T20456 | 9362-9372 | VB | denotes | containing |
T20455 | 9355-9361 | NN | denotes | buffer |
T20454 | 9349-9354 | NN | denotes | lysis |
T20453 | 9345-9348 | NN | denotes | SDS |
T20452 | 9343-9344 | DT | denotes | a |
T20451 | 9340-9342 | IN | denotes | in |
T20450 | 9328-9339 | VB | denotes | resuspended |
T20449 | 9326-9327 | -COMMA- | denotes | , |
T20448 | 9324-9326 | NN | denotes | °C |
T20447 | 9322-9323 | CD | denotes | 4 |
T20446 | 9319-9321 | IN | denotes | at |
T20445 | 9304-9318 | NN | denotes | centrifugation |
T20444 | 9301-9303 | IN | denotes | by |
T20443 | 9291-9300 | VB | denotes | collected |
T20442 | 9289-9290 | -COMMA- | denotes | , |
T20441 | 9279-9289 | NN | denotes | inhibitors |
T20440 | 9270-9278 | NN | denotes | protease |
T20439 | 9259-9269 | VB | denotes | containing |
T20438 | 9254-9258 | NN | denotes | EDTA |
T20437 | 9252-9253 | NN | denotes | % |
T20436 | 9249-9252 | CD | denotes | 0.1 |
T20435 | 9244-9248 | IN | denotes | with |
T20434 | 9235-9243 | NN | denotes | solution |
T20433 | 9230-9234 | NN | denotes | salt |
T20432 | 9221-9229 | JJ | denotes | balanced |
T20431 | 9219-9220 | POS | denotes | ' |
T20430 | 9214-9219 | NNP | denotes | Hanks |
T20429 | 9211-9213 | CD | denotes | 1× |
T20428 | 9202-9210 | JJ | denotes | ice-cold |
T20427 | 9199-9201 | IN | denotes | in |
T20426 | 9192-9198 | VB | denotes | rinsed |
T20425 | 9190-9191 | -COMMA- | denotes | , |
T20424 | 9188-9190 | NN | denotes | °C |
T20423 | 9185-9187 | CD | denotes | 37 |
T20422 | 9182-9184 | IN | denotes | at |
T20421 | 9178-9181 | NN | denotes | min |
T20420 | 9175-9177 | CD | denotes | 10 |
T20419 | 9171-9174 | IN | denotes | for |
T20418 | 9158-9170 | NN | denotes | formaldehyde |
T20417 | 9156-9157 | NN | denotes | % |
T20416 | 9155-9156 | CD | denotes | 1 |
T20415 | 9150-9154 | IN | denotes | with |
T20414 | 9142-9149 | VB | denotes | treated |
T20413 | 9137-9141 | VB | denotes | were |
T20412 | 9132-9136 | NN | denotes | mice |
T20411 | 9129-9131 | JJ | denotes | WT |
T20410 | 9120-9128 | JJ | denotes | 15.5-dpc |
T20409 | 9114-9119 | CD | denotes | three |
T20408 | 9109-9113 | IN | denotes | from |
T20407 | 9103-9108 | NN | denotes | cells |
T20406 | 9097-9102 | NN | denotes | liver |
T20405 | 9091-9096 | JJ | denotes | fetal |
T20404 | 9088-9090 | CC | denotes | or |
T20403 | 9086-9087 | -RRB- | denotes | ) |
T20402 | 9083-9086 | CD | denotes | 107 |
T20401 | 9081-9082 | NN | denotes | × |
T20400 | 9079-9080 | CD | denotes | 4 |
T20399 | 9078-9079 | -LRB- | denotes | ( |
T20398 | 9072-9077 | NN | denotes | cells |
T20397 | 9068-9071 | NN | denotes | MEL |
T20396 | 9063-9067 | IN | denotes | from |
T20395 | 9057-9062 | NN | denotes | Cells |
T20394 | 9055-9056 | -COLON- | denotes | : |
T20393 | 9050-9055 | NN | denotes | brief |
T20392 | 9047-9049 | IN | denotes | in |
T20391 | 9045-9046 | -COMMA- | denotes | , |
T20390 | 9044-9045 | -RRB- | denotes | ] |
T20389 | 9042-9044 | CD | denotes | 53 |
T20388 | 9041-9042 | -LRB- | denotes | [ |
T20387 | 9033-9040 | NNP | denotes | Nouzova |
T20386 | 9030-9032 | IN | denotes | by |
T20385 | 9020-9029 | VB | denotes | described |
T20384 | 9017-9019 | IN | denotes | As |
T20383 | 9010-9015 | NN | denotes | assay |
T20382 | 9005-9009 | NN | denotes | ChIP |
T19957 | 9001-9002 | -RRB- | denotes | ) |
T19956 | 8994-9001 | NN | denotes | MHB1650 |
T19955 | 8993-8994 | -LRB- | denotes | ( |
T19954 | 8952-8992 | NN | denotes | 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ |
T19953 | 8950-8951 | -COLON- | denotes | : |
T19952 | 8949-8950 | -RRB- | denotes | ) |
T19951 | 8947-8949 | NN | denotes | M3 |
T19950 | 8946-8947 | -LRB- | denotes | ( |
T19949 | 8944-8945 | CD | denotes | 3 |
T19948 | 8938-8943 | NN | denotes | probe |
T19947 | 8931-8937 | JJ | denotes | mutant |
T19946 | 8927-8930 | IN | denotes | for |
T19945 | 8925-8926 | -COLON- | denotes | ; |
T19944 | 8924-8925 | -RRB- | denotes | ) |
T19943 | 8917-8924 | NN | denotes | MHB1648 |
T19942 | 8916-8917 | -LRB- | denotes | ( |
T19940 | 8873-8874 | -COLON- | denotes | : |
T19939 | 8872-8873 | -RRB- | denotes | ) |
T19938 | 8870-8872 | NN | denotes | M2 |
T19937 | 8869-8870 | -LRB- | denotes | ( |
T19936 | 8867-8868 | CD | denotes | 2 |
T19935 | 8861-8866 | NN | denotes | probe |
T19934 | 8854-8860 | JJ | denotes | mutant |
T19933 | 8850-8853 | IN | denotes | for |
T19932 | 8848-8849 | -COLON- | denotes | ; |
T19931 | 8847-8848 | -RRB- | denotes | ) |
T19930 | 8840-8847 | NN | denotes | MHB1644 |
T19929 | 8839-8840 | -LRB- | denotes | ( |
T19928 | 8805-8838 | NN | denotes | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ |
T19927 | 8803-8804 | -COLON- | denotes | : |
T19926 | 8802-8803 | -RRB- | denotes | ) |
T19925 | 8800-8802 | NN | denotes | M1 |
T19924 | 8799-8800 | -LRB- | denotes | ( |
T19923 | 8797-8798 | CD | denotes | 1 |
T19922 | 8791-8796 | NN | denotes | probe |
T19921 | 8784-8790 | JJ | denotes | mutant |
T19920 | 8780-8783 | IN | denotes | for |
T19919 | 8778-8779 | -COLON- | denotes | ; |
T19918 | 8777-8778 | -RRB- | denotes | ) |
T19917 | 8770-8777 | NN | denotes | MHB1556 |
T19916 | 8769-8770 | -LRB- | denotes | ( |
T19915 | 8728-8768 | NN | denotes | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ |
T19914 | 8726-8727 | -COLON- | denotes | : |
T19913 | 8721-8726 | NN | denotes | probe |
T19912 | 8718-8720 | NN | denotes | WT |
T19911 | 8712-8717 | JJ | denotes | 36-bp |
T19910 | 8708-8711 | DT | denotes | the |
T19909 | 8704-8707 | IN | denotes | For |
T19908 | 8702-8703 | -COLON- | denotes | : |
T19907 | 8701-8702 | -RRB- | denotes | ) |
T19906 | 8695-8701 | VB | denotes | listed |
T19905 | 8691-8694 | VB | denotes | are |
T19904 | 8684-8690 | NN | denotes | oligos |
T19903 | 8676-8683 | JJ | denotes | forward |
T19902 | 8671-8675 | RB | denotes | only |
T19901 | 8670-8671 | -LRB- | denotes | ( |
T19900 | 8662-8669 | NN | denotes | follows |
T19899 | 8659-8661 | IN | denotes | as |
T19898 | 8655-8658 | VB | denotes | are |
T19897 | 8638-8654 | NN | denotes | oligonucleotides |
T19896 | 8634-8637 | DT | denotes | the |
T19895 | 8631-8633 | IN | denotes | of |
T19894 | 8621-8630 | NN | denotes | sequences |
T19893 | 8617-8620 | NN | denotes | DNA |
T19892 | 8613-8616 | DT | denotes | The |
T19891 | 8610-8611 | -RRB- | denotes | ) |
T19890 | 8605-8610 | JJ | denotes | above |
T19889 | 8602-8604 | IN | denotes | as |
T19888 | 8592-8601 | VB | denotes | described |
T19887 | 8591-8592 | -LRB- | denotes | ( |
T19886 | 8580-8590 | NN | denotes | antibodies |
T19885 | 8575-8579 | NN | denotes | Sox6 |
T19884 | 8571-8574 | CC | denotes | and |
T19883 | 8569-8570 | -COMMA- | denotes | , |
T19882 | 8567-8569 | NN | denotes | HA |
T19881 | 8565-8566 | -COMMA- | denotes | , |
T19880 | 8560-8565 | NN | denotes | c-Myc |
T19879 | 8551-8559 | VB | denotes | included |
T19878 | 8542-8550 | NN | denotes | analyses |
T19877 | 8531-8541 | NN | denotes | supershift |
T19876 | 8527-8530 | IN | denotes | for |
T19874 | 8511-8521 | NN | denotes | Antibodies |
T19873 | 8494-8509 | NN | denotes | autoradiography |
T19872 | 8491-8493 | TO | denotes | to |
T19871 | 8485-8490 | RB | denotes | prior |
T19870 | 8479-8484 | VB | denotes | dried |
T19869 | 8474-8478 | VB | denotes | were |
T19868 | 8469-8473 | NN | denotes | gels |
T19867 | 8465-8468 | DT | denotes | the |
T19866 | 8461-8464 | CC | denotes | and |
T19865 | 8459-8460 | -COMMA- | denotes | , |
T19864 | 8448-8459 | NN | denotes | temperature |
T19863 | 8443-8447 | NN | denotes | room |
T19862 | 8440-8442 | IN | denotes | at |
T19861 | 8438-8439 | NN | denotes | h |
T19860 | 8434-8437 | CD | denotes | 4–8 |
T19859 | 8430-8433 | IN | denotes | for |
T19858 | 8425-8429 | NN | denotes | mAmp |
T19857 | 8422-8424 | CD | denotes | 19 |
T19856 | 8413-8421 | JJ | denotes | constant |
T19855 | 8411-8412 | DT | denotes | a |
T19854 | 8408-8410 | IN | denotes | at |
T19853 | 8398-8407 | VB | denotes | performed |
T19852 | 8394-8397 | VB | denotes | was |
T19851 | 8378-8393 | NN | denotes | Electrophoresis |
T19850 | 8373-8376 | NN | denotes | gel |
T19849 | 8358-8372 | NN | denotes | polyacrylamide |
T19848 | 8356-8357 | -RRB- | denotes | ) |
T19847 | 8353-8356 | NN | denotes | w/v |
T19846 | 8352-8353 | -LRB- | denotes | ( |
T19845 | 8350-8351 | NN | denotes | % |
T19844 | 8349-8350 | CD | denotes | 6 |
T19843 | 8346-8348 | CC | denotes | or |
T19842 | 8344-8345 | NN | denotes | % |
T19841 | 8343-8344 | CD | denotes | 4 |
T19840 | 8341-8342 | DT | denotes | a |
T19839 | 8338-8340 | IN | denotes | on |
T19838 | 8331-8337 | VB | denotes | loaded |
T19837 | 8327-8330 | CC | denotes | and |
T19836 | 8315-8326 | NN | denotes | temperature |
T19835 | 8310-8314 | NN | denotes | room |
T19834 | 8307-8309 | IN | denotes | at |
T19833 | 8303-8306 | NN | denotes | min |
T19832 | 8300-8302 | CD | denotes | 60 |
T19831 | 8297-8299 | CC | denotes | or |
T19830 | 8293-8296 | NN | denotes | min |
T19829 | 8290-8292 | CD | denotes | 30 |
T19828 | 8286-8289 | IN | denotes | for |
T19827 | 8276-8285 | VB | denotes | incubated |
T19826 | 8271-8275 | VB | denotes | were |
T19825 | 8263-8270 | NN | denotes | samples |
T19824 | 8259-8262 | DT | denotes | the |
T19823 | 8257-8258 | -COMMA- | denotes | , |
T19822 | 8252-8257 | NN | denotes | probe |
T19821 | 8239-8251 | VB | denotes | radiolabeled |
T19820 | 8235-8238 | DT | denotes | the |
T19819 | 8232-8234 | IN | denotes | of |
T19818 | 8223-8231 | NN | denotes | addition |
T19817 | 8213-8222 | VB | denotes | Following |
T19816 | 8206-8211 | NN | denotes | probe |
T19815 | 8193-8205 | VB | denotes | radiolabeled |
T19814 | 8190-8192 | IN | denotes | of |
T19813 | 8181-8189 | NN | denotes | addition |
T19812 | 8178-8180 | TO | denotes | to |
T19811 | 8172-8177 | JJ | denotes | prior |
T19810 | 8168-8171 | NN | denotes | min |
T19809 | 8165-8167 | CD | denotes | 60 |
T19808 | 8162-8164 | TO | denotes | to |
T19807 | 8158-8161 | NN | denotes | min |
T19806 | 8155-8157 | CD | denotes | 30 |
T19805 | 8149-8154 | VB | denotes | added |
T19804 | 8145-8148 | VB | denotes | was |
T19803 | 8143-8144 | -RRB- | denotes | ) |
T19802 | 8141-8143 | NN | denotes | μl |
T19801 | 8139-8140 | CD | denotes | 3 |
T19800 | 8138-8139 | -LRB- | denotes | ( |
T19799 | 8129-8137 | NN | denotes | antibody |
T19798 | 8126-8128 | CC | denotes | or |
T19797 | 8124-8125 | -RRB- | denotes | ) |
T19796 | 8118-8124 | NN | denotes | excess |
T19795 | 8112-8117 | JJ | denotes | molar |
T19794 | 8103-8111 | JJ | denotes | 200-fold |
T19793 | 8102-8103 | -LRB- | denotes | ( |
T19792 | 8091-8101 | NN | denotes | competitor |
T19791 | 8075-8090 | NN | denotes | oligonucleotide |
T19790 | 8064-8074 | JJ | denotes | unlabelled |
T19789 | 8054-8063 | VB | denotes | indicated |
T19788 | 8050-8053 | DT | denotes | the |
T19787 | 8048-8049 | -COMMA- | denotes | , |
T19786 | 8042-8048 | NN | denotes | assays |
T19785 | 8031-8041 | NN | denotes | supershift |
T19784 | 8028-8030 | CC | denotes | or |
T19783 | 8016-8027 | NN | denotes | competition |
T19782 | 8012-8015 | IN | denotes | For |
T19781 | 8005-8010 | NN | denotes | MgCl2 |
T19780 | 8002-8004 | NN | denotes | mM |
T19779 | 7998-8001 | CD | denotes | 0.6 |
T19778 | 7996-7997 | -COMMA- | denotes | , |
T19777 | 7993-7996 | NN | denotes | DTT |
T19776 | 7990-7992 | NN | denotes | mM |
T19775 | 7985-7989 | CD | denotes | 0.25 |
T19705 | 7680-7681 | -RRB- | denotes | ] |
T19704 | 7675-7680 | NN | denotes | γ-32P |
T19703 | 7674-7675 | -LRB- | denotes | [ |
T19702 | 7669-7673 | IN | denotes | with |
T19701 | 7657-7668 | VB | denotes | end-labeled |
T19700 | 7653-7656 | CC | denotes | and |
T19699 | 7644-7652 | VB | denotes | annealed |
T19698 | 7639-7643 | VB | denotes | were |
T19697 | 7622-7638 | NN | denotes | oligonucleotides |
T19696 | 7608-7621 | JJ | denotes | complementary |
T19695 | 7592-7607 | JJ | denotes | Single-stranded |
T19694 | 7586-7590 | NN | denotes | EMSA |
T19503 | 7582-7583 | -RRB- | denotes | ) |
T19502 | 7576-7582 | NNP | denotes | States |
T19501 | 7569-7575 | NNP | denotes | United |
T19500 | 7567-7568 | -COMMA- | denotes | , |
T19499 | 7563-7567 | NNP | denotes | York |
T19498 | 7559-7562 | NNP | denotes | New |
T19497 | 7557-7558 | -COMMA- | denotes | , |
T19496 | 7551-7557 | NNP | denotes | Placid |
T19495 | 7546-7550 | NNP | denotes | Lake |
T19494 | 7545-7546 | -LRB- | denotes | ( |
T19493 | 7531-7544 | NNP | denotes | Biotechnology |
T19492 | 7523-7530 | NNP | denotes | Upstate |
T19491 | 7518-7522 | IN | denotes | from |
T19490 | 7509-7517 | VB | denotes | obtained |
T19240 | 7127-7134 | NN | denotes | control |
T19239 | 7118-7126 | JJ | denotes | negative |
T19238 | 7116-7117 | DT | denotes | a |
T19237 | 7113-7115 | IN | denotes | as |
T19236 | 7102-7112 | VB | denotes | translated |
T19235 | 7097-7101 | RB | denotes | also |
T19234 | 7093-7096 | VB | denotes | was |
T19233 | 7084-7092 | NN | denotes | sequence |
T19232 | 7077-7083 | NN | denotes | coding |
T19231 | 7072-7076 | NN | denotes | Sox6 |
T19230 | 7068-7071 | DT | denotes | the |
T19229 | 7060-7067 | IN | denotes | without |
T19228 | 7053-7059 | NN | denotes | vector |
T19227 | 7051-7052 | DT | denotes | A |
T19226 | 7048-7049 | -RRB- | denotes | ) |
T19225 | 7041-7048 | NNP | denotes | Promega |
T19224 | 7039-7040 | -COMMA- | denotes | , |
T19223 | 7032-7039 | NNP | denotes | Systems |
T19222 | 7006-7031 | NNP | denotes | Transcription/Translation |
T19221 | 6998-7005 | NNP | denotes | Coupled |
T19220 | 6992-6997 | NNP | denotes | Quick |
T19219 | 6987-6991 | NNP | denotes | TNT® |
T19218 | 6986-6987 | -LRB- | denotes | ( |
T19217 | 6979-6985 | NN | denotes | system |
T19216 | 6965-6978 | JJ | denotes | translational |
T19215 | 6959-6964 | FW | denotes | vitro |
T19214 | 6956-6958 | FW | denotes | in |
T19213 | 6950-6955 | VB | denotes | based |
T19212 | 6943-6949 | NN | denotes | lysate |
T19211 | 6930-6942 | NN | denotes | reticulocyte |
T19210 | 6928-6929 | DT | denotes | a |
T19209 | 6925-6927 | IN | denotes | in |
T19208 | 6915-6924 | VB | denotes | performed |
T19207 | 6911-6914 | VB | denotes | was |
T19206 | 6899-6910 | NN | denotes | translation |
T19205 | 6895-6898 | DT | denotes | The |
T19204 | 6892-6893 | -RRB- | denotes | ] |
T19203 | 6890-6892 | CD | denotes | 15 |
T19202 | 6889-6890 | -LRB- | denotes | [ |
T19201 | 6882-6888 | IN | denotes | before |
T19199 | 6868-6871 | VB | denotes | was |
T19198 | 6866-6867 | -COMMA- | denotes | , |
T19197 | 6864-6866 | NN | denotes | HA |
T19196 | 6860-6863 | CC | denotes | and |
T19195 | 6854-6859 | NN | denotes | c-Myc |
T19194 | 6849-6853 | IN | denotes | with |
T19193 | 6842-6848 | VB | denotes | tagged |
T19192 | 6840-6841 | -COMMA- | denotes | , |
T19191 | 6834-6840 | NN | denotes | vector |
T19190 | 6823-6833 | NN | denotes | expression |
T19189 | 6811-6822 | NN | denotes | translation |
T19188 | 6805-6810 | FW | denotes | vitro |
T19187 | 6802-6804 | FW | denotes | in |
T19186 | 6797-6801 | NN | denotes | Sox6 |
T19185 | 6793-6796 | DT | denotes | The |
T19184 | 6790-6791 | -RRB- | denotes | ) |
T19183 | 6784-6790 | NNP | denotes | States |
T19182 | 6777-6783 | NNP | denotes | United |
T19181 | 6775-6776 | -COMMA- | denotes | , |
T19180 | 6765-6775 | NNP | denotes | California |
T19179 | 6763-6764 | -COMMA- | denotes | , |
T19178 | 6755-6763 | NNP | denotes | Carlsbad |
T19177 | 6753-6754 | -COMMA- | denotes | , |
T19176 | 6748-6753 | NNP | denotes | Motif |
T19175 | 6741-6747 | JJ | denotes | Active |
T19174 | 6740-6741 | -LRB- | denotes | ( |
T19173 | 6736-6739 | NN | denotes | kit |
T19172 | 6734-6735 | DT | denotes | a |
T19171 | 6728-6733 | VB | denotes | using |
T19170 | 6726-6727 | -RRB- | denotes | ) |
T19169 | 6723-6726 | CD | denotes | 107 |
T19168 | 6721-6722 | CC | denotes | × |
T19167 | 6719-6720 | CD | denotes | 2 |
T19166 | 6718-6719 | -LRB- | denotes | ( |
T19165 | 6712-6717 | NN | denotes | cells |
T19164 | 6708-6711 | NN | denotes | MEL |
T19163 | 6703-6707 | IN | denotes | from |
T19162 | 6694-6702 | VB | denotes | prepared |
T19161 | 6689-6693 | VB | denotes | were |
T19160 | 6680-6688 | NN | denotes | extracts |
T19159 | 6672-6679 | JJ | denotes | Nuclear |
T19774 | 7983-7984 | -COMMA- | denotes | , |
T19773 | 7979-7983 | NN | denotes | EDTA |
T19772 | 7976-7978 | NN | denotes | mM |
T19771 | 7972-7975 | CD | denotes | 0.1 |
T19770 | 7970-7971 | -COMMA- | denotes | , |
T19769 | 7969-7970 | -RRB- | denotes | ) |
T19768 | 7968-7969 | CD | denotes | 7 |
T19767 | 7965-7967 | NN | denotes | pH |
T19766 | 7964-7965 | -LRB- | denotes | ( |
T19765 | 7958-7963 | NN | denotes | HEPES |
T19764 | 7955-7957 | NN | denotes | mM |
T19763 | 7952-7954 | CD | denotes | 10 |
T19762 | 7950-7951 | -COMMA- | denotes | , |
T19761 | 7949-7950 | -RRB- | denotes | ) |
T19760 | 7944-7949 | NN | denotes | dG-dC |
T19759 | 7943-7944 | -LRB- | denotes | ( |
T19758 | 7938-7942 | NN | denotes | poly |
T19757 | 7935-7937 | CC | denotes | or |
T19756 | 7933-7934 | -RRB- | denotes | ) |
T19755 | 7928-7933 | NN | denotes | dI-dC |
T19754 | 7927-7928 | -LRB- | denotes | ( |
T19753 | 7922-7926 | NN | denotes | poly |
T19752 | 7916-7921 | NN | denotes | ng/μl |
T19751 | 7913-7915 | CD | denotes | 50 |
T19750 | 7911-7912 | -COMMA- | denotes | , |
T19749 | 7908-7911 | NN | denotes | BSA |
T19748 | 7902-7907 | NN | denotes | ng/μl |
T19747 | 7898-7901 | CD | denotes | 200 |
T19746 | 7896-7897 | -COMMA- | denotes | , |
T19745 | 7888-7896 | NN | denotes | glycerol |
T19744 | 7886-7887 | NN | denotes | % |
T19743 | 7884-7886 | CD | denotes | 10 |
T19742 | 7882-7883 | -COMMA- | denotes | , |
T19741 | 7878-7882 | NN | denotes | NaCl |
T19740 | 7875-7877 | NN | denotes | mM |
T19739 | 7871-7874 | CD | denotes | 100 |
T19738 | 7869-7870 | -COLON- | denotes | : |
T19737 | 7863-7869 | NN | denotes | buffer |
T19736 | 7855-7862 | NN | denotes | binding |
T19735 | 7852-7854 | IN | denotes | in |
T19734 | 7845-7851 | NN | denotes | lysate |
T19733 | 7832-7844 | NN | denotes | reticulocyte |
T19732 | 7828-7831 | DT | denotes | the |
T19731 | 7823-7827 | IN | denotes | with |
T19730 | 7817-7822 | IN | denotes | along |
T19729 | 7812-7816 | NN | denotes | Sox6 |
T19728 | 7795-7811 | JJ | denotes | vitro-translated |
T19727 | 7792-7794 | FW | denotes | in |
T19726 | 7789-7791 | IN | denotes | of |
T19725 | 7786-7788 | NN | denotes | μl |
T19724 | 7784-7785 | CD | denotes | 3 |
T19723 | 7781-7783 | CC | denotes | or |
T19722 | 7775-7780 | NN | denotes | cells |
T19721 | 7771-7774 | NN | denotes | MEL |
T19720 | 7766-7770 | IN | denotes | from |
T19719 | 7757-7765 | NN | denotes | proteins |
T19718 | 7749-7756 | JJ | denotes | nuclear |
T19717 | 7746-7748 | IN | denotes | of |
T19716 | 7743-7745 | NN | denotes | μg |
T19715 | 7741-7742 | CD | denotes | 5 |
T19714 | 7736-7740 | IN | denotes | with |
T19713 | 7726-7735 | VB | denotes | performed |
T19712 | 7722-7725 | VB | denotes | was |
T19711 | 7717-7721 | NN | denotes | EMSA |
T19710 | 7709-7715 | NN | denotes | kinase |
T19709 | 7694-7708 | NN | denotes | polynucleotide |
T19708 | 7691-7693 | NN | denotes | T4 |
T19707 | 7686-7690 | IN | denotes | with |
T19706 | 7682-7685 | NN | denotes | ATP |
T19158 | 6666-6670 | NN | denotes | Sox6 |
T19157 | 6663-6665 | IN | denotes | of |
T19156 | 6651-6662 | NN | denotes | translation |
T19155 | 6645-6650 | FW | denotes | vitro |
T19154 | 6642-6644 | FW | denotes | in |
T19153 | 6638-6641 | CC | denotes | and |
T19152 | 6630-6637 | NN | denotes | extract |
T19151 | 6622-6629 | NN | denotes | protein |
T19150 | 6614-6621 | JJ | denotes | Nuclear |
T19463 | 7330-7343 | NNP | denotes | Biotechnology |
T19462 | 7325-7329 | NNP | denotes | Cruz |
T19461 | 7319-7324 | NNP | denotes | Santa |
T19460 | 7317-7318 | -COMMA- | denotes | , |
T19459 | 7316-7317 | NNP | denotes | X |
T19458 | 7307-7315 | NN | denotes | sc-17332 |
T19457 | 7303-7306 | NN | denotes | No. |
T19456 | 7295-7302 | NNP | denotes | Catalog |
T19455 | 7294-7295 | -LRB- | denotes | ( |
T19454 | 7285-7293 | VB | denotes | obtained |
T19453 | 7272-7284 | RB | denotes | commercially |
T19452 | 7269-7271 | CC | denotes | or |
T19451 | 7267-7268 | -RRB- | denotes | ) |
T19450 | 7266-7267 | -RRB- | denotes | ] |
T19449 | 7265-7266 | CD | denotes | 7 |
T19448 | 7264-7265 | -LRB- | denotes | [ |
T19447 | 7257-7263 | NNP | denotes | France |
T19446 | 7255-7256 | -COMMA- | denotes | , |
T19445 | 7248-7255 | NNP | denotes | Pasteur |
T19444 | 7242-7247 | NNP | denotes | Louis |
T19443 | 7231-7241 | NNP | denotes | Université |
T19442 | 7230-7231 | -LRB- | denotes | ( |
T19441 | 7224-7229 | NNP | denotes | Lalli |
T19440 | 7219-7223 | NNP | denotes | Enzo |
T19439 | 7215-7218 | NNP | denotes | Dr. |
T19438 | 7212-7214 | IN | denotes | by |
T19437 | 7203-7211 | VB | denotes | provided |
T19436 | 7196-7202 | RB | denotes | kindly |
T19435 | 7189-7195 | CC | denotes | either |
T19434 | 7184-7188 | VB | denotes | were |
T19433 | 7178-7183 | NN | denotes | study |
T19432 | 7173-7177 | DT | denotes | this |
T19431 | 7170-7172 | IN | denotes | in |
T19430 | 7165-7169 | VB | denotes | used |
T19429 | 7154-7164 | NN | denotes | antibodies |
T19428 | 7149-7153 | NN | denotes | Sox6 |
T19427 | 7137-7147 | NN | denotes | Antibodies |
T18887 | 6589-6599 | NN | denotes | ransfectio |
T18886 | 6577-6589 | NN | denotes | ontrol for t |
T18885 | 6574-6577 | IN | denotes | a c |
T18884 | 6567-6574 | NN | denotes | sed as |
T18883 | 6566-6567 | DT | denotes | u |
T18882 | 6564-6566 | IN | denotes | s |
T18881 | 6560-6564 | VB | denotes | ) wa |
T18880 | 6557-6560 | VB | denotes | ega |
T18879 | 6556-6557 | -RRB- | denotes | m |
T18878 | 6549-6556 | NN | denotes | ng (Pro |
T18877 | 6548-6549 | -LRB- | denotes | 5 |
T18876 | 6544-6548 | NN | denotes | MV 1 |
T18875 | 6537-6544 | NN | denotes | . pRL-C |
T18874 | 6536-6537 | -RRB- | denotes | ) |
T18873 | 6534-6536 | NN | denotes | ng |
T18872 | 6529-6533 | CD | denotes | 1000 |
T18871 | 6525-6528 | CC | denotes | and |
T18870 | 6523-6524 | -COMMA- | denotes | , |
T18869 | 6521-6523 | NN | denotes | ng |
T18868 | 6517-6520 | CD | denotes | 500 |
T18867 | 6515-6516 | -COMMA- | denotes | , |
T18866 | 6513-6515 | NN | denotes | ng |
T18865 | 6509-6512 | CD | denotes | 200 |
T18864 | 6504-6508 | VB | denotes | used |
T18863 | 6501-6503 | PRP | denotes | we |
T18862 | 6499-6500 | -COMMA- | denotes | , |
T18861 | 6493-6499 | NN | denotes | effect |
T18860 | 6486-6492 | NN | denotes | dosage |
T18859 | 6483-6485 | IN | denotes | of |
T18858 | 6476-6482 | NN | denotes | assays |
T18857 | 6473-6475 | IN | denotes | In |
T18856 | 6470-6471 | -RRB- | denotes | ) |
T18855 | 6468-6470 | NN | denotes | ng |
T18854 | 6463-6467 | CD | denotes | 1000 |
T18853 | 6462-6463 | -LRB- | denotes | ( |
T18852 | 6455-6461 | NN | denotes | vector |
T18851 | 6440-6454 | NN | denotes | overexpression |
T18850 | 6435-6439 | NN | denotes | Sox6 |
T18849 | 6432-6434 | CC | denotes | or |
T18848 | 6425-6431 | NN | denotes | vector |
T18847 | 6419-6424 | JJ | denotes | empty |
T18846 | 6412-6418 | CC | denotes | either |
T18845 | 6407-6411 | IN | denotes | with |
T18844 | 6401-6406 | IN | denotes | along |
T18843 | 6399-6400 | -RRB- | denotes | ) |
T18842 | 6397-6399 | NN | denotes | ng |
T18841 | 6393-6396 | CD | denotes | 500 |
T18840 | 6392-6393 | -LRB- | denotes | ( |
T18839 | 6381-6391 | NN | denotes | constructs |
T18838 | 6372-6380 | NN | denotes | reporter |
T18837 | 6363-6371 | NN | denotes | promoter |
T18836 | 6360-6362 | JJ | denotes | ɛy |
T18785 | 6098-6099 | CD | denotes | 2 |
T18784 | 6097-6098 | -LRB- | denotes | ( |
T18783 | 6085-6096 | NN | denotes | L-glutamine |
T18782 | 6081-6084 | CC | denotes | and |
T18781 | 6079-6080 | -COMMA- | denotes | , |
T18780 | 6078-6079 | -RRB- | denotes | ) |
T18779 | 6073-6078 | NN | denotes | μg/ml |
T18778 | 6069-6072 | CD | denotes | 100 |
T18777 | 6056-6068 | NN | denotes | streptomycin |
T18776 | 6054-6055 | -COMMA- | denotes | , |
T18775 | 6053-6054 | -RRB- | denotes | ) |
T18774 | 6045-6053 | NN | denotes | units/ml |
T18773 | 6041-6044 | CD | denotes | 100 |
T18772 | 6040-6041 | -LRB- | denotes | ( |
T18771 | 6029-6039 | NN | denotes | penicillin |
T18770 | 6027-6028 | -COMMA- | denotes | , |
T18769 | 6026-6027 | -RRB- | denotes | ) |
T18768 | 6020-6026 | NNP | denotes | States |
T18767 | 6013-6019 | NNP | denotes | United |
T18766 | 6011-6012 | -COMMA- | denotes | , |
T18765 | 6001-6011 | NNP | denotes | California |
T18764 | 5999-6000 | -COMMA- | denotes | , |
T18763 | 5991-5999 | NNP | denotes | Carlsbad |
T18762 | 5989-5990 | -COMMA- | denotes | , |
T18761 | 5980-5989 | NN | denotes | Ivitrogen |
T18760 | 5979-5980 | -LRB- | denotes | ( |
T18759 | 5973-5978 | NN | denotes | serum |
T18758 | 5968-5972 | NN | denotes | calf |
T18757 | 5962-5967 | JJ | denotes | fetal |
T18756 | 5960-5961 | NN | denotes | % |
T18755 | 5958-5960 | CD | denotes | 10 |
T18754 | 5941-5957 | JJ | denotes | heat-inactivated |
T18753 | 5936-5940 | IN | denotes | with |
T18752 | 5923-5935 | VB | denotes | supplemented |
T18751 | 5911-5922 | NN | denotes | L-glutamine |
T18750 | 5908-5910 | NN | denotes | mM |
T18749 | 5906-5907 | CD | denotes | 2 |
T18748 | 5901-5905 | IN | denotes | with |
T18747 | 5897-5900 | NN | denotes | F12 |
T18746 | 5894-5896 | POS | denotes | 's |
T18745 | 5891-5894 | NNP | denotes | Ham |
T18744 | 5888-5890 | IN | denotes | in |
T18743 | 5879-5887 | VB | denotes | cultured |
T18742 | 5874-5878 | VB | denotes | were |
T18741 | 5872-5873 | -RRB- | denotes | ) |
T18740 | 5866-5872 | NNP | denotes | States |
T18739 | 5859-5865 | NNP | denotes | United |
T18738 | 5857-5858 | -COMMA- | denotes | , |
T18737 | 5851-5857 | NNP | denotes | Jersey |
T18736 | 5847-5850 | NNP | denotes | New |
T18735 | 5845-5846 | -COMMA- | denotes | , |
T18734 | 5839-5845 | NNP | denotes | Camden |
T18733 | 5837-5838 | -COMMA- | denotes | , |
T18732 | 5825-5837 | NNP | denotes | Repositories |
T18731 | 5820-5824 | NNP | denotes | Cell |
T18730 | 5812-5819 | NNP | denotes | Coriell |
T18729 | 5811-5812 | -LRB- | denotes | ( |
T18728 | 5805-5810 | NN | denotes | cells |
T18727 | 5799-5804 | NN | denotes | GM979 |
T18726 | 5785-5797 | NN | denotes | transfection |
T18725 | 5781-5784 | CC | denotes | and |
T18724 | 5773-5780 | NN | denotes | culture |
T18723 | 5768-5772 | NN | denotes | Cell |
T19489 | 7505-7508 | VB | denotes | was |
T19488 | 7496-7504 | NN | denotes | antibody |
T19487 | 7492-7495 | NN | denotes | IgG |
T19486 | 7485-7491 | NN | denotes | rabbit |
T19485 | 7478-7484 | NNP | denotes | Normal |
T19484 | 7466-7477 | NNP | denotes | Invitrogen. |
T19483 | 7461-7465 | IN | denotes | from |
T19482 | 7451-7460 | VB | denotes | purchased |
T19481 | 7447-7450 | VB | denotes | was |
T19480 | 7438-7446 | NN | denotes | antibody |
T19479 | 7432-7437 | NN | denotes | c-Myc |
T19478 | 7423-7431 | JJ | denotes | results. |
T19477 | 7415-7422 | JJ | denotes | similar |
T19476 | 7405-7414 | VB | denotes | generated |
T19475 | 7394-7404 | NN | denotes | antibodies |
T19474 | 7389-7393 | NN | denotes | Sox6 |
T19473 | 7385-7388 | DT | denotes | All |
T19472 | 7382-7383 | -RRB- | denotes | ) |
T19471 | 7376-7382 | NNP | denotes | States |
T19470 | 7369-7375 | NNP | denotes | United |
T19469 | 7367-7368 | -COMMA- | denotes | , |
T19468 | 7357-7367 | NNP | denotes | California |
T19467 | 7355-7356 | -COMMA- | denotes | , |
T19466 | 7351-7355 | NNP | denotes | Cruz |
T19465 | 7345-7350 | NNP | denotes | Santa |
T19464 | 7343-7344 | -COMMA- | denotes | , |
T18301 | 5207-5216 | JJ | denotes | available |
T18300 | 5203-5206 | VB | denotes | are |
T18299 | 5196-5202 | NN | denotes | images |
T18298 | 5187-5195 | JJ | denotes | Original |
T18297 | 5181-5185 | CD | denotes | 4300 |
T18296 | 5173-5180 | NNP | denotes | Coolpix |
T18295 | 5167-5172 | NNP | denotes | Nikon |
T18294 | 5165-5166 | DT | denotes | a |
T18293 | 5161-5164 | VB | denotes | was |
T18292 | 5154-5160 | NN | denotes | camera |
T18835 | 6355-6359 | IN | denotes | with |
T18834 | 6343-6354 | VB | denotes | transfected |
T18833 | 6338-6342 | VB | denotes | were |
T18832 | 6332-6337 | NN | denotes | Cells |
T18831 | 6329-6330 | -RRB- | denotes | ) |
T18830 | 6323-6329 | NNP | denotes | States |
T18829 | 6316-6322 | NNP | denotes | United |
T18828 | 6314-6315 | -COMMA- | denotes | , |
T18827 | 6307-6314 | NNP | denotes | Indiana |
T18826 | 6305-6306 | -COMMA- | denotes | , |
T18825 | 6293-6305 | NNP | denotes | Indianapolis |
T18824 | 6291-6292 | -COMMA- | denotes | , |
T18823 | 6286-6291 | NNP | denotes | Roche |
T18822 | 6285-6286 | -LRB- | denotes | ( |
T18821 | 6277-6284 | NN | denotes | FuGENE6 |
T18820 | 6274-6276 | IN | denotes | by |
T18819 | 6265-6273 | NN | denotes | plasmids |
T18818 | 6260-6264 | IN | denotes | with |
T18817 | 6248-6259 | VB | denotes | transfected |
T18816 | 6243-6247 | VB | denotes | were |
T18815 | 6236-6242 | NN | denotes | growth |
T18814 | 6233-6235 | IN | denotes | of |
T18813 | 6227-6232 | NN | denotes | phase |
T18812 | 6223-6226 | NN | denotes | log |
T18811 | 6220-6222 | IN | denotes | in |
T18810 | 6218-6219 | -RRB- | denotes | ) |
T18809 | 6215-6218 | CD | denotes | 105 |
T18808 | 6213-6214 | NN | denotes | × |
T18807 | 6211-6212 | CD | denotes | 4 |
T18806 | 6210-6211 | -LRB- | denotes | ( |
T18805 | 6204-6209 | NN | denotes | cells |
T18804 | 6198-6203 | NN | denotes | GM979 |
T18803 | 6195-6196 | -RRB- | denotes | ) |
T18802 | 6190-6195 | NN | denotes | serum |
T18801 | 6186-6189 | DT | denotes | the |
T18800 | 6173-6185 | VB | denotes | inactivating |
T18799 | 6168-6172 | NN | denotes | heat |
T18798 | 6160-6167 | IN | denotes | without |
T18797 | 6159-6160 | -LRB- | denotes | ( |
T18796 | 6153-6158 | JJ | denotes | above |
T18795 | 6150-6152 | IN | denotes | as |
T18794 | 6137-6149 | VB | denotes | supplemented |
T18793 | 6132-6136 | NN | denotes | DMEM |
T18792 | 6129-6131 | IN | denotes | in |
T18791 | 6120-6128 | VB | denotes | cultured |
T18790 | 6115-6119 | VB | denotes | were |
T18789 | 6109-6114 | NN | denotes | cells |
T18788 | 6105-6108 | NN | denotes | MEL |
T18787 | 6102-6103 | -RRB- | denotes | ) |
T18786 | 6100-6102 | NN | denotes | mM |
T18291 | 5150-5153 | DT | denotes | The |
T18290 | 5147-5148 | -RRB- | denotes | ) |
T18289 | 5138-5147 | NN | denotes | objective |
T18288 | 5133-5137 | CD | denotes | 100× |
T18287 | 5132-5133 | -LRB- | denotes | ( |
T18286 | 5126-5131 | NNP | denotes | Nikon |
T18285 | 5117-5125 | CD | denotes | 160/0.17 |
T18284 | 5113-5116 | NN | denotes | oil |
T18283 | 5104-5112 | CD | denotes | 100/1.25 |
T18282 | 5099-5103 | NNP | denotes | Plan |
T18281 | 5097-5098 | NN | denotes | E |
T18280 | 5095-5096 | -COMMA- | denotes | , |
T18279 | 5094-5095 | -RRB- | denotes | ) |
T18278 | 5085-5094 | NN | denotes | objective |
T18277 | 5081-5084 | CD | denotes | 40× |
T18276 | 5080-5081 | -LRB- | denotes | ( |
T18275 | 5074-5079 | NNP | denotes | Nikon |
T18274 | 5065-5073 | CD | denotes | 160/0.17 |
T18273 | 5057-5064 | CD | denotes | 40/0.65 |
T18272 | 5052-5056 | NNP | denotes | Plan |
T18271 | 5050-5051 | NN | denotes | E |
T18270 | 5045-5049 | VB | denotes | were |
T18269 | 5040-5044 | VB | denotes | used |
T18268 | 5029-5039 | NN | denotes | Objectives |
T18267 | 5017-5027 | NN | denotes | microscope |
T18266 | 5006-5016 | NN | denotes | Labophot-2 |
T18265 | 5000-5005 | NNP | denotes | Nikon |
T18264 | 4995-4999 | IN | denotes | with |
T18263 | 4986-4994 | VB | denotes | obtained |
T18262 | 4981-4985 | VB | denotes | were |
T18261 | 4974-4980 | NN | denotes | Images |
T18260 | 4966-4972 | NN | denotes | manner |
T18259 | 4958-4965 | JJ | denotes | similar |
T18258 | 4956-4957 | DT | denotes | a |
T18257 | 4953-4955 | IN | denotes | in |
T18256 | 4944-4952 | VB | denotes | prepared |
T18255 | 4939-4943 | VB | denotes | were |
T18254 | 4937-4938 | -RRB- | denotes | ) |
T18253 | 4934-4937 | NN | denotes | dpc |
T18252 | 4929-4933 | CD | denotes | 18.5 |
T18251 | 4925-4928 | CC | denotes | and |
T18250 | 4921-4924 | NN | denotes | dpc |
T18249 | 4916-4920 | CD | denotes | 14.5 |
T18248 | 4913-4915 | IN | denotes | at |
T18247 | 4912-4913 | -LRB- | denotes | ( |
T18246 | 4904-4911 | NN | denotes | samples |
T18245 | 4898-4903 | NN | denotes | Liver |
T18244 | 4891-4896 | NN | denotes | eosin |
T18243 | 4887-4890 | CC | denotes | and |
T18242 | 4875-4886 | NN | denotes | hematoxylin |
T18241 | 4870-4874 | IN | denotes | with |
T18240 | 4862-4869 | VB | denotes | stained |
T18239 | 4858-4861 | CC | denotes | and |
T18238 | 4856-4857 | -COMMA- | denotes | , |
T18237 | 4854-4856 | NN | denotes | μm |
T18236 | 4852-4853 | CD | denotes | 5 |
T18235 | 4849-4851 | IN | denotes | at |
T18234 | 4839-4848 | VB | denotes | sectioned |
T18233 | 4837-4838 | -COMMA- | denotes | , |
T18232 | 4820-4837 | JJ | denotes | paraffin-embedded |
T18231 | 4818-4819 | -COMMA- | denotes | , |
T18230 | 4810-4818 | NN | denotes | formalin |
T18229 | 4808-4809 | NN | denotes | % |
T18228 | 4806-4808 | CD | denotes | 10 |
T18227 | 4803-4805 | IN | denotes | in |
T18226 | 4797-4802 | VB | denotes | fixed |
T18225 | 4792-4796 | VB | denotes | were |
T18224 | 4787-4791 | NN | denotes | mice |
T18223 | 4778-4786 | NN | denotes | day–10.5 |
T18222 | 4768-4777 | JJ | denotes | postnatal |
T18221 | 4764-4767 | CC | denotes | and |
T18220 | 4762-4763 | -COMMA- | denotes | , |
T18219 | 4755-4762 | NN | denotes | embryos |
T18218 | 4748-4754 | JJ | denotes | mutant |
T18217 | 4744-4747 | CC | denotes | and |
T18216 | 4741-4743 | NN | denotes | WT |
T18215 | 4732-4740 | JJ | denotes | 14.5-dpc |
T18214 | 4730-4731 | -COMMA- | denotes | , |
T18213 | 4722-4730 | NN | denotes | analysis |
T18212 | 4716-4721 | NN | denotes | mount |
T18211 | 4710-4715 | JJ | denotes | whole |
T18210 | 4706-4709 | IN | denotes | For |
T18209 | 4701-4704 | NNP | denotes | DAF |
T18208 | 4698-4700 | IN | denotes | by |
T18207 | 4693-4697 | VB | denotes | read |
T18206 | 4689-4692 | CC | denotes | and |
T18205 | 4674-4688 | JJ | denotes | Wright-stained |
T18204 | 4669-4673 | VB | denotes | were |
T18203 | 4662-4668 | NN | denotes | slides |
T18202 | 4658-4661 | DT | denotes | The |
T18201 | 4652-4656 | NN | denotes | mice |
T18200 | 4649-4651 | JJ | denotes | WT |
T18199 | 4645-4648 | CC | denotes | and |
T18198 | 4638-4644 | JJ | denotes | mutant |
T18197 | 4633-4637 | CC | denotes | both |
T18196 | 4628-4632 | IN | denotes | from |
T18195 | 4619-4627 | VB | denotes | prepared |
T18194 | 4614-4618 | VB | denotes | were |
T18193 | 4607-4613 | NN | denotes | smears |
T18192 | 4601-4606 | NN | denotes | blood |
T18191 | 4590-4600 | JJ | denotes | peripheral |
T17944 | 4527-4536 | JJ | denotes | available |
T17943 | 4523-4526 | VB | denotes | are |
T17942 | 4516-4522 | NN | denotes | images |
T17941 | 4507-4515 | JJ | denotes | Original |
T17940 | 4498-4505 | NN | denotes | plugins |
T17939 | 4496-4497 | -RRB- | denotes | ) |
T17938 | 4490-4496 | NNP | denotes | States |
T17937 | 4483-4489 | NNP | denotes | United |
T17936 | 4481-4482 | -COMMA- | denotes | , |
T17935 | 4473-4481 | NNP | denotes | Carolina |
T17934 | 4467-4472 | NNP | denotes | North |
T17933 | 4465-4466 | -COMMA- | denotes | , |
T17932 | 4456-4465 | NNP | denotes | Asheville |
T17931 | 4454-4455 | -COMMA- | denotes | , |
T17930 | 4446-4454 | NNP | denotes | Graphics |
T18565 | 5764-5765 | NN | denotes | d |
T18564 | 5762-5763 | CD | denotes | 6 |
T18563 | 5758-5761 | IN | denotes | for |
T18562 | 5755-5757 | NN | denotes | °C |
T18561 | 5751-5754 | CD | denotes | −80 |
T18560 | 5748-5750 | IN | denotes | at |
T18559 | 5746-5747 | -RRB- | denotes | ) |
T18558 | 5740-5746 | NNP | denotes | States |
T18557 | 5733-5739 | NNP | denotes | United |
T18556 | 5731-5732 | -COMMA- | denotes | , |
T18555 | 5727-5731 | NNP | denotes | York |
T18554 | 5723-5726 | NNP | denotes | New |
T18553 | 5721-5722 | -COMMA- | denotes | , |
T18552 | 5712-5721 | NNP | denotes | Rochester |
T18551 | 5710-5711 | -COMMA- | denotes | , |
T18550 | 5705-5710 | NNP | denotes | Kodak |
T18549 | 5704-5705 | -LRB- | denotes | ( |
T18548 | 5699-5703 | NN | denotes | film |
T18547 | 5693-5698 | NN | denotes | X-ray |
T18546 | 5690-5692 | TO | denotes | to |
T18545 | 5681-5689 | NN | denotes | exposure |
T18544 | 5678-5680 | TO | denotes | to |
T18543 | 5672-5677 | JJ | denotes | prior |
T18542 | 5669-5671 | NN | denotes | °C |
T18541 | 5666-5668 | CD | denotes | 60 |
T18540 | 5663-5665 | IN | denotes | at |
T18539 | 5659-5662 | NN | denotes | SDS |
T18538 | 5657-5658 | NN | denotes | % |
T18537 | 5656-5657 | CD | denotes | 1 |
T18536 | 5654-5655 | -COMMA- | denotes | , |
T18535 | 5651-5654 | NNP | denotes | SSC |
T18534 | 5646-5650 | CD | denotes | 0.2× |
T18533 | 5641-5645 | IN | denotes | with |
T18532 | 5634-5640 | VB | denotes | washed |
T18531 | 5629-5633 | VB | denotes | were |
T18530 | 5623-5628 | NN | denotes | Blots |
T18529 | 5613-5621 | NN | denotes | solution |
T18528 | 5599-5612 | NN | denotes | hybridization |
T18527 | 5595-5598 | NN | denotes | SDS |
T18526 | 5593-5594 | NN | denotes | % |
T18525 | 5592-5593 | CD | denotes | 7 |
T18524 | 5583-5591 | VB | denotes | buffered |
T18523 | 5573-5582 | NN | denotes | phosphate |
T18522 | 5570-5572 | IN | denotes | in |
T18521 | 5560-5569 | VB | denotes | performed |
T18520 | 5556-5559 | VB | denotes | was |
T18519 | 5542-5555 | NN | denotes | hybridization |
T18518 | 5538-5541 | DT | denotes | The |
T18517 | 5535-5536 | -RRB- | denotes | ) |
T18516 | 5528-5535 | NNP | denotes | Kingdom |
T18515 | 5521-5527 | NNP | denotes | United |
T18514 | 5519-5520 | -COMMA- | denotes | , |
T18513 | 5512-5519 | NNP | denotes | England |
T18512 | 5510-5511 | -COMMA- | denotes | , |
T18511 | 5495-5510 | NNP | denotes | Buckinghamshire |
T18510 | 5493-5494 | -COMMA- | denotes | , |
T18509 | 5482-5493 | NNP | denotes | Biosciences |
T18508 | 5473-5481 | NNP | denotes | Amersham |
T18507 | 5471-5472 | -COLON- | denotes | ; |
T18506 | 5460-5471 | NN | denotes | RediprimeII |
T18505 | 5459-5460 | -LRB- | denotes | ( |
T18504 | 5450-5458 | NN | denotes | labeling |
T18503 | 5443-5449 | NN | denotes | primer |
T18502 | 5436-5442 | JJ | denotes | random |
T18501 | 5433-5435 | IN | denotes | by |
T18500 | 5431-5432 | -COMMA- | denotes | , |
T18499 | 5427-5431 | NN | denotes | dCTP |
T18498 | 5426-5427 | -RRB- | denotes | ] |
T18497 | 5421-5426 | NN | denotes | α-32P |
T18496 | 5420-5421 | -LRB- | denotes | [ |
T18495 | 5415-5419 | IN | denotes | with |
T18494 | 5407-5414 | VB | denotes | labeled |
T18493 | 5403-5406 | CC | denotes | and |
T18492 | 5401-5402 | -RRB- | denotes | ) |
T18491 | 5392-5401 | CD | denotes | 1353–1927 |
T18490 | 5380-5391 | NN | denotes | nucleotides |
T18489 | 5379-5380 | -LRB- | denotes | ( |
T18488 | 5372-5378 | NN | denotes | RT-PCR |
T18487 | 5369-5371 | IN | denotes | by |
T18486 | 5359-5368 | VB | denotes | generated |
T18485 | 5353-5358 | NN | denotes | probe |
T18484 | 5348-5352 | NN | denotes | Sox6 |
T18483 | 5346-5347 | DT | denotes | a |
T18482 | 5341-5345 | IN | denotes | with |
T18481 | 5330-5340 | VB | denotes | hybridized |
T18480 | 5326-5329 | VB | denotes | was |
T18479 | 5324-5325 | -RRB- | denotes | ) |
T18478 | 5318-5324 | NNP | denotes | States |
T18477 | 5311-5317 | NNP | denotes | United |
T18476 | 5309-5310 | -COMMA- | denotes | , |
T18475 | 5301-5309 | NNP | denotes | Maryland |
T18474 | 5299-5300 | -COMMA- | denotes | , |
T18473 | 5290-5299 | NNP | denotes | Rockville |
T18472 | 5288-5289 | -COMMA- | denotes | , |
T18471 | 5281-5288 | NN | denotes | Seegene |
T18470 | 5280-5281 | -LRB- | denotes | ( |
T18469 | 5273-5279 | NN | denotes | filter |
T18468 | 5268-5272 | NN | denotes | blot |
T18467 | 5259-5267 | NN | denotes | Northern |
T18466 | 5252-5258 | NN | denotes | tissue |
T18465 | 5242-5251 | JJ | denotes | embryonic |
T18464 | 5236-5241 | NN | denotes | mouse |
T18463 | 5234-5235 | DT | denotes | A |
T18462 | 5228-5232 | NN | denotes | blot |
T18461 | 5219-5227 | NN | denotes | Northern |
T17929 | 4437-4445 | NNP | denotes | Reindeer |
T17928 | 4436-4437 | -LRB- | denotes | ( |
T17927 | 4432-4435 | NNP | denotes | Pro |
T17926 | 4426-4431 | NNP | denotes | Fovea |
T17925 | 4421-4425 | IN | denotes | with |
T17924 | 4412-4420 | NN | denotes | software |
T17923 | 4410-4411 | -RRB- | denotes | ) |
T17922 | 4404-4410 | NNP | denotes | States |
T17921 | 4397-4403 | NNP | denotes | United |
T17920 | 4395-4396 | -COMMA- | denotes | , |
T17919 | 4385-4395 | NNP | denotes | California |
T17918 | 4383-4384 | -COMMA- | denotes | , |
T17917 | 4379-4383 | NNP | denotes | Jose |
T17916 | 4375-4378 | NNP | denotes | San |
T17915 | 4373-4374 | -COMMA- | denotes | , |
T17914 | 4368-4373 | NNP | denotes | Adobe |
T17913 | 4367-4368 | -LRB- | denotes | ( |
T17912 | 4357-4366 | NNP | denotes | Photoshop |
T17911 | 4351-4356 | VB | denotes | using |
T17910 | 4342-4350 | VB | denotes | combined |
T17909 | 4338-4341 | CC | denotes | and |
T17908 | 4336-4337 | -COMMA- | denotes | , |
T17907 | 4323-4336 | VB | denotes | pseudocolored |
T17906 | 4321-4322 | -COMMA- | denotes | , |
T17905 | 4312-4321 | VB | denotes | processed |
T17904 | 4307-4311 | VB | denotes | were |
T17903 | 4300-4306 | NN | denotes | Images |
T17902 | 4297-4298 | -RRB- | denotes | ) |
T17901 | 4294-4297 | CD | denotes | 0.5 |
T17900 | 4292-4293 | SYM | denotes | = |
T17899 | 4289-4291 | NN | denotes | NA |
T17898 | 4288-4289 | -LRB- | denotes | ( |
T17897 | 4284-4287 | CD | denotes | 10× |
T17896 | 4280-4283 | CC | denotes | and |
T17895 | 4278-4279 | -RRB- | denotes | ) |
T17894 | 4274-4278 | CD | denotes | 0.04 |
T17893 | 4272-4273 | SYM | denotes | = |
T17892 | 4269-4271 | NN | denotes | NA |
T17891 | 4268-4269 | -LRB- | denotes | ( |
T17890 | 4265-4267 | CD | denotes | 1× |
T17889 | 4260-4264 | VB | denotes | were |
T17888 | 4255-4259 | VB | denotes | used |
T17887 | 4244-4254 | NN | denotes | Objectives |
T17886 | 4241-4242 | -RRB- | denotes | ) |
T17885 | 4235-4241 | NNP | denotes | States |
T17884 | 4228-4234 | NNP | denotes | United |
T17883 | 4226-4227 | -COMMA- | denotes | , |
T17882 | 4218-4226 | NNP | denotes | Michigan |
T17881 | 4216-4217 | -COMMA- | denotes | , |
T17880 | 4209-4216 | NNP | denotes | Heights |
T17879 | 4200-4208 | NNP | denotes | Sterling |
T17878 | 4198-4199 | -COMMA- | denotes | , |
T17877 | 4187-4198 | NNP | denotes | Instruments |
T17876 | 4176-4186 | JJ | denotes | Diagnostic |
T17875 | 4175-4176 | -LRB- | denotes | ( |
T17874 | 4168-4174 | NN | denotes | camera |
T17873 | 4160-4167 | JJ | denotes | digital |
T17872 | 4150-4159 | NN | denotes | RT-Slider |
T17871 | 4145-4149 | NN | denotes | SPOT |
T17870 | 4141-4144 | CC | denotes | and |
T17869 | 4139-4140 | -RRB- | denotes | ) |
T17868 | 4133-4139 | NNP | denotes | States |
T17867 | 4126-4132 | NNP | denotes | United |
T17866 | 4124-4125 | -COMMA- | denotes | , |
T17865 | 4120-4124 | NNP | denotes | York |
T17864 | 4116-4119 | NNP | denotes | New |
T17863 | 4114-4115 | -COMMA- | denotes | , |
T17862 | 4106-4114 | NNP | denotes | Melville |
T17861 | 4104-4105 | -COMMA- | denotes | , |
T17860 | 4099-4104 | NNP | denotes | Nikon |
T17859 | 4098-4099 | -LRB- | denotes | ( |
T17858 | 4087-4097 | NN | denotes | microscope |
T17857 | 4078-4086 | NNP | denotes | Optiphot |
T17856 | 4072-4077 | NNP | denotes | Nikon |
T17855 | 4070-4071 | DT | denotes | a |
T17854 | 4065-4069 | IN | denotes | with |
T17853 | 4056-4064 | VB | denotes | obtained |
T17852 | 4051-4055 | VB | denotes | were |
T17851 | 4044-4050 | NN | denotes | images |
T17850 | 4032-4043 | NN | denotes | brightfield |
T17849 | 4028-4031 | CC | denotes | and |
T17848 | 4018-4027 | NN | denotes | Darkfield |
T17847 | 4013-4016 | NN | denotes | 33P |
T17846 | 4008-4012 | IN | denotes | with |
T17845 | 4000-4007 | VB | denotes | labeled |
T17844 | 3993-3999 | NN | denotes | probes |
T17843 | 3989-3992 | NN | denotes | RNA |
T17842 | 3977-3988 | VB | denotes | transcribed |
T17841 | 3971-3976 | FW | denotes | vitro |
T17840 | 3968-3970 | FW | denotes | in |
T17839 | 3962-3967 | VB | denotes | using |
T17838 | 3960-3961 | -RRB- | denotes | ] |
T17837 | 3958-3960 | CD | denotes | 52 |
T17836 | 3957-3958 | -LRB- | denotes | [ |
T17835 | 3947-3956 | VB | denotes | described |
T17834 | 3944-3946 | IN | denotes | as |
T17833 | 3930-3943 | NN | denotes | hybridization |
T17832 | 3925-3929 | FW | denotes | situ |
T17831 | 3922-3924 | FW | denotes | in |
T17830 | 3918-3921 | IN | denotes | for |
T17829 | 3908-3917 | VB | denotes | processed |
T18190 | 4586-4589 | CC | denotes | and |
T18189 | 4572-4585 | VB | denotes | exsanguinated |
T18188 | 4567-4571 | VB | denotes | were |
T18187 | 4559-4566 | NN | denotes | embryos |
T18186 | 4550-4558 | JJ | denotes | 18.5-dpc |
T18185 | 4539-4548 | NNP | denotes | Histology |
T17394 | 3531-3532 | -RRB- | denotes | ) |
T17393 | 3525-3531 | NNP | denotes | States |
T17392 | 3518-3524 | NNP | denotes | United |
T17391 | 3516-3517 | -COMMA- | denotes | , |
T17390 | 3506-3516 | NNP | denotes | Washington |
T17389 | 3504-3505 | -COMMA- | denotes | , |
T17388 | 3497-3504 | NNP | denotes | Redmond |
T17387 | 3496-3497 | -LRB- | denotes | ( |
T17386 | 3490-3495 | NNP | denotes | Excel |
T17385 | 3480-3489 | NNP | denotes | Microsoft |
T17384 | 3477-3479 | IN | denotes | in |
T17383 | 3471-3476 | NN | denotes | GAPDH |
T17382 | 3468-3470 | TO | denotes | to |
T17381 | 3457-3467 | VB | denotes | normalized |
T17380 | 3453-3456 | CC | denotes | and |
T17379 | 3451-3452 | -RRB- | denotes | ) |
T17378 | 3441-3451 | NNP | denotes | Biosystems |
T17377 | 3433-3440 | NNP | denotes | Applied |
T17376 | 3432-3433 | -LRB- | denotes | ( |
T17375 | 3423-3431 | NNP | denotes | Software |
T17374 | 3419-3422 | NNP | denotes | SDS |
T17373 | 3414-3418 | CD | denotes | 7000 |
T17372 | 3408-3413 | NNP | denotes | Prism |
T17371 | 3404-3407 | NNP | denotes | ABI |
T17370 | 3400-3403 | DT | denotes | the |
T17369 | 3397-3399 | IN | denotes | in |
T17368 | 3386-3396 | VB | denotes | calculated |
T17367 | 3381-3385 | VB | denotes | were |
T17366 | 3374-3380 | NN | denotes | values |
T17365 | 3361-3373 | JJ | denotes | quantitative |
T17364 | 3352-3360 | JJ | denotes | Relative |
T17363 | 3342-3350 | NN | denotes | reaction |
T17362 | 3338-3341 | NN | denotes | PCR |
T17361 | 3333-3337 | DT | denotes | each |
T17360 | 3329-3332 | IN | denotes | for |
T17359 | 3324-3328 | VB | denotes | done |
T17358 | 3319-3323 | VB | denotes | were |
T17357 | 3307-3318 | NN | denotes | Triplicates |
T17356 | 3291-3305 | NN | denotes | amplifications |
T17355 | 3287-3290 | DT | denotes | the |
T17354 | 3284-3286 | IN | denotes | of |
T17353 | 3273-3283 | NN | denotes | efficiency |
T17352 | 3269-3272 | DT | denotes | the |
T17351 | 3264-3268 | VB | denotes | test |
T17350 | 3261-3263 | TO | denotes | to |
T17349 | 3251-3260 | VB | denotes | performed |
T17348 | 3246-3250 | VB | denotes | were |
T17347 | 3237-3245 | NN | denotes | analyses |
T17346 | 3231-3236 | NN | denotes | curve |
T17345 | 3222-3230 | JJ | denotes | Standard |
T17344 | 3217-3220 | NN | denotes | RNA |
T17343 | 3211-3216 | NN | denotes | input |
T17342 | 3207-3210 | IN | denotes | for |
T17341 | 3199-3206 | NN | denotes | control |
T17340 | 3196-3198 | IN | denotes | as |
T17339 | 3191-3195 | VB | denotes | used |
T17338 | 3186-3190 | VB | denotes | were |
T17337 | 3179-3185 | NN | denotes | levels |
T17336 | 3174-3178 | NN | denotes | mRNA |
T17335 | 3168-3173 | NN | denotes | GAPDH |
T17334 | 3158-3166 | NN | denotes | supermix |
T17333 | 3152-3157 | JJ | denotes | green |
T17332 | 3147-3151 | NN | denotes | SYBR |
T17331 | 3144-3146 | NN | denotes | μl |
T17330 | 3139-3143 | CD | denotes | 12.5 |
T17329 | 3134-3138 | IN | denotes | with |
T17328 | 3125-3133 | NN | denotes | reaction |
T17327 | 3119-3124 | JJ | denotes | 25-μl |
T17326 | 3117-3118 | DT | denotes | a |
T17325 | 3114-3116 | IN | denotes | in |
T17324 | 3104-3113 | VB | denotes | performed |
T17323 | 3100-3103 | VB | denotes | was |
T17322 | 3096-3099 | NN | denotes | PCR |
T17321 | 3092-3095 | DT | denotes | All |
T17320 | 3082-3090 | NN | denotes | facility |
T17319 | 3077-3081 | NN | denotes | core |
T17318 | 3069-3076 | NNP | denotes | Arizona |
T17317 | 3066-3068 | IN | denotes | of |
T17316 | 3055-3065 | NNP | denotes | University |
T17315 | 3051-3054 | DT | denotes | the |
T17314 | 3048-3050 | IN | denotes | at |
T17313 | 3046-3047 | -RRB- | denotes | ) |
T17312 | 3040-3046 | NNP | denotes | States |
T17311 | 3033-3039 | NNP | denotes | United |
T17310 | 3031-3032 | -COMMA- | denotes | , |
T17309 | 3021-3031 | NNP | denotes | California |
T17308 | 3019-3020 | -COMMA- | denotes | , |
T17307 | 3015-3019 | NNP | denotes | City |
T17306 | 3008-3014 | NNP | denotes | Foster |
T17305 | 3006-3007 | -COMMA- | denotes | , |
T17304 | 2996-3006 | NNP | denotes | Biosystems |
T17828 | 3903-3907 | VB | denotes | were |
T17827 | 3896-3902 | NN | denotes | Slides |
T17826 | 3893-3894 | -RRB- | denotes | ) |
T17825 | 3887-3893 | NNP | denotes | States |
T17824 | 3880-3886 | NNP | denotes | United |
T17823 | 3878-3879 | -COMMA- | denotes | , |
T17822 | 3866-3878 | NNP | denotes | Pennsylvania |
T17821 | 3864-3865 | -COMMA- | denotes | , |
T17820 | 3857-3864 | NNP | denotes | Chester |
T17819 | 3852-3856 | NNP | denotes | West |
T17818 | 3850-3851 | -COMMA- | denotes | , |
T17817 | 3847-3850 | NN | denotes | VWR |
T17816 | 3846-3847 | -LRB- | denotes | ( |
T17815 | 3839-3845 | NN | denotes | slides |
T17814 | 3830-3838 | VB | denotes | modified |
T17813 | 3823-3829 | VB | denotes | charge |
T17812 | 3820-3822 | TO | denotes | to |
T17811 | 3812-3819 | VB | denotes | adhered |
T17810 | 3808-3811 | CC | denotes | and |
T17809 | 3806-3807 | -COMMA- | denotes | , |
T17808 | 3804-3806 | NN | denotes | μm |
T17807 | 3802-3803 | CD | denotes | 5 |
T17806 | 3799-3801 | IN | denotes | at |
T17805 | 3789-3798 | VB | denotes | sectioned |
T17804 | 3787-3788 | -COMMA- | denotes | , |
T17803 | 3779-3787 | NN | denotes | paraffin |
T17802 | 3776-3778 | IN | denotes | in |
T17801 | 3767-3775 | VB | denotes | embedded |
T17800 | 3765-3766 | -COMMA- | denotes | , |
T17799 | 3749-3765 | NN | denotes | paraformaldehyde |
T17798 | 3747-3748 | NN | denotes | % |
T17797 | 3746-3747 | CD | denotes | 4 |
T17796 | 3743-3745 | IN | denotes | in |
T17795 | 3733-3742 | NN | denotes | immersion |
T17794 | 3730-3732 | IN | denotes | by |
T17793 | 3720-3729 | RB | denotes | overnight |
T17792 | 3714-3719 | VB | denotes | fixed |
T17791 | 3709-3713 | VB | denotes | were |
T17790 | 3701-3708 | NN | denotes | Embryos |
T17789 | 3690-3699 | CD | denotes | 1353–1927 |
T17788 | 3678-3689 | NN | denotes | nucleotides |
T17787 | 3673-3677 | NN | denotes | Sox6 |
T17786 | 3667-3672 | NN | denotes | mouse |
T17785 | 3663-3666 | CC | denotes | and |
T17784 | 3661-3662 | -COLON- | denotes | ; |
T17783 | 3654-3661 | CD | denotes | 458–549 |
T17782 | 3642-3653 | NN | denotes | nucleotides |
T17781 | 3635-3641 | NN | denotes | globin |
T17780 | 3630-3634 | SYM | denotes | βmaj |
T17779 | 3628-3629 | -COLON- | denotes | ; |
T17778 | 3621-3628 | CD | denotes | 509–584 |
T17777 | 3609-3620 | NN | denotes | nucleotides |
T17776 | 3602-3608 | NN | denotes | globin |
T17775 | 3599-3601 | JJ | denotes | ɛy |
T17774 | 3592-3598 | JJ | denotes | murine |
T17773 | 3589-3591 | TO | denotes | to |
T17772 | 3580-3588 | VB | denotes | designed |
T17771 | 3575-3579 | VB | denotes | were |
T17770 | 3568-3574 | NN | denotes | probes |
T17769 | 3558-3567 | JJ | denotes | Antisense |
T17768 | 3543-3556 | NN | denotes | hybridization |
T17767 | 3538-3542 | FW | denotes | situ |
T17766 | 3535-3537 | FW | denotes | In |
T17303 | 2988-2995 | NNP | denotes | Applied |
T17302 | 2987-2988 | -LRB- | denotes | ( |
T17301 | 2979-2986 | NN | denotes | ABI7000 |
T17300 | 2976-2978 | DT | denotes | an |
T17299 | 2973-2975 | IN | denotes | on |
T17298 | 2969-2972 | VB | denotes | run |
T17297 | 2965-2968 | VB | denotes | was |
T17296 | 2951-2964 | NN | denotes | amplification |
T17295 | 2947-2950 | NN | denotes | PCR |
T17294 | 2945-2946 | -COMMA- | denotes | , |
T17293 | 2944-2945 | -RRB- | denotes | ) |
T17292 | 2938-2944 | NNP | denotes | States |
T17291 | 2931-2937 | NNP | denotes | United |
T17290 | 2929-2930 | -COMMA- | denotes | , |
T17289 | 2919-2929 | NNP | denotes | California |
T17288 | 2917-2918 | -COMMA- | denotes | , |
T17287 | 2909-2917 | NNP | denotes | Hercules |
T17286 | 2907-2908 | -COMMA- | denotes | , |
T17285 | 2900-2907 | NNP | denotes | Bio-Rad |
T17284 | 2899-2900 | -LRB- | denotes | ( |
T17283 | 2895-2898 | NN | denotes | ROX |
T17282 | 2890-2894 | IN | denotes | with |
T17281 | 2886-2889 | NN | denotes | kit |
T17280 | 2877-2885 | NN | denotes | supermix |
T17279 | 2871-2876 | JJ | denotes | green |
T17278 | 2866-2870 | NN | denotes | SYBR |
T17277 | 2862-2865 | DT | denotes | the |
T17276 | 2856-2861 | VB | denotes | Using |
T17275 | 2830-2854 | NN | denotes | 5′ACGATCATATTGCCCAGGAG3′ |
T17274 | 2828-2829 | -COMMA- | denotes | , |
T17273 | 2821-2828 | NN | denotes | MHB1675 |
T17272 | 2817-2820 | CC | denotes | and |
T17271 | 2815-2816 | -COLON- | denotes | ; |
T17270 | 2791-2815 | NN | denotes | 5′ATGGCCTGAATCACTTGGAC3′ |
T17269 | 2789-2790 | -COLON- | denotes | : |
T17268 | 2782-2789 | NN | denotes | MHB1674 |
T17267 | 2780-2781 | -COLON- | denotes | : |
T17266 | 2774-2780 | NN | denotes | globin |
T17265 | 2765-2773 | NN | denotes | βmaj/min |
T17264 | 2761-2764 | IN | denotes | For |
T17263 | 2735-2759 | NN | denotes | 5′ACCTCTGGGGTGAATTCCTT3′ |
T17262 | 2733-2734 | -COMMA- | denotes | , |
T17261 | 2726-2733 | NN | denotes | MHB1673 |
T17260 | 2722-2725 | CC | denotes | and |
T17259 | 2720-2721 | -COLON- | denotes | ; |
T17258 | 2696-2720 | NN | denotes | 5′TGGACAACCTCAAGGAGACC3′ |
T17257 | 2694-2695 | -COMMA- | denotes | , |
T17256 | 2687-2694 | NN | denotes | MHB1672 |
T17255 | 2685-2686 | -COLON- | denotes | : |
T17254 | 2679-2685 | NN | denotes | globin |
T17253 | 2675-2678 | NN | denotes | βH1 |
T17252 | 2671-2674 | IN | denotes | For |
T17251 | 2645-2669 | NN | denotes | 5′CTTAACCGCATCCCCTACGG3′ |
T17250 | 2643-2644 | -COMMA- | denotes | , |
T17249 | 2636-2643 | NN | denotes | MHB1669 |
T17248 | 2632-2635 | CC | denotes | and |
T17247 | 2630-2631 | -COLON- | denotes | ; |
T17246 | 2605-2630 | NN | denotes | 5′CTACCCCCAGACGAAGACCTA3′ |
T17245 | 2603-2604 | -COMMA- | denotes | , |
T17244 | 2596-2603 | NN | denotes | MHB1668 |
T17243 | 2594-2595 | -COLON- | denotes | : |
T17242 | 2588-2594 | NN | denotes | globin |
T17241 | 2586-2587 | NN | denotes | ζ |
T17240 | 2582-2585 | IN | denotes | For |
T17239 | 2555-2580 | NN | denotes | 5′GAAGCAGAGGACAAGTTCCCA3′ |
T17238 | 2553-2554 | -COMMA- | denotes | , |
T17237 | 2546-2553 | NN | denotes | MHB1667 |
T17236 | 2542-2545 | CC | denotes | and |
T17235 | 2540-2541 | -COLON- | denotes | ; |
T17234 | 2515-2540 | NN | denotes | 5′TGGCCTGTGGAGTAAGGTCAA3′ |
T17233 | 2513-2514 | -COMMA- | denotes | , |
T17232 | 2506-2513 | NN | denotes | MHB1666 |
T17231 | 2504-2505 | -COLON- | denotes | : |
T17230 | 2498-2504 | NN | denotes | globin |
T17229 | 2495-2497 | JJ | denotes | ɛy |
T17228 | 2491-2494 | IN | denotes | For |
T17227 | 2478-2489 | NN | denotes | specificity |
T17226 | 2470-2477 | VB | denotes | confirm |
T17225 | 2467-2469 | TO | denotes | to |
T17224 | 2458-2466 | NN | denotes | database |
T17223 | 2453-2457 | NN | denotes | NCBI |
T17222 | 2449-2452 | DT | denotes | the |
T17221 | 2441-2448 | IN | denotes | against |
T17220 | 2432-2440 | VB | denotes | searched |
T17219 | 2427-2431 | VB | denotes | were |
T17218 | 2419-2426 | NN | denotes | primers |
T17217 | 2415-2418 | DT | denotes | All |
T17216 | 2412-2413 | -RRB- | denotes | ] |
T17215 | 2410-2412 | CD | denotes | 51 |
T17214 | 2409-2410 | -LRB- | denotes | [ |
T17213 | 2398-2408 | NNP | denotes | Primerbank |
T17212 | 2393-2397 | IN | denotes | from |
T17211 | 2384-2392 | VB | denotes | obtained |
T17210 | 2379-2383 | VB | denotes | were |
T17209 | 2373-2378 | NN | denotes | genes |
T17208 | 2366-2372 | NN | denotes | globin |
T17207 | 2363-2365 | IN | denotes | of |
T17206 | 2349-2362 | NN | denotes | amplification |
T17205 | 2345-2348 | NN | denotes | PCR |
T17204 | 2340-2344 | NN | denotes | cDNA |
T17203 | 2336-2339 | IN | denotes | for |
T17202 | 2328-2335 | NN | denotes | Primers |
T17201 | 2322-2326 | NN | denotes | cDNA |
T17200 | 2319-2321 | TO | denotes | to |
T17199 | 2307-2318 | VB | denotes | transcribed |
T17198 | 2299-2306 | JJ | denotes | reverse |
T17197 | 2293-2298 | RB | denotes | first |
T17196 | 2289-2292 | VB | denotes | was |
T17195 | 2285-2288 | NN | denotes | RNA |
T17194 | 2279-2283 | NN | denotes | mRNA |
T17193 | 2272-2278 | NN | denotes | globin |
T17192 | 2269-2271 | IN | denotes | of |
T17191 | 2256-2268 | NN | denotes | Quantitation |
T16443 | 2252-2253 | -RRB- | denotes | ) |
T16442 | 2249-2252 | CD | denotes | −18 |
T16441 | 2246-2248 | TO | denotes | to |
T16440 | 2242-2245 | CD | denotes | −63 |
T16439 | 2241-2242 | -LRB- | denotes | ( |
T16438 | 2238-2240 | NN | denotes | 3′ |
T16437 | 2189-2237 | NN | denotes | 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
T16436 | 2187-2188 | -COMMA- | denotes | , |
T16435 | 2180-2187 | NN | denotes | MHB1663 |
T16434 | 2176-2179 | CC | denotes | and |
T16433 | 2174-2175 | -COLON- | denotes | ; |
T16432 | 2173-2174 | -RRB- | denotes | ) |
T16431 | 2170-2173 | CD | denotes | −16 |
T16430 | 2167-2169 | TO | denotes | to |
T16429 | 2163-2166 | CD | denotes | −63 |
T16428 | 2162-2163 | -LRB- | denotes | ( |
T16427 | 2110-2161 | NN | denotes | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ |
T16426 | 2108-2109 | -COMMA- | denotes | , |
T16425 | 2101-2108 | NN | denotes | MHB1662 |
T16424 | 2099-2100 | -COLON- | denotes | ; |
T16423 | 2098-2099 | -RRB- | denotes | ) |
T16422 | 2095-2098 | CD | denotes | −19 |
T16421 | 2092-2094 | TO | denotes | to |
T16420 | 2088-2091 | CD | denotes | −63 |
T16184 | 665-669 | WDT | denotes | that |
T16183 | 659-664 | NN | denotes | sites |
T16182 | 651-658 | NN | denotes | HindIII |
T16181 | 647-650 | CC | denotes | and |
T16180 | 642-646 | NN | denotes | XhoI |
T16179 | 632-641 | VB | denotes | contained |
T16178 | 624-631 | NN | denotes | primers |
T16177 | 620-623 | NN | denotes | PCR |
T16176 | 616-619 | DT | denotes | The |
T16175 | 606-614 | NN | denotes | database |
T16174 | 604-605 | -RRB- | denotes | ) |
T16173 | 599-604 | NN | denotes | Mouse |
T16172 | 596-598 | IN | denotes | of |
T16171 | 585-595 | NN | denotes | Annotation |
T16170 | 574-584 | JJ | denotes | Functional |
T16169 | 573-574 | -LRB- | denotes | ( |
T16168 | 566-572 | NNP | denotes | Fantom |
T16167 | 562-565 | DT | denotes | the |
T16166 | 559-561 | IN | denotes | in |
T16165 | 554-558 | NN | denotes | cDNA |
T16164 | 546-553 | JJ | denotes | longest |
T16163 | 542-545 | DT | denotes | the |
T16162 | 539-541 | IN | denotes | on |
T16161 | 533-538 | VB | denotes | based |
T16160 | 530-532 | VB | denotes | is |
T16159 | 525-529 | NN | denotes | site |
T16158 | 519-524 | NN | denotes | start |
T16157 | 503-518 | JJ | denotes | transcriptional |
T16156 | 499-502 | DT | denotes | The |
T16155 | 493-497 | NN | denotes | site |
T16154 | 487-492 | NN | denotes | start |
T16153 | 473-486 | NN | denotes | transcription |
T16152 | 469-472 | DT | denotes | the |
T16151 | 466-468 | TO | denotes | to |
T16150 | 457-465 | JJ | denotes | relative |
T16149 | 454-456 | VB | denotes | is |
T16148 | 444-453 | NN | denotes | numbering |
T16147 | 433-443 | NN | denotes | Nucleotide |
T16146 | 430-431 | -RRB- | denotes | ] |
T16145 | 428-430 | CD | denotes | 50 |
T16144 | 427-428 | -LRB- | denotes | [ |
T16143 | 422-426 | NN | denotes | site |
T16142 | 418-421 | NN | denotes | cap |
T16141 | 413-417 | NN | denotes | gene |
T16140 | 406-412 | NN | denotes | globin |
T16139 | 404-405 | NN | denotes | ɛ |
T16138 | 400-403 | DT | denotes | the |
T16137 | 397-399 | IN | denotes | of |
T16136 | 388-396 | RB | denotes | upstream |
T16135 | 379-387 | NN | denotes | sequence |
T16134 | 376-378 | IN | denotes | of |
T16133 | 373-375 | NN | denotes | kb |
T16132 | 371-372 | CD | denotes | 2 |
T16131 | 365-370 | IN | denotes | about |
T16130 | 354-364 | VB | denotes | containing |
T16129 | 345-353 | NN | denotes | fragment |
T16128 | 339-344 | NN | denotes | EcoRI |
T16127 | 332-338 | JJ | denotes | 3.7-kb |
T16126 | 330-331 | DT | denotes | a |
T16125 | 323-329 | IN | denotes | within |
T16124 | 315-322 | JJ | denotes | located |
T16123 | 311-314 | VB | denotes | are |
T16122 | 301-310 | NN | denotes | silencing |
T16121 | 296-300 | NN | denotes | gene |
T16120 | 294-295 | NN | denotes | ɛ |
T16119 | 290-293 | IN | denotes | for |
T16118 | 281-289 | VB | denotes | required |
T16117 | 271-280 | NN | denotes | sequences |
T16116 | 267-270 | DT | denotes | all |
T16115 | 262-266 | IN | denotes | that |
T16114 | 256-261 | VB | denotes | shown |
T16113 | 251-255 | VB | denotes | been |
T16112 | 247-250 | VB | denotes | has |
T16111 | 244-246 | PRP | denotes | it |
T16110 | 236-243 | IN | denotes | because |
T16109 | 234-235 | -COMMA- | denotes | , |
T16108 | 230-234 | VB | denotes | used |
T16107 | 226-229 | VB | denotes | was |
T16106 | 224-225 | -RRB- | denotes | ) |
T16105 | 221-224 | NN | denotes | ATG |
T16104 | 220-221 | -LRB- | denotes | ( |
T16103 | 214-219 | NN | denotes | codon |
T16102 | 203-213 | NN | denotes | initiation |
T16101 | 196-202 | NN | denotes | globin |
T16100 | 193-195 | JJ | denotes | ɛy |
T16099 | 189-192 | DT | denotes | the |
T16098 | 186-188 | IN | denotes | of |
T16097 | 177-185 | RB | denotes | upstream |
T16096 | 168-176 | NN | denotes | fragment |
T16095 | 161-167 | JJ | denotes | 2.2-kb |
T16094 | 159-160 | DT | denotes | A |
T16093 | 149-157 | NN | denotes | promoter |
T16092 | 140-148 | JJ | denotes | proximal |
T16091 | 137-139 | JJ | denotes | ɛy |
T16090 | 133-136 | DT | denotes | the |
T16089 | 130-132 | IN | denotes | of |
T16088 | 116-129 | NN | denotes | amplification |
T16087 | 112-115 | NN | denotes | PCR |
T16086 | 109-111 | IN | denotes | by |
T16085 | 99-108 | VB | denotes | generated |
T16084 | 95-98 | VB | denotes | was |
T16083 | 93-94 | -RRB- | denotes | ) |
T16082 | 88-93 | NN | denotes | E-luc |
T16081 | 87-88 | -LRB- | denotes | ( |
T16080 | 79-86 | NN | denotes | plasmid |
T16079 | 70-78 | NN | denotes | reporter |
T16078 | 61-69 | NN | denotes | deletion |
T16077 | 52-60 | NN | denotes | promoter |
T16076 | 49-51 | JJ | denotes | ɛy |
T16075 | 45-48 | DT | denotes | The |
T16074 | 31-43 | NN | denotes | construction |
T16073 | 23-30 | NN | denotes | Plasmid |
T16374 | 1781-1785 | WDT | denotes | that |
T16373 | 1779-1780 | -RRB- | denotes | ) |
T16372 | 1761-1779 | NN | denotes | Sox6-ΔHMG-pcDNA3.1 |
T16371 | 1760-1761 | -LRB- | denotes | ( |
T16370 | 1750-1759 | NN | denotes | construct |
T16369 | 1735-1749 | NN | denotes | overexpression |
T16368 | 1730-1734 | NN | denotes | Sox6 |
T16367 | 1726-1729 | DT | denotes | the |
T16366 | 1723-1725 | IN | denotes | of |
T16365 | 1715-1722 | NN | denotes | version |
T16364 | 1705-1714 | VB | denotes | truncated |
T16363 | 1703-1704 | DT | denotes | A |
T16362 | 1697-1701 | NN | denotes | Sox6 |
T16361 | 1685-1696 | VB | denotes | overexpress |
T16360 | 1682-1684 | TO | denotes | to |
T16359 | 1677-1681 | VB | denotes | used |
T16358 | 1673-1676 | VB | denotes | was |
T16357 | 1671-1672 | -RRB- | denotes | ] |
T16356 | 1669-1671 | CD | denotes | 15 |
T16355 | 1668-1669 | -LRB- | denotes | [ |
T16354 | 1654-1667 | NN | denotes | Sox6-pcDNA3.1 |
T16353 | 1651-1652 | -RRB- | denotes | ) |
T16352 | 1648-1651 | CD | denotes | +20 |
T16351 | 1645-1647 | TO | denotes | to |
T16350 | 1641-1644 | CD | denotes | +45 |
T16349 | 1640-1641 | -LRB- | denotes | ( |
T16348 | 1610-1639 | NN | denotes | 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ |
T16347 | 1608-1609 | -COMMA- | denotes | , |
T16346 | 1601-1608 | NN | denotes | MHB1477 |
T16345 | 1599-1600 | -COLON- | denotes | : |
T16344 | 1595-1599 | NN | denotes | site |
T16343 | 1587-1594 | NN | denotes | HindIII |
T16342 | 1580-1586 | NN | denotes | primer |
T16341 | 1572-1579 | JJ | denotes | reverse |
T16340 | 1568-1571 | DT | denotes | the |
T16339 | 1563-1567 | IN | denotes | with |
T16338 | 1551-1562 | NN | denotes | combination |
T16337 | 1548-1550 | IN | denotes | in |
T16336 | 1543-1547 | VB | denotes | used |
T16335 | 1538-1542 | VB | denotes | were |
T16334 | 1530-1537 | NN | denotes | primers |
T16333 | 1522-1529 | JJ | denotes | forward |
T16332 | 1518-1521 | DT | denotes | All |
T16331 | 1515-1516 | -RRB- | denotes | ) |
T16330 | 1513-1515 | CD | denotes | −9 |
T16329 | 1510-1512 | TO | denotes | to |
T16328 | 1506-1509 | CD | denotes | −37 |
T16327 | 1505-1506 | -LRB- | denotes | ( |
T16326 | 1502-1504 | NN | denotes | 3′ |
T16325 | 1470-1501 | NN | denotes | 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
T16324 | 1468-1469 | -COMMA- | denotes | , |
T16323 | 1461-1468 | NN | denotes | MHB1507 |
T16322 | 1457-1460 | CC | denotes | and |
T16321 | 1455-1456 | -COLON- | denotes | ; |
T16320 | 1454-1455 | -RRB- | denotes | ) |
T16319 | 1451-1454 | CD | denotes | −34 |
T16318 | 1448-1450 | TO | denotes | to |
T16317 | 1444-1447 | CD | denotes | −63 |
T16316 | 1443-1444 | -LRB- | denotes | ( |
T16315 | 1408-1442 | NN | denotes | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ |
T16314 | 1406-1407 | -COMMA- | denotes | , |
T16313 | 1399-1406 | NN | denotes | MHB1532 |
T16312 | 1397-1398 | -COLON- | denotes | ; |
T16311 | 1396-1397 | -RRB- | denotes | ) |
T16310 | 1393-1396 | CD | denotes | −58 |
T16309 | 1390-1392 | TO | denotes | to |
T16308 | 1386-1389 | CD | denotes | −85 |
T16307 | 1385-1386 | -LRB- | denotes | ( |
T16306 | 1352-1384 | NN | denotes | 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ |
T16305 | 1350-1351 | -COMMA- | denotes | , |
T16304 | 1343-1350 | NN | denotes | MHB1506 |
T16303 | 1341-1342 | -COLON- | denotes | ; |
T16302 | 1340-1341 | -RRB- | denotes | ) |
T16301 | 1336-1340 | CD | denotes | −169 |
T16300 | 1333-1335 | TO | denotes | to |
T16299 | 1328-1332 | CD | denotes | −197 |
T16298 | 1327-1328 | -LRB- | denotes | ( |
T16297 | 1294-1326 | NN | denotes | 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ |
T16296 | 1292-1293 | -COMMA- | denotes | , |
T16295 | 1285-1292 | NN | denotes | MHB1505 |
T16294 | 1283-1284 | -COLON- | denotes | ; |
T16293 | 1282-1283 | -RRB- | denotes | ) |
T16292 | 1278-1282 | CD | denotes | −605 |
T16291 | 1275-1277 | TO | denotes | to |
T16290 | 1270-1274 | CD | denotes | −634 |
T16289 | 1269-1270 | -LRB- | denotes | ( |
T16288 | 1234-1268 | NN | denotes | 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ |
T16287 | 1232-1233 | -COMMA- | denotes | , |
T16286 | 1225-1232 | NN | denotes | MHB1503 |
T16285 | 1223-1224 | -COLON- | denotes | ; |
T16284 | 1222-1223 | -RRB- | denotes | ) |
T16283 | 1217-1222 | CD | denotes | −2052 |
T16282 | 1214-1216 | TO | denotes | to |
T16281 | 1208-1213 | CD | denotes | −2077 |
T16280 | 1207-1208 | -LRB- | denotes | ( |
T16279 | 1176-1206 | NN | denotes | 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ |
T16278 | 1174-1175 | -COMMA- | denotes | , |
T16277 | 1167-1174 | NN | denotes | MHB1457 |
T16276 | 1165-1166 | -COLON- | denotes | : |
T16275 | 1158-1165 | VB | denotes | include |
T16274 | 1153-1157 | NN | denotes | site |
T16273 | 1148-1152 | NN | denotes | XhoI |
T16272 | 1145-1147 | DT | denotes | an |
T16271 | 1140-1144 | IN | denotes | with |
T16270 | 1132-1139 | NN | denotes | primers |
T16269 | 1124-1131 | JJ | denotes | Forward |
T16268 | 1113-1122 | RB | denotes | similarly |
T16267 | 1103-1112 | VB | denotes | generated |
T16266 | 1098-1102 | VB | denotes | were |
T16265 | 1089-1097 | NN | denotes | promoter |
T16264 | 1086-1088 | JJ | denotes | ɛy |
T16263 | 1082-1085 | DT | denotes | the |
T16262 | 1079-1081 | IN | denotes | of |
T16261 | 1068-1078 | NN | denotes | constructs |
T16260 | 1059-1067 | NN | denotes | deletion |
T16259 | 1056-1058 | IN | denotes | of |
T16258 | 1049-1055 | NN | denotes | series |
T16257 | 1047-1048 | DT | denotes | A |
T16256 | 1037-1045 | NN | denotes | promoter |
T16255 | 1034-1036 | JJ | denotes | ɛy |
T16254 | 1030-1033 | DT | denotes | the |
T16253 | 1027-1029 | IN | denotes | by |
T16252 | 1020-1026 | VB | denotes | driven |
T16251 | 1017-1019 | VB | denotes | is |
T16250 | 1006-1016 | NN | denotes | expression |
T16249 | 995-1005 | NN | denotes | luciferase |
T16248 | 989-994 | WDT | denotes | which |
T16247 | 986-988 | IN | denotes | in |
T16246 | 976-985 | NN | denotes | construct |
T16245 | 967-975 | NN | denotes | reporter |
T16244 | 965-966 | DT | denotes | a |
T16243 | 962-964 | IN | denotes | in |
T16242 | 952-961 | VB | denotes | resulting |
T16241 | 950-951 | -COMMA- | denotes | , |
T16240 | 943-950 | NN | denotes | plasmid |
T16239 | 937-942 | JJ | denotes | Basic |
T16238 | 932-936 | NN | denotes | pGL3 |
T16237 | 926-931 | JJ | denotes | above |
T16236 | 922-925 | DT | denotes | the |
T16235 | 919-921 | IN | denotes | in |
T16234 | 910-918 | NN | denotes | promoter |
T16233 | 907-909 | JJ | denotes | ɛy |
T16232 | 903-906 | DT | denotes | the |
T16231 | 900-902 | IN | denotes | of |
T16230 | 891-899 | RB | denotes | upstream |
T16229 | 882-890 | VB | denotes | inserted |
T16228 | 877-881 | RB | denotes | then |
T16227 | 873-876 | VB | denotes | was |
T16226 | 871-872 | -RRB- | denotes | ) |
T16225 | 870-871 | -RRB- | denotes | ] |
T16224 | 868-870 | CD | denotes | 31 |
T16223 | 867-868 | -LRB- | denotes | [ |
T16222 | 865-866 | -COLON- | denotes | ; |
T16221 | 862-865 | NN | denotes | LCR |
T16220 | 856-861 | NN | denotes | micro |
T16219 | 855-856 | -LRB- | denotes | ( |
T16218 | 851-854 | CD | denotes | 9.3 |
T16217 | 845-850 | NN | denotes | μLCRβ |
T16216 | 842-844 | IN | denotes | of |
T16215 | 833-841 | NN | denotes | fragment |
T16214 | 823-832 | NN | denotes | SstI/XhoI |
T16213 | 816-822 | JJ | denotes | 2.5-kb |
T16212 | 814-815 | DT | denotes | A |
T16211 | 811-812 | -RRB- | denotes | ) |
T16210 | 805-811 | NNP | denotes | States |
T16209 | 798-804 | NNP | denotes | United |
T16208 | 796-797 | -COMMA- | denotes | , |
T16207 | 787-796 | NNP | denotes | Wisconsin |
T16206 | 785-786 | -COMMA- | denotes | , |
T16205 | 778-785 | NNP | denotes | Madison |
T16204 | 776-777 | -COMMA- | denotes | , |
T16203 | 769-776 | NNP | denotes | Promega |
T16202 | 768-769 | -LRB- | denotes | ( |
T16201 | 762-767 | JJ | denotes | Basic |
T16200 | 757-761 | NN | denotes | pGL3 |
T16199 | 754-756 | IN | denotes | in |
T16198 | 749-753 | NN | denotes | gene |
T16197 | 738-748 | NN | denotes | luciferase |
T16196 | 730-737 | NN | denotes | firefly |
T16195 | 726-729 | DT | denotes | the |
T16194 | 723-725 | IN | denotes | of |
T16193 | 714-722 | RB | denotes | upstream |
T16192 | 705-713 | NN | denotes | fragment |
T16191 | 696-704 | NN | denotes | promoter |
T16190 | 693-695 | JJ | denotes | ɛy |
T16189 | 689-692 | DT | denotes | the |
T16188 | 683-688 | VB | denotes | clone |
T16187 | 680-682 | TO | denotes | to |
T16186 | 675-679 | VB | denotes | used |
T16185 | 670-674 | VB | denotes | were |
T16419 | 2087-2088 | -LRB- | denotes | ( |
T16418 | 2037-2086 | NN | denotes | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ |
T16417 | 2035-2036 | -COMMA- | denotes | , |
T16416 | 2028-2035 | NN | denotes | MHB1661 |
T16415 | 2026-2027 | -COLON- | denotes | : |
T16414 | 2019-2026 | VB | denotes | include |
T16413 | 2008-2018 | NN | denotes | constructs |
T16412 | 1999-2007 | NN | denotes | reporter |
T16411 | 1990-1998 | NN | denotes | promoter |
T16410 | 1987-1989 | NN | denotes | ɛy |
T16409 | 1975-1986 | VB | denotes | mutagenized |
T16408 | 1969-1974 | DT | denotes | these |
T16407 | 1960-1968 | VB | denotes | generate |
T16406 | 1957-1959 | TO | denotes | to |
T16405 | 1952-1956 | VB | denotes | used |
T16404 | 1944-1951 | NN | denotes | primers |
T16403 | 1936-1943 | JJ | denotes | Forward |
T16402 | 1931-1934 | NN | denotes | PCR |
T16401 | 1928-1930 | IN | denotes | by |
T16400 | 1923-1927 | VB | denotes | done |
T16399 | 1918-1922 | VB | denotes | were |
T16398 | 1909-1917 | NN | denotes | promoter |
T16397 | 1906-1908 | JJ | denotes | ɛy |
T16396 | 1902-1905 | DT | denotes | the |
T16395 | 1899-1901 | IN | denotes | of |
T16394 | 1893-1898 | NN | denotes | sites |
T16393 | 1885-1892 | NN | denotes | binding |
T16392 | 1875-1884 | NN | denotes | consensus |
T16391 | 1866-1874 | NN | denotes | Sox/Sox6 |
T16390 | 1863-1865 | IN | denotes | of |
T16389 | 1851-1862 | NN | denotes | Mutagenesis |
T16388 | 1848-1849 | -RRB- | denotes | ] |
T16387 | 1846-1848 | CD | denotes | 32 |
T16386 | 1845-1846 | -LRB- | denotes | [ |
T16385 | 1838-1844 | NN | denotes | others |
T16384 | 1835-1837 | IN | denotes | by |
T16383 | 1825-1834 | VB | denotes | described |
T16382 | 1822-1824 | IN | denotes | as |
T16381 | 1820-1821 | -COMMA- | denotes | , |
T16380 | 1811-1820 | VB | denotes | generated |
T16379 | 1807-1810 | VB | denotes | was |
T16378 | 1800-1806 | NN | denotes | domain |
T16377 | 1796-1799 | NN | denotes | HMG |
T16376 | 1792-1795 | DT | denotes | the |
T16375 | 1786-1791 | VB | denotes | lacks |
T19875 | 8522-8526 | VB | denotes | used |
T19200 | 6872-6881 | VB | denotes | described |
R11081 | T16074 | T16073 | arg1Of | construction,Plasmid |
R11082 | T16080 | T16075 | arg1Of | plasmid,The |
R11083 | T16080 | T16076 | arg1Of | plasmid,ɛy |
R11084 | T16080 | T16077 | arg1Of | plasmid,promoter |
R11085 | T16080 | T16078 | arg1Of | plasmid,deletion |
R11086 | T16080 | T16079 | arg1Of | plasmid,reporter |
R11087 | T16080 | T16081 | arg1Of | plasmid,( |
R11088 | T16080 | T16084 | arg1Of | plasmid,was |
R11089 | T16080 | T16085 | arg2Of | plasmid,generated |
R11090 | T16082 | T16081 | arg2Of | E-luc,( |
R11091 | T16083 | T16081 | arg3Of | ),( |
R11092 | T16085 | T16084 | arg2Of | generated,was |
R11093 | T16088 | T16085 | arg1Of | amplification,generated |
R11094 | T16088 | T16086 | arg2Of | amplification,by |
R11095 | T16088 | T16087 | arg1Of | amplification,PCR |
R11096 | T16088 | T16089 | arg1Of | amplification,of |
R11097 | T16093 | T16089 | arg2Of | promoter,of |
R11098 | T16093 | T16090 | arg1Of | promoter,the |
R11099 | T16093 | T16091 | arg1Of | promoter,ɛy |
R11100 | T16093 | T16092 | arg1Of | promoter,proximal |
R11101 | T16096 | T16094 | arg1Of | fragment,A |
R11102 | T16096 | T16095 | arg1Of | fragment,2.2-kb |
R11103 | T16096 | T16097 | arg1Of | fragment,upstream |
R11104 | T16096 | T16107 | arg1Of | fragment,was |
R11105 | T16096 | T16108 | arg2Of | fragment,used |
R11106 | T16097 | T16098 | arg1Of | upstream,of |
R11107 | T16103 | T16098 | arg2Of | codon,of |
R11108 | T16103 | T16099 | arg1Of | codon,the |
R11109 | T16103 | T16100 | arg1Of | codon,ɛy |
R11110 | T16103 | T16101 | arg1Of | codon,globin |
R11111 | T16103 | T16102 | arg1Of | codon,initiation |
R11112 | T16103 | T16104 | arg1Of | codon,( |
R11113 | T16105 | T16104 | arg2Of | ATG,( |
R11114 | T16106 | T16104 | arg3Of | ),( |
R11115 | T16108 | T16107 | arg2Of | used,was |
R11116 | T16108 | T16109 | arg1Of | used,"," |
R11117 | T16108 | T16110 | arg1Of | used,because |
R11118 | T16111 | T16112 | arg1Of | it,has |
R11119 | T16111 | T16113 | arg1Of | it,been |
R11120 | T16111 | T16114 | arg2Of | it,shown |
R11121 | T16114 | T16110 | arg2Of | shown,because |
R11122 | T16114 | T16112 | arg2Of | shown,has |
R11123 | T16114 | T16113 | arg2Of | shown,been |
R11124 | T16117 | T16116 | arg1Of | sequences,all |
R11125 | T16117 | T16118 | arg2Of | sequences,required |
R11126 | T16117 | T16123 | arg1Of | sequences,are |
R11127 | T16117 | T16124 | arg1Of | sequences,located |
R11128 | T16118 | T16119 | arg1Of | required,for |
R11129 | T16122 | T16119 | arg2Of | silencing,for |
R11130 | T16122 | T16120 | arg1Of | silencing,ɛ |
R11131 | T16122 | T16121 | arg1Of | silencing,gene |
R11132 | T16123 | T16114 | arg3Of | are,shown |
R11133 | T16123 | T16115 | arg1Of | are,that |
R11134 | T16124 | T16123 | arg2Of | located,are |
R11135 | T16124 | T16125 | arg1Of | located,within |
R11136 | T16129 | T16125 | arg2Of | fragment,within |
R11137 | T16129 | T16126 | arg1Of | fragment,a |
R11138 | T16129 | T16127 | arg1Of | fragment,3.7-kb |
R11139 | T16129 | T16128 | arg1Of | fragment,EcoRI |
R11140 | T16129 | T16130 | arg1Of | fragment,containing |
R11141 | T16130 | T16144 | arg1Of | containing,[ |
R11142 | T16132 | T16131 | arg1Of | 2,about |
R11143 | T16133 | T16130 | arg2Of | kb,containing |
R11144 | T16133 | T16132 | arg1Of | kb,2 |
R11145 | T16133 | T16134 | arg1Of | kb,of |
R11146 | T16133 | T16136 | arg1Of | kb,upstream |
R11147 | T16135 | T16134 | arg2Of | sequence,of |
R11148 | T16136 | T16137 | arg1Of | upstream,of |
R11149 | T16143 | T16137 | arg2Of | site,of |
R11150 | T16143 | T16138 | arg1Of | site,the |
R11151 | T16143 | T16139 | arg1Of | site,ɛ |
R11152 | T16143 | T16140 | arg1Of | site,globin |
R11153 | T16143 | T16141 | arg1Of | site,gene |
R11154 | T16143 | T16142 | arg1Of | site,cap |
R11155 | T16145 | T16144 | arg2Of | 50,[ |
R11156 | T16146 | T16144 | arg3Of | ],[ |
R11157 | T16148 | T16147 | arg1Of | numbering,Nucleotide |
R11158 | T16148 | T16149 | arg1Of | numbering,is |
R11159 | T16148 | T16150 | arg1Of | numbering,relative |
R11160 | T16150 | T16149 | arg2Of | relative,is |
R11161 | T16150 | T16151 | arg1Of | relative,to |
R11162 | T16155 | T16151 | arg2Of | site,to |
R11163 | T16155 | T16152 | arg1Of | site,the |
R11164 | T16155 | T16153 | arg1Of | site,transcription |
R11165 | T16155 | T16154 | arg1Of | site,start |
R11166 | T16159 | T16156 | arg1Of | site,The |
R11167 | T16159 | T16157 | arg1Of | site,transcriptional |
R11168 | T16159 | T16158 | arg1Of | site,start |
R11169 | T16159 | T16160 | arg1Of | site,is |
R11170 | T16159 | T16161 | arg2Of | site,based |
R11171 | T16161 | T16160 | arg2Of | based,is |
R11172 | T16161 | T16162 | arg1Of | based,on |
R11173 | T16165 | T16162 | arg2Of | cDNA,on |
R11174 | T16165 | T16163 | arg1Of | cDNA,the |
R11175 | T16165 | T16164 | arg1Of | cDNA,longest |
R11176 | T16165 | T16166 | arg1Of | cDNA,in |
R11177 | T16168 | T16169 | arg1Of | Fantom,( |
R11178 | T16171 | T16169 | arg2Of | Annotation,( |
R11179 | T16171 | T16170 | arg1Of | Annotation,Functional |
R11180 | T16171 | T16172 | arg1Of | Annotation,of |
R11181 | T16173 | T16172 | arg2Of | Mouse,of |
R11182 | T16174 | T16169 | arg3Of | ),( |
R11183 | T16175 | T16166 | arg2Of | database,in |
R11184 | T16175 | T16167 | arg1Of | database,the |
R11185 | T16175 | T16168 | arg1Of | database,Fantom |
R11186 | T16178 | T16176 | arg1Of | primers,The |
R11187 | T16178 | T16177 | arg1Of | primers,PCR |
R11188 | T16178 | T16179 | arg1Of | primers,contained |
R11189 | T16180 | T16181 | arg1Of | XhoI,and |
R11190 | T16182 | T16181 | arg2Of | HindIII,and |
R11191 | T16183 | T16179 | arg2Of | sites,contained |
R11192 | T16183 | T16180 | arg1Of | sites,XhoI |
R11193 | T16183 | T16182 | arg1Of | sites,HindIII |
R11194 | T16183 | T16184 | arg1Of | sites,that |
R11195 | T16183 | T16185 | arg1Of | sites,were |
R11196 | T16183 | T16186 | arg2Of | sites,used |
R11197 | T16186 | T16185 | arg2Of | used,were |
R11198 | T16188 | T16186 | arg3Of | clone,used |
R11199 | T16188 | T16187 | arg1Of | clone,to |
R11200 | T16188 | T16193 | arg1Of | clone,upstream |
R11201 | T16192 | T16188 | arg2Of | fragment,clone |
R11202 | T16192 | T16189 | arg1Of | fragment,the |
R11203 | T16192 | T16190 | arg1Of | fragment,ɛy |
R11204 | T16192 | T16191 | arg1Of | fragment,promoter |
R11205 | T16193 | T16194 | arg1Of | upstream,of |
R11206 | T16198 | T16194 | arg2Of | gene,of |
R11207 | T16198 | T16195 | arg1Of | gene,the |
R11208 | T16198 | T16196 | arg1Of | gene,firefly |
R11209 | T16198 | T16197 | arg1Of | gene,luciferase |
R11210 | T16198 | T16199 | arg1Of | gene,in |
R11211 | T16201 | T16200 | arg1Of | Basic,pGL3 |
R11212 | T16203 | T16204 | arg1Of | Promega,"," |
R11213 | T16204 | T16206 | arg1Of | ",","," |
R11214 | T16205 | T16204 | arg2Of | Madison,"," |
R11215 | T16206 | T16208 | arg1Of | ",","," |
R11216 | T16207 | T16206 | arg2Of | Wisconsin,"," |
R11217 | T16208 | T16199 | arg2Of | ",",in |
R11218 | T16208 | T16201 | arg1Of | ",",Basic |
R11219 | T16208 | T16202 | arg2Of | ",",( |
R11220 | T16210 | T16208 | arg2Of | States,"," |
R11221 | T16210 | T16209 | arg1Of | States,United |
R11222 | T16211 | T16202 | arg3Of | ),( |
R11223 | T16215 | T16212 | arg1Of | fragment,A |
R11224 | T16215 | T16213 | arg1Of | fragment,2.5-kb |
R11225 | T16215 | T16214 | arg1Of | fragment,SstI/XhoI |
R11226 | T16215 | T16216 | arg1Of | fragment,of |
R11227 | T16215 | T16219 | arg1Of | fragment,( |
R11228 | T16215 | T16227 | arg1Of | fragment,was |
R11229 | T16215 | T16229 | arg2Of | fragment,inserted |
R11230 | T16217 | T16216 | arg2Of | μLCRβ,of |
R11231 | T16217 | T16218 | arg1Of | μLCRβ,9.3 |
R11232 | T16221 | T16220 | arg1Of | LCR,micro |
R11233 | T16221 | T16222 | arg1Of | LCR,; |
R11234 | T16222 | T16219 | arg2Of | ;,( |
R11235 | T16224 | T16222 | arg2Of | 31,; |
R11236 | T16224 | T16223 | arg2Of | 31,[ |
R11237 | T16225 | T16223 | arg3Of | ],[ |
R11238 | T16226 | T16219 | arg3Of | ),( |
R11239 | T16229 | T16227 | arg2Of | inserted,was |
R11240 | T16229 | T16228 | arg1Of | inserted,then |
R11241 | T16229 | T16230 | arg1Of | inserted,upstream |
R11242 | T16229 | T16235 | arg1Of | inserted,in |
R11243 | T16229 | T16241 | arg1Of | inserted,"," |
R11244 | T16229 | T16242 | modOf | inserted,resulting |
R11245 | T16230 | T16231 | arg1Of | upstream,of |
R11246 | T16234 | T16231 | arg2Of | promoter,of |
R11247 | T16234 | T16232 | arg1Of | promoter,the |
R11248 | T16234 | T16233 | arg1Of | promoter,ɛy |
R11249 | T16239 | T16238 | arg1Of | Basic,pGL3 |
R11250 | T16240 | T16235 | arg2Of | plasmid,in |
R11251 | T16240 | T16236 | arg1Of | plasmid,the |
R11252 | T16240 | T16237 | arg1Of | plasmid,above |
R11253 | T16240 | T16239 | arg1Of | plasmid,Basic |
R11254 | T16242 | T16243 | arg1Of | resulting,in |
R11255 | T16246 | T16243 | arg2Of | construct,in |
R11256 | T16246 | T16244 | arg1Of | construct,a |
R11257 | T16246 | T16245 | arg1Of | construct,reporter |
R11258 | T16246 | T16247 | arg2Of | construct,in |
R11259 | T16246 | T16248 | arg1Of | construct,which |
R11260 | T16250 | T16249 | arg1Of | expression,luciferase |
R11261 | T16250 | T16251 | arg1Of | expression,is |
R11262 | T16250 | T16252 | arg2Of | expression,driven |
R11263 | T16252 | T16247 | arg1Of | driven,in |
R11264 | T16252 | T16251 | arg2Of | driven,is |
R11265 | T16256 | T16252 | arg1Of | promoter,driven |
R11266 | T16256 | T16253 | arg2Of | promoter,by |
R11267 | T16256 | T16254 | arg1Of | promoter,the |
R11268 | T16256 | T16255 | arg1Of | promoter,ɛy |
R11269 | T16258 | T16257 | arg1Of | series,A |
R11270 | T16258 | T16259 | arg1Of | series,of |
R11271 | T16258 | T16266 | arg1Of | series,were |
R11272 | T16258 | T16267 | arg2Of | series,generated |
R11273 | T16261 | T16259 | arg2Of | constructs,of |
R11274 | T16261 | T16260 | arg1Of | constructs,deletion |
R11275 | T16261 | T16262 | arg1Of | constructs,of |
R11276 | T16265 | T16262 | arg2Of | promoter,of |
R11277 | T16265 | T16263 | arg1Of | promoter,the |
R11278 | T16265 | T16264 | arg1Of | promoter,ɛy |
R11279 | T16267 | T16266 | arg2Of | generated,were |
R11280 | T16267 | T16268 | arg1Of | generated,similarly |
R11281 | T16270 | T16269 | arg1Of | primers,Forward |
R11282 | T16270 | T16271 | arg1Of | primers,with |
R11283 | T16270 | T16275 | arg1Of | primers,include |
R11284 | T16274 | T16271 | arg2Of | site,with |
R11285 | T16274 | T16272 | arg1Of | site,an |
R11286 | T16274 | T16273 | arg1Of | site,XhoI |
R11287 | T16275 | T16276 | arg1Of | include,: |
R11288 | T16277 | T16275 | arg2Of | MHB1457,include |
R11289 | T16277 | T16278 | arg1Of | MHB1457,"," |
R11290 | T16277 | T16285 | arg1Of | MHB1457,; |
R11291 | T16279 | T16278 | arg2Of | 5′CCGCTCGAGTGCTAGGCAAACACTCA3′,"," |
R11292 | T16279 | T16280 | arg1Of | 5′CCGCTCGAGTGCTAGGCAAACACTCA3′,( |
R11293 | T16283 | T16280 | arg2Of | −2052,( |
R11294 | T16283 | T16281 | arg1Of | −2052,−2077 |
R11295 | T16283 | T16282 | arg1Of | −2052,to |
R11296 | T16284 | T16280 | arg3Of | ),( |
R11297 | T16286 | T16285 | arg2Of | MHB1503,; |
R11298 | T16286 | T16287 | arg1Of | MHB1503,"," |
R11299 | T16286 | T16294 | arg1Of | MHB1503,; |
R11300 | T16288 | T16287 | arg2Of | 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′,"," |
R11301 | T16288 | T16289 | arg1Of | 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′,( |
R11302 | T16292 | T16289 | arg2Of | −605,( |
R11303 | T16292 | T16290 | arg1Of | −605,−634 |
R11304 | T16292 | T16291 | arg1Of | −605,to |
R11305 | T16293 | T16289 | arg3Of | ),( |
R11306 | T16295 | T16294 | arg2Of | MHB1505,; |
R11307 | T16295 | T16296 | arg1Of | MHB1505,"," |
R11308 | T16295 | T16303 | arg1Of | MHB1505,; |
R11309 | T16297 | T16296 | arg2Of | 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′,"," |
R11310 | T16297 | T16298 | arg1Of | 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′,( |
R11311 | T16301 | T16298 | arg2Of | −169,( |
R11312 | T16301 | T16299 | arg1Of | −169,−197 |
R11313 | T16301 | T16300 | arg1Of | −169,to |
R11314 | T16302 | T16298 | arg3Of | ),( |
R11315 | T16304 | T16303 | arg2Of | MHB1506,; |
R11316 | T16304 | T16305 | arg1Of | MHB1506,"," |
R11317 | T16304 | T16312 | arg1Of | MHB1506,; |
R11318 | T16306 | T16305 | arg2Of | 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′,"," |
R11319 | T16306 | T16307 | arg1Of | 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′,( |
R11320 | T16310 | T16307 | arg2Of | −58,( |
R11321 | T16310 | T16308 | arg1Of | −58,−85 |
R11322 | T16310 | T16309 | arg1Of | −58,to |
R11323 | T16311 | T16307 | arg3Of | ),( |
R11324 | T16313 | T16314 | arg1Of | MHB1532,"," |
R11325 | T16313 | T16322 | arg1Of | MHB1532,and |
R11326 | T16315 | T16314 | arg2Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′,"," |
R11327 | T16315 | T16316 | arg1Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′,( |
R11328 | T16319 | T16316 | arg2Of | −34,( |
R11329 | T16319 | T16317 | arg1Of | −34,−63 |
R11330 | T16319 | T16318 | arg1Of | −34,to |
R11331 | T16320 | T16316 | arg3Of | ),( |
R11332 | T16322 | T16312 | arg2Of | and,; |
R11333 | T16322 | T16321 | arg1Of | and,; |
R11334 | T16323 | T16322 | arg2Of | MHB1507,and |
R11335 | T16323 | T16324 | arg1Of | MHB1507,"," |
R11336 | T16326 | T16324 | arg2Of | 3′,"," |
R11337 | T16326 | T16325 | arg1Of | 3′,5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
R11338 | T16326 | T16327 | arg1Of | 3′,( |
R11339 | T16330 | T16327 | arg2Of | −9,( |
R11340 | T16330 | T16328 | arg1Of | −9,−37 |
R11341 | T16330 | T16329 | arg1Of | −9,to |
R11342 | T16331 | T16327 | arg3Of | ),( |
R11343 | T16334 | T16332 | arg1Of | primers,All |
R11344 | T16334 | T16333 | arg1Of | primers,forward |
R11345 | T16334 | T16335 | arg1Of | primers,were |
R11346 | T16334 | T16336 | arg2Of | primers,used |
R11347 | T16336 | T16335 | arg2Of | used,were |
R11348 | T16336 | T16337 | arg1Of | used,in |
R11349 | T16336 | T16345 | arg1Of | used,: |
R11350 | T16336 | T16346 | arg1Of | used,MHB1477 |
R11351 | T16338 | T16337 | arg2Of | combination,in |
R11352 | T16338 | T16339 | arg1Of | combination,with |
R11353 | T16344 | T16339 | arg2Of | site,with |
R11354 | T16344 | T16340 | arg1Of | site,the |
R11355 | T16344 | T16341 | arg1Of | site,reverse |
R11356 | T16344 | T16342 | arg1Of | site,primer |
R11357 | T16344 | T16343 | arg1Of | site,HindIII |
R11358 | T16346 | T16347 | arg1Of | MHB1477,"," |
R11359 | T16348 | T16347 | arg2Of | 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′,"," |
R11360 | T16348 | T16349 | arg1Of | 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′,( |
R11361 | T16352 | T16349 | arg2Of | +20,( |
R11362 | T16352 | T16350 | arg1Of | +20,+45 |
R11363 | T16352 | T16351 | arg1Of | +20,to |
R11364 | T16353 | T16349 | arg3Of | ),( |
R11365 | T16354 | T16355 | arg1Of | Sox6-pcDNA3.1,[ |
R11366 | T16354 | T16358 | arg1Of | Sox6-pcDNA3.1,was |
R11367 | T16354 | T16359 | arg2Of | Sox6-pcDNA3.1,used |
R11368 | T16354 | T16361 | arg1Of | Sox6-pcDNA3.1,overexpress |
R11369 | T16356 | T16355 | arg2Of | 15,[ |
R11370 | T16357 | T16355 | arg3Of | ],[ |
R11371 | T16359 | T16358 | arg2Of | used,was |
R11372 | T16361 | T16359 | arg3Of | overexpress,used |
R11373 | T16361 | T16360 | arg1Of | overexpress,to |
R11374 | T16362 | T16361 | arg2Of | Sox6,overexpress |
R11375 | T16365 | T16363 | arg1Of | version,A |
R11376 | T16365 | T16364 | arg2Of | version,truncated |
R11377 | T16365 | T16366 | arg1Of | version,of |
R11378 | T16365 | T16379 | arg1Of | version,was |
R11379 | T16365 | T16380 | arg2Of | version,generated |
R11380 | T16370 | T16366 | arg2Of | construct,of |
R11381 | T16370 | T16367 | arg1Of | construct,the |
R11382 | T16370 | T16368 | arg1Of | construct,Sox6 |
R11383 | T16370 | T16369 | arg1Of | construct,overexpression |
R11384 | T16370 | T16371 | arg1Of | construct,( |
R11385 | T16370 | T16374 | arg1Of | construct,that |
R11386 | T16370 | T16375 | arg1Of | construct,lacks |
R11387 | T16372 | T16371 | arg2Of | Sox6-ΔHMG-pcDNA3.1,( |
R11388 | T16373 | T16371 | arg3Of | ),( |
R11389 | T16378 | T16375 | arg2Of | domain,lacks |
R11390 | T16378 | T16376 | arg1Of | domain,the |
R11391 | T16378 | T16377 | arg1Of | domain,HMG |
R11392 | T16380 | T16379 | arg2Of | generated,was |
R11393 | T16380 | T16381 | arg1Of | generated,"," |
R11394 | T16380 | T16382 | arg1Of | generated,as |
R11395 | T16383 | T16382 | arg2Of | described,as |
R11396 | T16385 | T16383 | arg1Of | others,described |
R11397 | T16385 | T16384 | arg2Of | others,by |
R11398 | T16385 | T16386 | arg1Of | others,[ |
R11399 | T16387 | T16386 | arg2Of | 32,[ |
R11400 | T16388 | T16386 | arg3Of | ],[ |
R11401 | T16389 | T16390 | arg1Of | Mutagenesis,of |
R11402 | T16389 | T16399 | arg1Of | Mutagenesis,were |
R11403 | T16389 | T16400 | arg2Of | Mutagenesis,done |
R11404 | T16394 | T16390 | arg2Of | sites,of |
R11405 | T16394 | T16391 | arg1Of | sites,Sox/Sox6 |
R11406 | T16394 | T16392 | arg1Of | sites,consensus |
R11407 | T16394 | T16393 | arg1Of | sites,binding |
R11408 | T16394 | T16395 | arg1Of | sites,of |
R11409 | T16398 | T16395 | arg2Of | promoter,of |
R11410 | T16398 | T16396 | arg1Of | promoter,the |
R11411 | T16398 | T16397 | arg1Of | promoter,ɛy |
R11412 | T16400 | T16399 | arg2Of | done,were |
R11413 | T16402 | T16400 | arg1Of | PCR,done |
R11414 | T16402 | T16401 | arg2Of | PCR,by |
R11415 | T16404 | T16403 | arg1Of | primers,Forward |
R11416 | T16404 | T16405 | arg2Of | primers,used |
R11417 | T16404 | T16414 | arg1Of | primers,include |
R11418 | T16407 | T16405 | arg3Of | generate,used |
R11419 | T16407 | T16406 | arg1Of | generate,to |
R11420 | T16413 | T16407 | arg2Of | constructs,generate |
R11421 | T16413 | T16408 | arg1Of | constructs,these |
R11422 | T16413 | T16409 | arg2Of | constructs,mutagenized |
R11423 | T16413 | T16410 | arg1Of | constructs,ɛy |
R11424 | T16413 | T16411 | arg1Of | constructs,promoter |
R11425 | T16413 | T16412 | arg1Of | constructs,reporter |
R11426 | T16414 | T16415 | arg1Of | include,: |
R11427 | T16416 | T16414 | arg2Of | MHB1661,include |
R11428 | T16416 | T16417 | arg1Of | MHB1661,"," |
R11429 | T16416 | T16424 | arg1Of | MHB1661,; |
R11430 | T16418 | T16417 | arg2Of | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,"," |
R11431 | T16418 | T16419 | arg1Of | 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′,( |
R11432 | T16422 | T16419 | arg2Of | −19,( |
R11433 | T16422 | T16420 | arg1Of | −19,−63 |
R11434 | T16422 | T16421 | arg1Of | −19,to |
R11435 | T16423 | T16419 | arg3Of | ),( |
R11436 | T16425 | T16426 | arg1Of | MHB1662,"," |
R11437 | T16425 | T16434 | arg1Of | MHB1662,and |
R11438 | T16427 | T16426 | arg2Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,"," |
R11439 | T16427 | T16428 | arg1Of | 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′,( |
R11440 | T16431 | T16428 | arg2Of | −16,( |
R11441 | T16431 | T16429 | arg1Of | −16,−63 |
R11442 | T16431 | T16430 | arg1Of | −16,to |
R11443 | T16432 | T16428 | arg3Of | ),( |
R11444 | T16434 | T16424 | arg2Of | and,; |
R11445 | T16434 | T16433 | arg1Of | and,; |
R11446 | T16435 | T16434 | arg2Of | MHB1663,and |
R11447 | T16435 | T16436 | arg1Of | MHB1663,"," |
R11448 | T16438 | T16436 | arg2Of | 3′,"," |
R11449 | T16438 | T16437 | arg1Of | 3′,5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11450 | T16438 | T16439 | arg1Of | 3′,( |
R11451 | T16442 | T16439 | arg2Of | −18,( |
R11452 | T16442 | T16440 | arg1Of | −18,−63 |
R11453 | T16442 | T16441 | arg1Of | −18,to |
R11454 | T16443 | T16439 | arg3Of | ),( |
R11937 | T17191 | T17192 | arg1Of | Quantitation,of |
R11938 | T17194 | T17192 | arg2Of | mRNA,of |
R11939 | T17194 | T17193 | arg1Of | mRNA,globin |
R11940 | T17195 | T17196 | arg1Of | RNA,was |
R11941 | T17198 | T17197 | arg1Of | reverse,first |
R11942 | T17201 | T17196 | arg2Of | cDNA,was |
R11943 | T17201 | T17198 | arg1Of | cDNA,reverse |
R11944 | T17201 | T17199 | arg2Of | cDNA,transcribed |
R11945 | T17201 | T17200 | arg1Of | cDNA,to |
R11946 | T17202 | T17203 | arg1Of | Primers,for |
R11947 | T17202 | T17210 | arg1Of | Primers,were |
R11948 | T17202 | T17211 | arg2Of | Primers,obtained |
R11949 | T17206 | T17203 | arg2Of | amplification,for |
R11950 | T17206 | T17204 | arg1Of | amplification,cDNA |
R11951 | T17206 | T17205 | arg1Of | amplification,PCR |
R11952 | T17206 | T17207 | arg1Of | amplification,of |
R11953 | T17209 | T17207 | arg2Of | genes,of |
R11954 | T17209 | T17208 | arg1Of | genes,globin |
R11955 | T17211 | T17210 | arg2Of | obtained,were |
R11956 | T17211 | T17212 | arg1Of | obtained,from |
R11957 | T17213 | T17212 | arg2Of | Primerbank,from |
R11958 | T17213 | T17214 | arg1Of | Primerbank,[ |
R11959 | T17215 | T17214 | arg2Of | 51,[ |
R11960 | T17216 | T17214 | arg3Of | ],[ |
R11961 | T17218 | T17217 | arg1Of | primers,All |
R11962 | T17218 | T17219 | arg1Of | primers,were |
R11963 | T17218 | T17220 | arg2Of | primers,searched |
R11964 | T17220 | T17219 | arg2Of | searched,were |
R11965 | T17220 | T17221 | arg1Of | searched,against |
R11966 | T17220 | T17225 | modOf | searched,to |
R11967 | T17224 | T17221 | arg2Of | database,against |
R11968 | T17224 | T17222 | arg1Of | database,the |
R11969 | T17224 | T17223 | arg1Of | database,NCBI |
R11970 | T17226 | T17225 | arg1Of | confirm,to |
R11971 | T17227 | T17226 | arg2Of | specificity,confirm |
R11972 | T17230 | T17228 | arg1Of | globin,For |
R11973 | T17230 | T17229 | arg1Of | globin,ɛy |
R11974 | T17230 | T17231 | arg1Of | globin,: |
R11975 | T17232 | T17231 | arg2Of | MHB1666,: |
R11976 | T17232 | T17233 | arg1Of | MHB1666,"," |
R11977 | T17232 | T17238 | arg1Of | MHB1666,"," |
R11978 | T17234 | T17236 | arg1Of | 5′TGGCCTGTGGAGTAAGGTCAA3′,and |
R11979 | T17236 | T17233 | arg2Of | and,"," |
R11980 | T17236 | T17235 | arg1Of | and,; |
R11981 | T17237 | T17236 | arg2Of | MHB1667,and |
R11982 | T17239 | T17238 | arg2Of | 5′GAAGCAGAGGACAAGTTCCCA3′,"," |
R11983 | T17242 | T17240 | arg1Of | globin,For |
R11984 | T17242 | T17241 | arg1Of | globin,ζ |
R11985 | T17242 | T17243 | arg1Of | globin,: |
R11986 | T17244 | T17243 | arg2Of | MHB1668,: |
R11987 | T17244 | T17245 | arg1Of | MHB1668,"," |
R11988 | T17244 | T17250 | arg1Of | MHB1668,"," |
R11989 | T17246 | T17248 | arg1Of | 5′CTACCCCCAGACGAAGACCTA3′,and |
R11990 | T17248 | T17245 | arg2Of | and,"," |
R11991 | T17248 | T17247 | arg1Of | and,; |
R11992 | T17249 | T17248 | arg2Of | MHB1669,and |
R11993 | T17251 | T17250 | arg2Of | 5′CTTAACCGCATCCCCTACGG3′,"," |
R11994 | T17254 | T17252 | arg1Of | globin,For |
R11995 | T17254 | T17253 | arg1Of | globin,βH1 |
R11996 | T17254 | T17255 | arg1Of | globin,: |
R11997 | T17256 | T17255 | arg2Of | MHB1672,: |
R11998 | T17256 | T17257 | arg1Of | MHB1672,"," |
R11999 | T17256 | T17262 | arg1Of | MHB1672,"," |
R12000 | T17258 | T17260 | arg1Of | 5′TGGACAACCTCAAGGAGACC3′,and |
R12001 | T17260 | T17257 | arg2Of | and,"," |
R12002 | T17260 | T17259 | arg1Of | and,; |
R12003 | T17261 | T17260 | arg2Of | MHB1673,and |
R12004 | T17263 | T17262 | arg2Of | 5′ACCTCTGGGGTGAATTCCTT3′,"," |
R12005 | T17266 | T17265 | arg1Of | globin,βmaj/min |
R12006 | T17266 | T17267 | arg1Of | globin,: |
R12007 | T17267 | T17264 | arg1Of | :,For |
R12008 | T17267 | T17269 | arg1Of | :,: |
R12009 | T17268 | T17267 | arg2Of | MHB1674,: |
R12010 | T17270 | T17272 | arg1Of | 5′ATGGCCTGAATCACTTGGAC3′,and |
R12011 | T17272 | T17271 | arg1Of | and,; |
R12012 | T17273 | T17272 | arg2Of | MHB1675,and |
R12013 | T17273 | T17274 | arg1Of | MHB1675,"," |
R12014 | T17275 | T17274 | arg2Of | 5′ACGATCATATTGCCCAGGAG3′,"," |
R12015 | T17276 | T17284 | arg1Of | Using,( |
R12016 | T17281 | T17276 | arg2Of | kit,Using |
R12017 | T17281 | T17277 | arg1Of | kit,the |
R12018 | T17281 | T17278 | arg1Of | kit,SYBR |
R12019 | T17281 | T17279 | arg1Of | kit,green |
R12020 | T17281 | T17280 | arg1Of | kit,supermix |
R12021 | T17281 | T17282 | arg1Of | kit,with |
R12022 | T17283 | T17282 | arg2Of | ROX,with |
R12023 | T17285 | T17286 | arg1Of | Bio-Rad,"," |
R12024 | T17286 | T17288 | arg1Of | ",","," |
R12025 | T17287 | T17286 | arg2Of | Hercules,"," |
R12026 | T17288 | T17290 | arg1Of | ",","," |
R12027 | T17289 | T17288 | arg2Of | California,"," |
R12028 | T17290 | T17284 | arg2Of | ",",( |
R12029 | T17292 | T17290 | arg2Of | States,"," |
R12030 | T17292 | T17291 | arg1Of | States,United |
R12031 | T17293 | T17284 | arg3Of | ),( |
R12032 | T17296 | T17295 | arg1Of | amplification,PCR |
R12033 | T17296 | T17297 | arg1Of | amplification,was |
R12034 | T17296 | T17298 | arg2Of | amplification,run |
R12035 | T17298 | T17276 | modOf | run,Using |
R12036 | T17298 | T17294 | arg1Of | run,"," |
R12037 | T17298 | T17297 | arg2Of | run,was |
R12038 | T17298 | T17299 | arg1Of | run,on |
R12039 | T17301 | T17299 | arg2Of | ABI7000,on |
R12040 | T17301 | T17300 | arg1Of | ABI7000,an |
R12041 | T17301 | T17302 | arg1Of | ABI7000,( |
R12042 | T17301 | T17314 | arg1Of | ABI7000,at |
R12043 | T17304 | T17303 | arg1Of | Biosystems,Applied |
R12044 | T17304 | T17305 | arg1Of | Biosystems,"," |
R12045 | T17305 | T17308 | arg1Of | ",","," |
R12046 | T17307 | T17305 | arg2Of | City,"," |
R12047 | T17307 | T17306 | arg1Of | City,Foster |
R12048 | T17308 | T17310 | arg1Of | ",","," |
R12049 | T17309 | T17308 | arg2Of | California,"," |
R12050 | T17310 | T17302 | arg2Of | ",",( |
R12051 | T17312 | T17310 | arg2Of | States,"," |
R12052 | T17312 | T17311 | arg1Of | States,United |
R12053 | T17313 | T17302 | arg3Of | ),( |
R12054 | T17316 | T17317 | arg1Of | University,of |
R12055 | T17318 | T17317 | arg2Of | Arizona,of |
R12056 | T17320 | T17314 | arg2Of | facility,at |
R12057 | T17320 | T17315 | arg1Of | facility,the |
R12058 | T17320 | T17316 | arg1Of | facility,University |
R12059 | T17320 | T17319 | arg1Of | facility,core |
R12060 | T17322 | T17321 | arg1Of | PCR,All |
R12061 | T17322 | T17323 | arg1Of | PCR,was |
R12062 | T17322 | T17324 | arg2Of | PCR,performed |
R12063 | T17324 | T17323 | arg2Of | performed,was |
R12064 | T17324 | T17325 | arg1Of | performed,in |
R12065 | T17328 | T17325 | arg2Of | reaction,in |
R12066 | T17328 | T17326 | arg1Of | reaction,a |
R12067 | T17328 | T17327 | arg1Of | reaction,25-μl |
R12068 | T17328 | T17329 | arg1Of | reaction,with |
R12069 | T17334 | T17329 | arg2Of | supermix,with |
R12070 | T17334 | T17330 | arg1Of | supermix,12.5 |
R12071 | T17334 | T17331 | arg1Of | supermix,μl |
R12072 | T17334 | T17332 | arg1Of | supermix,SYBR |
R12073 | T17334 | T17333 | arg1Of | supermix,green |
R12074 | T17337 | T17335 | arg1Of | levels,GAPDH |
R12075 | T17337 | T17336 | arg1Of | levels,mRNA |
R12076 | T17337 | T17338 | arg1Of | levels,were |
R12077 | T17337 | T17339 | arg2Of | levels,used |
R12078 | T17339 | T17338 | arg2Of | used,were |
R12079 | T17339 | T17340 | arg1Of | used,as |
R12080 | T17341 | T17340 | arg2Of | control,as |
R12081 | T17341 | T17342 | arg1Of | control,for |
R12082 | T17344 | T17342 | arg2Of | RNA,for |
R12083 | T17344 | T17343 | arg1Of | RNA,input |
R12084 | T17347 | T17345 | arg1Of | analyses,Standard |
R12085 | T17347 | T17346 | arg1Of | analyses,curve |
R12086 | T17347 | T17348 | arg1Of | analyses,were |
R12087 | T17347 | T17349 | arg2Of | analyses,performed |
R12088 | T17349 | T17348 | arg2Of | performed,were |
R12089 | T17351 | T17349 | arg3Of | test,performed |
R12090 | T17351 | T17350 | arg1Of | test,to |
R12091 | T17353 | T17351 | arg2Of | efficiency,test |
R12092 | T17353 | T17352 | arg1Of | efficiency,the |
R12093 | T17353 | T17354 | arg1Of | efficiency,of |
R12094 | T17356 | T17354 | arg2Of | amplifications,of |
R12095 | T17356 | T17355 | arg1Of | amplifications,the |
R12096 | T17357 | T17358 | arg1Of | Triplicates,were |
R12097 | T17357 | T17359 | arg2Of | Triplicates,done |
R12098 | T17359 | T17358 | arg2Of | done,were |
R12099 | T17359 | T17360 | arg1Of | done,for |
R12100 | T17363 | T17360 | arg2Of | reaction,for |
R12101 | T17363 | T17361 | arg1Of | reaction,each |
R12102 | T17363 | T17362 | arg1Of | reaction,PCR |
R12103 | T17366 | T17364 | arg1Of | values,Relative |
R12104 | T17366 | T17365 | arg1Of | values,quantitative |
R12105 | T17366 | T17367 | arg1Of | values,were |
R12106 | T17366 | T17368 | arg2Of | values,calculated |
R12107 | T17366 | T17381 | arg1Of | values,normalized |
R12108 | T17368 | T17367 | arg2Of | calculated,were |
R12109 | T17368 | T17369 | arg1Of | calculated,in |
R12110 | T17368 | T17380 | arg1Of | calculated,and |
R12111 | T17375 | T17369 | arg2Of | Software,in |
R12112 | T17375 | T17370 | arg1Of | Software,the |
R12113 | T17375 | T17371 | arg1Of | Software,ABI |
R12114 | T17375 | T17372 | arg1Of | Software,Prism |
R12115 | T17375 | T17373 | arg1Of | Software,7000 |
R12116 | T17375 | T17374 | arg1Of | Software,SDS |
R12117 | T17375 | T17376 | arg1Of | Software,( |
R12118 | T17378 | T17376 | arg2Of | Biosystems,( |
R12119 | T17378 | T17377 | arg1Of | Biosystems,Applied |
R12120 | T17379 | T17376 | arg3Of | ),( |
R12121 | T17381 | T17380 | arg2Of | normalized,and |
R12122 | T17381 | T17382 | arg1Of | normalized,to |
R12123 | T17383 | T17382 | arg2Of | GAPDH,to |
R12124 | T17383 | T17384 | arg1Of | GAPDH,in |
R12125 | T17386 | T17384 | arg2Of | Excel,in |
R12126 | T17386 | T17385 | arg1Of | Excel,Microsoft |
R12127 | T17386 | T17387 | arg1Of | Excel,( |
R12128 | T17388 | T17389 | arg1Of | Redmond,"," |
R12129 | T17389 | T17391 | arg1Of | ",","," |
R12130 | T17390 | T17389 | arg2Of | Washington,"," |
R12131 | T17392 | T17391 | arg2Of | United,"," |
R12132 | T17393 | T17387 | arg2Of | States,( |
R12133 | T17393 | T17388 | arg1Of | States,Redmond |
R12134 | T17393 | T17390 | arg1Of | States,Washington |
R12135 | T17393 | T17392 | arg1Of | States,United |
R12136 | T17394 | T17387 | arg3Of | ),( |
R12381 | T17767 | T17766 | arg1Of | situ,In |
R12382 | T17768 | T17767 | arg1Of | hybridization,situ |
R12383 | T17770 | T17769 | arg1Of | probes,Antisense |
R12384 | T17770 | T17771 | arg1Of | probes,were |
R12385 | T17770 | T17772 | arg2Of | probes,designed |
R12386 | T17772 | T17771 | arg2Of | designed,were |
R12387 | T17772 | T17773 | arg1Of | designed,to |
R12388 | T17777 | T17774 | arg1Of | nucleotides,murine |
R12389 | T17777 | T17775 | arg1Of | nucleotides,ɛy |
R12390 | T17777 | T17776 | arg1Of | nucleotides,globin |
R12391 | T17777 | T17778 | arg1Of | nucleotides,509–584 |
R12392 | T17777 | T17779 | arg1Of | nucleotides,; |
R12393 | T17779 | T17773 | arg2Of | ;,to |
R12394 | T17782 | T17780 | arg1Of | nucleotides,βmaj |
R12395 | T17782 | T17781 | arg1Of | nucleotides,globin |
R12396 | T17782 | T17783 | arg1Of | nucleotides,458–549 |
R12397 | T17782 | T17785 | arg1Of | nucleotides,and |
R12398 | T17785 | T17779 | arg2Of | and,; |
R12399 | T17785 | T17784 | arg1Of | and,; |
R12400 | T17788 | T17785 | arg2Of | nucleotides,and |
R12401 | T17788 | T17786 | arg1Of | nucleotides,mouse |
R12402 | T17788 | T17787 | arg1Of | nucleotides,Sox6 |
R12403 | T17788 | T17789 | arg1Of | nucleotides,1353–1927 |
R12404 | T17790 | T17791 | arg1Of | Embryos,were |
R12405 | T17790 | T17792 | arg2Of | Embryos,fixed |
R12406 | T17790 | T17811 | arg1Of | Embryos,adhered |
R12407 | T17792 | T17791 | arg2Of | fixed,were |
R12408 | T17792 | T17793 | arg1Of | fixed,overnight |
R12409 | T17792 | T17810 | arg1Of | fixed,and |
R12410 | T17795 | T17792 | arg1Of | immersion,fixed |
R12411 | T17795 | T17794 | arg2Of | immersion,by |
R12412 | T17795 | T17796 | arg1Of | immersion,in |
R12413 | T17795 | T17800 | arg1Of | immersion,"," |
R12414 | T17795 | T17801 | arg2Of | immersion,embedded |
R12415 | T17795 | T17804 | arg1Of | immersion,"," |
R12416 | T17795 | T17805 | arg2Of | immersion,sectioned |
R12417 | T17797 | T17798 | arg1Of | 4,% |
R12418 | T17799 | T17796 | arg2Of | paraformaldehyde,in |
R12419 | T17799 | T17797 | arg1Of | paraformaldehyde,4 |
R12420 | T17801 | T17802 | arg1Of | embedded,in |
R12421 | T17803 | T17802 | arg2Of | paraffin,in |
R12422 | T17805 | T17806 | arg1Of | sectioned,at |
R12423 | T17808 | T17806 | arg2Of | μm,at |
R12424 | T17808 | T17807 | arg1Of | μm,5 |
R12425 | T17810 | T17809 | arg1Of | and,"," |
R12426 | T17811 | T17810 | arg2Of | adhered,and |
R12427 | T17813 | T17811 | arg2Of | charge,adhered |
R12428 | T17813 | T17812 | arg1Of | charge,to |
R12429 | T17815 | T17813 | arg2Of | slides,charge |
R12430 | T17815 | T17814 | arg2Of | slides,modified |
R12431 | T17815 | T17816 | arg1Of | slides,( |
R12432 | T17817 | T17818 | arg1Of | VWR,"," |
R12433 | T17817 | T17821 | arg1Of | VWR,"," |
R12434 | T17820 | T17818 | arg2Of | Chester,"," |
R12435 | T17820 | T17819 | arg1Of | Chester,West |
R12436 | T17821 | T17816 | arg2Of | ",",( |
R12437 | T17821 | T17823 | arg1Of | ",","," |
R12438 | T17822 | T17821 | arg2Of | Pennsylvania,"," |
R12439 | T17825 | T17823 | arg2Of | States,"," |
R12440 | T17825 | T17824 | arg1Of | States,United |
R12441 | T17826 | T17816 | arg3Of | ),( |
R12442 | T17827 | T17828 | arg1Of | Slides,were |
R12443 | T17827 | T17829 | arg2Of | Slides,processed |
R12444 | T17829 | T17828 | arg2Of | processed,were |
R12445 | T17829 | T17830 | arg1Of | processed,for |
R12446 | T17829 | T17834 | arg1Of | processed,as |
R12447 | T17832 | T17831 | arg1Of | situ,in |
R12448 | T17833 | T17830 | arg2Of | hybridization,for |
R12449 | T17833 | T17832 | arg1Of | hybridization,situ |
R12450 | T17835 | T17834 | arg2Of | described,as |
R12451 | T17835 | T17836 | arg1Of | described,[ |
R12452 | T17835 | T17839 | modOf | described,using |
R12453 | T17837 | T17836 | arg2Of | 52,[ |
R12454 | T17838 | T17836 | arg3Of | ],[ |
R12455 | T17841 | T17840 | arg1Of | vitro,in |
R12456 | T17844 | T17839 | arg2Of | probes,using |
R12457 | T17844 | T17841 | arg1Of | probes,vitro |
R12458 | T17844 | T17842 | arg2Of | probes,transcribed |
R12459 | T17844 | T17843 | arg1Of | probes,RNA |
R12460 | T17844 | T17845 | arg2Of | probes,labeled |
R12461 | T17845 | T17846 | arg1Of | labeled,with |
R12462 | T17847 | T17846 | arg2Of | 33P,with |
R12463 | T17848 | T17849 | arg1Of | Darkfield,and |
R12464 | T17850 | T17849 | arg2Of | brightfield,and |
R12465 | T17851 | T17848 | arg1Of | images,Darkfield |
R12466 | T17851 | T17850 | arg1Of | images,brightfield |
R12467 | T17851 | T17852 | arg1Of | images,were |
R12468 | T17851 | T17853 | arg2Of | images,obtained |
R12469 | T17853 | T17852 | arg2Of | obtained,were |
R12470 | T17853 | T17854 | arg1Of | obtained,with |
R12471 | T17857 | T17856 | arg1Of | Optiphot,Nikon |
R12472 | T17858 | T17857 | arg1Of | microscope,Optiphot |
R12473 | T17858 | T17859 | arg1Of | microscope,( |
R12474 | T17858 | T17870 | arg1Of | microscope,and |
R12475 | T17860 | T17861 | arg1Of | Nikon,"," |
R12476 | T17861 | T17863 | arg1Of | ",","," |
R12477 | T17862 | T17861 | arg2Of | Melville,"," |
R12478 | T17863 | T17866 | arg1Of | ",","," |
R12479 | T17865 | T17863 | arg2Of | York,"," |
R12480 | T17865 | T17864 | arg1Of | York,New |
R12481 | T17866 | T17859 | arg2Of | ",",( |
R12482 | T17868 | T17866 | arg2Of | States,"," |
R12483 | T17868 | T17867 | arg1Of | States,United |
R12484 | T17869 | T17859 | arg3Of | ),( |
R12485 | T17870 | T17854 | arg2Of | and,with |
R12486 | T17870 | T17855 | arg1Of | and,a |
R12487 | T17870 | T17875 | arg1Of | and,( |
R12488 | T17874 | T17870 | arg2Of | camera,and |
R12489 | T17874 | T17871 | arg1Of | camera,SPOT |
R12490 | T17874 | T17872 | arg1Of | camera,RT-Slider |
R12491 | T17874 | T17873 | arg1Of | camera,digital |
R12492 | T17877 | T17878 | arg1Of | Instruments,"," |
R12493 | T17878 | T17881 | arg1Of | ",","," |
R12494 | T17880 | T17878 | arg2Of | Heights,"," |
R12495 | T17880 | T17879 | arg1Of | Heights,Sterling |
R12496 | T17881 | T17876 | arg1Of | ",",Diagnostic |
R12497 | T17881 | T17883 | arg1Of | ",","," |
R12498 | T17882 | T17881 | arg2Of | Michigan,"," |
R12499 | T17883 | T17875 | arg2Of | ",",( |
R12500 | T17885 | T17883 | arg2Of | States,"," |
R12501 | T17885 | T17884 | arg1Of | States,United |
R12502 | T17886 | T17875 | arg3Of | ),( |
R12503 | T17887 | T17888 | arg2Of | Objectives,used |
R12504 | T17887 | T17889 | arg1Of | Objectives,were |
R12505 | T17890 | T17891 | arg1Of | 1×,( |
R12506 | T17890 | T17896 | arg1Of | 1×,and |
R12507 | T17892 | T17891 | arg2Of | NA,( |
R12508 | T17892 | T17893 | arg1Of | NA,= |
R12509 | T17892 | T17894 | arg1Of | NA,0.04 |
R12510 | T17895 | T17891 | arg3Of | ),( |
R12511 | T17896 | T17889 | arg2Of | and,were |
R12512 | T17897 | T17896 | arg2Of | 10×,and |
R12513 | T17897 | T17898 | arg1Of | 10×,( |
R12514 | T17899 | T17898 | arg2Of | NA,( |
R12515 | T17899 | T17900 | arg1Of | NA,= |
R12516 | T17899 | T17901 | arg1Of | NA,0.5 |
R12517 | T17902 | T17898 | arg3Of | ),( |
R12518 | T17903 | T17904 | arg1Of | Images,were |
R12519 | T17903 | T17905 | arg2Of | Images,processed |
R12520 | T17903 | T17907 | arg2Of | Images,pseudocolored |
R12521 | T17903 | T17910 | arg2Of | Images,combined |
R12522 | T17905 | T17906 | arg1Of | processed,"," |
R12523 | T17906 | T17909 | arg1Of | ",",and |
R12524 | T17907 | T17906 | arg2Of | pseudocolored,"," |
R12525 | T17909 | T17904 | arg2Of | and,were |
R12526 | T17909 | T17908 | arg1Of | and,"," |
R12527 | T17909 | T17940 | arg2Of | and,plugins |
R12528 | T17910 | T17909 | arg2Of | combined,and |
R12529 | T17910 | T17911 | modOf | combined,using |
R12530 | T17912 | T17911 | arg2Of | Photoshop,using |
R12531 | T17912 | T17913 | arg1Of | Photoshop,( |
R12532 | T17914 | T17915 | arg1Of | Adobe,"," |
R12533 | T17915 | T17918 | arg1Of | ",","," |
R12534 | T17917 | T17915 | arg2Of | Jose,"," |
R12535 | T17917 | T17916 | arg1Of | Jose,San |
R12536 | T17918 | T17920 | arg1Of | ",","," |
R12537 | T17919 | T17918 | arg2Of | California,"," |
R12538 | T17920 | T17913 | arg2Of | ",",( |
R12539 | T17922 | T17920 | arg2Of | States,"," |
R12540 | T17922 | T17921 | arg1Of | States,United |
R12541 | T17923 | T17913 | arg3Of | ),( |
R12542 | T17924 | T17925 | arg1Of | software,with |
R12543 | T17924 | T17940 | arg1Of | software,plugins |
R12544 | T17927 | T17925 | arg2Of | Pro,with |
R12545 | T17927 | T17926 | arg1Of | Pro,Fovea |
R12546 | T17927 | T17928 | arg1Of | Pro,( |
R12547 | T17930 | T17929 | arg1Of | Graphics,Reindeer |
R12548 | T17930 | T17931 | arg1Of | Graphics,"," |
R12549 | T17931 | T17933 | arg1Of | ",","," |
R12550 | T17932 | T17931 | arg2Of | Asheville,"," |
R12551 | T17933 | T17936 | arg1Of | ",","," |
R12552 | T17935 | T17933 | arg2Of | Carolina,"," |
R12553 | T17935 | T17934 | arg1Of | Carolina,North |
R12554 | T17936 | T17928 | arg2Of | ",",( |
R12555 | T17938 | T17936 | arg2Of | States,"," |
R12556 | T17938 | T17937 | arg1Of | States,United |
R12557 | T17939 | T17928 | arg3Of | ),( |
R12558 | T17942 | T17941 | arg1Of | images,Original |
R12559 | T17942 | T17943 | arg1Of | images,are |
R12560 | T17942 | T17944 | arg1Of | images,available |
R12561 | T17944 | T17943 | arg2Of | available,are |
R12754 | T18187 | T18186 | arg1Of | embryos,18.5-dpc |
R12755 | T18187 | T18188 | arg1Of | embryos,were |
R12756 | T18187 | T18189 | arg2Of | embryos,exsanguinated |
R12757 | T18189 | T18188 | arg2Of | exsanguinated,were |
R12758 | T18189 | T18190 | arg1Of | exsanguinated,and |
R12759 | T18193 | T18191 | arg1Of | smears,peripheral |
R12760 | T18193 | T18192 | arg1Of | smears,blood |
R12761 | T18193 | T18194 | arg1Of | smears,were |
R12762 | T18193 | T18195 | arg2Of | smears,prepared |
R12763 | T18195 | T18190 | arg2Of | prepared,and |
R12764 | T18195 | T18194 | arg2Of | prepared,were |
R12765 | T18195 | T18196 | arg1Of | prepared,from |
R12766 | T18198 | T18199 | arg1Of | mutant,and |
R12767 | T18199 | T18197 | arg1Of | and,both |
R12768 | T18200 | T18199 | arg2Of | WT,and |
R12769 | T18201 | T18196 | arg2Of | mice,from |
R12770 | T18201 | T18198 | arg1Of | mice,mutant |
R12771 | T18201 | T18200 | arg1Of | mice,WT |
R12772 | T18203 | T18202 | arg1Of | slides,The |
R12773 | T18203 | T18204 | arg1Of | slides,were |
R12774 | T18203 | T18205 | arg2Of | slides,Wright-stained |
R12775 | T18203 | T18207 | arg2Of | slides,read |
R12776 | T18205 | T18206 | arg1Of | Wright-stained,and |
R12777 | T18206 | T18204 | arg2Of | and,were |
R12778 | T18207 | T18206 | arg2Of | read,and |
R12779 | T18209 | T18207 | arg1Of | DAF,read |
R12780 | T18209 | T18208 | arg2Of | DAF,by |
R12781 | T18213 | T18210 | arg2Of | analysis,For |
R12782 | T18213 | T18211 | arg1Of | analysis,whole |
R12783 | T18213 | T18212 | arg1Of | analysis,mount |
R12784 | T18215 | T18216 | arg1Of | 14.5-dpc,WT |
R12785 | T18215 | T18217 | arg1Of | 14.5-dpc,and |
R12786 | T18218 | T18217 | arg2Of | mutant,and |
R12787 | T18219 | T18215 | arg1Of | embryos,14.5-dpc |
R12788 | T18219 | T18218 | arg1Of | embryos,mutant |
R12789 | T18219 | T18221 | arg1Of | embryos,and |
R12790 | T18221 | T18220 | arg1Of | and,"," |
R12791 | T18221 | T18225 | arg1Of | and,were |
R12792 | T18221 | T18226 | arg2Of | and,fixed |
R12793 | T18221 | T18240 | arg2Of | and,stained |
R12794 | T18224 | T18221 | arg2Of | mice,and |
R12795 | T18224 | T18222 | arg1Of | mice,postnatal |
R12796 | T18224 | T18223 | arg1Of | mice,day–10.5 |
R12797 | T18226 | T18227 | arg1Of | fixed,in |
R12798 | T18226 | T18239 | arg1Of | fixed,and |
R12799 | T18228 | T18229 | arg1Of | 10,% |
R12800 | T18230 | T18227 | arg2Of | formalin,in |
R12801 | T18230 | T18228 | arg1Of | formalin,10 |
R12802 | T18230 | T18231 | arg1Of | formalin,"," |
R12803 | T18230 | T18233 | arg1Of | formalin,"," |
R12804 | T18230 | T18234 | arg2Of | formalin,sectioned |
R12805 | T18232 | T18231 | arg2Of | paraffin-embedded,"," |
R12806 | T18234 | T18235 | arg1Of | sectioned,at |
R12807 | T18237 | T18235 | arg2Of | μm,at |
R12808 | T18237 | T18236 | arg1Of | μm,5 |
R12809 | T18239 | T18210 | arg1Of | and,For |
R12810 | T18239 | T18214 | arg1Of | and,"," |
R12811 | T18239 | T18225 | arg2Of | and,were |
R12812 | T18239 | T18238 | arg1Of | and,"," |
R12813 | T18240 | T18239 | arg2Of | stained,and |
R12814 | T18240 | T18241 | arg1Of | stained,with |
R12815 | T18242 | T18243 | arg1Of | hematoxylin,and |
R12816 | T18243 | T18241 | arg2Of | and,with |
R12817 | T18244 | T18243 | arg2Of | eosin,and |
R12818 | T18246 | T18245 | arg1Of | samples,Liver |
R12819 | T18246 | T18247 | arg1Of | samples,( |
R12820 | T18246 | T18255 | arg1Of | samples,were |
R12821 | T18246 | T18256 | arg2Of | samples,prepared |
R12822 | T18248 | T18247 | arg2Of | at,( |
R12823 | T18250 | T18249 | arg1Of | dpc,14.5 |
R12824 | T18250 | T18251 | arg1Of | dpc,and |
R12825 | T18251 | T18248 | arg2Of | and,at |
R12826 | T18253 | T18251 | arg2Of | dpc,and |
R12827 | T18253 | T18252 | arg1Of | dpc,18.5 |
R12828 | T18254 | T18247 | arg3Of | ),( |
R12829 | T18256 | T18255 | arg2Of | prepared,were |
R12830 | T18256 | T18257 | arg1Of | prepared,in |
R12831 | T18260 | T18257 | arg2Of | manner,in |
R12832 | T18260 | T18258 | arg1Of | manner,a |
R12833 | T18260 | T18259 | arg1Of | manner,similar |
R12834 | T18261 | T18262 | arg1Of | Images,were |
R12835 | T18261 | T18263 | arg2Of | Images,obtained |
R12836 | T18263 | T18262 | arg2Of | obtained,were |
R12837 | T18263 | T18264 | arg1Of | obtained,with |
R12838 | T18267 | T18264 | arg2Of | microscope,with |
R12839 | T18267 | T18265 | arg1Of | microscope,Nikon |
R12840 | T18267 | T18266 | arg1Of | microscope,Labophot-2 |
R12841 | T18268 | T18269 | arg2Of | Objectives,used |
R12842 | T18268 | T18270 | arg1Of | Objectives,were |
R12843 | T18274 | T18273 | arg1Of | 160/0.17,40/0.65 |
R12844 | T18275 | T18270 | arg2Of | Nikon,were |
R12845 | T18275 | T18271 | arg1Of | Nikon,E |
R12846 | T18275 | T18272 | arg1Of | Nikon,Plan |
R12847 | T18275 | T18274 | arg1Of | Nikon,160/0.17 |
R12848 | T18275 | T18276 | arg1Of | Nikon,( |
R12849 | T18275 | T18280 | arg1Of | Nikon,"," |
R12850 | T18278 | T18276 | arg2Of | objective,( |
R12851 | T18278 | T18277 | arg1Of | objective,40× |
R12852 | T18279 | T18276 | arg3Of | ),( |
R12853 | T18282 | T18283 | arg1Of | Plan,100/1.25 |
R12854 | T18286 | T18280 | arg2Of | Nikon,"," |
R12855 | T18286 | T18281 | arg1Of | Nikon,E |
R12856 | T18286 | T18282 | arg1Of | Nikon,Plan |
R12857 | T18286 | T18284 | arg1Of | Nikon,oil |
R12858 | T18286 | T18285 | arg1Of | Nikon,160/0.17 |
R12859 | T18286 | T18287 | arg1Of | Nikon,( |
R12860 | T18289 | T18287 | arg2Of | objective,( |
R12861 | T18289 | T18288 | arg1Of | objective,100× |
R12862 | T18290 | T18287 | arg3Of | ),( |
R12863 | T18292 | T18291 | arg1Of | camera,The |
R12864 | T18292 | T18293 | arg1Of | camera,was |
R12865 | T18296 | T18293 | arg2Of | Coolpix,was |
R12866 | T18296 | T18294 | arg1Of | Coolpix,a |
R12867 | T18296 | T18295 | arg1Of | Coolpix,Nikon |
R12868 | T18296 | T18297 | arg1Of | Coolpix,4300 |
R12869 | T18299 | T18298 | arg1Of | images,Original |
R12870 | T18299 | T18300 | arg1Of | images,are |
R12871 | T18299 | T18301 | arg1Of | images,available |
R12872 | T18301 | T18300 | arg2Of | available,are |
R13006 | T18462 | T18461 | arg1Of | blot,Northern |
R13007 | T18469 | T18463 | arg1Of | filter,A |
R13008 | T18469 | T18464 | arg1Of | filter,mouse |
R13009 | T18469 | T18465 | arg1Of | filter,embryonic |
R13010 | T18469 | T18466 | arg1Of | filter,tissue |
R13011 | T18469 | T18467 | arg1Of | filter,Northern |
R13012 | T18469 | T18468 | arg1Of | filter,blot |
R13013 | T18469 | T18470 | arg1Of | filter,( |
R13014 | T18469 | T18480 | arg1Of | filter,was |
R13015 | T18469 | T18481 | arg2Of | filter,hybridized |
R13016 | T18471 | T18470 | arg2Of | Seegene,( |
R13017 | T18471 | T18472 | arg1Of | Seegene,"," |
R13018 | T18471 | T18476 | arg1Of | Seegene,"," |
R13019 | T18473 | T18474 | arg1Of | Rockville,"," |
R13020 | T18474 | T18472 | arg2Of | ",","," |
R13021 | T18475 | T18474 | arg2Of | Maryland,"," |
R13022 | T18478 | T18476 | arg2Of | States,"," |
R13023 | T18478 | T18477 | arg1Of | States,United |
R13024 | T18479 | T18470 | arg3Of | ),( |
R13025 | T18481 | T18480 | arg2Of | hybridized,was |
R13026 | T18481 | T18482 | arg1Of | hybridized,with |
R13027 | T18481 | T18500 | arg1Of | hybridized,"," |
R13028 | T18481 | T18501 | arg1Of | hybridized,by |
R13029 | T18485 | T18482 | arg2Of | probe,with |
R13030 | T18485 | T18483 | arg1Of | probe,a |
R13031 | T18485 | T18484 | arg1Of | probe,Sox6 |
R13032 | T18485 | T18486 | arg2Of | probe,generated |
R13033 | T18485 | T18494 | arg2Of | probe,labeled |
R13034 | T18486 | T18487 | arg1Of | generated,by |
R13035 | T18486 | T18493 | arg1Of | generated,and |
R13036 | T18488 | T18487 | arg2Of | RT-PCR,by |
R13037 | T18488 | T18489 | arg1Of | RT-PCR,( |
R13038 | T18490 | T18489 | arg2Of | nucleotides,( |
R13039 | T18490 | T18491 | arg1Of | nucleotides,1353–1927 |
R13040 | T18492 | T18489 | arg3Of | ),( |
R13041 | T18494 | T18493 | arg2Of | labeled,and |
R13042 | T18494 | T18495 | arg1Of | labeled,with |
R13043 | T18497 | T18496 | arg2Of | α-32P,[ |
R13044 | T18498 | T18496 | arg3Of | ],[ |
R13045 | T18499 | T18495 | arg2Of | dCTP,with |
R13046 | T18499 | T18496 | arg1Of | dCTP,[ |
R13047 | T18504 | T18501 | arg2Of | labeling,by |
R13048 | T18504 | T18502 | arg1Of | labeling,random |
R13049 | T18504 | T18503 | arg1Of | labeling,primer |
R13050 | T18504 | T18505 | arg1Of | labeling,( |
R13051 | T18506 | T18507 | arg1Of | RediprimeII,; |
R13052 | T18507 | T18505 | arg2Of | ;,( |
R13053 | T18507 | T18514 | arg1Of | ;,"," |
R13054 | T18509 | T18508 | arg1Of | Biosciences,Amersham |
R13055 | T18509 | T18510 | arg1Of | Biosciences,"," |
R13056 | T18510 | T18512 | arg1Of | ",","," |
R13057 | T18511 | T18510 | arg2Of | Buckinghamshire,"," |
R13058 | T18512 | T18507 | arg2Of | ",",; |
R13059 | T18513 | T18512 | arg2Of | England,"," |
R13060 | T18516 | T18514 | arg2Of | Kingdom,"," |
R13061 | T18516 | T18515 | arg1Of | Kingdom,United |
R13062 | T18517 | T18505 | arg3Of | ),( |
R13063 | T18519 | T18518 | arg1Of | hybridization,The |
R13064 | T18519 | T18520 | arg1Of | hybridization,was |
R13065 | T18519 | T18521 | arg2Of | hybridization,performed |
R13066 | T18521 | T18520 | arg2Of | performed,was |
R13067 | T18521 | T18522 | arg1Of | performed,in |
R13068 | T18523 | T18522 | arg2Of | phosphate,in |
R13069 | T18523 | T18524 | arg2Of | phosphate,buffered |
R13070 | T18525 | T18526 | arg1Of | 7,% |
R13071 | T18529 | T18524 | arg3Of | solution,buffered |
R13072 | T18529 | T18525 | arg1Of | solution,7 |
R13073 | T18529 | T18527 | arg1Of | solution,SDS |
R13074 | T18529 | T18528 | arg1Of | solution,hybridization |
R13075 | T18530 | T18531 | arg1Of | Blots,were |
R13076 | T18530 | T18532 | arg2Of | Blots,washed |
R13077 | T18532 | T18531 | arg2Of | washed,were |
R13078 | T18532 | T18533 | arg1Of | washed,with |
R13079 | T18535 | T18536 | arg1Of | SSC,"," |
R13080 | T18536 | T18534 | arg1Of | ",",0.2× |
R13081 | T18538 | T18536 | arg2Of | %,"," |
R13082 | T18538 | T18537 | arg1Of | %,1 |
R13083 | T18539 | T18533 | arg2Of | SDS,with |
R13084 | T18539 | T18535 | arg1Of | SDS,SSC |
R13085 | T18539 | T18538 | arg1Of | SDS,% |
R13086 | T18539 | T18540 | arg1Of | SDS,at |
R13087 | T18539 | T18543 | arg1Of | SDS,prior |
R13088 | T18539 | T18549 | arg1Of | SDS,( |
R13089 | T18539 | T18560 | arg1Of | SDS,at |
R13090 | T18542 | T18540 | arg2Of | °C,at |
R13091 | T18542 | T18541 | arg1Of | °C,60 |
R13092 | T18543 | T18544 | arg1Of | prior,to |
R13093 | T18545 | T18544 | arg2Of | exposure,to |
R13094 | T18545 | T18546 | arg1Of | exposure,to |
R13095 | T18548 | T18546 | arg2Of | film,to |
R13096 | T18548 | T18547 | arg1Of | film,X-ray |
R13097 | T18550 | T18551 | arg1Of | Kodak,"," |
R13098 | T18551 | T18553 | arg1Of | ",","," |
R13099 | T18552 | T18551 | arg2Of | Rochester,"," |
R13100 | T18553 | T18556 | arg1Of | ",","," |
R13101 | T18555 | T18553 | arg2Of | York,"," |
R13102 | T18555 | T18554 | arg1Of | York,New |
R13103 | T18556 | T18549 | arg2Of | ",",( |
R13104 | T18558 | T18556 | arg2Of | States,"," |
R13105 | T18558 | T18557 | arg1Of | States,United |
R13106 | T18559 | T18549 | arg3Of | ),( |
R13107 | T18562 | T18560 | arg2Of | °C,at |
R13108 | T18562 | T18561 | arg1Of | °C,−80 |
R13109 | T18562 | T18563 | arg1Of | °C,for |
R13110 | T18565 | T18563 | arg2Of | d,for |
R13111 | T18565 | T18564 | arg1Of | d,6 |
R13227 | T18724 | T18725 | arg1Of | culture,and |
R13228 | T18725 | T18723 | arg1Of | and,Cell |
R13229 | T18726 | T18725 | arg2Of | transfection,and |
R13230 | T18728 | T18727 | arg1Of | cells,GM979 |
R13231 | T18728 | T18729 | arg1Of | cells,( |
R13232 | T18728 | T18742 | arg1Of | cells,were |
R13233 | T18728 | T18743 | arg2Of | cells,cultured |
R13234 | T18732 | T18730 | arg1Of | Repositories,Coriell |
R13235 | T18732 | T18731 | arg1Of | Repositories,Cell |
R13236 | T18732 | T18733 | arg1Of | Repositories,"," |
R13237 | T18733 | T18735 | arg1Of | ",","," |
R13238 | T18734 | T18733 | arg2Of | Camden,"," |
R13239 | T18736 | T18735 | arg2Of | New,"," |
R13240 | T18737 | T18729 | arg2Of | Jersey,( |
R13241 | T18737 | T18732 | arg1Of | Jersey,Repositories |
R13242 | T18737 | T18734 | arg1Of | Jersey,Camden |
R13243 | T18737 | T18736 | arg1Of | Jersey,New |
R13244 | T18737 | T18738 | arg1Of | Jersey,"," |
R13245 | T18740 | T18738 | arg2Of | States,"," |
R13246 | T18740 | T18739 | arg1Of | States,United |
R13247 | T18741 | T18729 | arg3Of | ),( |
R13248 | T18743 | T18742 | arg2Of | cultured,were |
R13249 | T18743 | T18744 | arg1Of | cultured,in |
R13250 | T18745 | T18746 | arg2Of | Ham,'s |
R13251 | T18747 | T18744 | arg2Of | F12,in |
R13252 | T18747 | T18746 | arg1Of | F12,'s |
R13253 | T18747 | T18748 | arg1Of | F12,with |
R13254 | T18749 | T18750 | arg1Of | 2,mM |
R13255 | T18751 | T18748 | arg2Of | L-glutamine,with |
R13256 | T18751 | T18749 | arg1Of | L-glutamine,2 |
R13257 | T18751 | T18752 | arg2Of | L-glutamine,supplemented |
R13258 | T18752 | T18753 | arg1Of | supplemented,with |
R13259 | T18755 | T18756 | arg1Of | 10,% |
R13260 | T18759 | T18754 | arg1Of | serum,heat-inactivated |
R13261 | T18759 | T18755 | arg1Of | serum,10 |
R13262 | T18759 | T18757 | arg1Of | serum,fetal |
R13263 | T18759 | T18758 | arg1Of | serum,calf |
R13264 | T18759 | T18760 | arg1Of | serum,( |
R13265 | T18759 | T18782 | arg1Of | serum,and |
R13266 | T18761 | T18762 | arg1Of | Ivitrogen,"," |
R13267 | T18762 | T18764 | arg1Of | ",","," |
R13268 | T18763 | T18762 | arg2Of | Carlsbad,"," |
R13269 | T18764 | T18766 | arg1Of | ",","," |
R13270 | T18765 | T18764 | arg2Of | California,"," |
R13271 | T18766 | T18769 | arg1Of | ",",) |
R13272 | T18766 | T18770 | arg1Of | ",","," |
R13273 | T18768 | T18766 | arg2Of | States,"," |
R13274 | T18768 | T18767 | arg1Of | States,United |
R13275 | T18770 | T18776 | arg1Of | ",","," |
R13276 | T18771 | T18770 | arg2Of | penicillin,"," |
R13277 | T18771 | T18772 | arg1Of | penicillin,( |
R13278 | T18774 | T18772 | arg2Of | units/ml,( |
R13279 | T18774 | T18773 | arg1Of | units/ml,100 |
R13280 | T18775 | T18772 | arg3Of | ),( |
R13281 | T18776 | T18760 | arg2Of | ",",( |
R13282 | T18779 | T18776 | arg2Of | μg/ml,"," |
R13283 | T18779 | T18777 | arg1Of | μg/ml,streptomycin |
R13284 | T18779 | T18778 | arg1Of | μg/ml,100 |
R13285 | T18780 | T18760 | arg3Of | ),( |
R13286 | T18782 | T18753 | arg2Of | and,with |
R13287 | T18782 | T18781 | arg1Of | and,"," |
R13288 | T18783 | T18782 | arg2Of | L-glutamine,and |
R13289 | T18783 | T18784 | arg1Of | L-glutamine,( |
R13290 | T18786 | T18784 | arg2Of | mM,( |
R13291 | T18786 | T18785 | arg1Of | mM,2 |
R13292 | T18787 | T18784 | arg3Of | ),( |
R13293 | T18789 | T18788 | arg1Of | cells,MEL |
R13294 | T18789 | T18790 | arg1Of | cells,were |
R13295 | T18789 | T18791 | arg2Of | cells,cultured |
R13296 | T18791 | T18790 | arg2Of | cultured,were |
R13297 | T18791 | T18792 | arg1Of | cultured,in |
R13298 | T18793 | T18792 | arg2Of | DMEM,in |
R13299 | T18793 | T18794 | arg2Of | DMEM,supplemented |
R13300 | T18794 | T18795 | arg1Of | supplemented,as |
R13301 | T18794 | T18797 | arg1Of | supplemented,( |
R13302 | T18796 | T18795 | arg2Of | above,as |
R13303 | T18798 | T18797 | arg2Of | without,( |
R13304 | T18799 | T18798 | arg2Of | heat,without |
R13305 | T18799 | T18800 | arg1Of | heat,inactivating |
R13306 | T18802 | T18800 | arg2Of | serum,inactivating |
R13307 | T18802 | T18801 | arg1Of | serum,the |
R13308 | T18803 | T18797 | arg3Of | ),( |
R13309 | T18805 | T18804 | arg1Of | cells,GM979 |
R13310 | T18805 | T18806 | arg1Of | cells,( |
R13311 | T18805 | T18811 | arg1Of | cells,in |
R13312 | T18805 | T18816 | arg1Of | cells,were |
R13313 | T18805 | T18817 | arg2Of | cells,transfected |
R13314 | T18808 | T18806 | arg2Of | ×,( |
R13315 | T18808 | T18807 | arg1Of | ×,4 |
R13316 | T18808 | T18809 | arg1Of | ×,105 |
R13317 | T18810 | T18806 | arg3Of | ),( |
R13318 | T18813 | T18811 | arg2Of | phase,in |
R13319 | T18813 | T18812 | arg1Of | phase,log |
R13320 | T18813 | T18814 | arg1Of | phase,of |
R13321 | T18815 | T18814 | arg2Of | growth,of |
R13322 | T18817 | T18816 | arg2Of | transfected,were |
R13323 | T18817 | T18818 | arg1Of | transfected,with |
R13324 | T18817 | T18820 | arg1Of | transfected,by |
R13325 | T18817 | T18822 | arg1Of | transfected,( |
R13326 | T18819 | T18818 | arg2Of | plasmids,with |
R13327 | T18821 | T18820 | arg2Of | FuGENE6,by |
R13328 | T18823 | T18824 | arg1Of | Roche,"," |
R13329 | T18824 | T18826 | arg1Of | ",","," |
R13330 | T18825 | T18824 | arg2Of | Indianapolis,"," |
R13331 | T18826 | T18828 | arg1Of | ",","," |
R13332 | T18827 | T18826 | arg2Of | Indiana,"," |
R13333 | T18829 | T18828 | arg2Of | United,"," |
R13334 | T18830 | T18822 | arg2Of | States,( |
R13335 | T18830 | T18823 | arg1Of | States,Roche |
R13336 | T18830 | T18825 | arg1Of | States,Indianapolis |
R13337 | T18830 | T18827 | arg1Of | States,Indiana |
R13338 | T18830 | T18829 | arg1Of | States,United |
R13339 | T18831 | T18822 | arg3Of | ),( |
R13340 | T18832 | T18833 | arg1Of | Cells,were |
R13341 | T18832 | T18834 | arg2Of | Cells,transfected |
R13342 | T18834 | T18833 | arg2Of | transfected,were |
R13343 | T18834 | T18835 | arg1Of | transfected,with |
R13344 | T18834 | T18844 | arg1Of | transfected,along |
R13345 | T18839 | T18835 | arg2Of | constructs,with |
R13346 | T18839 | T18836 | arg1Of | constructs,ɛy |
R13347 | T18839 | T18837 | arg1Of | constructs,promoter |
R13348 | T18839 | T18838 | arg1Of | constructs,reporter |
R13349 | T18839 | T18840 | arg1Of | constructs,( |
R13350 | T18842 | T18840 | arg2Of | ng,( |
R13351 | T18842 | T18841 | arg1Of | ng,500 |
R13352 | T18843 | T18840 | arg3Of | ),( |
R13353 | T18844 | T18845 | arg1Of | along,with |
R13354 | T18848 | T18847 | arg1Of | vector,empty |
R13355 | T18848 | T18849 | arg1Of | vector,or |
R13356 | T18849 | T18845 | arg2Of | or,with |
R13357 | T18849 | T18846 | arg1Of | or,either |
R13358 | T18852 | T18849 | arg2Of | vector,or |
R13359 | T18852 | T18850 | arg1Of | vector,Sox6 |
R13360 | T18852 | T18851 | arg1Of | vector,overexpression |
R13361 | T18852 | T18853 | arg1Of | vector,( |
R13362 | T18855 | T18853 | arg2Of | ng,( |
R13363 | T18855 | T18854 | arg1Of | ng,1000 |
R13364 | T18856 | T18853 | arg3Of | ),( |
R13365 | T18858 | T18857 | arg2Of | assays,In |
R13366 | T18858 | T18859 | arg1Of | assays,of |
R13367 | T18861 | T18859 | arg2Of | effect,of |
R13368 | T18861 | T18860 | arg1Of | effect,dosage |
R13369 | T18863 | T18864 | arg1Of | we,used |
R13370 | T18864 | T18857 | arg1Of | used,In |
R13371 | T18864 | T18862 | arg1Of | used,"," |
R13372 | T18866 | T18865 | arg1Of | ng,200 |
R13373 | T18866 | T18867 | arg1Of | ng,"," |
R13374 | T18867 | T18871 | arg1Of | ",",and |
R13375 | T18869 | T18867 | arg2Of | ng,"," |
R13376 | T18869 | T18868 | arg1Of | ng,500 |
R13377 | T18871 | T18864 | arg2Of | and,used |
R13378 | T18871 | T18870 | arg1Of | and,"," |
R13379 | T18871 | T18874 | arg1Of | and,) |
R13380 | T18871 | T18880 | modOf | and,ega |
R13381 | T18873 | T18871 | arg2Of | ng,and |
R13382 | T18873 | T18872 | arg1Of | ng,1000 |
R13383 | T18876 | T18875 | arg1Of | MV 1,. pRL-C |
R13384 | T18876 | T18877 | arg1Of | MV 1,5 |
R13385 | T18876 | T18880 | arg1Of | MV 1,ega |
R13386 | T18876 | T18881 | arg2Of | MV 1,) wa |
R13387 | T18878 | T18877 | arg2Of | ng (Pro,5 |
R13388 | T18879 | T18877 | arg3Of | m,5 |
R13389 | T18881 | T18880 | arg2Of | ) wa,ega |
R13390 | T18881 | T18882 | arg1Of | ) wa,s |
R13391 | T18884 | T18882 | arg2Of | sed as ,s |
R13392 | T18884 | T18883 | arg1Of | sed as ,u |
R13393 | T18884 | T18885 | arg1Of | sed as ,a c |
R13394 | T18887 | T18885 | arg2Of | ransfectio,a c |
R13395 | T18887 | T18886 | arg1Of | ransfectio,ontrol for t |
R13578 | T19152 | T19150 | arg1Of | extract,Nuclear |
R13579 | T19152 | T19151 | arg1Of | extract,protein |
R13580 | T19152 | T19153 | arg1Of | extract,and |
R13581 | T19155 | T19154 | arg1Of | vitro,in |
R13582 | T19156 | T19153 | arg2Of | translation,and |
R13583 | T19156 | T19155 | arg1Of | translation,vitro |
R13584 | T19156 | T19157 | arg1Of | translation,of |
R13585 | T19158 | T19157 | arg2Of | Sox6,of |
R13586 | T19160 | T19159 | arg1Of | extracts,Nuclear |
R13587 | T19160 | T19161 | arg1Of | extracts,were |
R13588 | T19160 | T19162 | arg2Of | extracts,prepared |
R13589 | T19162 | T19161 | arg2Of | prepared,were |
R13590 | T19162 | T19163 | arg1Of | prepared,from |
R13591 | T19165 | T19163 | arg2Of | cells,from |
R13592 | T19165 | T19164 | arg1Of | cells,MEL |
R13593 | T19165 | T19166 | arg1Of | cells,( |
R13594 | T19165 | T19171 | arg1Of | cells,using |
R13595 | T19167 | T19168 | arg1Of | 2,× |
R13596 | T19168 | T19166 | arg2Of | ×,( |
R13597 | T19169 | T19168 | arg2Of | 107,× |
R13598 | T19170 | T19166 | arg3Of | ),( |
R13599 | T19173 | T19171 | arg2Of | kit,using |
R13600 | T19173 | T19172 | arg1Of | kit,a |
R13601 | T19173 | T19174 | arg1Of | kit,( |
R13602 | T19176 | T19177 | arg1Of | Motif,"," |
R13603 | T19177 | T19179 | arg1Of | ",","," |
R13604 | T19178 | T19177 | arg2Of | Carlsbad,"," |
R13605 | T19179 | T19175 | arg1Of | ",",Active |
R13606 | T19179 | T19181 | arg1Of | ",","," |
R13607 | T19180 | T19179 | arg2Of | California,"," |
R13608 | T19181 | T19174 | arg2Of | ",",( |
R13609 | T19183 | T19181 | arg2Of | States,"," |
R13610 | T19183 | T19182 | arg1Of | States,United |
R13611 | T19184 | T19174 | arg3Of | ),( |
R13612 | T19188 | T19187 | arg1Of | vitro,in |
R13613 | T19191 | T19185 | arg1Of | vector,The |
R13614 | T19191 | T19186 | arg1Of | vector,Sox6 |
R13615 | T19191 | T19188 | arg1Of | vector,vitro |
R13616 | T19191 | T19189 | arg1Of | vector,translation |
R13617 | T19191 | T19190 | arg1Of | vector,expression |
R13618 | T19191 | T19192 | arg1Of | vector,"," |
R13619 | T19191 | T19193 | arg2Of | vector,tagged |
R13620 | T19191 | T19199 | arg1Of | vector,was |
R13621 | T19191 | T19200 | arg2Of | vector,described |
R13622 | T19193 | T19194 | arg1Of | tagged,with |
R13623 | T19195 | T19196 | arg1Of | c-Myc,and |
R13624 | T19196 | T19194 | arg2Of | and,with |
R13625 | T19197 | T19196 | arg2Of | HA,and |
R13626 | T19200 | T19198 | arg1Of | described,"," |
R13627 | T19200 | T19199 | arg2Of | described,was |
R13628 | T19200 | T19201 | arg1Of | described,before |
R13629 | T19203 | T19201 | arg2Of | 15,before |
R13630 | T19203 | T19202 | arg2Of | 15,[ |
R13631 | T19204 | T19202 | arg3Of | ],[ |
R13632 | T19206 | T19205 | arg1Of | translation,The |
R13633 | T19206 | T19207 | arg1Of | translation,was |
R13634 | T19206 | T19208 | arg2Of | translation,performed |
R13635 | T19208 | T19207 | arg2Of | performed,was |
R13636 | T19208 | T19209 | arg1Of | performed,in |
R13637 | T19212 | T19209 | arg2Of | lysate,in |
R13638 | T19212 | T19210 | arg1Of | lysate,a |
R13639 | T19212 | T19211 | arg1Of | lysate,reticulocyte |
R13640 | T19212 | T19213 | arg2Of | lysate,based |
R13641 | T19213 | T19215 | arg1Of | based,vitro |
R13642 | T19215 | T19214 | arg1Of | vitro,in |
R13643 | T19217 | T19209 | arg3Of | system,in |
R13644 | T19217 | T19216 | arg1Of | system,translational |
R13645 | T19217 | T19218 | arg1Of | system,( |
R13646 | T19223 | T19218 | arg2Of | Systems,( |
R13647 | T19223 | T19219 | arg1Of | Systems,TNT® |
R13648 | T19223 | T19220 | arg1Of | Systems,Quick |
R13649 | T19223 | T19221 | arg1Of | Systems,Coupled |
R13650 | T19223 | T19222 | arg1Of | Systems,Transcription/Translation |
R13651 | T19223 | T19224 | arg1Of | Systems,"," |
R13652 | T19223 | T19225 | arg1Of | Systems,Promega |
R13653 | T19226 | T19218 | arg3Of | ),( |
R13654 | T19228 | T19227 | arg1Of | vector,A |
R13655 | T19228 | T19229 | arg1Of | vector,without |
R13656 | T19228 | T19234 | arg1Of | vector,was |
R13657 | T19228 | T19236 | arg2Of | vector,translated |
R13658 | T19233 | T19229 | arg2Of | sequence,without |
R13659 | T19233 | T19230 | arg1Of | sequence,the |
R13660 | T19233 | T19231 | arg1Of | sequence,Sox6 |
R13661 | T19233 | T19232 | arg1Of | sequence,coding |
R13662 | T19236 | T19234 | arg2Of | translated,was |
R13663 | T19236 | T19235 | arg1Of | translated,also |
R13664 | T19236 | T19237 | arg1Of | translated,as |
R13665 | T19240 | T19237 | arg2Of | control,as |
R13666 | T19240 | T19238 | arg1Of | control,a |
R13667 | T19240 | T19239 | arg1Of | control,negative |
R13772 | T19429 | T19428 | arg1Of | antibodies,Sox6 |
R13773 | T19429 | T19430 | arg2Of | antibodies,used |
R13774 | T19429 | T19434 | arg1Of | antibodies,were |
R13775 | T19429 | T19437 | arg2Of | antibodies,provided |
R13776 | T19429 | T19454 | arg2Of | antibodies,obtained |
R13777 | T19430 | T19431 | arg1Of | used,in |
R13778 | T19433 | T19431 | arg2Of | study,in |
R13779 | T19433 | T19432 | arg1Of | study,this |
R13780 | T19437 | T19436 | arg1Of | provided,kindly |
R13781 | T19437 | T19452 | arg1Of | provided,or |
R13782 | T19441 | T19437 | arg1Of | Lalli,provided |
R13783 | T19441 | T19438 | arg2Of | Lalli,by |
R13784 | T19441 | T19439 | arg1Of | Lalli,Dr. |
R13785 | T19441 | T19440 | arg1Of | Lalli,Enzo |
R13786 | T19441 | T19442 | arg1Of | Lalli,( |
R13787 | T19445 | T19443 | arg1Of | Pasteur,Université |
R13788 | T19445 | T19444 | arg1Of | Pasteur,Louis |
R13789 | T19445 | T19446 | arg1Of | Pasteur,"," |
R13790 | T19446 | T19442 | arg2Of | ",",( |
R13791 | T19447 | T19446 | arg2Of | France,"," |
R13792 | T19447 | T19448 | arg1Of | France,[ |
R13793 | T19449 | T19448 | arg2Of | 7,[ |
R13794 | T19450 | T19448 | arg3Of | ],[ |
R13795 | T19451 | T19442 | arg3Of | ),( |
R13796 | T19452 | T19434 | arg2Of | or,were |
R13797 | T19452 | T19435 | arg1Of | or,either |
R13798 | T19454 | T19452 | arg2Of | obtained,or |
R13799 | T19454 | T19453 | arg1Of | obtained,commercially |
R13800 | T19454 | T19455 | arg1Of | obtained,( |
R13801 | T19459 | T19455 | arg2Of | X,( |
R13802 | T19459 | T19456 | arg1Of | X,Catalog |
R13803 | T19459 | T19457 | arg1Of | X,No. |
R13804 | T19459 | T19458 | arg1Of | X,sc-17332 |
R13805 | T19459 | T19460 | arg1Of | X,"," |
R13806 | T19459 | T19469 | arg1Of | X,"," |
R13807 | T19463 | T19460 | arg2Of | Biotechnology,"," |
R13808 | T19463 | T19461 | arg1Of | Biotechnology,Santa |
R13809 | T19463 | T19462 | arg1Of | Biotechnology,Cruz |
R13810 | T19463 | T19464 | arg1Of | Biotechnology,"," |
R13811 | T19466 | T19465 | arg1Of | Cruz,Santa |
R13812 | T19466 | T19467 | arg1Of | Cruz,"," |
R13813 | T19467 | T19464 | arg2Of | ",","," |
R13814 | T19468 | T19467 | arg2Of | California,"," |
R13815 | T19471 | T19469 | arg2Of | States,"," |
R13816 | T19471 | T19470 | arg1Of | States,United |
R13817 | T19472 | T19455 | arg3Of | ),( |
R13818 | T19474 | T19473 | arg1Of | Sox6,All |
R13819 | T19474 | T19481 | arg1Of | Sox6,was |
R13820 | T19474 | T19482 | arg2Of | Sox6,purchased |
R13821 | T19475 | T19476 | arg1Of | antibodies,generated |
R13822 | T19480 | T19476 | arg2Of | antibody,generated |
R13823 | T19480 | T19477 | arg1Of | antibody,similar |
R13824 | T19480 | T19478 | arg1Of | antibody,results. |
R13825 | T19480 | T19479 | arg1Of | antibody,c-Myc |
R13826 | T19482 | T19476 | arg3Of | purchased,generated |
R13827 | T19482 | T19481 | arg2Of | purchased,was |
R13828 | T19482 | T19483 | arg1Of | purchased,from |
R13829 | T19485 | T19483 | arg2Of | Normal,from |
R13830 | T19485 | T19484 | arg1Of | Normal,Invitrogen. |
R13831 | T19488 | T19486 | arg1Of | antibody,rabbit |
R13832 | T19488 | T19487 | arg1Of | antibody,IgG |
R13833 | T19488 | T19489 | arg1Of | antibody,was |
R13834 | T19488 | T19490 | arg2Of | antibody,obtained |
R13835 | T19490 | T19481 | modOf | obtained,was |
R13836 | T19490 | T19489 | arg2Of | obtained,was |
R13837 | T19490 | T19491 | arg1Of | obtained,from |
R13838 | T19493 | T19491 | arg2Of | Biotechnology,from |
R13839 | T19493 | T19492 | arg1Of | Biotechnology,Upstate |
R13840 | T19493 | T19494 | arg1Of | Biotechnology,( |
R13841 | T19496 | T19494 | arg2Of | Placid,( |
R13842 | T19496 | T19495 | arg1Of | Placid,Lake |
R13843 | T19496 | T19497 | arg1Of | Placid,"," |
R13844 | T19496 | T19500 | arg1Of | Placid,"," |
R13845 | T19499 | T19497 | arg2Of | York,"," |
R13846 | T19499 | T19498 | arg1Of | York,New |
R13847 | T19502 | T19500 | arg2Of | States,"," |
R13848 | T19502 | T19501 | arg1Of | States,United |
R13849 | T19503 | T19494 | arg3Of | ),( |
R13935 | T19697 | T19695 | arg1Of | oligonucleotides,Single-stranded |
R13936 | T19697 | T19696 | arg1Of | oligonucleotides,complementary |
R13937 | T19697 | T19698 | arg1Of | oligonucleotides,were |
R13938 | T19697 | T19699 | arg2Of | oligonucleotides,annealed |
R13939 | T19697 | T19701 | arg2Of | oligonucleotides,end-labeled |
R13940 | T19699 | T19700 | arg1Of | annealed,and |
R13941 | T19700 | T19698 | arg2Of | and,were |
R13942 | T19701 | T19700 | arg2Of | end-labeled,and |
R13943 | T19701 | T19702 | arg1Of | end-labeled,with |
R13944 | T19704 | T19703 | arg2Of | γ-32P,[ |
R13945 | T19705 | T19703 | arg3Of | ],[ |
R13946 | T19706 | T19702 | arg2Of | ATP,with |
R13947 | T19706 | T19703 | arg1Of | ATP,[ |
R13948 | T19706 | T19707 | arg1Of | ATP,with |
R13949 | T19710 | T19707 | arg2Of | kinase,with |
R13950 | T19710 | T19708 | arg1Of | kinase,T4 |
R13951 | T19710 | T19709 | arg1Of | kinase,polynucleotide |
R13952 | T19711 | T19712 | arg1Of | EMSA,was |
R13953 | T19711 | T19713 | arg2Of | EMSA,performed |
R13954 | T19713 | T19712 | arg2Of | performed,was |
R13955 | T19713 | T19714 | arg1Of | performed,with |
R13956 | T19713 | T19738 | arg1Of | performed,: |
R13957 | T19716 | T19715 | arg1Of | μg,5 |
R13958 | T19716 | T19717 | arg1Of | μg,of |
R13959 | T19716 | T19723 | arg1Of | μg,or |
R13960 | T19719 | T19717 | arg2Of | proteins,of |
R13961 | T19719 | T19718 | arg1Of | proteins,nuclear |
R13962 | T19719 | T19720 | arg1Of | proteins,from |
R13963 | T19722 | T19720 | arg2Of | cells,from |
R13964 | T19722 | T19721 | arg1Of | cells,MEL |
R13965 | T19723 | T19714 | arg2Of | or,with |
R13966 | T19723 | T19731 | arg1Of | or,with |
R13967 | T19725 | T19723 | arg2Of | μl,or |
R13968 | T19725 | T19724 | arg1Of | μl,3 |
R13969 | T19725 | T19726 | arg1Of | μl,of |
R13970 | T19728 | T19727 | arg1Of | vitro-translated,in |
R13971 | T19729 | T19726 | arg2Of | Sox6,of |
R13972 | T19729 | T19728 | arg1Of | Sox6,vitro-translated |
R13973 | T19731 | T19730 | arg1Of | with,along |
R13974 | T19734 | T19731 | arg2Of | lysate,with |
R13975 | T19734 | T19732 | arg1Of | lysate,the |
R13976 | T19734 | T19733 | arg1Of | lysate,reticulocyte |
R13977 | T19734 | T19735 | arg1Of | lysate,in |
R13978 | T19737 | T19735 | arg2Of | buffer,in |
R13979 | T19737 | T19736 | arg1Of | buffer,binding |
R13980 | T19739 | T19740 | arg1Of | 100,mM |
R13981 | T19741 | T19739 | arg1Of | NaCl,100 |
R13982 | T19741 | T19742 | arg1Of | NaCl,"," |
R13983 | T19742 | T19746 | arg1Of | ",","," |
R13984 | T19743 | T19744 | arg1Of | 10,% |
R13985 | T19745 | T19742 | arg2Of | glycerol,"," |
R13986 | T19745 | T19743 | arg1Of | glycerol,10 |
R13987 | T19746 | T19750 | arg1Of | ",","," |
R13988 | T19749 | T19746 | arg2Of | BSA,"," |
R13989 | T19749 | T19747 | arg1Of | BSA,200 |
R13990 | T19749 | T19748 | arg1Of | BSA,ng/μl |
R13991 | T19750 | T19757 | arg1Of | ",",or |
R13992 | T19753 | T19750 | arg2Of | poly,"," |
R13993 | T19753 | T19751 | arg1Of | poly,50 |
R13994 | T19753 | T19752 | arg1Of | poly,ng/μl |
R13995 | T19753 | T19754 | arg1Of | poly,( |
R13996 | T19755 | T19754 | arg2Of | dI-dC,( |
R13997 | T19756 | T19754 | arg3Of | ),( |
R13998 | T19757 | T19770 | arg1Of | or,"," |
R13999 | T19758 | T19759 | arg1Of | poly,( |
R14000 | T19758 | T19762 | arg1Of | poly,"," |
R14001 | T19760 | T19759 | arg2Of | dG-dC,( |
R14002 | T19761 | T19759 | arg3Of | ),( |
R14003 | T19762 | T19757 | arg2Of | ",",or |
R14004 | T19763 | T19764 | arg1Of | 10,mM |
R14005 | T19765 | T19762 | arg2Of | HEPES,"," |
R14006 | T19765 | T19763 | arg1Of | HEPES,10 |
R14007 | T19765 | T19766 | arg1Of | HEPES,( |
R14008 | T19767 | T19766 | arg2Of | pH,( |
R14009 | T19767 | T19768 | arg1Of | pH,7 |
R14010 | T19769 | T19766 | arg3Of | ),( |
R14011 | T19771 | T19772 | arg1Of | 0.1,mM |
R14012 | T19773 | T19770 | arg2Of | EDTA,"," |
R14013 | T19773 | T19771 | arg1Of | EDTA,0.1 |
R14014 | T19773 | T19774 | arg1Of | EDTA,"," |
R14015 | T19773 | T19778 | arg1Of | EDTA,"," |
R14016 | T19775 | T19776 | arg1Of | 0.25,mM |
R14017 | T19777 | T19774 | arg2Of | DTT,"," |
R14018 | T19777 | T19775 | arg1Of | DTT,0.25 |
R14019 | T19779 | T19780 | arg1Of | 0.6,mM |
R14020 | T19781 | T19778 | arg2Of | MgCl2,"," |
R14021 | T19781 | T19779 | arg1Of | MgCl2,0.6 |
R14022 | T19783 | T19784 | arg1Of | competition,or |
R14023 | T19784 | T19782 | arg2Of | or,For |
R14024 | T19786 | T19784 | arg2Of | assays,or |
R14025 | T19786 | T19785 | arg1Of | assays,supershift |
R14026 | T19792 | T19789 | arg2Of | competitor,indicated |
R14027 | T19792 | T19790 | arg1Of | competitor,unlabelled |
R14028 | T19792 | T19791 | arg1Of | competitor,oligonucleotide |
R14029 | T19792 | T19793 | arg1Of | competitor,( |
R14030 | T19792 | T19798 | arg1Of | competitor,or |
R14031 | T19796 | T19793 | arg2Of | excess,( |
R14032 | T19796 | T19794 | arg1Of | excess,200-fold |
R14033 | T19796 | T19795 | arg1Of | excess,molar |
R14034 | T19797 | T19793 | arg3Of | ),( |
R14035 | T19798 | T19788 | arg1Of | or,the |
R14036 | T19798 | T19804 | arg1Of | or,was |
R14037 | T19798 | T19805 | arg2Of | or,added |
R14038 | T19799 | T19798 | arg2Of | antibody,or |
R14039 | T19799 | T19800 | arg1Of | antibody,( |
R14040 | T19802 | T19800 | arg2Of | μl,( |
R14041 | T19802 | T19801 | arg1Of | μl,3 |
R14042 | T19803 | T19800 | arg3Of | ),( |
R14043 | T19805 | T19782 | arg1Of | added,For |
R14044 | T19805 | T19787 | arg1Of | added,"," |
R14045 | T19805 | T19804 | arg2Of | added,was |
R14046 | T19806 | T19808 | arg1Of | 30,to |
R14047 | T19808 | T19807 | arg1Of | to,min |
R14048 | T19809 | T19808 | arg2Of | 60,to |
R14049 | T19810 | T19805 | arg3Of | min,added |
R14050 | T19810 | T19806 | arg1Of | min,30 |
R14051 | T19810 | T19811 | arg1Of | min,prior |
R14052 | T19811 | T19812 | arg1Of | prior,to |
R14053 | T19813 | T19812 | arg2Of | addition,to |
R14054 | T19813 | T19814 | arg1Of | addition,of |
R14055 | T19816 | T19814 | arg2Of | probe,of |
R14056 | T19816 | T19815 | arg2Of | probe,radiolabeled |
R14057 | T19818 | T19817 | arg2Of | addition,Following |
R14058 | T19818 | T19819 | arg1Of | addition,of |
R14059 | T19822 | T19819 | arg2Of | probe,of |
R14060 | T19822 | T19820 | arg1Of | probe,the |
R14061 | T19822 | T19821 | arg2Of | probe,radiolabeled |
R14062 | T19825 | T19824 | arg1Of | samples,the |
R14063 | T19825 | T19826 | arg1Of | samples,were |
R14064 | T19825 | T19827 | arg2Of | samples,incubated |
R14065 | T19825 | T19838 | arg2Of | samples,loaded |
R14066 | T19827 | T19828 | arg1Of | incubated,for |
R14067 | T19827 | T19837 | arg1Of | incubated,and |
R14068 | T19830 | T19829 | arg1Of | min,30 |
R14069 | T19830 | T19831 | arg1Of | min,or |
R14070 | T19831 | T19828 | arg2Of | or,for |
R14071 | T19831 | T19834 | arg1Of | or,at |
R14072 | T19833 | T19831 | arg2Of | min,or |
R14073 | T19833 | T19832 | arg1Of | min,60 |
R14074 | T19836 | T19834 | arg2Of | temperature,at |
R14075 | T19836 | T19835 | arg1Of | temperature,room |
R14076 | T19837 | T19817 | arg1Of | and,Following |
R14077 | T19837 | T19823 | arg1Of | and,"," |
R14078 | T19837 | T19826 | arg2Of | and,were |
R14079 | T19838 | T19837 | arg2Of | loaded,and |
R14080 | T19838 | T19839 | arg1Of | loaded,on |
R14081 | T19842 | T19843 | arg1Of | %,or |
R14082 | T19843 | T19841 | arg1Of | or,4 |
R14083 | T19844 | T19843 | arg2Of | 6,or |
R14084 | T19845 | T19839 | arg2Of | %,on |
R14085 | T19845 | T19840 | arg1Of | %,a |
R14086 | T19845 | T19842 | arg1Of | %,% |
R14087 | T19845 | T19844 | arg1Of | %,6 |
R14088 | T19847 | T19846 | arg2Of | w/v,( |
R14089 | T19848 | T19846 | arg3Of | ),( |
R14090 | T19850 | T19838 | arg3Of | gel,loaded |
R14091 | T19850 | T19846 | arg1Of | gel,( |
R14092 | T19850 | T19849 | arg1Of | gel,polyacrylamide |
R14093 | T19851 | T19852 | arg1Of | Electrophoresis,was |
R14094 | T19851 | T19853 | arg2Of | Electrophoresis,performed |
R14095 | T19853 | T19852 | arg2Of | performed,was |
R14096 | T19853 | T19854 | arg1Of | performed,at |
R14097 | T19853 | T19859 | arg1Of | performed,for |
R14098 | T19853 | T19862 | arg1Of | performed,at |
R14099 | T19853 | T19866 | arg1Of | performed,and |
R14100 | T19858 | T19854 | arg2Of | mAmp,at |
R14101 | T19858 | T19855 | arg1Of | mAmp,a |
R14102 | T19858 | T19856 | arg1Of | mAmp,constant |
R14103 | T19858 | T19857 | arg1Of | mAmp,19 |
R14104 | T19861 | T19859 | arg2Of | h,for |
R14105 | T19861 | T19860 | arg1Of | h,4–8 |
R14106 | T19864 | T19862 | arg2Of | temperature,at |
R14107 | T19864 | T19863 | arg1Of | temperature,room |
R14108 | T19866 | T19865 | arg1Of | and,"," |
R14109 | T19868 | T19867 | arg1Of | gels,the |
R14110 | T19868 | T19869 | arg1Of | gels,were |
R14111 | T19868 | T19870 | arg2Of | gels,dried |
R14112 | T19870 | T19866 | arg2Of | dried,and |
R14113 | T19870 | T19869 | arg2Of | dried,were |
R14114 | T19870 | T19871 | arg1Of | dried,prior |
R14115 | T19871 | T19872 | arg1Of | prior,to |
R14116 | T19873 | T19872 | arg2Of | autoradiography,to |
R14117 | T19874 | T19875 | arg2Of | Antibodies,used |
R14118 | T19874 | T19879 | arg1Of | Antibodies,included |
R14119 | T19875 | T19876 | arg1Of | used,for |
R14120 | T19878 | T19876 | arg2Of | analyses,for |
R14121 | T19878 | T19877 | arg1Of | analyses,supershift |
R14122 | T19880 | T19881 | arg1Of | c-Myc,"," |
R14123 | T19881 | T19884 | arg1Of | ",",and |
R14124 | T19882 | T19881 | arg2Of | HA,"," |
R14125 | T19884 | T19883 | arg1Of | and,"," |
R14126 | T19885 | T19884 | arg2Of | Sox6,and |
R14127 | T19886 | T19879 | arg2Of | antibodies,included |
R14128 | T19886 | T19880 | arg1Of | antibodies,c-Myc |
R14129 | T19886 | T19882 | arg1Of | antibodies,HA |
R14130 | T19886 | T19885 | arg1Of | antibodies,Sox6 |
R14131 | T19886 | T19887 | arg1Of | antibodies,( |
R14132 | T19888 | T19887 | arg2Of | described,( |
R14133 | T19888 | T19889 | arg1Of | described,as |
R14134 | T19890 | T19889 | arg2Of | above,as |
R14135 | T19891 | T19887 | arg3Of | ),( |
R14136 | T19894 | T19892 | arg1Of | sequences,The |
R14137 | T19894 | T19893 | arg1Of | sequences,DNA |
R14138 | T19894 | T19895 | arg1Of | sequences,of |
R14139 | T19894 | T19898 | arg1Of | sequences,are |
R14140 | T19894 | T19899 | arg1Of | sequences,as |
R14141 | T19897 | T19895 | arg2Of | oligonucleotides,of |
R14142 | T19897 | T19896 | arg1Of | oligonucleotides,the |
R14143 | T19898 | T19901 | arg1Of | are,( |
R14144 | T19898 | T19908 | arg1Of | are,: |
R14145 | T19899 | T19898 | arg2Of | as,are |
R14146 | T19900 | T19899 | arg2Of | follows,as |
R14147 | T19904 | T19902 | arg1Of | oligos,only |
R14148 | T19904 | T19903 | arg1Of | oligos,forward |
R14149 | T19904 | T19905 | arg1Of | oligos,are |
R14150 | T19904 | T19906 | arg2Of | oligos,listed |
R14151 | T19906 | T19901 | arg2Of | listed,( |
R14152 | T19906 | T19905 | arg2Of | listed,are |
R14153 | T19907 | T19901 | arg3Of | ),( |
R14154 | T19913 | T19909 | arg2Of | probe,For |
R14155 | T19913 | T19910 | arg1Of | probe,the |
R14156 | T19913 | T19911 | arg1Of | probe,36-bp |
R14157 | T19913 | T19912 | arg1Of | probe,WT |
R14158 | T19913 | T19914 | arg1Of | probe,: |
R14159 | T19915 | T19916 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,( |
R14160 | T19915 | T19919 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,; |
R14161 | T19915 | T19920 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,for |
R14162 | T19915 | T19927 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′,: |
R14163 | T19917 | T19916 | arg2Of | MHB1556,( |
R14164 | T19918 | T19916 | arg3Of | ),( |
R14165 | T19922 | T19920 | arg2Of | probe,for |
R14166 | T19922 | T19921 | arg1Of | probe,mutant |
R14167 | T19922 | T19923 | arg1Of | probe,1 |
R14168 | T19922 | T19924 | arg1Of | probe,( |
R14169 | T19925 | T19924 | arg2Of | M1,( |
R14170 | T19926 | T19924 | arg3Of | ),( |
R14171 | T19928 | T19929 | arg1Of | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,( |
R14172 | T19928 | T19932 | arg1Of | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,; |
R14173 | T19928 | T19933 | arg1Of | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,for |
R14174 | T19928 | T19940 | arg1Of | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′,: |
R14175 | T19930 | T19929 | arg2Of | MHB1644,( |
R14176 | T19931 | T19929 | arg3Of | ),( |
R14177 | T19935 | T19933 | arg2Of | probe,for |
R14178 | T19935 | T19934 | arg1Of | probe,mutant |
R14179 | T19935 | T19936 | arg1Of | probe,2 |
R14180 | T19935 | T19937 | arg1Of | probe,( |
R14181 | T19938 | T19937 | arg2Of | M2,( |
R14182 | T19939 | T19937 | arg3Of | ),( |
R14183 | T19941 | T19942 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,( |
R14184 | T19941 | T19945 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,; |
R14185 | T19941 | T19946 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,for |
R14186 | T19941 | T19953 | arg1Of | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′,: |
R14187 | T19943 | T19942 | arg2Of | MHB1648,( |
R14188 | T19944 | T19942 | arg3Of | ),( |
R14189 | T19948 | T19946 | arg2Of | probe,for |
R14190 | T19948 | T19947 | arg1Of | probe,mutant |
R14191 | T19948 | T19949 | arg1Of | probe,3 |
R14192 | T19948 | T19950 | arg1Of | probe,( |
R14193 | T19951 | T19950 | arg2Of | M3,( |
R14194 | T19952 | T19950 | arg3Of | ),( |
R14195 | T19954 | T19955 | arg1Of | 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′,( |
R14196 | T19956 | T19955 | arg2Of | MHB1650,( |
R14197 | T19957 | T19955 | arg3Of | ),( |
R14488 | T20383 | T20382 | arg1Of | assay,ChIP |
R14489 | T20385 | T20384 | arg2Of | described,As |
R14490 | T20387 | T20385 | arg1Of | Nouzova,described |
R14491 | T20387 | T20386 | arg2Of | Nouzova,by |
R14492 | T20387 | T20388 | arg1Of | Nouzova,[ |
R14493 | T20387 | T20391 | arg1Of | Nouzova,"," |
R14494 | T20387 | T20392 | arg1Of | Nouzova,in |
R14495 | T20387 | T20394 | arg1Of | Nouzova,: |
R14496 | T20389 | T20388 | arg2Of | 53,[ |
R14497 | T20390 | T20388 | arg3Of | ],[ |
R14498 | T20393 | T20392 | arg2Of | brief,in |
R14499 | T20395 | T20396 | arg1Of | Cells,from |
R14500 | T20395 | T20413 | arg1Of | Cells,were |
R14501 | T20395 | T20414 | arg2Of | Cells,treated |
R14502 | T20398 | T20397 | arg1Of | cells,MEL |
R14503 | T20398 | T20399 | arg1Of | cells,( |
R14504 | T20398 | T20404 | arg1Of | cells,or |
R14505 | T20401 | T20399 | arg2Of | ×,( |
R14506 | T20401 | T20400 | arg1Of | ×,4 |
R14507 | T20401 | T20402 | arg1Of | ×,107 |
R14508 | T20403 | T20399 | arg3Of | ),( |
R14509 | T20404 | T20396 | arg2Of | or,from |
R14510 | T20407 | T20404 | arg2Of | cells,or |
R14511 | T20407 | T20405 | arg1Of | cells,fetal |
R14512 | T20407 | T20406 | arg1Of | cells,liver |
R14513 | T20407 | T20408 | arg1Of | cells,from |
R14514 | T20412 | T20408 | arg2Of | mice,from |
R14515 | T20412 | T20409 | arg1Of | mice,three |
R14516 | T20412 | T20410 | arg1Of | mice,15.5-dpc |
R14517 | T20412 | T20411 | arg1Of | mice,WT |
R14518 | T20414 | T20413 | arg2Of | treated,were |
R14519 | T20414 | T20415 | arg1Of | treated,with |
R14520 | T20416 | T20417 | arg1Of | 1,% |
R14521 | T20418 | T20415 | arg2Of | formaldehyde,with |
R14522 | T20418 | T20416 | arg1Of | formaldehyde,1 |
R14523 | T20418 | T20419 | arg1Of | formaldehyde,for |
R14524 | T20421 | T20419 | arg2Of | min,for |
R14525 | T20421 | T20420 | arg1Of | min,10 |
R14526 | T20421 | T20422 | arg1Of | min,at |
R14527 | T20421 | T20425 | arg1Of | min,"," |
R14528 | T20421 | T20426 | arg2Of | min,rinsed |
R14529 | T20421 | T20435 | arg1Of | min,with |
R14530 | T20424 | T20422 | arg2Of | °C,at |
R14531 | T20424 | T20423 | arg1Of | °C,37 |
R14532 | T20426 | T20427 | arg1Of | rinsed,in |
R14533 | T20430 | T20431 | arg2Of | Hanks,' |
R14534 | T20434 | T20427 | arg2Of | solution,in |
R14535 | T20434 | T20428 | arg1Of | solution,ice-cold |
R14536 | T20434 | T20429 | arg1Of | solution,1× |
R14537 | T20434 | T20431 | arg1Of | solution,' |
R14538 | T20434 | T20432 | arg1Of | solution,balanced |
R14539 | T20434 | T20433 | arg1Of | solution,salt |
R14540 | T20436 | T20437 | arg1Of | 0.1,% |
R14541 | T20438 | T20435 | arg2Of | EDTA,with |
R14542 | T20438 | T20436 | arg1Of | EDTA,0.1 |
R14543 | T20438 | T20439 | arg1Of | EDTA,containing |
R14544 | T20441 | T20439 | arg2Of | inhibitors,containing |
R14545 | T20441 | T20440 | arg1Of | inhibitors,protease |
R14546 | T20441 | T20442 | arg1Of | inhibitors,"," |
R14547 | T20441 | T20443 | arg2Of | inhibitors,collected |
R14548 | T20441 | T20450 | arg2Of | inhibitors,resuspended |
R14549 | T20441 | T20461 | arg2Of | inhibitors,incubated |
R14550 | T20445 | T20443 | arg1Of | centrifugation,collected |
R14551 | T20445 | T20444 | arg2Of | centrifugation,by |
R14552 | T20445 | T20446 | arg1Of | centrifugation,at |
R14553 | T20448 | T20446 | arg2Of | °C,at |
R14554 | T20448 | T20447 | arg1Of | °C,4 |
R14555 | T20450 | T20451 | arg1Of | resuspended,in |
R14556 | T20450 | T20460 | arg1Of | resuspended,and |
R14557 | T20455 | T20451 | arg2Of | buffer,in |
R14558 | T20455 | T20452 | arg1Of | buffer,a |
R14559 | T20455 | T20453 | arg1Of | buffer,SDS |
R14560 | T20455 | T20454 | arg1Of | buffer,lysis |
R14561 | T20455 | T20456 | arg1Of | buffer,containing |
R14562 | T20458 | T20456 | arg2Of | inhibitors,containing |
R14563 | T20458 | T20457 | arg1Of | inhibitors,protease |
R14564 | T20460 | T20449 | arg1Of | and,"," |
R14565 | T20460 | T20459 | arg1Of | and,"," |
R14566 | T20461 | T20460 | arg2Of | incubated,and |
R14567 | T20461 | T20462 | arg1Of | incubated,on |
R14568 | T20461 | T20464 | arg1Of | incubated,for |
R14569 | T20463 | T20462 | arg2Of | ice,on |
R14570 | T20466 | T20464 | arg2Of | min,for |
R14571 | T20466 | T20465 | arg1Of | min,10 |
R14572 | T20468 | T20467 | arg1Of | complexes,DNA-protein |
R14573 | T20468 | T20469 | arg1Of | complexes,were |
R14574 | T20468 | T20470 | arg2Of | complexes,sonicated |
R14575 | T20470 | T20469 | arg2Of | sonicated,were |
R14576 | T20470 | T20471 | arg1Of | sonicated,to |
R14577 | T20472 | T20473 | arg1Of | 200,and |
R14578 | T20474 | T20473 | arg2Of | 600,and |
R14579 | T20475 | T20471 | arg2Of | bp,to |
R14580 | T20475 | T20472 | arg1Of | bp,200 |
R14581 | T20475 | T20474 | arg1Of | bp,600 |
R14582 | T20476 | T20477 | arg1Of | One-tenth,of |
R14583 | T20476 | T20480 | arg1Of | One-tenth,was |
R14584 | T20476 | T20481 | arg2Of | One-tenth,set |
R14585 | T20479 | T20477 | arg2Of | sample,of |
R14586 | T20479 | T20478 | arg1Of | sample,the |
R14587 | T20481 | T20480 | arg2Of | set,was |
R14588 | T20481 | T20482 | arg1Of | set,aside |
R14589 | T20481 | T20483 | arg1Of | set,for |
R14590 | T20481 | T20487 | arg1Of | set,and |
R14591 | T20485 | T20483 | arg2Of | control,for |
R14592 | T20485 | T20484 | arg1Of | control,input |
R14593 | T20487 | T20486 | arg1Of | and,"," |
R14594 | T20487 | T20496 | arg1Of | and,( |
R14595 | T20490 | T20488 | arg1Of | sample,the |
R14596 | T20490 | T20489 | arg1Of | sample,remaining |
R14597 | T20490 | T20491 | arg1Of | sample,was |
R14598 | T20490 | T20492 | arg2Of | sample,precleared |
R14599 | T20492 | T20487 | arg2Of | precleared,and |
R14600 | T20492 | T20491 | arg2Of | precleared,was |
R14601 | T20492 | T20493 | arg1Of | precleared,with |
R14602 | T20495 | T20493 | arg2Of | A-Sepharose,with |
R14603 | T20495 | T20494 | arg1Of | A-Sepharose,protein |
R14604 | T20498 | T20497 | arg1Of | Biosciences,Amersham |
R14605 | T20498 | T20499 | arg1Of | Biosciences,"," |
R14606 | T20499 | T20501 | arg1Of | ",","," |
R14607 | T20500 | T20499 | arg2Of | Piscataway,"," |
R14608 | T20501 | T20504 | arg1Of | ",","," |
R14609 | T20503 | T20501 | arg2Of | Jersey,"," |
R14610 | T20503 | T20502 | arg1Of | Jersey,New |
R14611 | T20504 | T20496 | arg2Of | ",",( |
R14612 | T20506 | T20504 | arg2Of | States,"," |
R14613 | T20506 | T20505 | arg1Of | States,United |
R14614 | T20507 | T20496 | arg3Of | ),( |
R14615 | T20509 | T20508 | arg2Of | preclearing,Following |
R14616 | T20512 | T20511 | arg1Of | samples,the |
R14617 | T20512 | T20513 | arg1Of | samples,were |
R14618 | T20512 | T20514 | arg2Of | samples,split |
R14619 | T20514 | T20513 | arg2Of | split,were |
R14620 | T20514 | T20515 | arg1Of | split,into |
R14621 | T20514 | T20532 | arg1Of | split,and |
R14622 | T20516 | T20515 | arg2Of | thirds,into |
R14623 | T20516 | T20517 | arg1Of | thirds,: |
R14624 | T20519 | T20517 | arg2Of | sample,: |
R14625 | T20519 | T20518 | arg1Of | sample,one |
R14626 | T20519 | T20520 | arg2Of | sample,treated |
R14627 | T20520 | T20521 | arg1Of | treated,with |
R14628 | T20522 | T20521 | arg2Of | anti-Sox6,with |
R14629 | T20522 | T20523 | arg1Of | anti-Sox6,"," |
R14630 | T20525 | T20523 | arg2Of | second,"," |
R14631 | T20525 | T20524 | arg1Of | second,a |
R14632 | T20525 | T20526 | arg2Of | second,treated |
R14633 | T20526 | T20527 | arg1Of | treated,with |
R14634 | T20530 | T20527 | arg2Of | IgG,with |
R14635 | T20530 | T20528 | arg1Of | IgG,normal |
R14636 | T20530 | T20529 | arg1Of | IgG,rabbit |
R14637 | T20532 | T20508 | arg1Of | and,Following |
R14638 | T20532 | T20510 | arg1Of | and,"," |
R14639 | T20532 | T20531 | arg1Of | and,"," |
R14640 | T20535 | T20533 | arg1Of | sample,the |
R14641 | T20535 | T20534 | arg1Of | sample,third |
R14642 | T20535 | T20536 | arg1Of | sample,without |
R14643 | T20535 | T20541 | arg1Of | sample,were |
R14644 | T20535 | T20542 | arg2Of | sample,used |
R14645 | T20540 | T20536 | arg2Of | two,without |
R14646 | T20540 | T20537 | arg1Of | two,Ab. |
R14647 | T20540 | T20538 | arg1Of | two,The |
R14648 | T20540 | T20539 | arg1Of | two,last |
R14649 | T20542 | T20532 | arg2Of | used,and |
R14650 | T20542 | T20541 | arg2Of | used,were |
R14651 | T20542 | T20543 | arg1Of | used,as |
R14652 | T20545 | T20543 | arg2Of | controls,as |
R14653 | T20545 | T20544 | arg1Of | controls,negative |
R14654 | T20548 | T20546 | arg1Of | complexes,The |
R14655 | T20548 | T20547 | arg1Of | complexes,chromatin-antibody |
R14656 | T20548 | T20549 | arg1Of | complexes,were |
R14657 | T20548 | T20550 | arg2Of | complexes,eluted |
R14658 | T20550 | T20549 | arg2Of | eluted,were |
R14659 | T20550 | T20552 | arg1Of | eluted,and |
R14660 | T20552 | T20551 | arg1Of | and,"," |
R14661 | T20556 | T20553 | arg1Of | cross-links,the |
R14662 | T20556 | T20554 | arg1Of | cross-links,DNA |
R14663 | T20556 | T20555 | arg1Of | cross-links,protein |
R14664 | T20556 | T20557 | arg1Of | cross-links,were |
R14665 | T20556 | T20558 | arg2Of | cross-links,reversed |
R14666 | T20558 | T20552 | arg2Of | reversed,and |
R14667 | T20558 | T20557 | arg2Of | reversed,were |
R14668 | T20558 | T20559 | arg1Of | reversed,with |
R14669 | T20558 | T20563 | arg1Of | reversed,at |
R14670 | T20560 | T20561 | arg1Of | 5,M |
R14671 | T20562 | T20559 | arg2Of | NaCl,with |
R14672 | T20562 | T20560 | arg1Of | NaCl,5 |
R14673 | T20565 | T20563 | arg2Of | °C,at |
R14674 | T20565 | T20564 | arg1Of | °C,65 |
R14675 | T20565 | T20566 | arg1Of | °C,for |
R14676 | T20568 | T20566 | arg2Of | h,for |
R14677 | T20568 | T20567 | arg1Of | h,4 |
R14678 | T20570 | T20569 | arg1Of | DNA,Input |
R14679 | T20570 | T20571 | arg1Of | DNA,or |
R14680 | T20571 | T20574 | arg1Of | or,was |
R14681 | T20571 | T20575 | arg2Of | or,used |
R14682 | T20573 | T20571 | arg2Of | DNA,or |
R14683 | T20573 | T20572 | arg2Of | DNA,immunoprecipitated |
R14684 | T20575 | T20574 | arg2Of | used,was |
R14685 | T20575 | T20576 | arg1Of | used,as |
R14686 | T20578 | T20576 | arg2Of | template,as |
R14687 | T20578 | T20577 | arg1Of | template,a |
R14688 | T20578 | T20579 | arg1Of | template,in |
R14689 | T20582 | T20579 | arg2Of | reaction,in |
R14690 | T20582 | T20580 | arg1Of | reaction,the |
R14691 | T20582 | T20581 | arg1Of | reaction,PCR |
R14692 | T20584 | T20583 | arg1Of | amplification,PCR |
R14693 | T20584 | T20585 | arg1Of | amplification,of |
R14694 | T20584 | T20589 | arg1Of | amplification,was |
R14695 | T20584 | T20590 | arg2Of | amplification,performed |
R14696 | T20584 | T20592 | arg1Of | amplification,yielded |
R14697 | T20588 | T20585 | arg2Of | promoter,of |
R14698 | T20588 | T20586 | arg1Of | promoter,the |
R14699 | T20588 | T20587 | arg1Of | promoter,ɛy |
R14700 | T20590 | T20589 | arg2Of | performed,was |
R14701 | T20590 | T20591 | arg1Of | performed,and |
R14702 | T20591 | T20596 | arg1Of | and,"," |
R14703 | T20591 | T20597 | arg1Of | and,corresponding |
R14704 | T20592 | T20591 | arg2Of | yielded,and |
R14705 | T20595 | T20592 | arg2Of | amplicon,yielded |
R14706 | T20595 | T20593 | arg1Of | amplicon,a |
R14707 | T20595 | T20594 | arg1Of | amplicon,172-bp |
R14708 | T20598 | T20597 | arg2Of | to,corresponding |
R14709 | T20599 | T20598 | arg2Of | nucleotides,to |
R14710 | T20599 | T20600 | arg1Of | nucleotides,−31 |
R14711 | T20600 | T20601 | arg1Of | −31,to |
R14712 | T20602 | T20601 | arg2Of | +140,to |
R14713 | T20602 | T20603 | arg1Of | +140,of |
R14714 | T20602 | T20607 | arg1Of | +140,( |
R14715 | T20606 | T20603 | arg2Of | promoter,of |
R14716 | T20606 | T20604 | arg1Of | promoter,the |
R14717 | T20606 | T20605 | arg1Of | promoter,ɛy |
R14718 | T20609 | T20610 | arg1Of | MHB1688,"," |
R14719 | T20610 | T20613 | arg1Of | ",",and |
R14720 | T20611 | T20610 | arg2Of | 5′CGAAGAATAAAAGGCCACCA3′,"," |
R14721 | T20613 | T20607 | arg2Of | and,( |
R14722 | T20613 | T20608 | arg1Of | and,primers |
R14723 | T20613 | T20612 | arg1Of | and,; |
R14724 | T20613 | T20615 | arg1Of | and,"," |
R14725 | T20614 | T20613 | arg2Of | MHB1689,and |
R14726 | T20616 | T20615 | arg2Of | 5′GCTTCACCACCAACCTCTTC3′,"," |
R14727 | T20617 | T20607 | arg3Of | ),( |
R14728 | T20618 | T20619 | arg1Of | PCR,was |
R14729 | T20618 | T20620 | arg2Of | PCR,performed |
R14730 | T20620 | T20619 | arg2Of | performed,was |
R14731 | T20620 | T20621 | arg1Of | performed,under |
R14732 | T20620 | T20625 | arg1Of | performed,: |
R14733 | T20624 | T20621 | arg2Of | conditions,under |
R14734 | T20624 | T20622 | arg1Of | conditions,the |
R14735 | T20624 | T20623 | arg1Of | conditions,following |
R14736 | T20627 | T20626 | arg1Of | °C,95 |
R14737 | T20627 | T20628 | arg1Of | °C,for |
R14738 | T20627 | T20631 | arg1Of | °C,followed |
R14739 | T20627 | T20655 | arg1Of | °C,ending |
R14740 | T20630 | T20628 | arg2Of | min,for |
R14741 | T20630 | T20629 | arg1Of | min,15 |
R14742 | T20631 | T20632 | arg1Of | followed,by |
R14743 | T20631 | T20635 | arg1Of | followed,at |
R14744 | T20631 | T20638 | arg1Of | followed,for |
R14745 | T20631 | T20641 | arg1Of | followed,"," |
R14746 | T20631 | T20651 | arg1Of | followed,for |
R14747 | T20631 | T20654 | arg1Of | followed,"," |
R14748 | T20631 | T20655 | modOf | followed,ending |
R14749 | T20634 | T20632 | arg2Of | cycles,by |
R14750 | T20634 | T20633 | arg1Of | cycles,30 |
R14751 | T20637 | T20635 | arg2Of | °C,at |
R14752 | T20637 | T20636 | arg1Of | °C,95 |
R14753 | T20640 | T20638 | arg2Of | s,for |
R14754 | T20640 | T20639 | arg1Of | s,30 |
R14755 | T20643 | T20642 | arg1Of | °C,60 |
R14756 | T20643 | T20644 | arg1Of | °C,for |
R14757 | T20643 | T20648 | arg1Of | °C,and |
R14758 | T20646 | T20644 | arg2Of | s,for |
R14759 | T20646 | T20645 | arg1Of | s,30 |
R14760 | T20648 | T20631 | arg2Of | and,followed |
R14761 | T20648 | T20647 | arg1Of | and,"," |
R14762 | T20650 | T20648 | arg2Of | °C,and |
R14763 | T20650 | T20649 | arg1Of | °C,72 |
R14764 | T20653 | T20651 | arg2Of | s,for |
R14765 | T20653 | T20652 | arg1Of | s,45 |
R14766 | T20655 | T20656 | arg1Of | ending,with |
R14767 | T20655 | T20663 | arg1Of | ending,for |
R14768 | T20659 | T20656 | arg2Of | extension,with |
R14769 | T20659 | T20657 | arg1Of | extension,a |
R14770 | T20659 | T20658 | arg1Of | extension,final |
R14771 | T20659 | T20660 | arg1Of | extension,at |
R14772 | T20662 | T20660 | arg2Of | °C,at |
R14773 | T20662 | T20661 | arg1Of | °C,72 |
R14774 | T20665 | T20663 | arg2Of | min,for |
R14775 | T20665 | T20664 | arg1Of | min,5 |
bionlp-st-ge-2016-test-proteins
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20360 | 10215-10217 | Protein | denotes | ɛy |
T20359 | 10110-10112 | Protein | denotes | ɛy |
T20358 | 9756-9760 | Protein | denotes | Sox6 |
T20357 | 9585-9594 | Protein | denotes | protein A |
T19138 | 7072-7076 | Protein | denotes | Sox6 |
T19137 | 6864-6866 | Protein | denotes | HA |
T19136 | 6854-6859 | Protein | denotes | c-Myc |
T19135 | 6797-6801 | Protein | denotes | Sox6 |
T19134 | 6666-6670 | Protein | denotes | Sox6 |
T17176 | 3471-3476 | Protein | denotes | GAPDH |
T17175 | 3168-3173 | Protein | denotes | GAPDH |
T17174 | 2770-2780 | Protein | denotes | min globin |
T17173 | 2765-2769 | Protein | denotes | βmaj |
T17172 | 2675-2685 | Protein | denotes | βH1 globin |
T17171 | 2586-2594 | Protein | denotes | ζ globin |
T17170 | 2495-2504 | Protein | denotes | ɛy globin |
T16053 | 1906-1908 | Protein | denotes | ɛy |
T16052 | 1761-1765 | Protein | denotes | Sox6 |
T16051 | 1730-1734 | Protein | denotes | Sox6 |
T16050 | 1697-1701 | Protein | denotes | Sox6 |
T16049 | 1654-1658 | Protein | denotes | Sox6 |
T16048 | 1086-1088 | Protein | denotes | ɛy |
T16047 | 1034-1036 | Protein | denotes | ɛy |
T16046 | 995-1005 | Protein | denotes | luciferase |
T16045 | 907-909 | Protein | denotes | ɛy |
T16044 | 738-748 | Protein | denotes | luciferase |
T16043 | 693-695 | Protein | denotes | ɛy |
T16042 | 404-412 | Protein | denotes | ɛ globin |
T16041 | 294-295 | Protein | denotes | ɛ |
T16040 | 193-202 | Protein | denotes | ɛy globin |
T16039 | 137-139 | Protein | denotes | ɛy |
T16038 | 49-51 | Protein | denotes | ɛy |
T18458 | 5348-5352 | Protein | denotes | Sox6 |
T17759 | 3673-3677 | Protein | denotes | Sox6 |
T17758 | 3630-3641 | Protein | denotes | βmaj globin |
T17757 | 3599-3608 | Protein | denotes | ɛy globin |
T19674 | 8575-8579 | Protein | denotes | Sox6 |
T19673 | 8567-8569 | Protein | denotes | HA |
T19672 | 8560-8565 | Protein | denotes | c-Myc |
T19671 | 7908-7911 | Protein | denotes | BSA |
T19670 | 7812-7816 | Protein | denotes | Sox6 |
T19669 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19410 | 7432-7437 | Protein | denotes | c-Myc |
T19409 | 7389-7393 | Protein | denotes | Sox6 |
T19408 | 7149-7153 | Protein | denotes | Sox6 |
T18716 | 6435-6439 | Protein | denotes | Sox6 |
T18715 | 6360-6362 | Protein | denotes | ɛy |
bionlp-st-ge-2016-uniprot
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T19959 | 8575-8579 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19958 | 7812-7816 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19505 | 7389-7393 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19504 | 7149-7153 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19243 | 7072-7076 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19242 | 6797-6801 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T19241 | 6666-6670 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T18888 | 6435-6439 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T17945 | 3673-3677 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T18566 | 5348-5352 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T17396 | 3471-3476 | http://www.uniprot.org/uniprot/P04406 | denotes | GAPDH |
T17395 | 3168-3173 | http://www.uniprot.org/uniprot/P04406 | denotes | GAPDH |
T16450 | 1870-1874 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16449 | 1761-1765 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16448 | 1730-1734 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16447 | 1697-1701 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16446 | 1654-1658 | http://www.uniprot.org/uniprot/P35712 | denotes | Sox6 |
T16445 | 995-1005 | http://www.uniprot.org/uniprot/P08659 | denotes | luciferase |
T16444 | 738-748 | http://www.uniprot.org/uniprot/P08659 | denotes | luciferase |
UBERON-AE
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20340 | 10475-10484 | http://purl.obolibrary.org/obo/UBERON_2000106 | denotes | extension |
T20339 | 9097-9102 | http://purl.obolibrary.org/obo/UBERON_0002107 | denotes | liver |
T18703 | 6190-6195 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T18702 | 5973-5978 | http://purl.obolibrary.org/obo/UBERON_0001977 | denotes | serum |
T18451 | 5252-5258 | http://purl.obolibrary.org/obo/UBERON_0000479 | denotes | tissue |
T18450 | 5242-5258 | http://purl.obolibrary.org/obo/UBERON_0005291 | denotes | embryonic tissue |
T18175 | 4601-4606 | http://purl.obolibrary.org/obo/UBERON_0000178 | denotes | blood |
T18174 | 4755-4762 | http://purl.obolibrary.org/obo/UBERON_0000922 | denotes | embryos |
T18173 | 4559-4566 | http://purl.obolibrary.org/obo/UBERON_0000922 | denotes | embryos |
T17742 | 4160-4167 | http://purl.obolibrary.org/obo/UBERON_0002544 | denotes | digital |
GO-BP
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T19662 | 7801-7811 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translated |
T17753 | 4150-4152 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T17752 | 3635-3641 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17751 | 3602-3608 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T20352 | 9349-9354 | http://purl.obolibrary.org/obo/GO_0019835 | denotes | lysis |
T19128 | 7006-7019 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | Transcription |
T19127 | 7102-7112 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translated |
T19126 | 6899-6910 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translation |
T19125 | 6811-6822 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translation |
T19124 | 6651-6662 | http://purl.obolibrary.org/obo/GO_0006412 | denotes | translation |
T18710 | 6236-6242 | http://purl.obolibrary.org/obo/GO_0040007 | denotes | growth |
T18456 | 5372-5374 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T17162 | 2774-2780 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17161 | 2679-2685 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17160 | 2588-2594 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17159 | 2498-2504 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17158 | 2366-2372 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17157 | 2272-2278 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T16013 | 503-518 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcriptional |
T16012 | 473-486 | http://purl.obolibrary.org/obo/GO_0006351 | denotes | transcription |
T16011 | 296-310 | http://purl.obolibrary.org/obo/GO_0016458 | denotes | gene silencing |
T16010 | 406-412 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T16009 | 196-202 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
GO-MF
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T17182 | 2774-2780 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17181 | 2679-2685 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17180 | 2588-2594 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17179 | 2498-2504 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17178 | 2366-2372 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17177 | 2272-2278 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T16056 | 1885-1892 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T16055 | 406-412 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T16054 | 196-202 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T20361 | 9895-9903 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T19677 | 8580-8590 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T19676 | 8129-8137 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T19675 | 7855-7862 | http://purl.obolibrary.org/obo/GO_0005488 | denotes | binding |
T18459 | 5372-5374 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T17762 | 4150-4152 | http://purl.obolibrary.org/obo/GO_0003964 | denotes | RT |
T17761 | 3635-3641 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T17760 | 3602-3608 | http://purl.obolibrary.org/obo/GO_0005344 | denotes | globin |
T19414 | 7496-7504 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T19413 | 7438-7446 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibody |
T19412 | 7394-7404 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
T19411 | 7154-7164 | http://purl.obolibrary.org/obo/GO_0003823 | denotes | antibodies |
GO-CC
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20363 | 9103-9108 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T20362 | 9072-9077 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19682 | 8580-8590 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T19681 | 8129-8137 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T19680 | 8580-8590 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T19679 | 8129-8137 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T19678 | 7775-7780 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T17183 | 3077-3081 | http://purl.obolibrary.org/obo/GO_0019013 | denotes | core |
T20370 | 9895-9903 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T20369 | 9895-9903 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T20368 | 9885-9894 | http://purl.obolibrary.org/obo/GO_0000785 | denotes | chromatin |
T20367 | 9431-9448 | http://purl.obolibrary.org/obo/GO_0043234 | denotes | protein complexes |
T20366 | 9427-9448 | http://purl.obolibrary.org/obo/GO_0097522 | denotes | DNA-protein complexes |
T20365 | 9427-9448 | http://purl.obolibrary.org/obo/GO_0032993 | denotes | DNA-protein complexes |
T20364 | 9427-9448 | http://purl.obolibrary.org/obo/GO_0001114 | denotes | DNA-protein complexes |
T19139 | 6712-6717 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T19423 | 7492-7504 | http://purl.obolibrary.org/obo/GO_0071736 | denotes | IgG antibody |
T19422 | 7496-7504 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T19421 | 7438-7446 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibody |
T19420 | 7394-7404 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T19419 | 7154-7164 | http://purl.obolibrary.org/obo/GO_0042571 | denotes | antibodies |
T19418 | 7496-7504 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T19417 | 7438-7446 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibody |
T19416 | 7394-7404 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T19415 | 7154-7164 | http://purl.obolibrary.org/obo/GO_0019815 | denotes | antibodies |
T18720 | 6204-6209 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18719 | 6109-6114 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | cells |
T18718 | 5820-5824 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
T18717 | 5768-5772 | http://purl.obolibrary.org/obo/GO_0005623 | denotes | Cell |
sentences
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20351 | 10361-10504 | Sentence | denotes | 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min. |
T20350 | 10311-10360 | Sentence | denotes | PCR was performed under the following conditions: |
T20349 | 10085-10310 | Sentence | denotes | PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). |
T20348 | 10005-10084 | Sentence | denotes | Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. |
T20347 | 9881-10004 | Sentence | denotes | The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. |
T20346 | 9668-9880 | Sentence | denotes | Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. The last two were used as negative controls. |
T20345 | 9483-9667 | Sentence | denotes | One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). |
T20344 | 9427-9482 | Sentence | denotes | DNA-protein complexes were sonicated to 200 and 600 bp. |
T20343 | 9057-9426 | Sentence | denotes | Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. |
T20342 | 9017-9056 | Sentence | denotes | As described by Nouzova [53], in brief: |
T20341 | 9005-9016 | Sentence | denotes | ChIP assay. |
T19661 | 8952-9003 | Sentence | denotes | 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650). |
T19660 | 8875-8951 | Sentence | denotes | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3): |
T19659 | 8805-8874 | Sentence | denotes | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2): |
T19658 | 8728-8804 | Sentence | denotes | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1): |
T19657 | 8704-8727 | Sentence | denotes | For the 36-bp WT probe: |
T19656 | 8613-8703 | Sentence | denotes | The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed): |
T19655 | 8511-8612 | Sentence | denotes | Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above). |
T19654 | 8378-8510 | Sentence | denotes | Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography. |
T19653 | 8213-8377 | Sentence | denotes | Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel. |
T19652 | 8012-8212 | Sentence | denotes | For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe. |
T19651 | 7871-8011 | Sentence | denotes | 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2. |
T19650 | 7717-7870 | Sentence | denotes | EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer: |
T19649 | 7592-7716 | Sentence | denotes | Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase. |
T19648 | 7586-7591 | Sentence | denotes | EMSA. |
T19123 | 7051-7135 | Sentence | denotes | A vector without the Sox6 coding sequence was also translated as a negative control. |
T19122 | 6895-7050 | Sentence | denotes | The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega). |
T19121 | 6793-6894 | Sentence | denotes | The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15]. |
T19120 | 6672-6792 | Sentence | denotes | Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States). |
T19119 | 6614-6671 | Sentence | denotes | Nuclear protein extract and in vitro translation of Sox6. |
T19404 | 7385-7584 | Sentence | denotes | All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States). |
T19403 | 7149-7384 | Sentence | denotes | Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States). |
T19402 | 7137-7148 | Sentence | denotes | Antibodies. |
T18709 | 6473-6612 | Sentence | denotes | In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency. |
T18708 | 6332-6472 | Sentence | denotes | Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng). |
T18707 | 6198-6331 | Sentence | denotes | GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States). |
T18706 | 6105-6197 | Sentence | denotes | MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum). |
T18705 | 5799-6104 | Sentence | denotes | GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM). |
T18704 | 5768-5798 | Sentence | denotes | Cell culture and transfection. |
T18455 | 5623-5766 | Sentence | denotes | Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d. |
T18454 | 5538-5622 | Sentence | denotes | The hybridization was performed in phosphate buffered 7% SDS hybridization solution. |
T18453 | 5234-5537 | Sentence | denotes | A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom). |
T18452 | 5219-5233 | Sentence | denotes | Northern blot. |
T17745 | 3701-3895 | Sentence | denotes | Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States). |
T17744 | 3558-3700 | Sentence | denotes | Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927. |
T17743 | 3535-3557 | Sentence | denotes | In situ hybridization. |
T17156 | 3352-3533 | Sentence | denotes | Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States). |
T17155 | 3307-3351 | Sentence | denotes | Triplicates were done for each PCR reaction. |
T17154 | 3222-3306 | Sentence | denotes | Standard curve analyses were performed to test the efficiency of the amplifications. |
T17153 | 3168-3221 | Sentence | denotes | GAPDH mRNA levels were used as control for input RNA. |
T17152 | 3092-3167 | Sentence | denotes | All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix. |
T17151 | 2856-3091 | Sentence | denotes | Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility. |
T17150 | 2791-2855 | Sentence | denotes | 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′. |
T17149 | 2761-2790 | Sentence | denotes | For βmaj/min globin: MHB1674: |
T17148 | 2671-2760 | Sentence | denotes | For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′. |
T17147 | 2582-2670 | Sentence | denotes | For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′. |
T17146 | 2491-2581 | Sentence | denotes | For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′. |
T17145 | 2415-2490 | Sentence | denotes | All primers were searched against the NCBI database to confirm specificity. |
T17144 | 2328-2414 | Sentence | denotes | Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51]. |
T17143 | 2285-2327 | Sentence | denotes | RNA was first reverse transcribed to cDNA. |
T17142 | 2256-2284 | Sentence | denotes | Quantitation of globin mRNA. |
T16008 | 1936-2254 | Sentence | denotes | Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18). |
T16007 | 1851-1935 | Sentence | denotes | Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. |
T16006 | 1703-1850 | Sentence | denotes | A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. |
T16005 | 1654-1702 | Sentence | denotes | Sox6-pcDNA3.1 [15] was used to overexpress Sox6. |
T16004 | 1518-1653 | Sentence | denotes | All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20). |
T16003 | 1124-1517 | Sentence | denotes | Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). |
T16002 | 1047-1123 | Sentence | denotes | A series of deletion constructs of the ɛy promoter were generated similarly. |
T16001 | 814-1046 | Sentence | denotes | A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. |
T16000 | 616-813 | Sentence | denotes | The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). |
T15999 | 499-615 | Sentence | denotes | The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. |
T15998 | 433-498 | Sentence | denotes | Nucleotide numbering is relative to the transcription start site. |
T15997 | 159-432 | Sentence | denotes | A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. |
T15996 | 45-158 | Sentence | denotes | The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. |
T15995 | 23-44 | Sentence | denotes | Plasmid construction. |
T18184 | 5187-5217 | Sentence | denotes | Original images are available. |
T18183 | 5150-5186 | Sentence | denotes | The camera was a Nikon Coolpix 4300. |
T18182 | 5029-5149 | Sentence | denotes | Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective). |
T18181 | 4974-5028 | Sentence | denotes | Images were obtained with Nikon Labophot-2 microscope. |
T18180 | 4898-4973 | Sentence | denotes | Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner. |
T18179 | 4706-4897 | Sentence | denotes | For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin. |
T18178 | 4658-4705 | Sentence | denotes | The slides were Wright-stained and read by DAF. |
T18177 | 4550-4657 | Sentence | denotes | 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice. |
T18176 | 4539-4549 | Sentence | denotes | Histology. |
T17750 | 4507-4537 | Sentence | denotes | Original images are available. |
T17749 | 4300-4506 | Sentence | denotes | Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins. |
T17748 | 4244-4299 | Sentence | denotes | Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5). |
T17747 | 4018-4243 | Sentence | denotes | Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States). |
T17746 | 3896-4017 | Sentence | denotes | Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P. |
T250 | 0-21 | Sentence | denotes | Materials and Methods |
T251 | 23-44 | Sentence | denotes | Plasmid construction. |
T252 | 45-158 | Sentence | denotes | The ɛy promoter deletion reporter plasmid (E-luc) was generated by PCR amplification of the ɛy proximal promoter. |
T253 | 159-432 | Sentence | denotes | A 2.2-kb fragment upstream of the ɛy globin initiation codon (ATG) was used, because it has been shown that all sequences required for ɛ gene silencing are located within a 3.7-kb EcoRI fragment containing about 2 kb of sequence upstream of the ɛ globin gene cap site [50]. |
T254 | 433-498 | Sentence | denotes | Nucleotide numbering is relative to the transcription start site. |
T255 | 499-615 | Sentence | denotes | The transcriptional start site is based on the longest cDNA in the Fantom (Functional Annotation of Mouse) database. |
T256 | 616-813 | Sentence | denotes | The PCR primers contained XhoI and HindIII sites that were used to clone the ɛy promoter fragment upstream of the firefly luciferase gene in pGL3 Basic (Promega, Madison, Wisconsin, United States). |
T257 | 814-1046 | Sentence | denotes | A 2.5-kb SstI/XhoI fragment of μLCRβ 9.3 (micro LCR; [31]) was then inserted upstream of the ɛy promoter in the above pGL3 Basic plasmid, resulting in a reporter construct in which luciferase expression is driven by the ɛy promoter. |
T258 | 1047-1123 | Sentence | denotes | A series of deletion constructs of the ɛy promoter were generated similarly. |
T259 | 1124-1517 | Sentence | denotes | Forward primers with an XhoI site include: MHB1457, 5′CCGCTCGAGTGCTAGGCAAACACTCA3′ (−2077 to −2052); MHB1503, 5′CCGCTCGAGTCTCTACACTGTCACTCCCTG3′ (−634 to −605); MHB1505, 5′CCGCTCGAGGGAGCCAAAAAAAGAATGC3′ (−197 to −169); MHB1506, 5′CCGCTCGAGCTGACCAATGGCTTCAAAG3′ (−85 to −58); MHB1532, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGA3′ (−63 to −34); and MHB1507, 5′CCGCTCGAGGTCTGCGAAGAATAAAAGGC 3′ (−37 to −9). |
T260 | 1518-1653 | Sentence | denotes | All forward primers were used in combination with the reverse primer HindIII site: MHB1477, 5′CGGAAGCTTGGGAGGTTGCTGGTGA3′ (+45 to +20). |
T261 | 1654-1702 | Sentence | denotes | Sox6-pcDNA3.1 [15] was used to overexpress Sox6. |
T262 | 1703-1850 | Sentence | denotes | A truncated version of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) that lacks the HMG domain was generated, as described by others [32]. |
T263 | 1851-1935 | Sentence | denotes | Mutagenesis of Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR. |
T264 | 1936-2254 | Sentence | denotes | Forward primers used to generate these mutagenized ɛy promoter reporter constructs include: MHB1661, 5′CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3′ (−63 to −19); MHB1662, 5′CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3′ (−63 to −16); and MHB1663, 5′CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA 3′ (−63 to −18). |
T265 | 2256-2284 | Sentence | denotes | Quantitation of globin mRNA. |
T266 | 2285-2327 | Sentence | denotes | RNA was first reverse transcribed to cDNA. |
T267 | 2328-2414 | Sentence | denotes | Primers for cDNA PCR amplification of globin genes were obtained from Primerbank [51]. |
T268 | 2415-2490 | Sentence | denotes | All primers were searched against the NCBI database to confirm specificity. |
T269 | 2491-2581 | Sentence | denotes | For ɛy globin: MHB1666, 5′TGGCCTGTGGAGTAAGGTCAA3′; and MHB1667, 5′GAAGCAGAGGACAAGTTCCCA3′. |
T270 | 2582-2670 | Sentence | denotes | For ζ globin: MHB1668, 5′CTACCCCCAGACGAAGACCTA3′; and MHB1669, 5′CTTAACCGCATCCCCTACGG3′. |
T271 | 2671-2760 | Sentence | denotes | For βH1 globin: MHB1672, 5′TGGACAACCTCAAGGAGACC3′; and MHB1673, 5′ACCTCTGGGGTGAATTCCTT3′. |
T272 | 2761-2790 | Sentence | denotes | For βmaj/min globin: MHB1674: |
T273 | 2791-2855 | Sentence | denotes | 5′ATGGCCTGAATCACTTGGAC3′; and MHB1675, 5′ACGATCATATTGCCCAGGAG3′. |
T274 | 2856-3091 | Sentence | denotes | Using the SYBR green supermix kit with ROX (Bio-Rad, Hercules, California, United States), PCR amplification was run on an ABI7000 (Applied Biosystems, Foster City, California, United States) at the University of Arizona core facility. |
T275 | 3092-3167 | Sentence | denotes | All PCR was performed in a 25-μl reaction with 12.5 μl SYBR green supermix. |
T276 | 3168-3221 | Sentence | denotes | GAPDH mRNA levels were used as control for input RNA. |
T277 | 3222-3306 | Sentence | denotes | Standard curve analyses were performed to test the efficiency of the amplifications. |
T278 | 3307-3351 | Sentence | denotes | Triplicates were done for each PCR reaction. |
T279 | 3352-3533 | Sentence | denotes | Relative quantitative values were calculated in the ABI Prism 7000 SDS Software (Applied Biosystems) and normalized to GAPDH in Microsoft Excel (Redmond, Washington, United States). |
T280 | 3535-3557 | Sentence | denotes | In situ hybridization. |
T281 | 3558-3700 | Sentence | denotes | Antisense probes were designed to murine ɛy globin nucleotides 509–584; βmaj globin nucleotides 458–549; and mouse Sox6 nucleotides 1353–1927. |
T282 | 3701-3895 | Sentence | denotes | Embryos were fixed overnight by immersion in 4% paraformaldehyde, embedded in paraffin, sectioned at 5 μm, and adhered to charge modified slides (VWR, West Chester, Pennsylvania, United States). |
T283 | 3896-4017 | Sentence | denotes | Slides were processed for in situ hybridization as described [52] using in vitro transcribed RNA probes labeled with 33P. |
T284 | 4018-4243 | Sentence | denotes | Darkfield and brightfield images were obtained with a Nikon Optiphot microscope (Nikon, Melville, New York, United States) and SPOT RT-Slider digital camera (Diagnostic Instruments, Sterling Heights, Michigan, United States). |
T285 | 4244-4299 | Sentence | denotes | Objectives used were 1× (NA = 0.04) and 10× (NA = 0.5). |
T286 | 4300-4506 | Sentence | denotes | Images were processed, pseudocolored, and combined using Photoshop (Adobe, San Jose, California, United States) software with Fovea Pro (Reindeer Graphics, Asheville, North Carolina, United States) plugins. |
T287 | 4507-4537 | Sentence | denotes | Original images are available. |
T288 | 4539-4549 | Sentence | denotes | Histology. |
T289 | 4550-4657 | Sentence | denotes | 18.5-dpc embryos were exsanguinated and peripheral blood smears were prepared from both mutant and WT mice. |
T290 | 4658-4705 | Sentence | denotes | The slides were Wright-stained and read by DAF. |
T291 | 4706-4897 | Sentence | denotes | For whole mount analysis, 14.5-dpc WT and mutant embryos, and postnatal day–10.5 mice were fixed in 10% formalin, paraffin-embedded, sectioned at 5 μm, and stained with hematoxylin and eosin. |
T292 | 4898-4973 | Sentence | denotes | Liver samples (at 14.5 dpc and 18.5 dpc) were prepared in a similar manner. |
T293 | 4974-5028 | Sentence | denotes | Images were obtained with Nikon Labophot-2 microscope. |
T294 | 5029-5149 | Sentence | denotes | Objectives used were E Plan 40/0.65 160/0.17 Nikon (40× objective), E Plan 100/1.25 oil 160/0.17 Nikon (100× objective). |
T295 | 5150-5186 | Sentence | denotes | The camera was a Nikon Coolpix 4300. |
T296 | 5187-5217 | Sentence | denotes | Original images are available. |
T297 | 5219-5233 | Sentence | denotes | Northern blot. |
T298 | 5234-5537 | Sentence | denotes | A mouse embryonic tissue Northern blot filter (Seegene, Rockville, Maryland, United States) was hybridized with a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) and labeled with [α-32P]dCTP, by random primer labeling (RediprimeII; Amersham Biosciences, Buckinghamshire, England, United Kingdom). |
T299 | 5538-5622 | Sentence | denotes | The hybridization was performed in phosphate buffered 7% SDS hybridization solution. |
T300 | 5623-5766 | Sentence | denotes | Blots were washed with 0.2× SSC, 1% SDS at 60 °C prior to exposure to X-ray film (Kodak, Rochester, New York, United States) at −80 °C for 6 d. |
T301 | 5768-5798 | Sentence | denotes | Cell culture and transfection. |
T302 | 5799-6104 | Sentence | denotes | GM979 cells (Coriell Cell Repositories, Camden, New Jersey, United States) were cultured in Ham's F12 with 2 mM L-glutamine supplemented with heat-inactivated 10% fetal calf serum (Ivitrogen, Carlsbad, California, United States), penicillin (100 units/ml), streptomycin 100 μg/ml), and L-glutamine (2 mM). |
T303 | 6105-6197 | Sentence | denotes | MEL cells were cultured in DMEM supplemented as above (without heat inactivating the serum). |
T304 | 6198-6331 | Sentence | denotes | GM979 cells (4 × 105) in log phase of growth were transfected with plasmids by FuGENE6 (Roche, Indianapolis, Indiana, United States). |
T305 | 6332-6472 | Sentence | denotes | Cells were transfected with ɛy promoter reporter constructs (500 ng) along with either empty vector or Sox6 overexpression vector (1000 ng). |
T306 | 6473-6612 | Sentence | denotes | In assays of dosage effect, we used 200 ng, 500 ng, and 1000 ng). pRL-CMV 15ng (Promega) was used as a control for transfection efficiency. |
T307 | 6614-6671 | Sentence | denotes | Nuclear protein extract and in vitro translation of Sox6. |
T308 | 6672-6792 | Sentence | denotes | Nuclear extracts were prepared from MEL cells (2 × 107) using a kit (Active Motif, Carlsbad, California, United States). |
T309 | 6793-6894 | Sentence | denotes | The Sox6 in vitro translation expression vector, tagged with c-Myc and HA, was described before [15]. |
T310 | 6895-7050 | Sentence | denotes | The translation was performed in a reticulocyte lysate based in vitro translational system (TNT® Quick Coupled Transcription/Translation Systems, Promega). |
T311 | 7051-7135 | Sentence | denotes | A vector without the Sox6 coding sequence was also translated as a negative control. |
T312 | 7137-7148 | Sentence | denotes | Antibodies. |
T313 | 7149-7384 | Sentence | denotes | Sox6 antibodies used in this study were either kindly provided by Dr. Enzo Lalli (Université Louis Pasteur, France [7]) or commercially obtained (Catalog No. sc-17332 X, Santa Cruz Biotechnology, Santa Cruz, California, United States). |
T314 | 7385-7477 | Sentence | denotes | All Sox6 antibodies generated similar results. c-Myc antibody was purchased from Invitrogen. |
T315 | 7478-7584 | Sentence | denotes | Normal rabbit IgG antibody was obtained from Upstate Biotechnology (Lake Placid, New York, United States). |
T316 | 7586-7591 | Sentence | denotes | EMSA. |
T317 | 7592-7716 | Sentence | denotes | Single-stranded complementary oligonucleotides were annealed and end-labeled with [γ-32P] ATP with T4 polynucleotide kinase. |
T318 | 7717-7870 | Sentence | denotes | EMSA was performed with 5 μg of nuclear proteins from MEL cells or 3 μl of in vitro-translated Sox6 along with the reticulocyte lysate in binding buffer: |
T319 | 7871-8011 | Sentence | denotes | 100 mM NaCl, 10% glycerol, 200 ng/μl BSA, 50 ng/μl poly (dI-dC) or poly (dG-dC), 10 mM HEPES (pH 7), 0.1 mM EDTA, 0.25 mM DTT, 0.6 mM MgCl2. |
T320 | 8012-8212 | Sentence | denotes | For competition or supershift assays, the indicated unlabelled oligonucleotide competitor (200-fold molar excess) or antibody (3 μl) was added 30 min to 60 min prior to addition of radiolabeled probe. |
T321 | 8213-8377 | Sentence | denotes | Following addition of the radiolabeled probe, the samples were incubated for 30 min or 60 min at room temperature and loaded on a 4% or 6% (w/v) polyacrylamide gel. |
T322 | 8378-8510 | Sentence | denotes | Electrophoresis was performed at a constant 19 mAmp for 4–8 h at room temperature, and the gels were dried prior to autoradiography. |
T323 | 8511-8612 | Sentence | denotes | Antibodies used for supershift analyses included c-Myc, HA, and Sox6 antibodies (described as above). |
T324 | 8613-8703 | Sentence | denotes | The DNA sequences of the oligonucleotides are as follows (only forward oligos are listed): |
T325 | 8704-8727 | Sentence | denotes | For the 36-bp WT probe: |
T326 | 8728-8804 | Sentence | denotes | 5′AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1556); for mutant probe 1 (M1): |
T327 | 8805-8874 | Sentence | denotes | 5′AACAAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1644); for mutant probe 2 (M2): |
T328 | 8875-8951 | Sentence | denotes | 5′AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3′ (MHB1648); for mutant probe 3 (M3): |
T329 | 8952-9003 | Sentence | denotes | 5′AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3′ (MHB1650). |
T330 | 9005-9016 | Sentence | denotes | ChIP assay. |
T331 | 9017-9056 | Sentence | denotes | As described by Nouzova [53], in brief: |
T332 | 9057-9426 | Sentence | denotes | Cells from MEL cells (4 × 107) or fetal liver cells from three 15.5-dpc WT mice were treated with 1% formaldehyde for 10 min at 37 °C, rinsed in ice-cold 1× Hanks' balanced salt solution with 0.1% EDTA containing protease inhibitors, collected by centrifugation at 4 °C, resuspended in a SDS lysis buffer containing protease inhibitors, and incubated on ice for 10 min. |
T333 | 9427-9482 | Sentence | denotes | DNA-protein complexes were sonicated to 200 and 600 bp. |
T334 | 9483-9667 | Sentence | denotes | One-tenth of the sample was set aside for input control, and the remaining sample was precleared with protein A-Sepharose (Amersham Biosciences, Piscataway, New Jersey, United States). |
T335 | 9668-9835 | Sentence | denotes | Following preclearing, the samples were split into thirds: one sample treated with anti-Sox6, a second treated with normal rabbit IgG, and the third sample without Ab. |
T336 | 9836-9880 | Sentence | denotes | The last two were used as negative controls. |
T337 | 9881-10004 | Sentence | denotes | The chromatin-antibody complexes were eluted, and the DNA protein cross-links were reversed with 5 M NaCl at 65 °C for 4 h. |
T338 | 10005-10084 | Sentence | denotes | Input DNA or immunoprecipitated DNA was used as a template in the PCR reaction. |
T339 | 10085-10310 | Sentence | denotes | PCR amplification of the ɛy promoter was performed and yielded a 172-bp amplicon, corresponding to nucleotides −31 to +140 of the ɛy promoter (primers MHB1688, 5′CGAAGAATAAAAGGCCACCA3′; and MHB1689, 5′GCTTCACCACCAACCTCTTC3′). |
T340 | 10311-10360 | Sentence | denotes | PCR was performed under the following conditions: |
T341 | 10361-10504 | Sentence | denotes | 95 °C for 15 min followed by 30 cycles at 95 °C for 30 s, 60 °C for 30 s, and 72 °C for 45 s, ending with a final extension at 72 °C for 5 min. |
simple1
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20381 | 10215-10217 | Protein | denotes | ɛy |
T20380 | 10110-10112 | Protein | denotes | ɛy |
T20379 | 9756-9760 | Protein | denotes | Sox6 |
T20378 | 9585-9594 | Protein | denotes | protein A |
T19693 | 8575-8579 | Protein | denotes | Sox6 |
T19692 | 8567-8569 | Protein | denotes | HA |
T19691 | 8560-8565 | Protein | denotes | c-Myc |
T19690 | 7908-7911 | Protein | denotes | BSA |
T19689 | 7812-7816 | Protein | denotes | Sox6 |
T19688 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19149 | 7072-7076 | Protein | denotes | Sox6 |
T19148 | 6864-6866 | Protein | denotes | HA |
T19147 | 6854-6859 | Protein | denotes | c-Myc |
T19146 | 6797-6801 | Protein | denotes | Sox6 |
T19145 | 6666-6670 | Protein | denotes | Sox6 |
T19426 | 7432-7437 | Protein | denotes | c-Myc |
T19425 | 7389-7393 | Protein | denotes | Sox6 |
T19424 | 7149-7153 | Protein | denotes | Sox6 |
T18722 | 6435-6439 | Protein | denotes | Sox6 |
T18721 | 6360-6362 | Protein | denotes | ɛy |
T18460 | 5348-5352 | Protein | denotes | Sox6 |
T17765 | 3673-3677 | Protein | denotes | Sox6 |
T17764 | 3630-3641 | Protein | denotes | βmaj globin |
T17763 | 3599-3608 | Protein | denotes | ɛy globin |
T17190 | 3471-3476 | Protein | denotes | GAPDH |
T17189 | 3168-3173 | Protein | denotes | GAPDH |
T17188 | 2770-2780 | Protein | denotes | min globin |
T17187 | 2765-2769 | Protein | denotes | βmaj |
T17186 | 2675-2685 | Protein | denotes | βH1 globin |
T17185 | 2586-2594 | Protein | denotes | ζ globin |
T17184 | 2495-2504 | Protein | denotes | ɛy globin |
T16072 | 1906-1908 | Protein | denotes | ɛy |
T16071 | 1761-1765 | Protein | denotes | Sox6 |
T16070 | 1730-1734 | Protein | denotes | Sox6 |
T16069 | 1697-1701 | Protein | denotes | Sox6 |
T16068 | 1654-1658 | Protein | denotes | Sox6 |
T16067 | 1086-1088 | Protein | denotes | ɛy |
T16066 | 1034-1036 | Protein | denotes | ɛy |
T16065 | 995-1005 | Protein | denotes | luciferase |
T16064 | 907-909 | Protein | denotes | ɛy |
T16063 | 738-748 | Protein | denotes | luciferase |
T16062 | 693-695 | Protein | denotes | ɛy |
T16061 | 404-412 | Protein | denotes | ɛ globin |
T16060 | 294-295 | Protein | denotes | ɛ |
T16059 | 193-202 | Protein | denotes | ɛy globin |
T16058 | 137-139 | Protein | denotes | ɛy |
T16057 | 49-51 | Protein | denotes | ɛy |
BioNLP16_DUT
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T21019 | 9585-9594 | Protein | denotes | protein A |
T21022 | 10215-10217 | Protein | denotes | ɛy |
T21021 | 10110-10112 | Protein | denotes | ɛy |
T21020 | 9756-9760 | Protein | denotes | Sox6 |
T20316 | 8575-8579 | Protein | denotes | Sox6 |
T20315 | 8567-8569 | Protein | denotes | HA |
T20314 | 8560-8565 | Protein | denotes | c-Myc |
T20313 | 7908-7911 | Protein | denotes | BSA |
T20312 | 7812-7816 | Protein | denotes | Sox6 |
T20311 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19620 | 7432-7437 | Protein | denotes | c-Myc |
T19619 | 7389-7393 | Protein | denotes | Sox6 |
T19618 | 7149-7153 | Protein | denotes | Sox6 |
T19096 | 6440-6454 | Gene_expression | denotes | overexpression |
T19095 | 6435-6439 | Protein | denotes | Sox6 |
T19094 | 6360-6362 | Protein | denotes | ɛy |
T19384 | 6823-6833 | Gene_expression | denotes | expression |
T19383 | 7072-7076 | Protein | denotes | Sox6 |
T19382 | 6864-6866 | Protein | denotes | HA |
T19381 | 6854-6859 | Protein | denotes | c-Myc |
T19380 | 6797-6801 | Protein | denotes | Sox6 |
T19379 | 6666-6670 | Protein | denotes | Sox6 |
T18692 | 5348-5352 | Protein | denotes | Sox6 |
T18169 | 3673-3677 | Protein | denotes | Sox6 |
T18168 | 3630-3641 | Protein | denotes | βmaj globin |
T18167 | 3599-3608 | Protein | denotes | ɛy globin |
T17722 | 3471-3476 | Protein | denotes | GAPDH |
T17721 | 3168-3173 | Protein | denotes | GAPDH |
T17720 | 2770-2780 | Protein | denotes | min globin |
T17719 | 2765-2769 | Protein | denotes | βmaj |
T17718 | 2675-2685 | Protein | denotes | βH1 globin |
T17717 | 2586-2594 | Protein | denotes | ζ globin |
T17716 | 2495-2504 | Protein | denotes | ɛy globin |
T17096 | 1685-1696 | Gene_expression | denotes | overexpress |
T17095 | 1685-1696 | Positive_regulation | denotes | overexpress |
T17094 | 1020-1026 | Positive_regulation | denotes | driven |
T17093 | 1006-1016 | Gene_expression | denotes | expression |
T17092 | 301-310 | Negative_regulation | denotes | silencing |
T17091 | 1906-1908 | Protein | denotes | ɛy |
T17090 | 1761-1765 | Protein | denotes | Sox6 |
T17089 | 1730-1734 | Protein | denotes | Sox6 |
T17088 | 1697-1701 | Protein | denotes | Sox6 |
T17087 | 1654-1658 | Protein | denotes | Sox6 |
T17086 | 1086-1088 | Protein | denotes | ɛy |
T17085 | 995-1005 | Protein | denotes | luciferase |
T17084 | 907-909 | Protein | denotes | ɛy |
T17083 | 1034-1036 | Protein | denotes | ɛy |
T17082 | 738-748 | Protein | denotes | luciferase |
T17081 | 693-695 | Protein | denotes | ɛy |
T17080 | 404-412 | Protein | denotes | ɛ globin |
T17079 | 294-295 | Protein | denotes | ɛ |
T17078 | 193-202 | Protein | denotes | ɛy globin |
T17077 | 137-139 | Protein | denotes | ɛy |
T17076 | 49-51 | Protein | denotes | ɛy |
R11932 | T17079 | T17092 | themeOf | ɛ,silencing |
R11933 | T17085 | T17093 | themeOf | luciferase,expression |
R11934 | T17088 | T17096 | themeOf | Sox6,overexpress |
R11935 | T17093 | T17094 | themeOf | expression,driven |
R11936 | T17096 | T17095 | themeOf | overexpress,overexpress |
R13574 | T19095 | T19096 | themeOf | Sox6,overexpression |
R13771 | T19380 | T19384 | themeOf | Sox6,expression |
BioNLP16_Messiy
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20669 | 10215-10217 | Protein | denotes | ɛy |
T20668 | 10110-10112 | Protein | denotes | ɛy |
T20667 | 9756-9760 | Protein | denotes | Sox6 |
T16456 | 693-695 | Protein | denotes | ɛy |
T16455 | 404-412 | Protein | denotes | ɛ globin |
T16454 | 294-295 | Protein | denotes | ɛ |
T16453 | 193-202 | Protein | denotes | ɛy globin |
T16452 | 137-139 | Protein | denotes | ɛy |
T16451 | 49-51 | Protein | denotes | ɛy |
T20666 | 9585-9594 | Protein | denotes | protein A |
T19965 | 8575-8579 | Protein | denotes | Sox6 |
T19964 | 8567-8569 | Protein | denotes | HA |
T19963 | 8560-8565 | Protein | denotes | c-Myc |
T19962 | 7908-7911 | Protein | denotes | BSA |
T19961 | 7812-7816 | Protein | denotes | Sox6 |
T19960 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19508 | 7432-7437 | Protein | denotes | c-Myc |
T19507 | 7389-7393 | Protein | denotes | Sox6 |
T19506 | 7149-7153 | Protein | denotes | Sox6 |
T19249 | 6823-6833 | Gene_expression | denotes | expression |
T19248 | 7072-7076 | Protein | denotes | Sox6 |
T19247 | 6864-6866 | Protein | denotes | HA |
T19246 | 6854-6859 | Protein | denotes | c-Myc |
T19245 | 6797-6801 | Protein | denotes | Sox6 |
T19244 | 6666-6670 | Protein | denotes | Sox6 |
T18891 | 6440-6454 | Gene_expression | denotes | overexpression |
T18890 | 6435-6439 | Protein | denotes | Sox6 |
T18889 | 6360-6362 | Protein | denotes | ɛy |
T17948 | 3673-3677 | Protein | denotes | Sox6 |
T17947 | 3630-3641 | Protein | denotes | βmaj globin |
T17946 | 3599-3608 | Protein | denotes | ɛy globin |
T18567 | 5348-5352 | Protein | denotes | Sox6 |
T17403 | 3471-3476 | Protein | denotes | GAPDH |
T17402 | 3168-3173 | Protein | denotes | GAPDH |
T17401 | 2770-2780 | Protein | denotes | min globin |
T17400 | 2765-2769 | Protein | denotes | βmaj |
T17399 | 2675-2685 | Protein | denotes | βH1 globin |
T17398 | 2586-2594 | Protein | denotes | ζ globin |
T17397 | 2495-2504 | Protein | denotes | ɛy globin |
T16472 | 1735-1749 | Positive_regulation | denotes | overexpression |
T16471 | 1685-1696 | Gene_expression | denotes | overexpress |
T16470 | 1006-1016 | Gene_expression | denotes | expression |
T16469 | 281-289 | Positive_regulation | denotes | required |
T16468 | 301-310 | Negative_regulation | denotes | silencing |
T16467 | 61-69 | Negative_regulation | denotes | deletion |
T16466 | 1906-1908 | Protein | denotes | ɛy |
T16465 | 1761-1765 | Protein | denotes | Sox6 |
T16464 | 1730-1734 | Protein | denotes | Sox6 |
T16463 | 1697-1701 | Protein | denotes | Sox6 |
T16462 | 1654-1658 | Protein | denotes | Sox6 |
T16461 | 1086-1088 | Protein | denotes | ɛy |
T16460 | 995-1005 | Protein | denotes | luciferase |
T16459 | 907-909 | Protein | denotes | ɛy |
T16458 | 1034-1036 | Protein | denotes | ɛy |
T16457 | 738-748 | Protein | denotes | luciferase |
R11455 | T16451 | T16467 | themeOf | ɛy,deletion |
R11456 | T16454 | T16468 | themeOf | ɛ,silencing |
R11457 | T16460 | T16470 | themeOf | luciferase,expression |
R11458 | T16463 | T16471 | themeOf | Sox6,overexpress |
R11459 | T16464 | T16472 | themeOf | Sox6,overexpression |
R11460 | T16468 | T16469 | themeOf | silencing,required |
R13396 | T18890 | T18891 | themeOf | Sox6,overexpression |
R13668 | T19245 | T19249 | themeOf | Sox6,expression |
DLUT931
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20673 | 10215-10217 | Protein | denotes | ɛy |
T20672 | 10110-10112 | Protein | denotes | ɛy |
T20671 | 9756-9760 | Protein | denotes | Sox6 |
T20670 | 9585-9594 | Protein | denotes | protein A |
T19978 | 7855-7862 | Binding | denotes | binding |
T19977 | 8575-8579 | Protein | denotes | Sox6 |
T19976 | 8567-8569 | Protein | denotes | HA |
T19975 | 8560-8565 | Protein | denotes | c-Myc |
T19974 | 7908-7911 | Protein | denotes | BSA |
T19973 | 7812-7816 | Protein | denotes | Sox6 |
T19972 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19518 | 7432-7437 | Protein | denotes | c-Myc |
T19517 | 7389-7393 | Protein | denotes | Sox6 |
T19516 | 7149-7153 | Protein | denotes | Sox6 |
T19260 | 6823-6833 | Gene_expression | denotes | expression |
T19259 | 7072-7076 | Protein | denotes | Sox6 |
T19258 | 6864-6866 | Protein | denotes | HA |
T19257 | 6854-6859 | Protein | denotes | c-Myc |
T19256 | 6797-6801 | Protein | denotes | Sox6 |
T19255 | 6666-6670 | Protein | denotes | Sox6 |
T18898 | 6440-6454 | Gene_expression | denotes | overexpression |
T18897 | 6435-6439 | Protein | denotes | Sox6 |
T18896 | 6360-6362 | Protein | denotes | ɛy |
T18570 | 5348-5352 | Protein | denotes | Sox6 |
T17957 | 3673-3677 | Protein | denotes | Sox6 |
T17956 | 3630-3641 | Protein | denotes | βmaj globin |
T17955 | 3599-3608 | Protein | denotes | ɛy globin |
T17430 | 3471-3476 | Protein | denotes | GAPDH |
T17429 | 3168-3173 | Protein | denotes | GAPDH |
T17428 | 2770-2780 | Protein | denotes | min globin |
T17427 | 2765-2769 | Protein | denotes | βmaj |
T17426 | 2675-2685 | Protein | denotes | βH1 globin |
T17425 | 2586-2594 | Protein | denotes | ζ globin |
T17424 | 2495-2504 | Protein | denotes | ɛy globin |
T16542 | 1735-1749 | Positive_regulation | denotes | overexpression |
T16541 | 1685-1696 | Gene_expression | denotes | overexpress |
T16540 | 1006-1016 | Gene_expression | denotes | expression |
T16539 | 281-289 | Positive_regulation | denotes | required |
T16538 | 301-310 | Negative_regulation | denotes | silencing |
T16537 | 61-69 | Negative_regulation | denotes | deletion |
T16536 | 1906-1908 | Protein | denotes | ɛy |
T16535 | 1761-1765 | Protein | denotes | Sox6 |
T16534 | 1730-1734 | Protein | denotes | Sox6 |
T16533 | 1697-1701 | Protein | denotes | Sox6 |
T16532 | 1654-1658 | Protein | denotes | Sox6 |
T16531 | 1086-1088 | Protein | denotes | ɛy |
T16530 | 995-1005 | Protein | denotes | luciferase |
T16529 | 907-909 | Protein | denotes | ɛy |
T16528 | 1034-1036 | Protein | denotes | ɛy |
T16527 | 738-748 | Protein | denotes | luciferase |
T16526 | 693-695 | Protein | denotes | ɛy |
T16525 | 404-412 | Protein | denotes | ɛ globin |
T16524 | 294-295 | Protein | denotes | ɛ |
T16523 | 193-202 | Protein | denotes | ɛy globin |
T16522 | 137-139 | Protein | denotes | ɛy |
T16521 | 49-51 | Protein | denotes | ɛy |
R11469 | T16521 | T16537 | themeOf | ɛy,deletion |
R11470 | T16524 | T16538 | themeOf | ɛ,silencing |
R11471 | T16530 | T16540 | themeOf | luciferase,expression |
R11472 | T16533 | T16541 | themeOf | Sox6,overexpress |
R11473 | T16534 | T16542 | themeOf | Sox6,overexpression |
R11474 | T16538 | T16539 | themeOf | silencing,required |
R13397 | T18897 | T18898 | themeOf | Sox6,overexpression |
R13669 | T19256 | T19260 | themeOf | Sox6,expression |
R14198 | T19973 | T19978 | themeOf | Sox6,binding |
bionlp-st-ge-2016-test-ihmc
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T21018 | 9931-9959 | Localization | denotes | the DNA protein cross-links |
T21017 | 9050-9062 | Entity | denotes | brief: Cells |
T21016 | 10018-10040 | Entity | denotes | immunoprecipitated DNA |
T21015 | 9114-9136 | Protein | denotes | three 15.5-dpc WT mice |
T21014 | 10000-10014 | Entity | denotes | 4 h. Input DNA |
T21013 | 9751-9802 | Protein | denotes | anti-Sox6, a second treated with normal rabbit IgG, |
T21012 | 10181-10226 | Entity | denotes | to nucleotides −31 to +140 of the ɛy promoter |
T21011 | 9895-9903 | Protein | denotes | antibody |
T21010 | 9202-9210 | Entity | denotes | ice-cold |
T21009 | 9408-9414 | Entity | denotes | on ice |
T21008 | 10067-10083 | Protein | denotes | the PCR reaction |
T21007 | 9155-9181 | Entity | denotes | 1% formaldehyde for 10 min |
T21006 | 9881-9913 | Entity | denotes | The chromatin-antibody complexes |
T21005 | 9978-9992 | Entity | denotes | 5 M NaCl at 65 |
T21004 | 9885-9894 | Entity | denotes | chromatin |
T21003 | 9935-9938 | Entity | denotes | DNA |
T21002 | 9373-9392 | Protein | denotes | protease inhibitors |
T21001 | 9254-9258 | Entity | denotes | EDTA |
T21000 | 10085-10088 | Protein | denotes | PCR |
T20999 | 9931-9958 | Protein | denotes | the DNA protein cross-links |
T20998 | 10311-10314 | Protein | denotes | PCR |
T20997 | 10215-10217 | Protein | denotes | ɛy |
T20996 | 10110-10112 | Protein | denotes | ɛy |
T20995 | 10103-10121 | Entity | denotes | of the ɛy promoter |
T20994 | 9595-9604 | Entity | denotes | Sepharose |
T20993 | 9343-9393 | Protein | denotes | a SDS lysis buffer containing protease inhibitors, |
T20992 | 9249-9289 | Protein | denotes | 0.1% EDTA containing protease inhibitors |
T20991 | 9427-9448 | Entity | denotes | DNA-protein complexes |
T20990 | 10211-10226 | Entity | denotes | the ɛy promoter |
T20310 | 8575-8590 | Entity | denotes | Sox6 antibodies |
T20309 | 8567-8569 | Protein | denotes | HA |
T20308 | 8341-8376 | Entity | denotes | a 4% or 6% (w/v) polyacrylamide gel |
T20307 | 8129-8144 | Protein | denotes | antibody (3 μl) |
T20306 | 8511-8526 | Entity | denotes | Antibodies used |
T20305 | 7792-7816 | Protein | denotes | in vitro-translated Sox6 |
T20304 | 7944-7949 | Protein | denotes | dG-dC |
T20303 | 8631-8654 | Entity | denotes | of the oligonucleotides |
T20302 | 7682-7715 | Entity | denotes | ATP with T4 polynucleotide kinase |
T20301 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T20300 | 7832-7844 | Entity | denotes | reticulocyte |
T20299 | 8341-8376 | Entity | denotes | a 4% or 6% (w/v) polyacrylamide gel |
T20298 | 8560-8565 | Protein | denotes | c-Myc |
T20297 | 7884-7896 | Entity | denotes | 10% glycerol |
T20296 | 7592-7638 | Entity | denotes | Single-stranded complementary oligonucleotides |
T20295 | 8465-8473 | Entity | denotes | the gels |
T20294 | 7972-7997 | Entity | denotes | 0.1 mM EDTA, 0.25 mM DTT, |
T20293 | 8064-8125 | Entity | denotes | unlabelled oligonucleotide competitor (200-fold molar excess) |
T20292 | 8800-8802 | Entity | denotes | M1 |
T20291 | 8870-8872 | Entity | denotes | M2 |
T20290 | 7908-7912 | Protein | denotes | BSA, |
T20289 | 7922-7934 | Entity | denotes | poly (dI-dC) |
T20288 | 8613-8669 | Entity | denotes | The DNA sequences of the oligonucleotides are as follows |
T20287 | 7938-7963 | Entity | denotes | poly (dG-dC), 10 mM HEPES |
T20286 | 7749-7780 | Protein | denotes | nuclear proteins from MEL cells |
T20285 | 8434-8459 | Entity | denotes | 4–8 h at room temperature |
T20284 | 7985-7996 | Entity | denotes | 0.25 mM DTT |
T20283 | 7938-7951 | Entity | denotes | poly (dG-dC), |
T20282 | 7871-7897 | Entity | denotes | 100 mM NaCl, 10% glycerol, |
T20281 | 8411-8429 | Entity | denotes | a constant 19 mAmp |
T20280 | 7691-7693 | Entity | denotes | T4 |
T20279 | 8575-8579 | Protein | denotes | Sox6 |
T19617 | 7432-7476 | Binding | denotes | c-Myc antibody was purchased from Invitrogen |
T19616 | 7385-7404 | Entity | denotes | All Sox6 antibodies |
T19615 | 7492-7504 | Entity | denotes | IgG antibody |
T19614 | 7137-7147 | Entity | denotes | Antibodies |
T19613 | 7389-7393 | Protein | denotes | Sox6 |
T19612 | 7432-7446 | Entity | denotes | c-Myc antibody |
T19611 | 7149-7153 | Protein | denotes | Sox6 |
T19610 | 7149-7183 | Entity | denotes | Sox6 antibodies used in this study |
T19609 | 7432-7437 | Protein | denotes | c-Myc |
T19093 | 6435-6461 | Gene_expression | denotes | Sox6 overexpression vector |
T19092 | 6435-6461 | Positive_regulation | denotes | Sox6 overexpression vector |
T19091 | 6029-6039 | Entity | denotes | penicillin |
T19090 | 6056-6068 | Entity | denotes | streptomycin |
T19089 | 6435-6439 | Protein | denotes | Sox6 |
T19088 | 5891-5945 | Protein | denotes | Ham's F12 with 2 mM L-glutamine supplemented with heat |
T19087 | 6198-6209 | Entity | denotes | GM979 cells |
T19086 | 5799-5810 | Entity | denotes | GM979 cells |
T19085 | 6085-6103 | Entity | denotes | L-glutamine (2 mM) |
T19084 | 6332-6337 | Entity | denotes | Cells |
T19083 | 6363-6371 | Entity | denotes | promoter |
T19082 | 6476-6499 | Entity | denotes | assays of dosage effect |
T19081 | 6109-6114 | Entity | denotes | cells |
T19080 | 5906-5922 | Entity | denotes | 2 mM L-glutamine |
T19079 | 5820-5824 | Entity | denotes | Cell |
T19078 | 6539-6542 | Protein | denotes | pRL |
T19077 | 6355-6362 | Protein | denotes | with ɛy |
T19378 | 6642-6670 | Translation | denotes | in vitro translation of Sox6 |
T19377 | 6930-6942 | Entity | denotes | reticulocyte |
T19376 | 6864-6866 | Protein | denotes | HA |
T19375 | 6672-6688 | Entity | denotes | Nuclear extracts |
T19374 | 6854-6859 | Protein | denotes | c-Myc |
T19373 | 6614-6637 | Protein | denotes | Nuclear protein extract |
T19372 | 6797-6801 | Protein | denotes | Sox6 |
T19371 | 6663-6670 | Protein | denotes | of Sox6 |
T19370 | 6614-6637 | Entity | denotes | Nuclear protein extract |
T19369 | 7072-7076 | Protein | denotes | Sox6 |
T18691 | 5369-5402 | Protein | denotes | by RT-PCR (nucleotides 1353–1927) |
T18690 | 5595-5598 | Protein | denotes | SDS |
T18689 | 5573-5582 | Entity | denotes | phosphate |
T18688 | 5346-5402 | Protein | denotes | a Sox6 probe generated by RT-PCR (nucleotides 1353–1927) |
T18687 | 5427-5449 | Entity | denotes | dCTP, by random primer |
T18686 | 5656-5668 | Protein | denotes | 1% SDS at 60 |
T18445 | 4633-4656 | Protein | denotes | both mutant and WT mice |
T18444 | 4875-4886 | Entity | denotes | hematoxylin |
T18443 | 4929-4937 | Entity | denotes | 18.5 dpc |
T18442 | 4768-4791 | Protein | denotes | postnatal day–10.5 mice |
T18441 | 4806-4838 | Entity | denotes | 10% formalin, paraffin-embedded, |
T18440 | 4820-4837 | Entity | denotes | paraffin-embedded |
T18439 | 4916-4924 | Entity | denotes | 14.5 dpc |
T17701 | 2272-2278 | Protein | denotes | globin |
T17700 | 2363-2378 | Protein | denotes | of globin genes |
T17699 | 2675-2685 | Protein | denotes | βH1 globin |
T17698 | 3211-3220 | Protein | denotes | input RNA |
T17697 | 3400-3413 | Protein | denotes | the ABI Prism |
T17696 | 3051-3090 | Entity | denotes | the University of Arizona core facility |
T17695 | 2495-2504 | Protein | denotes | ɛy globin |
T18166 | 3989-3992 | Protein | denotes | RNA |
T18165 | 3602-3653 | Protein | denotes | globin nucleotides 509–584; βmaj globin nucleotides |
T18164 | 3673-3677 | Protein | denotes | Sox6 |
T18163 | 3896-3902 | Entity | denotes | Slides |
T18162 | 3602-3653 | Entity | denotes | globin nucleotides 509–584; βmaj globin nucleotides |
T18161 | 3779-3788 | Entity | denotes | paraffin, |
T18160 | 3602-3653 | Entity | denotes | globin nucleotides 509–584; βmaj globin nucleotides |
T18159 | 3746-3766 | Entity | denotes | 4% paraformaldehyde, |
T18158 | 3667-3689 | Entity | denotes | mouse Sox6 nucleotides |
T18157 | 4432-4497 | Entity | denotes | Pro (Reindeer Graphics, Asheville, North Carolina, United States) |
T18156 | 3602-3608 | Protein | denotes | globin |
T17715 | 2947-2972 | Regulation | denotes | PCR amplification was run |
T17714 | 2947-2950 | Protein | denotes | PCR |
T17713 | 3168-3173 | Protein | denotes | GAPDH |
T17712 | 3338-3341 | Protein | denotes | PCR |
T17711 | 2586-2594 | Protein | denotes | ζ globin |
T17710 | 2895-2918 | Protein | denotes | ROX (Bio-Rad, Hercules, |
T17709 | 2774-2780 | Protein | denotes | globin |
T17708 | 2272-2283 | Protein | denotes | globin mRNA |
T17707 | 2285-2288 | Protein | denotes | RNA |
T17706 | 2340-2378 | Protein | denotes | cDNA PCR amplification of globin genes |
T17705 | 3471-3476 | Protein | denotes | GAPDH |
T17704 | 3092-3099 | Protein | denotes | All PCR |
T17703 | 2366-2372 | Protein | denotes | globin |
T17702 | 3419-3422 | Protein | denotes | SDS |
T17055 | 137-139 | Protein | denotes | ɛy |
T17054 | 1906-1908 | Protein | denotes | ɛy |
T17053 | 762-812 | Protein | denotes | Basic (Promega, Madison, Wisconsin, United States) |
T17052 | 130-157 | Entity | denotes | of the ɛy proximal promoter |
T17051 | 422-431 | Entity | denotes | site [50] |
T17050 | 196-202 | Protein | denotes | globin |
T17049 | 1792-1806 | Entity | denotes | the HMG domain |
T17048 | 406-412 | Protein | denotes | globin |
T17047 | 1079-1097 | Entity | denotes | of the ɛy promoter |
T17046 | 112-115 | Protein | denotes | PCR |
T17045 | 52-60 | Entity | denotes | promoter |
T17044 | 693-695 | Protein | denotes | ɛy |
T17043 | 642-646 | Protein | denotes | XhoI |
T17042 | 1730-1734 | Protein | denotes | Sox6 |
T17041 | 1034-1036 | Protein | denotes | ɛy |
T17040 | 907-909 | Protein | denotes | ɛy |
T17039 | 1987-1998 | Entity | denotes | ɛy promoter |
T17038 | 689-713 | Entity | denotes | the ɛy promoter fragment |
T17037 | 1697-1701 | Protein | denotes | Sox6 |
T17036 | 49-51 | Protein | denotes | ɛy |
T17035 | 620-623 | Protein | denotes | PCR |
T17034 | 433-443 | Entity | denotes | Nucleotide |
T17033 | 400-421 | Protein | denotes | the ɛ globin gene cap |
T17032 | 330-375 | Entity | denotes | a 3.7-kb EcoRI fragment containing about 2 kb |
T17031 | 1899-1917 | Entity | denotes | of the ɛy promoter |
T17030 | 1928-1934 | Protein | denotes | by PCR |
T17029 | 689-713 | Entity | denotes | the ɛy promoter fragment |
T17075 | 1685-1701 | Gene_expression | denotes | overexpress Sox6 |
T17074 | 1685-1701 | Positive_regulation | denotes | overexpress Sox6 |
T17073 | 1723-1780 | Positive_regulation | denotes | of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
T17072 | 1723-1780 | Gene_expression | denotes | of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
T17071 | 189-225 | Positive_regulation | denotes | the ɛy globin initiation codon (ATG) |
T17070 | 730-748 | Protein | denotes | firefly luciferase |
T17069 | 726-753 | Protein | denotes | the firefly luciferase gene |
T17068 | 542-558 | Entity | denotes | the longest cDNA |
T17067 | 1568-1599 | Entity | denotes | the reverse primer HindIII site |
T17066 | 1145-1157 | Entity | denotes | an XhoI site |
T17065 | 1027-1045 | Entity | denotes | by the ɛy promoter |
T17064 | 294-310 | Protein | denotes | ɛ gene silencing |
T17063 | 404-405 | Protein | denotes | ɛ |
T17062 | 1148-1152 | Protein | denotes | XhoI |
T17061 | 856-871 | Protein | denotes | micro LCR; [31] |
T17060 | 1987-1989 | Protein | denotes | ɛy |
T17059 | 1866-1934 | Protein | denotes | Sox/Sox6 consensus binding sites of the ɛy promoter were done by PCR |
T17058 | 903-931 | Entity | denotes | the ɛy promoter in the above |
T17057 | 193-195 | Protein | denotes | ɛy |
T17056 | 651-664 | Entity | denotes | HindIII sites |
R11921 | T17031 | T17054 | partOf | of the ɛy promoter,ɛy |
R11922 | T17037 | T17074 | themeOf | Sox6,overexpress Sox6 |
R11923 | T17037 | T17075 | themeOf | Sox6,overexpress Sox6 |
R11924 | T17038 | T17044 | partOf | the ɛy promoter fragment,ɛy |
R11925 | T17039 | T17060 | partOf | ɛy promoter,ɛy |
R11926 | T17042 | T17072 | themeOf | Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
R11927 | T17042 | T17073 | themeOf | Sox6,of the Sox6 overexpression construct (Sox6-ΔHMG-pcDNA3.1) |
R11928 | T17050 | T17071 | themeOf | globin,the ɛy globin initiation codon (ATG) |
R11929 | T17052 | T17055 | partOf | of the ɛy proximal promoter,ɛy |
R11930 | T17058 | T17040 | partOf | the ɛy promoter in the above,ɛy |
R11931 | T17065 | T17041 | partOf | by the ɛy promoter,ɛy |
R13572 | T19089 | T19092 | themeOf | Sox6,Sox6 overexpression vector |
R13573 | T19089 | T19093 | themeOf | Sox6,Sox6 overexpression vector |
R13770 | T19371 | T19378 | themeOf | of Sox6,in vitro translation of Sox6 |
R13933 | T19612 | T19617 | themeOf | c-Myc antibody,c-Myc antibody was purchased from Invitrogen |
R15085 | T20990 | T20997 | partOf | the ɛy promoter,ɛy |
R15086 | T20995 | T20996 | partOf | of the ɛy promoter,ɛy |
R15087 | T20999 | T21018 | themeOf | the DNA protein cross-links,the DNA protein cross-links |
R15088 | T21003 | T21018 | locationOf | DNA,the DNA protein cross-links |
bionlp-st-ge-2016-spacy-parsed
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T18080 | 4198-4199 | , | denotes | , |
T20986 | 10503-10504 | . | denotes | . |
T20985 | 10500-10503 | NN | denotes | min |
T20984 | 10498-10499 | CD | denotes | 5 |
T20983 | 10494-10497 | IN | denotes | for |
T20982 | 10492-10493 | NNP | denotes | C |
T20981 | 10491-10492 | CD | denotes | ° |
T20980 | 10488-10490 | CD | denotes | 72 |
T20979 | 10485-10487 | IN | denotes | at |
T20978 | 10475-10484 | NN | denotes | extension |
T20977 | 10469-10474 | JJ | denotes | final |
T20976 | 10467-10468 | DT | denotes | a |
T20975 | 10462-10466 | IN | denotes | with |
T20974 | 10455-10461 | VBG | denotes | ending |
T20973 | 10453-10454 | , | denotes | , |
T20972 | 10452-10453 | PRP | denotes | s |
T20971 | 10449-10451 | CD | denotes | 45 |
T20970 | 10445-10448 | IN | denotes | for |
T20969 | 10443-10444 | NNP | denotes | C |
T20968 | 10442-10443 | NN | denotes | ° |
T20967 | 10439-10441 | CD | denotes | 72 |
T20966 | 10435-10438 | CC | denotes | and |
T20965 | 10433-10434 | , | denotes | , |
T20964 | 10432-10433 | PRP | denotes | s |
T20963 | 10429-10431 | CD | denotes | 30 |
T20962 | 10425-10428 | IN | denotes | for |
T20961 | 10423-10424 | NNP | denotes | C |
T20960 | 10422-10423 | NN | denotes | ° |
T20959 | 10419-10421 | CD | denotes | 60 |
T20958 | 10417-10418 | , | denotes | , |
T20957 | 10416-10417 | PRP | denotes | s |
T20956 | 10413-10415 | CD | denotes | 30 |
T20955 | 10409-10412 | IN | denotes | for |
T20954 | 10407-10408 | NNP | denotes | C |
T20953 | 10406-10407 | CD | denotes | ° |
T20952 | 10403-10405 | CD | denotes | 95 |
T20951 | 10400-10402 | IN | denotes | at |
T20950 | 10393-10399 | NNS | denotes | cycles |
T20949 | 10390-10392 | CD | denotes | 30 |
T20948 | 10387-10389 | IN | denotes | by |
T20947 | 10378-10386 | VBN | denotes | followed |
T20946 | 10374-10377 | NN | denotes | min |
T20945 | 10371-10373 | CD | denotes | 15 |
T20944 | 10367-10370 | IN | denotes | for |
T20943 | 10365-10366 | NNP | denotes | C |
T20942 | 10364-10365 | NN | denotes | ° |
T20941 | 10361-10363 | CD | denotes | 95 |
T20940 | 10359-10360 | : | denotes | : |
T20939 | 10349-10359 | NNS | denotes | conditions |
T20938 | 10339-10348 | JJ | denotes | following |
T20937 | 10335-10338 | DT | denotes | the |
T20936 | 10329-10334 | IN | denotes | under |
T20935 | 10319-10328 | VBN | denotes | performed |
T20934 | 10315-10318 | VBD | denotes | was |
T20933 | 10311-10314 | NNP | denotes | PCR |
T20932 | 10309-10310 | . | denotes | . |
T20931 | 10308-10309 | -RRB- | denotes | ) |
T20930 | 10307-10308 | NNP | denotes | ′ |
T20929 | 10286-10307 | NNP | denotes | GCTTCACCACCAACCTCTTC3 |
T20928 | 10285-10286 | NN | denotes | ′ |
T20927 | 10284-10285 | CD | denotes | 5 |
T20926 | 10282-10283 | , | denotes | , |
T20925 | 10275-10282 | NNP | denotes | MHB1689 |
T20924 | 10271-10274 | CC | denotes | and |
T20923 | 10269-10270 | : | denotes | ; |
T20922 | 10268-10269 | NN | denotes | ′ |
T20921 | 10247-10268 | CD | denotes | CGAAGAATAAAAGGCCACCA3 |
T20920 | 10246-10247 | NN | denotes | ′ |
T20919 | 10245-10246 | CD | denotes | 5 |
T20918 | 10243-10244 | , | denotes | , |
T20917 | 10236-10243 | NNP | denotes | MHB1688 |
T20916 | 10228-10235 | NNS | denotes | primers |
T20915 | 10227-10228 | -LRB- | denotes | ( |
T20914 | 10218-10226 | NN | denotes | promoter |
T20913 | 10215-10217 | JJ | denotes | ɛy |
T20912 | 10211-10214 | DT | denotes | the |
T20911 | 10208-10210 | IN | denotes | of |
T20910 | 10203-10207 | CD | denotes | +140 |
T20909 | 10200-10202 | TO | denotes | to |
T20908 | 10197-10199 | CD | denotes | 31 |
T20907 | 10196-10197 | VBP | denotes | − |
T20906 | 10184-10195 | NNS | denotes | nucleotides |
T20905 | 10181-10183 | TO | denotes | to |
T20904 | 10167-10180 | JJ | denotes | corresponding |
T20903 | 10165-10166 | , | denotes | , |
T20902 | 10157-10165 | NN | denotes | amplicon |
T20901 | 10150-10156 | JJ | denotes | 172-bp |
T20900 | 10148-10149 | DT | denotes | a |
T20899 | 10140-10147 | VBD | denotes | yielded |
T20898 | 10136-10139 | CC | denotes | and |
T20897 | 10126-10135 | VBN | denotes | performed |
T20896 | 10122-10125 | VBD | denotes | was |
T20895 | 10113-10121 | NN | denotes | promoter |
T20894 | 10110-10112 | JJ | denotes | ɛy |
T20893 | 10106-10109 | DT | denotes | the |
T20892 | 10103-10105 | IN | denotes | of |
T20891 | 10089-10102 | NN | denotes | amplification |
T20890 | 10085-10088 | NNP | denotes | PCR |
T20889 | 10083-10084 | . | denotes | . |
T20888 | 10075-10083 | NN | denotes | reaction |
T20887 | 10071-10074 | NNP | denotes | PCR |
T20886 | 10067-10070 | DT | denotes | the |
T20885 | 10064-10066 | IN | denotes | in |
T20884 | 10055-10063 | NN | denotes | template |
T20883 | 10053-10054 | DT | denotes | a |
T20882 | 10050-10052 | IN | denotes | as |
T20881 | 10045-10049 | VBN | denotes | used |
T20880 | 10041-10044 | VBD | denotes | was |
T20879 | 10037-10040 | NN | denotes | DNA |
T20878 | 10018-10036 | JJ | denotes | immunoprecipitated |
T20877 | 10015-10017 | CC | denotes | or |
T20876 | 10011-10014 | NNP | denotes | DNA |
T20875 | 10005-10010 | NNP | denotes | Input |
T20874 | 10002-10004 | NN | denotes | h. |
T20873 | 10000-10001 | CD | denotes | 4 |
T20872 | 9996-9999 | IN | denotes | for |
T20871 | 9994-9995 | NNP | denotes | C |
T20870 | 9993-9994 | CD | denotes | ° |
T20869 | 9990-9992 | CD | denotes | 65 |
T20868 | 9987-9989 | IN | denotes | at |
T20867 | 9982-9986 | NNP | denotes | NaCl |
T20866 | 9980-9981 | NNP | denotes | M |
T20865 | 9978-9979 | CD | denotes | 5 |
T20864 | 9973-9977 | IN | denotes | with |
T20863 | 9964-9972 | VBN | denotes | reversed |
T20862 | 9959-9963 | VBD | denotes | were |
T20861 | 9947-9958 | NNS | denotes | cross-links |
T20860 | 9939-9946 | NN | denotes | protein |
T20859 | 9935-9938 | NNP | denotes | DNA |
T20858 | 9931-9934 | DT | denotes | the |
T20857 | 9927-9930 | CC | denotes | and |
T20856 | 9925-9926 | , | denotes | , |
T20855 | 9919-9925 | VBN | denotes | eluted |
T20854 | 9914-9918 | VBD | denotes | were |
T20853 | 9904-9913 | NNS | denotes | complexes |
T20852 | 9885-9903 | JJ | denotes | chromatin-antibody |
T20851 | 9881-9884 | DT | denotes | The |
T20850 | 9879-9880 | . | denotes | . |
T20849 | 9871-9879 | NNS | denotes | controls |
T20848 | 9862-9870 | JJ | denotes | negative |
T20847 | 9859-9861 | IN | denotes | as |
T20846 | 9854-9858 | VBN | denotes | used |
T20845 | 9849-9853 | VBD | denotes | were |
T20844 | 9845-9848 | CD | denotes | two |
T20843 | 9840-9844 | JJ | denotes | last |
T20842 | 9836-9839 | DT | denotes | The |
T20841 | 9834-9835 | . | denotes | . |
T20840 | 9832-9834 | NNP | denotes | Ab |
T20839 | 9824-9831 | IN | denotes | without |
T20838 | 9817-9823 | NN | denotes | sample |
T20837 | 9811-9816 | JJ | denotes | third |
T20836 | 9807-9810 | DT | denotes | the |
T20835 | 9803-9806 | CC | denotes | and |
T20834 | 9801-9802 | , | denotes | , |
T20833 | 9798-9801 | NNP | denotes | IgG |
T20832 | 9791-9797 | NN | denotes | rabbit |
T20831 | 9784-9790 | JJ | denotes | normal |
T20830 | 9779-9783 | IN | denotes | with |
T20829 | 9771-9778 | VBN | denotes | treated |
T20828 | 9764-9770 | JJ | denotes | second |
T20827 | 9762-9763 | DT | denotes | a |
T20826 | 9760-9761 | , | denotes | , |
T20825 | 9751-9760 | JJ | denotes | anti-Sox6 |
T20824 | 9746-9750 | IN | denotes | with |
T20823 | 9738-9745 | VBN | denotes | treated |
T20822 | 9731-9737 | NN | denotes | sample |
T20821 | 9727-9730 | CD | denotes | one |
T20820 | 9725-9726 | : | denotes | : |
T20819 | 9719-9725 | NNS | denotes | thirds |
T20818 | 9714-9718 | IN | denotes | into |
T20817 | 9708-9713 | VBN | denotes | split |
T20816 | 9703-9707 | VBD | denotes | were |
T20815 | 9695-9702 | NNS | denotes | samples |
T20814 | 9691-9694 | DT | denotes | the |
T20813 | 9689-9690 | , | denotes | , |
T20812 | 9678-9689 | NN | denotes | preclearing |
T20811 | 9668-9677 | VBG | denotes | Following |
T20810 | 9666-9667 | . | denotes | . |
T20809 | 9665-9666 | -RRB- | denotes | ) |
T20808 | 9659-9665 | NNPS | denotes | States |
T20807 | 9652-9658 | NNP | denotes | United |
T20806 | 9650-9651 | , | denotes | , |
T20805 | 9644-9650 | NNP | denotes | Jersey |
T20804 | 9640-9643 | NNP | denotes | New |
T20689 | 9047-9049 | IN | denotes | in |
T20688 | 9045-9046 | , | denotes | , |
T20687 | 9044-9045 | NNP | denotes | ] |
T20686 | 9042-9044 | CD | denotes | 53 |
T20685 | 9041-9042 | NNP | denotes | [ |
T20684 | 9033-9040 | NNP | denotes | Nouzova |
T20683 | 9030-9032 | IN | denotes | by |
T20682 | 9020-9029 | VBN | denotes | described |
T20681 | 9017-9019 | IN | denotes | As |
T20680 | 9015-9016 | . | denotes | . |
T20679 | 9010-9015 | NN | denotes | assay |
T20678 | 9005-9009 | NN | denotes | ChIP |
T20803 | 9638-9639 | , | denotes | , |
T20802 | 9628-9638 | NNP | denotes | Piscataway |
T20801 | 9626-9627 | , | denotes | , |
T20800 | 9615-9626 | NNP | denotes | Biosciences |
T20799 | 9606-9614 | NNP | denotes | Amersham |
T20798 | 9605-9606 | -LRB- | denotes | ( |
T20797 | 9593-9604 | JJ | denotes | A-Sepharose |
T20796 | 9585-9592 | NN | denotes | protein |
T20795 | 9580-9584 | IN | denotes | with |
T20794 | 9569-9579 | VBN | denotes | precleared |
T20793 | 9565-9568 | VBD | denotes | was |
T20792 | 9558-9564 | NN | denotes | sample |
T20791 | 9548-9557 | VBG | denotes | remaining |
T20790 | 9544-9547 | DT | denotes | the |
T20789 | 9540-9543 | CC | denotes | and |
T20788 | 9538-9539 | , | denotes | , |
T20787 | 9531-9538 | NN | denotes | control |
T20786 | 9525-9530 | NN | denotes | input |
T20785 | 9521-9524 | IN | denotes | for |
T20784 | 9515-9520 | RB | denotes | aside |
T20783 | 9511-9514 | VBN | denotes | set |
T20782 | 9507-9510 | VBD | denotes | was |
T20781 | 9500-9506 | NN | denotes | sample |
T20780 | 9496-9499 | DT | denotes | the |
T20779 | 9493-9495 | IN | denotes | of |
T20778 | 9483-9492 | NN | denotes | One-tenth |
T20777 | 9481-9482 | . | denotes | . |
T20776 | 9479-9481 | NN | denotes | bp |
T20775 | 9475-9478 | CD | denotes | 600 |
T20774 | 9471-9474 | CC | denotes | and |
T20773 | 9467-9470 | CD | denotes | 200 |
T20772 | 9464-9466 | TO | denotes | to |
T20771 | 9454-9463 | VBN | denotes | sonicated |
T20770 | 9449-9453 | VBD | denotes | were |
T20769 | 9439-9448 | NNS | denotes | complexes |
T20768 | 9427-9438 | JJ | denotes | DNA-protein |
T20767 | 9425-9426 | . | denotes | . |
T20766 | 9422-9425 | NN | denotes | min |
T20765 | 9419-9421 | CD | denotes | 10 |
T20764 | 9415-9418 | IN | denotes | for |
T20763 | 9411-9414 | NN | denotes | ice |
T20762 | 9408-9410 | IN | denotes | on |
T20761 | 9398-9407 | VBD | denotes | incubated |
T20760 | 9394-9397 | CC | denotes | and |
T20759 | 9392-9393 | , | denotes | , |
T20758 | 9382-9392 | NNS | denotes | inhibitors |
T20757 | 9373-9381 | NN | denotes | protease |
T20756 | 9362-9372 | VBG | denotes | containing |
T20755 | 9355-9361 | NN | denotes | buffer |
T20754 | 9349-9354 | NN | denotes | lysis |
T20753 | 9345-9348 | NNP | denotes | SDS |
T20752 | 9343-9344 | DT | denotes | a |
T20751 | 9340-9342 | IN | denotes | in |
T20750 | 9328-9339 | VBD | denotes | resuspended |
T20749 | 9326-9327 | , | denotes | , |
T20748 | 9325-9326 | NNP | denotes | C |
T20747 | 9324-9325 | CD | denotes | ° |
T20746 | 9322-9323 | CD | denotes | 4 |
T20745 | 9319-9321 | IN | denotes | at |
T20744 | 9304-9318 | NN | denotes | centrifugation |
T20743 | 9301-9303 | IN | denotes | by |
T20742 | 9291-9300 | VBN | denotes | collected |
T20741 | 9289-9290 | , | denotes | , |
T20740 | 9279-9289 | NNS | denotes | inhibitors |
T20739 | 9270-9278 | NN | denotes | protease |
T20738 | 9259-9269 | VBG | denotes | containing |
T20737 | 9254-9258 | NNP | denotes | EDTA |
T20736 | 9252-9253 | NN | denotes | % |
T20735 | 9249-9252 | CD | denotes | 0.1 |
T20734 | 9244-9248 | IN | denotes | with |
T20733 | 9235-9243 | NN | denotes | solution |
T20732 | 9230-9234 | NN | denotes | salt |
T20731 | 9221-9229 | JJ | denotes | balanced |
T20730 | 9219-9220 | POS | denotes | ' |
T20729 | 9214-9219 | NNP | denotes | Hanks |
T20728 | 9212-9213 | CD | denotes | × |
T20727 | 9211-9212 | CD | denotes | 1 |
T20726 | 9202-9210 | JJ | denotes | ice-cold |
T20725 | 9199-9201 | IN | denotes | in |
T20724 | 9192-9198 | VBD | denotes | rinsed |
T20723 | 9190-9191 | , | denotes | , |
T20722 | 9189-9190 | NNP | denotes | C |
T20721 | 9188-9189 | CD | denotes | ° |
T20720 | 9185-9187 | CD | denotes | 37 |
T20719 | 9182-9184 | IN | denotes | at |
T20718 | 9178-9181 | NN | denotes | min |
T20717 | 9175-9177 | CD | denotes | 10 |
T20716 | 9171-9174 | IN | denotes | for |
T20715 | 9158-9170 | NN | denotes | formaldehyde |
T20714 | 9156-9157 | NN | denotes | % |
T20713 | 9155-9156 | CD | denotes | 1 |
T20712 | 9150-9154 | IN | denotes | with |
T20711 | 9142-9149 | VBN | denotes | treated |
T20710 | 9137-9141 | VBD | denotes | were |
T20709 | 9132-9136 | NNS | denotes | mice |
T20708 | 9129-9131 | NNP | denotes | WT |
T20707 | 9120-9128 | JJ | denotes | 15.5-dpc |
T20706 | 9114-9119 | CD | denotes | three |
T20705 | 9109-9113 | IN | denotes | from |
T20704 | 9103-9108 | NNS | denotes | cells |
T20703 | 9097-9102 | NN | denotes | liver |
T20702 | 9091-9096 | JJ | denotes | fetal |
T20701 | 9088-9090 | CC | denotes | or |
T20700 | 9086-9087 | -RRB- | denotes | ) |
T20699 | 9083-9086 | CD | denotes | 107 |
T20698 | 9081-9082 | CD | denotes | × |
T20697 | 9079-9080 | CD | denotes | 4 |
T20696 | 9078-9079 | -LRB- | denotes | ( |
T20695 | 9072-9077 | NNS | denotes | cells |
T20694 | 9068-9071 | NNP | denotes | MEL |
T20693 | 9063-9067 | IN | denotes | from |
T20692 | 9057-9062 | NNS | denotes | Cells |
T20691 | 9055-9056 | : | denotes | : |
T20690 | 9050-9055 | NN | denotes | brief |
T20273 | 9002-9003 | . | denotes | . |
T20272 | 9001-9002 | -RRB- | denotes | ) |
T20271 | 8994-9001 | NNP | denotes | MHB1650 |
T20270 | 8993-8994 | -LRB- | denotes | ( |
T20269 | 8991-8992 | NNP | denotes | ′ |
T20268 | 8954-8991 | NNP | denotes | AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3 |
T20267 | 8953-8954 | NN | denotes | ′ |
T20266 | 8952-8953 | CD | denotes | 5 |
T20265 | 8950-8951 | : | denotes | : |
T20264 | 8949-8950 | -RRB- | denotes | ) |
T20263 | 8947-8949 | NN | denotes | M3 |
T20262 | 8946-8947 | -LRB- | denotes | ( |
T20261 | 8944-8945 | CD | denotes | 3 |
T20260 | 8938-8943 | NN | denotes | probe |
T20259 | 8931-8937 | JJ | denotes | mutant |
T20258 | 8927-8930 | IN | denotes | for |
T20226 | 8780-8783 | IN | denotes | for |
T20225 | 8778-8779 | : | denotes | ; |
T20224 | 8777-8778 | -RRB- | denotes | ) |
T20223 | 8770-8777 | NNP | denotes | MHB1556 |
T20222 | 8769-8770 | -LRB- | denotes | ( |
T20221 | 8767-8768 | NNP | denotes | ′ |
T20220 | 8730-8767 | NNP | denotes | AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3 |
T20219 | 8729-8730 | CD | denotes | ′ |
T20218 | 8728-8729 | CD | denotes | 5 |
T20217 | 8726-8727 | : | denotes | : |
T20216 | 8721-8726 | NN | denotes | probe |
T20215 | 8718-8720 | NNP | denotes | WT |
T20214 | 8712-8717 | JJ | denotes | 36-bp |
T20213 | 8708-8711 | DT | denotes | the |
T20212 | 8704-8707 | IN | denotes | For |
T20211 | 8702-8703 | : | denotes | : |
T20210 | 8701-8702 | -RRB- | denotes | ) |
T20209 | 8695-8701 | VBN | denotes | listed |
T20208 | 8691-8694 | VBP | denotes | are |
T20207 | 8684-8690 | NNS | denotes | oligos |
T20206 | 8676-8683 | RB | denotes | forward |
T20205 | 8671-8675 | RB | denotes | only |
T20204 | 8670-8671 | -LRB- | denotes | ( |
T20203 | 8662-8669 | VBZ | denotes | follows |
T20202 | 8659-8661 | IN | denotes | as |
T20201 | 8655-8658 | VBP | denotes | are |
T20200 | 8638-8654 | NNS | denotes | oligonucleotides |
T20199 | 8634-8637 | DT | denotes | the |
T20198 | 8631-8633 | IN | denotes | of |
T20197 | 8621-8630 | NNS | denotes | sequences |
T20196 | 8617-8620 | NNP | denotes | DNA |
T20195 | 8613-8616 | DT | denotes | The |
T20194 | 8611-8612 | . | denotes | . |
T20193 | 8610-8611 | -RRB- | denotes | ) |
T20192 | 8605-8610 | IN | denotes | above |
T20191 | 8602-8604 | RB | denotes | as |
T20190 | 8592-8601 | VBN | denotes | described |
T20189 | 8591-8592 | -LRB- | denotes | ( |
T20188 | 8580-8590 | NNS | denotes | antibodies |
T20187 | 8575-8579 | NNP | denotes | Sox6 |
T20186 | 8571-8574 | CC | denotes | and |
T20185 | 8569-8570 | , | denotes | , |
T20184 | 8567-8569 | NNP | denotes | HA |
T20183 | 8565-8566 | , | denotes | , |
T20182 | 8560-8565 | NNP | denotes | c-Myc |
T20181 | 8551-8559 | VBD | denotes | included |
T20180 | 8542-8550 | NNS | denotes | analyses |
T20179 | 8531-8541 | NN | denotes | supershift |
T20178 | 8527-8530 | IN | denotes | for |
T20177 | 8522-8526 | VBD | denotes | used |
T20176 | 8511-8521 | NNS | denotes | Antibodies |
T20175 | 8509-8510 | . | denotes | . |
T20174 | 8494-8509 | NN | denotes | autoradiography |
T20173 | 8491-8493 | TO | denotes | to |
T20172 | 8485-8490 | RB | denotes | prior |
T20171 | 8479-8484 | VBN | denotes | dried |
T20170 | 8474-8478 | VBD | denotes | were |
T20169 | 8469-8473 | NNS | denotes | gels |
T20168 | 8465-8468 | DT | denotes | the |
T20167 | 8461-8464 | CC | denotes | and |
T20166 | 8459-8460 | , | denotes | , |
T20165 | 8448-8459 | NN | denotes | temperature |
T20164 | 8443-8447 | NN | denotes | room |
T20163 | 8440-8442 | IN | denotes | at |
T20162 | 8438-8439 | NN | denotes | h |
T20161 | 8436-8437 | CD | denotes | 8 |
T20160 | 8434-8435 | CD | denotes | 4 |
T20159 | 8430-8433 | IN | denotes | for |
T20158 | 8425-8429 | NN | denotes | mAmp |
T20157 | 8422-8424 | CD | denotes | 19 |
T20156 | 8413-8421 | JJ | denotes | constant |
T20155 | 8411-8412 | DT | denotes | a |
T20154 | 8408-8410 | IN | denotes | at |
T20153 | 8398-8407 | VBN | denotes | performed |
T20152 | 8394-8397 | VBD | denotes | was |
T20151 | 8378-8393 | NNP | denotes | Electrophoresis |
T20150 | 8376-8377 | . | denotes | . |
T20149 | 8373-8376 | NN | denotes | gel |
T20148 | 8358-8372 | NN | denotes | polyacrylamide |
T20147 | 8356-8357 | -RRB- | denotes | ) |
T20146 | 8353-8356 | FW | denotes | w/v |
T20145 | 8352-8353 | -LRB- | denotes | ( |
T20144 | 8350-8351 | NN | denotes | % |
T20143 | 8349-8350 | CD | denotes | 6 |
T20142 | 8346-8348 | CC | denotes | or |
T20141 | 8344-8345 | NN | denotes | % |
T20140 | 8343-8344 | CD | denotes | 4 |
T20139 | 8341-8342 | DT | denotes | a |
T20138 | 8338-8340 | IN | denotes | on |
T20137 | 8331-8337 | VBN | denotes | loaded |
T20136 | 8327-8330 | CC | denotes | and |
T20135 | 8315-8326 | NN | denotes | temperature |
T20134 | 8310-8314 | NN | denotes | room |
T20133 | 8307-8309 | IN | denotes | at |
T20132 | 8303-8306 | NN | denotes | min |
T20131 | 8300-8302 | CD | denotes | 60 |
T20130 | 8297-8299 | CC | denotes | or |
T20129 | 8293-8296 | NN | denotes | min |
T20128 | 8290-8292 | CD | denotes | 30 |
T20127 | 8286-8289 | IN | denotes | for |
T20126 | 8276-8285 | VBN | denotes | incubated |
T20125 | 8271-8275 | VBD | denotes | were |
T20124 | 8263-8270 | NNS | denotes | samples |
T20123 | 8259-8262 | DT | denotes | the |
T20122 | 8257-8258 | , | denotes | , |
T20121 | 8252-8257 | NN | denotes | probe |
T20120 | 8239-8251 | JJ | denotes | radiolabeled |
T20119 | 8235-8238 | DT | denotes | the |
T20118 | 8232-8234 | IN | denotes | of |
T20117 | 8223-8231 | NN | denotes | addition |
T20116 | 8213-8222 | VBG | denotes | Following |
T20115 | 8211-8212 | . | denotes | . |
T20114 | 8206-8211 | NN | denotes | probe |
T20113 | 8193-8205 | JJ | denotes | radiolabeled |
T20112 | 8190-8192 | IN | denotes | of |
T20111 | 8181-8189 | NN | denotes | addition |
T20110 | 8178-8180 | TO | denotes | to |
T20109 | 8172-8177 | RB | denotes | prior |
T20108 | 8168-8171 | NN | denotes | min |
T20107 | 8165-8167 | CD | denotes | 60 |
T20106 | 8162-8164 | TO | denotes | to |
T20105 | 8158-8161 | NN | denotes | min |
T20104 | 8155-8157 | CD | denotes | 30 |
T20103 | 8149-8154 | VBN | denotes | added |
T20102 | 8145-8148 | VBD | denotes | was |
T20101 | 8143-8144 | -RRB- | denotes | ) |
T20100 | 8141-8143 | NN | denotes | μl |
T20099 | 8139-8140 | CD | denotes | 3 |
T20098 | 8138-8139 | -LRB- | denotes | ( |
T20097 | 8129-8137 | NN | denotes | antibody |
T20096 | 8126-8128 | CC | denotes | or |
T20095 | 8124-8125 | -RRB- | denotes | ) |
T20094 | 8118-8124 | NN | denotes | excess |
T20093 | 8112-8117 | NN | denotes | molar |
T20092 | 8103-8111 | JJ | denotes | 200-fold |
T20091 | 8102-8103 | -LRB- | denotes | ( |
T20090 | 8091-8101 | NN | denotes | competitor |
T20089 | 8075-8090 | NN | denotes | oligonucleotide |
T20088 | 8064-8074 | JJ | denotes | unlabelled |
T20087 | 8054-8063 | VBN | denotes | indicated |
T20086 | 8050-8053 | DT | denotes | the |
T20085 | 8048-8049 | , | denotes | , |
T20084 | 8042-8048 | NNS | denotes | assays |
T20083 | 8031-8041 | NN | denotes | supershift |
T20082 | 8028-8030 | CC | denotes | or |
T20081 | 8016-8027 | NN | denotes | competition |
T20080 | 8012-8015 | IN | denotes | For |
T20079 | 8010-8011 | . | denotes | . |
T20078 | 8005-8010 | NNP | denotes | MgCl2 |
T20077 | 8002-8004 | NNP | denotes | mM |
T20076 | 7998-8001 | CD | denotes | 0.6 |
T20075 | 7996-7997 | , | denotes | , |
T20074 | 7993-7996 | NNP | denotes | DTT |
T20073 | 7990-7992 | NNP | denotes | mM |
T20072 | 7985-7989 | CD | denotes | 0.25 |
T20071 | 7983-7984 | , | denotes | , |
T20070 | 7979-7983 | NNP | denotes | EDTA |
T20069 | 7976-7978 | NNP | denotes | mM |
T20068 | 7972-7975 | CD | denotes | 0.1 |
T20067 | 7970-7971 | , | denotes | , |
T20066 | 7969-7970 | -RRB- | denotes | ) |
T20065 | 7968-7969 | CD | denotes | 7 |
T20064 | 7965-7967 | NN | denotes | pH |
T20063 | 7964-7965 | -LRB- | denotes | ( |
T20062 | 7958-7963 | NNS | denotes | HEPES |
T20061 | 7955-7957 | NN | denotes | mM |
T20060 | 7952-7954 | CD | denotes | 10 |
T20059 | 7950-7951 | , | denotes | , |
T20058 | 7949-7950 | -RRB- | denotes | ) |
T20057 | 7944-7949 | JJ | denotes | dG-dC |
T20056 | 7943-7944 | -LRB- | denotes | ( |
T20055 | 7938-7942 | NN | denotes | poly |
T20054 | 7935-7937 | CC | denotes | or |
T20053 | 7933-7934 | -RRB- | denotes | ) |
T20052 | 7928-7933 | JJ | denotes | dI-dC |
T20051 | 7927-7928 | -LRB- | denotes | ( |
T20050 | 7922-7926 | NN | denotes | poly |
T20049 | 7919-7921 | NN | denotes | μl |
T20048 | 7918-7919 | NN | denotes | / |
T20047 | 7916-7918 | NN | denotes | ng |
T20046 | 7913-7915 | CD | denotes | 50 |
T20045 | 7911-7912 | , | denotes | , |
T20044 | 7908-7911 | NNP | denotes | BSA |
T20043 | 7905-7907 | NN | denotes | μl |
T20042 | 7904-7905 | NN | denotes | / |
T20041 | 7902-7904 | NN | denotes | ng |
T20040 | 7898-7901 | CD | denotes | 200 |
T20039 | 7896-7897 | , | denotes | , |
T20038 | 7888-7896 | NN | denotes | glycerol |
T20037 | 7886-7887 | NN | denotes | % |
T20036 | 7884-7886 | CD | denotes | 10 |
T20035 | 7882-7883 | , | denotes | , |
T20034 | 7878-7882 | NNP | denotes | NaCl |
T20033 | 7875-7877 | NNP | denotes | mM |
T20032 | 7871-7874 | CD | denotes | 100 |
T20031 | 7869-7870 | : | denotes | : |
T20030 | 7863-7869 | NN | denotes | buffer |
T20029 | 7855-7862 | JJ | denotes | binding |
T20028 | 7852-7854 | IN | denotes | in |
T20027 | 7845-7851 | NN | denotes | lysate |
T20026 | 7832-7844 | NN | denotes | reticulocyte |
T20025 | 7828-7831 | DT | denotes | the |
T20024 | 7823-7827 | IN | denotes | with |
T20023 | 7817-7822 | IN | denotes | along |
T20022 | 7812-7816 | NNS | denotes | Sox6 |
T20021 | 7795-7811 | JJ | denotes | vitro-translated |
T20020 | 7792-7794 | IN | denotes | in |
T20019 | 7789-7791 | IN | denotes | of |
T20018 | 7786-7788 | NN | denotes | μl |
T20017 | 7784-7785 | CD | denotes | 3 |
T20016 | 7781-7783 | CC | denotes | or |
T20015 | 7775-7780 | NNS | denotes | cells |
T20014 | 7771-7774 | NNP | denotes | MEL |
T20013 | 7766-7770 | IN | denotes | from |
T20012 | 7757-7765 | NNS | denotes | proteins |
T20011 | 7749-7756 | JJ | denotes | nuclear |
T19990 | 7639-7643 | VBD | denotes | were |
T19989 | 7622-7638 | NNS | denotes | oligonucleotides |
T19988 | 7608-7621 | JJ | denotes | complementary |
T19987 | 7592-7607 | JJ | denotes | Single-stranded |
T19986 | 7590-7591 | . | denotes | . |
T19985 | 7586-7590 | NNP | denotes | EMSA |
T20257 | 8925-8926 | : | denotes | ; |
T20256 | 8924-8925 | -RRB- | denotes | ) |
T20255 | 8917-8924 | NNP | denotes | MHB1648 |
T20254 | 8916-8917 | -LRB- | denotes | ( |
T20253 | 8914-8915 | NNP | denotes | ′ |
T20252 | 8877-8914 | NNP | denotes | AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3 |
T20251 | 8876-8877 | NN | denotes | ′ |
T20250 | 8875-8876 | CD | denotes | 5 |
T20249 | 8873-8874 | : | denotes | : |
T20248 | 8872-8873 | -RRB- | denotes | ) |
T20247 | 8870-8872 | NN | denotes | M2 |
T20246 | 8869-8870 | -LRB- | denotes | ( |
T20245 | 8867-8868 | CD | denotes | 2 |
T20244 | 8861-8866 | NN | denotes | probe |
T20243 | 8854-8860 | JJ | denotes | mutant |
T20242 | 8850-8853 | IN | denotes | for |
T20241 | 8848-8849 | : | denotes | ; |
T20240 | 8847-8848 | -RRB- | denotes | ) |
T20239 | 8840-8847 | NNP | denotes | MHB1644 |
T20238 | 8839-8840 | -LRB- | denotes | ( |
T20237 | 8837-8838 | NNP | denotes | ′ |
T20236 | 8807-8837 | NNP | denotes | AACAAAGGGTCAGAACATTGTCTGCGAAG3 |
T20235 | 8806-8807 | CD | denotes | ′ |
T20234 | 8805-8806 | CD | denotes | 5 |
T20233 | 8803-8804 | : | denotes | : |
T20232 | 8802-8803 | -RRB- | denotes | ) |
T20231 | 8800-8802 | NN | denotes | M1 |
T20230 | 8799-8800 | -LRB- | denotes | ( |
T20229 | 8797-8798 | CD | denotes | 1 |
T20228 | 8791-8796 | NN | denotes | probe |
T20227 | 8784-8790 | JJ | denotes | mutant |
T19604 | 7583-7584 | . | denotes | . |
T19603 | 7582-7583 | -RRB- | denotes | ) |
T19602 | 7576-7582 | NNPS | denotes | States |
T19601 | 7569-7575 | NNP | denotes | United |
T19600 | 7567-7568 | , | denotes | , |
T19599 | 7563-7567 | NNP | denotes | York |
T19598 | 7559-7562 | NNP | denotes | New |
T19597 | 7557-7558 | , | denotes | , |
T19596 | 7551-7557 | NNP | denotes | Placid |
T19595 | 7546-7550 | NNP | denotes | Lake |
T19594 | 7545-7546 | -LRB- | denotes | ( |
T19593 | 7531-7544 | NNP | denotes | Biotechnology |
T19592 | 7523-7530 | NNP | denotes | Upstate |
T19591 | 7518-7522 | IN | denotes | from |
T20010 | 7746-7748 | IN | denotes | of |
T20009 | 7743-7745 | NN | denotes | μg |
T20008 | 7741-7742 | CD | denotes | 5 |
T20007 | 7736-7740 | IN | denotes | with |
T20006 | 7726-7735 | VBN | denotes | performed |
T20005 | 7722-7725 | VBD | denotes | was |
T20004 | 7717-7721 | NNP | denotes | EMSA |
T20003 | 7715-7716 | . | denotes | . |
T20002 | 7709-7715 | NN | denotes | kinase |
T20001 | 7694-7708 | NN | denotes | polynucleotide |
T20000 | 7691-7693 | CD | denotes | T4 |
T19999 | 7686-7690 | IN | denotes | with |
T19998 | 7682-7685 | NNP | denotes | ATP |
T19997 | 7680-7681 | NNP | denotes | ] |
T19996 | 7675-7680 | NNP | denotes | γ-32P |
T19995 | 7674-7675 | NNP | denotes | [ |
T19994 | 7669-7673 | IN | denotes | with |
T19993 | 7657-7668 | JJ | denotes | end-labeled |
T19992 | 7653-7656 | CC | denotes | and |
T19991 | 7644-7652 | JJ | denotes | annealed |
T19590 | 7509-7517 | VBN | denotes | obtained |
T19589 | 7505-7508 | VBD | denotes | was |
T19588 | 7496-7504 | NN | denotes | antibody |
T19587 | 7492-7495 | NNP | denotes | IgG |
T19586 | 7485-7491 | NN | denotes | rabbit |
T19585 | 7478-7484 | JJ | denotes | Normal |
T19584 | 7476-7477 | . | denotes | . |
T19583 | 7466-7476 | NNP | denotes | Invitrogen |
T19582 | 7461-7465 | IN | denotes | from |
T19581 | 7451-7460 | VBN | denotes | purchased |
T19580 | 7447-7450 | VBD | denotes | was |
T19579 | 7438-7446 | NN | denotes | antibody |
T19578 | 7432-7437 | JJ | denotes | c-Myc |
T19577 | 7430-7431 | . | denotes | . |
T19576 | 7423-7430 | NNS | denotes | results |
T19575 | 7415-7422 | JJ | denotes | similar |
T19574 | 7405-7414 | VBD | denotes | generated |
T19573 | 7394-7404 | NNS | denotes | antibodies |
T19572 | 7389-7393 | JJ | denotes | Sox6 |
T19571 | 7385-7388 | DT | denotes | All |
T19570 | 7383-7384 | . | denotes | . |
T19569 | 7382-7383 | -RRB- | denotes | ) |
T19568 | 7376-7382 | NNPS | denotes | States |
T19567 | 7369-7375 | NNP | denotes | United |
T19566 | 7367-7368 | , | denotes | , |
T19565 | 7357-7367 | NNP | denotes | California |
T19564 | 7355-7356 | , | denotes | , |
T19563 | 7351-7355 | NNP | denotes | Cruz |
T19562 | 7345-7350 | NNP | denotes | Santa |
T19561 | 7343-7344 | , | denotes | , |
T19560 | 7330-7343 | NNP | denotes | Biotechnology |
T19559 | 7325-7329 | NNP | denotes | Cruz |
T19558 | 7319-7324 | NNP | denotes | Santa |
T19557 | 7317-7318 | , | denotes | , |
T19556 | 7316-7317 | NNP | denotes | X |
T19555 | 7307-7315 | JJ | denotes | sc-17332 |
T19554 | 7305-7306 | . | denotes | . |
T19553 | 7303-7305 | UH | denotes | No |
T19552 | 7295-7302 | NN | denotes | Catalog |
T19551 | 7294-7295 | -LRB- | denotes | ( |
T19550 | 7285-7293 | VBN | denotes | obtained |
T19549 | 7272-7284 | RB | denotes | commercially |
T19548 | 7269-7271 | CC | denotes | or |
T19547 | 7267-7268 | -RRB- | denotes | ) |
T19546 | 7266-7267 | NNP | denotes | ] |
T19545 | 7265-7266 | CD | denotes | 7 |
T19544 | 7264-7265 | NNP | denotes | [ |
T19543 | 7257-7263 | NNP | denotes | France |
T19542 | 7255-7256 | , | denotes | , |
T19541 | 7248-7255 | NNP | denotes | Pasteur |
T19540 | 7242-7247 | NNP | denotes | Louis |
T19539 | 7231-7241 | NNP | denotes | Université |
T19538 | 7230-7231 | -LRB- | denotes | ( |
T19537 | 7224-7229 | NNP | denotes | Lalli |
T19536 | 7219-7223 | NNP | denotes | Enzo |
T19535 | 7215-7218 | NNP | denotes | Dr. |
T19534 | 7212-7214 | IN | denotes | by |
T19533 | 7203-7211 | VBN | denotes | provided |
T19532 | 7196-7202 | RB | denotes | kindly |
T19531 | 7189-7195 | RB | denotes | either |
T19530 | 7184-7188 | VBD | denotes | were |
T19529 | 7178-7183 | NN | denotes | study |
T19528 | 7173-7177 | DT | denotes | this |
T19527 | 7170-7172 | IN | denotes | in |
T19526 | 7165-7169 | VBN | denotes | used |
T19525 | 7154-7164 | NNS | denotes | antibodies |
T19524 | 7149-7153 | JJ | denotes | Sox6 |
T19523 | 7147-7148 | . | denotes | . |
T19522 | 7137-7147 | NNS | denotes | Antibodies |
T19273 | 6651-6662 | NN | denotes | translation |
T19272 | 6645-6650 | NN | denotes | vitro |
T19271 | 6642-6644 | IN | denotes | in |
T19270 | 6638-6641 | CC | denotes | and |
T19269 | 6630-6637 | VB | denotes | extract |
T19268 | 6622-6629 | NN | denotes | protein |
T19267 | 6614-6621 | NNP | denotes | Nuclear |
T19074 | 6611-6612 | . | denotes | . |
T19073 | 6601-6611 | NN | denotes | efficiency |
T19072 | 6588-6600 | NN | denotes | transfection |
T19071 | 6584-6587 | IN | denotes | for |
T19070 | 6576-6583 | NN | denotes | control |
T19069 | 6574-6575 | DT | denotes | a |
T19068 | 6571-6573 | IN | denotes | as |
T19067 | 6566-6570 | VBN | denotes | used |
T19066 | 6562-6565 | VBD | denotes | was |
T19065 | 6560-6561 | -RRB- | denotes | ) |
T19064 | 6553-6560 | NNP | denotes | Promega |
T19063 | 6552-6553 | -LRB- | denotes | ( |
T19062 | 6547-6551 | JJ | denotes | 15ng |
T19061 | 6539-6546 | JJ | denotes | pRL-CMV |
T19060 | 6537-6538 | . | denotes | . |
T19059 | 6536-6537 | -RRB- | denotes | ) |
T19058 | 6534-6536 | NN | denotes | ng |
T19051 | 6513-6515 | NN | denotes | ng |
T19050 | 6509-6512 | CD | denotes | 200 |
T19049 | 6504-6508 | VBD | denotes | used |
T19036 | 6455-6461 | NN | denotes | vector |
T19035 | 6440-6454 | NN | denotes | overexpression |
T19034 | 6435-6439 | JJ | denotes | Sox6 |
T19033 | 6432-6434 | CC | denotes | or |
T19032 | 6425-6431 | NN | denotes | vector |
T19031 | 6419-6424 | JJ | denotes | empty |
T19030 | 6412-6418 | DT | denotes | either |
T19029 | 6407-6411 | IN | denotes | with |
T19028 | 6401-6406 | IN | denotes | along |
T19027 | 6399-6400 | -RRB- | denotes | ) |
T19026 | 6397-6399 | NN | denotes | ng |
T19025 | 6393-6396 | CD | denotes | 500 |
T19024 | 6392-6393 | -LRB- | denotes | ( |
T19023 | 6381-6391 | NNS | denotes | constructs |
T19022 | 6372-6380 | NN | denotes | reporter |
T19021 | 6363-6371 | NN | denotes | promoter |
T19020 | 6360-6362 | JJ | denotes | ɛy |
T19019 | 6355-6359 | IN | denotes | with |
T19018 | 6343-6354 | VBN | denotes | transfected |
T19017 | 6338-6342 | VBD | denotes | were |
T19016 | 6332-6337 | NNS | denotes | Cells |
T19015 | 6330-6331 | . | denotes | . |
T19014 | 6329-6330 | -RRB- | denotes | ) |
T19013 | 6323-6329 | NNPS | denotes | States |
T19012 | 6316-6322 | NNP | denotes | United |
T19011 | 6314-6315 | , | denotes | , |
T19010 | 6307-6314 | NNP | denotes | Indiana |
T19009 | 6305-6306 | , | denotes | , |
T19008 | 6293-6305 | NNP | denotes | Indianapolis |
T19007 | 6291-6292 | , | denotes | , |
T19006 | 6286-6291 | NNP | denotes | Roche |
T19005 | 6285-6286 | -LRB- | denotes | ( |
T19004 | 6277-6284 | NNP | denotes | FuGENE6 |
T19003 | 6274-6276 | IN | denotes | by |
T19002 | 6265-6273 | NNS | denotes | plasmids |
T19001 | 6260-6264 | IN | denotes | with |
T19000 | 6248-6259 | VBN | denotes | transfected |
T18999 | 6243-6247 | VBD | denotes | were |
T18998 | 6236-6242 | NN | denotes | growth |
T18997 | 6233-6235 | IN | denotes | of |
T18996 | 6227-6232 | NN | denotes | phase |
T18995 | 6223-6226 | VB | denotes | log |
T18994 | 6220-6222 | IN | denotes | in |
T18993 | 6218-6219 | -RRB- | denotes | ) |
T18992 | 6215-6218 | CD | denotes | 105 |
T18991 | 6213-6214 | CD | denotes | × |
T18990 | 6211-6212 | CD | denotes | 4 |
T18989 | 6210-6211 | -LRB- | denotes | ( |
T18988 | 6204-6209 | NNS | denotes | cells |
T18987 | 6198-6203 | CD | denotes | GM979 |
T18986 | 6196-6197 | . | denotes | . |
T18985 | 6195-6196 | -RRB- | denotes | ) |
T18984 | 6190-6195 | NN | denotes | serum |
T18983 | 6186-6189 | DT | denotes | the |
T18982 | 6173-6185 | VBG | denotes | inactivating |
T18981 | 6168-6172 | NN | denotes | heat |
T18980 | 6160-6167 | IN | denotes | without |
T18979 | 6159-6160 | -LRB- | denotes | ( |
T18978 | 6153-6158 | IN | denotes | above |
T18977 | 6150-6152 | IN | denotes | as |
T18976 | 6137-6149 | VBD | denotes | supplemented |
T18975 | 6132-6136 | NNP | denotes | DMEM |
T18974 | 6129-6131 | IN | denotes | in |
T18973 | 6120-6128 | VBN | denotes | cultured |
T18972 | 6115-6119 | VBD | denotes | were |
T18971 | 6109-6114 | NNS | denotes | cells |
T18970 | 6105-6108 | NNP | denotes | MEL |
T18969 | 6103-6104 | . | denotes | . |
T18968 | 6102-6103 | -RRB- | denotes | ) |
T18967 | 6100-6102 | NNP | denotes | mM |
T18966 | 6098-6099 | CD | denotes | 2 |
T18965 | 6097-6098 | -LRB- | denotes | ( |
T18964 | 6085-6096 | NNP | denotes | L-glutamine |
T18963 | 6081-6084 | CC | denotes | and |
T18962 | 6079-6080 | , | denotes | , |
T18961 | 6078-6079 | -RRB- | denotes | ) |
T18960 | 6076-6078 | NN | denotes | ml |
T18959 | 6075-6076 | NN | denotes | / |
T18958 | 6073-6075 | NN | denotes | μg |
T18957 | 6069-6072 | CD | denotes | 100 |
T18956 | 6056-6068 | NNP | denotes | streptomycin |
T18955 | 6054-6055 | , | denotes | , |
T18954 | 6053-6054 | -RRB- | denotes | ) |
T18953 | 6045-6053 | NN | denotes | units/ml |
T18952 | 6041-6044 | CD | denotes | 100 |
T18951 | 6040-6041 | -LRB- | denotes | ( |
T18950 | 6029-6039 | NN | denotes | penicillin |
T18949 | 6027-6028 | , | denotes | , |
T18948 | 6026-6027 | -RRB- | denotes | ) |
T18947 | 6020-6026 | NNPS | denotes | States |
T18946 | 6013-6019 | NNP | denotes | United |
T18945 | 6011-6012 | , | denotes | , |
T18944 | 6001-6011 | NNP | denotes | California |
T18943 | 5999-6000 | , | denotes | , |
T18942 | 5991-5999 | NNP | denotes | Carlsbad |
T18941 | 5989-5990 | , | denotes | , |
T18940 | 5980-5989 | NNP | denotes | Ivitrogen |
T18939 | 5979-5980 | -LRB- | denotes | ( |
T18938 | 5973-5978 | NN | denotes | serum |
T18937 | 5968-5972 | NN | denotes | calf |
T19363 | 7134-7135 | . | denotes | . |
T19362 | 7127-7134 | NN | denotes | control |
T19361 | 7118-7126 | JJ | denotes | negative |
T19360 | 7116-7117 | DT | denotes | a |
T19359 | 7113-7115 | IN | denotes | as |
T19358 | 7102-7112 | VBN | denotes | translated |
T19357 | 7097-7101 | RB | denotes | also |
T19356 | 7093-7096 | VBD | denotes | was |
T19355 | 7084-7092 | NN | denotes | sequence |
T19354 | 7077-7083 | NN | denotes | coding |
T19353 | 7072-7076 | JJ | denotes | Sox6 |
T19352 | 7068-7071 | DT | denotes | the |
T19351 | 7060-7067 | IN | denotes | without |
T19350 | 7053-7059 | NN | denotes | vector |
T19349 | 7051-7052 | DT | denotes | A |
T19348 | 7049-7050 | . | denotes | . |
T19347 | 7048-7049 | -RRB- | denotes | ) |
T19346 | 7041-7048 | NNP | denotes | Promega |
T19345 | 7039-7040 | , | denotes | , |
T19344 | 7032-7039 | NNPS | denotes | Systems |
T19343 | 7006-7031 | NNP | denotes | Transcription/Translation |
T19342 | 6998-7005 | NNP | denotes | Coupled |
T19341 | 6992-6997 | NNP | denotes | Quick |
T19340 | 6990-6991 | CD | denotes | ® |
T19339 | 6987-6990 | NNP | denotes | TNT |
T19338 | 6986-6987 | -LRB- | denotes | ( |
T19337 | 6979-6985 | NN | denotes | system |
T19336 | 6965-6978 | JJ | denotes | translational |
T19335 | 6959-6964 | NN | denotes | vitro |
T19334 | 6956-6958 | IN | denotes | in |
T19333 | 6950-6955 | VBN | denotes | based |
T19332 | 6943-6949 | NN | denotes | lysate |
T19331 | 6930-6942 | NN | denotes | reticulocyte |
T19330 | 6928-6929 | DT | denotes | a |
T19329 | 6925-6927 | IN | denotes | in |
T19328 | 6915-6924 | VBN | denotes | performed |
T19327 | 6911-6914 | VBD | denotes | was |
T19314 | 6854-6859 | JJ | denotes | c-Myc |
T19313 | 6849-6853 | IN | denotes | with |
T19312 | 6842-6848 | VBN | denotes | tagged |
T19311 | 6840-6841 | , | denotes | , |
T19310 | 6834-6840 | NN | denotes | vector |
T19309 | 6823-6833 | NN | denotes | expression |
T19308 | 6811-6822 | NN | denotes | translation |
T19307 | 6805-6810 | NN | denotes | vitro |
T19306 | 6802-6804 | IN | denotes | in |
T19305 | 6797-6801 | NNP | denotes | Sox6 |
T19304 | 6793-6796 | DT | denotes | The |
T19303 | 6791-6792 | . | denotes | . |
T19302 | 6790-6791 | -RRB- | denotes | ) |
T19301 | 6784-6790 | NNPS | denotes | States |
T19300 | 6777-6783 | NNP | denotes | United |
T19299 | 6775-6776 | , | denotes | , |
T19298 | 6765-6775 | NNP | denotes | California |
T19297 | 6763-6764 | , | denotes | , |
T19296 | 6755-6763 | NNP | denotes | Carlsbad |
T19295 | 6753-6754 | , | denotes | , |
T19294 | 6748-6753 | NN | denotes | Motif |
T19293 | 6741-6747 | JJ | denotes | Active |
T19292 | 6740-6741 | -LRB- | denotes | ( |
T19291 | 6736-6739 | NN | denotes | kit |
T19290 | 6734-6735 | DT | denotes | a |
T19289 | 6728-6733 | VBG | denotes | using |
T19288 | 6726-6727 | -RRB- | denotes | ) |
T19287 | 6723-6726 | CD | denotes | 107 |
T19286 | 6721-6722 | CD | denotes | × |
T19285 | 6719-6720 | CD | denotes | 2 |
T19284 | 6718-6719 | -LRB- | denotes | ( |
T19283 | 6712-6717 | NNS | denotes | cells |
T19282 | 6708-6711 | NNP | denotes | MEL |
T19281 | 6703-6707 | IN | denotes | from |
T19280 | 6694-6702 | VBN | denotes | prepared |
T19279 | 6689-6693 | VBD | denotes | were |
T19278 | 6680-6688 | NNS | denotes | extracts |
T19277 | 6672-6679 | NNP | denotes | Nuclear |
T19276 | 6670-6671 | . | denotes | . |
T19275 | 6666-6670 | NNP | denotes | Sox6 |
T19274 | 6663-6665 | IN | denotes | of |
T18936 | 5962-5967 | JJ | denotes | fetal |
T18935 | 5960-5961 | NN | denotes | % |
T18934 | 5958-5960 | CD | denotes | 10 |
T18933 | 5941-5957 | JJ | denotes | heat-inactivated |
T18932 | 5936-5940 | IN | denotes | with |
T18931 | 5923-5935 | VBD | denotes | supplemented |
T18930 | 5911-5922 | NNP | denotes | L-glutamine |
T18929 | 5908-5910 | NNP | denotes | mM |
T18928 | 5906-5907 | CD | denotes | 2 |
T18927 | 5901-5905 | IN | denotes | with |
T18926 | 5897-5900 | CD | denotes | F12 |
T18925 | 5894-5896 | POS | denotes | 's |
T18924 | 5891-5894 | NNP | denotes | Ham |
T18923 | 5888-5890 | IN | denotes | in |
T18922 | 5879-5887 | VBN | denotes | cultured |
T18921 | 5874-5878 | VBD | denotes | were |
T18920 | 5872-5873 | -RRB- | denotes | ) |
T18919 | 5866-5872 | NNPS | denotes | States |
T18918 | 5859-5865 | NNP | denotes | United |
T18917 | 5857-5858 | , | denotes | , |
T18916 | 5851-5857 | NNP | denotes | Jersey |
T18915 | 5847-5850 | NNP | denotes | New |
T18914 | 5845-5846 | , | denotes | , |
T18913 | 5839-5845 | NNP | denotes | Camden |
T18912 | 5837-5838 | , | denotes | , |
T18911 | 5825-5837 | NNPS | denotes | Repositories |
T18910 | 5820-5824 | NNP | denotes | Cell |
T18909 | 5812-5819 | NNP | denotes | Coriell |
T18908 | 5811-5812 | -LRB- | denotes | ( |
T18907 | 5805-5810 | NNS | denotes | cells |
T18906 | 5799-5804 | CD | denotes | GM979 |
T18905 | 5797-5798 | . | denotes | . |
T18904 | 5785-5797 | NN | denotes | transfection |
T18903 | 5781-5784 | CC | denotes | and |
T18902 | 5773-5780 | NN | denotes | culture |
T18901 | 5768-5772 | NNP | denotes | Cell |
T18684 | 5764-5766 | NN | denotes | d. |
T18683 | 5762-5763 | CD | denotes | 6 |
T18682 | 5758-5761 | IN | denotes | for |
T18681 | 5756-5757 | NNP | denotes | C |
T18680 | 5755-5756 | CD | denotes | ° |
T18679 | 5752-5754 | CD | denotes | 80 |
T18678 | 5751-5752 | CD | denotes | − |
T18677 | 5748-5750 | IN | denotes | at |
T18676 | 5746-5747 | -RRB- | denotes | ) |
T18675 | 5740-5746 | NNPS | denotes | States |
T18674 | 5733-5739 | NNP | denotes | United |
T18673 | 5731-5732 | , | denotes | , |
T18672 | 5727-5731 | NNP | denotes | York |
T18671 | 5723-5726 | NNP | denotes | New |
T19057 | 6529-6533 | CD | denotes | 1000 |
T19056 | 6525-6528 | CC | denotes | and |
T19055 | 6523-6524 | , | denotes | , |
T19054 | 6521-6523 | NN | denotes | ng |
T19053 | 6517-6520 | CD | denotes | 500 |
T19052 | 6515-6516 | , | denotes | , |
T18670 | 5721-5722 | , | denotes | , |
T18669 | 5712-5721 | NNP | denotes | Rochester |
T18668 | 5710-5711 | , | denotes | , |
T18667 | 5705-5710 | NNP | denotes | Kodak |
T18666 | 5704-5705 | -LRB- | denotes | ( |
T18665 | 5699-5703 | NN | denotes | film |
T18664 | 5693-5698 | NN | denotes | X-ray |
T18663 | 5690-5692 | TO | denotes | to |
T18662 | 5681-5689 | NN | denotes | exposure |
T18661 | 5678-5680 | TO | denotes | to |
T18660 | 5672-5677 | RB | denotes | prior |
T18659 | 5670-5671 | NNP | denotes | C |
T18658 | 5669-5670 | CD | denotes | ° |
T18657 | 5666-5668 | CD | denotes | 60 |
T18656 | 5663-5665 | IN | denotes | at |
T18655 | 5659-5662 | NNP | denotes | SDS |
T18654 | 5657-5658 | NN | denotes | % |
T18653 | 5656-5657 | CD | denotes | 1 |
T18652 | 5654-5655 | , | denotes | , |
T18651 | 5651-5654 | NNP | denotes | SSC |
T18650 | 5649-5650 | CD | denotes | × |
T18649 | 5646-5649 | CD | denotes | 0.2 |
T18648 | 5641-5645 | IN | denotes | with |
T18647 | 5634-5640 | VBN | denotes | washed |
T18646 | 5629-5633 | VBD | denotes | were |
T18645 | 5623-5628 | NNS | denotes | Blots |
T18644 | 5621-5622 | . | denotes | . |
T18643 | 5613-5621 | NN | denotes | solution |
T18642 | 5599-5612 | NN | denotes | hybridization |
T18641 | 5595-5598 | NNP | denotes | SDS |
T18640 | 5593-5594 | NN | denotes | % |
T18639 | 5592-5593 | CD | denotes | 7 |
T18638 | 5583-5591 | VBD | denotes | buffered |
T18637 | 5573-5582 | NN | denotes | phosphate |
T18636 | 5570-5572 | IN | denotes | in |
T18635 | 5560-5569 | VBN | denotes | performed |
T18634 | 5556-5559 | VBD | denotes | was |
T18633 | 5542-5555 | NN | denotes | hybridization |
T18632 | 5538-5541 | DT | denotes | The |
T18631 | 5536-5537 | . | denotes | . |
T18630 | 5535-5536 | -RRB- | denotes | ) |
T18629 | 5528-5535 | NNP | denotes | Kingdom |
T18628 | 5521-5527 | NNP | denotes | United |
T18627 | 5519-5520 | , | denotes | , |
T18615 | 5436-5442 | JJ | denotes | random |
T18614 | 5433-5435 | IN | denotes | by |
T18613 | 5431-5432 | , | denotes | , |
T18612 | 5427-5431 | NNP | denotes | dCTP |
T18611 | 5426-5427 | NNP | denotes | ] |
T18610 | 5421-5426 | NNP | denotes | α-32P |
T18609 | 5420-5421 | NNP | denotes | [ |
T18608 | 5415-5419 | IN | denotes | with |
T18607 | 5407-5414 | VBN | denotes | labeled |
T18606 | 5403-5406 | CC | denotes | and |
T18605 | 5401-5402 | -RRB- | denotes | ) |
T18604 | 5397-5401 | CD | denotes | 1927 |
T18603 | 5392-5396 | CD | denotes | 1353 |
T18602 | 5380-5391 | NNS | denotes | nucleotides |
T18601 | 5379-5380 | -LRB- | denotes | ( |
T18600 | 5372-5378 | NNP | denotes | RT-PCR |
T18599 | 5369-5371 | IN | denotes | by |
T18598 | 5359-5368 | VBN | denotes | generated |
T18597 | 5353-5358 | NN | denotes | probe |
T18596 | 5348-5352 | JJ | denotes | Sox6 |
T18595 | 5346-5347 | DT | denotes | a |
T18594 | 5341-5345 | IN | denotes | with |
T18593 | 5330-5340 | VBN | denotes | hybridized |
T18592 | 5326-5329 | VBD | denotes | was |
T18591 | 5324-5325 | -RRB- | denotes | ) |
T18590 | 5318-5324 | NNPS | denotes | States |
T18589 | 5311-5317 | NNP | denotes | United |
T18588 | 5309-5310 | , | denotes | , |
T18587 | 5301-5309 | NNP | denotes | Maryland |
T18586 | 5299-5300 | , | denotes | , |
T18585 | 5290-5299 | NNP | denotes | Rockville |
T18584 | 5288-5289 | , | denotes | , |
T18583 | 5281-5288 | NNP | denotes | Seegene |
T18582 | 5280-5281 | -LRB- | denotes | ( |
T18581 | 5273-5279 | NN | denotes | filter |
T18580 | 5268-5272 | NN | denotes | blot |
T18579 | 5259-5267 | NNP | denotes | Northern |
T18578 | 5252-5258 | NN | denotes | tissue |
T18577 | 5242-5251 | JJ | denotes | embryonic |
T18576 | 5236-5241 | NN | denotes | mouse |
T18575 | 5234-5235 | DT | denotes | A |
T18574 | 5232-5233 | . | denotes | . |
T18573 | 5228-5232 | NN | denotes | blot |
T18572 | 5219-5227 | NNP | denotes | Northern |
T18406 | 5083-5084 | NN | denotes | × |
T18405 | 5081-5083 | CD | denotes | 40 |
T18404 | 5080-5081 | -LRB- | denotes | ( |
T18403 | 5074-5079 | NNP | denotes | Nikon |
T18402 | 5070-5073 | CD | denotes | .17 |
T18401 | 5065-5070 | CD | denotes | 160/0 |
T18400 | 5061-5064 | CD | denotes | .65 |
T18399 | 5057-5061 | CD | denotes | 40/0 |
T18398 | 5052-5056 | NNP | denotes | Plan |
T18397 | 5050-5051 | NNP | denotes | E |
T18396 | 5045-5049 | VBD | denotes | were |
T18395 | 5040-5044 | VBN | denotes | used |
T18394 | 5029-5039 | NNS | denotes | Objectives |
T18393 | 5027-5028 | . | denotes | . |
T18392 | 5017-5027 | NN | denotes | microscope |
T18391 | 5006-5016 | NNP | denotes | Labophot-2 |
T18390 | 5000-5005 | NNP | denotes | Nikon |
T18389 | 4995-4999 | IN | denotes | with |
T18388 | 4986-4994 | VBN | denotes | obtained |
T18387 | 4981-4985 | VBD | denotes | were |
T18386 | 4974-4980 | NNS | denotes | Images |
T18385 | 4972-4973 | . | denotes | . |
T18384 | 4966-4972 | NN | denotes | manner |
T18383 | 4958-4965 | JJ | denotes | similar |
T18382 | 4956-4957 | DT | denotes | a |
T18381 | 4953-4955 | IN | denotes | in |
T18380 | 4944-4952 | VBN | denotes | prepared |
T18379 | 4939-4943 | VBD | denotes | were |
T18378 | 4937-4938 | -RRB- | denotes | ) |
T18377 | 4934-4937 | NN | denotes | dpc |
T18376 | 4929-4933 | CD | denotes | 18.5 |
T18375 | 4925-4928 | CC | denotes | and |
T18374 | 4921-4924 | NN | denotes | dpc |
T18373 | 4916-4920 | CD | denotes | 14.5 |
T18372 | 4913-4915 | IN | denotes | at |
T18371 | 4912-4913 | -LRB- | denotes | ( |
T18370 | 4904-4911 | NNS | denotes | samples |
T18369 | 4898-4903 | NNP | denotes | Liver |
T18368 | 4896-4897 | . | denotes | . |
T18367 | 4891-4896 | NN | denotes | eosin |
T18366 | 4887-4890 | CC | denotes | and |
T18365 | 4875-4886 | NN | denotes | hematoxylin |
T18364 | 4870-4874 | IN | denotes | with |
T18363 | 4862-4869 | VBN | denotes | stained |
T18362 | 4858-4861 | CC | denotes | and |
T18361 | 4856-4857 | , | denotes | , |
T18360 | 4854-4856 | NN | denotes | μm |
T18359 | 4852-4853 | CD | denotes | 5 |
T18358 | 4849-4851 | IN | denotes | at |
T18357 | 4839-4848 | VBN | denotes | sectioned |
T18356 | 4837-4838 | , | denotes | , |
T18355 | 4820-4837 | JJ | denotes | paraffin-embedded |
T18354 | 4818-4819 | , | denotes | , |
T18353 | 4810-4818 | NN | denotes | formalin |
T18352 | 4808-4809 | NN | denotes | % |
T18351 | 4806-4808 | CD | denotes | 10 |
T18350 | 4803-4805 | IN | denotes | in |
T18349 | 4797-4802 | VBN | denotes | fixed |
T18348 | 4792-4796 | VBD | denotes | were |
T18347 | 4787-4791 | NNS | denotes | mice |
T18346 | 4782-4786 | CD | denotes | 10.5 |
T18345 | 4778-4781 | NN | denotes | day |
T18344 | 4768-4777 | JJ | denotes | postnatal |
T18343 | 4764-4767 | CC | denotes | and |
T18342 | 4762-4763 | , | denotes | , |
T18341 | 4755-4762 | NNS | denotes | embryos |
T18340 | 4748-4754 | JJ | denotes | mutant |
T18339 | 4744-4747 | CC | denotes | and |
T18338 | 4741-4743 | NNP | denotes | WT |
T18337 | 4732-4740 | JJ | denotes | 14.5-dpc |
T18336 | 4730-4731 | , | denotes | , |
T18335 | 4722-4730 | NN | denotes | analysis |
T18334 | 4716-4721 | VBP | denotes | mount |
T18333 | 4710-4715 | JJ | denotes | whole |
T18332 | 4706-4709 | IN | denotes | For |
T18331 | 4704-4705 | . | denotes | . |
T18330 | 4701-4704 | NNP | denotes | DAF |
T18329 | 4698-4700 | IN | denotes | by |
T18328 | 4693-4697 | VBN | denotes | read |
T18327 | 4689-4692 | CC | denotes | and |
T18326 | 4674-4688 | JJ | denotes | Wright-stained |
T18325 | 4669-4673 | VBD | denotes | were |
T18324 | 4662-4668 | NNS | denotes | slides |
T18323 | 4658-4661 | DT | denotes | The |
T18322 | 4656-4657 | . | denotes | . |
T18321 | 4652-4656 | NNS | denotes | mice |
T18320 | 4649-4651 | NNP | denotes | WT |
T18319 | 4645-4648 | CC | denotes | and |
T18318 | 4638-4644 | JJ | denotes | mutant |
T18317 | 4633-4637 | DT | denotes | both |
T18316 | 4628-4632 | IN | denotes | from |
T18315 | 4619-4627 | VBN | denotes | prepared |
T18314 | 4614-4618 | VBD | denotes | were |
T18313 | 4607-4613 | NNS | denotes | smears |
T18312 | 4601-4606 | NN | denotes | blood |
T18311 | 4590-4600 | JJ | denotes | peripheral |
T18310 | 4586-4589 | CC | denotes | and |
T18309 | 4572-4585 | VBN | denotes | exsanguinated |
T18308 | 4567-4571 | VBD | denotes | were |
T18307 | 4559-4566 | NNS | denotes | embryos |
T18306 | 4550-4558 | JJ | denotes | 18.5-dpc |
T18305 | 4548-4549 | . | denotes | . |
T18304 | 4539-4548 | NNP | denotes | Histology |
T18044 | 3989-3992 | NNP | denotes | RNA |
T18043 | 3977-3988 | VBN | denotes | transcribed |
T18042 | 3971-3976 | NN | denotes | vitro |
T18041 | 3968-3970 | IN | denotes | in |
T18040 | 3962-3967 | VBG | denotes | using |
T18039 | 3960-3961 | NNP | denotes | ] |
T18038 | 3958-3960 | CD | denotes | 52 |
T18037 | 3957-3958 | NNP | denotes | [ |
T18036 | 3947-3956 | VBN | denotes | described |
T18035 | 3944-3946 | IN | denotes | as |
T18034 | 3930-3943 | NN | denotes | hybridization |
T18033 | 3925-3929 | NN | denotes | situ |
T18032 | 3922-3924 | IN | denotes | in |
T18031 | 3918-3921 | IN | denotes | for |
T18030 | 3908-3917 | VBN | denotes | processed |
T18029 | 3903-3907 | VBD | denotes | were |
T18028 | 3896-3902 | NNS | denotes | Slides |
T18027 | 3894-3895 | . | denotes | . |
T18026 | 3893-3894 | -RRB- | denotes | ) |
T18025 | 3887-3893 | NNPS | denotes | States |
T18024 | 3880-3886 | NNP | denotes | United |
T18023 | 3878-3879 | , | denotes | , |
T18022 | 3866-3878 | NNP | denotes | Pennsylvania |
T18021 | 3864-3865 | , | denotes | , |
T18020 | 3857-3864 | NNP | denotes | Chester |
T18019 | 3852-3856 | NNP | denotes | West |
T18018 | 3850-3851 | , | denotes | , |
T18017 | 3847-3850 | NNP | denotes | VWR |
T18016 | 3846-3847 | -LRB- | denotes | ( |
T18015 | 3839-3845 | NNS | denotes | slides |
T18014 | 3830-3838 | VBN | denotes | modified |
T18013 | 3823-3829 | VB | denotes | charge |
T18012 | 3820-3822 | TO | denotes | to |
T18011 | 3812-3819 | VBD | denotes | adhered |
T18010 | 3808-3811 | CC | denotes | and |
T18436 | 5216-5217 | . | denotes | . |
T18435 | 5207-5216 | JJ | denotes | available |
T18434 | 5203-5206 | VBP | denotes | are |
T18433 | 5196-5202 | NNS | denotes | images |
T18432 | 5187-5195 | NNP | denotes | Original |
T18431 | 5185-5186 | . | denotes | . |
T18430 | 5181-5185 | CD | denotes | 4300 |
T18429 | 5173-5180 | NNP | denotes | Coolpix |
T18428 | 5167-5172 | NNP | denotes | Nikon |
T18427 | 5165-5166 | DT | denotes | a |
T18426 | 5161-5164 | VBD | denotes | was |
T18425 | 5154-5160 | NN | denotes | camera |
T18424 | 5150-5153 | DT | denotes | The |
T18423 | 5148-5149 | . | denotes | . |
T18422 | 5147-5148 | -RRB- | denotes | ) |
T18421 | 5138-5147 | NN | denotes | objective |
T18420 | 5136-5137 | CD | denotes | × |
T18419 | 5133-5136 | CD | denotes | 100 |
T18418 | 5132-5133 | -LRB- | denotes | ( |
T18417 | 5126-5131 | NNP | denotes | Nikon |
T18416 | 5122-5125 | CD | denotes | .17 |
T18415 | 5117-5122 | CD | denotes | 160/0 |
T18414 | 5113-5116 | NN | denotes | oil |
T18413 | 5109-5112 | CD | denotes | .25 |
T18412 | 5104-5109 | CD | denotes | 100/1 |
T18411 | 5099-5103 | NNP | denotes | Plan |
T18410 | 5097-5098 | NNP | denotes | E |
T18409 | 5095-5096 | , | denotes | , |
T18408 | 5094-5095 | -RRB- | denotes | ) |
T18407 | 5085-5094 | NN | denotes | objective |
T17681 | 3532-3533 | . | denotes | . |
T17680 | 3531-3532 | -RRB- | denotes | ) |
T17679 | 3525-3531 | NNPS | denotes | States |
T17678 | 3518-3524 | NNP | denotes | United |
T17677 | 3516-3517 | , | denotes | , |
T17676 | 3506-3516 | NNP | denotes | Washington |
T17675 | 3504-3505 | , | denotes | , |
T17674 | 3497-3504 | NNP | denotes | Redmond |
T17673 | 3496-3497 | -LRB- | denotes | ( |
T17672 | 3490-3495 | NNP | denotes | Excel |
T17671 | 3480-3489 | NNP | denotes | Microsoft |
T17670 | 3477-3479 | IN | denotes | in |
T17669 | 3471-3476 | NNP | denotes | GAPDH |
T17668 | 3468-3470 | TO | denotes | to |
T17667 | 3457-3467 | VBN | denotes | normalized |
T17666 | 3453-3456 | CC | denotes | and |
T17665 | 3451-3452 | -RRB- | denotes | ) |
T17664 | 3441-3451 | NNPS | denotes | Biosystems |
T17663 | 3433-3440 | NNP | denotes | Applied |
T17662 | 3432-3433 | -LRB- | denotes | ( |
T17661 | 3423-3431 | NNP | denotes | Software |
T17660 | 3419-3422 | NNP | denotes | SDS |
T17659 | 3414-3418 | CD | denotes | 7000 |
T17658 | 3408-3413 | NNP | denotes | Prism |
T17657 | 3404-3407 | NNP | denotes | ABI |
T17656 | 3400-3403 | DT | denotes | the |
T17655 | 3397-3399 | IN | denotes | in |
T17654 | 3386-3396 | VBN | denotes | calculated |
T17653 | 3381-3385 | VBD | denotes | were |
T17652 | 3374-3380 | NNS | denotes | values |
T17651 | 3361-3373 | JJ | denotes | quantitative |
T17650 | 3352-3360 | JJ | denotes | Relative |
T17649 | 3350-3351 | . | denotes | . |
T17648 | 3342-3350 | NN | denotes | reaction |
T17647 | 3338-3341 | NNP | denotes | PCR |
T17646 | 3333-3337 | DT | denotes | each |
T17645 | 3329-3332 | IN | denotes | for |
T17644 | 3324-3328 | VBN | denotes | done |
T17643 | 3319-3323 | VBD | denotes | were |
T17642 | 3307-3318 | NNS | denotes | Triplicates |
T17641 | 3305-3306 | . | denotes | . |
T17640 | 3291-3305 | NNS | denotes | amplifications |
T17639 | 3287-3290 | DT | denotes | the |
T17638 | 3284-3286 | IN | denotes | of |
T17637 | 3273-3283 | NN | denotes | efficiency |
T17636 | 3269-3272 | DT | denotes | the |
T17635 | 3264-3268 | VB | denotes | test |
T17634 | 3261-3263 | TO | denotes | to |
T17633 | 3251-3260 | VBN | denotes | performed |
T17632 | 3246-3250 | VBD | denotes | were |
T17631 | 3237-3245 | NNS | denotes | analyses |
T17630 | 3231-3236 | NN | denotes | curve |
T17629 | 3222-3230 | NNP | denotes | Standard |
T17628 | 3220-3221 | . | denotes | . |
T17627 | 3217-3220 | NNP | denotes | RNA |
T17626 | 3211-3216 | NN | denotes | input |
T17625 | 3207-3210 | IN | denotes | for |
T17624 | 3199-3206 | NN | denotes | control |
T17623 | 3196-3198 | IN | denotes | as |
T17622 | 3191-3195 | VBN | denotes | used |
T17621 | 3186-3190 | VBD | denotes | were |
T17620 | 3179-3185 | NNS | denotes | levels |
T17619 | 3174-3178 | NNP | denotes | mRNA |
T17618 | 3168-3173 | NNP | denotes | GAPDH |
T17617 | 3166-3167 | . | denotes | . |
T17616 | 3158-3166 | NN | denotes | supermix |
T17615 | 3152-3157 | JJ | denotes | green |
T17614 | 3147-3151 | NNP | denotes | SYBR |
T17613 | 3144-3146 | NN | denotes | μl |
T17612 | 3139-3143 | CD | denotes | 12.5 |
T17611 | 3134-3138 | IN | denotes | with |
T17610 | 3125-3133 | NN | denotes | reaction |
T17609 | 3119-3124 | JJ | denotes | 25-μl |
T17608 | 3117-3118 | DT | denotes | a |
T17607 | 3114-3116 | IN | denotes | in |
T17606 | 3104-3113 | VBN | denotes | performed |
T17605 | 3100-3103 | VBD | denotes | was |
T17604 | 3096-3099 | NNP | denotes | PCR |
T17603 | 3092-3095 | DT | denotes | All |
T17602 | 3090-3091 | . | denotes | . |
T17601 | 3082-3090 | NN | denotes | facility |
T17600 | 3077-3081 | NN | denotes | core |
T17599 | 3069-3076 | NNP | denotes | Arizona |
T17598 | 3066-3068 | IN | denotes | of |
T17597 | 3055-3065 | NNP | denotes | University |
T17596 | 3051-3054 | DT | denotes | the |
T17595 | 3048-3050 | IN | denotes | at |
T17594 | 3046-3047 | -RRB- | denotes | ) |
T17593 | 3040-3046 | NNPS | denotes | States |
T17592 | 3033-3039 | NNP | denotes | United |
T17591 | 3031-3032 | , | denotes | , |
T17590 | 3021-3031 | NNP | denotes | California |
T17589 | 3019-3020 | , | denotes | , |
T17588 | 3015-3019 | NNP | denotes | City |
T17587 | 3008-3014 | NNP | denotes | Foster |
T18152 | 4536-4537 | . | denotes | . |
T18151 | 4527-4536 | JJ | denotes | available |
T18150 | 4523-4526 | VBP | denotes | are |
T18149 | 4516-4522 | NNS | denotes | images |
T18148 | 4507-4515 | NNP | denotes | Original |
T18147 | 4505-4506 | . | denotes | . |
T18146 | 4498-4505 | NNS | denotes | plugins |
T18145 | 4496-4497 | -RRB- | denotes | ) |
T18144 | 4490-4496 | NNPS | denotes | States |
T18143 | 4483-4489 | NNP | denotes | United |
T18142 | 4481-4482 | , | denotes | , |
T18141 | 4473-4481 | NNP | denotes | Carolina |
T18140 | 4467-4472 | NNP | denotes | North |
T18139 | 4465-4466 | , | denotes | , |
T18138 | 4456-4465 | NNP | denotes | Asheville |
T18137 | 4454-4455 | , | denotes | , |
T18136 | 4446-4454 | NNP | denotes | Graphics |
T18135 | 4437-4445 | NNP | denotes | Reindeer |
T18134 | 4436-4437 | -LRB- | denotes | ( |
T18133 | 4432-4435 | FW | denotes | Pro |
T18132 | 4426-4431 | NNP | denotes | Fovea |
T18131 | 4421-4425 | IN | denotes | with |
T18130 | 4412-4420 | NN | denotes | software |
T18129 | 4410-4411 | -RRB- | denotes | ) |
T18128 | 4404-4410 | NNPS | denotes | States |
T18127 | 4397-4403 | NNP | denotes | United |
T18126 | 4395-4396 | , | denotes | , |
T18125 | 4385-4395 | NNP | denotes | California |
T18124 | 4383-4384 | , | denotes | , |
T18123 | 4379-4383 | NNP | denotes | Jose |
T18122 | 4375-4378 | NNP | denotes | San |
T18121 | 4373-4374 | , | denotes | , |
T18120 | 4368-4373 | NNP | denotes | Adobe |
T18119 | 4367-4368 | -LRB- | denotes | ( |
T18118 | 4357-4366 | NNP | denotes | Photoshop |
T18117 | 4351-4356 | VBG | denotes | using |
T18107 | 4297-4298 | -RRB- | denotes | ) |
T18106 | 4294-4297 | CD | denotes | 0.5 |
T18105 | 4292-4293 | SYM | denotes | = |
T18104 | 4289-4291 | NNP | denotes | NA |
T18103 | 4288-4289 | -LRB- | denotes | ( |
T18102 | 4286-4287 | NN | denotes | × |
T18101 | 4284-4286 | CD | denotes | 10 |
T18100 | 4280-4283 | CC | denotes | and |
T18099 | 4278-4279 | -RRB- | denotes | ) |
T18098 | 4274-4278 | CD | denotes | 0.04 |
T18097 | 4272-4273 | SYM | denotes | = |
T18096 | 4269-4271 | NNP | denotes | NA |
T18095 | 4268-4269 | -LRB- | denotes | ( |
T18094 | 4266-4267 | NN | denotes | × |
T18093 | 4265-4266 | CD | denotes | 1 |
T18092 | 4260-4264 | VBD | denotes | were |
T18091 | 4255-4259 | VBN | denotes | used |
T18090 | 4244-4254 | NNS | denotes | Objectives |
T18089 | 4242-4243 | . | denotes | . |
T18088 | 4241-4242 | -RRB- | denotes | ) |
T18087 | 4235-4241 | NNPS | denotes | States |
T18086 | 4228-4234 | NNP | denotes | United |
T18085 | 4226-4227 | , | denotes | , |
T18084 | 4218-4226 | NNP | denotes | Michigan |
T18083 | 4216-4217 | , | denotes | , |
T18082 | 4209-4216 | NNP | denotes | Heights |
T18081 | 4200-4208 | NNP | denotes | Sterling |
T18079 | 4187-4198 | NNP | denotes | Instruments |
T18078 | 4176-4186 | NNP | denotes | Diagnostic |
T18077 | 4175-4176 | -LRB- | denotes | ( |
T18076 | 4168-4174 | NN | denotes | camera |
T18075 | 4160-4167 | JJ | denotes | digital |
T18074 | 4150-4159 | JJ | denotes | RT-Slider |
T18073 | 4145-4149 | NNP | denotes | SPOT |
T18072 | 4141-4144 | CC | denotes | and |
T18071 | 4139-4140 | -RRB- | denotes | ) |
T18070 | 4133-4139 | NNPS | denotes | States |
T18069 | 4126-4132 | NNP | denotes | United |
T18068 | 4124-4125 | , | denotes | , |
T18067 | 4120-4124 | NNP | denotes | York |
T18066 | 4116-4119 | NNP | denotes | New |
T18065 | 4114-4115 | , | denotes | , |
T18064 | 4106-4114 | NNP | denotes | Melville |
T18063 | 4104-4105 | , | denotes | , |
T18062 | 4099-4104 | NNP | denotes | Nikon |
T18061 | 4098-4099 | -LRB- | denotes | ( |
T18060 | 4087-4097 | NN | denotes | microscope |
T18059 | 4078-4086 | NNP | denotes | Optiphot |
T18058 | 4072-4077 | NNP | denotes | Nikon |
T18057 | 4070-4071 | DT | denotes | a |
T18056 | 4065-4069 | IN | denotes | with |
T18055 | 4056-4064 | VBN | denotes | obtained |
T18054 | 4051-4055 | VBD | denotes | were |
T18053 | 4044-4050 | NNS | denotes | images |
T18052 | 4032-4043 | JJ | denotes | brightfield |
T18051 | 4028-4031 | CC | denotes | and |
T18050 | 4018-4027 | NNP | denotes | Darkfield |
T18049 | 4016-4017 | . | denotes | . |
T18048 | 4013-4016 | NNP | denotes | 33P |
T18047 | 4008-4012 | IN | denotes | with |
T18046 | 4000-4007 | VBN | denotes | labeled |
T18045 | 3993-3999 | NNS | denotes | probes |
T17586 | 3006-3007 | , | denotes | , |
T17585 | 2996-3006 | NNPS | denotes | Biosystems |
T17584 | 2988-2995 | NNP | denotes | Applied |
T17583 | 2987-2988 | -LRB- | denotes | ( |
T17582 | 2979-2986 | NNP | denotes | ABI7000 |
T17581 | 2976-2978 | DT | denotes | an |
T17580 | 2973-2975 | IN | denotes | on |
T17579 | 2969-2972 | VBN | denotes | run |
T17578 | 2965-2968 | VBD | denotes | was |
T17577 | 2951-2964 | NN | denotes | amplification |
T17576 | 2947-2950 | NNP | denotes | PCR |
T17575 | 2945-2946 | , | denotes | , |
T17574 | 2944-2945 | -RRB- | denotes | ) |
T17573 | 2938-2944 | NNPS | denotes | States |
T17572 | 2931-2937 | NNP | denotes | United |
T17571 | 2929-2930 | , | denotes | , |
T17570 | 2919-2929 | NNP | denotes | California |
T17569 | 2917-2918 | , | denotes | , |
T17568 | 2909-2917 | NNP | denotes | Hercules |
T17567 | 2907-2908 | , | denotes | , |
T17566 | 2900-2907 | NNP | denotes | Bio-Rad |
T17565 | 2899-2900 | -LRB- | denotes | ( |
T17564 | 2895-2898 | NNP | denotes | ROX |
T17563 | 2890-2894 | IN | denotes | with |
T17562 | 2886-2889 | NN | denotes | kit |
T17561 | 2877-2885 | NN | denotes | supermix |
T17560 | 2871-2876 | JJ | denotes | green |
T17559 | 2866-2870 | NNP | denotes | SYBR |
T17558 | 2862-2865 | DT | denotes | the |
T17557 | 2856-2861 | VBG | denotes | Using |
T17556 | 2854-2855 | . | denotes | . |
T17555 | 2853-2854 | NN | denotes | ′ |
T17554 | 2832-2853 | NNP | denotes | ACGATCATATTGCCCAGGAG3 |
T17553 | 2831-2832 | CD | denotes | ′ |
T17552 | 2830-2831 | CD | denotes | 5 |
T17551 | 2828-2829 | , | denotes | , |
T17550 | 2821-2828 | NNP | denotes | MHB1675 |
T17549 | 2817-2820 | CC | denotes | and |
T17548 | 2815-2816 | : | denotes | ; |
T17547 | 2814-2815 | NN | denotes | ′ |
T17546 | 2793-2814 | NNP | denotes | ATGGCCTGAATCACTTGGAC3 |
T17545 | 2792-2793 | CD | denotes | ′ |
T17544 | 2791-2792 | CD | denotes | 5 |
T17543 | 2789-2790 | : | denotes | : |
T17542 | 2782-2789 | NNP | denotes | MHB1674 |
T17541 | 2780-2781 | : | denotes | : |
T17540 | 2774-2780 | NN | denotes | globin |
T17539 | 2770-2773 | NN | denotes | min |
T17538 | 2769-2770 | NN | denotes | / |
T17537 | 2765-2769 | JJ | denotes | βmaj |
T17536 | 2761-2764 | IN | denotes | For |
T17535 | 2759-2760 | . | denotes | . |
T17534 | 2758-2759 | NN | denotes | ′ |
T17533 | 2737-2758 | NNP | denotes | ACCTCTGGGGTGAATTCCTT3 |
T17532 | 2736-2737 | CD | denotes | ′ |
T17531 | 2735-2736 | CD | denotes | 5 |
T17530 | 2733-2734 | , | denotes | , |
T17529 | 2726-2733 | NNP | denotes | MHB1673 |
T17528 | 2722-2725 | CC | denotes | and |
T17527 | 2720-2721 | : | denotes | ; |
T17526 | 2719-2720 | NN | denotes | ′ |
T17525 | 2698-2719 | CD | denotes | TGGACAACCTCAAGGAGACC3 |
T17524 | 2697-2698 | CD | denotes | ′ |
T17523 | 2696-2697 | CD | denotes | 5 |
T17522 | 2694-2695 | , | denotes | , |
T17521 | 2687-2694 | NNP | denotes | MHB1672 |
T17520 | 2685-2686 | : | denotes | : |
T17519 | 2679-2685 | NN | denotes | globin |
T17518 | 2675-2678 | JJ | denotes | βH1 |
T17517 | 2671-2674 | IN | denotes | For |
T17516 | 2669-2670 | . | denotes | . |
T17515 | 2668-2669 | NN | denotes | ′ |
T17514 | 2647-2668 | CD | denotes | CTTAACCGCATCCCCTACGG3 |
T17513 | 2646-2647 | NN | denotes | ′ |
T17512 | 2645-2646 | CD | denotes | 5 |
T17511 | 2643-2644 | , | denotes | , |
T17510 | 2636-2643 | NNP | denotes | MHB1669 |
T17509 | 2632-2635 | CC | denotes | and |
T17508 | 2630-2631 | : | denotes | ; |
T17507 | 2629-2630 | NN | denotes | ′ |
T17506 | 2607-2629 | CD | denotes | CTACCCCCAGACGAAGACCTA3 |
T17505 | 2606-2607 | NN | denotes | ′ |
T17504 | 2605-2606 | CD | denotes | 5 |
T17503 | 2603-2604 | , | denotes | , |
T17502 | 2596-2603 | CD | denotes | MHB1668 |
T17501 | 2594-2595 | : | denotes | : |
T17500 | 2588-2594 | NN | denotes | globin |
T17499 | 2586-2587 | JJ | denotes | ζ |
T17498 | 2582-2585 | IN | denotes | For |
T17497 | 2580-2581 | . | denotes | . |
T17496 | 2579-2580 | NN | denotes | ′ |
T17495 | 2557-2579 | NNP | denotes | GAAGCAGAGGACAAGTTCCCA3 |
T17494 | 2556-2557 | CD | denotes | ′ |
T17493 | 2555-2556 | CD | denotes | 5 |
T17492 | 2553-2554 | , | denotes | , |
T17491 | 2546-2553 | NNP | denotes | MHB1667 |
T17490 | 2542-2545 | CC | denotes | and |
T17489 | 2540-2541 | : | denotes | ; |
T17488 | 2539-2540 | NN | denotes | ′ |
T17487 | 2517-2539 | CD | denotes | TGGCCTGTGGAGTAAGGTCAA3 |
T17486 | 2516-2517 | CD | denotes | ′ |
T16996 | 2253-2254 | . | denotes | . |
T16995 | 2252-2253 | -RRB- | denotes | ) |
T16994 | 2250-2252 | CD | denotes | 18 |
T16993 | 2249-2250 | CD | denotes | − |
T16992 | 2246-2248 | TO | denotes | to |
T16991 | 2243-2245 | CD | denotes | 63 |
T16990 | 2242-2243 | FW | denotes | − |
T16989 | 2241-2242 | -LRB- | denotes | ( |
T16988 | 2239-2240 | NN | denotes | ′ |
T16987 | 2238-2239 | CD | denotes | 3 |
T16986 | 2191-2237 | NNP | denotes | CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
T16985 | 2190-2191 | NN | denotes | ′ |
T17485 | 2515-2516 | CD | denotes | 5 |
T17484 | 2513-2514 | , | denotes | , |
T17483 | 2506-2513 | NNP | denotes | MHB1666 |
T17482 | 2504-2505 | : | denotes | : |
T17481 | 2498-2504 | NN | denotes | globin |
T17480 | 2495-2497 | JJ | denotes | ɛy |
T17479 | 2491-2494 | IN | denotes | For |
T17478 | 2489-2490 | . | denotes | . |
T17477 | 2478-2489 | NN | denotes | specificity |
T17476 | 2470-2477 | VB | denotes | confirm |
T17475 | 2467-2469 | TO | denotes | to |
T17474 | 2458-2466 | NN | denotes | database |
T17473 | 2453-2457 | NNP | denotes | NCBI |
T17472 | 2449-2452 | DT | denotes | the |
T17471 | 2441-2448 | IN | denotes | against |
T17470 | 2432-2440 | VBN | denotes | searched |
T17469 | 2427-2431 | VBD | denotes | were |
T17468 | 2419-2426 | NNS | denotes | primers |
T17467 | 2415-2418 | DT | denotes | All |
T17466 | 2413-2414 | . | denotes | . |
T17465 | 2412-2413 | NNP | denotes | ] |
T17464 | 2410-2412 | CD | denotes | 51 |
T17463 | 2409-2410 | NNP | denotes | [ |
T17462 | 2398-2408 | NNP | denotes | Primerbank |
T17461 | 2393-2397 | IN | denotes | from |
T17460 | 2384-2392 | VBN | denotes | obtained |
T17459 | 2379-2383 | VBD | denotes | were |
T17458 | 2373-2378 | NNS | denotes | genes |
T17457 | 2366-2372 | NN | denotes | globin |
T17456 | 2363-2365 | IN | denotes | of |
T17455 | 2349-2362 | NN | denotes | amplification |
T17454 | 2345-2348 | NNP | denotes | PCR |
T17453 | 2340-2344 | NNP | denotes | cDNA |
T17452 | 2336-2339 | IN | denotes | for |
T17451 | 2328-2335 | NNS | denotes | Primers |
T17450 | 2326-2327 | . | denotes | . |
T17449 | 2322-2326 | NNP | denotes | cDNA |
T17448 | 2319-2321 | TO | denotes | to |
T17447 | 2307-2318 | VBN | denotes | transcribed |
T17446 | 2299-2306 | JJ | denotes | reverse |
T17445 | 2293-2298 | JJ | denotes | first |
T17444 | 2289-2292 | VBD | denotes | was |
T17443 | 2285-2288 | NNP | denotes | RNA |
T17442 | 2283-2284 | . | denotes | . |
T17441 | 2279-2283 | NNP | denotes | mRNA |
T17440 | 2272-2278 | NN | denotes | globin |
T17439 | 2269-2271 | IN | denotes | of |
T17438 | 2256-2268 | NN | denotes | Quantitation |
T16984 | 2189-2190 | CD | denotes | 5 |
T16983 | 2187-2188 | , | denotes | , |
T16982 | 2180-2187 | NNP | denotes | MHB1663 |
T16981 | 2176-2179 | CC | denotes | and |
T16980 | 2174-2175 | : | denotes | ; |
T16979 | 2173-2174 | -RRB- | denotes | ) |
T16978 | 2171-2173 | CD | denotes | 16 |
T16977 | 2170-2171 | CD | denotes | − |
T16976 | 2167-2169 | TO | denotes | to |
T16975 | 2164-2166 | CD | denotes | 63 |
T16974 | 2163-2164 | FW | denotes | − |
T16973 | 2162-2163 | -LRB- | denotes | ( |
T16972 | 2160-2161 | NN | denotes | ′ |
T16971 | 2112-2160 | CD | denotes | CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3 |
T16970 | 2111-2112 | NN | denotes | ′ |
T16969 | 2110-2111 | CD | denotes | 5 |
T16968 | 2108-2109 | , | denotes | , |
T16967 | 2101-2108 | NNP | denotes | MHB1662 |
T16966 | 2099-2100 | : | denotes | ; |
T16965 | 2098-2099 | -RRB- | denotes | ) |
T16964 | 2096-2098 | CD | denotes | 19 |
T16963 | 2095-2096 | CD | denotes | − |
T16962 | 2092-2094 | TO | denotes | to |
T16961 | 2089-2091 | CD | denotes | 63 |
T16960 | 2088-2089 | FW | denotes | − |
T16959 | 2087-2088 | -LRB- | denotes | ( |
T16958 | 2085-2086 | NN | denotes | ′ |
T16957 | 2039-2085 | CD | denotes | CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3 |
T16956 | 2038-2039 | NN | denotes | ′ |
T16955 | 2037-2038 | CD | denotes | 5 |
T16954 | 2035-2036 | , | denotes | , |
T16953 | 2028-2035 | CD | denotes | MHB1661 |
T16952 | 2026-2027 | : | denotes | : |
T16951 | 2019-2026 | VBP | denotes | include |
T16950 | 2008-2018 | NNS | denotes | constructs |
T16949 | 1999-2007 | NN | denotes | reporter |
T16948 | 1990-1998 | NN | denotes | promoter |
T16947 | 1987-1989 | NN | denotes | ɛy |
T16946 | 1975-1986 | VBN | denotes | mutagenized |
T16945 | 1969-1974 | DT | denotes | these |
T16944 | 1960-1968 | VB | denotes | generate |
T16943 | 1957-1959 | TO | denotes | to |
T16942 | 1952-1956 | VBN | denotes | used |
T16941 | 1944-1951 | NNS | denotes | primers |
T16940 | 1936-1943 | RB | denotes | Forward |
T16939 | 1934-1935 | . | denotes | . |
T16938 | 1931-1934 | NNP | denotes | PCR |
T16937 | 1928-1930 | IN | denotes | by |
T16936 | 1923-1927 | VBN | denotes | done |
T16935 | 1918-1922 | VBD | denotes | were |
T16934 | 1909-1917 | NN | denotes | promoter |
T16933 | 1906-1908 | JJ | denotes | ɛy |
T16932 | 1902-1905 | DT | denotes | the |
T16931 | 1899-1901 | IN | denotes | of |
T16930 | 1893-1898 | NNS | denotes | sites |
T16929 | 1885-1892 | JJ | denotes | binding |
T16928 | 1875-1884 | NN | denotes | consensus |
T16927 | 1866-1874 | NNP | denotes | Sox/Sox6 |
T16926 | 1863-1865 | IN | denotes | of |
T16925 | 1851-1862 | NNP | denotes | Mutagenesis |
T16924 | 1849-1850 | . | denotes | . |
T16923 | 1848-1849 | NNP | denotes | ] |
T16922 | 1846-1848 | CD | denotes | 32 |
T16921 | 1845-1846 | NNP | denotes | [ |
T16920 | 1838-1844 | NNS | denotes | others |
T16919 | 1835-1837 | IN | denotes | by |
T16918 | 1825-1834 | VBN | denotes | described |
T16917 | 1822-1824 | IN | denotes | as |
T16916 | 1820-1821 | , | denotes | , |
T16915 | 1811-1820 | VBN | denotes | generated |
T16914 | 1807-1810 | VBD | denotes | was |
T16913 | 1800-1806 | NN | denotes | domain |
T16912 | 1796-1799 | NNP | denotes | HMG |
T16911 | 1792-1795 | DT | denotes | the |
T16910 | 1786-1791 | VBZ | denotes | lacks |
T16909 | 1781-1785 | WDT | denotes | that |
T16908 | 1779-1780 | -RRB- | denotes | ) |
T16907 | 1777-1779 | CD | denotes | .1 |
T16906 | 1761-1777 | JJ | denotes | Sox6-ΔHMG-pcDNA3 |
T16905 | 1760-1761 | -LRB- | denotes | ( |
T16904 | 1750-1759 | VBP | denotes | construct |
T16903 | 1735-1749 | NN | denotes | overexpression |
T16902 | 1730-1734 | JJ | denotes | Sox6 |
T16901 | 1726-1729 | DT | denotes | the |
T16900 | 1723-1725 | IN | denotes | of |
T16899 | 1715-1722 | NN | denotes | version |
T16898 | 1705-1714 | VBN | denotes | truncated |
T16897 | 1703-1704 | DT | denotes | A |
T16896 | 1701-1702 | . | denotes | . |
T16895 | 1697-1701 | NNP | denotes | Sox6 |
T16894 | 1685-1696 | VB | denotes | overexpress |
T16893 | 1682-1684 | TO | denotes | to |
T16892 | 1677-1681 | VBN | denotes | used |
T16891 | 1673-1676 | VBD | denotes | was |
T16890 | 1671-1672 | NNP | denotes | ] |
T16889 | 1669-1671 | CD | denotes | 15 |
T16888 | 1668-1669 | NNP | denotes | [ |
T16887 | 1665-1667 | CD | denotes | .1 |
T16886 | 1654-1665 | JJ | denotes | Sox6-pcDNA3 |
T16885 | 1652-1653 | . | denotes | . |
T16884 | 1651-1652 | -RRB- | denotes | ) |
T16873 | 1599-1600 | : | denotes | : |
T16872 | 1595-1599 | NN | denotes | site |
T16871 | 1587-1594 | NNP | denotes | HindIII |
T16870 | 1580-1586 | NN | denotes | primer |
T16869 | 1572-1579 | NN | denotes | reverse |
T16868 | 1568-1571 | DT | denotes | the |
T16867 | 1563-1567 | IN | denotes | with |
T16866 | 1551-1562 | NN | denotes | combination |
T16865 | 1548-1550 | IN | denotes | in |
T16864 | 1543-1547 | VBN | denotes | used |
T16863 | 1538-1542 | VBD | denotes | were |
T16862 | 1530-1537 | NNS | denotes | primers |
T16861 | 1522-1529 | RB | denotes | forward |
T16860 | 1518-1521 | DT | denotes | All |
T16859 | 1516-1517 | . | denotes | . |
T16858 | 1515-1516 | -RRB- | denotes | ) |
T16857 | 1514-1515 | CD | denotes | 9 |
T16856 | 1513-1514 | CD | denotes | − |
T16855 | 1510-1512 | TO | denotes | to |
T16854 | 1507-1509 | CD | denotes | 37 |
T16853 | 1506-1507 | FW | denotes | − |
T16852 | 1505-1506 | -LRB- | denotes | ( |
T16851 | 1503-1504 | NN | denotes | ′ |
T16850 | 1502-1503 | CD | denotes | 3 |
T16849 | 1472-1501 | NNP | denotes | CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
T16848 | 1471-1472 | NN | denotes | ′ |
T16847 | 1470-1471 | CD | denotes | 5 |
T16846 | 1468-1469 | , | denotes | , |
T16845 | 1461-1468 | NNP | denotes | MHB1507 |
T16844 | 1457-1460 | CC | denotes | and |
T16843 | 1455-1456 | : | denotes | ; |
T16842 | 1454-1455 | -RRB- | denotes | ) |
T16841 | 1452-1454 | CD | denotes | 34 |
T16840 | 1451-1452 | CD | denotes | − |
T16839 | 1448-1450 | TO | denotes | to |
T16838 | 1445-1447 | CD | denotes | 63 |
T16837 | 1444-1445 | FW | denotes | − |
T16836 | 1443-1444 | -LRB- | denotes | ( |
T16835 | 1441-1442 | NN | denotes | ′ |
T16834 | 1410-1441 | CD | denotes | CCGCTCGAGAATGCAGAACAAAGGGTCAGA3 |
T16833 | 1409-1410 | NN | denotes | ′ |
T16832 | 1408-1409 | CD | denotes | 5 |
T16831 | 1406-1407 | , | denotes | , |
T16830 | 1399-1406 | NNP | denotes | MHB1532 |
T16829 | 1397-1398 | : | denotes | ; |
T16828 | 1396-1397 | -RRB- | denotes | ) |
T16827 | 1394-1396 | CD | denotes | 58 |
T16826 | 1393-1394 | CD | denotes | − |
T16825 | 1390-1392 | TO | denotes | to |
T16824 | 1387-1389 | CD | denotes | 85 |
T16823 | 1386-1387 | FW | denotes | − |
T16822 | 1385-1386 | -LRB- | denotes | ( |
T16821 | 1383-1384 | NN | denotes | ′ |
T16820 | 1354-1383 | CD | denotes | CCGCTCGAGCTGACCAATGGCTTCAAAG3 |
T16819 | 1353-1354 | NN | denotes | ′ |
T16818 | 1352-1353 | CD | denotes | 5 |
T16817 | 1350-1351 | , | denotes | , |
T16816 | 1343-1350 | NNP | denotes | MHB1506 |
T16815 | 1341-1342 | : | denotes | ; |
T16814 | 1340-1341 | -RRB- | denotes | ) |
T16813 | 1337-1340 | CD | denotes | 169 |
T16812 | 1336-1337 | CD | denotes | − |
T16811 | 1333-1335 | TO | denotes | to |
T16810 | 1329-1332 | CD | denotes | 197 |
T16809 | 1328-1329 | FW | denotes | − |
T16808 | 1327-1328 | -LRB- | denotes | ( |
T16807 | 1325-1326 | NN | denotes | ′ |
T16806 | 1296-1325 | CD | denotes | CCGCTCGAGGGAGCCAAAAAAAGAATGC3 |
T16805 | 1295-1296 | NN | denotes | ′ |
T16804 | 1294-1295 | CD | denotes | 5 |
T16803 | 1292-1293 | , | denotes | , |
T16802 | 1285-1292 | NNP | denotes | MHB1505 |
T16801 | 1283-1284 | : | denotes | ; |
T16800 | 1282-1283 | -RRB- | denotes | ) |
T16799 | 1279-1282 | CD | denotes | 605 |
T16798 | 1278-1279 | CD | denotes | − |
T16797 | 1275-1277 | TO | denotes | to |
T16796 | 1271-1274 | CD | denotes | 634 |
T16795 | 1270-1271 | FW | denotes | − |
T16794 | 1269-1270 | -LRB- | denotes | ( |
T16793 | 1267-1268 | NN | denotes | ′ |
T16792 | 1236-1267 | CD | denotes | CCGCTCGAGTCTCTACACTGTCACTCCCTG3 |
T16791 | 1235-1236 | NN | denotes | ′ |
T16790 | 1234-1235 | CD | denotes | 5 |
T16789 | 1232-1233 | , | denotes | , |
T16788 | 1225-1232 | NNP | denotes | MHB1503 |
T16787 | 1223-1224 | : | denotes | ; |
T16786 | 1222-1223 | -RRB- | denotes | ) |
T16785 | 1218-1222 | CD | denotes | 2052 |
T16784 | 1217-1218 | CD | denotes | − |
T16783 | 1214-1216 | TO | denotes | to |
T16782 | 1209-1213 | CD | denotes | 2077 |
T16781 | 1208-1209 | FW | denotes | − |
T16780 | 1207-1208 | -LRB- | denotes | ( |
T16779 | 1205-1206 | NN | denotes | ′ |
T16778 | 1178-1205 | CD | denotes | CCGCTCGAGTGCTAGGCAAACACTCA3 |
T16777 | 1177-1178 | NN | denotes | ′ |
T16776 | 1176-1177 | CD | denotes | 5 |
T16775 | 1174-1175 | , | denotes | , |
T16774 | 1167-1174 | NNP | denotes | MHB1457 |
T16773 | 1165-1166 | : | denotes | : |
T16772 | 1158-1165 | VBP | denotes | include |
T16771 | 1153-1157 | NN | denotes | site |
T16770 | 1148-1152 | NNP | denotes | XhoI |
T16769 | 1145-1147 | DT | denotes | an |
T16768 | 1140-1144 | IN | denotes | with |
T16767 | 1132-1139 | NNS | denotes | primers |
T16766 | 1124-1131 | RB | denotes | Forward |
T16765 | 1122-1123 | . | denotes | . |
T16764 | 1113-1122 | RB | denotes | similarly |
T16763 | 1103-1112 | VBN | denotes | generated |
T16762 | 1098-1102 | VBD | denotes | were |
T16761 | 1089-1097 | NN | denotes | promoter |
T16760 | 1086-1088 | JJ | denotes | ɛy |
T16759 | 1082-1085 | DT | denotes | the |
T16758 | 1079-1081 | IN | denotes | of |
T16757 | 1068-1078 | NNS | denotes | constructs |
T16756 | 1059-1067 | NN | denotes | deletion |
T16755 | 1056-1058 | IN | denotes | of |
T16754 | 1049-1055 | NN | denotes | series |
T16753 | 1047-1048 | DT | denotes | A |
T16752 | 1045-1046 | . | denotes | . |
T16751 | 1037-1045 | NN | denotes | promoter |
T16750 | 1034-1036 | JJ | denotes | ɛy |
T16749 | 1030-1033 | DT | denotes | the |
T16748 | 1027-1029 | IN | denotes | by |
T16747 | 1020-1026 | VBN | denotes | driven |
T16746 | 1017-1019 | VBZ | denotes | is |
T16745 | 1006-1016 | NN | denotes | expression |
T16744 | 995-1005 | NN | denotes | luciferase |
T16743 | 989-994 | WDT | denotes | which |
T16742 | 986-988 | IN | denotes | in |
T16741 | 976-985 | VB | denotes | construct |
T16740 | 967-975 | NN | denotes | reporter |
T16739 | 965-966 | DT | denotes | a |
T16738 | 962-964 | IN | denotes | in |
T16737 | 952-961 | VBG | denotes | resulting |
T16736 | 950-951 | , | denotes | , |
T16735 | 943-950 | NN | denotes | plasmid |
T16734 | 937-942 | JJ | denotes | Basic |
T16733 | 932-936 | JJ | denotes | pGL3 |
T16732 | 926-931 | JJ | denotes | above |
T16731 | 922-925 | DT | denotes | the |
T16730 | 919-921 | IN | denotes | in |
T16729 | 910-918 | NN | denotes | promoter |
T16728 | 907-909 | JJ | denotes | ɛy |
T16727 | 903-906 | DT | denotes | the |
T16726 | 900-902 | IN | denotes | of |
T16725 | 891-899 | RB | denotes | upstream |
T16724 | 882-890 | VBN | denotes | inserted |
T16723 | 877-881 | RB | denotes | then |
T16722 | 873-876 | VBD | denotes | was |
T16721 | 871-872 | -RRB- | denotes | ) |
T16720 | 870-871 | NNP | denotes | ] |
T16719 | 868-870 | CD | denotes | 31 |
T16718 | 867-868 | NNP | denotes | [ |
T16717 | 865-866 | : | denotes | ; |
T16716 | 862-865 | NNP | denotes | LCR |
T16715 | 856-861 | NN | denotes | micro |
T16714 | 855-856 | -LRB- | denotes | ( |
T16713 | 851-854 | CD | denotes | 9.3 |
T16712 | 845-850 | NNP | denotes | μLCRβ |
T16711 | 842-844 | IN | denotes | of |
T16710 | 833-841 | NN | denotes | fragment |
T16709 | 823-832 | NNP | denotes | SstI/XhoI |
T16708 | 816-822 | JJ | denotes | 2.5-kb |
T16707 | 814-815 | DT | denotes | A |
T16706 | 812-813 | . | denotes | . |
T16705 | 811-812 | -RRB- | denotes | ) |
T16704 | 805-811 | NNPS | denotes | States |
T16703 | 798-804 | NNP | denotes | United |
T16702 | 796-797 | , | denotes | , |
T16701 | 787-796 | NNP | denotes | Wisconsin |
T16700 | 785-786 | , | denotes | , |
T16699 | 778-785 | NNP | denotes | Madison |
T16698 | 776-777 | , | denotes | , |
T16697 | 769-776 | NNP | denotes | Promega |
T16696 | 768-769 | -LRB- | denotes | ( |
T16695 | 762-767 | NNP | denotes | Basic |
T16694 | 757-761 | NNP | denotes | pGL3 |
T16693 | 754-756 | IN | denotes | in |
T16692 | 749-753 | NN | denotes | gene |
T16691 | 738-748 | NN | denotes | luciferase |
T16690 | 730-737 | JJ | denotes | firefly |
T16689 | 726-729 | DT | denotes | the |
T16688 | 723-725 | IN | denotes | of |
T16687 | 714-722 | RB | denotes | upstream |
T16686 | 705-713 | NN | denotes | fragment |
T16685 | 696-704 | NN | denotes | promoter |
T16684 | 693-695 | JJ | denotes | ɛy |
T16683 | 689-692 | DT | denotes | the |
T16682 | 683-688 | VB | denotes | clone |
T16681 | 680-682 | TO | denotes | to |
T16680 | 675-679 | VBN | denotes | used |
T16679 | 670-674 | VBD | denotes | were |
T16678 | 665-669 | WDT | denotes | that |
T16677 | 659-664 | NNS | denotes | sites |
T16676 | 651-658 | NNP | denotes | HindIII |
T16675 | 647-650 | CC | denotes | and |
T16674 | 642-646 | NNP | denotes | XhoI |
T16673 | 632-641 | VBD | denotes | contained |
T16672 | 624-631 | NNS | denotes | primers |
T16671 | 620-623 | NNP | denotes | PCR |
T16670 | 616-619 | DT | denotes | The |
T16669 | 614-615 | . | denotes | . |
T16668 | 606-614 | NN | denotes | database |
T16667 | 604-605 | -RRB- | denotes | ) |
T16666 | 599-604 | NNP | denotes | Mouse |
T16665 | 596-598 | IN | denotes | of |
T16664 | 585-595 | NNP | denotes | Annotation |
T16663 | 574-584 | NNP | denotes | Functional |
T16662 | 573-574 | -LRB- | denotes | ( |
T16661 | 566-572 | NNP | denotes | Fantom |
T16660 | 562-565 | DT | denotes | the |
T16659 | 559-561 | IN | denotes | in |
T16658 | 554-558 | NN | denotes | cDNA |
T16635 | 427-428 | NNP | denotes | [ |
T16634 | 422-426 | NN | denotes | site |
T16633 | 418-421 | NN | denotes | cap |
T16632 | 413-417 | NN | denotes | gene |
T16631 | 406-412 | NN | denotes | globin |
T16630 | 404-405 | NN | denotes | ɛ |
T16629 | 400-403 | DT | denotes | the |
T16628 | 397-399 | IN | denotes | of |
T16627 | 388-396 | RB | denotes | upstream |
T16626 | 379-387 | NN | denotes | sequence |
T16625 | 376-378 | IN | denotes | of |
T16624 | 373-375 | NN | denotes | kb |
T16623 | 371-372 | CD | denotes | 2 |
T16622 | 365-370 | IN | denotes | about |
T16621 | 354-364 | VBG | denotes | containing |
T16620 | 345-353 | NN | denotes | fragment |
T16619 | 339-344 | NNP | denotes | EcoRI |
T16618 | 332-338 | JJ | denotes | 3.7-kb |
T16617 | 330-331 | DT | denotes | a |
T16616 | 323-329 | IN | denotes | within |
T16615 | 315-322 | VBN | denotes | located |
T16614 | 311-314 | VBP | denotes | are |
T16613 | 301-310 | VBG | denotes | silencing |
T16612 | 296-300 | NN | denotes | gene |
T16611 | 294-295 | NN | denotes | ɛ |
T16610 | 290-293 | IN | denotes | for |
T16609 | 281-289 | VBN | denotes | required |
T16608 | 271-280 | NNS | denotes | sequences |
T16607 | 267-270 | DT | denotes | all |
T16606 | 262-266 | IN | denotes | that |
T16605 | 256-261 | VBN | denotes | shown |
T16604 | 251-255 | VBN | denotes | been |
T16603 | 247-250 | VBZ | denotes | has |
T16602 | 244-246 | PRP | denotes | it |
T16601 | 236-243 | IN | denotes | because |
T16600 | 234-235 | , | denotes | , |
T16599 | 230-234 | VBN | denotes | used |
T16598 | 226-229 | VBD | denotes | was |
T16597 | 224-225 | -RRB- | denotes | ) |
T16596 | 221-224 | NNP | denotes | ATG |
T16595 | 220-221 | -LRB- | denotes | ( |
T16594 | 214-219 | NN | denotes | codon |
T16593 | 203-213 | NN | denotes | initiation |
T16592 | 196-202 | NN | denotes | globin |
T16591 | 193-195 | JJ | denotes | ɛy |
T16590 | 189-192 | DT | denotes | the |
T16589 | 186-188 | IN | denotes | of |
T16588 | 177-185 | RB | denotes | upstream |
T16587 | 168-176 | NN | denotes | fragment |
T16586 | 161-167 | JJ | denotes | 2.2-kb |
T16585 | 159-160 | DT | denotes | A |
T16584 | 157-158 | . | denotes | . |
T16583 | 149-157 | NN | denotes | promoter |
T16582 | 140-148 | JJ | denotes | proximal |
T16581 | 137-139 | JJ | denotes | ɛy |
T16580 | 133-136 | DT | denotes | the |
T16579 | 130-132 | IN | denotes | of |
T16578 | 116-129 | NN | denotes | amplification |
T16577 | 112-115 | NNP | denotes | PCR |
T16576 | 109-111 | IN | denotes | by |
T16575 | 99-108 | VBN | denotes | generated |
T16574 | 95-98 | VBD | denotes | was |
T16573 | 93-94 | -RRB- | denotes | ) |
T16572 | 88-93 | JJ | denotes | E-luc |
T16571 | 87-88 | -LRB- | denotes | ( |
T16570 | 79-86 | NN | denotes | plasmid |
T16569 | 70-78 | NN | denotes | reporter |
T16568 | 61-69 | NN | denotes | deletion |
T16567 | 52-60 | NN | denotes | promoter |
T16566 | 49-51 | JJ | denotes | ɛy |
T16565 | 45-48 | DT | denotes | The |
T16564 | 43-44 | . | denotes | . |
T16563 | 31-43 | NN | denotes | construction |
T16562 | 23-30 | JJ | denotes | Plasmid |
T16883 | 1648-1651 | CD | denotes | +20 |
T16882 | 1645-1647 | TO | denotes | to |
T16881 | 1641-1644 | CD | denotes | +45 |
T16880 | 1640-1641 | -LRB- | denotes | ( |
T16879 | 1638-1639 | NN | denotes | ′ |
T16878 | 1612-1638 | CD | denotes | CGGAAGCTTGGGAGGTTGCTGGTGA3 |
T16877 | 1611-1612 | NN | denotes | ′ |
T16876 | 1610-1611 | CD | denotes | 5 |
T16875 | 1608-1609 | , | denotes | , |
T16874 | 1601-1608 | NNP | denotes | MHB1477 |
T16657 | 546-553 | JJS | denotes | longest |
T16656 | 542-545 | DT | denotes | the |
T16655 | 539-541 | IN | denotes | on |
T16654 | 533-538 | VBN | denotes | based |
T16653 | 530-532 | VBZ | denotes | is |
T16652 | 525-529 | NN | denotes | site |
T16651 | 519-524 | NN | denotes | start |
T16650 | 503-518 | JJ | denotes | transcriptional |
T16649 | 499-502 | DT | denotes | The |
T16648 | 497-498 | . | denotes | . |
T16647 | 493-497 | NN | denotes | site |
T16646 | 487-492 | VB | denotes | start |
T16645 | 473-486 | NN | denotes | transcription |
T16644 | 469-472 | DT | denotes | the |
T16643 | 466-468 | TO | denotes | to |
T16642 | 457-465 | JJ | denotes | relative |
T16641 | 454-456 | VBZ | denotes | is |
T16640 | 444-453 | NN | denotes | numbering |
T16639 | 433-443 | NNP | denotes | Nucleotide |
T16638 | 431-432 | . | denotes | . |
T16637 | 430-431 | NNP | denotes | ] |
T16636 | 428-430 | CD | denotes | 50 |
T18002 | 3776-3778 | IN | denotes | in |
T18001 | 3767-3775 | VBN | denotes | embedded |
T18009 | 3806-3807 | , | denotes | , |
T18008 | 3804-3806 | NN | denotes | μm |
T18007 | 3802-3803 | CD | denotes | 5 |
T18006 | 3799-3801 | IN | denotes | at |
T18005 | 3789-3798 | VBN | denotes | sectioned |
T18004 | 3787-3788 | , | denotes | , |
T18003 | 3779-3787 | NN | denotes | paraffin |
T18000 | 3765-3766 | , | denotes | , |
T17999 | 3749-3765 | NN | denotes | paraformaldehyde |
T17998 | 3747-3748 | NN | denotes | % |
T17997 | 3746-3747 | CD | denotes | 4 |
T17996 | 3743-3745 | IN | denotes | in |
T17995 | 3733-3742 | NN | denotes | immersion |
T17994 | 3730-3732 | IN | denotes | by |
T17993 | 3720-3729 | RB | denotes | overnight |
T17992 | 3714-3719 | VBN | denotes | fixed |
T17991 | 3709-3713 | VBD | denotes | were |
T17990 | 3701-3708 | NNS | denotes | Embryos |
T17989 | 3699-3700 | . | denotes | . |
T17988 | 3695-3699 | CD | denotes | 1927 |
T17987 | 3690-3694 | CD | denotes | 1353 |
T17986 | 3678-3689 | NNS | denotes | nucleotides |
T17985 | 3673-3677 | JJ | denotes | Sox6 |
T17984 | 3667-3672 | NN | denotes | mouse |
T17983 | 3663-3666 | CC | denotes | and |
T17982 | 3661-3662 | : | denotes | ; |
T17981 | 3658-3661 | CD | denotes | 549 |
T17980 | 3654-3657 | CD | denotes | 458 |
T17979 | 3642-3653 | NNS | denotes | nucleotides |
T17978 | 3635-3641 | NN | denotes | globin |
T17977 | 3630-3634 | NN | denotes | βmaj |
T17976 | 3628-3629 | : | denotes | ; |
T17975 | 3625-3628 | CD | denotes | 584 |
T17974 | 3621-3624 | CD | denotes | 509 |
T17973 | 3609-3620 | NNS | denotes | nucleotides |
T17972 | 3602-3608 | NN | denotes | globin |
T17971 | 3599-3601 | JJ | denotes | ɛy |
T17970 | 3592-3598 | VB | denotes | murine |
T17969 | 3589-3591 | TO | denotes | to |
T17968 | 3580-3588 | VBN | denotes | designed |
T17967 | 3575-3579 | VBD | denotes | were |
T17966 | 3568-3574 | NNS | denotes | probes |
T17965 | 3558-3567 | JJ | denotes | Antisense |
T17964 | 3556-3557 | . | denotes | . |
T17963 | 3543-3556 | NN | denotes | hybridization |
T17962 | 3538-3542 | NN | denotes | situ |
T17961 | 3535-3537 | IN | denotes | In |
T18116 | 4342-4350 | VBN | denotes | combined |
T18115 | 4338-4341 | CC | denotes | and |
T18114 | 4336-4337 | , | denotes | , |
T18113 | 4323-4336 | VBN | denotes | pseudocolored |
T18112 | 4321-4322 | , | denotes | , |
T18111 | 4312-4321 | VBN | denotes | processed |
T18110 | 4307-4311 | VBD | denotes | were |
T18109 | 4300-4306 | NNS | denotes | Images |
T18108 | 4298-4299 | . | denotes | . |
T18626 | 5512-5519 | NNP | denotes | England |
T18625 | 5510-5511 | , | denotes | , |
T18624 | 5495-5510 | NNP | denotes | Buckinghamshire |
T18623 | 5493-5494 | , | denotes | , |
T18622 | 5482-5493 | NNP | denotes | Biosciences |
T18621 | 5473-5481 | NNP | denotes | Amersham |
T18620 | 5471-5472 | : | denotes | ; |
T18619 | 5460-5471 | NNP | denotes | RediprimeII |
T18618 | 5459-5460 | -LRB- | denotes | ( |
T18617 | 5450-5458 | VBG | denotes | labeling |
T18616 | 5443-5449 | NN | denotes | primer |
T19048 | 6501-6503 | PRP | denotes | we |
T19047 | 6499-6500 | , | denotes | , |
T19046 | 6493-6499 | NN | denotes | effect |
T19045 | 6486-6492 | NN | denotes | dosage |
T19044 | 6483-6485 | IN | denotes | of |
T19043 | 6476-6482 | NNS | denotes | assays |
T19042 | 6473-6475 | IN | denotes | In |
T19041 | 6471-6472 | . | denotes | . |
T19040 | 6470-6471 | -RRB- | denotes | ) |
T19039 | 6468-6470 | NN | denotes | ng |
T19038 | 6463-6467 | CD | denotes | 1000 |
T19037 | 6462-6463 | -LRB- | denotes | ( |
T19326 | 6899-6910 | NN | denotes | translation |
T19325 | 6895-6898 | DT | denotes | The |
T19324 | 6893-6894 | . | denotes | . |
T19323 | 6892-6893 | NNP | denotes | ] |
T19322 | 6890-6892 | CD | denotes | 15 |
T19321 | 6889-6890 | NNP | denotes | [ |
T19320 | 6882-6888 | IN | denotes | before |
T19319 | 6872-6881 | VBN | denotes | described |
T19318 | 6868-6871 | VBD | denotes | was |
T19317 | 6866-6867 | , | denotes | , |
T19316 | 6864-6866 | NNP | denotes | HA |
T19315 | 6860-6863 | CC | denotes | and |
R11478 | T16562 | T16563 | amod | Plasmid,construction |
R11479 | T16563 | T16563 | ROOT | construction,construction |
R11480 | T16564 | T16563 | punct | .,construction |
R11481 | T16565 | T16570 | det | The,plasmid |
R11482 | T16566 | T16567 | amod | ɛy,promoter |
R11483 | T16567 | T16570 | compound | promoter,plasmid |
R11484 | T16568 | T16570 | compound | deletion,plasmid |
R11485 | T16569 | T16570 | compound | reporter,plasmid |
R11486 | T16570 | T16575 | nsubjpass | plasmid,generated |
R11487 | T16571 | T16570 | punct | (,plasmid |
R11488 | T16572 | T16570 | appos | E-luc,plasmid |
R11489 | T16573 | T16570 | punct | ),plasmid |
R11490 | T16574 | T16575 | auxpass | was,generated |
R11491 | T16575 | T16575 | ROOT | generated,generated |
R11492 | T16576 | T16575 | agent | by,generated |
R11493 | T16577 | T16578 | compound | PCR,amplification |
R11494 | T16578 | T16576 | pobj | amplification,by |
R11495 | T16579 | T16578 | prep | of,amplification |
R11496 | T16580 | T16583 | det | the,promoter |
R11497 | T16581 | T16583 | amod | ɛy,promoter |
R11498 | T16582 | T16583 | amod | proximal,promoter |
R11499 | T16583 | T16579 | pobj | promoter,of |
R11500 | T16584 | T16575 | punct | .,generated |
R11501 | T16585 | T16587 | det | A,fragment |
R11502 | T16586 | T16587 | compound | 2.2-kb,fragment |
R11503 | T16587 | T16588 | compound | fragment,upstream |
R11504 | T16588 | T16599 | nsubjpass | upstream,used |
R11505 | T16589 | T16588 | prep | of,upstream |
R11506 | T16590 | T16593 | det | the,initiation |
R11507 | T16591 | T16593 | amod | ɛy,initiation |
R11508 | T16592 | T16593 | compound | globin,initiation |
R11509 | T16593 | T16594 | compound | initiation,codon |
R11510 | T16594 | T16589 | pobj | codon,of |
R11511 | T16595 | T16596 | punct | (,ATG |
R11512 | T16596 | T16594 | appos | ATG,codon |
R11513 | T16597 | T16594 | punct | ),codon |
R11514 | T16598 | T16599 | auxpass | was,used |
R11515 | T16599 | T16599 | ROOT | used,used |
R11516 | T16600 | T16599 | punct | ",",used |
R11517 | T16601 | T16605 | mark | because,shown |
R11518 | T16602 | T16605 | nsubjpass | it,shown |
R11519 | T16603 | T16605 | aux | has,shown |
R11520 | T16604 | T16605 | auxpass | been,shown |
R11521 | T16605 | T16599 | advcl | shown,used |
R11522 | T16606 | T16615 | mark | that,located |
R11523 | T16607 | T16608 | det | all,sequences |
R11524 | T16608 | T16615 | nsubjpass | sequences,located |
R11525 | T16609 | T16608 | acl | required,sequences |
R11526 | T16610 | T16609 | prep | for,required |
R11527 | T16611 | T16612 | compound | ɛ,gene |
R11528 | T16612 | T16610 | pobj | gene,for |
R11529 | T16613 | T16612 | acl | silencing,gene |
R11530 | T16614 | T16615 | auxpass | are,located |
R11531 | T16615 | T16605 | ccomp | located,shown |
R11532 | T16616 | T16615 | prep | within,located |
R11533 | T16617 | T16620 | det | a,fragment |
R11534 | T16618 | T16620 | compound | 3.7-kb,fragment |
R11535 | T16619 | T16620 | compound | EcoRI,fragment |
R11536 | T16620 | T16616 | pobj | fragment,within |
R11537 | T16621 | T16620 | acl | containing,fragment |
R11538 | T16622 | T16624 | quantmod | about,kb |
R11539 | T16623 | T16624 | nummod | 2,kb |
R11540 | T16624 | T16621 | dobj | kb,containing |
R11541 | T16625 | T16624 | prep | of,kb |
R11542 | T16626 | T16625 | pobj | sequence,of |
R11543 | T16627 | T16621 | advmod | upstream,containing |
R11544 | T16628 | T16627 | prep | of,upstream |
R11545 | T16629 | T16634 | det | the,site |
R11546 | T16630 | T16634 | nmod | ɛ,site |
R11547 | T16631 | T16634 | compound | globin,site |
R11548 | T16632 | T16633 | compound | gene,cap |
R11549 | T16633 | T16634 | compound | cap,site |
R11550 | T16634 | T16628 | pobj | site,of |
R11551 | T16635 | T16634 | appos | [,site |
R11552 | T16636 | T16637 | nummod | 50,] |
R11553 | T16637 | T16634 | appos | ],site |
R11554 | T16638 | T16599 | punct | .,used |
R11555 | T16639 | T16640 | compound | Nucleotide,numbering |
R11556 | T16640 | T16641 | nsubj | numbering,is |
R11557 | T16641 | T16641 | ROOT | is,is |
R11558 | T16642 | T16641 | acomp | relative,is |
R11559 | T16643 | T16642 | prep | to,relative |
R11560 | T16644 | T16645 | det | the,transcription |
R11561 | T16645 | T16646 | nsubj | transcription,start |
R11562 | T16646 | T16641 | conj | start,is |
R11563 | T16647 | T16646 | dobj | site,start |
R11564 | T16648 | T16641 | punct | .,is |
R11565 | T16649 | T16652 | det | The,site |
R11566 | T16650 | T16652 | amod | transcriptional,site |
R11567 | T16651 | T16652 | compound | start,site |
R11568 | T16652 | T16654 | nsubjpass | site,based |
R11569 | T16653 | T16654 | auxpass | is,based |
R11570 | T16654 | T16654 | ROOT | based,based |
R11571 | T16655 | T16654 | prep | on,based |
R11572 | T16656 | T16658 | det | the,cDNA |
R11573 | T16657 | T16658 | amod | longest,cDNA |
R11574 | T16658 | T16655 | pobj | cDNA,on |
R11575 | T16659 | T16658 | prep | in,cDNA |
R11576 | T16660 | T16661 | det | the,Fantom |
R11577 | T16661 | T16659 | pobj | Fantom,in |
R11578 | T16662 | T16661 | punct | (,Fantom |
R11579 | T16663 | T16664 | compound | Functional,Annotation |
R11580 | T16664 | T16661 | appos | Annotation,Fantom |
R11581 | T16665 | T16664 | prep | of,Annotation |
R11582 | T16666 | T16665 | pobj | Mouse,of |
R11583 | T16667 | T16661 | punct | ),Fantom |
R11584 | T16668 | T16658 | conj | database,cDNA |
R11585 | T16669 | T16654 | punct | .,based |
R11586 | T16670 | T16672 | det | The,primers |
R11587 | T16671 | T16672 | compound | PCR,primers |
R11588 | T16672 | T16673 | nsubj | primers,contained |
R11589 | T16673 | T16673 | ROOT | contained,contained |
R11590 | T16674 | T16677 | nmod | XhoI,sites |
R11591 | T16675 | T16674 | cc | and,XhoI |
R11592 | T16676 | T16674 | conj | HindIII,XhoI |
R11593 | T16677 | T16673 | dobj | sites,contained |
R11594 | T16678 | T16680 | nsubjpass | that,used |
R11595 | T16679 | T16680 | auxpass | were,used |
R11596 | T16680 | T16677 | relcl | used,sites |
R11597 | T16681 | T16682 | aux | to,clone |
R11598 | T16682 | T16680 | xcomp | clone,used |
R11599 | T16683 | T16686 | det | the,fragment |
R11600 | T16684 | T16686 | amod | ɛy,fragment |
R11601 | T16685 | T16686 | compound | promoter,fragment |
R11602 | T16686 | T16682 | dobj | fragment,clone |
R11603 | T16687 | T16682 | advmod | upstream,clone |
R11604 | T16688 | T16687 | prep | of,upstream |
R11605 | T16689 | T16692 | det | the,gene |
R11606 | T16690 | T16692 | amod | firefly,gene |
R11607 | T16691 | T16692 | compound | luciferase,gene |
R11608 | T16692 | T16688 | pobj | gene,of |
R11609 | T16693 | T16692 | prep | in,gene |
R11610 | T16694 | T16695 | compound | pGL3,Basic |
R11611 | T16695 | T16693 | pobj | Basic,in |
R11612 | T16696 | T16699 | punct | (,Madison |
R11613 | T16697 | T16699 | nmod | Promega,Madison |
R11614 | T16698 | T16697 | punct | ",",Promega |
R11615 | T16699 | T16692 | appos | Madison,gene |
R11616 | T16700 | T16699 | punct | ",",Madison |
R11617 | T16701 | T16699 | npadvmod | Wisconsin,Madison |
R11618 | T16702 | T16701 | punct | ",",Wisconsin |
R11619 | T16703 | T16704 | compound | United,States |
R11620 | T16704 | T16701 | appos | States,Wisconsin |
R11621 | T16705 | T16699 | punct | ),Madison |
R11622 | T16706 | T16673 | punct | .,contained |
R11623 | T16707 | T16710 | det | A,fragment |
R11624 | T16708 | T16710 | amod | 2.5-kb,fragment |
R11625 | T16709 | T16710 | compound | SstI/XhoI,fragment |
R11626 | T16710 | T16724 | nsubjpass | fragment,inserted |
R11627 | T16711 | T16710 | prep | of,fragment |
R11628 | T16712 | T16713 | quantmod | μLCRβ,9.3 |
R11629 | T16713 | T16711 | pobj | 9.3,of |
R11630 | T16714 | T16724 | punct | (,inserted |
R11631 | T16715 | T16716 | compound | micro,LCR |
R11632 | T16716 | T16724 | nsubjpass | LCR,inserted |
R11633 | T16717 | T16720 | punct | ;,] |
R11634 | T16718 | T16720 | compound | [,] |
R11635 | T16719 | T16720 | nummod | 31,] |
R11636 | T16720 | T16716 | appos | ],LCR |
R11637 | T16721 | T16720 | punct | ),] |
R11638 | T16722 | T16724 | auxpass | was,inserted |
R11639 | T16723 | T16724 | advmod | then,inserted |
R11640 | T16724 | T16724 | ROOT | inserted,inserted |
R11641 | T16725 | T16724 | advmod | upstream,inserted |
R11642 | T16726 | T16725 | prep | of,upstream |
R11643 | T16727 | T16729 | det | the,promoter |
R11644 | T16728 | T16729 | amod | ɛy,promoter |
R11645 | T16729 | T16726 | pobj | promoter,of |
R11646 | T16730 | T16729 | prep | in,promoter |
R11647 | T16731 | T16735 | det | the,plasmid |
R11648 | T16732 | T16735 | amod | above,plasmid |
R11649 | T16733 | T16735 | amod | pGL3,plasmid |
R11650 | T16734 | T16735 | amod | Basic,plasmid |
R11651 | T16735 | T16730 | pobj | plasmid,in |
R11652 | T16736 | T16724 | punct | ",",inserted |
R11653 | T16737 | T16724 | advcl | resulting,inserted |
R11654 | T16738 | T16737 | prep | in,resulting |
R11655 | T16739 | T16740 | det | a,reporter |
R11656 | T16740 | T16738 | pobj | reporter,in |
R11657 | T16741 | T16724 | punct | construct,inserted |
R11658 | T16742 | T16747 | prep | in,driven |
R11659 | T16743 | T16742 | pobj | which,in |
R11660 | T16744 | T16745 | amod | luciferase,expression |
R11661 | T16745 | T16747 | nsubjpass | expression,driven |
R11662 | T16746 | T16747 | auxpass | is,driven |
R11663 | T16747 | T16724 | advcl | driven,inserted |
R11664 | T16748 | T16747 | agent | by,driven |
R11665 | T16749 | T16751 | det | the,promoter |
R11666 | T16750 | T16751 | amod | ɛy,promoter |
R11667 | T16751 | T16748 | pobj | promoter,by |
R11668 | T16752 | T16724 | punct | .,inserted |
R11669 | T16753 | T16754 | det | A,series |
R11670 | T16754 | T16763 | nsubjpass | series,generated |
R11671 | T16755 | T16754 | prep | of,series |
R11672 | T16756 | T16757 | compound | deletion,constructs |
R11673 | T16757 | T16755 | pobj | constructs,of |
R11674 | T16758 | T16757 | prep | of,constructs |
R11675 | T16759 | T16761 | det | the,promoter |
R11676 | T16760 | T16761 | amod | ɛy,promoter |
R11677 | T16761 | T16758 | pobj | promoter,of |
R11678 | T16762 | T16763 | auxpass | were,generated |
R11679 | T16763 | T16763 | ROOT | generated,generated |
R11680 | T16764 | T16763 | advmod | similarly,generated |
R11681 | T16765 | T16763 | punct | .,generated |
R11682 | T16766 | T16767 | amod | Forward,primers |
R11683 | T16767 | T16772 | nsubj | primers,include |
R11684 | T16768 | T16767 | prep | with,primers |
R11685 | T16769 | T16771 | det | an,site |
R11686 | T16770 | T16771 | compound | XhoI,site |
R11687 | T16771 | T16768 | pobj | site,with |
R11688 | T16772 | T16772 | ROOT | include,include |
R11689 | T16773 | T16772 | punct | :,include |
R11690 | T16774 | T16772 | dobj | MHB1457,include |
R11691 | T16775 | T16774 | punct | ",",MHB1457 |
R11692 | T16776 | T16779 | nummod | 5,′ |
R11693 | T16777 | T16778 | quantmod | ′,CCGCTCGAGTGCTAGGCAAACACTCA3 |
R11694 | T16778 | T16779 | nummod | CCGCTCGAGTGCTAGGCAAACACTCA3,′ |
R11695 | T16779 | T16774 | appos | ′,MHB1457 |
R11696 | T16780 | T16779 | punct | (,′ |
R11697 | T16781 | T16779 | nmod | −,′ |
R11698 | T16782 | T16781 | pobj | 2077,− |
R11699 | T16783 | T16779 | prep | to,′ |
R11700 | T16784 | T16783 | pobj | −,to |
R11701 | T16785 | T16784 | appos | 2052,− |
R11702 | T16786 | T16784 | punct | ),− |
R11703 | T16787 | T16783 | punct | ;,to |
R11704 | T16788 | T16783 | pobj | MHB1503,to |
R11705 | T16789 | T16788 | punct | ",",MHB1503 |
R11706 | T16790 | T16791 | nummod | 5,′ |
R11707 | T16791 | T16788 | appos | ′,MHB1503 |
R11708 | T16792 | T16793 | nummod | CCGCTCGAGTCTCTACACTGTCACTCCCTG3,′ |
R11709 | T16793 | T16791 | appos | ′,′ |
R11710 | T16794 | T16795 | punct | (,− |
R11711 | T16795 | T16793 | appos | −,′ |
R11712 | T16796 | T16795 | nummod | 634,− |
R11713 | T16797 | T16796 | prep | to,634 |
R11714 | T16798 | T16797 | pobj | −,to |
R11715 | T16799 | T16798 | appos | 605,− |
R11716 | T16800 | T16798 | punct | ),− |
R11717 | T16801 | T16802 | punct | ;,MHB1505 |
R11718 | T16802 | T16793 | appos | MHB1505,′ |
R11719 | T16803 | T16802 | punct | ",",MHB1505 |
R11720 | T16804 | T16805 | nummod | 5,′ |
R11721 | T16805 | T16807 | dep | ′,′ |
R11722 | T16806 | T16807 | nummod | CCGCTCGAGGGAGCCAAAAAAAGAATGC3,′ |
R11723 | T16807 | T16802 | appos | ′,MHB1505 |
R11724 | T16808 | T16809 | punct | (,− |
R11725 | T16809 | T16816 | nmod | −,MHB1506 |
R11726 | T16810 | T16809 | nummod | 197,− |
R11727 | T16811 | T16815 | quantmod | to,; |
R11728 | T16812 | T16811 | pobj | −,to |
R11729 | T16813 | T16812 | appos | 169,− |
R11730 | T16814 | T16812 | punct | ),− |
R11731 | T16815 | T16816 | punct | ;,MHB1506 |
R11732 | T16816 | T16830 | nmod | MHB1506,MHB1532 |
R11733 | T16817 | T16816 | punct | ",",MHB1506 |
R11734 | T16818 | T16819 | nummod | 5,′ |
R11735 | T16819 | T16830 | nmod | ′,MHB1532 |
R11736 | T16820 | T16821 | nummod | CCGCTCGAGCTGACCAATGGCTTCAAAG3,′ |
R11737 | T16821 | T16819 | appos | ′,′ |
R11738 | T16822 | T16823 | punct | (,− |
R11739 | T16823 | T16821 | appos | −,′ |
R11740 | T16824 | T16823 | nummod | 85,− |
R11741 | T16825 | T16824 | prep | to,85 |
R11742 | T16826 | T16825 | pobj | −,to |
R11743 | T16827 | T16826 | appos | 58,− |
R11744 | T16828 | T16826 | punct | ),− |
R11745 | T16829 | T16830 | punct | ;,MHB1532 |
R11746 | T16830 | T16807 | appos | MHB1532,′ |
R11747 | T16831 | T16830 | punct | ",",MHB1532 |
R11748 | T16832 | T16833 | nummod | 5,′ |
R11749 | T16833 | T16835 | dep | ′,′ |
R11750 | T16834 | T16835 | nummod | CCGCTCGAGAATGCAGAACAAAGGGTCAGA3,′ |
R11751 | T16835 | T16830 | appos | ′,MHB1532 |
R11752 | T16836 | T16837 | punct | (,− |
R11753 | T16837 | T16835 | appos | −,′ |
R11754 | T16838 | T16837 | nummod | 63,− |
R11755 | T16839 | T16838 | prep | to,63 |
R11756 | T16840 | T16839 | pobj | −,to |
R11757 | T16841 | T16840 | appos | 34,− |
R11758 | T16842 | T16840 | punct | ),− |
R11759 | T16843 | T16837 | punct | ;,− |
R11760 | T16844 | T16837 | cc | and,− |
R11761 | T16845 | T16835 | appos | MHB1507,′ |
R11762 | T16846 | T16845 | punct | ",",MHB1507 |
R11763 | T16847 | T16848 | nummod | 5,′ |
R11764 | T16848 | T16849 | compound | ′,CCGCTCGAGGTCTGCGAAGAATAAAAGGC |
R11765 | T16849 | T16851 | quantmod | CCGCTCGAGGTCTGCGAAGAATAAAAGGC,′ |
R11766 | T16850 | T16851 | nummod | 3,′ |
R11767 | T16851 | T16835 | appos | ′,′ |
R11768 | T16852 | T16853 | punct | (,− |
R11769 | T16853 | T16851 | appos | −,′ |
R11770 | T16854 | T16853 | dobj | 37,− |
R11771 | T16855 | T16853 | prep | to,− |
R11772 | T16856 | T16855 | pobj | −,to |
R11773 | T16857 | T16856 | appos | 9,− |
R11774 | T16858 | T16856 | punct | ),− |
R11775 | T16859 | T16772 | punct | .,include |
R11776 | T16860 | T16862 | det | All,primers |
R11777 | T16861 | T16862 | amod | forward,primers |
R11778 | T16862 | T16864 | nsubjpass | primers,used |
R11779 | T16863 | T16864 | auxpass | were,used |
R11780 | T16864 | T16864 | ROOT | used,used |
R11781 | T16865 | T16864 | prep | in,used |
R11782 | T16866 | T16865 | pobj | combination,in |
R11783 | T16867 | T16864 | prep | with,used |
R11784 | T16868 | T16872 | det | the,site |
R11785 | T16869 | T16870 | compound | reverse,primer |
R11786 | T16870 | T16872 | compound | primer,site |
R11787 | T16871 | T16872 | compound | HindIII,site |
R11788 | T16872 | T16867 | pobj | site,with |
R11789 | T16873 | T16872 | punct | :,site |
R11790 | T16874 | T16872 | appos | MHB1477,site |
R11791 | T16875 | T16874 | punct | ",",MHB1477 |
R11792 | T16876 | T16877 | nummod | 5,′ |
R11793 | T16877 | T16874 | appos | ′,MHB1477 |
R11794 | T16878 | T16879 | nummod | CGGAAGCTTGGGAGGTTGCTGGTGA3,′ |
R11795 | T16879 | T16877 | appos | ′,′ |
R11796 | T16880 | T16881 | punct | (,+45 |
R11797 | T16881 | T16879 | appos | +45,′ |
R11798 | T16882 | T16881 | prep | to,+45 |
R11799 | T16883 | T16882 | pobj | +20,to |
R11800 | T16884 | T16881 | punct | ),+45 |
R11801 | T16885 | T16864 | punct | .,used |
R11802 | T16886 | T16890 | amod | Sox6-pcDNA3,] |
R11803 | T16887 | T16890 | nummod | .1,] |
R11804 | T16888 | T16890 | nmod | [,] |
R11805 | T16889 | T16890 | nummod | 15,] |
R11806 | T16890 | T16892 | nsubjpass | ],used |
R11807 | T16891 | T16892 | auxpass | was,used |
R11808 | T16892 | T16892 | ROOT | used,used |
R11809 | T16893 | T16894 | aux | to,overexpress |
R11810 | T16894 | T16892 | xcomp | overexpress,used |
R11811 | T16895 | T16894 | dobj | Sox6,overexpress |
R11812 | T16896 | T16892 | punct | .,used |
R11813 | T16897 | T16899 | det | A,version |
R11877 | T16961 | T16960 | nummod | 63,− |
R11878 | T16962 | T16961 | prep | to,63 |
R11879 | T16963 | T16962 | pobj | −,to |
R11880 | T16964 | T16963 | appos | 19,− |
R11881 | T16965 | T16963 | punct | ),− |
R11882 | T16966 | T16967 | punct | ;,MHB1662 |
R11883 | T16967 | T16951 | dobj | MHB1662,include |
R11884 | T16968 | T16967 | punct | ",",MHB1662 |
R11885 | T16969 | T16970 | nummod | 5,′ |
R11886 | T16970 | T16986 | nmod | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11887 | T16971 | T16972 | nummod | CCGCTCGAGAATGCAGAACAAAGGGTCAGATGAGTGTCTGCGAAGAA3,′ |
R11888 | T16972 | T16970 | appos | ′,′ |
R11889 | T16973 | T16974 | punct | (,− |
R11890 | T16974 | T16972 | appos | −,′ |
R11891 | T16975 | T16974 | nummod | 63,− |
R11892 | T16976 | T16975 | prep | to,63 |
R11893 | T16977 | T16976 | pobj | −,to |
R11894 | T16978 | T16977 | appos | 16,− |
R11895 | T16979 | T16977 | punct | ),− |
R11896 | T16980 | T16970 | punct | ;,′ |
R11897 | T16981 | T16970 | cc | and,′ |
R11898 | T16982 | T16970 | conj | MHB1663,′ |
R11899 | T16983 | T16982 | punct | ",",MHB1663 |
R11900 | T16984 | T16985 | nummod | 5,′ |
R11901 | T16985 | T16986 | compound | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11902 | T16986 | T16967 | conj | CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA,MHB1662 |
R11903 | T16987 | T16988 | nummod | 3,′ |
R11904 | T16988 | T16986 | appos | ′,CCGCTCGAGAATGCATGCCAAGGGTCAGATGAGTGTCTGCGAAGAA |
R11905 | T16989 | T16990 | punct | (,− |
R11906 | T16990 | T16988 | appos | −,′ |
R11907 | T16991 | T16990 | nummod | 63,− |
R11908 | T16992 | T16990 | prep | to,− |
R11909 | T16993 | T16992 | pobj | −,to |
R11910 | T16994 | T16993 | appos | 18,− |
R11911 | T16995 | T16993 | punct | ),− |
R11912 | T16996 | T16951 | punct | .,include |
R12137 | T17438 | T17438 | ROOT | Quantitation,Quantitation |
R12138 | T17439 | T17438 | prep | of,Quantitation |
R12139 | T17440 | T17441 | compound | globin,mRNA |
R12140 | T17441 | T17439 | pobj | mRNA,of |
R12141 | T17442 | T17438 | punct | .,Quantitation |
R12142 | T17443 | T17444 | nsubj | RNA,was |
R12143 | T17444 | T17444 | ROOT | was,was |
R12144 | T17445 | T17446 | amod | first,reverse |
R12145 | T17446 | T17447 | advmod | reverse,transcribed |
R12146 | T17447 | T17444 | acomp | transcribed,was |
R12147 | T17448 | T17447 | prep | to,transcribed |
R12148 | T17449 | T17448 | pobj | cDNA,to |
R12149 | T17450 | T17444 | punct | .,was |
R12150 | T17451 | T17460 | nsubjpass | Primers,obtained |
R12151 | T17452 | T17451 | prep | for,Primers |
R12152 | T17453 | T17455 | compound | cDNA,amplification |
R12153 | T17454 | T17455 | compound | PCR,amplification |
R12154 | T17455 | T17452 | pobj | amplification,for |
R12155 | T17456 | T17455 | prep | of,amplification |
R12156 | T17457 | T17458 | compound | globin,genes |
R12157 | T17458 | T17456 | pobj | genes,of |
R12158 | T17459 | T17460 | auxpass | were,obtained |
R12159 | T17460 | T17460 | ROOT | obtained,obtained |
R12160 | T17461 | T17460 | prep | from,obtained |
R12161 | T17462 | T17463 | compound | Primerbank,[ |
R12162 | T17463 | T17461 | pobj | [,from |
R12163 | T17464 | T17465 | nummod | 51,] |
R12164 | T17465 | T17463 | appos | ],[ |
R12165 | T17466 | T17460 | punct | .,obtained |
R12166 | T17467 | T17468 | det | All,primers |
R12167 | T17468 | T17470 | nsubjpass | primers,searched |
R12168 | T17469 | T17470 | auxpass | were,searched |
R12169 | T17470 | T17470 | ROOT | searched,searched |
R12170 | T17471 | T17470 | prep | against,searched |
R12171 | T17472 | T17474 | det | the,database |
R12172 | T17473 | T17474 | compound | NCBI,database |
R12173 | T17474 | T17471 | pobj | database,against |
R12174 | T17475 | T17476 | aux | to,confirm |
R12175 | T17476 | T17470 | advcl | confirm,searched |
R12176 | T17477 | T17476 | dobj | specificity,confirm |
R12177 | T17478 | T17470 | punct | .,searched |
R12178 | T17479 | T17479 | ROOT | For,For |
R12179 | T17480 | T17481 | amod | ɛy,globin |
R12180 | T17481 | T17479 | pobj | globin,For |
R12181 | T17482 | T17481 | punct | :,globin |
R12182 | T17483 | T17496 | nmod | MHB1666,′ |
R12183 | T17484 | T17483 | punct | ",",MHB1666 |
R12184 | T17485 | T17483 | nummod | 5,MHB1666 |
R12185 | T17486 | T17483 | nummod | ′,MHB1666 |
R12186 | T17487 | T17488 | nummod | TGGCCTGTGGAGTAAGGTCAA3,′ |
R12187 | T17488 | T17488 | ROOT | ′,′ |
R12188 | T17489 | T17483 | punct | ;,MHB1666 |
R12189 | T17490 | T17483 | cc | and,MHB1666 |
R12190 | T17491 | T17483 | conj | MHB1667,MHB1666 |
R12191 | T17492 | T17491 | punct | ",",MHB1667 |
R12192 | T17493 | T17496 | nummod | 5,′ |
R12193 | T17494 | T17496 | nummod | ′,′ |
R12194 | T17495 | T17496 | compound | GAAGCAGAGGACAAGTTCCCA3,′ |
R12195 | T17496 | T17481 | appos | ′,globin |
R12196 | T17497 | T17479 | punct | .,For |
R12197 | T17498 | T17498 | ROOT | For,For |
R12198 | T17499 | T17500 | amod | ζ,globin |
R12199 | T17500 | T17498 | pobj | globin,For |
R12200 | T17501 | T17500 | punct | :,globin |
R12201 | T17502 | T17515 | nummod | MHB1668,′ |
R12202 | T17503 | T17507 | punct | ",",′ |
R12203 | T17504 | T17507 | nummod | 5,′ |
R12204 | T17505 | T17507 | nmod | ′,′ |
R12205 | T17506 | T17507 | nummod | CTACCCCCAGACGAAGACCTA3,′ |
R12206 | T17507 | T17502 | meta | ′,MHB1668 |
R12207 | T17508 | T17502 | punct | ;,MHB1668 |
R12208 | T17509 | T17502 | cc | and,MHB1668 |
R12209 | T17510 | T17515 | nmod | MHB1669,′ |
R12210 | T17511 | T17510 | punct | ",",MHB1669 |
R12211 | T17512 | T17513 | nummod | 5,′ |
R12212 | T17513 | T17515 | nmod | ′,′ |
R12213 | T17514 | T17515 | nummod | CTTAACCGCATCCCCTACGG3,′ |
R12214 | T17515 | T17500 | appos | ′,globin |
R12215 | T17516 | T17498 | punct | .,For |
R12216 | T17517 | T17517 | ROOT | For,For |
R12217 | T17518 | T17519 | amod | βH1,globin |
R12218 | T17519 | T17517 | pobj | globin,For |
R12219 | T17520 | T17519 | punct | :,globin |
R12220 | T17521 | T17534 | nmod | MHB1672,′ |
R12221 | T17522 | T17521 | punct | ",",MHB1672 |
R12222 | T17523 | T17521 | nummod | 5,MHB1672 |
R12223 | T17524 | T17521 | nummod | ′,MHB1672 |
R12224 | T17525 | T17526 | nummod | TGGACAACCTCAAGGAGACC3,′ |
R12225 | T17526 | T17526 | ROOT | ′,′ |
R12226 | T17527 | T17521 | punct | ;,MHB1672 |
R12227 | T17528 | T17521 | cc | and,MHB1672 |
R12228 | T17529 | T17521 | conj | MHB1673,MHB1672 |
R12229 | T17530 | T17529 | punct | ",",MHB1673 |
R12230 | T17531 | T17534 | nummod | 5,′ |
R12231 | T17532 | T17534 | nummod | ′,′ |
R12232 | T17533 | T17534 | compound | ACCTCTGGGGTGAATTCCTT3,′ |
R12233 | T17534 | T17519 | appos | ′,globin |
R12234 | T17535 | T17517 | punct | .,For |
R12235 | T17536 | T17536 | ROOT | For,For |
R12236 | T17537 | T17540 | amod | βmaj,globin |
R12237 | T17538 | T17540 | compound | /,globin |
R12238 | T17539 | T17540 | compound | min,globin |
R12239 | T17540 | T17536 | pobj | globin,For |
R12240 | T17541 | T17540 | punct | :,globin |
R12241 | T17542 | T17555 | nmod | MHB1674,′ |
R12242 | T17543 | T17542 | punct | :,MHB1674 |
R12243 | T17544 | T17547 | nummod | 5,′ |
R12244 | T17545 | T17547 | nummod | ′,′ |
R12245 | T17546 | T17547 | compound | ATGGCCTGAATCACTTGGAC3,′ |
R12246 | T17547 | T17542 | appos | ′,MHB1674 |
R12247 | T17548 | T17542 | punct | ;,MHB1674 |
R12248 | T17549 | T17542 | cc | and,MHB1674 |
R12249 | T17550 | T17542 | conj | MHB1675,MHB1674 |
R12250 | T17551 | T17550 | punct | ",",MHB1675 |
R12251 | T17552 | T17555 | nummod | 5,′ |
R12252 | T17553 | T17555 | nummod | ′,′ |
R12253 | T17554 | T17555 | compound | ACGATCATATTGCCCAGGAG3,′ |
R12254 | T17555 | T17540 | appos | ′,globin |
R12255 | T17556 | T17536 | punct | .,For |
R12256 | T17557 | T17579 | advcl | Using,run |
R12257 | T17558 | T17562 | det | the,kit |
R12258 | T17559 | T17562 | nmod | SYBR,kit |
R12259 | T17560 | T17562 | amod | green,kit |
R12260 | T17561 | T17562 | compound | supermix,kit |
R12261 | T17562 | T17557 | dobj | kit,Using |
R12262 | T17563 | T17557 | prep | with,Using |
R12263 | T17564 | T17563 | pobj | ROX,with |
R12264 | T17565 | T17566 | punct | (,Bio-Rad |
R12265 | T17566 | T17564 | appos | Bio-Rad,ROX |
R12266 | T17567 | T17566 | punct | ",",Bio-Rad |
R12267 | T17568 | T17566 | conj | Hercules,Bio-Rad |
R12268 | T17569 | T17568 | punct | ",",Hercules |
R12269 | T17570 | T17568 | conj | California,Hercules |
R12270 | T17571 | T17570 | punct | ",",California |
R12271 | T17572 | T17573 | compound | United,States |
R12272 | T17573 | T17570 | conj | States,California |
R12273 | T17574 | T17570 | punct | ),California |
R12274 | T17575 | T17579 | punct | ",",run |
R12275 | T17576 | T17577 | compound | PCR,amplification |
R12276 | T17577 | T17579 | nsubjpass | amplification,run |
R12277 | T17578 | T17579 | auxpass | was,run |
R12278 | T17579 | T17579 | ROOT | run,run |
R12279 | T17580 | T17579 | prep | on,run |
R12280 | T17581 | T17585 | det | an,Biosystems |
R12281 | T17582 | T17585 | nmod | ABI7000,Biosystems |
R12282 | T17583 | T17585 | punct | (,Biosystems |
R12283 | T17584 | T17585 | compound | Applied,Biosystems |
R12284 | T17585 | T17580 | pobj | Biosystems,on |
R12285 | T17586 | T17585 | punct | ",",Biosystems |
R12286 | T17587 | T17588 | compound | Foster,City |
R12287 | T17588 | T17585 | conj | City,Biosystems |
R12288 | T17589 | T17588 | punct | ",",City |
R12289 | T17590 | T17588 | appos | California,City |
R12290 | T17591 | T17590 | punct | ",",California |
R12291 | T17592 | T17593 | compound | United,States |
R12292 | T17593 | T17590 | appos | States,California |
R12293 | T17594 | T17588 | punct | ),City |
R12294 | T17595 | T17585 | prep | at,Biosystems |
R12295 | T17596 | T17597 | det | the,University |
R12296 | T17597 | T17601 | nmod | University,facility |
R12297 | T17598 | T17597 | prep | of,University |
R12298 | T17599 | T17598 | pobj | Arizona,of |
R12299 | T17600 | T17601 | amod | core,facility |
R12300 | T17601 | T17595 | pobj | facility,at |
R12301 | T17602 | T17579 | punct | .,run |
R12302 | T17603 | T17604 | det | All,PCR |
R12303 | T17604 | T17606 | nsubjpass | PCR,performed |
R12304 | T17605 | T17606 | auxpass | was,performed |
R12305 | T17606 | T17606 | ROOT | performed,performed |
R12306 | T17607 | T17606 | prep | in,performed |
R12307 | T17608 | T17610 | det | a,reaction |
R12308 | T17609 | T17610 | amod | 25-μl,reaction |
R12309 | T17610 | T17607 | pobj | reaction,in |
R12310 | T17611 | T17610 | prep | with,reaction |
R12311 | T17612 | T17613 | nummod | 12.5,μl |
R12312 | T17613 | T17611 | pobj | μl,with |
R12313 | T17614 | T17616 | nmod | SYBR,supermix |
R12314 | T17615 | T17616 | amod | green,supermix |
R12315 | T17616 | T17613 | appos | supermix,μl |
R12316 | T17617 | T17606 | punct | .,performed |
R12317 | T17618 | T17619 | compound | GAPDH,mRNA |
R12318 | T17619 | T17620 | compound | mRNA,levels |
R12319 | T17620 | T17622 | nsubjpass | levels,used |
R12320 | T17621 | T17622 | auxpass | were,used |
R12321 | T17622 | T17622 | ROOT | used,used |
R12322 | T17623 | T17622 | prep | as,used |
R12323 | T17624 | T17623 | pobj | control,as |
R12324 | T17625 | T17624 | prep | for,control |
R12325 | T17626 | T17627 | compound | input,RNA |
R12326 | T17627 | T17625 | pobj | RNA,for |
R12327 | T17628 | T17622 | punct | .,used |
R12328 | T17629 | T17631 | compound | Standard,analyses |
R12329 | T17630 | T17631 | compound | curve,analyses |
R12330 | T17631 | T17633 | nsubjpass | analyses,performed |
R12331 | T17632 | T17633 | auxpass | were,performed |
R12332 | T17633 | T17633 | ROOT | performed,performed |
R12333 | T17634 | T17635 | aux | to,test |
R12334 | T17635 | T17633 | xcomp | test,performed |
R12335 | T17636 | T17637 | det | the,efficiency |
R12336 | T17637 | T17635 | dobj | efficiency,test |
R12337 | T17638 | T17637 | prep | of,efficiency |
R12338 | T17639 | T17640 | det | the,amplifications |
R12339 | T17640 | T17638 | pobj | amplifications,of |
R12340 | T17641 | T17633 | punct | .,performed |
R12341 | T17642 | T17644 | nsubjpass | Triplicates,done |
R12342 | T17643 | T17644 | auxpass | were,done |
R12343 | T17644 | T17644 | ROOT | done,done |
R12344 | T17645 | T17644 | prep | for,done |
R12345 | T17646 | T17648 | det | each,reaction |
R12346 | T17647 | T17648 | compound | PCR,reaction |
R12347 | T17648 | T17645 | pobj | reaction,for |
R12348 | T17649 | T17644 | punct | .,done |
R12349 | T17650 | T17652 | amod | Relative,values |
R12350 | T17651 | T17652 | amod | quantitative,values |
R12351 | T17652 | T17654 | nsubjpass | values,calculated |
R12352 | T17653 | T17654 | auxpass | were,calculated |
R12353 | T17654 | T17654 | ROOT | calculated,calculated |
R12354 | T17655 | T17654 | prep | in,calculated |
R12355 | T17656 | T17661 | det | the,Software |
R12356 | T17657 | T17658 | compound | ABI,Prism |
R12357 | T17658 | T17661 | nmod | Prism,Software |
R12358 | T17659 | T17661 | nummod | 7000,Software |
R12359 | T17660 | T17661 | compound | SDS,Software |
R12360 | T17661 | T17655 | pobj | Software,in |
R12361 | T17662 | T17664 | punct | (,Biosystems |
R12362 | T17663 | T17664 | compound | Applied,Biosystems |
R12363 | T17664 | T17661 | appos | Biosystems,Software |
R12364 | T17665 | T17664 | punct | ),Biosystems |
R12365 | T17666 | T17654 | cc | and,calculated |
R12366 | T17667 | T17654 | conj | normalized,calculated |
R12367 | T17668 | T17667 | prep | to,normalized |
R12368 | T17669 | T17668 | pobj | GAPDH,to |
R12369 | T17670 | T17667 | prep | in,normalized |
R12370 | T17671 | T17672 | compound | Microsoft,Excel |
R12371 | T17672 | T17670 | pobj | Excel,in |
R12372 | T17673 | T17674 | punct | (,Redmond |
R12373 | T17674 | T17672 | appos | Redmond,Excel |
R12374 | T17675 | T17674 | punct | ",",Redmond |
R12375 | T17676 | T17674 | conj | Washington,Redmond |
R12376 | T17677 | T17676 | punct | ",",Washington |
R12377 | T17678 | T17679 | compound | United,States |
R12378 | T17679 | T17674 | appos | States,Redmond |
R12379 | T17680 | T17674 | punct | ),Redmond |
R12380 | T17681 | T17654 | punct | .,calculated |
R12582 | T17981 | T17979 | dep | 549,nucleotides |
R12583 | T17982 | T17979 | punct | ;,nucleotides |
R12584 | T17983 | T17979 | cc | and,nucleotides |
R12585 | T17984 | T17986 | nmod | mouse,nucleotides |
R12586 | T17985 | T17986 | compound | Sox6,nucleotides |
R12587 | T17986 | T17979 | conj | nucleotides,nucleotides |
R12588 | T17987 | T17979 | dep | 1353,nucleotides |
R12589 | T17988 | T17979 | appos | 1927,nucleotides |
R12590 | T17989 | T17977 | punct | .,βmaj |
R12591 | T17990 | T17992 | nsubjpass | Embryos,fixed |
R12592 | T17991 | T17992 | auxpass | were,fixed |
R12593 | T17992 | T17992 | ROOT | fixed,fixed |
R12594 | T17993 | T17992 | advmod | overnight,fixed |
R12595 | T17994 | T17992 | agent | by,fixed |
R12596 | T17995 | T17994 | pobj | immersion,by |
R12597 | T17996 | T17992 | prep | in,fixed |
R12598 | T17997 | T17998 | nummod | 4,% |
R12599 | T17998 | T17999 | compound | %,paraformaldehyde |
R12600 | T17999 | T17996 | pobj | paraformaldehyde,in |
R12601 | T18000 | T17992 | punct | ",",fixed |
R12602 | T18001 | T17992 | conj | embedded,fixed |
R12603 | T18002 | T18001 | prep | in,embedded |
R12604 | T18003 | T18002 | pobj | paraffin,in |
R12605 | T18004 | T17992 | punct | ",",fixed |
R12606 | T18005 | T17992 | conj | sectioned,fixed |
R12607 | T18006 | T18005 | prep | at,sectioned |
R12608 | T18007 | T18008 | nummod | 5,μm |
R12609 | T18008 | T18006 | pobj | μm,at |
R12610 | T18009 | T17992 | punct | ",",fixed |
R12611 | T18010 | T17992 | cc | and,fixed |
R12612 | T18011 | T17992 | conj | adhered,fixed |
R12613 | T18012 | T18013 | aux | to,charge |
R12614 | T18013 | T18011 | xcomp | charge,adhered |
R12615 | T18014 | T18015 | amod | modified,slides |
R12616 | T18015 | T18013 | dobj | slides,charge |
R12617 | T18016 | T18017 | punct | (,VWR |
R12618 | T18017 | T18015 | appos | VWR,slides |
R12619 | T18018 | T18017 | punct | ",",VWR |
R12620 | T18019 | T18020 | compound | West,Chester |
R12621 | T18020 | T18017 | conj | Chester,VWR |
R12622 | T18021 | T18020 | punct | ",",Chester |
R12623 | T18022 | T18020 | conj | Pennsylvania,Chester |
R12624 | T18023 | T18022 | punct | ",",Pennsylvania |
R12625 | T18024 | T18025 | compound | United,States |
R12626 | T18025 | T18022 | conj | States,Pennsylvania |
R12627 | T18026 | T18015 | punct | ),slides |
R12628 | T18027 | T17992 | punct | .,fixed |
R12629 | T18028 | T18030 | nsubjpass | Slides,processed |
R12630 | T18029 | T18030 | auxpass | were,processed |
R12631 | T18030 | T18030 | ROOT | processed,processed |
R12632 | T18031 | T18030 | prep | for,processed |
R12633 | T18032 | T18030 | prep | in,processed |
R12634 | T18033 | T18034 | compound | situ,hybridization |
R12635 | T18034 | T18032 | pobj | hybridization,in |
R12636 | T18035 | T18036 | mark | as,described |
R12637 | T18036 | T18030 | advcl | described,processed |
R12638 | T18037 | T18039 | nmod | [,] |
R12639 | T18038 | T18039 | nummod | 52,] |
R12640 | T18039 | T18036 | dobj | ],described |
R12641 | T18040 | T18036 | advcl | using,described |
R12642 | T18041 | T18040 | prep | in,using |
R12643 | T18042 | T18041 | pobj | vitro,in |
R12644 | T18043 | T18045 | amod | transcribed,probes |
R12645 | T18044 | T18045 | compound | RNA,probes |
R12646 | T18045 | T18040 | dobj | probes,using |
R12647 | T18046 | T18045 | acl | labeled,probes |
R12648 | T18047 | T18046 | prep | with,labeled |
R12649 | T18048 | T18047 | pobj | 33P,with |
R12650 | T18049 | T18030 | punct | .,processed |
R12651 | T18050 | T18053 | nmod | Darkfield,images |
R12652 | T18051 | T18050 | cc | and,Darkfield |
R12653 | T18052 | T18050 | conj | brightfield,Darkfield |
R12654 | T18053 | T18055 | nsubjpass | images,obtained |
R12655 | T18054 | T18055 | auxpass | were,obtained |
R12656 | T18055 | T18055 | ROOT | obtained,obtained |
R12657 | T18056 | T18055 | prep | with,obtained |
R12658 | T18057 | T18060 | det | a,microscope |
R12659 | T18058 | T18060 | compound | Nikon,microscope |
R12660 | T18059 | T18060 | compound | Optiphot,microscope |
R12661 | T18060 | T18056 | pobj | microscope,with |
R12662 | T18061 | T18062 | punct | (,Nikon |
R12663 | T18062 | T18076 | nmod | Nikon,camera |
R12664 | T18063 | T18062 | punct | ",",Nikon |
R12665 | T18064 | T18062 | conj | Melville,Nikon |
R12666 | T18065 | T18064 | punct | ",",Melville |
R12667 | T18066 | T18067 | compound | New,York |
R12668 | T18067 | T18064 | conj | York,Melville |
R12669 | T18068 | T18067 | punct | ",",York |
R12670 | T18069 | T18070 | compound | United,States |
R12671 | T18070 | T18067 | conj | States,York |
R12672 | T18071 | T18070 | punct | ),States |
R12673 | T18072 | T18070 | cc | and,States |
R12674 | T18073 | T18076 | nmod | SPOT,camera |
R12675 | T18074 | T18076 | amod | RT-Slider,camera |
R12676 | T18075 | T18076 | amod | digital,camera |
R12677 | T18076 | T18060 | appos | camera,microscope |
R12678 | T18077 | T18079 | punct | (,Instruments |
R12679 | T18078 | T18079 | compound | Diagnostic,Instruments |
R12680 | T18079 | T18076 | appos | Instruments,camera |
R12681 | T18080 | T18079 | punct | ",",Instruments |
R12682 | T18081 | T18082 | compound | Sterling,Heights |
R12683 | T18082 | T18079 | conj | Heights,Instruments |
R12684 | T18083 | T18082 | punct | ",",Heights |
R12685 | T18084 | T18082 | conj | Michigan,Heights |
R12686 | T18085 | T18084 | punct | ",",Michigan |
R12687 | T18086 | T18087 | compound | United,States |
R12688 | T18087 | T18084 | conj | States,Michigan |
R12689 | T18088 | T18079 | punct | ),Instruments |
R12690 | T18089 | T18055 | punct | .,obtained |
R12691 | T18090 | T18092 | nsubj | Objectives,were |
R12692 | T18091 | T18090 | acl | used,Objectives |
R12693 | T18092 | T18092 | ROOT | were,were |
R12694 | T18093 | T18094 | nummod | 1,× |
R12695 | T18094 | T18092 | attr | ×,were |
R12696 | T18095 | T18098 | punct | (,0.04 |
R12697 | T18096 | T18098 | dep | NA,0.04 |
R12698 | T18097 | T18098 | punct | =,0.04 |
R12699 | T18098 | T18094 | parataxis | 0.04,× |
R12700 | T18099 | T18098 | punct | ),0.04 |
R12701 | T18100 | T18098 | cc | and,0.04 |
R12702 | T18101 | T18102 | nummod | 10,× |
R12703 | T18102 | T18098 | conj | ×,0.04 |
R12704 | T18103 | T18102 | punct | (,× |
R12705 | T18104 | T18107 | nmod | NA,) |
R12706 | T18105 | T18106 | punct | =,0.5 |
R12707 | T18106 | T18104 | nummod | 0.5,NA |
R12708 | T18107 | T18102 | punct | ),× |
R12709 | T18108 | T18092 | punct | .,were |
R12710 | T18109 | T18111 | nsubjpass | Images,processed |
R12711 | T18110 | T18111 | auxpass | were,processed |
R12712 | T18111 | T18111 | ROOT | processed,processed |
R12713 | T18112 | T18111 | punct | ",",processed |
R12714 | T18113 | T18111 | conj | pseudocolored,processed |
R12715 | T18114 | T18113 | punct | ",",pseudocolored |
R12716 | T18115 | T18113 | cc | and,pseudocolored |
R12717 | T18116 | T18113 | conj | combined,pseudocolored |
R12718 | T18117 | T18116 | advcl | using,combined |
R12719 | T18118 | T18117 | dobj | Photoshop,using |
R12720 | T18119 | T18120 | punct | (,Adobe |
R12721 | T18120 | T18118 | appos | Adobe,Photoshop |
R12722 | T18121 | T18120 | punct | ",",Adobe |
R12723 | T18122 | T18123 | compound | San,Jose |
R12724 | T18123 | T18120 | npadvmod | Jose,Adobe |
R12725 | T18124 | T18123 | punct | ",",Jose |
R12726 | T18125 | T18123 | conj | California,Jose |
R12727 | T18126 | T18125 | punct | ",",California |
R12728 | T18127 | T18128 | compound | United,States |
R12729 | T18128 | T18125 | appos | States,California |
R12730 | T18129 | T18125 | punct | ),California |
R12731 | T18130 | T18118 | conj | software,Photoshop |
R12732 | T18131 | T18117 | prep | with,using |
R12733 | T18132 | T18136 | nmod | Fovea,Graphics |
R12734 | T18133 | T18136 | nmod | Pro,Graphics |
R12735 | T18134 | T18136 | punct | (,Graphics |
R12736 | T18135 | T18136 | compound | Reindeer,Graphics |
R12737 | T18136 | T18146 | nmod | Graphics,plugins |
R12738 | T18137 | T18136 | punct | ",",Graphics |
R12739 | T18138 | T18146 | nmod | Asheville,plugins |
R12740 | T18139 | T18138 | punct | ",",Asheville |
R12741 | T18140 | T18141 | compound | North,Carolina |
R12742 | T18141 | T18138 | conj | Carolina,Asheville |
R12743 | T18142 | T18141 | punct | ",",Carolina |
R12744 | T18143 | T18144 | compound | United,States |
R12745 | T18144 | T18141 | appos | States,Carolina |
R12746 | T18145 | T18146 | punct | ),plugins |
R12747 | T18146 | T18131 | pobj | plugins,with |
R12748 | T18147 | T18111 | punct | .,processed |
R12749 | T18148 | T18149 | amod | Original,images |
R12750 | T18149 | T18150 | nsubj | images,are |
R12751 | T18150 | T18150 | ROOT | are,are |
R12752 | T18151 | T18150 | acomp | available,are |
R12753 | T18152 | T18150 | punct | .,are |
R12873 | T18304 | T18304 | ROOT | Histology,Histology |
R12874 | T18305 | T18304 | punct | .,Histology |
R12875 | T18306 | T18307 | amod | 18.5-dpc,embryos |
R12876 | T18307 | T18309 | nsubjpass | embryos,exsanguinated |
R12877 | T18308 | T18309 | auxpass | were,exsanguinated |
R12878 | T18309 | T18309 | ROOT | exsanguinated,exsanguinated |
R12879 | T18310 | T18309 | cc | and,exsanguinated |
R12880 | T18311 | T18309 | conj | peripheral,exsanguinated |
R12881 | T18312 | T18313 | compound | blood,smears |
R12882 | T18313 | T18314 | nsubj | smears,were |
R12883 | T18314 | T18315 | auxpass | were,prepared |
R12884 | T18315 | T18309 | conj | prepared,exsanguinated |
R12885 | T18316 | T18315 | prep | from,prepared |
R12886 | T18317 | T18318 | preconj | both,mutant |
R12887 | T18318 | T18321 | amod | mutant,mice |
R12888 | T18319 | T18318 | cc | and,mutant |
R12889 | T18320 | T18318 | conj | WT,mutant |
R12890 | T18321 | T18316 | pobj | mice,from |
R12891 | T18322 | T18309 | punct | .,exsanguinated |
R12892 | T18323 | T18324 | det | The,slides |
R12893 | T18324 | T18325 | nsubj | slides,were |
R12894 | T18325 | T18325 | ROOT | were,were |
R12895 | T18326 | T18325 | acomp | Wright-stained,were |
R12896 | T18327 | T18325 | cc | and,were |
R12897 | T18328 | T18325 | conj | read,were |
R12898 | T18329 | T18328 | agent | by,read |
R12899 | T18330 | T18329 | pobj | DAF,by |
R12900 | T18331 | T18325 | punct | .,were |
R12901 | T18332 | T18349 | prep | For,fixed |
R12902 | T18333 | T18335 | amod | whole,analysis |
R12903 | T18334 | T18335 | compound | mount,analysis |
R12904 | T18335 | T18332 | pobj | analysis,For |
R12905 | T18336 | T18349 | punct | ",",fixed |
R12906 | T18337 | T18338 | compound | 14.5-dpc,WT |
R12907 | T18338 | T18349 | nsubjpass | WT,fixed |
R12908 | T18339 | T18338 | cc | and,WT |
R12909 | T18340 | T18341 | amod | mutant,embryos |
R12910 | T18341 | T18338 | conj | embryos,WT |
R12911 | T18342 | T18341 | punct | ",",embryos |
R12912 | T18343 | T18341 | cc | and,embryos |
R12913 | T18344 | T18345 | amod | postnatal,day |
R12914 | T18345 | T18349 | npadvmod | day,fixed |
R12915 | T18346 | T18347 | nummod | 10.5,mice |
R12916 | T18347 | T18349 | nsubjpass | mice,fixed |
R12917 | T18348 | T18349 | auxpass | were,fixed |
R12918 | T18349 | T18349 | ROOT | fixed,fixed |
R12919 | T18350 | T18349 | prep | in,fixed |
R12920 | T18351 | T18352 | nummod | 10,% |
R12921 | T18352 | T18353 | compound | %,formalin |
R12922 | T18353 | T18350 | pobj | formalin,in |
R12923 | T18354 | T18353 | punct | ",",formalin |
R12924 | T18355 | T18357 | amod | paraffin-embedded,sectioned |
R12925 | T18356 | T18355 | punct | ",",paraffin-embedded |
R12926 | T18357 | T18349 | conj | sectioned,fixed |
R12927 | T18358 | T18357 | prep | at,sectioned |
R12928 | T18359 | T18360 | nummod | 5,μm |
R12929 | T18360 | T18358 | pobj | μm,at |
R12930 | T18361 | T18357 | punct | ",",sectioned |
R12931 | T18362 | T18357 | cc | and,sectioned |
R12932 | T18363 | T18357 | conj | stained,sectioned |
R12933 | T18364 | T18363 | prep | with,stained |
R12934 | T18365 | T18364 | pobj | hematoxylin,with |
R12935 | T18366 | T18365 | cc | and,hematoxylin |
R12936 | T18367 | T18365 | conj | eosin,hematoxylin |
R12937 | T18368 | T18349 | punct | .,fixed |
R12938 | T18369 | T18370 | compound | Liver,samples |
R12939 | T18370 | T18380 | nsubjpass | samples,prepared |
R12940 | T18371 | T18372 | punct | (,at |
R12941 | T18372 | T18370 | prep | at,samples |
R12942 | T18373 | T18372 | pobj | 14.5,at |
R12943 | T18374 | T18380 | nsubjpass | dpc,prepared |
R12944 | T18375 | T18374 | cc | and,dpc |
R12945 | T18376 | T18377 | nummod | 18.5,dpc |
R12946 | T18377 | T18374 | conj | dpc,dpc |
R12947 | T18378 | T18374 | punct | ),dpc |
R12948 | T18379 | T18380 | auxpass | were,prepared |
R12949 | T18380 | T18380 | ROOT | prepared,prepared |
R12950 | T18381 | T18380 | prep | in,prepared |
R12951 | T18382 | T18384 | det | a,manner |
R12952 | T18383 | T18384 | amod | similar,manner |
R12953 | T18384 | T18381 | pobj | manner,in |
R12954 | T18385 | T18380 | punct | .,prepared |
R12955 | T18386 | T18388 | nsubjpass | Images,obtained |
R12956 | T18387 | T18388 | auxpass | were,obtained |
R12957 | T18388 | T18388 | ROOT | obtained,obtained |
R12958 | T18389 | T18388 | prep | with,obtained |
R12959 | T18390 | T18392 | compound | Nikon,microscope |
R12960 | T18391 | T18392 | compound | Labophot-2,microscope |
R12961 | T18392 | T18389 | pobj | microscope,with |
R12962 | T18393 | T18388 | punct | .,obtained |
R12963 | T18394 | T18396 | nsubj | Objectives,were |
R12964 | T18395 | T18394 | acl | used,Objectives |
R12965 | T18396 | T18396 | ROOT | were,were |
R12966 | T18397 | T18398 | compound | E,Plan |
R12967 | T18398 | T18396 | attr | Plan,were |
R12968 | T18399 | T18398 | nummod | 40/0,Plan |
R12969 | T18400 | T18398 | nummod | .65,Plan |
R12970 | T18401 | T18398 | appos | 160/0,Plan |
R12971 | T18402 | T18403 | nummod | .17,Nikon |
R12972 | T18403 | T18398 | conj | Nikon,Plan |
R12973 | T18404 | T18403 | punct | (,Nikon |
R12974 | T18405 | T18406 | nummod | 40,× |
R12975 | T18406 | T18407 | compound | ×,objective |
R12976 | T18407 | T18403 | appos | objective,Nikon |
R12977 | T18408 | T18403 | punct | ),Nikon |
R12978 | T18409 | T18403 | punct | ",",Nikon |
R12979 | T18410 | T18411 | compound | E,Plan |
R12980 | T18411 | T18398 | conj | Plan,Plan |
R12981 | T18412 | T18411 | nummod | 100/1,Plan |
R12982 | T18413 | T18398 | appos | .25,Plan |
R12983 | T18414 | T18415 | compound | oil,160/0 |
R12984 | T18415 | T18417 | nmod | 160/0,Nikon |
R12985 | T18416 | T18417 | nummod | .17,Nikon |
R12986 | T18417 | T18398 | conj | Nikon,Plan |
R12987 | T18418 | T18417 | punct | (,Nikon |
R12988 | T18419 | T18421 | nummod | 100,objective |
R12989 | T18420 | T18421 | nummod | ×,objective |
R12990 | T18421 | T18417 | appos | objective,Nikon |
R12991 | T18422 | T18417 | punct | ),Nikon |
R12992 | T18423 | T18396 | punct | .,were |
R12993 | T18424 | T18425 | det | The,camera |
R12994 | T18425 | T18426 | nsubj | camera,was |
R12995 | T18426 | T18426 | ROOT | was,was |
R12996 | T18427 | T18429 | det | a,Coolpix |
R12997 | T18428 | T18429 | compound | Nikon,Coolpix |
R12998 | T18429 | T18430 | compound | Coolpix,4300 |
R12999 | T18430 | T18426 | attr | 4300,was |
R13000 | T18431 | T18426 | punct | .,was |
R13001 | T18432 | T18433 | amod | Original,images |
R13002 | T18433 | T18434 | nsubj | images,are |
R13003 | T18434 | T18434 | ROOT | are,are |
R13004 | T18435 | T18434 | acomp | available,are |
R13005 | T18436 | T18434 | punct | .,are |
R13112 | T18572 | T18573 | compound | Northern,blot |
R13113 | T18573 | T18573 | ROOT | blot,blot |
R13114 | T18574 | T18573 | punct | .,blot |
R13115 | T18575 | T18581 | det | A,filter |
R13116 | T18576 | T18581 | compound | mouse,filter |
R13117 | T18577 | T18578 | amod | embryonic,tissue |
R13118 | T18578 | T18581 | compound | tissue,filter |
R13119 | T18579 | T18580 | compound | Northern,blot |
R13120 | T18580 | T18581 | compound | blot,filter |
R13121 | T18581 | T18593 | nsubjpass | filter,hybridized |
R13122 | T18582 | T18581 | punct | (,filter |
R13123 | T18583 | T18581 | appos | Seegene,filter |
R13124 | T18584 | T18583 | punct | ",",Seegene |
R13125 | T18585 | T18583 | conj | Rockville,Seegene |
R13126 | T18586 | T18585 | punct | ",",Rockville |
R13127 | T18587 | T18585 | conj | Maryland,Rockville |
R13128 | T18588 | T18587 | punct | ",",Maryland |
R13129 | T18589 | T18590 | compound | United,States |
R13130 | T18590 | T18587 | appos | States,Maryland |
R13131 | T18591 | T18587 | punct | ),Maryland |
R13132 | T18592 | T18593 | auxpass | was,hybridized |
R13133 | T18593 | T18593 | ROOT | hybridized,hybridized |
R13134 | T18594 | T18593 | prep | with,hybridized |
R13135 | T18595 | T18597 | det | a,probe |
R13136 | T18596 | T18597 | amod | Sox6,probe |
R13137 | T18597 | T18594 | pobj | probe,with |
R13138 | T18598 | T18597 | acl | generated,probe |
R13139 | T18599 | T18598 | agent | by,generated |
R13140 | T18600 | T18599 | pobj | RT-PCR,by |
R13141 | T18601 | T18602 | punct | (,nucleotides |
R13142 | T18602 | T18597 | appos | nucleotides,probe |
R13143 | T18603 | T18602 | nummod | 1353,nucleotides |
R13144 | T18604 | T18602 | npadvmod | 1927,nucleotides |
R13145 | T18605 | T18602 | punct | ),nucleotides |
R13146 | T18606 | T18593 | cc | and,hybridized |
R13147 | T18607 | T18593 | conj | labeled,hybridized |
R13148 | T18608 | T18607 | prep | with,labeled |
R13149 | T18609 | T18612 | compound | [,dCTP |
R13150 | T18610 | T18612 | compound | α-32P,dCTP |
R13151 | T18611 | T18612 | compound | ],dCTP |
R13152 | T18612 | T18608 | pobj | dCTP,with |
R13153 | T18613 | T18612 | punct | ",",dCTP |
R13154 | T18614 | T18607 | agent | by,labeled |
R13155 | T18615 | T18616 | amod | random,primer |
R13156 | T18616 | T18614 | pobj | primer,by |
R13157 | T18617 | T18616 | acl | labeling,primer |
R13158 | T18618 | T18619 | punct | (,RediprimeII |
R13159 | T18619 | T18617 | ccomp | RediprimeII,labeling |
R13160 | T18620 | T18619 | punct | ;,RediprimeII |
R13161 | T18621 | T18622 | compound | Amersham,Biosciences |
R13162 | T18622 | T18619 | conj | Biosciences,RediprimeII |
R13163 | T18623 | T18622 | punct | ",",Biosciences |
R13164 | T18624 | T18622 | conj | Buckinghamshire,Biosciences |
R13165 | T18625 | T18624 | punct | ",",Buckinghamshire |
R13166 | T18626 | T18624 | conj | England,Buckinghamshire |
R13167 | T18627 | T18626 | punct | ",",England |
R13168 | T18628 | T18629 | compound | United,Kingdom |
R13169 | T18629 | T18619 | npadvmod | Kingdom,RediprimeII |
R13170 | T18630 | T18619 | punct | ),RediprimeII |
R13171 | T18631 | T18593 | punct | .,hybridized |
R13172 | T18632 | T18633 | det | The,hybridization |
R13173 | T18633 | T18635 | nsubjpass | hybridization,performed |
R13174 | T18634 | T18635 | auxpass | was,performed |
R13175 | T18635 | T18635 | ROOT | performed,performed |
R13176 | T18636 | T18635 | prep | in,performed |
R13177 | T18637 | T18636 | pobj | phosphate,in |
R13178 | T18638 | T18635 | advcl | buffered,performed |
R13179 | T18639 | T18640 | nummod | 7,% |
R13180 | T18640 | T18643 | compound | %,solution |
R13181 | T18641 | T18643 | compound | SDS,solution |
R13182 | T18642 | T18643 | compound | hybridization,solution |
R13183 | T18643 | T18638 | dobj | solution,buffered |
R13184 | T18644 | T18635 | punct | .,performed |
R13185 | T18645 | T18647 | nsubjpass | Blots,washed |
R13186 | T18646 | T18647 | auxpass | were,washed |
R13187 | T18647 | T18647 | ROOT | washed,washed |
R13188 | T18648 | T18647 | prep | with,washed |
R13189 | T18649 | T18651 | nummod | 0.2,SSC |
R13190 | T18650 | T18651 | nummod | ×,SSC |
R13191 | T18651 | T18648 | pobj | SSC,with |
R13192 | T18652 | T18651 | punct | ",",SSC |
R13193 | T18653 | T18654 | nummod | 1,% |
R13194 | T18654 | T18655 | compound | %,SDS |
R13195 | T18655 | T18651 | appos | SDS,SSC |
R13196 | T18656 | T18647 | prep | at,washed |
R13197 | T18657 | T18658 | nummod | 60,° |
R13198 | T18658 | T18656 | pobj | °,at |
R13199 | T18659 | T18660 | compound | C,prior |
R13200 | T18660 | T18647 | advmod | prior,washed |
R13201 | T18661 | T18660 | prep | to,prior |
R13202 | T18662 | T18661 | pobj | exposure,to |
R13203 | T18663 | T18662 | prep | to,exposure |
R13204 | T18664 | T18665 | compound | X-ray,film |
R13205 | T18665 | T18663 | pobj | film,to |
R13206 | T18666 | T18667 | punct | (,Kodak |
R13207 | T18667 | T18665 | appos | Kodak,film |
R13208 | T18668 | T18667 | punct | ",",Kodak |
R13209 | T18669 | T18667 | conj | Rochester,Kodak |
R13210 | T18670 | T18669 | punct | ",",Rochester |
R13211 | T18671 | T18672 | compound | New,York |
R13212 | T18672 | T18669 | conj | York,Rochester |
R13213 | T18673 | T18672 | punct | ",",York |
R13214 | T18674 | T18675 | compound | United,States |
R13215 | T18675 | T18672 | appos | States,York |
R13216 | T18676 | T18672 | punct | ),York |
R13217 | T18677 | T18660 | prep | at,prior |
R13218 | T18678 | T18680 | nummod | −,° |
R13219 | T18679 | T18680 | nummod | 80,° |
R13220 | T18680 | T18677 | pobj | °,at |
R13221 | T18681 | T18660 | npadvmod | C,prior |
R13222 | T18682 | T18660 | prep | for,prior |
R13223 | T18683 | T18684 | nummod | 6,d. |
R13224 | T18684 | T18682 | pobj | d.,for |
R13398 | T18901 | T18902 | compound | Cell,culture |
R13399 | T18902 | T18902 | ROOT | culture,culture |
R13400 | T18903 | T18902 | cc | and,culture |
R13401 | T18904 | T18902 | conj | transfection,culture |
R13402 | T18905 | T18902 | punct | .,culture |
R13403 | T18906 | T18907 | nummod | GM979,cells |
R13404 | T18907 | T18922 | nsubjpass | cells,cultured |
R13405 | T18908 | T18907 | punct | (,cells |
R13406 | T18909 | T18911 | compound | Coriell,Repositories |
R13407 | T18910 | T18911 | compound | Cell,Repositories |
R13408 | T18911 | T18907 | appos | Repositories,cells |
R13409 | T18912 | T18911 | punct | ",",Repositories |
R13410 | T18913 | T18911 | conj | Camden,Repositories |
R13411 | T18914 | T18913 | punct | ",",Camden |
R13412 | T18915 | T18916 | compound | New,Jersey |
R13413 | T18916 | T18913 | conj | Jersey,Camden |
R13414 | T18917 | T18916 | punct | ",",Jersey |
R13415 | T18918 | T18919 | compound | United,States |
R13416 | T18919 | T18916 | appos | States,Jersey |
R13417 | T18920 | T18916 | punct | ),Jersey |
R13418 | T18921 | T18922 | auxpass | were,cultured |
R13419 | T18922 | T18922 | ROOT | cultured,cultured |
R13420 | T18923 | T18922 | prep | in,cultured |
R13421 | T18924 | T18926 | poss | Ham,F12 |
R13422 | T18925 | T18924 | case | 's,Ham |
R13423 | T18926 | T18923 | pobj | F12,in |
R13424 | T18927 | T18931 | mark | with,supplemented |
R13425 | T18928 | T18930 | nummod | 2,L-glutamine |
R13426 | T18929 | T18930 | compound | mM,L-glutamine |
R13427 | T18930 | T18931 | nsubj | L-glutamine,supplemented |
R13428 | T18931 | T18922 | advcl | supplemented,cultured |
R13429 | T18932 | T18931 | prep | with,supplemented |
R13430 | T18933 | T18938 | amod | heat-inactivated,serum |
R13431 | T18934 | T18935 | nummod | 10,% |
R13432 | T18935 | T18938 | compound | %,serum |
R13433 | T18936 | T18937 | amod | fetal,calf |
R13434 | T18937 | T18938 | compound | calf,serum |
R13435 | T18938 | T18932 | pobj | serum,with |
R13436 | T18939 | T18938 | punct | (,serum |
R13437 | T18940 | T18968 | nmod | Ivitrogen,) |
R13438 | T18941 | T18940 | punct | ",",Ivitrogen |
R13439 | T18942 | T18940 | conj | Carlsbad,Ivitrogen |
R13440 | T18943 | T18942 | punct | ",",Carlsbad |
R13441 | T18944 | T18942 | conj | California,Carlsbad |
R13442 | T18945 | T18944 | punct | ",",California |
R13443 | T18946 | T18947 | compound | United,States |
R13444 | T18947 | T18944 | conj | States,California |
R13445 | T18948 | T18944 | punct | ),California |
R13446 | T18949 | T18940 | punct | ",",Ivitrogen |
R13447 | T18950 | T18967 | nmod | penicillin,mM |
R13448 | T18951 | T18953 | punct | (,units/ml |
R13449 | T18952 | T18953 | nummod | 100,units/ml |
R13450 | T18953 | T18950 | appos | units/ml,penicillin |
R13451 | T18954 | T18953 | punct | ),units/ml |
R13452 | T18955 | T18950 | punct | ",",penicillin |
R13453 | T18956 | T18960 | nmod | streptomycin,ml |
R13454 | T18957 | T18956 | nummod | 100,streptomycin |
R13455 | T18958 | T18960 | compound | μg,ml |
R13456 | T18959 | T18960 | compound | /,ml |
R13457 | T18960 | T18950 | appos | ml,penicillin |
R13458 | T18961 | T18960 | punct | ),ml |
R13459 | T18962 | T18950 | punct | ",",penicillin |
R13460 | T18963 | T18950 | cc | and,penicillin |
R13461 | T18964 | T18950 | conj | L-glutamine,penicillin |
R13462 | T18965 | T18966 | punct | (,2 |
R13463 | T18966 | T18967 | nummod | 2,mM |
R13464 | T18967 | T18940 | appos | mM,Ivitrogen |
R13465 | T18968 | T18938 | punct | ),serum |
R13466 | T18969 | T18922 | punct | .,cultured |
R13467 | T18970 | T18971 | compound | MEL,cells |
R13468 | T18971 | T18976 | nsubjpass | cells,supplemented |
R13469 | T18972 | T18976 | auxpass | were,supplemented |
R13470 | T18973 | T18972 | acomp | cultured,were |
R13471 | T18974 | T18973 | prep | in,cultured |
R13472 | T18975 | T18974 | pobj | DMEM,in |
R13473 | T18976 | T18976 | ROOT | supplemented,supplemented |
R13474 | T18977 | T18976 | prep | as,supplemented |
R13475 | T18978 | T18977 | prep | above,as |
R13476 | T18979 | T18978 | punct | (,above |
R13477 | T18980 | T18978 | prep | without,above |
R13478 | T18981 | T18980 | pobj | heat,without |
R13479 | T18982 | T18978 | pcomp | inactivating,above |
R13480 | T18983 | T18984 | det | the,serum |
R13481 | T18984 | T18982 | dobj | serum,inactivating |
R13482 | T18985 | T18977 | punct | ),as |
R13483 | T18986 | T18976 | punct | .,supplemented |
R13484 | T18987 | T18988 | nummod | GM979,cells |
R13485 | T18988 | T19000 | nsubjpass | cells,transfected |
R13486 | T18989 | T18988 | punct | (,cells |
R13487 | T18990 | T18992 | nummod | 4,105 |
R13488 | T18991 | T18992 | nummod | ×,105 |
R13489 | T18992 | T18988 | appos | 105,cells |
R13490 | T18993 | T18988 | punct | ),cells |
R13491 | T18994 | T18988 | prep | in,cells |
R13492 | T18995 | T18996 | compound | log,phase |
R13493 | T18996 | T18994 | pobj | phase,in |
R13494 | T18997 | T18996 | prep | of,phase |
R13495 | T18998 | T18997 | pobj | growth,of |
R13496 | T18999 | T19000 | auxpass | were,transfected |
R13497 | T19000 | T19000 | ROOT | transfected,transfected |
R13498 | T19001 | T19000 | prep | with,transfected |
R13499 | T19002 | T19001 | pobj | plasmids,with |
R13500 | T19003 | T19000 | agent | by,transfected |
R13501 | T19004 | T19003 | pobj | FuGENE6,by |
R13502 | T19005 | T19006 | punct | (,Roche |
R13503 | T19006 | T19004 | appos | Roche,FuGENE6 |
R13504 | T19007 | T19006 | punct | ",",Roche |
R13505 | T19008 | T19013 | nmod | Indianapolis,States |
R13506 | T19009 | T19008 | punct | ",",Indianapolis |
R13507 | T19010 | T19008 | conj | Indiana,Indianapolis |
R13508 | T19011 | T19010 | punct | ",",Indiana |
R13509 | T19012 | T19013 | compound | United,States |
R13510 | T19013 | T19006 | conj | States,Roche |
R13511 | T19014 | T19006 | punct | ),Roche |
R13512 | T19015 | T19000 | punct | .,transfected |
R13513 | T19016 | T19018 | nsubjpass | Cells,transfected |
R13514 | T19017 | T19018 | auxpass | were,transfected |
R13515 | T19018 | T19018 | ROOT | transfected,transfected |
R13516 | T19019 | T19018 | prep | with,transfected |
R13517 | T19020 | T19022 | amod | ɛy,reporter |
R13518 | T19021 | T19022 | compound | promoter,reporter |
R13519 | T19022 | T19023 | compound | reporter,constructs |
R13520 | T19023 | T19019 | pobj | constructs,with |
R13521 | T19024 | T19023 | punct | (,constructs |
R13522 | T19025 | T19026 | nummod | 500,ng |
R13523 | T19026 | T19023 | appos | ng,constructs |
R13524 | T19027 | T19023 | punct | ),constructs |
R13525 | T19028 | T19018 | prep | along,transfected |
R13526 | T19029 | T19028 | prep | with,along |
R13527 | T19030 | T19032 | preconj | either,vector |
R13528 | T19031 | T19032 | amod | empty,vector |
R13529 | T19032 | T19029 | pobj | vector,with |
R13530 | T19033 | T19032 | cc | or,vector |
R13531 | T19034 | T19036 | amod | Sox6,vector |
R13532 | T19035 | T19036 | compound | overexpression,vector |
R13533 | T19036 | T19032 | conj | vector,vector |
R13534 | T19037 | T19036 | punct | (,vector |
R13535 | T19038 | T19039 | nummod | 1000,ng |
R13536 | T19039 | T19036 | appos | ng,vector |
R13537 | T19040 | T19036 | punct | ),vector |
R13538 | T19041 | T19018 | punct | .,transfected |
R13539 | T19042 | T19049 | prep | In,used |
R13540 | T19043 | T19042 | pobj | assays,In |
R13541 | T19044 | T19043 | prep | of,assays |
R13542 | T19045 | T19046 | compound | dosage,effect |
R13543 | T19046 | T19044 | pobj | effect,of |
R13544 | T19047 | T19049 | punct | ",",used |
R13545 | T19048 | T19049 | nsubj | we,used |
R13546 | T19049 | T19049 | ROOT | used,used |
R13547 | T19050 | T19051 | nummod | 200,ng |
R13548 | T19051 | T19049 | dobj | ng,used |
R13549 | T19052 | T19051 | punct | ",",ng |
R13550 | T19053 | T19054 | nummod | 500,ng |
R13551 | T19054 | T19051 | appos | ng,ng |
R13552 | T19055 | T19054 | punct | ",",ng |
R13553 | T19056 | T19054 | cc | and,ng |
R13554 | T19057 | T19058 | nummod | 1000,ng |
R13555 | T19058 | T19054 | conj | ng,ng |
R13556 | T19059 | T19051 | punct | ),ng |
R13557 | T19060 | T19049 | punct | .,used |
R13558 | T19061 | T19062 | amod | pRL-CMV,15ng |
R13559 | T19062 | T19067 | nsubjpass | 15ng,used |
R13560 | T19063 | T19064 | punct | (,Promega |
R13561 | T19064 | T19062 | appos | Promega,15ng |
R13562 | T19065 | T19064 | punct | ),Promega |
R13563 | T19066 | T19067 | auxpass | was,used |
R13564 | T19067 | T19067 | ROOT | used,used |
R13565 | T19068 | T19067 | prep | as,used |
R13566 | T19069 | T19070 | det | a,control |
R13567 | T19070 | T19068 | pobj | control,as |
R13568 | T19071 | T19070 | prep | for,control |
R13569 | T19072 | T19073 | compound | transfection,efficiency |
R13570 | T19073 | T19071 | pobj | efficiency,for |
R13571 | T19074 | T19067 | punct | .,used |
R13673 | T19267 | T19268 | compound | Nuclear,protein |
R13674 | T19268 | T19269 | nsubj | protein,extract |
R13675 | T19269 | T19269 | ROOT | extract,extract |
R13676 | T19270 | T19269 | cc | and,extract |
R13677 | T19271 | T19269 | prep | in,extract |
R13678 | T19272 | T19273 | amod | vitro,translation |
R13679 | T19273 | T19271 | pobj | translation,in |
R13680 | T19274 | T19273 | prep | of,translation |
R13681 | T19275 | T19274 | pobj | Sox6,of |
R13682 | T19276 | T19269 | punct | .,extract |
R13683 | T19277 | T19278 | compound | Nuclear,extracts |
R13684 | T19278 | T19280 | nsubjpass | extracts,prepared |
R13685 | T19279 | T19280 | auxpass | were,prepared |
R13686 | T19280 | T19280 | ROOT | prepared,prepared |
R13687 | T19281 | T19280 | prep | from,prepared |
R13688 | T19282 | T19283 | compound | MEL,cells |
R13689 | T19283 | T19281 | pobj | cells,from |
R13690 | T19284 | T19283 | punct | (,cells |
R13691 | T19285 | T19286 | nummod | 2,× |
R13692 | T19286 | T19287 | nummod | ×,107 |
R13693 | T19287 | T19283 | appos | 107,cells |
R13694 | T19288 | T19283 | punct | ),cells |
R13695 | T19289 | T19280 | advcl | using,prepared |
R13696 | T19290 | T19291 | det | a,kit |
R13697 | T19291 | T19289 | dobj | kit,using |
R13698 | T19292 | T19291 | punct | (,kit |
R13699 | T19293 | T19294 | amod | Active,Motif |
R13700 | T19294 | T19291 | appos | Motif,kit |
R13701 | T19295 | T19294 | punct | ",",Motif |
R13702 | T19296 | T19294 | conj | Carlsbad,Motif |
R13703 | T19297 | T19296 | punct | ",",Carlsbad |
R13704 | T19298 | T19296 | conj | California,Carlsbad |
R13705 | T19299 | T19298 | punct | ",",California |
R13706 | T19300 | T19301 | compound | United,States |
R13707 | T19301 | T19298 | conj | States,California |
R13708 | T19302 | T19296 | punct | ),Carlsbad |
R13709 | T19303 | T19280 | punct | .,prepared |
R13710 | T19304 | T19305 | det | The,Sox6 |
R13711 | T19305 | T19312 | nsubjpass | Sox6,tagged |
R13712 | T19306 | T19312 | prep | in,tagged |
R13713 | T19307 | T19309 | amod | vitro,expression |
R13714 | T19308 | T19309 | compound | translation,expression |
R13715 | T19309 | T19310 | compound | expression,vector |
R13716 | T19310 | T19306 | pobj | vector,in |
R13717 | T19311 | T19312 | punct | ",",tagged |
R13718 | T19312 | T19312 | ROOT | tagged,tagged |
R13719 | T19313 | T19312 | prep | with,tagged |
R13720 | T19314 | T19313 | pobj | c-Myc,with |
R13721 | T19315 | T19314 | cc | and,c-Myc |
R13722 | T19316 | T19314 | conj | HA,c-Myc |
R13723 | T19317 | T19319 | punct | ",",described |
R13724 | T19318 | T19319 | auxpass | was,described |
R13725 | T19319 | T19312 | conj | described,tagged |
R13726 | T19320 | T19319 | prep | before,described |
R13727 | T19321 | T19323 | nmod | [,] |
R13728 | T19322 | T19321 | nummod | 15,[ |
R13729 | T19323 | T19320 | pobj | ],before |
R13730 | T19324 | T19319 | punct | .,described |
R13731 | T19325 | T19326 | det | The,translation |
R13732 | T19326 | T19328 | nsubjpass | translation,performed |
R13733 | T19327 | T19328 | auxpass | was,performed |
R13734 | T19328 | T19328 | ROOT | performed,performed |
R13735 | T19329 | T19328 | prep | in,performed |
R13736 | T19330 | T19332 | det | a,lysate |
R13737 | T19331 | T19332 | amod | reticulocyte,lysate |
R13738 | T19332 | T19329 | pobj | lysate,in |
R13739 | T19333 | T19332 | acl | based,lysate |
R13740 | T19334 | T19333 | prep | in,based |
R13741 | T19335 | T19337 | amod | vitro,system |
R13742 | T19336 | T19337 | amod | translational,system |
R13743 | T19337 | T19334 | pobj | system,in |
R13744 | T19338 | T19337 | punct | (,system |
R13745 | T19339 | T19344 | nmod | TNT,Systems |
R13746 | T19340 | T19339 | nummod | ®,TNT |
R13747 | T19341 | T19344 | compound | Quick,Systems |
R13748 | T19342 | T19344 | compound | Coupled,Systems |
R13749 | T19343 | T19344 | compound | Transcription/Translation,Systems |
R13750 | T19344 | T19337 | appos | Systems,system |
R13751 | T19345 | T19344 | punct | ",",Systems |
R13752 | T19346 | T19344 | appos | Promega,Systems |
R13753 | T19347 | T19337 | punct | ),system |
R13754 | T19348 | T19328 | punct | .,performed |
R13755 | T19349 | T19350 | det | A,vector |
R13756 | T19350 | T19358 | nsubjpass | vector,translated |
R13757 | T19351 | T19350 | prep | without,vector |
R13758 | T19352 | T19355 | det | the,sequence |
R13759 | T19353 | T19355 | amod | Sox6,sequence |
R13760 | T19354 | T19355 | compound | coding,sequence |
R13761 | T19355 | T19351 | pobj | sequence,without |
R13762 | T19356 | T19358 | auxpass | was,translated |
R13763 | T19357 | T19358 | advmod | also,translated |
R13764 | T19358 | T19358 | ROOT | translated,translated |
R13765 | T19359 | T19358 | prep | as,translated |
R13766 | T19360 | T19362 | det | a,control |
R13767 | T19361 | T19362 | amod | negative,control |
R13768 | T19362 | T19359 | pobj | control,as |
R13769 | T19363 | T19358 | punct | .,translated |
R13850 | T19522 | T19522 | ROOT | Antibodies,Antibodies |
R13851 | T19523 | T19522 | punct | .,Antibodies |
R13852 | T19524 | T19525 | amod | Sox6,antibodies |
R13853 | T19525 | T19530 | nsubj | antibodies,were |
R13854 | T19526 | T19525 | acl | used,antibodies |
R13855 | T19527 | T19526 | prep | in,used |
R13856 | T19528 | T19529 | det | this,study |
R13857 | T19529 | T19527 | pobj | study,in |
R13858 | T19530 | T19533 | auxpass | were,provided |
R13859 | T19531 | T19533 | preconj | either,provided |
R13860 | T19532 | T19533 | advmod | kindly,provided |
R13861 | T19533 | T19533 | ROOT | provided,provided |
R13862 | T19534 | T19533 | agent | by,provided |
R13863 | T19535 | T19537 | compound | Dr.,Lalli |
R13864 | T19536 | T19537 | compound | Enzo,Lalli |
R13865 | T19537 | T19534 | pobj | Lalli,by |
R13866 | T19538 | T19541 | punct | (,Pasteur |
R13867 | T19539 | T19541 | compound | Université,Pasteur |
R13868 | T19540 | T19541 | compound | Louis,Pasteur |
R13869 | T19541 | T19537 | appos | Pasteur,Lalli |
R13870 | T19542 | T19541 | punct | ",",Pasteur |
R13871 | T19543 | T19550 | nsubj | France,obtained |
R13872 | T19544 | T19546 | nmod | [,] |
R13873 | T19545 | T19546 | nummod | 7,] |
R13874 | T19546 | T19543 | nmod | ],France |
R13875 | T19547 | T19546 | punct | ),] |
R13876 | T19548 | T19543 | cc | or,France |
R13877 | T19549 | T19550 | advmod | commercially,obtained |
R13878 | T19550 | T19533 | conj | obtained,provided |
R13879 | T19551 | T19556 | punct | (,X |
R13880 | T19552 | T19553 | compound | Catalog,No |
R13881 | T19553 | T19556 | nmod | No,X |
R13882 | T19554 | T19556 | punct | .,X |
R13883 | T19555 | T19556 | compound | sc-17332,X |
R13884 | T19556 | T19550 | dobj | X,obtained |
R13885 | T19557 | T19556 | punct | ",",X |
R13886 | T19558 | T19559 | compound | Santa,Cruz |
R13887 | T19559 | T19560 | compound | Cruz,Biotechnology |
R13888 | T19560 | T19556 | conj | Biotechnology,X |
R13889 | T19561 | T19560 | punct | ",",Biotechnology |
R13890 | T19562 | T19563 | compound | Santa,Cruz |
R13891 | T19563 | T19560 | conj | Cruz,Biotechnology |
R13892 | T19564 | T19563 | punct | ",",Cruz |
R13893 | T19565 | T19563 | conj | California,Cruz |
R13894 | T19566 | T19565 | punct | ",",California |
R13895 | T19567 | T19568 | compound | United,States |
R13896 | T19568 | T19565 | conj | States,California |
R13897 | T19569 | T19550 | punct | ),obtained |
R13898 | T19570 | T19533 | punct | .,provided |
R13899 | T19571 | T19573 | det | All,antibodies |
R13900 | T19572 | T19573 | amod | Sox6,antibodies |
R13901 | T19573 | T19574 | nsubj | antibodies,generated |
R13902 | T19574 | T19574 | ROOT | generated,generated |
R13903 | T19575 | T19576 | amod | similar,results |
R13904 | T19576 | T19574 | dobj | results,generated |
R13905 | T19577 | T19574 | punct | .,generated |
R13906 | T19578 | T19579 | amod | c-Myc,antibody |
R13907 | T19579 | T19581 | nsubjpass | antibody,purchased |
R13908 | T19580 | T19581 | auxpass | was,purchased |
R13909 | T19581 | T19581 | ROOT | purchased,purchased |
R13911 | T19583 | T19582 | pobj | Invitrogen,from |
R13912 | T19584 | T19581 | punct | .,purchased |
R13913 | T19585 | T19588 | amod | Normal,antibody |
R13914 | T19586 | T19588 | compound | rabbit,antibody |
R13915 | T19587 | T19588 | compound | IgG,antibody |
R13916 | T19588 | T19590 | nsubjpass | antibody,obtained |
R13917 | T19589 | T19590 | auxpass | was,obtained |
R13918 | T19590 | T19590 | ROOT | obtained,obtained |
R13919 | T19591 | T19590 | prep | from,obtained |
R13920 | T19592 | T19593 | compound | Upstate,Biotechnology |
R13921 | T19593 | T19591 | pobj | Biotechnology,from |
R13922 | T19594 | T19596 | punct | (,Placid |
R13923 | T19595 | T19596 | compound | Lake,Placid |
R13924 | T19596 | T19593 | appos | Placid,Biotechnology |
R13925 | T19597 | T19596 | punct | ",",Placid |
R13926 | T19598 | T19599 | compound | New,York |
R13927 | T19599 | T19596 | npadvmod | York,Placid |
R13928 | T19600 | T19599 | punct | ",",York |
R13929 | T19601 | T19602 | compound | United,States |
R13930 | T19602 | T19599 | appos | States,York |
R13931 | T19603 | T19596 | punct | ),Placid |
R13932 | T19604 | T19590 | punct | .,obtained |
R14199 | T19985 | T19985 | ROOT | EMSA,EMSA |
R14200 | T19986 | T19985 | punct | .,EMSA |
R14201 | T19987 | T19989 | amod | Single-stranded,oligonucleotides |
R14202 | T19988 | T19989 | amod | complementary,oligonucleotides |
R14203 | T19989 | T19990 | nsubj | oligonucleotides,were |
R14204 | T19990 | T19990 | ROOT | were,were |
R14205 | T19991 | T19990 | acomp | annealed,were |
R14206 | T19992 | T19991 | cc | and,annealed |
R14207 | T19993 | T19991 | conj | end-labeled,annealed |
R14208 | T19994 | T19991 | prep | with,annealed |
R14209 | T19995 | T19998 | compound | [,ATP |
R14210 | T19996 | T19998 | compound | γ-32P,ATP |
R14211 | T19997 | T19998 | compound | ],ATP |
R14212 | T19998 | T19994 | pobj | ATP,with |
R14213 | T19999 | T19994 | prep | with,with |
R14214 | T20000 | T20002 | nummod | T4,kinase |
R14215 | T20001 | T20002 | compound | polynucleotide,kinase |
R14216 | T20002 | T19999 | pobj | kinase,with |
R14217 | T20003 | T19990 | punct | .,were |
R14218 | T20004 | T20006 | nsubjpass | EMSA,performed |
R14219 | T20005 | T20006 | auxpass | was,performed |
R14220 | T20006 | T20006 | ROOT | performed,performed |
R14221 | T20007 | T20006 | prep | with,performed |
R14222 | T20008 | T20009 | nummod | 5,μg |
R14223 | T20009 | T20007 | pobj | μg,with |
R14224 | T20010 | T20009 | prep | of,μg |
R14225 | T20011 | T20012 | amod | nuclear,proteins |
R14226 | T20012 | T20010 | pobj | proteins,of |
R14227 | T20013 | T20009 | prep | from,μg |
R14228 | T20014 | T20015 | compound | MEL,cells |
R14229 | T20015 | T20013 | pobj | cells,from |
R14230 | T20016 | T20015 | cc | or,cells |
R14231 | T20017 | T20018 | nummod | 3,μl |
R14232 | T20018 | T20015 | conj | μl,cells |
R14233 | T20019 | T20018 | prep | of,μl |
R14234 | T20020 | T20018 | prep | in,μl |
R14235 | T20021 | T20022 | amod | vitro-translated,Sox6 |
R14236 | T20022 | T20020 | pobj | Sox6,in |
R14237 | T20023 | T20009 | prep | along,μg |
R14238 | T20024 | T20023 | prep | with,along |
R14239 | T20025 | T20027 | det | the,lysate |
R14240 | T20026 | T20027 | compound | reticulocyte,lysate |
R14241 | T20027 | T20024 | pobj | lysate,with |
R14242 | T20028 | T20027 | prep | in,lysate |
R14243 | T20029 | T20030 | amod | binding,buffer |
R14244 | T20030 | T20028 | pobj | buffer,in |
R14245 | T20031 | T20009 | punct | :,μg |
R14246 | T20032 | T20034 | nummod | 100,NaCl |
R14247 | T20033 | T20034 | compound | mM,NaCl |
R14248 | T20034 | T20009 | appos | NaCl,μg |
R14249 | T20035 | T20034 | punct | ",",NaCl |
R14250 | T20036 | T20037 | nummod | 10,% |
R14251 | T20037 | T20038 | compound | %,glycerol |
R14252 | T20038 | T20034 | appos | glycerol,NaCl |
R14253 | T20039 | T20038 | punct | ",",glycerol |
R14254 | T20040 | T20041 | nummod | 200,ng |
R14255 | T20041 | T20050 | npadvmod | ng,poly |
R14256 | T20042 | T20044 | nmod | /,BSA |
R14257 | T20043 | T20044 | compound | μl,BSA |
R14258 | T20044 | T20050 | nmod | BSA,poly |
R14259 | T20045 | T20050 | punct | ",",poly |
R14260 | T20046 | T20047 | nummod | 50,ng |
R14261 | T20047 | T20050 | compound | ng,poly |
R14262 | T20048 | T20050 | compound | /,poly |
R14263 | T20049 | T20050 | compound | μl,poly |
R14264 | T20050 | T20009 | appos | poly,μg |
R14265 | T20051 | T20050 | punct | (,poly |
R14266 | T20052 | T20050 | appos | dI-dC,poly |
R14267 | T20053 | T20052 | punct | ),dI-dC |
R14268 | T20054 | T20052 | cc | or,dI-dC |
R14269 | T20055 | T20055 | ROOT | poly,poly |
R14270 | T20056 | T20057 | punct | (,dG-dC |
R14271 | T20057 | T20055 | appos | dG-dC,poly |
R14272 | T20058 | T20057 | punct | ),dG-dC |
R14273 | T20059 | T20055 | punct | ",",poly |
R14274 | T20060 | T20062 | nummod | 10,HEPES |
R14275 | T20061 | T20062 | compound | mM,HEPES |
R14276 | T20062 | T20055 | appos | HEPES,poly |
R14277 | T20063 | T20064 | punct | (,pH |
R14278 | T20064 | T20062 | parataxis | pH,HEPES |
R14279 | T20065 | T20064 | nummod | 7,pH |
R14280 | T20066 | T20064 | punct | ),pH |
R14281 | T20067 | T20064 | punct | ",",pH |
R14282 | T20068 | T20070 | nummod | 0.1,EDTA |
R14283 | T20069 | T20070 | compound | mM,EDTA |
R14284 | T20070 | T20064 | appos | EDTA,pH |
R14285 | T20071 | T20070 | punct | ",",EDTA |
R14286 | T20072 | T20074 | nummod | 0.25,DTT |
R14287 | T20073 | T20074 | compound | mM,DTT |
R14288 | T20074 | T20070 | appos | DTT,EDTA |
R14289 | T20075 | T20074 | punct | ",",DTT |
R14290 | T20076 | T20078 | nummod | 0.6,MgCl2 |
R14291 | T20077 | T20078 | compound | mM,MgCl2 |
R14292 | T20078 | T20074 | appos | MgCl2,DTT |
R14293 | T20079 | T20006 | punct | .,performed |
R14294 | T20080 | T20103 | prep | For,added |
R14295 | T20081 | T20080 | pobj | competition,For |
R14296 | T20082 | T20081 | cc | or,competition |
R14297 | T20083 | T20084 | compound | supershift,assays |
R14298 | T20084 | T20081 | conj | assays,competition |
R14299 | T20085 | T20084 | punct | ",",assays |
R14300 | T20086 | T20090 | det | the,competitor |
R14301 | T20087 | T20090 | amod | indicated,competitor |
R14302 | T20088 | T20090 | amod | unlabelled,competitor |
R14303 | T20089 | T20090 | compound | oligonucleotide,competitor |
R14304 | T20090 | T20084 | conj | competitor,assays |
R14305 | T20091 | T20090 | punct | (,competitor |
R14306 | T20092 | T20094 | amod | 200-fold,excess |
R14307 | T20093 | T20094 | compound | molar,excess |
R14308 | T20094 | T20090 | appos | excess,competitor |
R14309 | T20095 | T20090 | punct | ),competitor |
R14310 | T20096 | T20090 | cc | or,competitor |
R14311 | T20097 | T20090 | conj | antibody,competitor |
R14312 | T20098 | T20097 | punct | (,antibody |
R14313 | T20099 | T20100 | nummod | 3,μl |
R14314 | T20100 | T20097 | appos | μl,antibody |
R14315 | T20101 | T20097 | punct | ),antibody |
R14316 | T20102 | T20103 | auxpass | was,added |
R14317 | T20103 | T20103 | ROOT | added,added |
R14318 | T20104 | T20107 | quantmod | 30,60 |
R14319 | T20105 | T20107 | quantmod | min,60 |
R14320 | T20106 | T20107 | quantmod | to,60 |
R14321 | T20107 | T20103 | dobj | 60,added |
R14322 | T20108 | T20107 | quantmod | min,60 |
R14323 | T20109 | T20103 | advmod | prior,added |
R14324 | T20110 | T20103 | prep | to,added |
R14325 | T20111 | T20110 | pobj | addition,to |
R14326 | T20112 | T20111 | prep | of,addition |
R14327 | T20113 | T20114 | amod | radiolabeled,probe |
R14328 | T20114 | T20112 | pobj | probe,of |
R14329 | T20115 | T20103 | punct | .,added |
R14330 | T20116 | T20126 | prep | Following,incubated |
R14331 | T20117 | T20116 | pobj | addition,Following |
R14332 | T20118 | T20117 | prep | of,addition |
R14333 | T20119 | T20121 | det | the,probe |
R14334 | T20120 | T20121 | compound | radiolabeled,probe |
R14335 | T20121 | T20118 | pobj | probe,of |
R14336 | T20122 | T20126 | punct | ",",incubated |
R14337 | T20123 | T20124 | det | the,samples |
R14338 | T20124 | T20126 | nsubjpass | samples,incubated |
R14339 | T20125 | T20126 | auxpass | were,incubated |
R14340 | T20126 | T20126 | ROOT | incubated,incubated |
R14341 | T20127 | T20126 | prep | for,incubated |
R14342 | T20128 | T20129 | nummod | 30,min |
R14343 | T20129 | T20127 | pobj | min,for |
R14344 | T20130 | T20129 | cc | or,min |
R14345 | T20131 | T20132 | nummod | 60,min |
R14346 | T20132 | T20129 | conj | min,min |
R14347 | T20133 | T20132 | prep | at,min |
R14348 | T20134 | T20135 | compound | room,temperature |
R14349 | T20135 | T20133 | pobj | temperature,at |
R14350 | T20136 | T20132 | cc | and,min |
R14351 | T20137 | T20129 | acl | loaded,min |
R14352 | T20138 | T20137 | prep | on,loaded |
R14353 | T20139 | T20141 | det | a,% |
R14354 | T20140 | T20141 | nummod | 4,% |
R14355 | T20141 | T20138 | pobj | %,on |
R14356 | T20142 | T20141 | cc | or,% |
R14357 | T20143 | T20144 | nummod | 6,% |
R14358 | T20144 | T20141 | conj | %,% |
R14359 | T20145 | T20146 | punct | (,w/v |
R14360 | T20146 | T20144 | appos | w/v,% |
R14361 | T20147 | T20126 | punct | ),incubated |
R14362 | T20148 | T20149 | compound | polyacrylamide,gel |
R14363 | T20149 | T20149 | ROOT | gel,gel |
R14364 | T20150 | T20149 | punct | .,gel |
R14365 | T20151 | T20153 | nsubjpass | Electrophoresis,performed |
R14366 | T20152 | T20153 | auxpass | was,performed |
R14367 | T20153 | T20153 | ROOT | performed,performed |
R14368 | T20154 | T20153 | prep | at,performed |
R14369 | T20155 | T20158 | det | a,mAmp |
R14370 | T20156 | T20158 | amod | constant,mAmp |
R14371 | T20157 | T20158 | nummod | 19,mAmp |
R14372 | T20158 | T20154 | pobj | mAmp,at |
R14373 | T20159 | T20153 | prep | for,performed |
R14374 | T20160 | T20159 | pobj | 4,for |
R14375 | T20161 | T20162 | nummod | 8,h |
R14376 | T20162 | T20171 | nsubjpass | h,dried |
R14377 | T20163 | T20162 | prep | at,h |
R14378 | T20164 | T20165 | compound | room,temperature |
R14379 | T20165 | T20163 | pobj | temperature,at |
R14380 | T20166 | T20162 | punct | ",",h |
R14381 | T20167 | T20162 | cc | and,h |
R14382 | T20168 | T20169 | det | the,gels |
R14383 | T20169 | T20162 | conj | gels,h |
R14384 | T20170 | T20171 | auxpass | were,dried |
R14385 | T20171 | T20153 | conj | dried,performed |
R14386 | T20172 | T20171 | advmod | prior,dried |
R14387 | T20173 | T20172 | prep | to,prior |
R14388 | T20174 | T20173 | pobj | autoradiography,to |
R14389 | T20175 | T20171 | punct | .,dried |
R14390 | T20176 | T20177 | nsubj | Antibodies,used |
R14391 | T20177 | T20177 | ROOT | used,used |
R14392 | T20178 | T20177 | prep | for,used |
R14393 | T20179 | T20180 | compound | supershift,analyses |
R14394 | T20180 | T20178 | pobj | analyses,for |
R14395 | T20181 | T20177 | conj | included,used |
R14396 | T20182 | T20188 | nmod | c-Myc,antibodies |
R14397 | T20183 | T20182 | punct | ",",c-Myc |
R14398 | T20184 | T20182 | conj | HA,c-Myc |
R14399 | T20185 | T20184 | punct | ",",HA |
R14400 | T20186 | T20184 | cc | and,HA |
R14401 | T20187 | T20184 | conj | Sox6,HA |
R14402 | T20188 | T20181 | dobj | antibodies,included |
R14403 | T20189 | T20188 | punct | (,antibodies |
R14404 | T20190 | T20188 | acl | described,antibodies |
R14405 | T20191 | T20190 | prep | as,described |
R14406 | T20192 | T20191 | pcomp | above,as |
R14407 | T20193 | T20188 | punct | ),antibodies |
R14408 | T20194 | T20177 | punct | .,used |
R14409 | T20195 | T20197 | det | The,sequences |
R14410 | T20196 | T20197 | compound | DNA,sequences |
R14411 | T20197 | T20201 | nsubj | sequences,are |
R14412 | T20198 | T20197 | prep | of,sequences |
R14413 | T20199 | T20200 | det | the,oligonucleotides |
R14414 | T20200 | T20198 | pobj | oligonucleotides,of |
R14415 | T20201 | T20201 | ROOT | are,are |
R14416 | T20202 | T20203 | mark | as,follows |
R14417 | T20203 | T20201 | advcl | follows,are |
R14418 | T20204 | T20209 | punct | (,listed |
R14419 | T20205 | T20206 | advmod | only,forward |
R14420 | T20206 | T20209 | advmod | forward,listed |
R14421 | T20207 | T20209 | nsubjpass | oligos,listed |
R14422 | T20208 | T20209 | auxpass | are,listed |
R14423 | T20209 | T20201 | advcl | listed,are |
R14424 | T20210 | T20209 | punct | ),listed |
R14425 | T20211 | T20237 | punct | :,′ |
R14426 | T20212 | T20237 | prep | For,′ |
R14427 | T20213 | T20216 | det | the,probe |
R14428 | T20214 | T20216 | amod | 36-bp,probe |
R14429 | T20215 | T20216 | compound | WT,probe |
R14430 | T20216 | T20212 | pobj | probe,For |
R14431 | T20217 | T20237 | punct | :,′ |
R14432 | T20218 | T20221 | nummod | 5,′ |
R14433 | T20219 | T20221 | nummod | ′,′ |
R14434 | T20220 | T20221 | compound | AATGCAGAACAAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14435 | T20221 | T20237 | npadvmod | ′,′ |
R14436 | T20222 | T20223 | punct | (,MHB1556 |
R14437 | T20223 | T20221 | appos | MHB1556,′ |
R14438 | T20224 | T20223 | punct | ),MHB1556 |
R14439 | T20225 | T20237 | punct | ;,′ |
R14440 | T20226 | T20237 | prep | for,′ |
R14441 | T20227 | T20228 | amod | mutant,probe |
R14442 | T20228 | T20226 | pobj | probe,for |
R14443 | T20229 | T20228 | nummod | 1,probe |
R14444 | T20230 | T20228 | punct | (,probe |
R14445 | T20231 | T20228 | appos | M1,probe |
R14446 | T20232 | T20228 | punct | ),probe |
R14447 | T20233 | T20237 | punct | :,′ |
R14448 | T20234 | T20237 | nummod | 5,′ |
R14449 | T20235 | T20237 | nummod | ′,′ |
R14450 | T20236 | T20237 | compound | AACAAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14451 | T20237 | T20237 | ROOT | ′,′ |
R14452 | T20238 | T20239 | punct | (,MHB1644 |
R14453 | T20239 | T20237 | appos | MHB1644,′ |
R14454 | T20240 | T20239 | punct | ),MHB1644 |
R14455 | T20241 | T20253 | punct | ;,′ |
R14456 | T20242 | T20253 | prep | for,′ |
R14457 | T20243 | T20244 | amod | mutant,probe |
R14458 | T20244 | T20242 | pobj | probe,for |
R14459 | T20245 | T20244 | nummod | 2,probe |
R14460 | T20246 | T20244 | punct | (,probe |
R14461 | T20247 | T20244 | appos | M2,probe |
R14462 | T20248 | T20244 | punct | ),probe |
R14463 | T20249 | T20253 | punct | :,′ |
R14464 | T20250 | T20251 | nummod | 5,′ |
R14465 | T20251 | T20253 | compound | ′,′ |
R14466 | T20252 | T20253 | compound | AATGCAGAACAAAGGGTCAGAtgagTGTCTGCGAAG3,′ |
R14467 | T20253 | T20237 | conj | ′,′ |
R14468 | T20254 | T20253 | punct | (,′ |
R14469 | T20255 | T20253 | appos | MHB1648,′ |
R14470 | T20256 | T20253 | punct | ),′ |
R14471 | T20257 | T20253 | punct | ;,′ |
R14472 | T20258 | T20258 | ROOT | for,for |
R14473 | T20259 | T20260 | amod | mutant,probe |
R14474 | T20260 | T20258 | pobj | probe,for |
R14475 | T20261 | T20260 | nummod | 3,probe |
R14476 | T20262 | T20260 | punct | (,probe |
R14477 | T20263 | T20260 | appos | M3,probe |
R14478 | T20264 | T20260 | punct | ),probe |
R14479 | T20265 | T20258 | punct | :,for |
R14480 | T20266 | T20267 | nummod | 5,′ |
R14481 | T20267 | T20269 | compound | ′,′ |
R14482 | T20268 | T20269 | compound | AATGCAGtgccAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R14483 | T20269 | T20269 | ROOT | ′,′ |
R14484 | T20270 | T20269 | punct | (,′ |
R14485 | T20271 | T20269 | appos | MHB1650,′ |
R14486 | T20272 | T20269 | punct | ),′ |
R14487 | T20273 | T20237 | punct | .,′ |
R14776 | T20678 | T20679 | compound | ChIP,assay |
R14777 | T20679 | T20679 | ROOT | assay,assay |
R14778 | T20680 | T20679 | punct | .,assay |
R14779 | T20681 | T20682 | mark | As,described |
R14780 | T20682 | T20711 | advcl | described,treated |
R14781 | T20683 | T20682 | agent | by,described |
R14782 | T20684 | T20685 | compound | Nouzova,[ |
R14783 | T20685 | T20687 | nmod | [,] |
R14784 | T20686 | T20687 | nummod | 53,] |
R14785 | T20687 | T20683 | pobj | ],by |
R14786 | T20688 | T20682 | punct | ",",described |
R14787 | T20689 | T20682 | prep | in,described |
R14788 | T20690 | T20689 | pobj | brief,in |
R14789 | T20691 | T20711 | punct | :,treated |
R14790 | T20692 | T20711 | nsubjpass | Cells,treated |
R14791 | T20693 | T20692 | prep | from,Cells |
R14792 | T20694 | T20695 | compound | MEL,cells |
R14793 | T20695 | T20693 | pobj | cells,from |
R14794 | T20696 | T20695 | punct | (,cells |
R14795 | T20697 | T20699 | nummod | 4,107 |
R14796 | T20698 | T20699 | nummod | ×,107 |
R14797 | T20699 | T20695 | appos | 107,cells |
R14798 | T20700 | T20699 | punct | ),107 |
R14799 | T20701 | T20699 | cc | or,107 |
R14800 | T20702 | T20704 | amod | fetal,cells |
R14801 | T20703 | T20704 | compound | liver,cells |
R14802 | T20704 | T20711 | nsubjpass | cells,treated |
R14803 | T20705 | T20704 | prep | from,cells |
R14804 | T20706 | T20709 | nummod | three,mice |
R14805 | T20707 | T20709 | amod | 15.5-dpc,mice |
R14806 | T20708 | T20709 | compound | WT,mice |
R14807 | T20709 | T20705 | pobj | mice,from |
R14808 | T20710 | T20711 | auxpass | were,treated |
R14809 | T20711 | T20711 | ROOT | treated,treated |
R14810 | T20712 | T20711 | prep | with,treated |
R14811 | T20713 | T20714 | nummod | 1,% |
R14812 | T20714 | T20715 | compound | %,formaldehyde |
R14813 | T20715 | T20712 | pobj | formaldehyde,with |
R14814 | T20716 | T20711 | prep | for,treated |
R14815 | T20717 | T20718 | nummod | 10,min |
R14816 | T20718 | T20716 | pobj | min,for |
R14817 | T20719 | T20711 | prep | at,treated |
R14818 | T20720 | T20721 | nummod | 37,° |
R14819 | T20721 | T20722 | nummod | °,C |
R14820 | T20722 | T20719 | pobj | C,at |
R14821 | T20723 | T20711 | punct | ",",treated |
R14822 | T20724 | T20711 | conj | rinsed,treated |
R14823 | T20725 | T20724 | prep | in,rinsed |
R14824 | T20726 | T20729 | amod | ice-cold,Hanks |
R14825 | T20727 | T20728 | nummod | 1,× |
R14826 | T20728 | T20729 | compound | ×,Hanks |
R14827 | T20729 | T20733 | poss | Hanks,solution |
R14828 | T20730 | T20729 | case | ',Hanks |
R14829 | T20731 | T20733 | amod | balanced,solution |
R14830 | T20732 | T20733 | compound | salt,solution |
R14831 | T20733 | T20725 | pobj | solution,in |
R14832 | T20734 | T20733 | prep | with,solution |
R14833 | T20735 | T20736 | nummod | 0.1,% |
R14834 | T20736 | T20737 | compound | %,EDTA |
R14835 | T20737 | T20738 | nsubj | EDTA,containing |
R14836 | T20738 | T20734 | pcomp | containing,with |
R14837 | T20739 | T20740 | compound | protease,inhibitors |
R14838 | T20740 | T20738 | dobj | inhibitors,containing |
R14839 | T20741 | T20740 | punct | ",",inhibitors |
R14840 | T20742 | T20740 | acl | collected,inhibitors |
R14841 | T20743 | T20742 | agent | by,collected |
R14842 | T20744 | T20743 | pobj | centrifugation,by |
R14843 | T20745 | T20742 | prep | at,collected |
R14844 | T20746 | T20747 | nummod | 4,° |
R14845 | T20747 | T20748 | nummod | °,C |
R14846 | T20748 | T20745 | pobj | C,at |
R14847 | T20749 | T20748 | punct | ",",C |
R14848 | T20750 | T20724 | conj | resuspended,rinsed |
R14849 | T20751 | T20750 | prep | in,resuspended |
R14850 | T20752 | T20755 | det | a,buffer |
R14851 | T20753 | T20755 | compound | SDS,buffer |
R14852 | T20754 | T20755 | compound | lysis,buffer |
R14853 | T20755 | T20751 | pobj | buffer,in |
R14854 | T20756 | T20755 | acl | containing,buffer |
R14855 | T20757 | T20758 | compound | protease,inhibitors |
R14856 | T20758 | T20756 | dobj | inhibitors,containing |
R14857 | T20759 | T20750 | punct | ",",resuspended |
R14858 | T20760 | T20750 | cc | and,resuspended |
R14859 | T20761 | T20750 | conj | incubated,resuspended |
R14860 | T20762 | T20761 | prep | on,incubated |
R14861 | T20763 | T20762 | pobj | ice,on |
R14862 | T20764 | T20761 | prep | for,incubated |
R14863 | T20765 | T20766 | nummod | 10,min |
R14864 | T20766 | T20764 | pobj | min,for |
R14865 | T20767 | T20711 | punct | .,treated |
R14866 | T20768 | T20769 | amod | DNA-protein,complexes |
R14867 | T20769 | T20771 | nsubjpass | complexes,sonicated |
R14868 | T20770 | T20771 | auxpass | were,sonicated |
R14869 | T20771 | T20771 | ROOT | sonicated,sonicated |
R14870 | T20772 | T20771 | prep | to,sonicated |
R14871 | T20773 | T20776 | nummod | 200,bp |
R14872 | T20774 | T20773 | cc | and,200 |
R14873 | T20775 | T20773 | conj | 600,200 |
R14874 | T20776 | T20772 | pobj | bp,to |
R14875 | T20777 | T20771 | punct | .,sonicated |
R14876 | T20778 | T20783 | nsubjpass | One-tenth,set |
R14877 | T20779 | T20778 | prep | of,One-tenth |
R14878 | T20780 | T20781 | det | the,sample |
R14879 | T20781 | T20779 | pobj | sample,of |
R14880 | T20782 | T20783 | auxpass | was,set |
R14881 | T20783 | T20783 | ROOT | set,set |
R14882 | T20784 | T20783 | advmod | aside,set |
R14883 | T20785 | T20783 | prep | for,set |
R14884 | T20786 | T20787 | compound | input,control |
R14885 | T20787 | T20785 | pobj | control,for |
R14886 | T20788 | T20783 | punct | ",",set |
R14887 | T20789 | T20783 | cc | and,set |
R14888 | T20790 | T20792 | det | the,sample |
R14889 | T20791 | T20792 | amod | remaining,sample |
R14890 | T20792 | T20794 | nsubjpass | sample,precleared |
R14891 | T20793 | T20794 | auxpass | was,precleared |
R14892 | T20794 | T20783 | conj | precleared,set |
R14893 | T20795 | T20794 | prep | with,precleared |
R14894 | T20796 | T20797 | compound | protein,A-Sepharose |
R14895 | T20797 | T20795 | pobj | A-Sepharose,with |
R14896 | T20798 | T20800 | punct | (,Biosciences |
R14897 | T20799 | T20800 | compound | Amersham,Biosciences |
R14898 | T20800 | T20797 | appos | Biosciences,A-Sepharose |
R14899 | T20801 | T20800 | punct | ",",Biosciences |
R14900 | T20802 | T20800 | npadvmod | Piscataway,Biosciences |
R14901 | T20803 | T20802 | punct | ",",Piscataway |
R14902 | T20804 | T20805 | compound | New,Jersey |
R14903 | T20805 | T20802 | conj | Jersey,Piscataway |
R14904 | T20806 | T20805 | punct | ",",Jersey |
R14905 | T20807 | T20808 | compound | United,States |
R14906 | T20808 | T20802 | appos | States,Piscataway |
R14907 | T20809 | T20802 | punct | ),Piscataway |
R14908 | T20810 | T20794 | punct | .,precleared |
R14909 | T20811 | T20817 | prep | Following,split |
R14910 | T20812 | T20811 | pobj | preclearing,Following |
R14911 | T20813 | T20817 | punct | ",",split |
R14912 | T20814 | T20815 | det | the,samples |
R14913 | T20815 | T20817 | nsubjpass | samples,split |
R14914 | T20816 | T20817 | auxpass | were,split |
R14915 | T20817 | T20817 | ROOT | split,split |
R14916 | T20818 | T20817 | prep | into,split |
R14917 | T20819 | T20818 | pobj | thirds,into |
R14918 | T20820 | T20817 | punct | :,split |
R14919 | T20821 | T20822 | nummod | one,sample |
R14920 | T20822 | T20829 | nsubjpass | sample,treated |
R14921 | T20823 | T20822 | acl | treated,sample |
R14922 | T20824 | T20823 | prep | with,treated |
R14923 | T20825 | T20824 | pobj | anti-Sox6,with |
R14924 | T20826 | T20825 | punct | ",",anti-Sox6 |
R14925 | T20827 | T20828 | det | a,second |
R14926 | T20828 | T20829 | amod | second,treated |
R14927 | T20829 | T20817 | conj | treated,split |
R14928 | T20830 | T20829 | prep | with,treated |
R14929 | T20831 | T20832 | amod | normal,rabbit |
R14930 | T20832 | T20833 | compound | rabbit,IgG |
R14931 | T20833 | T20830 | pobj | IgG,with |
R14932 | T20834 | T20829 | punct | ",",treated |
R14933 | T20835 | T20829 | cc | and,treated |
R14934 | T20836 | T20838 | det | the,sample |
R14935 | T20837 | T20838 | amod | third,sample |
R14936 | T20838 | T20829 | conj | sample,treated |
R14937 | T20839 | T20838 | prep | without,sample |
R14938 | T20840 | T20839 | pobj | Ab,without |
R14939 | T20841 | T20829 | punct | .,treated |
R14940 | T20842 | T20844 | det | The,two |
R14941 | T20843 | T20844 | amod | last,two |
R14942 | T20844 | T20846 | nsubjpass | two,used |
R14943 | T20845 | T20846 | auxpass | were,used |
R14944 | T20846 | T20846 | ROOT | used,used |
R14945 | T20847 | T20846 | prep | as,used |
R14946 | T20848 | T20849 | amod | negative,controls |
R14947 | T20849 | T20847 | pobj | controls,as |
R14948 | T20850 | T20846 | punct | .,used |
R14949 | T20851 | T20853 | det | The,complexes |
R14950 | T20852 | T20853 | amod | chromatin-antibody,complexes |
R14951 | T20853 | T20855 | nsubjpass | complexes,eluted |
R14952 | T20854 | T20855 | auxpass | were,eluted |
R14953 | T20855 | T20855 | ROOT | eluted,eluted |
R14954 | T20856 | T20855 | punct | ",",eluted |
R14955 | T20857 | T20855 | cc | and,eluted |
R14956 | T20858 | T20860 | det | the,protein |
R14957 | T20859 | T20860 | compound | DNA,protein |
R14958 | T20860 | T20861 | compound | protein,cross-links |
R14959 | T20861 | T20863 | nsubjpass | cross-links,reversed |
R14960 | T20862 | T20863 | auxpass | were,reversed |
R14961 | T20863 | T20855 | conj | reversed,eluted |
R14962 | T20864 | T20863 | prep | with,reversed |
R14963 | T20865 | T20867 | nummod | 5,NaCl |
R14964 | T20866 | T20867 | compound | M,NaCl |
R14965 | T20867 | T20864 | pobj | NaCl,with |
R14966 | T20868 | T20863 | prep | at,reversed |
R14967 | T20869 | T20871 | nummod | 65,C |
R14968 | T20870 | T20871 | nummod | °,C |
R14969 | T20871 | T20868 | pobj | C,at |
R14970 | T20872 | T20863 | prep | for,reversed |
R14971 | T20873 | T20874 | nummod | 4,h. |
R14972 | T20874 | T20876 | compound | h.,DNA |
R14973 | T20875 | T20876 | compound | Input,DNA |
R14974 | T20876 | T20872 | pobj | DNA,for |
R14975 | T20877 | T20876 | cc | or,DNA |
R14976 | T20878 | T20879 | amod | immunoprecipitated,DNA |
R14977 | T20879 | T20876 | conj | DNA,DNA |
R14978 | T20880 | T20881 | auxpass | was,used |
R14979 | T20881 | T20863 | conj | used,reversed |
R14980 | T20882 | T20881 | prep | as,used |
R14981 | T20883 | T20884 | det | a,template |
R14982 | T20884 | T20882 | pobj | template,as |
R14983 | T20885 | T20884 | prep | in,template |
R14984 | T20886 | T20888 | det | the,reaction |
R14985 | T20887 | T20888 | compound | PCR,reaction |
R14986 | T20888 | T20885 | pobj | reaction,in |
R14987 | T20889 | T20863 | punct | .,reversed |
R14988 | T20890 | T20891 | compound | PCR,amplification |
R14989 | T20891 | T20897 | nsubjpass | amplification,performed |
R14990 | T20892 | T20891 | prep | of,amplification |
R14991 | T20893 | T20895 | det | the,promoter |
R14992 | T20894 | T20895 | amod | ɛy,promoter |
R14993 | T20895 | T20892 | pobj | promoter,of |
R14994 | T20896 | T20897 | auxpass | was,performed |
R14995 | T20897 | T20897 | ROOT | performed,performed |
R14996 | T20898 | T20897 | cc | and,performed |
R14997 | T20899 | T20897 | conj | yielded,performed |
R14998 | T20900 | T20902 | det | a,amplicon |
R14999 | T20901 | T20902 | amod | 172-bp,amplicon |
R15000 | T20902 | T20899 | dobj | amplicon,yielded |
R15001 | T20903 | T20902 | punct | ",",amplicon |
R15002 | T20904 | T20902 | amod | corresponding,amplicon |
R15003 | T20905 | T20907 | aux | to,− |
R15004 | T20906 | T20905 | pobj | nucleotides,to |
R15005 | T20907 | T20904 | xcomp | −,corresponding |
R15006 | T20908 | T20910 | quantmod | 31,+140 |
R15007 | T20909 | T20910 | quantmod | to,+140 |
R15008 | T20910 | T20907 | dobj | +140,− |
R15009 | T20911 | T20910 | prep | of,+140 |
R15010 | T20912 | T20914 | det | the,promoter |
R15011 | T20913 | T20914 | amod | ɛy,promoter |
R15012 | T20914 | T20911 | pobj | promoter,of |
R15013 | T20915 | T20916 | punct | (,primers |
R15014 | T20916 | T20914 | appos | primers,promoter |
R15015 | T20917 | T20922 | nmod | MHB1688,′ |
R15016 | T20918 | T20917 | punct | ",",MHB1688 |
R15017 | T20919 | T20920 | nummod | 5,′ |
R15018 | T20920 | T20922 | nmod | ′,′ |
R15019 | T20921 | T20922 | nummod | CGAAGAATAAAAGGCCACCA3,′ |
R15020 | T20922 | T20916 | dobj | ′,primers |
R15021 | T20923 | T20916 | punct | ;,primers |
R15022 | T20924 | T20916 | cc | and,primers |
R15023 | T20925 | T20916 | conj | MHB1689,primers |
R15024 | T20926 | T20925 | punct | ",",MHB1689 |
R15025 | T20927 | T20928 | nummod | 5,′ |
R15026 | T20928 | T20930 | compound | ′,′ |
R15027 | T20929 | T20930 | compound | GCTTCACCACCAACCTCTTC3,′ |
R15028 | T20930 | T20925 | conj | ′,MHB1689 |
R15029 | T20931 | T20930 | punct | ),′ |
R15030 | T20932 | T20897 | punct | .,performed |
R15031 | T20933 | T20935 | nsubjpass | PCR,performed |
R15032 | T20934 | T20935 | auxpass | was,performed |
R15033 | T20935 | T20935 | ROOT | performed,performed |
R15034 | T20936 | T20935 | prep | under,performed |
R15035 | T20937 | T20939 | det | the,conditions |
R15036 | T20938 | T20939 | amod | following,conditions |
R15037 | T20939 | T20936 | pobj | conditions,under |
R15038 | T20940 | T20939 | punct | :,conditions |
R15039 | T20941 | T20942 | nummod | 95,° |
R15040 | T20942 | T20943 | compound | °,C |
R15041 | T20943 | T20939 | appos | C,conditions |
R15042 | T20944 | T20943 | prep | for,C |
R15043 | T20945 | T20946 | nummod | 15,min |
R15044 | T20946 | T20944 | pobj | min,for |
R15045 | T20947 | T20939 | acl | followed,conditions |
R15046 | T20948 | T20947 | agent | by,followed |
R15047 | T20949 | T20950 | nummod | 30,cycles |
R15048 | T20950 | T20948 | pobj | cycles,by |
R15049 | T20951 | T20950 | prep | at,cycles |
R15050 | T20952 | T20951 | pobj | 95,at |
R15051 | T20953 | T20954 | nummod | °,C |
R15052 | T20954 | T20950 | conj | C,cycles |
R15053 | T20955 | T20947 | prep | for,followed |
R15054 | T20956 | T20955 | pobj | 30,for |
R15055 | T20957 | T20939 | appos | s,conditions |
R15056 | T20958 | T20935 | punct | ",",performed |
R15057 | T20959 | T20960 | nummod | 60,° |
R15058 | T20960 | T20961 | compound | °,C |
R15059 | T20961 | T20935 | npadvmod | C,performed |
R15060 | T20962 | T20935 | prep | for,performed |
R15061 | T20963 | T20962 | pobj | 30,for |
R15062 | T20964 | T20935 | dep | s,performed |
R15063 | T20965 | T20935 | punct | ",",performed |
R15064 | T20966 | T20935 | cc | and,performed |
R15065 | T20967 | T20969 | nummod | 72,C |
R15066 | T20968 | T20969 | compound | °,C |
R15067 | T20969 | T20935 | conj | C,performed |
R15068 | T20970 | T20969 | prep | for,C |
R15069 | T20971 | T20970 | pobj | 45,for |
R15070 | T20972 | T20969 | appos | s,C |
R15071 | T20973 | T20969 | punct | ",",C |
R15072 | T20974 | T20935 | advcl | ending,performed |
R15073 | T20975 | T20974 | prep | with,ending |
R15074 | T20976 | T20978 | det | a,extension |
R15075 | T20977 | T20978 | amod | final,extension |
R15076 | T20978 | T20975 | pobj | extension,with |
R15077 | T20979 | T20978 | prep | at,extension |
R15078 | T20980 | T20981 | nummod | 72,° |
R15079 | T20981 | T20979 | pobj | °,at |
R15080 | T20982 | T20978 | npadvmod | C,extension |
R15081 | T20983 | T20978 | prep | for,extension |
R15082 | T20984 | T20985 | nummod | 5,min |
R15083 | T20985 | T20983 | pobj | min,for |
R15084 | T20986 | T20935 | punct | .,performed |
R12562 | T17961 | T17961 | ROOT | In,In |
R12563 | T17962 | T17963 | compound | situ,hybridization |
R12564 | T17963 | T17961 | pobj | hybridization,In |
R12565 | T17964 | T17963 | punct | .,hybridization |
R12566 | T17965 | T17966 | compound | Antisense,probes |
R12567 | T17966 | T17968 | nsubjpass | probes,designed |
R12568 | T17967 | T17968 | auxpass | were,designed |
R12569 | T17968 | T17968 | ROOT | designed,designed |
R12570 | T17969 | T17970 | aux | to,murine |
R12571 | T17970 | T17968 | xcomp | murine,designed |
R12572 | T17971 | T17973 | amod | ɛy,nucleotides |
R12573 | T17972 | T17973 | compound | globin,nucleotides |
R12574 | T17973 | T17970 | dobj | nucleotides,murine |
R12575 | T17974 | T17970 | npadvmod | 509,murine |
R12576 | T17975 | T17970 | meta | 584,murine |
R12577 | T17976 | T17968 | punct | ;,designed |
R12578 | T17977 | T17968 | conj | βmaj,designed |
R12579 | T17978 | T17979 | compound | globin,nucleotides |
R12580 | T17979 | T17977 | dobj | nucleotides,βmaj |
R12581 | T17980 | T17979 | nummod | 458,nucleotides |
R11814 | T16898 | T16899 | amod | truncated,version |
R11815 | T16899 | T16904 | nsubj | version,construct |
R11816 | T16900 | T16899 | prep | of,version |
R11817 | T16901 | T16903 | det | the,overexpression |
R11818 | T16902 | T16903 | amod | Sox6,overexpression |
R11819 | T16903 | T16900 | pobj | overexpression,of |
R11820 | T16904 | T16904 | ROOT | construct,construct |
R11821 | T16905 | T16908 | punct | (,) |
R11822 | T16906 | T16908 | nmod | Sox6-ΔHMG-pcDNA3,) |
R11823 | T16907 | T16906 | nummod | .1,Sox6-ΔHMG-pcDNA3 |
R11824 | T16908 | T16904 | punct | ),construct |
R11825 | T16909 | T16910 | nsubj | that,lacks |
R11826 | T16910 | T16904 | ccomp | lacks,construct |
R11827 | T16911 | T16913 | det | the,domain |
R11828 | T16912 | T16913 | compound | HMG,domain |
R11829 | T16913 | T16915 | nsubjpass | domain,generated |
R11830 | T16914 | T16915 | auxpass | was,generated |
R11831 | T16915 | T16910 | ccomp | generated,lacks |
R11832 | T16916 | T16915 | punct | ",",generated |
R11833 | T16917 | T16918 | mark | as,described |
R11834 | T16918 | T16915 | advcl | described,generated |
R11835 | T16919 | T16918 | agent | by,described |
R11836 | T16920 | T16919 | pobj | others,by |
R11837 | T16921 | T16923 | nmod | [,] |
R11838 | T16922 | T16923 | nummod | 32,] |
R11839 | T16923 | T16920 | appos | ],others |
R11840 | T16924 | T16904 | punct | .,construct |
R11841 | T16925 | T16936 | nsubjpass | Mutagenesis,done |
R11842 | T16926 | T16925 | prep | of,Mutagenesis |
R11843 | T16927 | T16928 | compound | Sox/Sox6,consensus |
R11844 | T16928 | T16930 | nmod | consensus,sites |
R11845 | T16929 | T16930 | amod | binding,sites |
R11846 | T16930 | T16926 | pobj | sites,of |
R11847 | T16931 | T16930 | prep | of,sites |
R11848 | T16932 | T16934 | det | the,promoter |
R11849 | T16933 | T16934 | amod | ɛy,promoter |
R11850 | T16934 | T16931 | pobj | promoter,of |
R11851 | T16935 | T16936 | auxpass | were,done |
R11852 | T16936 | T16936 | ROOT | done,done |
R11853 | T16937 | T16936 | agent | by,done |
R11854 | T16938 | T16937 | pobj | PCR,by |
R11855 | T16939 | T16936 | punct | .,done |
R11856 | T16940 | T16941 | amod | Forward,primers |
R11857 | T16941 | T16951 | nsubj | primers,include |
R11858 | T16942 | T16941 | acl | used,primers |
R11859 | T16943 | T16944 | aux | to,generate |
R11860 | T16944 | T16942 | xcomp | generate,used |
R11861 | T16945 | T16950 | det | these,constructs |
R11862 | T16946 | T16950 | amod | mutagenized,constructs |
R11863 | T16947 | T16950 | compound | ɛy,constructs |
R11864 | T16948 | T16949 | compound | promoter,reporter |
R11865 | T16949 | T16950 | compound | reporter,constructs |
R11866 | T16950 | T16951 | nsubj | constructs,include |
R11867 | T16951 | T16951 | ROOT | include,include |
R11868 | T16952 | T16951 | punct | :,include |
R11869 | T16953 | T16967 | nummod | MHB1661,MHB1662 |
R11870 | T16954 | T16956 | punct | ",",′ |
R11871 | T16955 | T16956 | nummod | 5,′ |
R11872 | T16956 | T16967 | nmod | ′,MHB1662 |
R11873 | T16957 | T16958 | nummod | CCGCTCGAGAATGCAGTGCCAAGGGTCAGAACATTGTCTGCGAAG3,′ |
R11874 | T16958 | T16956 | appos | ′,′ |
R11875 | T16959 | T16960 | punct | (,− |
R11876 | T16960 | T16958 | appos | −,′ |
R13910 | T19582 | T19581 | prep | from,purchased |
bionlp-st-ge-2016-test-tees
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20377 | 9885-9903 | Protein | denotes | chromatin-antibody |
T20376 | 9798-9801 | Protein | denotes | IgG |
T20375 | 9756-9760 | Protein | denotes | Sox6 |
T19687 | 8575-8579 | Protein | denotes | Sox6 |
T19686 | 8567-8569 | Protein | denotes | HA |
T19685 | 8560-8565 | Protein | denotes | c-Myc |
T19684 | 7812-7816 | Protein | denotes | Sox6 |
T19683 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19515 | 7485-7504 | Protein | denotes | rabbit IgG antibody |
T19514 | 7432-7446 | Protein | denotes | c-Myc antibody |
T19513 | 7389-7393 | Protein | denotes | Sox6 |
T19512 | 7149-7153 | Protein | denotes | Sox6 |
T19254 | 7072-7092 | Protein | denotes | Sox6 coding sequence |
T19253 | 6864-6866 | Protein | denotes | HA |
T19252 | 6854-6859 | Protein | denotes | c-Myc |
T19251 | 6797-6801 | Protein | denotes | Sox6 |
T19250 | 6666-6670 | Protein | denotes | Sox6 |
T17954 | 4145-4152 | Protein | denotes | SPOT RT |
T17953 | 3673-3677 | Protein | denotes | Sox6 |
T17952 | 3592-3641 | Protein | denotes | murine ɛy globin nucleotides 509–584; βmaj globin |
T17418 | 2765-2780 | Protein | denotes | βmaj/min globin |
T17417 | 2675-2685 | Protein | denotes | βH1 globin |
T17416 | 2596-2603 | Protein | denotes | MHB1668 |
T17415 | 2586-2594 | Protein | denotes | ζ globin |
T17414 | 2506-2513 | Protein | denotes | MHB1666 |
T17413 | 2495-2504 | Protein | denotes | ɛy globin |
T17412 | 2366-2378 | Protein | denotes | globin genes |
T17411 | 2272-2283 | Protein | denotes | globin mRNA |
T17423 | 3471-3476 | Protein | denotes | GAPDH |
T17422 | 3168-3178 | Protein | denotes | GAPDH mRNA |
T17421 | 2904-2907 | Protein | denotes | Rad |
T17420 | 2900-2903 | Protein | denotes | Bio |
T17419 | 2895-2898 | Protein | denotes | ROX |
T16499 | 823-827 | Protein | denotes | SstI |
T16498 | 632-641 | Gene_expression | denotes | contained |
T16497 | 632-641 | Gene_expression | denotes | contained |
T16496 | 757-761 | Protein | denotes | pGL3 |
T16495 | 730-753 | Protein | denotes | firefly luciferase gene |
T16494 | 651-664 | Protein | denotes | HindIII sites |
T16493 | 642-646 | Protein | denotes | XhoI |
T16492 | 404-417 | Protein | denotes | ɛ globin gene |
T16491 | 339-344 | Protein | denotes | EcoRI |
T16490 | 193-202 | Protein | denotes | ɛy globin |
T16489 | 137-157 | Protein | denotes | ɛy proximal promoter |
T18895 | 6435-6439 | Protein | denotes | Sox6 |
T18894 | 6277-6284 | Protein | denotes | FuGENE6 |
T18303 | 4891-4896 | Protein | denotes | eosin |
T18302 | 4875-4886 | Protein | denotes | hematoxylin |
T18569 | 5348-5352 | Protein | denotes | Sox6 |
T16520 | 1975-2018 | Protein | denotes | mutagenized ɛy promoter reporter constructs |
T16519 | 1870-1874 | Protein | denotes | Sox6 |
T16518 | 1866-1869 | Protein | denotes | Sox |
T16517 | 1786-1791 | Negative_regulation | denotes | lacks |
T16516 | 1796-1806 | Protein | denotes | HMG domain |
T16515 | 1761-1765 | Protein | denotes | Sox6 |
T16514 | 1730-1734 | Protein | denotes | Sox6 |
T16513 | 1685-1696 | Positive_regulation | denotes | overexpress |
T16512 | 1685-1696 | Positive_regulation | denotes | overexpress |
T16511 | 1685-1696 | Gene_expression | denotes | overexpress |
T16510 | 1685-1696 | Gene_expression | denotes | overexpress |
T16509 | 1697-1701 | Protein | denotes | Sox6 |
T16508 | 1654-1658 | Protein | denotes | Sox6 |
T16507 | 1601-1608 | Protein | denotes | MHB1477 |
T16506 | 1587-1599 | Protein | denotes | HindIII site |
T16505 | 1461-1468 | Protein | denotes | MHB1507 |
T16504 | 1148-1157 | Protein | denotes | XhoI site |
T16503 | 1006-1016 | Gene_expression | denotes | expression |
T16502 | 995-1005 | Protein | denotes | luciferase |
T16501 | 845-854 | Protein | denotes | μLCRβ 9.3 |
T16500 | 828-832 | Protein | denotes | XhoI |
R11461 | T16493 | T16497 | themeOf | XhoI,contained |
R11462 | T16494 | T16498 | themeOf | HindIII sites,contained |
R11463 | T16502 | T16503 | themeOf | luciferase,expression |
R11464 | T16508 | T16510 | themeOf | Sox6,overexpress |
R11465 | T16509 | T16511 | themeOf | Sox6,overexpress |
R11466 | T16510 | T16512 | themeOf | overexpress,overexpress |
R11467 | T16511 | T16513 | themeOf | overexpress,overexpress |
R11468 | T16516 | T16517 | themeOf | HMG domain,lacks |
testone
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20330 | 10215-10217 | Protein | denotes | ɛy |
T20329 | 10110-10112 | Protein | denotes | ɛy |
T20328 | 9756-9760 | Protein | denotes | Sox6 |
T20327 | 9585-9594 | Protein | denotes | protein A |
T19635 | 8575-8579 | Protein | denotes | Sox6 |
T19634 | 8567-8569 | Protein | denotes | HA |
T19633 | 8560-8565 | Protein | denotes | c-Myc |
T19632 | 7908-7911 | Protein | denotes | BSA |
T19631 | 7812-7816 | Protein | denotes | Sox6 |
T19630 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19108 | 7072-7076 | Protein | denotes | Sox6 |
T19107 | 6864-6866 | Protein | denotes | HA |
T19106 | 6854-6859 | Protein | denotes | c-Myc |
T19105 | 6797-6801 | Protein | denotes | Sox6 |
T19104 | 6666-6670 | Protein | denotes | Sox6 |
T19395 | 7432-7437 | Protein | denotes | c-Myc |
T19394 | 7389-7393 | Protein | denotes | Sox6 |
T19393 | 7149-7153 | Protein | denotes | Sox6 |
T18697 | 6435-6439 | Protein | denotes | Sox6 |
T18696 | 6360-6362 | Protein | denotes | ɛy |
T18447 | 5348-5352 | Protein | denotes | Sox6 |
T17735 | 3673-3677 | Protein | denotes | Sox6 |
T17734 | 3630-3641 | Protein | denotes | βmaj globin |
T17733 | 3599-3608 | Protein | denotes | ɛy globin |
T17127 | 2256-2268 | Negative_regulation | denotes | Quantitation |
T17126 | 3471-3476 | Protein | denotes | GAPDH |
T17125 | 3168-3173 | Protein | denotes | GAPDH |
T17124 | 2770-2780 | Protein | denotes | min globin |
T17123 | 2765-2769 | Protein | denotes | βmaj |
T17122 | 2675-2685 | Protein | denotes | βH1 globin |
T17121 | 2586-2594 | Protein | denotes | ζ globin |
T17120 | 2495-2504 | Protein | denotes | ɛy globin |
T15960 | 1020-1026 | Positive_regulation | denotes | driven |
T15959 | 1006-1016 | Gene_expression | denotes | expression |
T15958 | 301-310 | Negative_regulation | denotes | silencing |
T15957 | 1906-1908 | Protein | denotes | ɛy |
T15956 | 1761-1765 | Protein | denotes | Sox6 |
T15955 | 1730-1734 | Protein | denotes | Sox6 |
T15954 | 1697-1701 | Protein | denotes | Sox6 |
T15953 | 1654-1658 | Protein | denotes | Sox6 |
T15952 | 1086-1088 | Protein | denotes | ɛy |
T15951 | 1034-1036 | Protein | denotes | ɛy |
T15950 | 995-1005 | Protein | denotes | luciferase |
T15949 | 907-909 | Protein | denotes | ɛy |
T15948 | 738-748 | Protein | denotes | luciferase |
T15947 | 693-695 | Protein | denotes | ɛy |
T15946 | 404-412 | Protein | denotes | ɛ globin |
T15945 | 294-295 | Protein | denotes | ɛ |
T15944 | 193-202 | Protein | denotes | ɛy globin |
T15943 | 137-139 | Protein | denotes | ɛy |
T15942 | 49-51 | Protein | denotes | ɛy |
R11066 | T15945 | T15958 | themeOf | ɛ,silencing |
R11067 | T15950 | T15959 | themeOf | luciferase,expression |
R11068 | T15959 | T15960 | themeOf | expression,driven |
test3
Id | Subject | Object | Predicate | Lexical cue |
---|---|---|---|---|
T20338 | 10215-10217 | Protein | denotes | ɛy |
T20337 | 10110-10112 | Protein | denotes | ɛy |
T20336 | 9756-9760 | Protein | denotes | Sox6 |
T20335 | 9585-9594 | Protein | denotes | protein A |
T20334 | 10215-10217 | Protein | denotes | ɛy |
T20333 | 10110-10112 | Protein | denotes | ɛy |
T20332 | 9756-9760 | Protein | denotes | Sox6 |
T20331 | 9585-9594 | Protein | denotes | protein A |
T19647 | 8575-8579 | Protein | denotes | Sox6 |
T19646 | 8567-8569 | Protein | denotes | HA |
T19645 | 8560-8565 | Protein | denotes | c-Myc |
T19644 | 7908-7911 | Protein | denotes | BSA |
T19643 | 7812-7816 | Protein | denotes | Sox6 |
T19642 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19641 | 8575-8579 | Protein | denotes | Sox6 |
T19640 | 8567-8569 | Protein | denotes | HA |
T19639 | 8560-8565 | Protein | denotes | c-Myc |
T19638 | 7908-7911 | Protein | denotes | BSA |
T19637 | 7812-7816 | Protein | denotes | Sox6 |
T19636 | 7691-7715 | Protein | denotes | T4 polynucleotide kinase |
T19118 | 7072-7076 | Protein | denotes | Sox6 |
T19117 | 6864-6866 | Protein | denotes | HA |
T19116 | 6854-6859 | Protein | denotes | c-Myc |
T19115 | 6797-6801 | Protein | denotes | Sox6 |
T19114 | 6666-6670 | Protein | denotes | Sox6 |
T19113 | 7072-7076 | Protein | denotes | Sox6 |
T19112 | 6864-6866 | Protein | denotes | HA |
T19111 | 6854-6859 | Protein | denotes | c-Myc |
T19110 | 6797-6801 | Protein | denotes | Sox6 |
T19109 | 6666-6670 | Protein | denotes | Sox6 |
T19401 | 7432-7437 | Protein | denotes | c-Myc |
T19400 | 7389-7393 | Protein | denotes | Sox6 |
T19399 | 7149-7153 | Protein | denotes | Sox6 |
T19398 | 7432-7437 | Protein | denotes | c-Myc |
T19397 | 7389-7393 | Protein | denotes | Sox6 |
T19396 | 7149-7153 | Protein | denotes | Sox6 |
T18701 | 6435-6439 | Protein | denotes | Sox6 |
T18700 | 6360-6362 | Protein | denotes | ɛy |
T18699 | 6435-6439 | Protein | denotes | Sox6 |
T18698 | 6360-6362 | Protein | denotes | ɛy |
T18449 | 5348-5352 | Protein | denotes | Sox6 |
T18448 | 5348-5352 | Protein | denotes | Sox6 |
T17741 | 3673-3677 | Protein | denotes | Sox6 |
T17740 | 3630-3641 | Protein | denotes | βmaj globin |
T17739 | 3599-3608 | Protein | denotes | ɛy globin |
T17738 | 3673-3677 | Protein | denotes | Sox6 |
T17737 | 3630-3641 | Protein | denotes | βmaj globin |
T17736 | 3599-3608 | Protein | denotes | ɛy globin |
T17141 | 3471-3476 | Protein | denotes | GAPDH |
T17140 | 3168-3173 | Protein | denotes | GAPDH |
T17139 | 2770-2780 | Protein | denotes | min globin |
T17138 | 2765-2769 | Protein | denotes | βmaj |
T17137 | 2675-2685 | Protein | denotes | βH1 globin |
T17136 | 2586-2594 | Protein | denotes | ζ globin |
T17135 | 2495-2504 | Protein | denotes | ɛy globin |
T17134 | 3471-3476 | Protein | denotes | GAPDH |
T17133 | 3168-3173 | Protein | denotes | GAPDH |
T17132 | 2770-2780 | Protein | denotes | min globin |
T17131 | 2765-2769 | Protein | denotes | βmaj |
T17130 | 2675-2685 | Protein | denotes | βH1 globin |
T17129 | 2586-2594 | Protein | denotes | ζ globin |
T17128 | 2495-2504 | Protein | denotes | ɛy globin |
T15994 | 1906-1908 | Protein | denotes | ɛy |
T15993 | 1761-1765 | Protein | denotes | Sox6 |
T15992 | 1730-1734 | Protein | denotes | Sox6 |
T15991 | 1697-1701 | Protein | denotes | Sox6 |
T15990 | 1654-1658 | Protein | denotes | Sox6 |
T15989 | 1086-1088 | Protein | denotes | ɛy |
T15988 | 1034-1036 | Protein | denotes | ɛy |
T15987 | 1020-1026 | Positive_regulation | denotes | driven |
T15986 | 1006-1016 | Gene_expression | denotes | expression |
T15985 | 995-1005 | Protein | denotes | luciferase |
T15984 | 907-909 | Protein | denotes | ɛy |
T15983 | 738-748 | Protein | denotes | luciferase |
T15982 | 693-695 | Protein | denotes | ɛy |
T15981 | 404-412 | Protein | denotes | ɛ globin |
T15980 | 294-295 | Protein | denotes | ɛ |
T15979 | 193-202 | Protein | denotes | ɛy globin |
T15978 | 137-139 | Protein | denotes | ɛy |
T15977 | 49-51 | Protein | denotes | ɛy |
T15976 | 1906-1908 | Protein | denotes | ɛy |
T15975 | 1761-1765 | Protein | denotes | Sox6 |
T15974 | 1730-1734 | Protein | denotes | Sox6 |
T15973 | 1697-1701 | Protein | denotes | Sox6 |
T15972 | 1654-1658 | Protein | denotes | Sox6 |
T15971 | 1086-1088 | Protein | denotes | ɛy |
T15970 | 1034-1036 | Protein | denotes | ɛy |
T15969 | 995-1005 | Protein | denotes | luciferase |
T15968 | 907-909 | Protein | denotes | ɛy |
T15967 | 738-748 | Protein | denotes | luciferase |
T15966 | 693-695 | Protein | denotes | ɛy |
T15965 | 404-412 | Protein | denotes | ɛ globin |
T15964 | 294-295 | Protein | denotes | ɛ |
T15963 | 193-202 | Protein | denotes | ɛy globin |
T15962 | 137-139 | Protein | denotes | ɛy |
T15961 | 49-51 | Protein | denotes | ɛy |
R11069 | T15985 | T15986 | themeOf | luciferase,expression |
R11070 | T15986 | T15987 | themeOf | expression,driven |
R13575 | T19116 | T19115 | themeOf | c-Myc,Sox6 |
R13576 | T19117 | T19115 | themeOf | HA,Sox6 |
R13934 | T19644 | T19643 | themeOf | BSA,Sox6 |