CORD-19:8d0766574126db767f1ed688326f3e7dbafcc35c JSONTXT 9 Projects

Paediatric infections P1231 Acute bacterial conjuctivitis in children P1232 Pertussis of adults and infants in Bulgarian population: role of PCR diagnosis Abstract Introduction: Acute bacterial conjunctivitis (ABC) is one of the most commonly ocular diseases in children examined by pediatricians at the outpatients Department. Since the treatment is usually empirical and prior cultures are not normally taken, the virulent factors involved in the process are often unidentified. Objectives: 1. To determine the incidence of the isolated pathogens from conjunctival exudates cultures and 2.To examine the antibiotic susceptibility for the efficacy of the therapy in the management of confirmed ABC in children. Methods: Conjunctival swabs were collected from 780 children, aged 1 month to 14 years old, who were attended with the diagnosis of ABC in our Children Hospital, during a 5-years period (2000)(2001)(2002)(2003)(2004). All bacteria were identified by classical microbiological methods and the antimicrobial susceptibility was performed according to NCCLS guidelines. Results: 453 cultures out of 780 ocular specimens were positive(58%). A total of 501 bacteria were isolated. The most frequent isolated bacteria were: Haemophilus influenzae (37.5%), Streptococcus pneumoniae (20%), Staphylococcus coagulase negative (CNS) (15.2%),and Staphylococcus aureus (14.8%) followed by Streptococcus viridans (4%), various Gram negative bacteria (3%), Moraxella catarrhalis (2.5%) and Haemophilus spp (1.6%).42 patients developed mixed cultures with two or more types of bacteria. Among 99 isolates of S. pneumoniae tested, were resistant for penicillin 14.1% and for gentamicin (Gm) and tobramycin (Tob) 45.4% and 49.5% respectively. Resistance to ampicillin was recovered in 9.5% of H. influenzae, of 66.6% of S. aureus and in 79.5% of CNS strains. Aminoglycosides showed higher resistance (Gm 17.9%, Tob 25.6%) against CNS isolates, in comparison to S. aureus (Gm 12%, Tob 14.6%) and H. influenzae strains (Gm 1.6%,Tob 2.6%) respectively. The most isolates were sensitive to chloramphenicol and ciprofloxacin. Conclusions: 1. The main pathogens causing ABC were H. influenzae and S. pneumoniae. 2. Chloramphenicol and ciprofloxacin showed favorable in vitro activity against the majority of pathogens. 3. Resistance rates indicate the need for continuous surveillance and for motoring studies. Pertussis of adults and infants in Bulgarian population: role of PCR diagnosis S. Panaiotov, V. Levterova, I. Ivanov, T. Kantardjiev, N. Vladimirova, V. Voinova, E. Kazarova (Sofia, BG) Pertussis continues to be an important vaccine preventable disease. There is a long lasting tradition in Bulgaria in pertussis prevention. More than 40 years a whole-cell pertussis vaccine is administered to infants and a high vaccine coverage is achieved and maintained. Pertussis morbidity decreased dramatically but pertussis continues to occur among different ages. Making a specific diagnosis of pertussis in patients with clinical evidence of infection is one of the many challenges presented by Bordetella pertussis. For more than 20 years, pertussis diagnosis in Bulgaria routinely is done using two classic lab methods: the direct fluorescent antibody test and the pertussis-agglutinating anti-body test. Recently ELISA method is introduced too but only for research purposes. Objectives: 1. To describe the PCR diagnosis of B. pertussis in our country and to present first results of this assay in pertussis suspect patients 2. To compare results between PCR diagnosis and direct fluorescent antibody test in the same patients. 3. To assess the role of Mycoplasma pneumoniae and Chlamidia pneumoniae as causatives of infants' respiratory infections misdiagnosed by the general practitioners as pertussis infection. Results: 334 nasopharyngeal swabs were collected from infants with pertussis symptoms and contact adults. All samples were tested by PCR. PCR was performed for insertion element IS481 of B. pertussis. 69 samples out of them were found positive for B. pertussis by PCR. Two were positive for M. pneumoniae by PCR.100 samples were tested comparatively by two methods :PCR and direct fluorescent antibody test. Vaccination status of patients and clinical data were analysed too. Conclusions: First results of B. pertussis PCR assay are presented. Pertussis continues to circulate in Bulgaria even the achieved high vaccine coverage of infants and children. PCR is rapid and simplifies the laboratory diagnosis of pertussis. Further serological, immunofluorescence or culture comparative studies are needed with the aim to better evaluate the role of PCR diagnosis. Molecular epidemiology of respiratory syncytial virus infection in a university hospital in Kuala Lumpur, Malaysia by using specific primers for each RSV group. Random Amplification of Polymorphic DNA (RAPD) technique was performed as a simple method to observe the genetic diversity of the isolated RSV. Results: Thirty NPA samples were positive for RSV using the DIF assay but only 20 samples were positive by tissue culture. The peak months are from the months of October to January for both years. Seminested PCR on RSV isolates revealed 17 cases of RSV Group A while the remaining three cases, RSV Group B. RAPD result suggested that there may be five main subgroups during the study period. Conclusion: This study confirmed RSV Group A as the more dominant group and may be more virulent in the Malaysian context. This is similar to most studies in other parts of the world. Intragroup variation occurs throughout the duration of the study. This variation may have a considerable effect of the efficiency of transmission and virulence. Restriction analysis study will be done in order to compare the isolates objectively with other studies. These findings can be used as part of the globally initiative towards vaccine development. Objective: To determine epidemiological characteristics, i.e. the occurrence of respiratory syncytial virus (RSV) infection in Croatian children with acute respiratory tract infections. Methods: At Virology Department, Croatian National Institute of Public Health (CNIPH), we tested nasopharyngeal secretions obtained from 1232 patients most of whom were hospitalized in two Zagreb hospitals for acute respiratory infections. Demonstration of the virus was by isolating it in cell culture and/or by detecting it with monoclonal antibodies in the direct immunofluorescence assay. Results: Most often, the virus demonstrated was RSV (43.8%; 540/1232). Other respiratory viruses (adeno, parainfluenza, influenza) were shown considerably less commonly (5.1%). Viral infection could not be demonstrated in 629 (51.1%) patients. As to bronchiolitis, RSV was demonstrated to be its most common cause (60.77%; 251/413). It was also proven to be the most common causative agent of infections in children aged 0-6 months (55.6%; 300/540). Bronchiolitis (63%; 190/300) and, less commonly, pneumonia (9.7%; 29/300) were the diagnoses linked with RSV in this age group. On the other hand, RSV was demonstrated in 21% (63/300) of the children diagnosed with upper respiratory tract infection (URTI). We showed the presence of the majority of RSV infections in winter months, i.e. between November and June. Conclusion: RSV is a common cause of lower respiratory tract infections in Croatian infants and young children with its annual outbreaks occurring in winter season. Their onset is mostly in November. Human metapneumovirus infection among children hospitalised with acute respiratory illness in Taiwan C.Y. Lin, J.S. Lin (Changhua, TW) Objectives: To understand the association of human metapneumovirus (hMPV) with acute respiratory infection (RI) among hospitalized children in Taiwan, we conducted this study. Methods: From February to August 2004, consecutive nasopharyngeal aspirates (NPAs) collected from children hospitalized with acute RI and submitted to a virology laboratory for rapid detection of respiratory syncytial virus (RSV) antigens were retrospectively analysed for hMPV. After extraction of nucleic acids from these frozen NPAs, RSV was first detected by amplifying RSV-specific fusion (F) and nucleocapsid (N) genes, respectively, using reverse transcription-polymerase chain reaction (RT-PCR). The same extracts were subsequently detected for hMPV by amplifying hMPV-specific F and N genes, respectively, using nested RT-PCR. If multiple samples during the same course of illness were submitted, either one of the virus-positive samples (first choice) or one of the virus-negative samples (second choice) was included for analysis to decrease a statistical bias. Results: 667 NPAs collected from 623 hospitalized children with acute RI were examined, however, only 580 NPAs of them had been successfully detected for both RSV and hMPV by RT-PCR. The age of patients ranged from 0 to 9 years. A positive rate of RSV or hMPV in NPAs was 39.1% (n = 227) and 8.6 (n = 50) respectively. In 353 NPAs negative for RSV, hMPV was found in 13.3% (n = 47) of samples. Only 2 NPAs (0.3%) were positive for both viruses. The infection rates of hMPV were significantly related to the month of recruitment (p = 0.001, Pearson Chi-squared test), with peak rates of 17.0% and 16.9% in May and June, respectively. According to the clinical diagnosis, 486 samples (83.8%) with pneumonia, bronchiolitis, bronchitis or brochopneumonia were arbitrarily defined to have a lower RI, otherwise, upper RI was recognized (16.2%, n = 94). Among NPAs negative for RSV, lower RI was significantly associated with hMPV when compared with upper RI (p = 0.034, Fisher's exact test). Conclusions: This preliminary study discloses that hMPV plays a role in Taiwanese children with acute RI with a comparable rate of infection as reported in western countries. hMPV infection in children may have seasonal preference as shown in this study, though a longer period of evaluation remains necessary. The rare co-infection of RSV and hMPV in children with acute RI implies the importance of hMPV detection especially in NPAs negative for RSV. Acute CMV infection in paediatric population P. Koudounis, M. Pagkalou, G. Triantafillou, P. Rozi (Serres, GR) Objectives: The aim of this study is the laboratory confirmation of acute CMV infection in children who have been hospitalized or have attended the Outpatient's Department with signs and symptoms that suggest recent CMV infection. Methods: Blood samples were taken from 66 children (40 boys and 26 girls), aged 9 months to 13 years, with symptoms suggesting recent CMV infection, from July 2002 to December 2003. They were tested for detection of CMV antibodies (IgM and IgG) by Microparticle Enzyme Immunoassay (AXSYM, ABBOTT) Enzyme linked Fluorescent Assay was used as a method of confirmation of the IgM positive tests. Also, the test of IgG-avidity was used as a supplementary means for the exclusion of a recent primary infection of less than 3 months (Vidas, bioMerieux). Results: Out of the total of 66 children examined, the 17 (group I) were found to be positive both for IgM and IgG antibodies, 3 (group II) were found to be positive only for IgM antibodies and 24 (group III) were found to be positive only for IgG antibodies. 22 children haven't been exposed to the disease (IgM-/IgG-). In group I children, with the use of the CMV-avidity test, the acute infection was excluded in 8 out of 17 children, a fact that was also confirmed with the second antibody detection test. In group II, 2 in 3 children were excluded in the same way, while in the other child acute infection was confirmed in the tests of confirmation. In group III, old infection was found with the CMV avidity test. Conclusion: Those results give us indicative information about the incidence of CMV infections in our hospital in the chronological period that is referred above. This study showed that the use of confirmation tests are necessary in several cases, especially those with unclear clinical and laboratory findings. The patterns of nasopharyngeal microflora in pre-school children with recurrent respiratory tract infections U. Kosikowska, I. Korona-Glowniak, R. Los, A. Biernasiuk, A. Malm (Lublin, PL) Objectives: Respiratory tract infections, predominantly of viral etiology, are the most common, community-acquired infections in young children. Some of them are complicated by bacterial infections usually of endogenous origin. The mucous membranes of nasopharynx are known to be the important reservoir of some opportunistic or potentially pathogenic bacteria. The aim of the present study was to compare the nasopharyngeal microflora in two groups of pre-school children -without or with the recurrent respiratory tract infections. Methods: Nasal and throat specimens were obtained from 225 children aged 3-5 years. The cotton swabs were immediately placed onto appropriate nonselective (blood agar) or selective media (Haemophilus chocolate agar, Chapman agar, McConkey agar or Sabouraud agar). Plates were incubated in an appropriate atmosphere -with or without increased CO 2 concentration) for 18-48 hrs at 35°C. The isolated microorganisms were identified on the basis of routinely methods (macroscopic, microscopic or biochemical assays) or by rapid commercial latex tests -Slidex Staph-Kit and Slidex Pneumo-Kit (bioMerieux). Results: The prevalence of potentially pathogenic bacteria typical for nasopharynx such as Staphylococcus aureus, Streptococcus pneumoniae, Moraxella catarrhalis or Haemophilus influenzae and also of yeast-like fungi (Candida sp., mostly C. albicans) was similar in both groups of children. However, in nasopharynx of children with the recurrent respiratory tract infections several opportunistic bacteria belonging to Enterobacteriaceae (Escherichia coli, Citrobacter freundii) or non-fermentative rods (Pseudomonas putida, Agrobacterium radiobacter, Acinetobacter lwoffii) were found. Also other bacteria such as slime-producing Bacillus sp. or streptomycetes were isolated from this group of children. Conclusion: The obtained data suggest that young children with the recurrent respiratory tract infections are predisposed for nasopharynx colonization by several opportunistic bacterial species of Gram-negative rods or even by some unusual microorganisms, e.g. slime-producing Bacillus sp. or streptomycetes. Objective: Establish a correlation between antimicrobial resistance in S. pneumoniae and H. influenzae, isolated from children with upper respiratory tract infection (URTI) in São Paulo, Brazil, and their history of antimicrobial use and/or vaccination. Methods: Samples (one per patient) were selected from patients under 7 years old between 2002 and 2004. All subjects were diagnosed with URTI and had a positive culture result for at least one of the selected pathogens (S. pneumoniae and H. influenzae). Clinical data related to age, gender, diagnosis and samples are described. S. pneumoniae isolates were tested against penicillin and another five antimicrobials for minimum inhibitory concentrations (MICs) by E-test methodology. Interpretative criteria used were those described by NCCLS document M100-S14. H. influenzae isolates were tested for betalactamase production by a chromogenic cephalosporin method. Logistic regression was performed to investigate the correlation between S. pneumoniae (intermediate and high) penicillin resistance and previous antimicrobial use and pneumococcal vaccination. The same procedure was done for beta-lactamase-positive H. influenzae and previous antimicrobial use and vaccination against H. influenzae type b (Hib). Results: Of patients with S. pneumoniae isolation, 62 had information on previous antibiotic use and 53 on pneumococcal vaccination. Of patients with H. influenzae isolation, 121 had information on previous antibiotic use and 101 on vaccination to H. influenzae. There was no correlation between presence of penicillin-resistant S. pneumoniae and previous antibiotic use (p = 0.16; OR = 2.28; IC95% = 0.73-7.16) or vaccination against pneumococci (p = 0.61; OR = 0.72; IC95% = 0.20-2.54). Similarly, no correlation was found between presence of betalactamase-producing H. influenzae and previous antibiotic use (p = 0.71; OR = 0.78; IC95% = 0.21-2.96) or Hib vaccination (p = 0.78; OR = 0.72; IC95% = 0.08-6.72). Conclusions: No correlation was found between antibiotic use and respective vaccinations against S. pneumoniae and Hib and their related resistance characteristics, penicillin resistance and beta-lactamase production respectively. However, among possible bias influencing the results, vaccination against both pathogens is still low in the study population and it was not possible to compare resistance and previous antimicrobial use by drug class. alone. The median age of patients with SCVs differed distinctly from the median age of patients with only NCVs [28.6 years (range, 2-45) vs. 19 years (range, 1-39) ]. Persistence of the SCVs could be demonstrated for all SCV-positive patients with subsequent microbiological investigation during the study period. An antibiotic prophylaxis with trimethoprim-sulfamethoxazol could be elicited for 7 (63.6%) of the 11 SCV-positive patients. All SCV isolates were resistant to trimethoprimsulfamethoxazol and high resistance rates were also documented for ciprofloxacin (53.8%) and gentamicin (46.2%). Analysis of the underlying auxotrophism revealed a predominance of thymidine dependence in 69.2% of the SCV isolates. Most of the SCVs showed the known fried-egg or pinpoint morphology, while 4 strains exhibited a mucous phenotype not previously observed. Conclusions: The presented data show that S. aureus SCVs can be isolated frequently and repeatedly from the airways of CF patients. Further investigations are required to illuminate the genetic background and pathogenic role of this S. aureus phenotype in persistent infections. Stenotrophomonas maltophilia (Sm) has been isolated from the airway secretions of children with Cystic Fibrosis (CF) with increasing prevalence last years. The aim of our study is to determine trends in prevalence and in resistance to the 1st choice antibiotics for these patients. Material and method: We reviewed retrospectively the clinical, demographic and laboratory data of the 388 patients who have been attended our hospital, between 01/2000 and 11/2004 for at least one year. During this period 5010 sputum or deep throat specimens were cultured. The identification of the isolates was made by the API 20NE identification system (Biomerieux, France) and the antibiotic resistance was determined with the E-test strips (AB Biodisk, Sweden). Results: (1) Sm has been harboured by 62 (16.0 %) of our patients (38 were female and 24 male). Chronically infected remained 11.3 % of them, while 59.7 % had only one positive culture for Sm. (2) The mean age of the 1st isolation of Sm was 8.3 ± 4.9 years. (3) The yearly incidence rate of Sm acquisition and the yearly prevalence were 2.8-3.6% and 4.7-9.2% respectively. (4) The sensitivity to ticarcillin/clavulanic acid as well as to co-trimoxazole were 59.3% and 62.6% respectively. Conclusions: (1)Yearly prevalence and incidence rates for Sm in CF patients showed no trends. (2)the resistance to ticarcillin/ clavulanic acid is gradually increasing. Objectives: A highly transmissible, epidemic strain of Pseudomonas aeruginosa is widespread among cystic fibrosis patients attending clinics in Liverpool, United Kingdom. We studied the emergence of clonal variants of this Liverpool Epidemic strain (LES) over time in chronically infected patients. Methods: Forty LES isolates from seven patients were typed by macrorestriction analysis of SpeI and XbaI-digested DNA by pulsed field gel electrophoresis (PFGE) . A total of 4 to 8 isolates from each patient were studied, collected at three different times during their colonisation (1995) (1996) (1997) (1998) (1999) (2000) (2001) (2002) (2003) . Macrorestriction fragment patterns were compared with the first LES in our collection isolated in 1988 and clonal variants had 1 to 3 band differences from this control strain. All isolates were tested positive with a PCR assay specific for LES. Results: PFGE analysis of SpeI and XbaI digests revealed 9 and 7 clonal variants of LES respectively. There was overall good correlation between SpeI and XbaI fragment patterns, however digestion with SpeI was more discriminatory in this study. All patients had clonal variants of LES (range 2-4). The variant with identical fragment pattern to the 1988 isolate was the most common and was isolated from all but one patient at least once. Two other variants were also common and were detected in three or more patients. Emergence of clonal variants in individual patients appeared to occur at random and did not persist throughout the study period in most of them. There was no correlation between clonal variants and phenotype or antibiotic sensitivity pattern of the isolates. Conclusion: Clonal variants of LES are common and were detected in all the patients. This study confirms that genomic diversity and evolution of a clonal lineage as indicated by subtle band shifts of the macrorestriction fragment pattern is common in chronically infected cystic fibrosis patients. In vitro effect of subMICs of antibiotics on the antigenic structure of Pseudomonas aeruginosa strains isolated from patients with cystic fibrosis J. Vranes, B. Bedenic, D. Tjesic-Drinkovic, N. Jarza-Davila (Zagreb, HR) Objectives: Pseudomonas aeruginosa is the leading pathogen responsible for morbidity and mortality in patients with cystic fibrosis (CF), and is the primary reason for the reduced survival age. Different molecules are responsible for P. aeruginosa virulence, including lipopolysaccharide (LPS) as a cellular component. Suppression or modulation of P. aeruginosa virulence factors may be an alternative strategy for treatment of lung infections in CF. The aim of this study was to examine the influence of subminimal inhibitory concentrations (subMICs) of ceftazidime and ciprofloxacin on the LPS structure of P. aeruginosa strains isolated from patients with CF. Methods: A total of 20 strains isolated from sputa of patients with CF were used. Serotyping based on the detection of heat stable LPS bacterial surface antigens (O-antigens) was performed as slide agglutination tests using O-specific polyclonal sera and a suspension of live bacterial isolate to be examined, according to the International Antigenic Typing System. Serotyping was performed before and after exposure of strains to 1/ 2, 1/4, 1/8, 1/16, and 1/32 MIC of antibiotics. Results: The slide agglutination test with polyclonal diagnostic sera showed that only nine strains were typable, while six strains were polyagglutinable, three strains were non-typable, and two strains were auto-agglutinable. After the exposure of strains in exponential phase of their growth to subMICs of antibiotics, a significant difference in typeability of the strains were observed. Treatment with subMICs of ceftazidime and ciprofloxacin resulted in the alteration of polysaccharide structure of typable strains. Out of nine monoagglutinable strains, seven strains have become auto-agglutinable after exposure to 1/2, 1/4, 1/8 and 1/16 MIC of ceftazidime, while two strains have become polyagglutinable, suggesting the loss of most of the O-antigenic determinants of the LPS. The polyagglutinability was observed more frequently after exposure of those strains to 1/2, 1/4 and 1/8 MIC of ciprofloxacin (five out of nine strains). The non-typable strains have become auto-agglutinable or polyagglutinable, depending on the concentration of antibiotic. Conclusion: The results of this study have shown that the antigenic structure of P. aeruginosa strains isolated from sputa of patients with CF was significantly changed after in vitro exposure to subMICs of ceftazidime and ciprofloxacin, due to the loss of O-antigenic determinants. Objectives: The asymptomatic colonisation by Pneumocystis jirovecii (Pc) has been recently demonstrated in immunocompetent patients, mainly in subjects with different pulmonary diseases. Cross-sectional studies have shown that healthy adults have frequently serum antibodies to Pneumocystis, and the primary contact usually occurs at an early age. However, the dynamic of the humoral immune response against this pathogen still remains unknown. The objective of this study was to evaluate the dynamic of antibody response to P. jirovecii in patients with cystic fibrosis (CF). Methods: (1) Population: Cohort study in which were included a total of 75 consecutive patients with CF, attended in a specialized unit between May 2001 and July 2002. Patients were followed every six months during one year. At each visit respiratory and serum samples were collected for Pc evaluation. (2)Methods: Nested PCR was performed in respiratory samples to detect the presence of Pc colonization. Serum specimens were assayed for total IgA/IgM/IgG antibodies to Pneumocystis antigens by western blot (WB). A commercial monoclonal antibody (MoAb) to a human Pc component (DAKO, Glostrup, Denmark) was used as a positive control. The presence of an immunoreactive band of 120 kDa (molecular weight of MoAb) was interpreted as a positive result. Results: The mean age of the CF patients was 16.4 ± 6.7 years (range: 1-35), 31 (41%) of whom were male. Pc carriage was found in 14/75 (18.7%) of the CF patients at baseline. During the follow-up Pc colonisation was observed in 36 (48%) of the 61 initially PCR-negative subjects. WB was positive at baseline in 37/75 (49%) of the patients with CF. During the follow-up serologic dynamic was as follows: among the 37 initially WBpositive subjects 32 (86%) remained positive, but in 5 (14%) cases a seroreversion was observed (WB became negative); among the 38 initially WB-negative subjects a seroconversion was observed in 20 (53%) cases and the remaining 18 (47%) were persistently negative. Conclusions: There is a high rate of Pneumocystis exposition in patients with cystic fibrosis. Contrary to previous belief, our results show for the first time that serologic response to P. jirovecii is not permanent, and that the presence of specific antibodies could be a result of repeated exposure to the pathogen. This study was supported by the Grants FIS 03/1743 and Consejería de Salud 32/02 and by Thematic Network for Joint Research (G03/90. Nosocomial infections in paediatric patients M. Renko, S. Kinnula, M. Uhari (Oulu, FIN) Background and aim: We evaluated the incidence of nosocomial infections occurring within 14 days after care at the paediatric infection ward of Oulu University Hospital between VI/2001 and V/2003 . Methods: At discharge from the hospital data on clinical diagnosis, aetiology of the infection, number of patients in the same room and whether or not the child got a nosocomial infection during the hospital stay were registered. Two weeks after the child was discharged the parents filled in a questionnaire concerning whether the child became ill after the discharge. Results: We have data from 1922 patients. Most of the patients (90%) were treated in a single patient room. The most common diagnoses were obstructive bronchitis in 437 (23%) and gastroenteritis in 566 (29%) cases. Twenty-three out of 1922 (1.3%) got a nosocomial infection during their stay at the ward, most of them gastroenteritis. Parents of 1136 patients (59%) returned the questionnaires. 313 children out of 1136 (28%) were taken ill after discharge, 88 (8%) of these within 72 hours. Cough was the most common symptom on those taken ill 4-14 days after discharge (53%), and diarrhoea on those taken ill within the first 72 hours (49%) (Figure) . The children who got nosocomial infections were younger than the other patients (mean 2.3 years, vs. others 3.0, P = 0.03) and the duration of the hospital care was longer in them (mean 3.6 vs 2.9 days, P = 0.005). Conclusions: Due to the short hospital care only a few children were reported to get a nosocomial infection during their stay. Yet, 8% of the children discharged from the ward were taken ill within 72 hours. Viruses causing gastroenteritis seem to be more difficult to prevent from spreading than respiratory viruses. plasma levels above 2 ng/ml on the 1st day after surgery (n = 28) were randomized into two groups. IgM-enriched immunoglobulin preparation (Pentaglobin, Biotest Pharma GmbH, Germany) was administrated to the patients in the study group (n = 15) in addition to standard treatment (1-3 days after surgery, 5 ml/kg each day). Patients in the control group (n = 13) received only standard treatment. Patients in both groups were comparable by severity of initial condition, age and CPB time. PCT blood plasma concentrations were measured on the 1st, 2nd, 3rd and 6th days after surgery by immunoluminometric method (PCT LIA, B.R.A.H.M.S Aktiengesellschaft GmbH, Germany). Post-op infections rates were analysed in these groups. The data were compared by Mann-Whitney U-test and p-value of (0.05 was considered statistically significant. Results: None of the patients had exhibited any signs of infection before surgery. Patients with PCT blood plasma levels less than 2 ng/ml on the 1st day after surgery (n = 3) had smooth post-op period. The rate of post-op infectious complications was significantly lower in the study group (1/15 (6.7%) vs. 5/13 (38.5%), p = 0.03). Two deaths in the control group occurred due to sepsis and (n = 1) and peritonitis (n = 1). Postoperative PCT levels were significantly higher in the control group during all observation period (see the table) . The data are expressed as median (ng/ml) and 25th and 75th percentiles. Conclusions: High PCT levels on the 1st day after surgery are associated with infectious complications. PCT monitoring allows to select patients with systemic bacterial inflammation after CPB. Early post-op administration of IgM-enriched immunoglobulins effectively prevents infectious complications in these patients after cardiac surgery. Clinical characteristics of rotavirus, enteric adenovirus and astrovirus infections among hospitalised children in Hungary Objectives: The aim of this study was to determine the prevalence, severity and clinical characteristics of viral gastroenteritis caused by astrovirus (HAstV), rotavirus (RV) or enteric adenovirus (EAd) resulting in hospitalization among children in Baranya County, Hungary. Methods: Stool specimens were collected between May 2003 and May 2004 from children hospitalized for gastroenteritis. Samples were tested for HAstV, RV, and EAd. HAstVs were detected by reverse transcriptase-polymerase chain reaction while RV and EAd were identified by latex agglutination test. Demographic and clinical data were collected for all enrolled children. Clinical symptoms and severity of illness were determined. Results: During this 1-year period, 227 children hospitalized for acute gastroenteritis were enrolled. The mean age was 37 months (range: 21 days to 213 months). HAstV, RV or EAd were detected in 51% of enrolled children. RV was detected in 94 (41%), EAd in 13 (6%) and HAstV in 12 (5%) from the collected stool samples. The most common clinical presentation of RV infected children were the combination of diarrhoea, vomiting and fever (34%), while in children with HAstV or EAd infection diarrhoea alone was more characteristic (50% and 62%, respectively). Children infected with either virus had diarrhoea lasting 1-4 days with 1-3 episodes per day, vomiting episodes lasted 1-2 days and fever ‡38.0°C. Based on the 20-point Vesikari severity score system; 58% of RV infected children had moderate or severe infection (score: ‡8) while 77% of children with EAd or 67% with HAstV had rather mild disease (score: £ 7); (p < 0.05). Conclusion: Clinical presentations of gastroenteritis by RV, HAstV or EAd are similar with diarrhoea the most common manifestation followed by vomiting and/or fever. RV infected patients had a more severe illness than those children infected with EAd or HAstV. Based on the epidemiological and clinical data we can conclude that these enteric viruses are a significant burden of disease based upon hospitalizations for childhood gastroenteritis in Baranya County, Hungary. Background: The neonatal gut normally becomes colonised with a variety of bacterial species. However, surgical intervention, nutritional deprivation and antibiotic therapy devastate the normal gastro-intestinal (GI) ecosystem and may contribute to the risk of bacterial translocation (BT). Intervention using probiotic bacteria or prebiotic carbohydrates has been proposed to reduce this problem but few studies have looked at the ability of probiotic bacteria to colonise the abnormal gut. Objectives: To demonstrate the persistence of probiotic bacteria demonstrate a biological effect using short chain fatty acid profiles. Methods: Conventional culture of stools and stoma fluid was performed on 5% Horse blood, neomycin blood agar and MacConkey agar Extended culture was performed using Rogosa agar for Lactobacillus spp. and Beeren's Agar for Bifidobacterium spp. Short Chain Fatty Acid (SCFA) Analysis was performed by Gas Liquid Chromatography Chromatography and Isolates of lactobacilli were genotyped using. Random Amplification of Polymorphic DNA (RAPD) using primer 272 a eubacterial primer followed by gel electrophoresis. Results: Routine bacterial culture on 320 specimens yielded Coagulase Negative Staphylococci (CNS), Enterococci and coliforms with Gram positive bacilli being isolated from only 7 specimens. On extended culture of 170 specimens Gram positive bacilli were isolated on 39 occasions. Short Chain Fatty Acid (SCFA) analysis showed that no patient samples demonstrated a SCFA profile similar to a healthy breastfed infants. In one patient studied longitudinally a change of diet along with administration of a probiotic resulted in a change in the fatty acid profile from being predominantly octanoic acid to proprionic acid. RAPD analysis showed that a lactobacillus indistinguishable from the probiotic strain could be isolated from the faeces of one patient throughout the period of probiotic administration. Conclusions: This pilot study confirms the potential for SCFA analysis to detect changes as a result of pre and probiotic dietary supplements and the RAPD method used successfully discriminated between the Lactobacillus spp investigated. Further work needs to be done in this area in particular the on resolution of RAPD and whether other DNA-based methodologies e.g. FISH may further improve the detection of specific probiotic strains and allow greater understanding of the effects detected by SCFA analysis. Children's urinary pathogens: one-year survey in a Greek hospital P1249 Antimicrobial susceptibility of urinary pathogens: comparison between paediatric and paediatric surgical units E. Iosifidis, E. Farmaki, C. Antachopoulos, D. Sofianou, E. Roilides (Thessaloniki, GR) Objectives: Urinary tract infections (UTI) are usually treated empirically before results of urine cultures are available. Periodic evaluation of antimicrobial susceptibility of the causative microorganisms is warranted due to the emerging bacterial resistance. Purpose of this study was to review current antimicrobial susceptibility patterns of pathogens causing UTI and compare them between paediatric (PU) and paediatric surgical (PSU) in a tertiary care hospital. Methods: Retrospective analysis of microbiology records on bacterial isolates from urine cultures of children with UTI admitted in two PU and one PSU in Hippokration Hospital during 2002-03. Identification and susceptibility testing were performed using the Vitek 2 automated system (bioMerieux, France). Results: A total of 369 isolates were reviewed from 270 children. The distribution of Escherichia coli (E. coli) varied significantly between PU and PSU (69.4% vs 29.6%, p <0.0001). Susceptibility rates of E. coli varied (p ( 0.006) among isolates from PU and PSU in amikacin (AM, 99 vs 62%), ampicillin (54 vs 15%), trimethoprim/sulfamethoxazole (S/T, 71 vs 35%), cefalothin (66 vs 19%) and ceftazidime (TAZ, 95 vs 39%), respectively. On the other hand, there were no significant differences between PU and PSU for cefoxitin (96% each), amoxicillin/clavulanate (84 vs 73%), nitrofurantoin (96 vs 92%) and ciprofloxacin (CIP, 100 vs 96%). In addition, 4% of E. coli isolates in PU and 54% in PSU had the phenotype of extended-spectrum a-lactamase (ESBL) producers. Other common pathogens were Pseudomonas aeruginosa (PSA), Klebsiella pneumoniae (KPN) and Enterobacter cloacae (ECL). Most PSA isolates were susceptible to AM, TAZ, piperacillin/tazobactam, ticarcillin and imipenem (IMI) in both departments (74-100%). Susceptibility rates of KPN and ECL in patients from PU were significantly higher than those in PSU (p < 0.05) for AM, TAZ and S/T, but there was no difference for IMI and CIP ((95%). Conclusions: Resistance of E. coli isolates from PU and particularly PSU to common antimicrobials and the presence of ESBLproducing strains are of concern. The increased resistance rates of all common isolates in PSU patients should be highlighted. Continuous evaluation of antimicrobial susceptibility patterns of uropathogens is necessary to ascertain optimal empiric therapy. Prevalence of vaginal pathogens in childhood and adolescence R. Kourkouli, S. Baka, E. Kouskouni (Athens, GR) Objective: The microbiology of the female genital tract is a complex entity always found in a dynamic situation. In children and adolescents normal flora cannot be easily defined. The purpose of this study was to assess the prevalence of pathogens in vaginal cultures obtained from children presenting to our hospital. Methods: Between January 2003 and October 2004 we examined 227 vaginal cultures from an equal number of symptomatic non-sexually active young girls (mean age 8.5 years, range 5-14 years). Vaginal secretions were inoculated onto culture plates and were incubated in aerobic and anaerobic conditions for 24 and 48 h, respectively. Isolation, identification and susceptibility to antibiotics were carried out under standard conditions using the VITEK System ATB Expression (Bio-Merieux, France). For the detection of Mycoplasma hominis each specimen was inoculated on DNA agar and then incubated in anaerobic conditions for 48 h whereas Ureaplasma urealyticum was identified by urease production using urea broth. Results: Our results show that out of 227 young girls 146 (64.3%) had positive cultures, 69 (30.4%) had negative cultures for pathogens and in 12 cases (5.2%) there was no growth on the plates whatsoever. Of the 146 positive cultures we isolated 179 pathogens: 29.6% anaerobic bacteria, 22.9% Streptococci, 16.8% Ureaplasma urealyticum, 13.4% Gram-negative rods, 13.4% Gardnerella vaginalis, 3.3% Staphylococci and 0.6% Mycoplasma hominis. Conclusions: Distinguishing pathogenic isolates from nonpathogenic ones is not a simple task in children and adolescents. The Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 most commonly isolated pathogens were anaerobic bacteria and streptococci. The prevalence of Ureaplasma urealyticum in our study group was high. Since our results indicate the involvement of Ureaplasma urealyticum in young girls' vulvovaginitis a routine examination for this pathogen is suggested. Fever in infants less than three months of age M. Christodoulaki, F. Barabouti, V. Makri, D. Athanasopoulos, E. Kataki, E. Balomenaki (Chania, GR) Objective: Management of febrile infants younger than 3 months of age is a difficult challenge for pediatricians because of the relatively high prevalence of serious bacterial infection. The purpose of this study was to evaluate the clinical characteristics, management and infectious outcomes of febrile infants aged 1 to 3 months. Methods: We reviewed 153 cases of febrile infants (rectal temperature ‡ 38°C) 29-90 days old who admitted to our hospital during the period 2002-2003. Infants were considered as low risk for serious bacterial infection if they met the following (Rochester) criteria: (1) appear well; (2) were previously healthy; (3) have no focal infection; (4) have white blood cell (WBC) count 5000-15,000/mm 3 , band form count £1500/ mm 3 , £ 10 WBC per high power field on microscopic examination of urine sediment, and £ 5 WBC per high power field on microscopic examination of a stool smear (if diarrhoea). The remaining infants were classified as being at high risk group. Serious bacterial infection was defined as a positive culture of blood, urine, cerebrospinal fluid, stool or any aspirated specimen. Results: Of 153 infants that were studied, 89 (58%) were boys and 64 (42%) were girls. 71 (46.4%) of all infants classified as being at low risk group and 82 (53.6%) as being at high risk group. The overall incidence of serious bacterial infection was 34% (53 patients): 32 infants (60.3%) had a urinary tract infection; 14 (26.4%) bacteraemia; 5 (9.4%) meningitis; 1 (1.8%) bacterial enteritis and 1 (1.8%) pneumonia. Antibiotics administered in 85 infants (55.5%). The mean duration of hospitalization was 7.8 (4-14) days. All infants had good outcome except of one infant with meningitis who was transferred to intensive care unit because of refractory seizures. Only 4 (5.6%) of the infants in the low risk group had a serious infection, compared with 49 (55.5%) of the infants in the high risk group (p < 0.0001). None of the infants in the low risk group had bacteraemia. Conclusion: Infants younger than three months of age with fever who meet the low risk criteria are unlikely to have serious bacterial infection. This probability forms a basis for well founded decisions in the management of the individual febrile infants. Objective: The frequency, relative enlarged, in the new born and toddler, of the respiratory system's infections, accompanied by morpho-functional alterations of the excretory renal system and/or of the suprarenal glands, draw attention on the knowledge of the structural particularities of those systems that can become a risk factor in the prognostic of the infections' evolutions. It is known that the morphogenesis of those systems is incomplete in the moment of the birth and that it continues long time post partum. We proposed to ourselves to evaluate the morpho-differentiation of the functional structures from the respiratory, renal excretory in order to know the potentialities of evolution and/or extension of the inflammatory processes. Methods: The lung and kidney fragments, harvested from 15 new born and 10 toddlers deceased by cardio-respiratory insufficiency, were fixed using formaldehyde 1% at the pH 7.5. The sections made after the paraffin inclusion, were colored with HE, Van Gieson, Gö mö ri and PAS stains. Results: In the serial sections' analysis of the new born's lung, we noticed the presence of the "terminal bags" (synonym with "pulmonary alveoli"), with entoblastic origin, lined by a cylindrical epithelium and here and there cubical. On the sections realized on the new born kidney we noticed a structural heterogeneity of the renal cortex, due to the presence pf the intermediary stages in genesis of the 'excretory unities of the metanephros'. In the extracellular matrix, surrounding the renal corpuscle partially differentiated, we found an enlargement of the heparin-sulfate proteoglycans' quantities. Conclusions: The identification in new born's lungs and kidneys of the functional structures, still in differentiation shows that those organs are reactional instability sources to the infectious aggressions. The influence of severe early-onset infections on dynamic changes of serum gastrin concentration in full-term and pre-term neonates significantly higher than in infected prematures without these symptoms. In second determination, the mean s.g.c. in full-term infected neonates with alimentary tract disorders (79.09 ± 22.37) was lower (p < 0.005) than in full-term neonates without such disorders (114.47 ± 31.56) . Conclusion: The dynamic changes in serum gastrin concentration in course of severe early-onset neonatal infections, observed in first month of life, both in full-term and preterm newborns, indicate its function on alimentary tract disorders. Objectives: Infections caused by Gram(+) flora are a major cause of morbidity in patients with haematological conditions associated with neutropenia. Although vancomycin is often indicated for these infections, it is associated with infusionrelated reactions and renal toxicity. This study was to evaluate the efficacy and tolerability of linezolid, the first member of a new class of antibacterial agents, oxazolidinones, in the treatment of infectious complications in oncohematological patients. Methods: This was a retrospective analysis based on data from 46 paediatric patients (age 8 mo to 16 y) with haematological conditions. Linezolid 10 mg/kg bid was administered by 1-h intravenous infusion, always as a component of combined antibacterial therapy (ceftazidime, cefepim or carbapenem with or without amikacin). Indications for antibacterial therapy included fever of unknown origin in neutropenic patients, soft tissue infection, mucositis, enterocolitis, catheter related infections, pneumonia, osteomyelitis, urinary tract infection and subhepatic abscesses. Microbiological samples were taken before the start of therapy and repeated on days 7 and 14 of treatment if the results were positive. Results: A total of 50 courses of linezolid were delivered. The mean duration of therapy was 9 days (5-106 days). Clinical response to therapy was observed in 76% (38/50) of courses, including complete resolution of the symptoms in 68% (34/50) of courses and eradication of Gram(+) organisms in patients with mixed fungal and bacterial infection in 8% (4/50) of courses. Clinical response was achieved in 70% (26/37) of empirical therapy courses. In courses with documented Gram(+) infection, eradication was 100% (13/13). Complete resolution of symptoms was achieved in 50% (8/16) and improvement in 19% (3/13) of courses in patients who were switched to linezolid following ineffective vancomycin therapy. Only 1 (2%) course of linezolid therapy had to be discontinued due to exacerbation of cytopenia in a child with acquired severe aplastic anemia. Conclusions: This is the first study assessing the efficacy and tolerability of linezolid in children with infectious complications of oncohematological diseases. Linezolid was highly effective when used as a component of empirical therapy of the febrile neutropenia. Haematological toxicity of linezolid was low, even when baseline suppression of hemopoiesis was present, allowing full compliance with treatment schedule. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 amoxicillin and ciprofloxacin) increased from 51 to 82 DDD/ 100PD, mainly explained by the rise of cefuroxime (share from 6 to 58% of total oral drugs). The IV drugs decreased from 156 to 140 DDD/100 PD and total antibiotics consumption was slightly increased (207 DDD/100 PD in 2001 versus 222 DDD/100 PD in 2003 . Broad spectrum antibiotics use decreased (133 to 85 DDD/ 100 PD), mainly due to decrease in AC and ceftriaxone which went down from 17.4 to 9.3 DDD/100 PD. Conclusion: 1. Antibiotics use analysis showed adherence to new CAP guidelines with change in ceftriaxone, AC, cefuroxime and penicillin prescription pattern. 2. Oral drugs increased and IV antibiotics decreased. 3. Broad spectrum drugs decreased and narrow spectrum ones increased. These data provide interesting information feedback for all hospital physicians and should encourage the implementation of more concerted guidelines. Determinants of under-and overuse of antibiotics in primary care patients with acute otitis media Objectives: In the Netherlands, antibiotic prescribing rates for acute otitis media (AOM) are very low compared to other countries. Some publications suggested a relation between decline in antibiotic use and a rise in complications of respiratory tract infections. Therefore it is important to study not only overprescription but also underprescription of antibiotics, and which clinical factors are associated with both phenomena. Thus, a study was undertaken to assess the appropriateness of antibiotic treatment in AOM in a low prescribing country like the Netherlands and to assess clinical patient characteristics that cause both under-and overprescribing of antibiotics in cases of AOM. Methods: During four weeks in the winter of 2002/2003, 146 Dutch GPs in the middle region of the Netherlands included all patients with acute ear complaints. They registered patient demographics, clinical presentation (signs and symptoms), severity of illness, whether they thought patients expected antibiotic treatment, diagnosis and management. Using key issues of current guidelines on AOM as benchmark, we assessed the appropriateness of antibiotic prescribing in cases of AOM. In addition, we assessed the association between clinical patient characteristics and under-or overprescribing of antibiotics in cases of AOM. Results: In seven out of ten patients with acute ear complaints antibiotic treatment was according to the guidelines. In 17% of all consultations antibiotics were indicated but not prescribed (underprescribing) and in 12% antibiotics were not indicated but prescribed (overprescribing). The lower the GP assessed the severity of illness, if there was no worsening since the previous contact, if the duration of symptoms prior to the consultation was short, or if the patient had only one inflammation sign, more underprescribing occurred. If the GP assessed a high severity of illness, if the patient was coughing, or if the GP thought the patient expected an antibiotic, then the GP prescribed more often antibiotics without indication (overprescribing). Conclusion: Both incorrect interpretation of signs and symptoms and perceived expectation of patients were correlated with incorrect antibiotic management in acute otitis media. Clarithromycin, a good alternative to tetracyclines, in the treatment of Mediterranean spotted fever in children. A randomised trial E. Antó n, T. Muñ oz, B. Font, M.D. Ferrer, I. Sanfeliu, F. Segura (Sabadell, E) Background: In vitro and in vivo studies demonstrated the high efficacy of doxycycline in the treatment of MSF. However, it is convenient to have another alternatives available for patients who are allergic to tetracyclines, pregnant, or for children under 8 years. Based on good results in vitro we considered of interest to evaluate the clinical efficacy of clarithromycin in the treatment of MSF. Methods: Randomized therapeutic study . Group A received clarithromycin 500 mg/12 h for 5 days in adults and 15 mg/kg/12 h for 5 days in children. Group B received the treatment of choice which was, doxycycline (200 mg/12 h for 1 day) in adults and doxycycline (5 mg/kg/12 h for 1 day) or josamycin (50 mg/kg/12 h for 5 days) in children. Inclusion criteria: patients who had the compatible clinical with MSF and the presence of the primary lesion (tache noire) or a positive serology against R. conorii. Exclusion criteria: patients who had received effective antibiotic treatment or whose symptoms appeared 8 or more days before enrolment in the study. Results: There were randomized 48 patients. There were excluded 14 patients, 10 from group A and 4 from group B. 34 patients were evaluated. 20 males. Mean age: 38.4 years. 12 were under 14 years. 33 patients presented fever. The exanthema was presented in 30 cases. The tache noire was observed in 29 cases. The diagnosis was confirmed by serology in 31 cases. 14 patients received clarithromycin (group A) and 20 doxycycline or josamycin (group B) . The interval between the onset of the symptoms and the start of treatment was 3.6 ± 2.2 days in group A and 3.6 ± 1.9 days in group B (p = NS). The time taken for disappearance of the fever after treatment was 2.57 ± 1.7 days in group A vs 2.19 ± 1.4 days in group B (p = NS). The symptoms had disappeared at 4.35 ± 2.5 days in group A vs 4.52 ± 3.4 days in group B (p = NS). There were no adverse reactions to the treatment or relapses in either group. Conclusion: Clarithromycin could be considered as an alternative in the treatment of MSF. Objectives: Many questions remain unanswered about the fate of antibiotic resistance (AbR) in drug-free environments. We examined the fitness cost and expression of five AbR-coding mobile genetic elements in the absence of drug selection. Methods: Plasmids RP1, pUB307 and N3, the transposon Tn1 and the ICE element R391 were separately introduced into 345-2 RifR, a rifampicin-resistant derivative of a recent porcine isolate. The insertion site of Tn1 was identified using PCR and DNA sequencing. The fitness cost of each AbR element was assessed in vitro by pairwise growth competition and in vivo by monitoring the number of CFU/g of faeces regularly for 21 days following inoculation of six seven-week old organic piglets with 10 10 CFU. The bacteria were recovered by plating onto MacConkey agar containing rifampicin and retention of the AbR elements monitored by replicating onto agar containing the appropriate antibiotics. Isolates that did not express the expected resistance profile were characterised by PCR and DNA sequencing. Results: Tn1 inserted into a cryptic DNA sequence adjacent to the rhsD gene. The insertion site was 2.1 kb away from an independent insertion made in a previous study, where we found that Tn1 enhanced host fitness. The Tn1 insertion described here had no effect on fitness in vitro and in vivo. The plasmid RP1 had a 3.3 ± 0.9% fitness cost per generation in vitro but was recovered at the same rate from the pig gut as the plasmid-free strain (p = 0.09). Similarly the plasmid pUB307, which is RP1 without Tn1, had an in vitro fitness cost of 1.9 ± 0.8% but no effect on fitness in vivo (p = 0.21). The plasmid N3 had a large fitness cost of 9.1 ± 1.8% in vitro and was also recovered at lower rates in vivo (p = 0.04). The ICE element R391 had a neutral effect on fitness in vitro and in vivo. Most AbR element-carrying strains recovered from the animals retained resistance to the relevant antibiotics, except three RP1carrying isolates, which lost resistance to ampicillin, tetracycline and kanamycin. These isolates retained the plasmid including intact wild-type resistance gene and promoter sequences, indicating the genes have been silenced. Conclusions: The fitness impact exerted upon E. coli 345-2 RifR by carriage of AbR elements is variable depending on the element, and can also be absent. The advantage sometimes conferred by Tn1 appears dependent on the insertion site. Silencing of resistance genes encoded on RP1 can occur in vivo. Development of a protein based test for multiple antibiotic-resistant Salmonella typhimurium gel electrophoresis and 2-dimensional HPLC-mass spectrometry. Results: The number of proteins detected in 2D gels derived from control cultures was significantly (P < 0.05) reduced following treatment with ciprofloxacin (31.2 ng/ml) from 296 ± 77 to 153 ± 36 (mean + 1 SD) respectively. However, increased expression (P < 0.05) of 17 cell envelope proteins was detected. The greatest increase in expression, by up to 10 fold (P < 0.0001), was observed in the AtpA, AtpB, AtpC and AtpH protein sub units of the F1F0-ATP synthase proton pump complex. Increased expression of other proteins including the outer membrane channel protein TolC, organic solvent tolerance protein Imp, the outer membrane protein OmpA and the porin OmpB was also observed. Analysis of the cell envelope proteome by 2D-HPLC-MSn provided a more complete assessment and identification scores suggested increased expression of many other proteins including AcrA and AcrB. Conclusion: The F1F0-ATP synthase proton pump complex provides the motive force for efflux activity and may modulate the membrane potential for porin selective molecular influx and presents a possible target protein complex for Mar. The expression of other outer membrane proteins, such as phospholipase A, was increased after treatment with fluoroquinolones and may provide alternative targets. Molecular epidemiology and mechanisms of resistance to several antimicrobial agents in sporadic Salmonella spp. strains causing acute gastroenteritis in Cuba Objective: Determine the antimicrobial susceptibility and the molecular mechanisms of resistance of Salmonella spp. strains causing acute gastroenteritis in Cuba and determine the potential dissemination of a resistant clone. Methods: A total of 34 Salmonella strains isolated from feces of patients with acute gastroenteritis isolated from different regions of Cuba in 2002 were received and processed in the laboratory of Clinical Microbiology of Clínic Hospital in Barcelona. The antimicrobial susceptibility to 9 antibiotics: ampicillin, amoxicillin/clavulanic acid, nalidixic acid, tetracycline, trimethoprim/sulphametoxazole, chloramphenicol, gentamicin, ciprofloxacin and spectinomycin, was determined using the agar dilution method. The molecular mechanisms of resistance to several antimicrobial agents were detected by PCR and the chloramphenicol acetyl transferase activity by a colorimetric assay. Analysis of molecular epidemiology was performed by pulsed field gel electrophoresis using the low frequency restriction enzyme XbaI. Results: Twenty-two strains presented resistance, 64% was multirresistant. The serotype Typhimurium phagetype 104 was the most frequent and presented similar genetic profiles of PFGE. High levels of resistance to tetracycline (53%), spectinomycin (50%), ampicillin (44%) and chloramphenicol (41%) were found. Resistance to tetracycline was associated with the tet G and tet A genes. Resistance to ampicillin was due to the presence of b-lactamases, mainly the CARB type. The floR gene was the main mechanism of resistance to chloramphenicol. Among the susceptible strains, six belong to the serotype Agona were epidemiologically related. Conclusions: The presence of two main clones was detected in Cuba, with the widespread dissemination of a multiresistant clone of Salmonella enterica serotype Typhimurium DT 104 and an antimicrobial susceptible clone of Salmonella enterica serotype Agona in two separate regions in the country. Molecular characterisation of antibiotic resistance in clinical isolates of Pseudomonas putida T. Horii, Y. Shiba, H. Muramatsu, A. Takeshita, M. Maekawa (Hamamatsu, Nagoya, JP) Objectives: Infections caused by Pseudomonas putida are mostly reported in compromised patients such as newborns and cancer patients. Recently, emergence of resistance to carbapenems and other antibiotics have been reported. In the present study, we examined susceptibilities and characterized resistance to betalactams and fluoroquinolones in clinical isolates of P. putida. Methods: Six clinical isolates of P. putida from the different patients and Pseudomonas aeruginosa PAO-1 were used. These isolates showed different pulsed-field gel electrophoresis genotypes. MICs were determined by an agar dilution method as described by the National Committee for Clinical Laboratory Standards. Detection of the metallo-beta-lactamase genes, blaIMP-1, blaVIM-1 and blaVIM-2, was carried out by polymerase chain reaction amplification. Outer membrane protein profiles were characterized by SDS-PAGE. Nucleotide sequences of the quinolone resistance-detemining regions (QRDRs) of the gyrA, gyrB and parC genes were determined in 6 isolates of P. putida and P. aeruginosa PAO-1. Results: Five P. putida isolates showed resistance to betalactams, including ampicillin (>128 mg/L), ceftazidime (>128 mg/L) and carbapenems (8->128 mg/L) such as imipenem and meropenem. Four isolates showed high resistance to fluoroquinolones (>128 mg/L), including norfloxacin, levofloxacin, sparfloxacin, gatifloxacin and pazufloxacin. The MIC range for sitafloxacin was between <0.25 and 8 mg/L. Four isolates resistant to both beta-lactams and fluoroquinolones also showed minocycline resistance (>16 mg/L). One isolate was susceptible to both beta-lactams and fluoroquinolones. All of carbapenemresistant isolates had the blaIMP-1 gene. In one isolate highly resistant to all carbapenems (>128 mg/L) except sitafloxacin (8 mg/L) SDS-PAGE showed reduced production of a protein band, which was identified as OprD by amino acid sequencing. Some specific mutations conferring fluoroquinolone resistance were found in the QRDRs of GyrA (Thr83Ile), GyrB (Glu469Asp) and ParC (Ser87Leu) in P. putida isolates. Conclusion: Five of 6 isolates of P. putida were resistant to carbapenems because of acquisition of the metallo-bata-lactamase gene. Our results suggested that reduced production of OprD was associated with increse in MICs of carbapenems. Four isolates showing resistance to fluoroquinolones except sitafloxacin had a combination of 3 amino acid alterations in the QRDRs of GyrA, GyrB and ParC. Porin expression among clinical isolates of Escherichia coli showing AmpC-hyperproduction phenotype Objectives: From June-August 2004, ARMRL received 4 carbapenem-resistant isolates of K. pneumoniae from separate patients on the Liver ICU of a London tertiary care hospital for investigation. Two isolates were from blood cultures, one from bronchial washings and one from a wound swab. All patients had clinical infections and were treated with broadspectrum antibiotics, including colistin. One patient with bacteraemia died shortly after beginning treatment, but there was no other attributable mortality. We sought to define the resistance mechanisms of the isolates. Methods: Isolates were compared by PFGE of XbaI-digested genomic DNA and analysed with BioNumerics software. MICs were determined and interpreted according to BSAC guidelines. Isolates were screened for beta-lactamase genes, including those for known carbapenemases by PCR. Imipenem hydrolysis was investigated by spectrophotometry. Iso-electric focusing (IEF) was performed to visualise beta-lactamase. Outer membrane profiles were examined by SDS-PAGE analysis. Results: The four isolates were 95% similar by PFGE and represented a single strain. Their antibiogram was complex. Resistance was evident to ertapenem (MIC > 16 mg/L), but less marked to meropenem (MIC 4-16 mg/L) and imipenem (1-8 mg/L). MICs were unaffected by EDTA, and no carbapenemase activity or genes were detected by spectrophotometry or PCR, respectively. Resistance to all cephalosporins tested, including cefepime (MIC > 64 mg/L), was not reduced significantly by clavulanate; isolates were also highly resistant to cefoxitin (MIC > 64 mg/L). Isolates were resistant to gentamicin, tobramycin and ciprofloxacin. All were susceptible to colistin, and 3 showed borderline susceptibility to amikacin (MIC 4 mg/L). Two beta-lactamases were apparent by IEF, and were consistent with the group 1 blaCTX-M and blaOXA-1-like alleles detected by PCR; blaSHV was also detected. Neither IEF nor PCR yielded evidence of AmpC production. SDS-PAGE showed the loss of a major outer membrane protein (OMP). Conclusions: Impermeability, associated with OMP loss, combined with the production of group 1 CTX-M and OXA-1-like enzymes appears to underlie the complex pattern of beta-lactam resistance in this K. pneumoniae strain. However, the lack of potentiation of cephalosporins by clavulanate is unusual for CTX-M producing klebsiellae, as is the carbapenem resistance. Limited treatment options for these more resistant variants poses a significant clinical problem. Characterisation of a multiresistant mutator strain of Pseudomonas aeruginosa from an ICU patient B. Henrichfreise, I. Wiegand, B. Wiedemann (Bonn, D) Objectives: Hypermutation is a common feature of P. aeruginosa from cystic fibrosis patients with chronic infections. Little is known about mutator strains from patients with acute infections among which hypermutation seems to be rare. The aim of our study was (I) to characterize the molecular alteration responsible for the mutator phenotype and (II) to investigate mutationmediated resistance in a multiresistant mutator strain of P. aeruginosa from an ICU patient. Methods: A multiresistant P. aeruginosa strain was isolated from a wound swab from a 63-year old patient in an IC unit of a German hospital in 2004. The strain showed resistance to Levofloxacin and Piperacillin and intermediate resistance to Imipenem, Ceftazidime, and Gentamicin. Hypermutation was detected by disk diffusion tests. Mutation frequency was determined on selective rifampicin agar. The mismatch repair system genes mutS, mutL and uvrD were amplified and sequenced. Effluxpump overexpression was detected by testing levofloxacin MICs both with and without the effluxpump inhibitor 110 . MexR coding for the repressor of the mexABoprM operon and the QRDR of gyrA and parC and were amplified and sequenced. Results: The mutation rate of the strain was 2.26 · 10 )6 . Sequencing of the mismatch repair system genes revealed a 1 bp deletion (A1250) in mutL resulting in a frameshift. The levofloxacin MIC was reduced from 128 mg/L to 2 mg/L in presence of 110 indicating effluxpump overexpression and alterations in type II topoisomerases. In mexR a N insertion after L52 was detected. Two changes in gyrA (T83I, D87G) and one change in parC (S80L) were found. Conclusions: This is the first genetic characterisation of a multiresistant mutator strain of P. aeruginosa from an ICU patient with an acute infection. A new mutation in mutL of P. aeruginosa responsible for the mutator phenotype was found. A mutator phenotype can confer a selective advantage in stressful environments. So, one could consider coselection of the mutator and the mutation-mediated resistance phenotype in this strain. Further work will be necessary to understand the underlying mechanisms of this evolutionary process in a strain of a patient with an acute infection. A novel class 1 integron containing an aadA aminoglycoside resistance gene cassette resulting from in vivo homologous recombination M.E. Cano, I. de Benito, J.M. García-Lobo, J. Agü ero (Santander, E) Objective: To describe a new variant of the aadA gene encoding resistance to aminoglycosides, as the result of a sequence reassortment between the aadA2 and aadA1a gene cassettes. Methods: A total of 78 clinical isolates of Yersinia enterocolitica collected from different patients in our area between 1994 and 2003, were analysed for the presence of class 1 integrons. Identification and susceptibility testing were performed with the Microscan Walkaway System (Dade Behring). Susceptibility to chloramphenicol, nalidixic acid, tetracycline, kanamycin, streptomycin and spectinomycin was determined by disk-diffusion. Strains were screened by PCR using primers specific for IntI1 gene, and gene cassettes were identified by sequencing the PCR products of the integron variable regions obtained with primers 5'CS and 3'CS. Results: Sixty out of the 78 Y. enterocolitica isolates (77%) showed the presence of integrons, and they could all be grouped into two clusters of 1000 bp (45 isolates) and 1900 bp (15 isolates) according to the two patterns obtained from the amplification of the variable region. The sequencing of the 1000 bp products revealed the presence of a new aadA gene cassette the sequence of which was a mosaic built up from pieces from both aadA2 and aadA1a. All the isolates were resistant to streptomycin, spectinomycin and chloramphenicol, and susceptible to gentamicin, tobramycin, amikacin and kanamycin. Conclusions: The new aadA gene described here enlarges the reported examples of integron containing gene cassettes. Furthermore, nucleotide sequence analysis revealed that new gene variants can be produced in nature by exchange mechanisms probably mediated by homologous recombination. Sulfamethoxazole resistance genes in uropathogenic E. coli J. Shchepetova, K. Truusalu, E. Sepp, M. Mikelsaar (Tartu, EST) Increasing antimicrobial resistance among E. coli (Ec) causing urinary tract infection (UTI) is a serious worldwide problem. The treatment with co-trimoxazole (ST), a combination of sulfamethoxazol (Sulfa) and trimetoprim, often does not prevent recurrent UTI (rUTI). The sensitivity to antibiotics of consecutive rUTI isolates is usually detected by disk-diffusion or E-test, but it does not always reflect the presence of resistance genes. Sulfa resistance in enterobacteria arises from acquisition of two additional genes, sulI and sulII, encoding the dihydropteroate synthetase. These genes are located on different types of mobile elements: sulI is associated with type I integrons and sulII with non-conjugative plasmids. However, there are few data on the prevalence of Sulfa resistant genes and integron 1 in community-acquired Ec strains isolated from children with rUTI. One of the putative reasons for rUTI may lie in non-accordance of pheno-and genotypical results of antibiotic susceptibility determination, resulting in non-efficient antimicrobial treatment. The aim of this study was to determine the prevalence of Sulfa resistance genes (Int1, SulI and SulII) among Ec causing rUTI in children. Material and methods: Altogether 29 consecutive Ec isolates from 10 rUTI patients (Tartu University Children Hospital) with changes in antibiotic resistance to ST were applied. Ec resistance to Sulfa was detected by E-test (Bio Mereux). DNA was extracted using QIAamp DNA Mini Kit (QIAGEN). Int1, sulI and sulII genes were detected by PCR (Polymerase Chain Reaction) . Results: 20 out of 29 (65.5%) Ec isolates were resistant to Sulfa (MIC 3 512 mg/L). Int 1 was present in 15 out 29 (51.7%) Ec isolates. SulI and/or sulII genes were detected in all resistant Ec isolates. Three different combinations of genes were found: 9 isolates contained sulI and sulII; 3 isolates only sulI and 8 isolates only sulII gene. Among 9 phenotypically sensitive Ec strains 3 isolates (MIC 8 mg/L) carried sulI and sulII genes while 6 strains (MIC 12-32 mg/L) did not contain any of the three genes. Conclusions: This study demonstrates that the resistance genes of Sulfa (sulI and sulII) are widely distributed in Ec strains from children with rUTI. Half of the rUTI causing strains carry integron 1 providing them with capability to obtain multiresistance. The detection of Sulfa gene in Ec might be of importance in prevention of rUTI. Plasmid transfer from Klebsiella pneumoniae to Escherichia coli S. Schjørring, C. Struve, K.A. Krogfelt (Copenhagen, DK) Objectives: The increased number of gastrointestinal infections and the rapid increase in antibiotic bacterial resistance, makes investigation of antibiotic resistance development during intestinal colonization a very important issue. The objectives are to investigate a Klebsiella pneumoniae strain's ability to conjugate with Escherichia coli, in vitro in vivo, and to characterise the transconjugants by plasmid profiling and restriction fragment analysis. Methods: The donor K. pneumoniae ATCC 700721 strain was a multi-resistant mucoid strain, which contains three large plasmids (100--150 kbp.) and two small ones (<7 kbp.). The recipient was an E. coli MG1655 StrepR, RifR. The in vitro conjugation was performed on solid and liquid media, whereas the in vivo conjugations were performed during colonisation of the large intestine of streptomycin/ampicillin treated mice. Transconjugants were isolated from both in vitro and in vivo experiments. A combination of plasmid purification (which purify large plasmids in a way that allows following restriction cutting), plasmid profiles, and restriction fragment analysis, was used to characterise the transconjugants obtained from these experiments. Results: In vitro conjugation between K. pneumoniae and E. coli showed transfer of either only 1 or all 5 plasmids depending on the conditions. When K. pneumoniae was used to colonise the large intestine, it was shown that K. pneumoniae transferred one of its plasmids containing antibiotic resistance genes to an indigenous E. coli strain. When mice were co-infected with K. pneumoniae and the laboratory E. coli strain, it was seen that K. pneumoniae again transferred its plasmid with antibiotic resistance to E. coli. Both the laboratory strain and the indigenous E. coli with the newly acquired plasmids were tested for their conjugative ability and it was seen that they both had obtained conjugative plasmids from K. pneumoniae. Furthermore, the plasmids were characterised by restriction fragment analysis confirming, that all the transconjugants plasmids were identical with the plasmids from the original donor; the K. pneumoniae ATCC 700721. Conclusion: K. pneumoniae ATCC 700721 contains conjugative plasmids, and conjugation is occurring in a high frequency both in vivo and in vitro. The type of plasmid, which is conjugated depends on the environmental conditions. Accuracy of the Microscan Walkaway system for identifying P. aeruginosa strains carrying class 1 integrons with MICs of cefepime higher than those of ceftazidime E. Ugalde, A.B. Campo-Esquisabel, M.E. Cano, J. Calvo-Montes, J. Agü ero, L. Martínez-Martínez (Santander, E) Objectives: MICs of Cefepime (FEP) against P. aeruginosa are usually similar to those of Ceftazidime (CAZ), but isolates expressing efflux pumps and containing PSE-1 or OXA enzymes may present MICs of FEP higher than those of CAZ. In this study we have evaluated the Microscan Walkaway system (W/A) for detecting P. aeruginosa isolates with any of the following phenotypes: 1. CAZ susceptible (S) and FEP intermediate (I); 2. CAZ-S and FEP resistant (R); 3. CAZ-I and FEP-R. The presence of Class 1 integrons in these isolates was also investigated. Methods: From May to Sept. 2004, all P. aeruginosa isolates (one per patient) I or R to FEP and S to CAZ, and the first 30 strains I or R to both CAZ and FEP were evaluated. MICs of FEP and CAZ were determined by reference microdilution (NCCLS guidelines). Then clinical categories obtained with W/A for organisms with any of the previously indicated phenotypes were compared with those obtained by the reference method. Class 1 integrons were detected by PCR using primers specific for the type 1 integrase gene and primers specific for conserved regions 5' and 3' of class 1 integrons. Gene cassettes were identified by sequencing the amplicons obtained from two different isolates for each integron type found. Results: The following phenotypes of CAZ/FEP and number of isolates were identified by the W/A system as: S/I:9; S/R:4; I/ I:15; R/I:4, and R/R:11. Reference microdilution confirmed that 23 isolates were more susceptible to CAZ than to FEP. The W/A correctly identified 13 out of these isolates (53.5% sensitivity). Reference microdilution confirmed higher susceptibility to CAZ than to FEP in all 13 isolates detected by W/A (100% specificity). For the 23 isolates, the W/A did not cause any Major (false resistance) error for CAZ or FEP. The phenotypes of CAZ/FEP for the 10 isolates not recognized by W/A were I/I (n = 6), R/I (n = 3) or R/R (n = 1). A class 1 integron was identified in 18 out of the 23 (78.3%)isolates: 13 with a 1600 bp integron, coding for an OXA protein which shares the highest aminoacid identity with group II OXA enzymes (77%), 3 with a 1200 bp integron, coding for PSE-1, and 2 in which PCR failed to amplify any integron conserved region. Conclusions: The W/A system is very specific, but poorly sensitive, for recognition of P. aeruginosa more susceptible to CAZ than to FEP. In our centre, this phenotype is often associated to the presence of integrons coding for an OXA enzyme or PSE-1. Non-beta-lactamase mediated beta-lactam resistance in Stenotrophomonas maltophilia V. Gould, D. Miller, R.A. Howe, M. Avison (Bristol, UK) Objectives: Stenotrophomonas maltophilia is an important, emerging, Gram-negative, nosocomial pathogen that can cause bacteraemias, respiratory tract colonisation and other organspecific infections. Isolates have the potential to mutate to multidrug resistance (MDR), which has been linked to overexpression of the efflux pump SmeDEF. Beta-lactam resistance is thought to be due to beta-lactamase over-expression since SmeDEF does not pump out beta-lactams. Methods: Beta-lactam resistant mutants of S. maltophilia isolates K279a and N531 were selected using either ceftazidime or meropenem. MICs of various classes of antimicrobial agents were determined by Etest using Muller-Hinton agar. Betalactamase induction was attempted using cefoxitin challenge (10 mg/L, 2 h) and specific beta-lactamase assays were performed using nitrocefin with (L2) or without (L1+L2) EDTA (500 mM). RNA extraction and RT-PCR for smeE and smeF used kits from Quiagen. Results: From parent isolate K279a one high level meropenemresistant (MIC ‡ 512) and one high level ceftazidime resistant mutant (MIC = 16) were selected. From parent isolate N531 one high level meropenem resistant mutant was selected (MIC ‡ 512). Beta-lactamase assays in the absence of inducer revealed that none of these mutants over-express beta-lactamase. Indeed, unlike the parent strains, beta-lactamase expression in the mutants was not inducible under the conditions tested. MICs of other classes of antimicrobials revealed increased MICs of fluoroquinolones against the beta-lactam resistant mutants. RT-PCR confirmed that smeDEF are not overexpressed in any of the mutants. Conclusions: These data suggest that beta-lactam resistance is part of an MDR phenotype in some S. maltophilia mutants. The mechanism involved appears to alter drug accumulation rates, since beta-lactam inducer was not able to reach a concentration high enough to stimulate beta-lactamase expression. The mechanism is most likely to be efflux-pump mediated, suggesting the existence of a previously uncharacterised efflux pump in S. maltophilia. First complete sequence of a penicillin-binding protein of the genus Aeromonas Objectives: Members of the genus Aeromonas are human pathogens causing several infections especially to immunocompromised patients and patients with severe underlying diseases. Antibiotic resistance is an increasing problem for effective therapeutic strategies and it is important to understand the mechansims of resistance. Beta-Lactam antibiotics are known to bind to and inhibit PBPs which leads to a disturbance of the peptidoglycan metabolism. Until now there is only little information about the PBPs of Aeromonas veronii. Eight PBPs with different molecular masses were identified. Tn5 insertion mutants of Aeromonas that over-express beta-lactamases have a disruption within one of two different genes. The partial sequences of both gene products have been assigned functions as D-D-carboxypeptidases. We identified the complete sequence of one of the inactivated genes encoding a D-D-carboxypeptidase with homology to PBP4 from different species, in order to create a basis for further studies of the cell wall metabolism and beta-lactamase induction. Methods: Purified genomic DNA from one Tn5 insertion mutant was digested with EcoRI or SalI. The DNA-fragments were ligated into an equal linearized vector, pSU18 and transformed into E. coli DH5a. The selected colonies were investigated for recombinant plasmids with the correct insert. Sequences were determined using primer walking strategy. Results: The sequenced fragment codes for an open reading frame of 481 amino acids with a calculated MW of 52 kDa. This MW is in good agreement with the MW of PBP4 from E. coli, Vibrio and Shewanella where the MW ranges between 52-56 kDa. The deduced protein shows homology to PBP4 from different species, a bifunctional enzyme with both D-D-carboxypeptidase and D-D-endopeptidase function. All characteristic active-site fingerprints of PBPs are located in the sequence. Conclusions: This is the first complete sequence of a PBP of the genus Aeromonas. The disruption of this pbp-gene leads to overexpression of beta-lactamases in Aeromonas veronii. This result will be the starting point for further studies of the role of PBPs in peptidoglycan metabolism and beta-lactamase induction of Aeromonas veronii. Metronidazole resistance in nim-positive and nim-negative B. fragilis strains after several passages on metronidazole containing Columbia agar plates R. Schaumann, S. Petzold, A.C. Rodloff (Leipzig, D) Objectives: Recent data show an emergence of B. fragilis strains resistant against fluoroquinolones and in part against other antimicrobial agents. The aim of the present study was to investigate inducible metronidazole (MTR) resistant in B. fragilis strains. Methods: Of 18 B. fragilis strains (including 4 nim-positive reference strains and one ATCC strain) MIC values for MTR were determined by E-test and analysed for nim-genes (A-D) by PCR. After that bacterial suspension were incubated on supplemented columbia agar plates containing MTR at twice the MICvalue of the specific strain tested and incubated under anaerobic conditions for 48 h. After incubation growing bacteria were harvested and cultivated and thereafter incubated at 4 times MIC. This procedure was repeated with increasing antibiotic concentrations. The resulting MIC-values were confirmed by E-test. Results: The MIC-values for MTR of the four nim-positive reference strains ranged from 3 to 8 mg/L. Three clinical isolates of B. fragilis strains showed MIC-values >256 mg/L. In all 3 strains the nim-gene was detected by PCR. The B. fragilis ATCC 25285 strain was nim-negative with a MIC-value of 0.19 mg/L. The other 10 clinical isolates of B. fragilis were also nim-negative. MIC-values ranged from 0.25 to 0.75 mg/L. The nim-positive reference strains showed after few passages MIC-values >256 mg/L for MTR. After several passages on MTR containing agar, all other B. fragilis strains including the ATCC 25285 strain exhibited MIC values of 8 to 256 mg/L. Conclusion: MTR resistance can be selected not only in nimpositive B. fragilis strains but also in nim-negative strains. This suggests that mechanisms other than nim are involved in MTR resistance. These findings underscore the importance of susceptibility testing of anaerobes even in routine laboratories. Dissemination of nitroimidazole resistance determinants among Gram-negative anaerobic bacteria in Greece Objectives: The surveillance of the incidence of nitroimidazole resistance (nim) determinants among Gram-negative anaerobic clinical isolates in Greece. Materials and methods: A total of 185 Gram-negative anaerobic bacteria collected from eight hospitals in Athens, Greece, were tested for metronidazole resistance using the Etest method on brucella blood agar plates. Incubation in a ChelLab Anaerobic Chamber was performed for 48 hours. Interpretation of the results was according to NCCLS guidelines. For quality control the strains B. fragilis ATCC25285 and B. thetaiotaomicron ATCC29741 were used. Strains having an MIC > 1 mg/L were screened for nim genes by PCR using the nim 3 /nim 5 set of primers. PCR products were stained with ethidium bromide and documented under UV illumination. Sequencing was performed in an ABI 3100 genetic analyzer using the BigDye terminator kit. The Blast search programme of the National Center for Biotechnology Information was used to search the Gene Bank for significant alignments. Results: A total of 16 isolates having an MIC > 1 mg/L were detected (four Bacteroides fragilis group, eight Prevotella spp., one Bacteroides spp. non-fragilis and three miscellaneous). Three, three, two, one and seven strains had MICs of 2, 4, 8, 16 and 32 mg/L or higher, respectively. Eight strains were positive by PCR for the 458 bp amplicon, of which three had a metronidazole MIC of 4 to 16 mg/L (lower than the current NCCLS breakpoint). DNA sequencing revealed that one, two, two and three strains harboured nimA, nimC, nimD and nimE genes, respectively. No strain was detected harbouring the nimB gene. No particular relationship was detected regarding species or MIC distribution and nim gene class. Conclusions: Nitroimidazole resistance determinants were detected among both metronidazole resistant and susceptible Gram-negative anaerobic bacteria in Greece. This study confirms the widespread occurrence of nim genes and demonstrates that 'silent' nim genes can be detected by PCR in metronidazole susceptible isolates.Members of The Hellenic Study Group on Gram-Negative Anaerobic Bacteria are: A. Avlamis, C. Koutsia-Karouzou, C. Kontou-Kastelanou, A. Pangalis, E. Papafrangas, E. Trika-Grafakos, H. Malamou-Ladas and A. Vogiatzi. Morphological changes in Clostridium difficile during exposure to metronidazole T. Peláez, R. Alonso, L. Alcalá, J. Martínez-Alarcó n, E. Cercenado, M. Rodriguez-Créixems, E. Bouza (Madrid, E) Background: We report a high prevalence (6%) of metronidazole (MTZ) resistance in Clostridium difficile in our institution. Resistance to MTZ seems to be heterogeneous and unstable. We observed morphological alterations in the strains growing in the presence of metronidazole. Objective: The aim of this study was to characterize these morphological changes and to study the stability of the altered phenotypes after MTZ removal. Methods: We selected a total of 18 isolates which were resistant to metronidazole (MICs from 16 to 64 mg/L). C. difficile ATCC 9689 was also included as a control. Brain Heart Infusion broth tubes (B.H.I.) were prepared with 4 and 8 mg/L MTZ. Brucella plates without antibiotic were also used. Bacterial morphology was evaluated by microscopy (Gram-stained) and also by plate colonies. A volume of 0.1 mL, from a 0.5 McFarland culture, was used to inoculate the B.H.I. tubes. Broths were incubated at 37°C in an anaerobic chamber for 10 days. Every two days, the cultures were screened by microscopy and by serial passages performed on Brucella plates without antibiotic. Plates were further incubated under the same conditions and observed for 10 days. Results: The ATCC 9689 C. difficile strain was not able to grow in the presence of any of the MTZ concentrations. Gram stains of MTZ-resistant C. difficile strains, grown in the presence of both assayed MTZ concentrations, revealed Gram-positive coccoid forms that co-existed, at first with typical Gram-positive bacillary forms, which became progressively predominant during the 10 day-period. Subcultures of the antibiotic B.H.I. tubes on Brucella plates rendered colonies with an atypical white appearance and round shape. Colonies reverted progressively to typical C. difficile phenotypes and after 7-10 days' incubation in free-MTZ Brucella plates, they showed their characteristic pleomorphic and yellow-green, ground glass appearance. Gram staining of the reverted phenotypes showed the typical spore-forming, Gram-positive bacilli. Conclusions: The presence of MTZ induces morphological changes in C. difficile that can easily be reverted in antibioticfree medium. A similar phenomenon has been described in another genus (Helicobacter pylori), and is related to a decrease in intracellular ATP levels, although further studies are needed to explain this phenomenon in C. difficile. A reporter gene system for the identification and characterisation of multiple antibiotic resistance (mar) in E. coli associated with altered expression of the AcrAB-TolC drug efflux pump N. Matthiessen, P. Heisig (Hamburg, D) Objectives: The increasing prevalence of bacterial resistance to antibiotics is a worldwide problem for the therapy of infectious diseases. Among the three basic mechanism leading to antibiotic resistance, i.e. alteration of the target, inactivation of the drug , and reduced accumulation of the drug at the target site, the latter has become the most important resistance-mechanism due to the following reasons: (i) it is the most abundant mechanism detectable in both Gram-negative and Gram-positive bacteria, (ii) it often mediates multi drug resistance (mdr) to a broad range of -unrelated -drug classes, (iii) it can favor the acquisition of additional mechanisms of resistance. Most frequently mdr is achieved by one of several mutations resulting in the deregulation of mdr efflux pump expression. The major multidrug efflux pump in E.coli AcrAB-TolC is a constitutively expressed tripartite complex consisting of a RND-type transporter AcrB, a membrane fusion protein AcrA and an outer membrane channel TolC. The expression of acrAB is regulated by a local repressor AcrR and known global regulator systems MarRAB, SoxRS and Rob. Since any mutation inactivating AcrR or a global regulator, like MarR may result in acrAB overexpression, detection of a resistance mutation requires extensive sequencing and additional susceptibility tests using different antibiotics. Methods: Thus, a reporter gene system has been developed that senses alterations in the expression of the AcrAB-TolC efflux pump caused by induction and/or mutation/deletion of the local and/or global regulators. Briefly, the luciferase gene luc of the firefly Photinus pyralis as a reporter gene was fused to the promotor pacrAB by a modified PCR technique (SOEing) and inserted into the plasmid pBR322. Results: Firefly luciferase as a reporter is advantageous due to the high sensitivity with no background activity, wide range of applicability, ease of use and cost efficiency. Alterations in the expression of acrAB either due to the presence of inductors or mutations in marR could be detected as increased luciferase activities by this reporter gene system. Conclusions: Thus, this newly developed reporter gene system can be used to identify acrR mutants and to quantify alterations of the expression of the acrAB operon. Moreover, it is a useful tool to study under different environmental conditions the expression and to screen for inductors or inhibitors of the AcrAB-TolC efflux pump. Expression of mRNA for efflux pump proteins in Pseudomonas aeruginosa strains from cystic fibrosis patients in relation to antibiotic resistance S Islam, H. Oh, S. Jalal, O. Ciofu, N. Hoiby, B. Wretlind (Stockholm, S; Copenhagen, DK) Objectives: Multidrug efflux system plays a prominent role in resistance to several antibiotics in Pseudomonas aeruginosa. To date, 7 different MDR efflux systems have been characterized in P. aeruginosa: MexAB-OprM, MexCD-OprJ, MexEF-OprN, MexXY-OprM, MexJK-OprM, MexVW-OprM and MexHI-OpmD. The aim of the present investigation was to discern to which extent overexpression of efflux pumps contributes to antimicrobial resistance, with particular interest on quinolone and aminoglycoside resistance in P. aeruginosa strains from CF-patients. Methods: Twenty Pseudomonas aeruginosa isolates collected from six cystic fibrosis (CF) patients, aged 27 to 33, in 1994 (9 isolates) and 1997 (11 isolates) at the CF Center, Copenhagen, Denmark, were studied. MICs to norfloxacin, ciprofloxacin, amikacin, tobramycin, tetracycline, ceftazidime, piperacillin/ tazobactam, meropenem and imipenem were determined using Etest. The relative expression of mRNA for four efflux pump proteins was determined by real-time PCR and correlated with susceptibilities to two fluoroquinolones and seven other antimicrobial agents. Results: A strain was considered to hyperproduce mRNA for pump proteins if cDNA level was >5x strain PAO1. MexY mRNA overproduction (18/20 strains) did not seem to achieve clinically relevant levels of resistance to quinolones but was correlated with decreased susceptibility to aminoglycosides. MexB overproduction (3/20 strains, <23x PAO1) did not mediate any significant quinolone resistance, but seemed to decrease susceptibilities to other antimicrobials. High-level overexpression of MexD (4/20) affected quinolone susceptibility. No clear correlation between the R82L alteration in 16/20 strains in NfxB (regulates MexCD-OprJ) and MexD mRNA hyperproduction was seen. MexF mRNA expressed at high levels (6/20) was correlated with resistance to quinolones and imipenem. Conclusion: Elevated production of mRNA for the four efflux pumps tested correlated not only to decreased susceptibility to quinolones, but also to other antimicrobials including penems, aminoglycosides and beta-lactams. Public health, surveillance and geographic information systems Background: The International Circumpolar Surveillance (ICS) system conducts population-based surveillance of invasive bacterial diseases in Greenland (GN), Northern Canada (N Can), Northern Sweden (N Swe) and in the U.S. Arctic (Alaska [AK]). Methods: Isolates from patients with invasive diseases caused by Haemophilus influenzae (Hi), Neisseria meningitidis (Nm), Group A Streptococcus (GAS), and Group B Streptococcus (GBS) were forwarded to reference laboratories in Alaska (2000 Alaska ( -2004 , Canada (2000 Canada ( -2004 , Greenland (2001 -2003 ), and Sweden (2003 for confirmation and serotyping. Clinical and demographic information were collected using standardized surveillance forms. Data reported for 2004 is preliminary. Results: The total numbers of reported cases were 110 Hi, 43 Nm, 153 GAS, and 130 GBS. Crude annualized rates of invasive disease per 100,000 population varied by country and organism (Table 1) . AK Native and N Can Aboriginal people had consistently higher rates of disease (except GBS in N Can) than non-Aboriginals. Of the 105 Hi cases that were serotyped, 20 (19%) were Hib [AK 15 cases (rate 0.48), N Can 5 cases (rate 0.80)] and age ranged from <1 to 69 years; most Hib disease occurred in persons <2 years of age (AK = 53%, N Can = 80%). Thirty-three (31%) Hi cases were serotype a (Hia) [AK 10 cases (rate 0.32), N Can 23 cases (rate 3.68)]. No Hia cases were reported in AK during 2000, 2001 and 2004 to date; in 2002 and 2003 , rates in AK were 0.62 and 0.92, respectively. In N Can, Hia cases were reported during each year from 2000-2004; rates were 2.99, 7.03, 3.13, 2.34 and 2.82 respectively. Case fatality ratios were higher in AK than N Can and GN for invasive disease caused by both Hi (AK = 18%, N Can = 7.4%) and Nm (AK = 12.2%, N Can = 0%, GN = 0%). Conclusion: Aboriginal peoples of AK and N Can have high rates of invasive bacterial disease caused by Hi, Nm, GAS and GBS. Overall rates of Nm disease are higher in GN than AK, N Can and N Swe. Cases of invasive Hib disease continue to occur in children <2 years of age. Rates of Hia appear to be elevated in N Can; this trend merits further surveillance. Objectives: The laboratory surveillance of Salmonella in Italy has a high level of integration among involved institutions. It is represented by the Enter-net system, coordinated by the Istituto Superiore di Sanità, which concerns notifications from human cases, food items and environmental sampling, and the Entervet network, coordinated by the Istituto Zooprofilattico Sperimentale delle Venezie, which collects information on isolations from animals and food of animal origin. Methods: The networks use harmonised microbiological methods and share their databases. Data on Salmonella serotypes, phagetypes and antimicrobial resistance are collected with epidemiological informations. Each year, the network collects and analyzes data on about 6000 human isolates and 2000 isolates each from animals, foods and environment. More than 70% of the human isolates is represented by S. typhimurium (ST) and S. enteritidis. Subdivision within phagetypes is becoming necessary to elucidate outbreaks during investigations because, since the 1990s, some phagetype of epidemiological importance have predominated: S. enteritidis phagetype 4 and S. typhimurium phagetype 104 are the more common phagetypes among human and animal isolates. Molecular typing may be an important subtyping tool for isolates belonging to the same phagetype and Pulsed-Field Gel Electrophoresis analysis is considered the gold standard method. Results: An accurate analysis of the Enter-net and Enter-vet databases allowed us to detect an increase during 2002 and 2003 in the prevalence of S. typhimurium non phagetypable (NT) and of an atypical monophasic strain, defined as 4,5,12: i,-, both in human cases and in veterinary samples. ST NT accounted for the 25% of the ST isolated in humans during this period and for the 20% of the ST isolated from sample of swine origin. The resistance to Ampicillin, Streptomycin, Sulphonamides, and Tetracycline is the typical profile found in a high percentage of human and swine strains such as PFGE shows the same profile of restriction for the most part of human and swine ST NT isolates. Conclusions: The Italian surveillance integrated network for Salmonella represents an important database for the study of Salmonella infection epidemiology. Epidemiological data together with serotyping, phagetyping and molecular typing of Salmonella isolates from human and animal sources provide further information for a better estimate of risk factor for human infections. Background: Crimean-Congo Haemorrhagic Fever (CCHF) is a potentially fatal viral infection caused by a tick-born virus, nosocomial outbreaks with high mortality among hospital staff been documented. Sporadic cases occur through In 1999, 3 health care workers (HCWs) in Iran were infected with CCHF virus following contact with one suspected case of CCHF that one of them died. Systan-Baluchestan (south-east of Iran) and Isfahan (centre of Iran) provinces are now endemic area of CCHF infection in Iran. HCWs of these two provinces are frequently in contact with CCHF cases. Materials & Methods: 191 pre-tested and self-administered questionnaires were filled by HCWs who work in admitting wards of hospitals of Systan-Baluchestan and Isfahan provinces of Iran. Collected data was analysed to determine the level of Abstracts knowledge and attitude of these staff and to distinguish the predicting factors of knowledge and attitude. Results: 82% of these HCWs had good knowledge on CCHF, while 83% showed acceptable attitude towards the disease. Knowledge is directly associated with attitude (p < 0.03). Those in higher job rank had better knowledge (p < 0.001) and higher attitude (p < 0.01). The most common used source of data on CCHF was 'Poster and pamphlet' (32.2%) among these HCWs. Those who used 'Poster and pamphlets' had higher knowledge (p < 0.05). No significant difference was seen among different sex, job or provinces groups in using 'Poster and pamphlets'. The most common type of contact to CCHF patients was 'Intact skin to blood' contact in 37.3% of enrolled HCWs, while 10% had 'Percutaneous' contact with CCHF cases. Working in Systan-Baluchestan province was accompanied with higher risk of contact with CCHF cases (p < 0.05). Conclusion: We conclude that enrolled HCWs in Systan-Baluchestan and Isfahan provinces of Iran had acceptable knowledge and attitude. Improvement of knowledge via 'Poster and pamphlet' could be an effective modality in these setting. Health authority should pay more attention on Systan-Baluchestan province to provide it with sufficient and effective universal protection to lower nosocomial transmission risk of CCHF in HCWs of this area. Seroprevalence of rubella among puerperae in an area of North-Eastern Italy Serologic evidence of susceptibility to rubella infection was found in 44 (9.7%). The proportion of susceptible women did not vary across different ages (18-39 yrs 9.8%, >39 yrs 8.8%, P = NS) and nationality groups (Italians 9.7%, other 9.6%, P = NS). Correct retesting in pregnancy occurred in 365 cases (64.5%). Among 44 susceptible women, 24 (54.5%) had been pregnant at least once before (8 had two child or more). No acute infection during pregnancy was diagnosed. Conclusion: In our study, prenatal screening rates for rubella in puerperae was unsatisfactory. Moreover a proportion of nearly 10% of susceptible pregnant women results in a high risk of rubella infection in pregnancy. No correlation was found between age, nationality and rubella susceptibility. Besides more than half of rubella susceptible puerperae had one child or more. These results also suggest a need for improved postpartum vaccine implementation. Spatial distribution and registry based casecontrol analysis of Campylobacter infections in Denmark, 1991 Denmark, -2001 S. Ethelberg, J. Simonsen, P. Gerner-Smidt, K.E.P. Olsen, K. Mølbak (Copenhagen, DK) Objective: To examine the potential of environmental sources contributing to Campylobacter infections in Denmark, using geographical analyses. Methods: We analysed available information on the place of living of all registered laboratory confirmed domestically acquired cases of campylobacteriosis in Denmark over a period of 11 years. The study was performed as a register-based case control study; 15 controls for each case were selected from the national population register, individually matched on age, gender and county of residence. A total of 22,066 cases were compared to 318,958 controls and variables relating to geography and the addresses of living were analysed by logistic regression. Results: Three factors were independently associated with an increased risk of infection: 1) Type of housing. Relative to the one-family house, there was a decrease in odds of housing typical of cities and an increase in odds of housing typical of rural areas. 2) Living in areas with a low population density. This was assessed by counting the people living in a 1 km 2 square surrounding each case and control subject. Children were largely responsible for the increased odds ratio associated with areas with a low population density. 3) The municipality of residence. After adjustment for type of housing and population density the odds of living in different municipalities (274 in Denmark) varied (p < 0.0001) and there was no apparent order in low/high risk municipalities when they were visualized on a map. Conclusions: This is the largest study so far made of the geography and type of housing of Campylobacter cases. We found that children living in non-urban areas are at increased risk of Campylobacter infections. Under the assumption that risk foods (i.e. fresh chicken in particular) are equally distributed across the country, the results indicate that exposures via animals and the environment are the sources of a substantial proportion of sporadic infections of Campylobacter among children in the countryside. Furthermore, contaminated drinking water is a likely explanation of the finding of varying risks between municipalities, since people in different municipalities have different water suppliers in Denmark. Use of spatial analysis on a survey of H. influenzae and S. pneumoniae isolated from children in an urban area of southeastern Brazil Objectives: In French Guiana, tuberculosis (TB) incidence appear to be great, but many problems prevent from effective TB control in this region. One way of improving TB control is to increase case-finding rates and therefore the proportion of cases treated by the identification of population at risk for tuberculosis. The aim of the study presented here is to determine vulnerability index of populations living in the Ile-de-Cayenne for tuberculosis, in order to produce risk map for tuberculosis. Methods: A geographic information system (G.I.S.) is a tool that allows to organize and analyze data that can be referenced spatially, i.e. data that can be tied to a physical location. Many types of data have a spatial aspect, including epidemiological studies. A digital map from IGN and a Spot-5 satellite image were included in the G.I.S. as a cartographic base. In addition, data that should be used to assess the degree of insalubrity of the urban area was included, as well as demographic data that can influence transmission rate. These different layers were cross-linked to assess the vulnerability index of populations. The cartography of tuberculosis cases was combined to the vulnerability map in order to adjust the model of risk map for tuberculosis. Results: The distribution of the 387 TB cases reported from 1 January 1996 to 31 December 2003 have been monitored by GPS using home locations of the patients. A vulnerability index of populations have been derived from a qualitative analysis of both urban landscape and socioeconomic data. Using a G.I.S. and geostatistical tools, we cross-linked variables as habitat typology (derived from air photo interpretation), population density, or type of urban sewerage systems, which are indeed indicative of existing socio-spatial inequalities. A map of tuberculosis risk among populations was established, coupling the cartography of tuberculosis cases with the cartography of vulnerability. Conclusion: This framework will allow to reveal some transmission patterns of tuberculosis in the Ile-de-Cayenne, providing support for the development of health policies and programmes in French Guiana. It will also offer the unique opportunity to dispose of an impressive environment-health database which will serve to regional health authorities for health planification and forecasting. Re. Khaydarov, Ra. Khaydarov (Tashkent, UZB) According to announcements of the Ministry of Public health of Republic of Uzbekistan -a quality of portable water is the main reason of infectious diseases in the Aral Sea Region, where fresh water resources are limited and unevenly distributed, and drinking water often contains extraordinary large numbers of pathogenic bacteria. The water disinfecting method presented in this work is based on the destructive impact of low concentrations of metal ions on bacteria in water. During the disinfection process, alloyed electrodes are placed into the water body and a current applied to the electrode causes the release of metal ions. The metal ions bind to the bacterial cell wall, causing its disruption and lyses. The efficacy of using different metal ions (Ag + , Cu 2+ , Au) combinations (within the limits of current drinking water regulations) for killing typhoid-paratyphoid, Legionella pneumophila, Salmonella, V. Cholerae etc. has been examined. The cultivation, culture enrichment and the testing bacteria were performed following the Standard Methods for the Examination of Water and Wastewater (American Public Health Association, 1995) for the evaluation of disinfection. Tests which were carried out by various independent labs and universities during the period of 1999 through 2003 have shown the dependence of bacteria killing time against metal ion concentration, different initial bacteria concentrations (from 10 3 to 10 12 CFU/L), and the influence of different ion (Cl -, SO, S 2) , Fe 2+ , Fe 3+ ) concentrations on the disinfection process. The best disinfection is obtained by using an alloy of silver/copper/gold composition with concentrations of metals in the ratio 70-90%/ 10-30%/0.1-0.2%, respectively. In the Aral Sea region (Uzbekistan) water disinfecting devices that were based on the developed method were installed on several hundreds manual water pumps, that allowed to decrease community-acquired infectious diseases in this region. A. Heczey, G. Prinz, É . Bán (Budapest, HUN) Objectives: In Hungary, statistical data of infective endocarditis (IE) is unknown; therefore, a prospective study was conducted. The goal of this investigation was to determine the most common pathogens, predisposing factors, affected valves, the mean time from the first symptoms to the established diagnosis, the incidence of vascular phenomena, the percentage when surgery is needed, and the total in-hospital mortality. Elek tests in all cases indicated no toxin production. Sensitivities to a number of antibiotics (ampicillin, penicillin, erythromycin, gentamicin, piperacillin and cefuroxime) were determined by the Kirby-Bauer disc diffusion method. With the exception of penicillin and Ampicillin resistance in one patient, all antibiotics tested were sensitive. Patients were treated with penicillin and gentamicin parenterally and all survived without complications. Conclusion: Non-toxigenic C. diphtheriae is an infectious pathogen, and detection of coryneform bacteria in the blood can no longer be dismissed as contamination and must be investigated. Failure to recognise this pathogen can delay final diagnosis and initiation of appropriate chemotherapy. Species identification is important as mortality differs with the different biotypes. The importance of this organism as emergent pathogen should not be underestimated. Aerococcus urinae -a rarely detected pathogen of infective endocarditis M. Slany, P. Pavlik, J. Cerny, T. Freiberger (Brno, CZ) Objectives: Aerococcus urinae is a rarely reported pathogen, possibly due to difficulties in the identification of the organism. A. urinae is a Gram-positive coccus that grows in pairs and clusters as alpha-hemolytic colonies on blood agar. Because of these characteristics A. urinae is often misidentified as a streptococcus, enterococcus, or staphylococcus. In addition, there were also reported several cases of blood culture negative infections due to A. urinae. Most infections are mild, but serious ones such as endocarditis and septicemia can occur. To our best knowledge, the total number of thirteen cases of infective endocarditis including eight fatal cases have been described in the world literature so far. Objectives: Antimicrobial resistance in campylobacters has become a subject of great concern as resistant strains are more and more commonly found in samples of both human and animal origin. C. jejuni ATCC 33560-strain has been confirmed to be a suitable quality control (QC) strain for campylobacters. However, so far only tentative ranges of minimal inhibitory concentrations (MICs) for this strain are available. In this study a broth microdilution method (VetMIC TM ) was validated for C. jejuni. The manufacturer's method guideline for VetMIC TM Camp-plates (SVA, Sweden) was modified to standardize the size of the inoculum. Methods: A nephelometer and colony counts were used to measure inoculum densities. Inoculum sizes were determined for bovine intestinal isolates and repeatedly for the QC strain using both pre-incubation and direct inoculation. The QC strain was tested in 28 independent VetMIC TM -procedures using preincubation in broth and 25 times by direct inoculation. Results: No correlation was detected between colony counts and McFarland levels by nephelometer. It was concluded that standardizing the inoculum size could not be based on this, for other bacteria commonly used method. However, it was noticed that growing campylobacters in Brucella broth for 24 hours yielded consistently approximately 10 to the 8th CFU/ml. The mean cell density for bovine isolates was 8.2 log10 CFU/ml with the standard deviation (SD) of 0.3 when campylobacters were pre-incubated in broth (n = 140). By direct inoculation the mean cell density was 8.9 log10 CFU/ml (SD 0.2, n = 156). Cell densities for the QC strain were 8.3 log10 CFU/ml (SD 0.2, n = 24) and 8.9 log10 CFU/ml (SD 0.2, n = 27) respectively. Preincubation in broth yielded more accurately the target inoculum size of 10 to the 8th CFU/ml. All VetMIC TM -results of the QC strain for erythromycin, nalixidic acid, oxytetracyclin and gentamicin by both methods were within tentative QC ranges given by NCCLS. Slight differences could be seen in distributions of results between methods. Based on the results we set QC limits of 2-8 mg/l for ampicillin and 0.25-0.5 mg/l for enrofloxacin to be used in our laboratory for the modified method. The results suggest that the modified broth microdilution method presented here is reliable and reproducible for testing antimicrobial resistance in C. jejuni. Conclusions: Early presumptive reporting of Salmonella can be achieved with a positive LDC profile with confirmatory serology 3 h after isolation on chromogenic media and also on media that utilise hydrogen sulphide as a discriminatory character. Comparison of three Clostridium difficile toxin assays, C. difficile GDH-antigen EIA, C. difficile GDH-PCR, bacterial culture and cytotoxicity assay for the diagnosis of C. difficile-associated diarrhoea K. Sachs, G. Ackermann, A.C. Rodloff (Leipzig, D) Objectives: Clostridium difficile-associated diarrhoea (CDAD) remains the leading cause of nosocomial-acquired diarrhoea. Prolonged hospital stay and diagnostic and therapeutic procedures due to CDAD cause additional costs. The present study had the aim to assess the value of different assays to detect C. difficile infections among patients with nosokomial diarrhoea. Among the 50 stools with a positive toxigenic culture, 24 were positive for the three toxin assays, 9 were positive for Tox A and Tox A+B, 4 for Tox A+B and faecal cytotoxin, 8 for Tox A+B only and 7 for none of the three tests. Among the 4 specimens with positive Tox A+B and negative culture, one was from a patient who had a positive stool culture ten days before. Conclusion: Tox A+B was the most sensitive and highly specific assay for the detection of C. difficile toxins in faecal specimens. Moreover, compared to other detection methods, Tox A+B is particularly fast, easy to perform and has the added benefit of detecting both toxins. A new approach to laboratory diagnostic of infectious gastroenteritis Objectives: To detect the major virulence genes, the clonal diversity, phage types and antibiotic susceptibility evolution of 30 Escherichia coli O157:H7 strains isolated from patients with gastroenteritis in Catalunya for the last 13 years (1990) (1991) (1992) (1993) (1994) (1995) (1996) (1997) (1998) (1999) (2000) (2001) (2002) (2003) . Methods: The main virulence genes from E. coli O157:H7 were characterized by classic PCR with specific primers for the phageencoded cytotoxins stx1 and stx2 genes (shiga toxins 1 and 2), eae-gamma1 (specific O157:H7 intimin) and the plasmidic ehxA gene (enterohemolysin). We also studied the chromosomal encoded eae (intimin) gene and the plasmid encoded pO157 gene (pCDV419 plasmid). The serotypes were confirmed by multiplex PCR, detecting the somatic antigen O157 (rfbEO157 gene) and the flagellar antigen H7 (fliCH7 gene). The epidemiologic subtyping was performed by pulsed field electrophoresis (PFGE) method. Cleavege of the agarose-embedded total genomic DNA was achieved with XbaI. Phage typing (16 strains) was carried out in the Enterobacterial Department of the Carlos III Health Institute. The sensitivity of the 30 strains was assayed with 23 antibiotics using the Kirby-Bauer method. Results: PCR showed that 21 (70%) isolates harboured both stx1 and stx2 genes (stx1+/stx2+) whereas 8 (26.6%) only carried stx2 gene (stx1-/stx2+). Only 1 (3.3%) strain carried the stx1 gene at all (stx1+/stx2-). The specific O157:H7 eae-gamma1 gene, the pCDV419 plasmid, the enterohemolysin, as well as the somatic and flagellar antigens, were detected in all the strains (100% Conclusion: Based on our results, the source of contamination was raw chicken. It is important to protect the public from contaminated raw chicken, and to investigate sources of contamination at the chicken farm level. An outbreak of gastroenteritis due to Aeromonas hydrophila M. Carev, D. Tandara, P. Rizvan, Z. Barisic, K. Sisko Kraljevic, E. Borzic (Split, HR) Objectives: Our goal was to report an outbreak of Aeromonas hydrophila gastrointestinal infection due to consumption of contaminated water, in the rural area of Dalmatia County, Croatia. This report warns about diagnostic difficulties and importance of finding Aeromonas in both water and human stool samples. Methods: Our epidemiologist personally interviewed 30 symptomatic and 36 asymptomatic villagers. Four human stools (13.3%) from the diseased were analysed on: Salmonella spp., Shigella spp., Yersinia spp., Vibrio spp., Campylobacter spp., Rota and Adenoviruses, intestinal protozoa and helmint eggs. Six water samples were examined bacteriologically, virologically and parasitologically. Results: All diseased were drinking water from local drinking water distribution system, with pipelines very distant from the water source. Main symptoms were abdominal pain, watery diarrhoea and tiredness. Most of the patients recovered completely after 48 hrs and were only treated symptomatically. 28 persons (78%) from control group didn't drink that water at all.All stool samples were negative on viruses, parasites and bacterial pathogens. The result of water analyses was negative for viruses and intestinal parasites. Bacteriological analyses of first water sample showed that the number of aerobic mesophilic and psychrophilic bacteria per ml was higher than standard. A. hydrophila was isolated from Cefsulodin Irgasan Novobiocin (CIN) agar (>1800 CFU/100 ml). Further analysis of the last two stool samples included additional testing of pink colonies from CIN agar. They were transferred on Kligler Iron Agar and incubated at 37°C and 25°C. Oxydase and catalase tests were positive and Api 20E and BBL crystals confirmed isolates as A. hydrophila. Stool and water isolates showed same susceptibility patterns for antibiotics (resistance to amoxicillin and cefazolin). This was the first confirmed isolation of these bacteria as cause of an outbreak in our County. After cleaning, chlorination and connection to new water source, water samples were in accordance to the standards. There were no new cases. Conclusion: Identical biochemical and antimicrobial susceptibility patterns of human and water strains, with positive clinical findings and epidemiological data showed us that this small outbreak was due to A. hydrophila. This conclusion was supported by negative tests for other pathogens. Real prevalence of this pathogen is still unknown and probably underestimated. Antimicrobial resistance and molecular typing of Salmonella isolates from food Objectives: To study the clonal relationship and the antimicrobial resistance showed by strains of different serotypes of Salmonella spp. isolated from food for human consumption during a one-year period. Methods: Antimicrobial susceptibility to 23 antibiotics was determined by disk diffusion in 380 Salmonella spp. isolates submitted to LNRSSE from all Spanish regions with the following distribution by serotypes: Enteritidis (n = 176), Typhimurium (n = 60) and other serotypes (n = 144). Molecular epidemiology of Enteritidis and Typhimurium serotypes was investigated using PFGE and computerized numerical analysis of the data. Phage typing was also performed. Results: Analysis was carried out with strains without epidemiological link. Analyzed Enteritidis strains (n = 96) were mainly from eggs and derived (27%) and from poultry and derived (24%), detecting 16 phage types (PT) with predominance of PT1 (39%). They were identified 9 pulsetypes, with a similarity genetic range of 81-96%, emerging a frequent clone (74%). Analyzed Typhimurium strains (n = 53) were from sausage and cold meat (21%), pig and derived (15%), and from poultry and derived (15%), detecting 12 DTs, with predominance of DT104 (28%) and U302 (19%). They were identified 13 pulsetypes, with a similarity genetic range of 64-86%, emerging a frequent clone (34%). Antimicrobial resistance rates (NCCLS, M100-S13) for the strains of Enteritidis, Typhimurium, and other 49 different serotypes (n = 115) were, respectively: ampicillin (8, 62 and 14%), spectinomycin (99, 87 and 100%), streptomycin (1, 53 and 59%), gentamicin (1, 4 and 0%), tobramycin (1, 4 and 0%), amikacin (1, 0 and 0%), netilmicin (1, 4 and 0%), nalidixic acid (41, 22 and 14%), tetracycline (16, 72 and 31%), sulphonamide (7, 62 and 21%), trimethoprim-sulphamethoxazole (7, 19 and 14%) and cloramphenicol (0, 51 and 9% Severe pseudomembranous colitis mimicking an acute abdomen in elderly patients L. Legout, L. Bernard, D. Gasselin, M. Assal, P. Rohner, P. Hoffmeyer (Geneve, CH; Paris, F) Background: Pseudomembranous colitis is a life threatening complication of broad spectrum antibiotic therapy caused by Clostridium difficile. The frequency of pseudomembranous colitis with potential fatal outcome is underestimated especially in elderly patients. Patients and methods: We report 5 cases of pseudomembranous colitis in elderly patients who had an adynamic ileus mimicking an acute abdomen. C. difficile was identified by toxins and culture. Plain films of the abdomen and CT were performed for all patients. Results: 5 females ( median age: 83 years-range: 76-95) were admitted in hospital for pneumonia (n = 1), osteomyelitis (n = 2), diarrhoea (n = 1), elective orthopaedic surgery (n = 1) and received a betalactamin (n = 4), or clindamycin (n = 1). Their co-morbidity were lupus (n = 2), diabetes mellitus (n = 1), cancer (n = 1), renal chronic failure (n = 1). They had fever (n = 5), bad general condition (n = 5), cramping abdominal pains (n = 5) following by an acute abdominal (n = 5). The diarrhoea was only present at the beginning of medical history for 2 patients. The biological exams found:white-cell count: 30.7 G/L (15.4-49.7); neutrophils polynuclear count: 25.8 G/L (10.1-41.2), platelets count: 481 G/L (313-622); C-reactive protein: 235 mg/l (180-300); creatinine:129 lmol/l (82-270); urea: 8.5 mmol/l (4-17.8). The liver tests and chest x-ray were all normal. Plain films of the abdomen showed a megacolon (n = 2). Abdomen CT suspected a volvulus of caecum (n = 1), diverticulitis (n = 1), found wall thickening of the transverse colon (n = 4), ascites (n = 1) but no perforation. 2 patients had have an abdominal laparoscopic exploration. After 4 days of treatment with metronidazole, the outcome was fatal for 2 patients due to heart failure. Discussion and conclusions: The diagnosis of pseudomembranous colitis must be evocated in elderly patients especially if an history of antibiotic therapy even a short course (for example perioperative prophylaxis) is found and cramping abdominal pain is associated with a high white cell count (> 25 G/L). If surgical treatment is required, the overall mortality increase. Characterisation of Campylobacter jejuni/coli strains isolated in Serbia and Montenegro In addition, there is lack of evidence about data related to serotype distribution for some geographical areas and also for GBS associated strains. Methods: In this study, we have characterized a strain of thermophilic Campylobacter isolated in a patient with GBS, 37 strains of thermophilic Campylobacters isolated in patients with diarrhoea in Nis, and 6 strains from the collection of the Institute for Immunobiology and Virology ''Torlak'', Belgrad. Strains presumptively identified as campylobacters were differentiated to the species level by a combination of biotyping tests and by the use of a PCR-based RFLP test. HS serotyping was performed using a passive hemagglutination test using erythrocytes sensitized with heat extracted antigens and antisera. Conclusions: TGC is an expanded-broad-spectrum IV glycylcycline with activity against gram-positive, gram-negative and anaerobic pathogens, including strains resistant to commonly used antibiotics. TGC met statistical criteria for non-inferiority to the comparator IMI/CIS and appears to be safe and effecacious in the treatment of hospitalized patients with cIAI. Objective: The purpose of this study was to apply PCR based procedures to assess the stability of pathogen specific nucleic acid sequences present in frozen and archived faecal samples of the English Infectious Intestinal disease (IID). Methods: Faecal samples were collected from cases and controls as part of the IID study and were stored as frozen suspensions for eight to 12 years. Samples were selected from the archive where either Cryptosporidium, Giardia, Salmonella, Campylobacter, enteroaggregative Escherichia coli (EAggEC), In 13 patients more than one bacterium were found. The patients with PPB had 1.7 mean exacerbations/year compared to 1.5 in patients with non-PB. The patients were stratified according to severity of COPD: 18% were moderate (FEV1 ( 50%), 56% were severe (FEV1 (30% to (50%) and 26% were very severe (FEV1 ( 30%). In the very severe COPD group patients with PPB and non-PB had 2.2 and 1.9 and in the severe COPD group patients had 1.5 and 1.4 mean exacerbations/year, respectively. There was not a higher frequency of colonisation in current smokers as compared to ex-smokers neither in the whole group nor when stratified for severity. Conclusion: 46% of the 575 stable COPD patients spontaneously produced sputum, and of these 33% had pathogenic bacteria. There was no correlation between colonisation and current smoking. The patients with colonisation had an increased number of severe exacerbations, even when stratified for severity of COPD, suggesting that the presence of bacteria is clinically relevant. The next step will be to perform intervention studies aimed at reducing colonisation. benefit of this is questionable. The objective of our study was to identify predictors of pneumonia that could contribute to the identification of patients in need of antibiotic treatment. This may lead to a reduction in antibiotic prescribing in the group of patients with non-pneumonic LRTI. Methods: We prospectively studied 364 consecutive outpatients with LRTI. Patient characteristics were registered, a chest x-ray was taken, and blood samples were drawn for measuring C-reactive protein (CRP) and leukocytes. Pneumonia was defined by a transient infiltrate on chest X-ray. Results: Pneumonia was found in 48 patients (13%). The pneumonic patients were older with a median age of 61 years compared to 48 years in the non-pneumonic patients. There were no differences in the occurrence of cough, dyspnoea, chest pain or auscultative abnormalities, but sputum production was less common in pneumonic compared to non-pneumonic patients (69% vs. 83%; p = 0.03). The median CRP was higher in pneumonic patients (73 mg/l vs. 11 mg/l; p ( 0.01), as was the median leukocyte count (10 · 109/l vs. 8 · 109/l; p ( 0.01). There was no significant difference in the median temperature between groups (37.5°C vs. 37.3°C). The median respiratory frequency was higher (21/min vs. 18/min; p ( 0.01), and the oxygen saturation lower (0.95 vs. 0.98; p ( 0.01) in the pneumonic patients. Conclusions: Pneumonic patients differed from non-pneumonic patients in being older and presenting less often with a productive cough. The respiratory frequency was higher, and the oxygen saturation lower. A promising predictor was found in the measure of CRP found to be higher in pneumonic patients. A point-of-care-test for CRP is available for use in primary care. This may guide the general practitioner in identifying patients with LRTI in need of antibiotic treatment. Materials and methods: Epidemiological records of all community outbreaks of legionellosis reported to the Department of Health of the Generalitat of Catalonia (6.3 million inhabitants), Spain, excluding those of nosocomial origin, during the period 1990-2003 were studied. An epidemic outbreak was considered as the appearance of two or more epidemiologically-related cases of legionellosis. Descriptive variables were recorded for each outbreak and a comparative analysis made of outbreaks occurring between 1990 occurring between and 1996 occurring between (period I) and 1997 occurring between and 2003 . v 2 test was used to compare qualitative variables. Results: Ninety outbreaks were studied. The origin was determined solely by epidemiological data in 47 (52.2%), and by epidemiological data and molecular biology in 6 (6.7%). The origin could not be determined in the remaining outbreaks. Cooling towers were involved in 34.4% of the outbreaks. The annual evolution of the number of outbreaks has been progressively greater from 1990 with a clear increase from 1999 onwards. 71.1% of the outbreaks occurred in the period June-October. The total number of people affected in all 90 outbreaks was 558 and the median number affected per outbreak was 3 (range 2-113). The average age of those affected was 57.3 years (SD 10.8) . Hospitalization was required in 463 (82.9%) cases and 27 people died (global case-fatality rate 4.8%). The outbreaks during period I were smaller, the average age of patients was higher and the outbreak was detected later. The case-fatality rate was significantly higher in period I than in period II (12.2% versus 4.1%). In period I, the diagnostic methods used were BCYE and serology, whereas 97.1% of the outbreaks in period II were diagnosed by the urinary antigen test. Conclusion: In Catalonia, the number and size of LD outbreaks has risen clearly from the 1990s to the present. However, the beginning of the outbreaks was detected sooner and the case fatality rate has fallen significantly. The use of more sensitive diagnostic tests for Legionella and the rapid establishment of appropriate treatment may explain these results. High prevalence of rhinovirus in lower respiratory tract specimens Objectives: The aim of this study was to improve the etiological diagnostic accuracy in patients with severe community-acquired pneumonia (sCAP) using an invasive procedure (IP). Methods: Over a 2-year period, 46 patients showing clinical and radiological characteristics of severe CAP and failing to respond to antimicrobial therapy were studied. 33 males and 13 females with a mean age of 60 years and ranging between the ages of 21 and 84 years were admitted either to the Pneumology Department or Intensive Care Unit (ICU). Severe pneumonia was defined by clinical criteria determined according to FINE score class IV or V. In conjunction to initial routine serological and microbiological diagnostic tests on blood, urine and sputum (if available), Bronchoalveolar Lavage (BAL) or Transthoracic Fine Needle Agoaspiration (TTFNA) was performed to identify the responsible infecting pathogen. Granulocytes (50% and a bacterial culture cut-off (10.000 CFU/ml defined infectious pneumonia. Results: Of the 46 patients enrolled, 10 presented a noninfectious lung disease that mimicked CAP. The final differential diagnoses were: 3 lung carcinoma, 1 ARDS, 2 BOOP, 1 T cell lung lymphoma, 1 drug parenchymal damage, 1 Wegener's Granulomatosis, and 1 unknown diagnosis but granulocytes (50% in BAL ruled out infectious pneumonia. Of the remaining 36 patients, 1 had a malignancy overlapping infectious pneumonia. By means of invasive procedure, an etiological diagnosis was achieved in 13 cases. M. tuberculosis was isolated in 4 of these cases. Therapeutic treatment was modified in 9 cases. Conclusions: Invasive procedure significantly improved the diagnostic accuracy in patients with sCAP and established the differential diagnosis in noninfectious and unusual infectious pneumonia that mimicked sCAP. Though not routinely used, IP had a substantial impact on the etiological diagnosis and decisively influenced change in therapeutic strategy in a selected number of cases. The implementation of IP proved to be a safe and effective means of reducing therapeutic failure in sCAP. Identification of unsuspected or resistant pathogens would otherwise have been unattainable and patient survival reduced. The unexpected findings of pertussis by 16S rDNA sequencing in broncho-alveolar lavage fluid in an immunocompromised patient in an endemic setting S. Dudman, T.Ø. Jonassen, M. Steinbakk (Lørenskog, N) Objectives: The immunization of infants has reduced the prevalence of pertussis in Norway, however in 1997 an epidemic of whooping cough started to spread in older children and adolescents throughout the country. Pertussis is a notifiable disease and in 2002 a total of 3182 cases were reported. The diagnosis of this disease can be made by the isolation of B. pertussis or detection by PCR from respiratory secretions, as well as using serological methods (ELISA) at our laboratory. This paper reports the results from the different methods used, and describes a case where pertussis was found unexpectedly. Methods: All cases of pertussis were included from January 1st to October 31st 2004, and the positive rates were calculated according to the different laboratory methods. For the case of pertussis detected in broncho-alveolar lavage fluid, medical records were obtained. Results: A total number of 458 patients were diagnosed with pertussis during the observation period. In some patients, the organism could be found in two different specimens. 391 (15%) out of 2614 samples were found positive by serological methods. 74 (8%) out of 954 samples were found to be PCR positive. In 6 (5%) of the 110 cultured samples, the B. pertussis could be isolated from nasopharyngeal secretions. In one case the bacteria was isolated from a blood culture. In addition, one case was detected in broncho-alveolar lavage fluid, this patient suffered from chronic lymphatic leukaemia. He was admitted to hospital because of a fever, dyspnoea and a dry cough, and was diagnosed with interstitial pneumonia. 16S rDNA sequencing performed directly on the culture negative broncho-alveolar A prospective study was performed that comprised 407 hospitalized adult patients with community acquired pneumonia (CAP). Chlamydia pneumoniae (CP) as a cause of CAP was detected in 13.27% (n = 54) and it was a single cause in 10.32% (n = 42). The diagnosis was made serologically with EIA and MIF assays. Mean age of the patients with CP pneumonia (n = 42) was x = 47, 57 years (s = 18.26). There were 66.7% (n = 28) males. Clinical, laboratory and radiographic findings were analysed and compared with a control group of patients with bacterial etiology of the CAP (n = 80). The analysis of radiographic changes prior to admission in the hospital of those patients with Chlamydia pneumoniae pneumonia revealed that only half of them had interstitial infiltration (v 2 ‡ 100, p £ 0.001) and the remaining had alveolar or mixed infiltration. Beside of domination of diffuse extension of changes in 71.4%, in 16.7% of the patients with CP pneumonia there was lobar and in 11.9% segmental extension of the infiltration in the lungs (v 2 = 10.54, p = 0.0144). Pleural effusion was found in 7.1% (v 2 = 1.177, p = 0.758) of the patients with CP pneumonia and hilar adenopathy in 23.8% (v 2 = 1.959, p = 0.16). Partial regression of the changes was found in 4.8% and contra lateral progression in 2.4% (v 2 = 2.85, p = 0.24). Infiltrations were more frequently in lower lobes either left or right (v 2 = 3.5857, p = 0.3098). In order to increase the percentage of patients with CP pneumonia who would be initially treated with adequate antimicrobial therapy, multifactor regression and discrimination factors analyses were done based on the results obtained. This was followed by postulating diagnostic algorithm for making more exact diagnosis -Chlamydia pneumoniae pneumonia. Surveillance of probably bacterial pneumonia in children less than 5 years old in two geographical areas in Argentina The prevalence of Mycoplasma pneumoniae in hospitalised children with lower respiratory infections community -acquired pneumonia (CAP) or extrapulmonary symptoms. 2. To provide epidemiological data for the seasonal distribution and the annual incidence of Mycoplasma pneumoniae infections. Materials and methods: A total of 1074 patients from 2 to 14 years old with symptoms and signs compatible with CAP were enrolled during a 4-year period (2001) (2002) (2003) (2004) . Thorax radiography and paired sera were obtained from each patient and the course of illness was monitored uniformly. Specific IgG and IgM antibodies were measured by enzyme linked immunosorbent assay (Remel, USA) and Immunocard based IgM EIA (Meridian France). The children were divided in three age groups: Group A: 2-6 years old Group B: 7-12 years and Group C: more than 12 years. The serum CRP concentration was also determined by nephelometry. of the sample were 80-year-old or older, 27% had an age between 60 and 79, 16% between 40 and 59, and 13% between 18 and 39. Comorbidities were very common since up to 83% reported at least one of them. Of these, their frequency was as follows: previous hospital admittance in the last 5 years 22%; COPD 13%; diabetes mellitus 10%; smoker 10%; previous episode of pneumonia 8%; malignancy 7%; immunosuppression, chronic heart failure and cerebrovascular disease 5% each; hepatopathy 4%; alcoholism and nephropathy 3% each; others 2%. Antibiotics were already being taken before admission in 26.2% (penicillins 8.6%; macrolides 6.2%; quinolones 5.6%; cephalosporins 3.9%). The data of proper influenza and/or pneumococcal vaccination was of no use in the medical management of these patients. The antecedent of vaccination was acknowledged in 0.6% and 0.8% of the subjects studied. Only 0.2% of the subjects were participating in a clinical trial of CAP. Mean, median and modal length of hospital stay for the CAP episode was 11.3, 9 and 8 days, respectively. Five per cent of the subject entered the ICU with a corresponding mean, median and modal stay of 9.3, 5 and 1 day, respectively. Fine variables were properly recorded in only 1722 subjects (53.3%), whose distribution is broken down in the Table. Conclusions: The occupation rate of hospital admitted adult CAP was 37.9/100 beds/year. There was a male predominance and a clear trend age disbalance as 71% of the patients were at least 60 years old. 26.2% of the subjects were already taking antibiotics when admitted. 47.2% of the subjects were admitted to hospital with very low Fine scores (I-III), but hypoxemia occurred in 34.1% of them. Hospital differences in the diagnostic microbiological workup in patients admitted to hospital with community-acquired pneumonia in Spain E. Pérez-Trallero, J.L. Pérez, C. García-Rey, R. Landínez, J. Garau on behalf of the NACER Group Objectives: The processing of microbiological samples is known to yield different results depending on many external factors some of them logistic in nature. We sought to assess the differences in microbiological workup in patients with community-acquired pneumonia (CAP) admitted to 10 Spanish hospitals. Conclusions: (1) Microbiological confirmation was obtained in only 22.4% of the patients and diagnostic performance varied considerably among centres (Mean: 20.1%; Min: 7.1%, Max: 39.0%). (2) Large differences were observed among hospitals in the number and the quality of the diagnostic microbiological procedures done. (3) Globally, only 57.2% of the adult patients with CAP admitted to hospital had blood cultures done (range: 29.4-82.6%). Besides centres with a lower proportion of blood cultures ((55%) seemed also to have done them more frequently at the wrong time, and in fact, blood was drawn before starting antibiotic therapy in 78.7% of the episodes. Therefore, a proper blood sample for microbiological processing occurred in 45.0% (4) Success in obtaining sputa from patients was also diverse, but even in those providing sputum for microbiological exam a considerable proportion was done while on antibiotic treatment. Mean proportion of sputa obtained was 41.7%, and properly obtained in 43.2%. Clinical presentation of community-acquired pneumonia in adults admitted to hospital in Spain J.L. Pérez, J. Ruiz, J.E. Martín-Herrero, R. Dal-Ré, J. Garau on behalf of the NACER Group Objectives: To assess the frequency of classical signs and symptoms of acute pneumonia in a large series of adult patients with community-acquired pneumonia (CAP) that required hospital admission. Methods: Retrospective review of the hospital charts of patients admitted to the hospital with the diagnosis of CAP over a 1-year period in 10 geographically scattered hospitals in Spain. All patients admitted from 1 November 2001 to 31 October 2002 were included. Data were available from 3233 patients. Results: Fever defined as an axillary temperature >38°C was present in only 38.7% of subjects, and its presence decreased in patients with high risk Fine score (groups IV-V) compared with low risk Fine score (groups I-III) (35.0% vs. 45.4%; p ( 0.0001). Leukocytosis was present in 68.9% and the sputa were purulent in 53.8%. An abrupt onset was recorded in 34.7%. Hypoxemia occurred in 45.2%, hypotension in 9.3% and mechanic ventilation was needed in 3.1% of the subjects. Based on the above results, the estimated probability of the classic association of fever, leukocytosis, purulent sputum and abrupt onset, typical of classic pneumococcal pneumonia would only have taken place in 5% of the adults patients with CAP admitted to the hospital. As for chest X-ray films, 85% of the cases were unilateral, and 77.6% were monolobar. A predominant alveolar pattern occurred in 80.3%, an interstitial in 7.2%, pleural effusion in 11.3% and only 1.1% presented cavitation. Conclusions: (1) In real practice classic clinical presentation of bacterial pneumonia does not fit well with that presented in patients with CAP admitted to hospital. Isolated signs and symptoms have not a good sensibility as predictors of admission to hospital in CAP. (2) Only 5% of subject can be expected to present a classic pneumococcal presentation. (3) An alveolar chest X-ray pattern was predominant in our experience. Pleural effusion was not uncommon at all since it occurred in one tenth of subjects. (4) The proportion of patients with a body temperature >38°C decreases as Fine store increases. Objectives: Acute lower respiratory tract infections (LRTIs) in elderly are of great concern to general practitioners since their course is often more complicated. Classification into low-or high risk may improve medical care, hence reducing unnecessary treatment and target monitoring and therapy more efficiently. Our objective was to develop a prediction rule for 30-day hospitalization or death in elderly primary care patients with a LRTI. Methods: To develop a prediction rule we retrospectively analysed easily obtainable medical data from 3166 episodes of physician-attended LRTI including pneumonia, acute bronchitis and exacerbations of COPD in patients ‡65 years of age. Characteristics were identified that were predictive for 30-day hospitalisation or mortality. We subsequently developed a prediction rule with the use of logistic regression. Results: Hospitalization or death in 30 days, occurred in 274 (8.7%) of all episodes (2.4% all cause mortality). Increasing age, male gender, hospitalization in 12 month prior to diagnosis, heart failure, diabetes, use of oral glucocorticoids, use of antibiotics in the prior month and a diagnosis of pneumonia or an exacerbation of COPD were predictors for hospitalization or death. Patients with £3 points had a 97 % chance of an uncomplicated course. Patients with ‡8 points had a 30% chance of hospitalization or death. Conclusions: This prediction rule discerns elderly patients with high or low risk for hospitalization or death. Classification into risk groups can help the general practitioner to adjust his preventive and therapeutic decisions to the expected prognosis. This might lead to fewer complications and lower costs. Objectives: Mycoplasma pneumoniae (MP) is an etiological agent responsible for 10-30% of community-acquired pneumonia cases. Pneumonia due to MP is labeled under atypical pneumonia infections. MP may be detected in all parts of the respiratory system, and its effects are well recognized and documented. In respect to diagnosis and treatment, the most prominent structural feature of MP is the lack of a cell wall. It has been shown that surface-exposed polypeptides elicit immunogenic response, in particular those that are involved in the attachment organelle of MP. This attachment organelle is composed of a complex of polypeptides, in which P1 Cytadhesin Protein has a major role. Due to its high immunogenicity P1 is a paradigm for utilizing a definitive antigen in sero-diagnostical systems. On the way to produce either a recombinant-or a peptide-based antigen of a similar nature, a modified extraction procedure of membranous proteins has been employed. Methods: MP cells were exposed to the non-ionic detergent Triton X-114. The same detergent was applied then on the separated membranes, extracting insoluble proteins in a temperature-dependent way. The antigenic activity of the revealed extract was tested in ELISA with characterized sera, utilizing detection systems specific to IgG, IgM and IgA. Results: The insoluble phase of the Triton X-114 extract was comprised of a single 65 kDa polypeptide, as shown in SDS-PAGE. The soluble phase of the extraction, as well as the currently used antigen in SeroMP test, has shown multiple bands. Comparison in ELISA between the three preparations revealed that the antigenic activity of the insoluble extract is comparable to that of the current assay. This result was repeated for IgG, IgM and IgA, meaning that the majority of the antigenic activity in the insoluble fraction may be attributed to the 65 kDa polypeptide. Conclusions: The current observation is supported by previous works that have indicated the same size of polypeptide as a detergent extractable and being associated with the attachment organelle. We show here the antigenic potential of the 65 kDa extracted in our modified procedure, which reveals a comparable activity as the current assay. This finding identifies the 65 kDa polypeptide as an appropriate candidate to be used in diagnostic tests. Nowadays legionellae are known as common water bacteria with ability to cause outbreaks and epidemics of both: Legionnaires' disease and Pontiac fever. In the time of intensive traveling of people the laboratories must be capable to type environmental and human isolates and to give clear answers about the source of infection. In Bulgaria there were no data concerning the typescope of the L. pneumophila strains circulating in the potable waters. We present here the results from a pilot study for the typing L. pneumophila (Lp) strains isolated from water samples from three geographically different Bulgarian regions. After isolation of the strains they were subjected to characterization by the use of serogroup specific techniques, monoclonal antibody and Amplified Fragment Length Polymorfism (AFLP) typing methods. Water samples collected from buildings located in one west and two east Bulgarian regions revealed presence of variety L. pneumophila isolates. A total of twenty six Lp strains were isolated. The predominant serogroup was Lp serogroup 1, but there were also 7 isolates belonging to Lp serogroup 6, Lp serogroup 8 and Lp serogroup 15. Co-contamination of water samples with different Lp serogroups was observed. The most frequent Lp serogroup 1 monoclonal subtypes were Knoxville and Allentown. The obtained AFLP profiles show good discriminatory power. Our results from this pilot study point that Lp serogroup 1 is not so rare finding in our potable waters as it was considered in the past based on a restricted study in one town Lp serogroup 15 was isolated for the first time in our country during this study. The necessity for use of a complex of methods for clear epidemiological typing was demonstrated. The results show that more extensive studies are needed to give clear picture of the environmental distribution of Lp types in Bulgarian waters and to compare Lp types from environmental sources with those from clinical cases of Legionnaires' disease. Methods: The records of hospitalized pneumonia patients were screened for MI and results of antibiotic treatment (AT). 222 records with MI were selected for years 2000-2002. There were evaluated presence of clinically significant pathogens, the time between MI and beginning of AT, accordance between pathogens sensitivity (SN) to antibiotics and real AT, results of AT. The MI were interpreted as utilized if SN was available before of within 3 days after the beginning of AT according SN. The MI were interpreted as non-utilised if pathogens were not identified, or SN was available 3 days after beginning of AT, or there were discrepancy between SN and real AT. Clinical effectiveness of AT was determined in the case of utilised and nonutilised MI. Also it was evaluated the number of MI needed to determine SN; the formula 'Number needed to screen' (NNS) was used to calculate the number of MI with SN needed to prevent one case of ineffective AT. The cost of total number of MI was compared with the buying costs of second-line antibiotics such as 3rd, 4th generation cephalosporins, vancomycin and carbapenems for course of treatment. The other costs associated with ineffective first AT course were not calculated. Results: In the case of pneumonia etiologically significant pathogens were identified in 44% of probes, it means that 2.27 MI were done to get one SN. In the case of utilised and nonutilised MI the effectiveness of AT was 95% and 47% respectively, based on these figures NNS calculation demonstrate that 2.09 MI with SN were needed to prevent one case of ineffective AT. So the total number of MI needed for prevention of one case of ineffective AT was 4.74 (2.2 multiply 2.09). The costs of 4.74 MI were significantly less than the buying costs of any secondline antibiotics. Conclusion: MI significantly increase the effectiveness of AT of pneumonia. In the hospital were investigation was performed the direct buying costs of second-line antibiotics were higher than cost of MI. To increase the effectiveness of MI it is necessary to reduce number of MI without pathogens, MI with wrong SN and MI which are not used by physicians for selection of AT. In the settings with other cost structure to evaluate economical effectiveness of MI it may require to calculate the full costs associated with ineffective AT. The outcome of non-hospital pneumonia depending on pre-hospital tactics during patient's first application for medical aid A. Vertkin, A. Naumov (Moscow, RUS) Aim: Elaboration, introduction and evaluation of the effectiveness of clinical recommendations for treating patients with nonhospital pneumonia on the pre-hospital stage. Methods: The research was carried out in 1081 patients with community acquired pneumonia (CAP). The patients were divided into 3 groups: I -431, patients diagnosed with CAP, in a number of cases, was not confirmed while in hospital; II -391,the tactics of treating CAP on the pre-hospital stage did not correspond to the clinical recommendations; III -259 patients with confirmed CAP, the diagnosis of which and the prehospital treatment corresponded to the clinical recommendations. The patients of all the groups were comparable. Results: On the pre-hospital stage the clinical picture was evaluated only in 4% of the patients, on average. The underestimation of the clinical picture caused hyper diagnostics of CAP on the pre-hospital stage, whereas in hospital, the absence of characteristic complaints and physical signs of CAP allowed to evaluate the situation adequately and to change the diagnosis. On the pre-hospital stage the patients of group II did not have the clinical criteria of CAP (70.3%)in the accompanying documents, their concomitant diseases were not revealed (81.4%), the anamnesis and data about the previous treatment were not collected, the adequate treatment of CAP was not carried out (antibacterial drugs were not administered in any of the cases). The risk of unfavorable termination was known to be not evaluated in 47% of the cases, and the hospitalization of more than one third of the patients was non-profile. Besides, the index of the pre-day lethality came to 12.1% and the general lethality came to 4.6%. in this group. In group III all the patients had the symptoms of CAP which allowed to evaluate the degree of the disease severity correctly, to administer the therapy of antibiotics -amoxicillin (Phlemoxin Solutab) in the case of non-severe pneumonia and ceftriaxon in case of severe pneumonia and to carry out correct sorting of the patients. The pre-day lethality came to 3.1% and the general lethality came to 2.3%. in this group. The time of group III patients' stay in hospital came to 17 ± 3.4 days, and that of group II patients came to 21 ± 4.7 days (p ( 0.05). Moreover, the necessity of antibacterial therapy changing in group III, when in hospital, occurred only in 13.1% of the observation, whereas in group II it happened in 34.3% of the cases. Comparison the bacteriology and beta-lactamase production of the tonsils and adenoids surface and core flora Objectives: Adenoidectomy and tonsillectomy, indicated for children with recurrent or persistent symptoms of infection or hypertrophy, are among the most frequent operations performed in children. This study was carried out for investigating the microbial surface and core flora of the tonsils and adenoids. Methods: Core and surface cultures were taken from the tonsils and adenoids of the 40 patients at the time of the surgery for tonsillectomy and adenoidectomy. Patients' ages ranged from 3 to 13 years (mean age 6.6 years). Specimens were inoculated onto 5% sheep blood, chocolate, EMB agar and Haemophilus medium (BioMerieux/France). For anaerobic bacteria, core samples were inoculated onto anaerobic blood agar and incubated in Genbaganaer pockets (Biomerieux/France). The anaerobic plates examined at 48 and 96 hours. Aerobic organisms were identified by conventional methods and anaerobic organism were identified by VITEK ANI (Biomerieux/France) systems. Chocolate agar and Haemophilus medium (HAEM) were also compared for Haemophilus influenza identification. Results: One hundred and thirty three aerobic bacterial isolates were recovered from surface of the tonsils, 111 from core of the tonsils, 128 from surface of the adenoids and 74 from core of the adenoids. Eight anaerobic bacteria were identified from core of the tonsils and 14 from core of the adenoids. The most frequently isolated microorganisms were alpha-haemolytic streptococci, Neisseria spp, and H. influenza. Beta-lactamase producing bacteria (BLPB) were found in all patients. The most frequently BLPB were Staphylococcus aureus (100% of the isolates), H. influenza (58% of the isolates), and Neisseria spp (45.2% of the isolates). Potential pathogenic microorganisms (beta-haemolytic streptococci, S. aureus, H. influenza and S. pneumoniae) were isolated in 33 patients. Conclusion: This study demonstrates a polymicrobial aerobicanaerobic flora in both adenoids and tonsils. There was a close relationship between the bacteriology of the tonsil and adenoid core and surface flora. We could not find any statistical difference between the bacteriology and BLPB of the tonsil and adenoid core and surface flora. HAEM and chocolate agar were also found similar for H. influenza but for H. parainfluenza a statistical difference was found. Microbial colonization of laryngectomy stomas M. Villar Vidal, E. Eraso, L. Madariaga, C. Marcos, A. Acha, J. Aguirre, G. Quindó s (Bizkaia, E) Objective: To investigate the microbial colonization of the stoma of laryngectomy patients. Patients and methods: Nineteen consecutive patients who had previously undergone laryngectomy were recruited from the Odontology Clinic of our University. Swabs were taken from the laryngectomy stoma site. Microbiological culture and isolation were performed following standard procedures in Columbia agar and Candida ID2 chromogenic agar plates (bioMérieux, France). Identification of isolates was done by catalase production detection, differential growth in Mannitol-Salt agar, Slidex Staph Plus latex reagent and ID 32 STAPH (bioMérieux). Slidex MRSA detection test (bioMérieux) was used for the evaluation of methicillin resistance. Results: Despite no clinical sign of infection, 13 patients were carriers of potentially pathogenic microorganisms (68.4%). Staphylococcus aureus was detected in the stoma of 10 patients (52.6%). Methicillin-resistant S. aureus (MRSA) were not isolated. Staphylococcus epidermidis was isolated from three patients (15.8%). Staphylococcus xylosus was isolated from the stoma of a patient (5.3%) also colonized by S. aureus. Candida albicans and yeast species were not isolated from these clinical specimens. Conclusion: We have found a high incidence of colonization with Staphylococci in laryngectomy stomas with no clinical signs of infection. These microorganisms could be the potentially source for superficial or deep infections. The epidemiology of peritonsillar abscess disease in Northern Ireland Results: 128 patients with confirmed peritonsillar abscess were treated as inpatients accounting for 1 in 10,000 per year of the population in the hospitals' catchment area. The mean age was 26.4 years (range 9-78). Sixty-nine (54%) patients were male; the mean length of hospital stay was 3 days. Needle aspirates, swabs of pus, throat swabs and blood were submitted for microbial culture. Culture yield was greatest from needle aspirates, and was similar even with prior antibiotic exposure, although the relative frequency of pathogens was different in the group who had received prior antibiotics. Beta-haemolytic streptococci were the most common isolates, however a variety of pathogens were implicated. Throat swabs and blood cultures were typically unhelpful. The results of culture and sensitivity did not affect individual patient treatment, but reviewing the sensitivities demonstrated frequent resistance of isolates of Group A beta-haemolytic streptococci to macrolide antibiotics. Heterophil antibody testing was routine and revealed that Epstein-Barr Virus infectious mononucleosis had a prevalence of 1.8% in this population. Conclusion: We support the view that aspirates of pus from peritonsillar abscesses should be periodically cultured to guide empirical antibiotic management since performing cultures in every case may be unnecessary. Patients who have taken antibiotics prior to aspiration may be included in such surveillance. Single-dose azithromycin microspheres versus three-day azithromycin for the treatment of group A beta-haemolytic streptococcal (GABHS) pharyngitis/tonsillitis in adults and adolescents Objective: Antibiotic therapy for GABHS pharyngitis is recommended for earlier symptom resolution, prevention of complications, and reduced spread of disease. Azithromycin (500 mg QD for 3 days) is an effective treatment for documented GABHS pharyngitis in adults. A novel microsphere formulation of azithromycin now makes it possible to administer a full course of therapy as a single dose while maintaining tolerability and optimizing compliance. The objective of this study was to test the hypothesis that a single 2.0 g dose of azithromycin microspheres is bacteriologically noninferior to 3 days of azithromycin (500 mg QD for 3 days) when used to treat adults and adolescents with GABHS pharyngitis/tonsillitis. Methods: This was a Phase III multicentre, randomized, double-blind, double-dummy trial conducted in North America, Europe, and India. The primary endpoint was bacteriologic response at Test of Cure (TOC; Day 24-28) in the Bacteriologic Per Protocol (BPP) population. The secondary endpoints were clinical response at TOC and safety. Results: Five hundred ninety-eight subjects were enrolled in the study; of the 594 treated subjects 420 (70.7%) were included in the BPP population. Bacteriologic eradication was achieved in 86.3% (177/205) and 81.4% (175/215) subjects in the azithromycin microspheres and 3-day azithromycin groups, respectively at TOC (95% CI (2.1, 12.0). At Long-Term Follow Up (LFTU; Day 38-45), bacteriologic recurrence was observed in 5.5% (9/163) subjects in the azithromycin-microspheres group, compared with 7.7% (12/156) subjects in the 3-day azithromycin group. Clinical cure was observed in 99.0% (203/205) of subjects in the azithromycin microspheres group and 96.7% (208/215) in the 3-day azithromycin group. Both treatments were well tolerated and most adverse events were mild to moderate in intensity. The most frequent adverse event (AE) was diarrhoea/loose stools, which occurred in 11% of both treatment groups. No subjects in either group discontinued treatment due to treatment-related AEs. Conclusion: A single 2.0 g dose of azithromycin microspheres is as effective and well tolerated as 3 days of azithromycin (500 mg QD) for treating GABHS pharyngitis in adults and adolescents. Predicting prognosis and effect of antibiotic treatment in rhinosinusitis Background: In dealing with patients with suspected rhinosinusitis , family physicians have to rely mainly on history, physical examination and plain radiographs. Yet, evidence of the value of this information for the management is sparse. The aim of this study was to examine whether in patients with suspected rhinosinusitis illness duration and/or the effect of antibiotic treatment can be predicted on basis of clinical symptoms/signs or radiology. Methods: Participants were 300 patients with suspected rhinosinusitis participating in an RCT comparing amoxicillin with placebo. By means of Cox regression we assessed the association between the presence at baseline of rhinosinusitis symptoms/ signs or an abnormal radiograph and the subsequent illness course. By testing for interactions we investigated whether the presence at baseline of any of these symptoms/signs could predict a beneficial effect of antibiotic treatment. Results: 'Poor general condition' {Hazard ratio 0.77(0.60-0.99)} and 'reduced productivity' {(HR 0.68(0.53-0.88)} at baseline were independently associated with a prolonged course. None of the classical sinusitis-like symptoms, nor abnormalities on radiography had any prognostic value. Prognosis also remained unchanged whether or not the patient was treated with antibiotics, regardless of his baseline symptoms. Conclusions: In a representative group of patients with suspected acute rhinosinusitis in FP, neither the presence of sinusitis symptoms/signs nor an abnormal radiograph provided information with regard to the prognosis or effect of amoxicillin treatment. Patients who felt poorly at baseline, or didn't feel able to work, needed more time to recover, but this could not be influenced by amoxicillin. Effects of moxifloxacin and clarithromycin on the chlamydial gene expression in treatmentrefractory persistent Chlamydia pneumoniae infection J. Rupp, V. Wobbe, M. Maass (Lü beck, D) Objectives: Chlamydia pneumoniae causes chronic infections that have been related to asthma bronchiale and atherosclerosis. These chronic infections cannot be eradicated by short-term antimicrobial treatment due to a non-replicating persistent state of C. pneumoniae that survives and continues to synthesize mRNA in the presence of antibiotics. It is unknown if antibiotics modify the gene expression profile of these persistent chlamydiae in a clinically relevant manner. Therefore, we analysed the differential expression of selected genes in the presence of moxifloxacin and clarithromycin, which both are active in acute chlamydial infection, using a model of chlamydial persistence in peripheral blood monocytes (PBMC). Methods: Persistent infection with C. pneumoniae was initiated in PBMC in established methodology. Infected cells were continuously exposed to moxifloxacin (3.1 lg/ml) or clarithromycin (2 lg/ml) or kept in antibiotic-free medium. Differential gene expression of selected C. pneumoniae target genes (type III secretion: LcrD, YscL, YscN; inclusion membrane: IncA, IncC; amino acid metabolism; TyrB, GlyA) was quantitatively analysed between 1 and 192 h after infection by RT-PCR using the LightCycler system. Results: In antibiotic-free medium gene expression levels varied individually over time for each gene analysed. However, all target genes showed a 5-to 9-fold upregulation of mRNA peaking at 120 h under exposure to moxifloxacin. This was less prominent under clarithromycin. Conclusion: Our initial expectation to further reduce transcription levels in persistent C. pneumoniae by adding antibiotics proved wrong. The surprisingly clear upregulation of gene expression under moxifloxacin rather indicated a general regulatory effect of the drug on the pathogen. This is the first demonstration that chlamydiae in the persistent state are not completely inert and show a reaction to antibiotics. It is under investigation whether protein synthesis is upregulated in parallel. The potential clinical relevance of this finding regarding host cell response and course of the infection remains to be analysed in in vivo models for which this study provides the basis. The application of a validated risk score safely reduces the rate of hospital admission in patients with community-acquired pneumonia presenting to the emergency department Objectives: Patients receiving a diagnosis of community acquired pneumonia (CAP) in the hospital Emergency Department (ED) need to be carefully evaluated to be treated as in-or out-patients. The Pneumonia Score Index (PSI) is a validated score predicting the short term risk of death in patients with CAP and could therefore assist in deciding whether a single patient with CAP needs to be hospitalized or not. Methods: We implemented a computer-based critical decision pathway for the management of patients with CAP, based on the PSI score and a dedicated software (GesPOrEx ª ). Briefly, all adults aged >18 years with provisional diagnosis of CAP were eligible for inclusion in the study. All patients received written information about their diagnosis of pneumonia and their treatment plan. CAP was defined as the presence of new pulmonary infiltrate on chest Rx and symptoms consistent with pneumonia, including cough, dyspnea, change in sputum, pleuritic chest pain. The PSI score was then calculated for all patients meeting eligibility criteria. Patients with scores of 90 points or lower were recommended for outpatients treatment, whereas those with higher scores were recommended for hospital admission. The PSI score was used only as a guide to the admission decision and did not superseded clinical judgment. The follow-up consisted of two visits, within 10 days and about 1 month after discharge from the hospital. Results: The protocol was applied to 117 consecutive patients with CAP presenting at our ED. Compared to the previous year, we detected a significant 37% reduction (p < 0.001, 95% CI 26-49%) in the rate of admissions to the hospital of patients with CAP. Moreover, the length of stay in the hospital showed a trend toward reduction (from 9 ± 2 days before protocol implementation, to 7 ± 5 days). In the 3 months follow up, we did not detect any re-hospitalization in patients treated as out-patients and the rate of cure was similar before and after the protocol implementation. Conclusion: We estimated that the application of this critical pathway generated a potential saving of about 110.00 Euros in one year. Interestingly, after the study end the trend towards a reduction in admission rate for CAP patients was maintained, thus suggesting that the use of the PSI score entered clinical practice with persistent beneficial effects on clinically safe and cost-effective management of CAP patients. Adult community-acquired pneumonia. Evaluation of the antibiotherapy proposed in an emergency department and analysis of the impact of training L. Piglione, V. Blanc, L. Lerousseau, D. Rafidiniaina, C. Rotomondo (Antibes, F) We evaluated the quality of adult communityacquired pneumonia (CAP) probabilist antibiotherapy within an Emergency Department and the influence of a targeted training on this prescription. Methods: Study took place in a medium sized general hospital. All the files related to patients admitted for the diagnosis of CAP and hospitalized were reviewed in a prospective way by a local committee of independent Experts during the first half-year 2003 (T1) and the first half-year 2004 (T2), and compared. Between the two periods, the prescribing physicians have been trained (educational sessions based on the guidelines for pneumonia care of the French Society of Infectious Diseases (SPILF)). Three major quality indicators were used: initial molecule selection, dosage and time to first dose. Cost of antibiotherapy was calculated. Results: 53 files were selected during T1 and 42 during T2. The 2 groups were well matched (age, sex, Fine's score). Inadequate initial molecule selection decreased from 43% to 29% (NS), inadequate dosage decreased from 4% to 0% (NS). Time to first dose was <4 hours in the 2 groups. Between T1 and T2, the prescription of amoxicillin increased by 15%, at the expense of fluoroquinolones ()13%) and of the 3rd-generation cephalosporins ()9%). Macrolides prescription remained stable. Antibiotherapy cost decreased by a 2.5 fold ratio (p < 0.05) Conclusions: Our work demonstrates that, even if the dosage errors are rare and the antibiotic therapy is always early, there was a mediocre adhesion to the recommendations as regards to the choice of the molecule, before the intervention. Even though results obtained with our targeted training are modest, they are encouraging as they increased the use of guidelines recommended antibiotherapy, and leaded to significant cost gain. The development of different educational strategies is essential for the application of good medical practices for a better patient's management from the moment they are admitted in the Emergency Department. Moraxella catarrhalis replacement in the nasopharynx of asymptomatic children A. Sulikowska, P. Grzesiowski, W. Hryniewicz (Warsaw, PL) Objective: The aim of the study was to analyse, using phenotypic and molecular methods, the dynamics of nasopharyngeal carriage of Moraxella catarrhalis in asymptomatic children sampled at two time points with a 4-month interval. Methods: 77 children (43 from an orphanage and 34 from a day care centre -DCC) were examined twice, first in Winter and again in the following Spring. Clinical data and information about sex, age, socio-economic status, respiratory tract infections and antibiotic treatment within 3-months prior the sampling, were collected by questionnaire. Nasopharyngeal swabs were processed and M. catarrhalis was identified by standard procedures. The b-lactamase production was determined using the nitrocefin test. Pulsed-field gel electrophoresis (PFGE) of BcuIdigested M. catarrhalis DNA was performed to determine the relatedness among isolates. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 Results: Altogether 58 M. catarrhalis isolates were identified; 35 were derived from children from the orphanage and 23 from the DCC. Thirty children (17 from the orphanage and 13 from the DCC) were colonised in Winter and 28 (18 from the orphanage and 10 from the DCC) in Spring. Fourteen children (9 from the orphanage and 5 from the DCC) were colonised by M. catarrhalis both in Winter and Spring. Out of them only one child was colonised by the same strain during the first and second sampling. In most cases, M. catarrhalis isolated at 2 different points of the year from the same child were unrelated. All isolates of M. catarrhalis were b-lactamase producers. Conclusions: Colonisation of nasopharynx by M. catarrhalis represents a dynamic process -bacteria are acquired, eliminated and re-acquired over a period of 3-4 months. Long-term colonization (over 4 months) involved only 1 of the 77 investigated children. Haemophilus influenzae-isolates in a highly vaccinated population B Grö ndahl (Mainz, D) Objectives: Characterization of invasive and non-invasive Haemophilus influenzae (Hi)-strains has not been done since the implementation of general vaccination against Hi type b in Germany. Methods: Invasive isolates were acquired through a population based, nationwide surveillance using 2 detection systems. Colonizing, non-invasive isolates were isolated from nasopharyngeal aspirates of hospitalized children with acute respiratory diseases. Results: From 09/2001 to 08/2004 a total of 175 invasive isolates were collected, of which 160 (91.4%) could be evaluated. Most strains were non-capsulated (n = 99; 56.6%). The most frequent capsular type was type b (n = 39; 22.3%), followed by types f (n = 19; 10.9%), e (n = 3; 1.7%) and a (n = 1; 0.6%). Types c and d were not detected. There was no increase of 'non-b'-isolates over the observation period. More capsulated Hi (13%) were detected by PCR than by agglutination (n = 62 vs. n = 54). The most frequent biotype was type I (n = 65; 37.1%), followed by type II (n = 51; 29.1%) and type III (n = 26; 14.9%). Only a small proportion of isolates produced beta-lactamase (n = 6; 3.4%). In the same period 102 non-invasive, colonizing Hi were isolated. All strains but one (capsular type e) were non-capsulated. No Hi type b could be detected. The most frequent biotype was type II (n = 41; 42.7%), followed by type I (n = 23; 24.0%) and III (n = 20; 20.8%). Only four isolates produced beta-lactamase (3.9%). Conclusions: Haemophilus influenzae type b as colonizing or as invasive pathogen has almost disappeared in Germany. Replacement was not observed. Invasive or colonizing Hi-isolates rarely produced beta-lactamase (3.4 -3.9%). Objectives: Simkania negevensis, environmental Chlamydia-like intracellular bacterium, has been shown, in a few reports, to be associated to respiratory infections in infants and in adults (1). There is no data available on the prevalence of S. negevensis antibodies or infections from Finland. We developed microimmunofluorescence (MIF) method for the measurement of S. negevensis antibodies and tested paired sera obtained from Finnish children with infectious episode using this method. Methods: Serum samples from 262 children were screened for IgG, IgA and IgM antibodies by in-house MIF test utilizing urografin purified formalinized bacteria of S. negevensis, ATCC strain (VR-1471) as antigens. The incubation time was overnight. If the patient had three sera, the middle serum sample was selected and when only paired sera were available, the last serum was selected for the screening. All S. negevensis positive screenings (a titer of ‡8) were tested with paired sera (or three sera). The presence of IgM antibodies (after removing IgG antibodies with Gullsorb reagent) or four-fold titer rise in IgG or IgA between paired sera were considered diagnostic for acute infection. Results: The prevalence of S. negevensis antibodies was 19 % for IgG, 0 % for IgA and 5.7 % for IgM. Acute S. negevensis infection was diagnosed in altogether 23 (8.8%) of 262 children: in six cases by IgG seroconversions and in 18 cases by the presence of IgM antibodies. Conclusion: S. negevensis antibodies were demonstrated for the first time in Finnish children. Serological diagnosis of acute S. negevensis infection was obtained in 9% of children. Further studies using e.g. direct demonstration of S. negevensis by culture and PCR in clinical samples are needed to elucidate the pathogenetic significance and clinical picture associated to this bacterium. MIF method developed in this study seems to be suitable for the measurement of S. negevensis antibodies and there seems to be no cross-reactivity with Chlamydia pneumoniae antibodies when using this test. Objectives: To describe failure of Clarithromycin in the treatment of pulmonary Nocardia Nova infection, despite in vitro susceptibility to macrolides. Patient and Methods: A 61-year-old male with diabetes mellitus, non Hodgkin's lymphoma after chemotherapy, chronic adrenal replacement therapy (due to lymphomatous infiltration of the adrenals), presented with persistent cough in the previous 3 month. Weakly acid fast bacilii were detected in sputum and treatment with ethambutol, rifampin and clarithromycin was given for presumed MOTT infection. Although the patient reports strict compliance with drug therapy for three weeks, neither symptomatic nor radiographic improvement was noted. Nocardia spp. was isolated from sputum culture. DNA was extracted from bacterial colonies. A 439-bp fragment encompassing the hsp-65 gene was PCR-amplified and subsequently digested with BstEII and HaeIII endonucleases. Bacterial DNA was also PCR-amplified using a primer pair specific for conserved regions of 16S rRNA. The nucleotide sequence of the resulting amplicons was established and analysed using the BLAST software. Results: PCR-RFLP analysis revealed a restriction pattern compatible with that of N. Nova. This identification was ultimately confirmed as N. Nova, (99% homology) based on BLAST analysis of the bacteria 16S rRNA sequence. The isolate was sensitive to erythromycin. The patient received trimethoprim/ sulfamethoxazole with gradual clinical and radiologic improvement. After three month of follow-up he remains well. Conclusions: Nocardia Nova may account for 20% of Nocardia isolates identified as N. asteroides. N. Nova strains were previously noted for their susceptibility to ampicillin, cephalosporins and erythromycin. A macrolide was suggested as an alternative to sulfonamide in nonresponders or those with allergy to sulfa. The apparent disparity between in vitro susceptibility to macrolides and clinical failure warrants cautious use of these antibiotics in N. nova infections. Sequence based identification allows for accurate separation of N. nova from other related species. Background: Although antimicrobial resistance (R) rates among S. pneumoniae (SPN) and H. influenzae (HI) have increased significantly in most countries in the last years, most studies from Brazil report relatively low R rates among these pathogens. We analysed the susceptibility (S) patterns of SPN and HI from Brazil (6 years) for significant trends. Methods: 729 SPN and 566 HI collected from 1998-2003, mainly from respiratory tract and bloodstream infections, were susceptibility (S) tested by NCCLS broth microdilution methods against >30 drugs and the results analysed by year. Results: Results are summarized below: Conclusions: R to PEN has increased markedly among SPN over 6 years (from 3 to 10%). R to T/S also escalated from 50 to 61%, but S to ERY, CLI and TET significantly decreased among SPN strains. R to the antimicrobials tested remained very stable among HI with only some year-to-year variations. R to the newer fluoroquinolones was not detected and CHL showed an excellent spectrum (>95% S) against both pathogens. Objectives: To determine the potency of gemifloxacin (GEMI) tested against S. pneumoniae (SPN) for the years 1999-2004. The evaluation of GEMI compared to other currently marketed fluoroquinolones (FQ) will also be made including mechanisms of resistance (R). Methods: During a six year period (1999) (2000) (2001) (2002) (2003) (2004) , a total of 5892 SPN isolates were collected from medical centres on three continents and tested for antimicrobial susceptibility (S) using reference NCCLS broth microdilution methods and interpretive criteria (M100-S15, 2005). The antimicrobial agents tested included five FQs: GEMI, ciprofloxacin (CIPRO), levofloxacin (LEVO), gatifloxacin (GATI) and moxifloxacin (MOXI). Analysis of the quinolone resistance determining region (QRDR) was performed for 35 FQ-R strains (LEVO MIC at >4 mg/L). Results: The activity of GEMI against SPN over a six year period is shown in the table: During the six years, the rank order of potency (MIC90, mg/L) for the FQs was GEMI (0.03) > MOXI (0.12-0.25) > GATI (0.5) > LEVO (1-2) > CIPRO (2). All FQ median and modal potencies remained stable over the monitored interval. SPN isolates with CIPRO MIC values ‡4 mg/L ranged from 1.6 to 2.1% with no detectable trend towards increasing R across all regions. The most common QRDR mutations among strains with CIPRO and LEVO MIC values ‡4 mg/L were: gyrA (S83F or T), parC (S79F or T and D83N) and parE (I460V). Against these isolates, GEMI maintained the most potent activity at MIC50/90 values of 0.5/1 mg/L and a MIC range of only 0.25-2 mg/L. Conclusions: Among the FQs tested, GEMI was clearly the most potent agent and remains a valuable candidate for treating multidrug R SPN, an increasingly observed respiratory-tract pathogen. During the study years, FQ-R did not increase significantly and S rates to GEMI remained at >99.2% and was unrelated to increasing R among beta-lactam and macrolide antimicrobials. Conclusions: A significant rate of beta-lactamase production in H. influenzae was detected. The prevalence of penicillin intermediate/resistant S. pneumoniae, was high and more common compared with previous years. Empiric therapy with penicillins alone or in low dose should be avoided in this population. Amoxicillin would still be appropriate to treat pneumococcal infections (despite penicillin resistance) and so would be co-amoxiclav. Evidence for the emergence of non-vaccine types causing invasive pneumococcal disease in Spain Objectives: S. pneumoniae (Sp) is an important cause of morbidity and mortality in children and in adults. Vaccination reduces carriage and prevents the disease. In a nationwide point prevalence study, 147 institutions from all areas of Spain collected all Sp isolated during one week (February 16-22th, 2004) . The isolates were sent to a central laboratory for susceptibility testing and serotyping. In this study we analyze the distribution of serotypes and the resistance to antimicrobials of Sp isolated from children and adults. Methods: A total of 360 Sp isolates were identified. Susceptibility testing was performed by the broth microdilution method in cation-adjusted Mueller-Hinton broth with 5% lysed horse blood following NCCLS guidelines. Serotyping was performed by standard methods. The isolates belonged to 251 adults (70%) and 109 children. Origins were: respiratory tract (48%), blood (24%), ear (12%), conjunctiva (7%), CSF (4%), other sterile fluids (3%) and miscellaneous (2%). Penicillin resistance (I+R) was 42%, and erythromycin resistance was 36%. A total of 34 isolates were non-typeable and were excluded for further analysis. The most frequent serotypes (St) were 3, 19F, and 19A. St 14, 19F, and 23F were the most frequent among the penicillin-resistant strains, and St 3 among susceptible strains. The most frequent St of the 96 invasive isolates (blood and CSF) were 14 and 19F, in children and in adults, respectively. Among the 96 invasive isolates, 84% corresponded to St included in the 23-valent (23-V) vaccine, and 46% to St included in the 7-valent (7-V) vaccine. The most frequent non-vaccine St were 6A, 16, 31, 34, 35B, and 35F. A total of 106 (45%)of Sp isolated from adults belonged to St frequently isolated from children (6, 14, 18, 19, and 23) . Considering Sp isolated from all origins, the estimated coverage of the 7-V vaccine was 40% in children and 38% in adults; and the estimated coverage of the 23-V vaccine was 77% in adults. Considering only invasive isolates, the estimated coverage of the 7-V vaccine was 61% in children and 41% in adults; and the estimated coverage of the 23-V vaccine was 79% in adults. Conclusions: These results confirm the high rates of resistance of Sp to penicillin and erythromycin, the spread to adults of St frequently isolated from children, the evidence for the emergence of non-vaccine types causing invasive pneumococcal disease, and the moderate coverage of the 7-valent pneumococcal vaccine. Objectives: To determine the incidence of invasive pneumococcal infections (IPI) in patient groups recommended to receive pneumococcal polysaccaride vaccine (PPV23) as well as outcome of the illness. Methods: All laboratories performing blood and cerebrospinal fluid (CSF) cultures submitted data on isolation of Streptococcus pneumoniae from blood or CSF during 1995-2002. Information on vital status, comorbidities and denominator data on persons at risk were obtained from the Population Information System, National Hospital Discharge Registry, Cancer Registry, National Social Insurance Institution, and National Infectious Disease Registry. The patient's national identity code was used for linking databases. Only the first episode of IPI was included in the analysis. Results: A total of 4357 episodes of IPI were identified (incidence 10.6 cases per 100,000 population). Highest incidence of IPI was seen in patients with haematological malignancy (547 per 100,000 population), organ or bone marrow transplantation (164), males aged ‡55 with chronic obstructive pulmonary disease (143) and persons with HIV (130). The overall casefatality proportions (CFPs) at 7, 28 and 90 days after the positive culture were 9%, 12% and 16%, respectively. At 28 days the CFPs ranged from 1% to 25% in different age groups. In patients aged ‡50 they were significantly higher in men than in women (20% vs 15%; p < 0.01). Patients with non-hematological malignancy and alcoholism had the highest CFPs at 28 days, 31% and 27%, respectively. In patients with hematological malignancy the 28-day CFP was 16% and 6% among healthy adults aged 18-64 years. In adults aged 18-64 years, 931 (42%) of 2216 cases had an underlying condition for which PPV23 is recommended. The incidence and outcome of IPI varied considerably in different patient groups. However, the patient groups with highest rates of IPI were not always the same as those at highest risk of death. The overall mortality associated with IPI was nearly twice as high 90 days after infection compared with the first week, suggesting the contribution of pre-existing illness or long-term sequelae. Among non-elderly adults, the high prevalence of underlying conditions for which PPV23 is recommended emphasizes the importance of vaccinating groups at highest risk of disease and death. Usefulness of prognostic score systems -Pneumonia Severity Index (PSI), CURB-65, and Ewig scores -in community-acquired bacteraemic pneumococcal pneumonia Objectives: Predictive score systems for CAP have all been developed for the heterogeneous group of 'all' CAP, but none have been evaluated for pneumonia caused by a single pathogen. Streptococcus pneumoniae is the most common cause of CAP and the most common cause of fatal pneumonia. We have prospectively studied the accuracy of three score systems, PSI, CURB-65, and Ewig's score, for predicting need of ICU-treatment, and death due to community-acquired bacteraemic pneumococcal pneumonia (BPP). Methods: All adult patients (n = 114) with invasive pneumococcal disease (IPD) and x-ray verified pneumonia at Karolinska and Danderyd Hospitals, Stockholm, Sweden, 1999-2000, were included. 88 patients were treated in the dpt of Infectious Diseases (DID) and 26 patients in other dpts (ODs). Severity scores were calculated according to the original publications and the independent prognostic importance of different variables was analysed by multiple regression analyses. Results: PSI > III, CURB-65 > 1, and presence of 1 major or >1 minor risk factor in Ewig's score all had a high sensitivity, but somewhat less good specificity, for predicting fatal outcome (Table) . The area under the Receiver Operating Characteristics curves for predicting death were between 0.83 and 0.85 for all three tests. The death rate was 12% (14/114), but patients treated in DID had a significantly lower rates than those treated in ODs, 5% (4/88) vs. 35% (10/26) (p < 0.0001). Also within the same severity score strata mortality was lower among patients treated in DID than in ODs. The fatality for a PSI-score of IV-V was 9/20 in OD vs. 4/33 in DID (p = 0.01). No other factors explaining this difference were found in the multiple regression analyses. Conclusions: All score-systems were useful for predicting need of ICU-care and risk for death due to BPP. PSI was the most sensitive, but CURB-65 score more easy to use. That the death rate was 3-4 times higher for patients treated in OD, compared to those treated in DID, despite the same severity score, illustrates that comparisons of mortality between different patient materials must be interpreted with caution, even if the analysis is based on calculation of severity of disease. Prevalence of international clones among invasive isolates from Portugal I. Serrano, J. Melo-Cristino, M. Ramirez (Lisbon, P) Objective: To evaluate the prevalence of international clones recognized by the Pneumococcal Molecular Epidemiology Network (PMEN) among invasive isolates from Portugal. Methods: A collection of 465 invasive isolates from Portugal (1999) (2000) (2001) (2002) described recently (Serrano, I., et al. 2004 . Invasive Streptococcus pneumoniae from Portugal: implications for vaccination and antimicrobial therapy. Clin Microbiol Infect 10:652-6.) was characterized using a combination of macrorestriction profiling, using SmaI and pulsed field gel electrophoresis (PFGE), and multi-locus sequence typing. Serotypes 14, 1, 3, 4, 8, 9V, 23F, 7F, 19A and 12B were the 10 most prevalent overall by decreasing rank order. A total of 12% of the strains were recovered from children <2 years old. Results: By combining the PFGE data with the sequence types (ST) of 104 isolates we were able to identify the genetic lineages of the majority of the strains. We found 66 STs, including 20 novel STs, corresponding to 47 different lineages by e-BURST analysis. Out of the 26 clones currently recognized by the PMEN we found representatives of 5 among our collection: Spain23F-1, Spain6B-2, Spain9V-3, England14-9, Poland6B-20, Greece6B-22 and Colombia23F-26. The clones Greece6B-22 and Spain6B-2 grouped into a single PFGE cluster including 57% (n = 8) of the isolates expressing serotype 6B. An additional 3 isolates belonged to the same cluster as the clone Poland6B-20, such that 79% of the isolates expressing serotype 6B belonged to either one of the clones. In serotype 9V all the isolates (n = 21) belonged to the same cluster as clone Spain9V-3. This same clone accounted for the majority (n = 52) of the serotype 14 isolates. Since the cluster including the England14-9 clone encompassed 9 strains, a total of 98% of the strains expressing serotype 14 belonged to PMEN clones. Among serotype 19A strains, clone Spain23F-1 accounted for 41% (n = 7) of the isolates. The clones Colombia23F-26 (n = 17) and Spain23F-1 (n = 3) accounted for 91% of all 23F isolates. The PMEN clones accounted for 87% of penicillin non-susceptible (PNS) strains, including all resistant isolates, as well as the majority (61%) of the strains resistant to erythromycin. Results: A total of 77 patients with 78 disease episodes and 79 isolates were included. The mean age was 2.5 yrs (1mo-9 yr) and 46 (59%) children were male. Clinical spectrums included occult bacteraemia (22/78, 28.2%), uncomplicated pneumonia (16/78, 20.5%), complicated pneumonia (15/78, 19.2%), meningitis (13/78, 16.7%), septic shock (5/78, 6.4%), septic arthritis (3/78, 3.8%), mastoiditis (1/78, 1.2%), and nosocomial bacteraemia (3/78, 3.8%). 82% of the isolates were penicillin nonsusceptible (MIC > 0.1 lg/mL). Nine children (12%) died, and 6 of them had underlying diseases. A total of 7 serotypes were found and three predominant serotypes, including 23F (30%), 14 (28%), and 6B (27%), were found. Serotype 14 accounted for 14 (45%) of 31 isolates from patients with pneumonia. Serotype 23F isolates (71%) presented more resistant to penicillin than serotype 14 (18%). 31 PFGE types were identified. There were only two genotypes with 10 or more isolates (15 and 10). Fourteen of 15 isolates of genotype 3 were serotype 23F. All 10 isolates of genotype 1 were serotype 14 and 7 of them caused pneumonia. Conclusions: Pneumonia and occult bacteraemia were the two most common presentations. Three were three major serotypes. Relative clusters in two genotypes were identified with one clone associated with serotype 14 and pneumonia. Introduction: Patients with pneumonia resistant to treatment prove to be a common problem in chest Hospitals. Pneumocystis jiroveci (PJ) should always be thought of as an opportunistic pathogen in case of potential, especially T-cell-related immunodeficiency -even if AIDS-disease is not apparent. We report on cases of PJP without associated AIDS-disease in a chest hospital. Objectives: The aim of the study was to investigate frequency, diagnostic procedures, course and outcome of PJP without associated AIDS-disease in our hospital. Methods: In a retrospective study, we evaluated hospitalized patients presenting with pneumonia during January 1st 2003 and August 31st 2004 in our hospital. The identification of the cases with PJP was based upon discharge diagnosis as well as our microbiological database (confirmed PJ in broncho-alveolar lavage by immunofluorescence-test (IFT) and/or PCR). Results: The diagnosis of PJP without associated AIDS-disease could be made in 7 out of 506 patients (1.4%) hospitalized because of proven pneumonia. All 7 patients were treated with immunosuppressive medication prior to admission (indications: pulmonary fibrosis, COPD, and cerebral edema respectively). CD4-cell-counts were substantially decreased (CD4 cells <200/ ll) in 3 out of 6 cases. To establish the diagnosis of PJP a PJ-PCR (using broncho-alveolar lavage as material) was necessary in 5 cases -in all of these cases the PJ-IFT proved falsely-negative. Severe hypoxemia could successfully bridged by non-invasive Ventilation in 2 patients, l patient had to be ventilated invasively. The mortality-rate was 28.6 % (2 out 7 patients). See table 1 for details. Conclusion: PJP is an important differential diagnosis and at the same time a severe pulmonary complication in immunodeficient patients. We were able to confirm the high mortality rates of 30-60 % in PJP-patients without associated AIDS-disease published in literature. As expected, PJ-PCR was superior to PJ-IFT and should therefore be performed on a routine basis for diagnosing PJP. Non-invasive Ventilation demonstrated to be a worthwhile therapeutic Option for bridging severe hypoxemia in patients with PJP. Introduction: The Idiopathic Interstitial Pneumonia (IIP) is one of the most severe pulmonary diseases. Initial chronic inflammation leading to parenchymal fibrosis is the common characteristic of this process; and infectious agents are the possible cause for the initial inflammation. It has been proved that Pneumocystis jirovecii (Pj) mediate an inflammatory response, increasing the permeability of alveolo-capillary membrane and, causes diffuse alveolar damage. Therefore, pulmonary carriage of Pj could play a role in the pathogenesis of the disease. However, the molecular epidemiology of Pj in this kind of patients is still unknown. Objective: To study the prevalence and molecular epidemiology of Pj carriers in IIP patients. Patients and Methods: The study included 95 consecutive patients with a final diagnosis of IIP. DNA was isolated from 80 bronchoalveolar lavage and 15 oropharyngeal wash samples. A nested PCR protocol was used to analyse the presence of Pj. The polymorphisms at mt LSU rRNA region were studied by direct sequencing. A touchdown-PCR protocol followed by RFLP with AccI and HaeIII was assayed to determinate mutations at DHPS gene. Introduction: Pneumocystis jirovecii carriers may exist among cystic fibrosis (CF) patients due to their underlying pulmonary diseases, but their role in the natural history of the disease is poorly understood. The prevalence and molecular epidemiology patients still remains unknown. Moreover, the knowledge of P. jiroveci genotypes distribution may help for understanding the epidemiology of this pathogen. Objective: To describe the prevalence and genotypes distribution of P. jirovecii in a population of CF Spanish patients. Methods: A cross-sectional study was performed in 100 CF patients, including 12 lung transplant recipients. P. jirovecii was identify by nested PCR the mt LSU rRNA gene in respiratory samples (sputum or oropharyngeal washes). The genotype was analysed by direct sequencing at positions 85 and 248. Results: The overall prevalence of P. jirovecii colonization among CF patients was 24%. The prevalence in lung transplant recipients was higher than in non transplanted CF patients. The polymorphism 85C/248C (42.8%) and 85T/248C (28.5%) were predominant, and also genotype 85A/248C (21.4%) was identified; in one case we founded a mix of genotypes. The colonisation is higher in CF patients under 18 years old. Besides, 35.7% patients receiving prophylaxis with cotrimoxazol and 17.2% with azithromycin were colonized for P. jirovecii but none of them developed Pneumocystis pneumonia (PcP) for a year follow-up. The analysis shows concordance in the colonization status between brother groups. Conclusions: They are a high prevalence of P. jirovecii carriers among CF patients in Spain. These data suggest that chemoprophylaxis with Cotrimoxazol and Azithromycin may prevent PcP but not avoid colonization. The concordance observed among brothers support the idea of a common source of infection or person-toperson transmission. This study was partially supported by the and acute leukaemia (21%). 23.5% were blood stem-cell transplant recipients. 66% of episodes were community acquired. 60% had neutropenia at the diagnosis of pneumonia, and 14% were bacteriemic. An aetiologic diagnosis was established in 46% of episodes. Bacterial aetiology was predominant (n = 21, 55%), followed by fungal (n = 17, 45%). The most frequent bacteria were Pseudomonas aeruginosa (n = 8, 21%), Streptococcus pneumoniae (n = 4, 10%), Legionella pneumophila (n = 2, 5%) and Fusobacterium nucleatum (n = 2, 5%). The aetiology of invasive mycosis were aspergillosis (n = 13, 34%, definitive n = 3, probable n = 1, and possible n = 9), and Pneumocystis jiroveci (n = 4, 10%). Diagnostic yield of blood cultures was 14%. TC had diagnostic usefulness in 37%. The global mortality at 30th day was 32%, and in patients with neutropenia was 33%. The presence of neutropenia (p = 0.02; RR 1.9; CI95% 1.05-3.3), bacteraemia (p < 0.001; RR 4.6; IC95%: 2.6-7.9) and multilobar extension (p = 0.01; RR 3.1; CI95%: 1.5-6.5) were associated with severe clinical features in the first 48 hours. The presence of initial respiratory failure was the only independent factor of adverse outcome selected by multivariate analysis (p = 0.001; RR 5.4; CI95%: 1.4-20.6). Conclusions: The incidence of pneumonia in cancer patients is high. Aetiology is eestablished in one half of episodes. Bacteria are the most frequent aetiology, and P. aeruginosa the more frequent specie. Aspergillus spp make up one third of the episodes. Mortality of pneumonia in these patients is high and associated with initial respiratory failure. Treatment was started empirically with ceftriaxone (4 g/d) plus amikacin (1 g/d) and modified according to the antimicrobial susceptibility pattern and was continued for 6-12 months. Results: Nocardia species were isolated from consecutive nine patients. In six of the nine patients (67%), predisposing factors were identified. The most common predisposing factor included receiving immunosuppressive therapy (67%), cadaveric kidney transplant (44%), diabetes mellitus (22%) and systemic lupus erythematosus (11%). Clinical syndromes of nocardial infection seen were pulmonary infection in three patients, cerebral infection in five patients and disseminated infection in one patient. All previously healthy patients developed cerebral nocardiosis due to Nocardia farcinica. The initial antibiotics used were not appropriate in four of the nine patients (44%). However, only two of these four patients experienced relapse and one with relapse died of disease. Overall mortality in our patients was 33%; in two cases death was due to the Nocardia infection. Conclusions: Despite its relative rarity, Nocardia is an important cause of infection, especially for patients with a predisposing factor. The use of imipenem or meropenem in combination with amikacin is suggested for initial therapy of serious Nocardia infections. The duration of therapy should be protracted for 12 months for preventing relapse. Background: S. maltophilia, a nonfermentative gram-negative bacteria is often associated with serious ventilator-associated pneumonia. We sought to determine characteristics of S. maltophilia lung infections in cancer patients who had lowsuspicion of S. maltophilia infection. Methods: All S. maltophilia from respiratory samples during 1998-2004 were evaluated retrospectively. Patients with established risk of S. maltophilia infection such as critical care unit (CCU) stay, mechanical ventilation (MV), neutropenia (ANC <500 cells/lL), HIV infection and underlying structural lung disease were excluded. Results: In 40 patients, median age was 54 ± 16 years, 27 (68%) were male, 10 patients (25%) had severe lymphocytopenia (<500 cells/lL), APACHE II score was 10 ± 4, and 9 (33%) of 27 with hematologic malignancies had acute leukaemia. Fourteen (82%) of 17 BMT recipients had received allogeneic grafts and were being treated for chronic graft-versus-host disease (cGVHD; systemic corticosteroids >60 mg daily prednisolone or equivalent dose). Infection occurred 184 ± 325 days (range, 35-1458 days) after BMT. 15 patients (38%) had refractory or advanced cancer, 7 (18%) had diabetes mellitus and 4 (10%) had COPD. Twenty-three patients (58%) had nosocomial infection. None had either prior S. maltophilia orointestinal, genitourinary tract colonization or concomitant S. maltophilia bacteraemia. Cough was common (n = 24; 60%), dyspnea and fever occurred in 22 (55%) and 16 (40%) patients, respectively. Thirty-three patients (83%) presented with pneumonia while receiving broad-spectrum systemic antibiotics for 7 ± 31 days. Most S. maltophilia (n = 37; 93%) were susceptible to trimethoprim-sulfamethoxazole and ticarcillinclavulanic acid (n = 26; 65%). Fifteen patients (38%) did not need hospitalization. In 25 hospitalized patients, 6 (15%) required CCU admission and 5 MV for 3 ± 5 days. Eight (20%) deaths were attributed to S. maltophilia pneumonia; presence of young age (37 vs 59 years; P < 0.004), prolonged hospitalization (42 vs 14 days; P < 0.01), and high APACHE II score (13 vs 10; P = 0.05) were associated with increased mortality. By univariate analysis, presence of acute leukaemia, APACHE II score >16, MV, CCU stay and cGVHD were poor predictors of outcome, by stepwise logistic regression analysis, only the later 2 emerged as significant prognosticators of death. Conclusions: S. maltophilia pneumonia was a serious lung infection in these non-neutropenic, non-CCU patients with cancer. Usual interstitial pneumonia associated with cytomegalovirus infection after percutaneous transluminal coronary angioplasty M. Falagas, M. Rizos, S. Tsiodras, A. Betsou, P. Foukas, A. Michalopoulos (Athens, GR) Background: Ventilator associated pneumonia due to CMV is a largely unexpected but probably underestimated diagnosis. Methods: We describe a patient with usual interstitial pneumonia associated with cytomegalovirus infection after percutaneous transluminal coronary angioplasty. Results: A 71-year-old woman, with history of diabetes mellitus, was admitted to the ICU of our hospital due to acute myocardial infarction. Percutaneous transluminal coronary angioplasty was performed. Two days following ICU discharge, the patient became febrile 38.5°C with non-productive cough and progressive dyspnoea. Three days later, she was readmitted to the ICU due to severe dyspnoea and type I respiratory failure. The patient was intubated and admission-CXR revealed diffuse infiltrates in both lungs and pleural effusions. The patient was treated with intravenous piperacillin-tazobactam, ofloxacin and teicoplanin. She remained febrile 39°C with no improvement. A chest CT-scan demonstrated confluent opacities in the right upper and middle lobes and in the left lower lobe as well as airbronchograms, an extensive right pleural effusion and a pathological swelling of pretracheal lymph nodes. Serologic tests for CMV revealed positive IgG antibodies, with no IgM antibodies present. An open lung biopsy revealed distortion of lung parenchyma, moderate inflammation and patchy fibrosis with a subpleural accentuation. The fibrotic areas consisted of dense collagen with focal 'honeycomb' pattern alternating with areas of relatively normal alveolar parenchyma. There were also focal alveolar macrophage accumulation, smooth muscle proliferation and focal subpleural fatty metaplasia. The overall pattern was consistent with usual interstitial pneumonia. Some epithelial type II pneumocytes showed atypia with abundant cytoplasma and large pleomorphic nuclei harbouring intranuclear inclusions consistent with CMV infection. Despite treatment with ganciclovir the patient died two weeks later from severe ARDS and multiple organ failure. Conclusion: Clinicians should be aware of CMV associated severe bilateral pneumonia after cardiac procedures even in non-transplanted patients. Correct diagnosis depends on clinical awareness in the appropriate setting along with proof of viral infection. Objectives: The MRSA epidemic in Norway is steadily growing with a more than 10-fold increase in reported cases since 1997. In the last years, a significant increase in MRSA-cases in nursing homes has been reported. In August 2003 a more sensitive method for MRSA detection has been introduced in the reference laboratory for Central Norway at St Olav Hospital. In this same period, we have observed a growing incidence of MRSA in the throat, both alone and combined with findings at other sites of the body. The aim of the present study was to investigate the importance of including throat swabs in MRSA screening. We have examined the occurrence of all new patients positive for MRSA in any site A (in the period January 1st 1997-October 22nd 2004, and B) in the period from August 1st 2003 to October 22nd 2004, the same period the new MRSA detection broth has been in used. Only the first positive specimen-set from new patients, both carriage and infections, were included. In period A the specimens were grown on a selective mannitol agar containing 6% NaCl (2% NaCl after October 2002) and Oxacillin 4 mg/L, whereas in period B the specimens were grown in a selective broth containing phenol red mannitol with aztreonam 75 mg/L and ceftizoxime 5 mg/L. Isolates of MRSA were verified by PCR detection of nuc and mecA genes by PCR in both periods. Objectives: Challenged by an increasing demand for MRSA surveillance and declining resources, clinical laboratories require sensitive and specific screening media to ensure a rapid turn-around-time (TAT) to notification and a low falsepositivity rate if costs and MRSA are to be controlled. Conclusion: While the CFOX plates were more costly, they were significantly more sensitive (P < 0.0001) and specific (P < 0.0001) than MSOX resulting in less material and labour costs. The TAT to notification appears reduced due the ease of working directly from the CFOX plate. Results: Using a breakpoint of R < 19 mm (cefox 10); R < 24 mm (cefox 30) and R < 29 mm (cefox 60) two, three and two mecA positive isolates tested false susceptible, respectively. Five, four and six mecA negative isolates tested false resistant. Zone edges for the 10 mcg tablet were more distinct and easier to read. For S. aureus ATCC 29213 the following zone diameters were found 21-23 mm, 27-29 mm and 29-33 mm, respectively and for S. aureus ATCC 25923 22-23 mm; 27-29 mm, and 32-33 mm, respectively. Conclusions: All three cefoxitin Neo-Sensitabs performed with high accuracy using this challenge set and as good as the results obtained in a recent evaluation of a 10 mcg paperdisk. The cefoxitin 10 mcg Neo-Sensitabs performed slightly better than the 30 or 60 mcg and zone edges were easier to read why we will suggest the use of 10 mcg tablet. Evaluation of lipovitellin-salt-mannitol-agar with an oxacillin and cefoxitin disc as primary screening medium for methicillin-resistant Staphylococcus aureus M. Boudewijns, K. Lagrou, J. Verhaegen (Leuven, B) Introduction: Numerous primary media have been advocated for the enhanced detection of methicillin-resistant Staphylococcus aureus (MRSA). Recently, a lipovitellin-salt-mannitol-agar (LSM) with an oxacillin disk has been described. On this medium, detection of MRSA isolates is enhanced due to production of a lecithinase, which results in enlarged colonies surrounded by a zone of opacification. Also, the use of a cefoxitin disk method has recently been described. It has been reported as being superior to the oxacillin disk method. Aim: To evaluate the performance of LSM with a 1 lg oxacillin disk and a 30 lg cefoxitin disk (LSMoc) as selective and differential primary medium for detection of MRSA from screening specimens. Materials and methods: Screening specimens (swabs of nose and perineum) were obtained from a patient population at the intensive care unit. The LSMoc medium was compared with an in house method using colistin-nalidixic acid agar (CNA) with 5% horse blood by performing parallel inoculation. S. aureus isolates were presumptively identified by colonial morphology and confirmed by coagulase tube test and Vitek 2 ID-GPC testcard. Methicillin resistance on the LSMoc medium was presumptively detected by reading the zones of inhibition around both disks and confirmed by disk diffusion and PBP2' latex agglutination assay. Objectives: Uro-Quick system has been employed to detect methicillin-resistance (met-R) in S. aureus and coagulase-negative Staphylococci (CoNS). In order to achieve full agreement between the antibiotic susceptibility results obtained by the reference method (NCCLS) and the Uro-Quick system, the optimal experimental conditions (inoculum size, time of incubation, antibiotic and NaCl concentration) were determined for S. aureus and CoNS respectively. Methods: 72 met-R Staphylococci including different species (42 S. aureus and 30 CoNS, in which 12 S. epidermidis) heterogeneous in their expression of resistance to b-lactam agents were screened with the Uro-Quick System. S. aureus ATCC 29213 (mecA negative) and S. aureus ATCC 43300 (mecA positive) were used for quality control. Oxacillin (in appropriate concentration following the NCCLS breakpoints) was added in a vial containing 2 ml of suspension of strain to tested (a drug-free vial was used as control). After an opportune time of incubation the instrument printed the results: no growth and a growth curve like the control are representative of a susceptible and resistant strain respectively. Results: The best results were obtained using Mueller-Hinton broth and a concentration of 106 cells/ml for S. aureus and 5x106 for CoNS. All the 42 S. aureus tested grown within 5 hours of incubation and the met-R phenotype was correctly detected within 6 hours in 100% of strains (66.7% and 93.3% in 4 and 5 hours respectively). The 97% of CoNS strains grown within 10 hours of incubation, an insufficient growth within this period of time was observed for 1 strain of S. haemolyticus only. Met-R was correctly detected within 10 hours in 100% of strain grown at this time (55%, 64% and 95% in 6, 7 and 8 hours respectively). Conclusion: On the basis of the present findings, the Uro-Quick system appears to be useful for the rapid detection of met-R Staphylococci. Excellent results were obtained on S. aureus, concerning CoNS our result suggest that there are differences in the growth rate among the various members of this group and in the incubation time necessary for the met-R detection (more isolates of the respective species must be analysed to reach generalized conclusion). Comparison of different techniques to detect methicillin resistance in Staphylococci and evaluation of Vitek2 P523AST cards Ö . Akan, S. Uysal (Ankara, TR) Laboratory diagnosis of methicillin resistance has been a problem and every system should be evaluated before introduction to routine laboratory practice. In this study the results of comparison of disk diffusion (oxacillin 1 mcg disks) (DD), oxacillin agar screen (OAT) tests, miniapi staph 5 AST system (biomerieux) (MA), and Vitek 2 AST p-523 cards (biomerieux) (VT) for detection of methicillin resistance in clinical Staphylococci is presented. MIC values using E-test (AB biodisk) were used as reference. NCCLS procedures and manufacturers' recommendations were used. There was no difference to detect methicillin resistance in DD, OAT,MA and E-tests among 151 S. aureus except false susceptibility in OAT in 2 strains (1.3%) and DD in one strain (0.7%). Randomly selected 50 methicillin resistant 43 methicillin sensitive strains were studied using VT and 13 (14%) strains showed false resistance. Among them 12 showed discordance in oxacillin screening wells and MIC detection wells and could not pass advanced expert system and only 1 (1.1% ) was real false positive. When same validation is applied to 141 coagulase negative Staphylococi (CNS) (116 S. epidermidis, 25 CNS) false negativity was more common in 16 ( 11.3%) OAT (not recommended by NCCLS) and one strain (0.7%) in DD. 5 strains (3.5%) were falsely resistant by MA. For VT validation among randomly selected 81CNS strains (58 S. epidermidis, 23 CNS) only one strain (0.7%) was falsely resistant. 10 (7.1%) strains showed discordance in oxacillin screening wells and MIC detection wells. When we ommitted oxacillin screening well (because of its high antibiotic content to detect resistant CNS) false positivity in 3 strains still remained. Antibiotic susceptibility tests were more compatible in S. aureus isolates. Results obtained from VT shows that this system can be adopted to our routine laboratory practice, but it should be used with complementary tests both for S. aureus and CNS in case of discordant interpretative results between two wells for oxacillin resistance. Comparison of oxacillin resistance screen agar base with real-time PCR and conventional culture for rapid detection of methicillin-resistant A. Anders, G. Geis, S. Gatermann (Bochum, D) Objectives: Rapid and accurate identification of methicillinresistant S. aureus (MRSA) is crucial for therapy and management of infected and colonized patients. The use of conventional culture techniques requires prolonged incubation and timeconsuming isolation procedures followed by identification and susceptibility testing. An accurate diagnosis may take up to five days. The most early point of time for reporting MRSA by conventional methods is after 48 hours. The aim of this study is to evaluate the new Oxacillin resistance screen agar base (ORSAB) and a 24-hour PCR-method for the identification of MRSA in clinical specimen and compare it to the conventional culture. Methods: Swabs from various sites were suspended in 1 ml of 0.9 % NaCl and equal aliquots were used for the three methods. The methods were a) ORSAB (Oxoid) b) real-time PCR detecting the mecA gene and a S. aureus-specific marker after an incubation in a selective broth and c) the conventional culture consisting of a blood agar plate and tryptic soy broth containing 10% NaCl. Objectives: Although Staphylococcus aureus (S. aureus) is relatively easy to cultivate, culture methods require 24 h incubation and conventional identification methods may yield false-positive or false-negative results. Standard susceptibility and penicillin-binding protein latex agglutination tests are timeconsuming because they require colonies to be isolated from 24 h culture or more. The correct identification of S. aureus and the detection of the mecA gene based on molecular methods is considered as a gold standard in the determination of methicillin-resistant S. aureus (MRSA). Many PCR for simultaneous detection of S. aureus specific gene target and mecA gene were developed, but cannot be applied for the direct detection of MRSA from nonsterile specimens such as nasal samples without an isolation step. A more comprehensive real time PCR assay that targets both an S. aureus-specific gene and the mecA gene within a single PCR tube reaction using only one couple of primer and two adjacent fluorescent probes was established and evaluated. Objective: Frequent outbreaks of Staphylococcus aureus infections worldwide emphasizes urgent need for rapid and reliable detection methods for S. aureus, especially in hospital settings and community. The ultimate aim of the study is to identify potential diagnostic marker and to develop DNA based assays that can be used in any microbiological laboratories for the rapid and reliable detection of S. aureus from pure culture and also directly from clinical samples. Methods: To select a genetic target for diagnostic purpose, S. aureus isolates obtained different hospitals in Malaysia were fingerprinted using rep (repetitive element sequence) primers. From rep fingerprint, a marker band present in all isolates was cloned and sequenced. A primer pair to amplify a 197 bp fragment and an oligonucleotide probe was designed from the most conserved region. Primers and probe were tested against 89 local S. aureus isolates and 1 ATCC to validate the ubiquity. The specificity of molecular assays were verified by using genomic DNA from a battery of gram-positive and gram negative bacterial species. The ability of assays to detect S. aureus directly from clinical samples was also tested. PCR and membrane assays were compared for ubiquity, specificity, and rapidity. Results: The rep fragment sequenced with universal M13 primers determined the size of marker as 489 bp, showed high similarity (>95%) to GAP (glyceraldehyde-3-phosphate Dehydrogenase) Operon in S. aureus genome. The molecular assays developed with innovated primers and probe was very successful, as none of other non-S. aureus species showed positive signal confirming the ubiquity and specificity. PCR assay was more efficient in detection of S. aureus direct from clinical samples, membrane assay required purified DNA. In terms of rapidity, both assays produced results in 2-3 hrs. Conclusion: The development of simple and rapid molecular assays with innovated primers and probe, specific and ubiquitous for S. aureus that can even detect S. aureus directly from clinical samples could be applied in any microbiological laboratory for fast diagnosis of S. aureus infection. The novel achievements made in this study will allow the faster and correct identification of S. aureus, establishes the effective antibiotic therapy and thereby controls and prevent future outbreaks. Development of a membrane based assay for the identification of Staphylococcus aureus at species level and detection of multiple drug resistant isolates Objectives: The incidence of Staphylococcus aureus infection has increased in recent years, due to the spread of multidrugresistant isolates. Conventional identification based on biochemical characteristics and determining the antibiotic resistance based on antibiotic susceptibility pattern can identify S. aureus, but the rapidities and efficiencies of these methods need to be improved. Rapid and direct identification of this bacterium from clinical samples (urine) would be useful for the early diagnosis of S. aureus infection in the clinical microbiology laboratory. This study incorporates the development of a single tube PCR system (multiplex) and membrane based assay for the identification of S. aureus and detection of multiple antibiotic resistant isolates directly from clinical samples. Methods: Seventy isolates of S. aureus from different hospitals in Malaysia were studied. The single tube PCR system for the identification of S. aureus and detection of methicillin, gentamycin, erythromycin and vancomycin resistant genes was carried out using a set of published primers. The S. aureus was isolated directly from urine samples by boiling method. The sensitivity of the system was determined by serially diluting the S. aureus culture, an aliquot of each dilution was subjected to DNA isolation and the purified DNA was used as template for PCR. The specificity of the system was verified using a panel of gram positive and gram negative isolates. A membrane based assay was developed based on DNA-probe hybridization technique. Results: The single tube PCR system yielded products of 108 bp for S. aureus (identity fragment), 139 bp for erythromycin, 174 for gentamycin and 533 bp for methicillin resistant genes, when sequenced showed 100% homology. None of the isolates amplified vancomycin resistant gene. The assay was very specific for S. aureus as none of the other gram negative and positive isolates amplified the identity fragment. The sensitivity level achieved with urine samples was 1 CFU with 25 cycles of amplification. Chemiluminescence detection of hybrid obtained from membrane based assay with a minimum concentration of 160 ng probe confirmed the identity of S. aureus and detected the multiple drug resistant isolate. Conclusions: This study demonstrates the practical value, sensitivity, rapidity, specificity and accuracy of the molecular based method for the diagnosis and thereby treatment of S. aureus infections with the right choice of drugs. Efficient genotyping of methicillin-resistant Staphylococcus aureus using a combination of binary markers and single nucleotide polymorphisms Objectives: Staphylococcus aureus continues to be a significant human pathogen. Several lineages of methicillin resistant S. aureus (MRSA) are common agents of nosocomial infections, and recent years have seen the appearance and rapid spread of MRSA clones capable of causing community acquired infections. The objective of this study was to develop an efficient S. aureus genotyping method that is carried out using real-time PCR technology. The method was designed to provide an epidemiological fingerprint and also allow inference of clinically relevant aspects of the phenotype, through identification of the lineage of the genome backbone using SNPs in combination with the testing for the presence of genes that exhibit binary variability. Methods: The basis of our approach to designing genotyping methods is the computerised analysis of comparative sequence databases in order to identify minimal sets of genetic polymorphisms that provide the desired degree of resolving power. Such analyses are carried out using the computer programme 'Minimum SNPs' which assembles sets of single nucleotide polymorphisms (SNPs) empirically on the basis of maximisation of the Simpsons Index of Diversity (D). SNPs were interrogated using allele specific PCR in the real time format (kinetic PCR Objectives: Based on its biofilm forming capacity Staphylococcus epidermidis is the most frequent cause of foreign-body related infections. Several specific factors mediating primary attachment and accumulation have been characterized. In order to analyze the concerted action of these factors methods for in situ expression analysis are demanded. The aim of the present study was to establish a Green Fluorescent Protein (GFP) based reporter gene system in Staphylococcus epidermidis. Results: Therefore we cloned gfpmut3.1 (Clontech) into pASI under the control of a xylose-inducible promotor and introduced the resulting construct into S. epidermidis 1457. However, under xylose induction no significant increase of fluorescence intensity compared to the un-induced control was detected. This finding may be attributed to inefficient translation initiation at the natural Shine-Delgarno (SD) sequence. Indeed, by coupling different SD-sequences from well-characterized S. epidermidis genes in front of the gfp start codon the crucial impact of this element for gfp translation initiation was demonstrated: whereas a strong fluorescence signal was obtained in presence of the hld SD sequence, almost no signal was detected with the sarA SD sequence. The influence of different SD sequences on transcription and translation of gfpmut3.1 was also analysed in real-time transcription and semi-quantitative western blotting experiments. In all constructs investigated an almost identical gfp transcription level was found regardless of the SD sequence present. In contrast, western blot analysis using an anti-GFP antibody revealed huge differences in GFP amounts that corresponded to the respective quantitative fluorescence signal. The calculated half-life in S. epidermidis 1457 is 6.9 h. Importantly, expression of gfpmut3.1 did not interfere with the biofilm-positive phenotype of this strain. Conclusions: In conclusion, using an appropriate SD sequence for optimal translation initiation gfpmut3.1 offers an attractive system for monitoring gene expression in S. epidermidis. Bordetella pertussis is a fastidious aerobic, Gram-negative coccobacillus that causes the classical disease of whooping cough. The clinical manifestations of pertussis are due to the toxins that are produced by the organism locally and not by bacterial invasion. Isolation from blood cultures is extremely rare and to our knowledge this is the third reported case of Bordetella pertussis bacteraemia (1,2). All cases have been reported in immunocompromised patients. The patient was a 63 year old man with a 2 year history of multiple myeloma, initially treated with autologous bone marrow transplantation and currently treated with chemotherapy due to disease progression. One weak after treatment with vincristine, adriamycin and dexamethasone (VAD) he developed a productive cough and fever and was admitted to medical department. On admission C-reactive protein was 131 mg/l, WBC count and chest x-ray were normal and blood cultures were initially negative. He was treated for 5 days with intravenous cefotaxime for suspected bronchopneumonia and discharged in good condition.The patient was readmitted 8 days later with dry cough, hoarseness and fever. C-reactive protein was 270 mg/l and WBC count was 12.7*10 9/l. Chest X-ray was normal and blood cultures were negative. Again bronchopneumonia was suspected, and he was given intravenous penicillin for 7 days. Eventually, blood culture from the first admission revealed growth of an atypical Gram-negative rod from an aerobic bottle. The bacterium was identified as Bordetella pertussis by sequencing of the 16S rRNA gene. The patient was discarged in good condition and treated for 10 days with oral clarithromycin. Norway has experienced an outbreak of whooping cough since 1997 with more than 3000 reported cases annually. Systemic infections may occur in the immunocompromised host. Growth in blood culture may be slow, and prolonged incubation is recommended. Results: 311 patients with bacterial infections were identified. Median age was 65 y (range 20-80 y). Acute leukemias were most common -41%, followed by lymphomas -32%, chronic leukaemia -18%, and myelomas -5%. Only 44% were neutropenic, and 45% were on antibacterial prophylaxis. Sites of infection included respiratory tract -38%, BSI (including catheter-related) -38%, urinary tract -10%, skin and skin structure -8%, and gastrointestinal tract -5%. 221 episodes (71%) were monomicrobial and 90 (29%) were polymicrobial. Gram-positive bacteria accounted for 67% of monomicrobial BSI but only 45% of infections overall (i.e. when polymicrobial infections were also included in the spectrum). Gram-negative bacteria accounted for 33% of monomicrobial BSI, but only 26% of infections overall. More than 85% of polymicrobial infections had a gram-negative component, with P. aeruginosa being the single most common species isolated. The most common gram-positives were coagulase-negative staphylococci, S. aureus, viridans group streptococci, and Enterococcus spp. The most common gram-negatives were E. coli, P. aeruginosa, S. maltophilia, and Klebsiella spp. Background: We have previously demonstrated that procalcitonin (PCT) values higher than 3 ng/mL were associated with fungal invasive infections (IFI) in patients with persistent fever after five days of empirical antibiotherapy during neutropenic phase after Hematopoietic Stem Cell Transplantation (HSCT). Objective: To analyse if PCT is an independent and early diagnostic marker of IFI in high risk adult patients undergoing allogeneic HSCT. Patients and methods: PCT levels were determined in 129 febrile episodes developed by 65 consecutive patients receiving an allogeneic HSCT. There were 72 episodes during neutropenic period and 57 within the second and third phase of immune recovery after HSCT. All febrile episodes were classified according to the final diagnosis in: fever of unknown origin, microbiological or clinical documented infection and noninfectious febrile episodes. The microbiological or clinical documented infection were classified as possible, probable or proven IFI according to the EORTC/MSG criteria. The values of PCT were not included in the classification criteria. Results: The final diagnosis of febrile episodes were: fever of unknown origin in 58 cases, microbiological or clinical documented infection in 54 and non-infectious fever in 17. Among the 54 patients with a documented infection, 29 did not fulfil any IFI criteria, and 8, 15 and 2 had a possible, probable and proven IFI, respectively. Eleven out of 25 IFI cases occurred during the neutropenic phase (neutrophil absolute count, NAC, < 0.5 · 109/L) and 14 cases during the non-neutropenic phase of HSCT. Mean (ng/mL) (±SD) values of PCT on the first day of fever among neutropenic patients were: 1.0 (±0.3) in patients with infections other than IFI (n = 19); 0.9 (±1.3) in possible IFI (n = 5); 1.2 (±2.1) in probable IFI (n = 5) and 0.63 in proven IFI (n = 1). Mean values of PCT on the first day of fever among nonneutropenic patients were: 1.5 (±0.9) in infections other than IFI (n = 10); 6.1 (±3.4) in possible IFI (n = 3); 9.7 (±6.1)* in probable IFI (n = 10) and 6.3 in proven IFI (n = 1), (*p = 0.013, Kruskal-Wallis; OR: 1.1, IC 95%: 0.92-2.1). Conclusions: During the non-neutropenic phases of allogeneic HSCT, a high PCT value on first day of fever is associated significatively with IFI. PCT monitoring could be an early and useful help to the differential diagnosis of febrile episodes in patients with high risk of IFI. Agrobacterium radiobacter peritonitis in a patient on continuous ambulatory peritoneal dialysis Objective: The presentation of Agrobacterium radiobacter peritonitis in an adult under continuous ambulatory peritoneal dialysis (CAPD). Methods: Peritoneal fluid specimens were examined for cells count and were cultured in Bactec Plus culture vials (Bactec plus, Becton Dickinson). After centrifugation the specimen was also cultured on appropriate media for aerobic and anaerobic microorganisms and smears were performed by Gram stain. The identification of bacterium was carried out by standard methods and API-32E, API 32GN (bioMerieux). The susceptibility testing was performed by disk diffusion method. Case report: A male patient aged 87 years, at final stage of renal failure under CAPD for 15 months and deficient renal function, was admitted to hospital because of the appearance of a cloudy peritoneal dialysate effluent and nausea. The patient had a history of three episodes of peritonitis caused by Gram negative bacteria (Klebsiella pneumoniae and Pseudomonas aeruginosa, Flavomonas oryzihabitans, Acinetobacter johnsonii). The patient was successfully treated with IP tobramycin and recovered completely. On day of admission the peritoneal analysis showed 3100 WBC/ìl (96% neutrophills). The patient was treated empirically with IP tobramycin. Forty eight hours after the incubation of peritoneal fluid gram negative bacterium was isolated. Tests for oxidase and catalase were positive. The hydrolysis test of esculine was positive. The bacterium was identified as Agrobacterium radiobacter. The bacterium was susceptible to cefuroxime, ceftriaxone, ciprofloxacin, imipenem, tetracycline and gentamicin and resistant to ampicillin, trimethoprime-sulfamethoxazole, cephalothin and tobramycin. The patient was treated with cefuroxime 750mgx3 IP for three weeks and he recovered completely. Conclusion: Agrobacterium radiobacter is a microorganism found in the environment and more particularly in several kinds of soils and is considered a plant pathogen. In rare cases of immunocompromised patients and especially for patients with transcutaneous catheters or implanted biomedical protheses, Agrobacterium radiobacter has been regarded as the cause of bacteramia and peritonitis. Erysipelothrix rhusiopathiae. Introduction: E. rhisiopathiae is a rare pathogen found worldwide. It is a commensal of a wide variety of vertebrate and invertebrate species but its major reservoir is domestic swine. The greatest commercial impact of infection is due to swine erysipelas. Serious infection in humans in extremely rare and associated with cutaneous infection in those who have had occupational exposure. Clinical manifestations include brain abscesses, osteomyelitis and chronic arthritis. Systemic infection can often be complicated by infective endocarditis, in which the mortality rate appears to be higher than for other organisms. We report a rare case of E. rhusiopathiae joint infection. Case Report: A 74 year old male patient on long term treatment for rheumatoid arthritis presented to clinic with an isolated knee sepsis, associated with a raised CRP and WCC. The knee was aspirated and E. rhusiopathiae isolated from culture broth after failing to grow on initial culture media. There were no other systemic manifestations. No direct occupational exposure was reported. A repeat knee aspirate failed to grow E. rhusiopathiae, but a third aspirate taken at arthroscopy once more isolated the organism. It was assumed that a soft tissue infection with E. rhusiopathiae had led to a bacteraemia which seeded into the rheumatoid knee joint. He underwent prolonged treatment, with a six week course of Clindamycin. Unfortunately, a low grade chronic infection persisted leading to complete disorganisation of the joint. A joint replacement is being considered. Discussion: This report is of interest because of the exceptionally unusual nature of the pathogen and because of the lack of systemic symptoms or history of any social or occupational exposure to explain the presence of the organism. Diagnosis of E. rhusiopathiae was problematical but is essential to ensure effective treatment as most strains are resistant to vancomycin, which is often used empirically to treat bacteraemia due to gram positive organisms. All patients were immunocompromised: 3 of them suffering from malignancies, 2 from diabetes mellitus, one from collagenic disease, one from pulmonary tuberculosis and one from ITP. The microbiologic testing included a combination of methods: • Colonial and microscopic morphology:using the acid-fast Kinyoun-modified stain • Simple biochemical and hydrolysis testing: casein hydrolysis, gelatin liquefaction and decomposition of tyrosine, xanthine and hypoxanthine • Antibiotic susceptibility profiles: susceptibility to cefamandole and tobramycin. Results: A high degree of correspondence between biochemical characteristics and antibiotic susceptibility patterns was noted. All strains were identified as N. asteroides, by both biochemical and susceptibility pattern criteria. Patients were treated either with cotrimoxazole, high doses of imipenem or minocyclin. Three patients died, two suffering from lung cancer and one of ITP. Objectives: Fournier's gangrene is a serious skin and soft tissue infectious-necrotising process in the peri-neogenital area affect-ing adults, usually in their sixties or seventies. Isolated flora from cultures of the necrotic lesion is commonly multi-microbial. Although an idiopathic condition is considered in the past, today a genitourinary, anorectal or dermal triggering factor can be identified in most patients. There are a series of systemic host debilitating disorders such as diabetes mellitus, chronic alcohol abuse, and malignant neoplasia that are associated with this condition and may be considered risk factor to suffer this disease. In this study, 11 patients with FG, eight of whom had uncontrolled DM were investigated for risk factors, clinical signs, laboratory findings and prognosis. Methods: In this study, 11 FG patients who were hospitalized in Gulhane Military Medical Academy Haydarpasa Training Hospital Department of General Surgery Service were presented between 1998 to 2004. Their age, clinical presentation, predisposing factors, microbiology testing, management and prognosis were studied. Broad -spectrum parenteral antibiotics, early and aggressive surgical debridement of the necrotic areas and hiperbaric oxygene therapy were applied to all cases. Results: The mean age was 39.2 (21-79) of 11 FG cases. The average time from begin the symptoms to apply to hospital was 7.2 (3-17) days. The most prominent associated disease was diabetes, affecting 72.7 per cent of the patients, other potential contributing factors included trauma and surgical operations in three cases. The fasting blood glucose levels, HbA1C levels of the diabetic patients were 182-522 mg/dl and 8.1-10.5, respectively. Bacterial culture results revealed a single organism in 28.6%, and more than one organism in 71.4% of the cases. The most frequently isolated bacteriae were Escherichia col, Streptococcus pyogenes and Klebsiella pneumoniae from quantitative tissue cultures. The overall mortality rate was 45 percent. However, the mortality rate among diabetics was 62.5 per cent (P = 0.001). Conclusion: Fournier's gangrene is a very serious life-threatening disorder in especially diabetic patients despite of early aggressive debridement with the use of appropriate antimicrobial therapy. Relationship between uropathogenicity of Escherichia coli and host compromise status Objectives: To evaluate the role that compromise status play in the uropathogenicity of E. coli strains, we set virulence factors and ECOR phylogenetic group against patients with and without compromise status. Methods: 50 E. coli strains from patients with pyelonephritis and negative blood culture and 50 from urinary bacteraemia were analysed for ECOR phylogenetic groups: A, B1, B2 and D; virulence factors (VF) genes: papA, papGI, papGII, papGIII, fimH, afa/draBC, sfa/focDE, hlyA, cnf1, iutA, fyuA, kpsMII, ibeA, traT, malX by PCR. O antigens associated to UTI (O1, O2, O4, O6, O7, O18 and O83) were determined using agglutination microtechnique. Compromise status, obtained from medical records, included immnunocompromise and/or local predisposing factors to urinary tract infection. Results: 58% patients with pyelonephritis and 68% with urosepsis were compromised. Pyelonephritic strains from healthy patients belonged to: group B2 76% and group D 24%, and from compromised patients: groups A and B1 10%, group B2 59% and group D 21%. Urosepsis strains from normal patients belonged to: group A 6% and group B2 94%, and from compromised patients: group A 21%, group B1 6%, group B2 56% and group D 18%. E. coli strains from noncompromised patients were associated to higher virulence score: pyelonephritis 7.52 virulent traits and urosepsis 8.50 than strains from compromised host: pyelonephritis 6.59 virulent traits and urosepsis 7.41. Despite this, only papGII was significantly more prevalent in pyelonephritic strains from healthy patients vs compromised (P < 0.05); whereas malX, papA, kpsMII and fyuA were somewhat more prevalent in normal people with both pyelonephritis and urosepsis that in people with compromise, while the remain traits were similary distributed. Strains from group B2 showed a high virulence score with a mean of 8.34 traits, followed by group D (6.06), group B1 (4.80) and A (4.64) (P = 0.004, group B2 vs others). Conclusions: E. coli strains from normal hosts were predominantly from the ECOR phylogenetic group B2, harbouring a great number of virulent traits and consequently showed a high virulence score; whereas strains from phylogenetic group A and B1, posses few virulent traits and only infect patients with compromise status. However the substantially prevalence of group B2 strains, with a lot of virulent traits, among compromised host, could explain the lack of associations between this condition and reduced virulence. Objective: Peritonitis is the most important complication of continuous ambulatory peritoneal dialysis (CAPD). We reviewed the incidence and the etiology of CAPD-associated peritonitis. Methods: A total of 468 peritoneal fluid samples from 76 adult patients on CAPD were examined from January 2001 to October 2004. Effluent samples were cultured on appropriate solid and liquid media after 10 min centrifugation. In addition 10 ml of fluids were inoculated in aerobic and anaerobic VITAL culture vials (BioMerieux, Marcy-l' Etoile, France). Enumeration of WBC was done using a standard counting chamber. The identification of microorganisms was performed using standard methods and the API systems (BioMerieux). Results: A total of 102 out of the 468 dialysates were positive (21.8%). Two of the positive samples were polymicrobial. Grampositive organisms accounted for 68.3% of the infections of which coagulase negative staphylococci (CNS) were the commonest (35.6%). Gram-negative bacteria were found in 21.1% of the positive samples, anaerobic bacteria in 1.9%, and fungi in 8.7%. Conclusion: CAPD-associated peritonitis was most commonly caused by coagulase negative staphylococci. Prompt identification of the causative agents is essential for the appropriate management of microbial peritonitis in patients on CAPD. Objectives: To report an unusual case of peritonitis caused by N. sicca in a continuous ambulatory peritoneal dialysis (CAPD) patient. Methods: Peritoneal effluent specimens were examined for WBC count and detection of microorganisms by Gram stained direct smears. They were cultured on appropriate media after centrifugation and were also inoculated in Bactec culture vials (Becton Dickinson). The identification of the microorganism was performed by standard methods, biochemical characteristics, colonies morphology and API NH system (bioMerieux). Susceptibility testing was carried out by disc diffusion method according to the NCCLS performance standard. Case report: A female 57-year-old CAPD patient end stage renal failure, was admitted to the hospital because of peritoneal effluent turbidity. She started CAPD eleven months ago. She was suffering from systemic lupus erythematosus for 17 years and was on corticosteroids for 15 years. That was the 1st episode of peritonitis for her. On admission WBCs count of peritoneal fluid was 2.600/ ll (95% neutrophils) and was decreased to 1.000/ ll and 200/ ll at second and third day respectively. On admission was administered cefazolin 1.5 gr I.P. and afterward 300 mg · 6 I.P. for the next 3 days. Gram (-) diplococci (intracellular or not) were seen on direct smears by gram stain. From two peritoneal effluent cultures Gram(-) diplococcus, oxidase positive and strict aerobic was isolated. The colonies were white, opaque, wrinkled, adhesive, peaked. The nitrate reduction was negative. With API NH (biotype:7101, %id:99,8 :1,00 -very good identification) the strain was identified as Neisseria spp group, which included the species N. sicca, N. mucosa I. subflava. The strain was differentiated from I. subflava on the base of colony morphology and from N. mucosa of nitrate reduction. The strain was beta-lactamase negative and resistant to erythromycin, trimethoprime/sulphamethoxazole, clindamycin and susceptible to penicillin, cephalosporines, aminoglycosides, ampicillin, ciprofloxacin and tetracycline. The patient was treated with cefazolin 300 mg · 4 I.P per day for the 18 next days and recovered completely. Conclusions: 'Nonpathogenic' Neisseria spp can cause severe disease in immunocompromised patients. This is the first case report of CAPD peritonitis with Neisseria sicca in Greece and the third world wide. Antibiotic resistance of enterococci in faecal samples from cancer patients E. Chinou, P. Apostolakopoulos, E. Skouteli, A. Georgouli, P. Golemati (Athens, GR) Objectives: The aim of this study was to determine the prevalence of antibiotic resistance of isolated enterococci in fecal samples from oncologic patients. Methods: A total of 38 strains of enterococci were isolated in fecal cultures from 234 oncologic patients undergoing peripheral blood stem cell transplantation (PBSCT) or bone marrow transplantation (BMT) during one year (2003). The fecal samples were inoculated into bile esculin agar plates with and without 6 mgr/lt vancomycin and into an enrichment bile-esculin broth supplemented with 4 mgr/lt vancomycin. The identification of the isolated bacteria was performed by standard methods and the Api-strep system. The susceptibility testing was carried out by disk diffusion method according to the NCCLS guideline and by E-test for vancomycin and teicoplanin. All patients were febrile, with diarrhoea and were treated with antimicrobial agents before stool cultures. Results: From 38 strains of isolated enterococci, 28 strains were identified as E. faecalis, 8 strains as E.faecium and two strains as Enterococcus sp. A total of 19 strains were found resistant to ampicillin (50%) 15 to high level gentamycin (39. 5%), 27 to ciprofloxacin (71%), 21 to tetracycline (55%) and 5 to quinopristin / dalfopristin (13%). All the isolated strains were sensitive to vancomycin, teicoplanin and linezolid. 7 of the 8 isolated strains of E.faecium were observed multidrug resistant and sensitive only to glycopeptides, linezolid and quinopristin / dalfopristin. Conclusions: The present study indicates that the prevalence of V.R.E. in fecal samples from oncologic patients appears to be very low. Ciprofloxacin, a frequently used antimicrobial agent in cancer patients, was the less active of the antibiotics tested. In general, the good activity of the glycopeptides and linezolid tested shows promise for the combination therapy required in enterococcal infection in immunocompromised patients. Objectives: Infections are a major cause of morbidity and mortality in patients undergoing high-dose therapy and subsequent autologous or allogeneic stem cell transplantation (SCT), despite antimicrobial prophylaxis, use of growth factors and newer antimicrobial drugs. Methods: We compared the incidence of early infectious complications between autologous SCT and allogeneic SCT recipients in a single centre over a 6-year period (between January 1997 and June 2004) in 164 consecutive adult patients. Infections occurring within the 30 days after transplant were defined as early infections. Forty-two patients were allografted and 157 autografted. Antimicrobial prophylaxis was mainly quinolones, fluconazole, acyclovir and trimethoprim/sulfamethoxazole. Results: Within the first 30 days, 120 of 164 patients (73.2%) developed febrile neutropenia episodes. Infections were documented in 78 patients (47.6%). Patients undergoing allogeneic SCT tended to have more documented infections compared to recipients of autologous SCT (78.6% vs 36.9%, respectively; p < 0.001). The most frequent infection was bacteremia (41%), followed by urinary infection (19.2%), pneumonia (16.7%) and catheter-related infection (15.4%). Pathogens isolated in 66.7% of the febrile neutropenia episodes were mostly gram-positive organisms (50.6%), followed by gram-negative rods (46.9%) and Candida spp. (2.4%). Predominant pathogens were coagulasenegative staphylococcus (26.5%), E. coli (24.1%) and S. aureus (16.9%). Infections were responsible for 2.4% of deaths after transplantation within the 30 days in all patients. Early mortality associated with infection was 4.8% after allogeneic SCT and 1.6% after autologous SCT (p < 0.005). Conclusions: Febrile episodes are the most frequent complication of both autologous and allogeneic SCT and gram-positive isolates remain the main pathogen in these patients Methicillin resistance is increasing and glycopeptides remain the only choice for treating such infections. The high incidence of febrile episodes and bacteraemia may be due to the lack of efficacy of antimicrobial prophylaxis. Although the infection rate is high, measures taken to prevent and treat infections result in very low rates of mortality from infection in SCT patients. Studies reporting local microbiological findings are necessary because they support an antibiotic choice for prophylaxis or therapy more accurately than reports from other areas. Microbiologically documented infections following peripheral blood stem cell transplantation Objectives: To assess the isolation rate of bacterial and fungal causative agents in early and late infections in patients who underwent peripheral blood stem cell transplantation (PBSCT). Methods: Conditioning and the pre-engraftment period were defined as the early period; the post-engraftment period until one year was defined as the late period. This study was performed to evaluate early and late infections in 114 patients who underwent PBSCT (84 autologous, 30 allogeneic) in a single institution in 1997 until 2003. All the patients received antibiotic prophylaxis (ciprofloxacin, acyclovir, fluconazole and TMP/ SMX orally) and hematopoietic growth factors during neutropenia. Febrile patients received i.v. imipenem or cefepime plus amikacin or ceftazidime plus amikacin. Results: A total of 117 episodes with microbiologically documented infections were seen 90 of 114 patients and 79% of the patients experienced at least one febrile episode with microbiologically documented infections during their post-transplant course. Of these episodes, 69 (59%) were in the early period and 48 (41%) were in the late period. In the early period, 38.8% of causative organisms were gram positive, 51.5% were gram negative and 7.7% were fungi. The most common pathogens were Coagulase-negative Staphylococcus (CoNS) and E. coli in the early period. In the late period, 44.6% of causative organisms were gram positive, 44.6% were gram negative and 6.8% were fungi. CoNS and E. coli were also the most commonly isolated agents in this period. A total of 19 microbiologically documented catheter infections were seen, of 11 were in the early period and of 8 were in the late period. The most common pathogen was CoNS in catheter related infections. Resistance to methicillin was detected 47.4% of S. aureus and 86.5% of CoNS isolates. Susceptibility patterns in gram-negative isolates (percentage of susceptible to tested antibiotics) Conclusions: The isolation rate was in accordance with previous reports; similar percentages of gram positive and gram negative isolates were found in patients with underwent PBSCT. A remarkably low rate of viridans group streptococci and fungi were observed. The spectrum of pathogens detected in these cases serves as the basis for recommendations on the choice of empiric antimicrobial treatment regimens. Therefore, studies reporting local microbiological findings as well as their susceptibility profiles are necessary. We suggest that local microbiologic surveillance should be known before empiric antimicrobial therapy is started in each institution. Detection of human polyomaviruses (BKV and JCV) infection by PCR assay in patients after haematopoietic progenitor cell transplantation Objectives: Two human polyomaviruses BK (BKV) and JC (JCV) are common in population. Following the primary infection both viruses establish latency in renal tissue and in B lymphocytes, 60-90% adults are asymptomatic polyomavirus carriers. Polyomavirus-related disease is largely associated with immunological impairment. JCV is the causative agent of the progressive multifocal leukoencephalopathy in AIDS patients as well as in other immune compromised hosts. In patients undergoing renal or bone marrow transplantation the reactivation of both polyomaviruses may result in hemorrhagic cystitis (HC). Late-onset viral HC mainly related to BKV reactivation is a significant cause of post-transplant morbidity.The aim of the study was to evaluate the frequency and clinical implication of human polyomaviruses infections in children who underwent hematopoietic progenitor cell transplantation (HPCT). Methods: Polyomavirus DNA was detected in plasma and urine with PCR-based assays. Viral DNA was extracted from plasma or urine samples by digestion with proteinase K and purification on Qiagen columns according to manufacturer's protocol. The primers pair amplified a 176-bp sequence from BKV genome and a 173-bp sequence from JCV genome. Digestion of the PCR products with the BamH1 prior to electrophoresis was used to discriminate between BKV and JCV sequences. Results: A regular screening for polyomavirus infections was performed in 103 children who underwent HPCT. BKV was detected in urine of 39 children (37.9%) and in serum of 8 patients (7.8%). JCV was detected in urine of only 4 patients (3.9%) and in plasma of 1 patient. The most frequent clinical manifestation probably related to HPV infection was hemorrhagic cystitis, however almost 50% of HPV positive patients was asymptomatic. Conclusion: In conclusions we demonstrated that rapid identification of viral agents may allow to initiate effective therapy and is imperative to polyomavirus infections following hematopoietic stem cell transplantation. Monitoring of herpesvirus DNA load in children after allogeneic hematopoietic stem cell transplantation -EBV and CMV may be sufficient C.albicans was isolated in 58 of 121 cases (47.9%). 2 strains C.nonalbicans were isolated from blood. Wounds were infected with mixed microflora including Candida spp. in patients who have previously received 2 or 3 lines of antimicrobial therapy and all pts had C.non-albicans from wound discharge. 28 C. albicans and 16 C. non-albicans were isolated from sputum and 26 C. albicans and 27 C. non-albicans were isolated from bronchoscopic materials in pts with clinical and radiographic evidence of pneumonia. Prevalence of C.albicans in sputum may be explained as this material was taken from less severely ill patients, than bronchoscopy, which was undertaken in critically ill patients. Urine was colonized with 4 C. albicans and 13 C. non-albicans. All pts had urinary cateters and didn't have clinical evidences of urinary infection. C. non-albicans consisted of C. glabrata -30 (24.8%), C. parapsilosis -13 (10.8%), C. krusei -6 .0%), C.inconspicua/norvegensis -5 (4.1%), C. tropicalis -3 (2.5%), Ñ . kefyr -2 (1.7%), Ñ . globosa, C. sake, C. lusitaniae, C. dubliniensis -1 strain each (0.8% each). Susceptibility testing performed in 3 more often isolated strains were the follows: All tested strains of C. albicans were susceptible to amphotericin B, flucitozine, miconazole. Intermediate susceptibility was seen to ketokonazole, econazole and nystatin (each -2%) and resistance was revealed to nystatin (2% Comments: qnr gene is still infrequent among ESBL-producing microorganisms, but can be occasionally found. No qnr harbouring, ESBL-producing enterobacteria had been previously described in Spain. In this case, qnr is not enough, in absence of topoisomerase mutations, to produce fluoroquinolone resistance, though mutant selection might be more frequent than in strains which do not harbour qnr. Effect of the plasmid encoded quinolone resistance determinant in P. stuartii on the selection of strains with clinical resistance to ciprofloxacin I. Wiegand, I. Luhmer-Becker, B. Wiedemann (Bonn, D) Objectives: The influence of the plasmid encoded quinolone resistance determinant qnr in E. coli and K. pneumoniae strains with different single target gene mutations, efflux levels and porin patterns has already been studied. None of the strains was clinically resistant to ciprofloxacin. P. stuartii strains show a slightly higher ciprofloxacin MIC in their natural sensitive population than the studied E. coli and K. pneumoniae strains. As we had detected qnr in three different clinical P. stuartii isolates we wanted to determine the influence of qnr in this species on the ability to select ciprofloxacin resistant mutants. Methods: Qnr was transferred to P. stuartii ATCC29914 RifR using the filter mating technique with the qnr-positive strain P. vulgaris Pv123 as donor. A qnr-positive transconjugand (TCPs123) was selected and used for further studies. MIC values were determined by E-test according to the manufacturers instructions. Mutants were selected using inocula of more than 1 · 10 10 cells plated on LB agarplates containing ciprofloxacin concentrations of 2x-32x the MIC. Results: Transconjugands were obtained with a conjugation frequency of 1.2 · 10 )5 . MIC values are presented in table 1. The mutant prevention concentration was determined to be 16x the MIC for both strains. Some mutants that were picked showed normal colony sizes but also minor subpopulations of small colony variants (SCVs). These were shown to be stable on antibiotic free medium for at least three passages. MIC values of four or more representatives of each colony type per strain were uniform within a small range, the median value is given in table 1. Conclusions: For P. stuartii the combination of qnr with a single mutational event can lead to clinical resistance. Thus it is likely that with a single quinolone treatment such single step mutants can be selected. Species other than E. coli and Klebsiella spp. may be an important reservoir for the qnr resistance determinant. Their role in the clinical setting remains to be determined. Evidence of fluoroquinolone-resistant mechanism associated with efflux pump and outer membrane protein(OMP) in Neisseria gonorrhoeae J. Yoo, B. Kim, C. Yoo, W. Seong (Seoul, KOR) Objectives: Ciprofloxacin resistant N.gonorrhoeae in Korea have been dramatically increased 1% in 1999 to 87% in 2003. Although it was known to be mainly caused by mutation within gyrA and parC, the fact which another mechanisms involved in the resistance to fluoroquinolones was well known in other organisms. This study was designed to investigate the evidence of another mechanisms related to resistance to ciprofloxacin in N.gonorrhoeae. Methods: Mutants derived from 2 parent strains which isolated in Korea were obtained after several in vitro selection on GC agar supplemented with increasing concentrations of ciprofloxacin. Amino acid substitutions within the quinolone resistance-determining region (QRDR) of GyrA, ParC were determined. SDS-PAGE and 2D gel electrophresis of outer membrane proteins (OMP) were performed. Results: A significant reduced sensitivity to ciprofloxacin was observed in the selected mutants. MICs of ciprofloxacin for 76mu10 and 92mu13 strains were increased seven-, eleven-fold higher than those of wild type strains respectively. Mutants derived from 76/WT showed the resistance to PEN, TE and CRO either. However, It was observed that mutants from 92/ WT had reduced sensitivity to AZI, TE and increased sensitivity to SPT. On addition of CCCP, a proton motive force uncoupler, MIC of ciprofloxacin for 92mu13 strain was most greatly reduced by 8-fold. The sequence analysis of the gyrA has demonstrated a single mutation at 91(S91Y) or 95(D95N) except 1 strain but no mutations in parC for all mutant. 76mu10 strain only showed both point mutation at 91,95 in gyrA . SDS-PAGE analysis of the OMPs of 76mu10 strain revealed remarkable alteration in the expression of proteins which located in the range from 29 to 50 kDa. And also in 2D analysis, it showed over thirty spots which is changed in amount five-fold. Interestingly, OMPs of 92mu13 strain showed little changes comparing to wild type. We induced the two kinds of mutants in which probably had different fluoroquinolone resistant mechanisms. Although they had one mutation in gyrA , it was strongly suggested that the main cause of resistance to ciprofloxacin was reduction of OMPs or increase of efflux pump by OMPs analysis and genetic analysis. Methods: Susceptibility studies were performed using a microdilution method (Sensititre R) following NCCLS guidelines, and Etest following the manufacturer's procedures. A clonal relationship between the two strains was ruled out by pulsed-field gel electrophoresis. Mutational alterations in the QRDR of gyrA and parC were investigated by PCR and sequencing using the dideoxy method with the Thermo SequenaseTM CyTM5 Dye Terminator Sequencing kit and the Automatic Laser Fluorescent DNA Sequencer. Results: The first ciprofloxacin-resistant S. agalactiae strain (P0162) was recovered in October 2003; the second (P0425) was isolated in September 2004. Both strains were isolated from urological patients previously treated several times with ciprofloxacin.The two ciprofloxacin-resistant S. agalactiae isolates were also resistant to tetracycline and susceptible to penicillin, vancomycin, erythromycin, clindamycin, quinupristin-dalfopristin, chloramphenicol and rifampicin. MICs values of quinolones for P0162 and P0425 strains were: ciprofloxacin >32 mg/L, norfloxacin >256 mg/L, levofloxacin 8 mg/L and >32 mg/L, sparfloxacin 4 mg/L and >32 mg/L, moxifloxacin 0.5 mg/L and 2 mg/L, and clinafloxacin 0.25 mg/L and 0.75 mg/L, respectively. Both quinolone-resistant S. agalactiae isolates showed the same mutation in parC (Ser79Phe), as well as an additional mutation in gyrA. The P0162 strain showed Glu85Ala whereas P0425 strain presented Glu85Lys. Conclusion: This is the first report of S. agalactiae quinolone resistant strains in Spain, whose mechanism of resistance was mutations in parC and gyrA. Both strains were isolated from patients treated with ciprofloxacin, and no clonal relationship was observed among them. Novel gyrB and parE mutations detected in the quinolone-resistance-determining-region of clinical quinolone-resistant Pseudomonas aeruginosa S. Ferreira, T.R. Walsh, S. Mendo (Aveiro, P; Bristol, UK) Objectives: The aim of the present study was to characterize mutations occurring in quinolone-resistance-determining-region (QRDR) region of the gyrA, gyrB, parC and parE genes of the 35 clinical ciprofloxacin and pefloxacin resistant Pseudomonas aeruginosa isolated from patients in a Hospital from central Portugal. Methods: Nucleotide sequences of the PCR-amplified gyrA, gyrB, parC and parE fragments were determined using an automated DNA sequencer. The Biological Sequence Alignment Editor, BioEdit version 7.0.0 was used for DNA and amino acid sequence alignments. Sequences obtained were compared to others deposited in the EMBL Genebank. Results: DNA sequences were analysed for mutations leading to amino acid changes associated with fluoroquinolone resistance. Nine strains harboured a mutation (Thr fi Ile) in the codon 83 of gyrA. Some silent mutations were also found. Four of the P. aeruginosa strains harboured a gyrB mutation that occurred in codon 464 leading to an amino acid substitution (Ser fi Tyr). Two strains showed a mutation in codon 465 (Gly fi Arg), also leading to an amino acid substitution. However compared to the sequence of the gyrB fragment obtained from P. aeruginosa PAO1, some silent mutations were found. In parC, four strains exhibited amino acid substitution (Ser->Leu) in codon 87. A new mutation occurred in codon 35 leading to an amino acid substitution (Asp fi Glu) in two of the strains. Silent mutations were also found in the parC QRDR region. In the nucleotide sequence of the par E gene a few amino acid replacements were found. Those changes occurred in codons 431 (Leu fi Val), 483 (Glu fi Gln), 487 (Ala fi Pro), 530 (Ala fi Pro), 538 (Gly fi Val) and 544 (Gln fi His). Two of these replacements are novel (codon 483, Glu->Gln and codon 487, Ala fi Pro) and both occurred in the same strain. This replacement occurred inside the highly conserved motif EGDSA. Furthermore, silent mutations were also found. Conclusion: GyrA mutants containing a Thr-83-Ile substitution showed higher levels of resistance to fluoroquinolones than mutants containing a different single point mutation. Novel mutations were detected in gyrB and parE genes. Also, the results obtained for parC and par E genes revealed that mutations in type II topoisomerase subunit B are not as rare as they used to be. Single mutations in parC gene among levofloxacin susceptible clinical isolates of Streptococcus pneumoniae E. Mateo, R. Alonso, R. Cisterna (Vitoria, Bilbao, E) Objectives: Levofloxacin (LVX) is recommended for the treatment of community-acquired pneumonia because increasing multidrug resistance in Streptococcus pneumoniae. The incidence of levofloxacin resistance in clinical isolates of S. pneumoniae is relatively low. LVX resistance requires at least 2 mutations in the quinolone resistance determining region (QRDR) of topoisomerase IV and DNA gyrase. The purpose of this study was to determine the prevalence of single QRDR mutations in parC gene of S. pneumoniae. Methods: Sixty-nine levofloxacin-susceptible pneumococci (MICs 1-2 mg/L) were isolated at the Microbiology Service of Hospital de Basuto, Bilbao (Spain) during 2004. Eight isolates showed a LVX MIC of 2 mg/L and 61 isolates showed a LVX MIC of 1 mg/L. We used a PCR-RFLP assay to screen 27 randomly chosen pneumococcal isolates with levofloxacin MIC of 1 mg/L and 8 isolates with a MIC of 2 mg/L for mutations known to confer resistance (parC: S79, D83; gyrA: S81, E85). The QRDR region of parC of isolates with suspected mutations was amplified by PCR and its DNA sequence determined. Results: Of the 27 strains with LVX MICs of 1 mg/L, no strains had a S79 or D83 ParC change. Among 8 strains with LVX MICs of 2 mg/L, 5 strains (62.5%) had a S79 or D83 ParC change. Four isolates showed single parC mutation (S79F, D83G, D83V). Only one isolate showed double parC mutation (S79F + K137N). No mutations in gyrA gene were detected in any strains. Conclusions: Fluoroquinolone resistance among S. pneumoniae remains low, however, an increase in isolates containing a parC mutation has been observed. The selection of parC mutations could be related to the use of levofloxacin to treat S. pneumoniae infections. Mutations in parC and gyrA genes among levofloxacin resistant clinical isolates of Streptococcus pneumoniae R. Alonso, E. Mateo, F. Calvo, R. Cisterna (Vitoria, Galdácano, Bilbao, E) Objectives: The incidence of levofloxacin resistance in clinical isolates of S. pneumoniae is relatively low. LVX resistance requires at least 2 mutations in the quinolone resistance determining region (QRDR) of topoisomerase IV and DNA gyrase. The purpose of this study was to characterize among recent clinical isolates of S. pneumoniae the mutations that conferred resistance to levofloxacin. Methods: Twenty-four levofloxacin-resistant pneumococci (MICs > 4 mg/L) isolated from respiratory samples during 2004 were analysed. Minimal inhibitory concentrations (CMIs) to levofloxacin, gatifloxacin, moxifloxacin, and gemifloxacin were determined by agar dilution method using Mueller-Hinton agar with 5% horse blood. The QRDR regions of parC and gyrA were amplified by PCR and their DNA sequence determined. Results: Levofloxacin resistance was associated with combinations of at least two amino acid substitutions, most commonly involving ParC Ser79Phe (23/25), and GyrA Ser81Tyr (20/25). Of the 24 strains, three strains showed single parC mutation (S79F) and a double gyrA mutation (S81Y + E85G). One strain showed a K137N substitution in ParC and no mutations were found in the QRDR of gyrA. This strain may be harbour mutations in gyrB gene. None of the 24 strains was susceptible to gatifloxacin; twelve and twenty isolates were susceptible to moxifloxacin (CMI < 4 mg/L) and gemifloxacin (CMI < 1 mg/ L), respectively. Conclusions: The results suggest that resistance to levofloxacin require at least two substitutions of amino acids within the QRDR region of gyrase and topoisomerase IV, and that there is considerable cross-resistance among fluoroquinolones associated with these changes. Mechanisms of quinolone resistance in P. aeruginosa strains with efflux pump overexpression B. Henrichfreise, I. Wiegand, B. Wiedemann (Bonn, D) Objectives: The aim of our study was to determine whether additional mechanisms of quinolone resistance (target modification via mutation or protection) can be found in P. aeruginosa (PA) strains with effluxpump overexpression (EPO). Methods: 4 levofloxacin-resistant strains of PA were collected in a German hospital in 2004. EPO was verified by testing Levofloxacin (LEV) MICs using broth microdilution both with and without the effluxpump inhibitor (EPI) MC-270,110. The QRDR of gyrA and parC, furthermore mexR and the intergenic region between mexR and mexA (ir) containing the shared operator-promotor region of mexA-mexB-oprM and mexR were amplified and sequenced. Also, a screening for qnr was conducted. Clonal identity was investigated by multiple-locus variable number of tandem repeat analysis (MLVA). Results: The phenotypic and genotypic characterisation of all strains is shown in Table 1. In 3 strains (1-3) whose LEV MIC was reduced by EPI to the wildtype (wt) level of 0.125 mg/L no aminoacid changes in GyrA and ParC were found. In strain 4 two changes in GyrA and one change in ParC were detected. All strains showed mutations in mexR but no mutations in ir. The exchange of V126 to E in strains 2 and 3 was previously described in LEV-susceptible isolates. Qnr was not detected. MLVA indicated no clonal relationship among all strains. Conclusions: For strain 1 and 4 nalB mutations were observed. The EPO phenotype in strains 2 and 3 could be caused by nalC or by overexpression of other EPs. Contrary to usual findings in our strains no correlation between EPO and target mutation was found. Analysis of sequential isolates of Pseudomonas aeruginosa from cystic fibrosis patients, repeatedly treated with ciprofloxacin by mutant prevention concentration, minimal inhibitory concentration and pulsed field gel electrophoresis J. Blondeau, L. Blondeau, C. Williams (Saskatoon, CAN; Glasgow, UK) Objective: MPC measures the propensity of an antimicrobial (AM) compound to select for AM resistance based on drug concentrations required to block growth of first-step resistant mutants. Cystic fibrosis patients (CFP) are frequently infected with Pseudomonas aeruginosa (PA) and require repeat courses of AM therapy. As AM therapy may precipitate AM resistance, we tested sequential PA isolates from CFP, repeatedly treated with Cpx, by MIC and MPC. Methods: Sequential isolates were collected over a 3-yr period. PA isolates were tested to Cpx and levofloxacin (Lfx) by microbroth dilution in accordance with NCCLS guidelines. For MPC testing, 10 billion organisms were applied to agar plates containing drug and incubated 24-48 hr. The lowest concentration preventing growth was the MPC. PA strains were compared by pulsed field gel electrophoresis (PFGE) using Spe I. Results: Patient 1 (P1) (10 isolates) received 6 courses of Cpx (500-750 mg bid) and patient 2 (P2) 5 courses over the period collected (3 yrs). MICs for Cpx and Lfx for P1 and P2 ranged 0.031-1 lg/ml and 0.25-2 lg/ml respectively; MPCs ranged 1-4 lg/ml (79% £ 2 lg/ml) and 2-16 lg/ml (64% ‡ 8 lg/ml) respectively. PFGE profile for P1 isolates were identical while P2 had 3 different strains. Cpx therapy did result in increased MPC values. Lfx MPC values were higher than Cpx in every instance. Conclusion: This represents first report of MPC testing on sequential PA isolates where AM history was available. MPCs remained constant to Cpx over the duration of organism isolations. MPCs to Lfx were high and beyond achievable and sustainable drug concentrations. As P1, P2 have never received Lfx, yet MPC values were so high, suggests Lfx will more readily select for quinolone resistant PA. MPC can be used to monitor changes in susceptibility and as such guide appropriate selection of AM therapy. Detection of a quinolone resistance-mediating gyrA mutation in a fluoroquinolone susceptible Salmonella live vaccine strain A. Preisler, P. Heisig (Hamburg, D) Objectives: The production of effective vaccines instead of developing new antibiotics is a promising approach to circumvent rapid development of bacterial resistance. Beside an attenuated Salmonella typhi live vaccine strain used in human, S. typhimurium strain TAD Salmonella vacT is being used as live vaccine strain in food-producing chicken. Attenuation of virulence has been achieved by random mutagenesis of the wildtype S. typhimurium DT009 strain M415 followed by selection for reduced virulence. Epidemiological markers of vaccine strain include reduced susceptibilities to rifampicin (rifR) and nalidixic acid (nalR) and the loss of tensid tolerance, presumably associated with altered membrane permeability (marker rtt). Curiously, the vaccine strain retains a high susceptibility to fluoroquinolones and macrolides. The present study aimed at understanding the molecular basis for this phenotype. Methods: TAD Salmonella vacT was characterized by determination of antibiotic susceptibility pattern, generation time, DNA-supercoiling degree, and DNA-sequence of the entire gyrA genes as well as the quinolone resistance-determining regions (QRDRs) of the remaining fluoroquinolone target genes gyrB, parC, and parE -encoding the subunits B of gyrase or A and B of topoisomerase IV, respectively. Results: Compared to its parent, TAD Salmonella vacT showed a reduced growth rate, but no significant changes in the DNA supercoiling. DNA sequence analysis of the complete gyrA gene revealed three novel mutations affecting codons 59 (trp-arg), 75 (gly-ala), and 867 (ser-ile) and one known point mutation at position 87 (asp-gly). Although the mutation at codon 87 is known to mediate quinolone resistance, the vaccine strain is highly susceptible to fluoroquinolones like sparfloxacin, and ciprofloxacin and only moderately resistant to nalidixic acid. Conclusions: Two hypotheses might -alone or in combinationexplain this phenotype (1) At least one of the novel gyrA mutations compensates for the fluoroquinolone resistance mutation (asp-87-gly) and (2) an increase in drug accumulation, resulting from the inactivation of a multi-drug efflux pump (presumably associated with the rtt marker) allows for a higher accumulation of fluoroquinolones -and macrolides-in the cell. Our results point to a combination of both mechanisms and therefore provide a molecular basis to understand the reported stability of the live vaccine in vitro and in the field. Identification of plasmid-mediated quinolone resistance in enterobacterial isolates in Turkey Objectives: The plasmid-mediated quinolone-resistance determinant QnrA has been identified recently from enterobacterial isolates in USA, China, Thailand, Korea, The Netherlands and France. These strains were resistant to nalidixic-acid and most of them produced expanded-spectrum beta-lactamases. Our objective was to evaluate the prevalence of the qnr gene in nalidixicacid resistant enterobacterial isolates recovered at the University Hospital of Istanbul, Turkey, since it is located just between mainland Europe and Asia. Methods: PCR with primers specific for the qnrA-like gene was used for screening. Primers specific for the different ESBL genes were used to identify the corresponding beta-lactamase genes. Mating-out assays were attempted to demonstrate the transferability of the Qnr determinant. Combinations of primers were used to identify the qnr-surrounding sequences. Eighty-eight nalidixic-acid resistant enterobacterial strains isolated in 2004 were studied. Among them, 51 were ESBL producers. Results: The qnrA gene was identified in two ESBL-positive isolates (1% of the ESBL (+) strains), an Enterobacter cloacae and a Citrobacter freundii isolate. The E. cloacae isolate expressed an SHV-5-like ESBL that was encoded on a plasmid that co-transferred the nalidixic-acid resistance in addition to resistance to kanamycin, tobramycin, chloramphenicol, trimethoprim, and sulfonamides. The C. freundii isolate possessed also a conjugative plasmid that harboured the qnrA gene associated with the blaVEB-1 gene and that conferred also resistance to streptomycin, tobramycin, chloramphenicol, rifampin, and sulfonamides. In both cases, the qnrA gene was located downstream of the Orf513 recombinase gene, as previously identified in other qnrA-positive isolates. Conclusion: This study emphasizes that the qnrA gene conferring resistance to nalidixic acid is present in distantly-located European countries. Interestingly, the qnrA gene was found in association with blaVEB-1 gene, that corresponds to the first identification of this latter ESBL in Turkey. Norfloxacin as an alternative marker of decreased susceptibility to fluorquinolones in Salmonella enterica L. Ló pez, A. Gisaeus, A. Pascual (Seville, E; Malmö, S) Objective: Treatment failure with fluorquinolones has been a problem in cases when the salmonella strains show resistance to Nalidixic acid (NAL). The Ciprofloxacin (CIP) MIC value increase if the salmonella strain is NAL resistant so several authors have proposed a change of the Ciprofloxacin susceptibility breakpoint from £1 to £ 0.125 mg/L for Salmonella enterica. The VITEK system is extensively used as automated susceptibility system but NAL testing is not included and the lowest CIP dilution in the VITEK cards is 0.25 mg/L. The aim of this study is to trace Nalidixic acid resistance in Salmonella enterica isolates with the VITEK system, using the Norfloxacin MIC value as a marker of nalidixic acid resistance. Material and methods: Forty-two clinical Salmonella enterica isolates were collected during July-August 2004. The susceptibility tests were achieved by: 1) using AST-N020 cards and the VITEK system (bioMérieux) Methods: Southern-RFLP analysis was also performed to investigate basic structural details of plasmids containing qnrA. Copy number of qnrA was determined by dot blot hybridization. Transcriptional studies were carried out using total RNA isolated from transconjugants grown in the absence or in the presence of ciprofloxacin or moxifloxacin at 0.2, 0.4, 0.8 or 1 x MIC. Results: qnrA is located in plasmids with similar mobility and identical Southern-RFLP (in all four plasmids, the qnrA probe hybridized with one EcoRI fragment of 4.1 Kb). MICs of quinolones against transconjugants from the same donor were identical, but MICs against transconjugants from different parental strains varied within a 4-fold range. qnrA copy numbers in strains UAB1 and 1132 were 8 times higher than in strains 1160, and 2.7 times higher than in strain N5. No differences in qnrA copy number in the E. coli transconjugants were observed. The amount of qnrA transcripts was at least 5-fold greater in the transconjugant from UAB1 than in the transconjugants from strain N5 or 1960 without quinolone induction. Differences in transcription of qnrA in different transconjugants were also noted at both basal levels and after induction by quinolones. A dose-response study of the inducing effect of ciprofloxacin on qnrA transcription was performed with transconjugants from strains UAB1, N5 and 1960, with a maximum effect at 0.4 XMIC. After induction with ciprofloxacin at 0.4 · MIC, transcription of qnrA increased 4.3, 5.1 and 2.6 times over baseline in transconjugants from strains UAB1, N5, and 1960, respectively. Induction of qnrA by ciprofloxacin was 1.04, 2.2 and 2.03 times higher than that caused by moxifloxacin against transconjugants from UAB1, N5 and 1960, respectively. Conclusion: Regulation of qnrA expression may be similar in all four strains. There are differences in qnrA copy number in strains containing this gene. Transcriptional analysis revealed that both ciprofloxacin and moxifloxacin are able to induce qnrA gene, with ciprofloxacin being a better inducer than moxifloxacin. The use of norfloxacin 10 mcg as a screening disc to predict fluoroquinolone resistance in Streptococcus pneumoniae C. Borén, R.W. Smyth, W. Hryniewicz, G. Kahlmeter, E. Sadowy (Växjö, S; Warsaw, PL) Objectives: The use of sensitive screen discs for the detection of antibiotic class resistance is becoming increasingly important. A nalidixic acid disc (30 mcg) has been successfully used for the detection of fluoroquinolone (FQ) resistance in Enterobacteriaceae, Haemophilus spp and Neisseria spp. Cefpodoxime has been used for the detection of ESBL and most recently cefoxitin for the detection of MRSA. We compared the sensitivity of norfloxacin (10 mcg) and ciprofloxacin (1 and 5 mcg) discs for the detection of fluoroquinolone resistance in a collection of FQ sensitive and resistant Streptococcus pneumoniae. Methods: A collection of S. pneumoniae strains with (from Poland) and without (from Sweden) fluoroquinolone resistance mechanisms were tested with antibiotic discs, norfloxacin 10 mcg and ciprofloxacin 1 and 5 mcg, from Oxoid UK. Mueller-Hinton Agar (Oxoid, UK) with 5% defibrinated sheep blood and IsoSensitest Agar (Oxoid,UK) with 5% defibrinated horse blood and NAD were used. Mueller-Hinton agar was investigated with confluent and semi-confluent inoculum while ISA was tested with a semi-confluent inoculum. Ciprofloxacin MIC-values (E-test, AB Biodisk, Sweden) were determined on ISA. All plates were incubated at 35-37 C in 5% carbon dioxide for 18-24 h before measuring the inhibition zones. Strains exhibiting ciprofloxacin MIC-values of 0.125-2.0 mg/L were considered part of the wild type MIC distribution as defined by the EUCAST epidemiological cut-off value (www.eucast.org). Results: Strains with MIC ‡ 32 mg/L were reliably detected with all methods and discs. Most difficult to reliably separate from the wild type distribution were strains with MIC 4.0 mg/L. Irrespective of agar and inoculum the norfloxacin 10 mcg disc more easily distinguished strains with MIC 4 mg/L from strains of £2 mg/L. Ciprofloxacin 1 mcg was slightly inferior to the norfloxacin disc but much more reliable than ciprofloxacin 5 mcg. Conclusion: Using methods based on NCCLS and BSAC/ SRGA methodologies, norfloxacin 10 mcg and ciprofloxacin 1 mcg were preferable to ciprofloxacin 5 mcg in the detection of fluoroquinolone resistance in S. pneumoniae. We suggest that fluoroquinolone resistance surveillance is performed with one of these discs and that ciprofloxacin MIC-determination is performed on strains identified by the screen test. Antibacterial susceptibility studies -II Objective: Antibiotic lock therapy (ALT) is recently recommended for conserving catheters in treatment of central venous catheter (CVC)-related infections. We performed this study to investigate the adequate antibiotics, the concentration of antibiotics, and treatment duration in ALT. Methods : We evaluated the bacterial killing activity of vancomycin, teicoplanin, ciprofloxacin, rifampin, cefazolin, gentamicin, nafcillin, and erythromycin against biofilms of S. aureus (SA204 and SA195) and S. epidermidis (ATCC35983 and ATCC35984). The effectiveness of the antibiotic locks was assayed after exposure to antibiotics (1, 5, and 10 mg/ml) for 1, 3, 5, 7, 10, or 14 days by using in vitro model of biofilms on polyurethane (PU) film. Biofilm bacteria were quantified by the determination of viable counts. Results: Significant biofilm killings were not achieved with cefazolin, nafcillin, gentamicin, and erythromycin at any of the time intervals examined. Objectives: Pseudomonas aeruginosa is an opportunistic pathogen with innate resistance to many antibiotics, predominantly infecting patients with defects in antibacterial defenses. Ultrasound is currently used in medical practice for diagnostic and therapeutic purposes. A recent application of ultrasound is in drug delivery. There are many reports in the literature suggesting that ultrasound activates, potentializes, or makes more effective some pharmacological agents. In this study, we investigated the effect of ultrasound and sMICs of ceftazidime on phagocytosis of Pseudomonas aeruginosa (ATCC 27853) separately and in combination. Methods: The susceptibility of bacteria to murine macrophage killing was examined following exposure to ceftazidime and ultrasound (at a frequency of 1 MHz and power output of 0.25 W). Bacteria were added to macrophage-containing polypropylene tubes. After incubation, centrifugation, and washing of macrophages to remove adherent but unphagocytized organisms, cells were lysed by distilled water. Each sample was plated and after incubation, the number of viable colonies was counted. Results: In vitro, pretreatment of bacteria with sMICs of antibiotic and ultrasound separately resulted in an enhancement of macrophage phagocytosis and killing of the organisms (p < 0.0001). But there was a notable enhancement effect manifested by increased nonopsonic killing following pretreatment of bacteria with those two independent variables in combination (p < 0.0001). Conclusion: These results showed that simultaneous application of ultrasound and ceftazidime has some efficacy in inactivating Pseudomonas aeruginosa, and improves phagocyte activation. The physical mechanism of inactivation by ultrasound alone appears to be transient cavitation, but the mechanism by which ultrasound enhanced antibiotic action may be due to perturbation of the cell membrane or to stress responses by the bacteria. The mechanism of synergistic effect of ultrasound and ceftazidime is unknown and many more attempts should be made. Occurrence of resistance to wide spectrum of antimicrobial agents in clinical isolates of the genus Acinetobacter Objectives: The aim of the study was to determine the occurrence of resistance to 33 antimicrobial agents in Acinetobacter clinical isolates. 1 . 5 · 10 4 2.2 · 10 4 1.1 · 10 4 ND 9.1 · 10 1 1.1 · 10 6 2.7 · 10 1 4.1 · 10 4 4.8 · 10 1 ND 1.7 · 10 1 0 0 3 2 . 9 · 10 4 1.0 · 10 4 9.7 · 10 4 ND 5.6 · 10 1 4.9 · 10 4 3.1 · 10 1 1.4 · 10 1 0 N D1 . 3 · 10 6 0 0 5 3 . 6 · 10 4 1.8 · 10 4 0 N D1 . 2 · 10 1 1.6 · 10 1 8.0 · 10 1 8.2 · 10 1 0 N D0 00 7 1 . 4 · 10 28 5.7 · 10 1 0 N D3 . 0 · 10 1 0 0 1 . 4 · 10 1 0 N D0 00 10 1.1 · 10 28 6.2 · 10 1 0 N D0 0 0 0 0 N D0 00 14 2.4 · 10 28 3.0 · 10 1 0 N D0 0 0 0 0 N D0 00 inoculum. Synergism or antagonism were defined as a decrease or increase major or equal to 2 log10 cfu/ml in the viable count with the combination at 24, 72 h compared with the most active agent alone. Objectives: Non-typeable Haemophilus influenzae (NTHi), a well-known, major respiratory tract pathogen, has recently been shown to be able to invade and persist inside human epithelial cells. In this study we analysed the intracellular in vitro activity of ampicillin, azithromycin, telithromycin, ciprofloxacin and moxifloxacin against NTHi. Methods: Confluent normal human bronchial epithelial (NHBE) cells were loaded with 100 bacteria per epithelial cell for 2 h. Extracellular H. influenzae were killed by gentamicin, and the intracellular bacteria were incubated with fresh invasion medium, supplemented with selected antimicrobial agents at concentrations of 1 and 10 mg/l for further 4 and 8 h. As final step the invasion medium was removed and the number of intracellular viable bacteria was determined after lysis of the epithelial cells. Results: Moxifloxacin showed the highest bactericidal efficacy against intracellular NTHi, followed by ciprofloxacin, azithromycin and telithromycin. During the first 8 h, ampicillin was not able to influence the intracellular survival of H. influenzae in comparison to a control without antibiotic. When compared with the other tested antibiotics, moxifloxacin was most effective in killing intracellular NTHi. Therefore, moxifloxacin, which combines high extracellular and intracellular activity, can be seen as an important tool for the treatment of RTIs. Antibiotic susceptibility of Fusobacterium necrophorum strains causing serious infections R. Hannula, L. Bevanger (Trondheim, N) Objectives: F. necrophorum causes abscesses, mainly in the oropharynx, and Lemierre's syndrome (postanginal sepsis), a rare life-threatening disease in young, previously healthy adults. Long-term antibiotic treatment is often needed.We studied the susceptibility pattern for F. necrophorum in 13 available clinical isolates in our hospital from January 1991 until October 2004. Methods: Four blood-stream isolates and nine other clinical isolates, mainly from abscesses, were available for testing.The bacteria were cultured on fastidious anaerobic agar (FAA) and were identified by their colony morphology, microscopic morphology, chartreuse fluorescence, lipase positivity and biochemically by the rapid ID 32 A (bioMérieux).Bacteria suspended in Brain Heart broth of 1 McFarland turbidity were swabbed on PDM agar with 5% defibrinated horse blood. Etest strips (BIODISK) were applied on the dry agar surface. The plates were incubated anaerobically for 48 hours before reading the results. The strains were tested for penicillinase activity with nitrocephin. Results: Three strains were resistant for penicillin but did not produce penicillinase. MIC values for ciprofloxacin were generally higher than for other antibiotics. The colony size on these agar plates was increased compared to the colonies on the other plates, suggesting that the growth was stimulated by ciprofloxacin. Etest results for imipenem showed a high MIC due to hazy colonies in the inhibition zone. Etest results indicate resistance to penicillin and imipenem in some F. necrophorum strains.Clindamycin and metronidazole seem to be good therapy alternatives.MIC values for ciprofloxacin were high and ciprofloxacin is not a choice for therapy. Doxycyclin and cefotaxime might be used as second line therapy. MIC testing should always be performed in serious anaerobic infections. In vitro activities of various antibiotics, alone and in combination with colistin methanesulfonate against Pseudomonas aeruginosa strains isolated from cystic fibrosis patients project focused to analysis of association between resistance to antimicrobials and pathogenicity in bacteria. Methods: MICs were estimated by modifications of the standard colorimetric method. Potential factors of pathogenicity were evaluated in vitro using test for hydrophobicity (adherence to xylene), motility (0.35% agar), production of biofilm (microtiter plate assay), HSLs (biosensors: C. violaceum 026 and A. tumefaciens NTL4) and response to oxidative stress evoked by hydrogen peroxide. Results: The strains demonstrated the greatest level of resistance in addition to natural resistance to cefotaxime (90%). Isolates in the range of 42-56% were resistant to aminoglycosides and ciprofloxacin, of 26-38% to cephalosporins. On the other hand, 98% of the strains remained susceptible to meropenem, 92% to piperacillin/tazobactam and 84% to piperacillin. The majority of the strains (74%) manifested hydrophilic character. Higher zones of motility showed 12 isolates (in average 54.8 mm) as compared to the other ones (31.1 mm). One third of the strains (32%) produced higher amount of biofilm quantified by measuring of absorbance of solubilized crystal violet (0.2-0.46) than the rest of isolates (0-0.19). All, but two strains produced 3-oxo-C12-HSL and in 46% of samples were detected C4-HSL. Only four isolates with higher biofilm production showed both types of HSLs. Majority of the strains (68%) manifested higher resistance to hydrogen peroxide as compared to the rest of strains. The group of strains resistant to aminoglycosides and ciprofloxacin revealed significantly higher number of hydrophobic strains as compared to sensitive ones. Such association was not found among the rest of the tested parameters. The data obtained in this study indicated that the resistance to antimicrobials in Pseudomonas spp. isolates was not always associated with the changes in the production of the pathogenicity factors. Study of synergetic action of dioxidine and isoniazid on the structure of tubercle bacillus in vitro Background: The epidemiology of S. aureus is rapidly changing. MRSA has traditionally been confined to institutional settings and the occurrence of multi-drug resistance is a cause for concern. However, even more concerning is the increasing prevalence of MRSA in the community. Therapeutic options for these infections are limited. DAP is a cyclic lipopeptide recently Objectives: Quinolones are potent bactericidal agents. While their mechanism of killing is poorly understood, one interesting feature is represented by the fact that, under anaerobic conditions, the growth of bacteria is inhibited while their viability is not affected. A similar effect is observed when these drugs are associated to protein synthesis inhibitors. In this study was evaluated the quinolone susceptibility in presence of chloramphenicol on two mutant strains previously described (Int. J. Antimicrob. Agents 2001, 17:S161-2) susceptible to nalidixic acid under anaerobic environment. Methods: The mutations were co-transferred with Tn10 inserted at 28.5 min of the E. coli map (P1-mediated transduction performed by standard method) into wilde-type strain SA224. Time-kill experiments, under both aerobic and anaerobic condition, were carried out with two different quinolones (ciprofloxacin or nalidixic acid 5xMIC) alone or in combination with chloramphenicol (50 mg/l) following the procedures suggested by the NCCLS and reported elsewhere (Antimicrob. Agents Chemother. 2002, 46:4022) . Results: The transductants revealed the same phenotypes as the original mutants: susceptibility to nalidixic acid under anaerobic conditions (assessed by time kill) and elongated cells formation during the aerobic growth, generation time about 65 min in comparison to 25 min of the control. Time kill experiment under aerobic environment revealed that the two transductants were also susceptible to ciprofloxacin but not nalidixic acid in the presence of chloramphenicol. Isolates were excluded if they were duplicates within 2 weeks, or from samples collected > 48 hours after hospitalisation, or from patients with cystic fibrosis. MICs were determined centrally using the BSAC agar dilution method and interpreted by BSAC criteria. Logistic regression models were fitted separately for penicillinnon-susceptibility and tetracycline-, erythromycin-and ciprofloxacin-resistance (PEN-NS, TET-R, ERY-R & CIP-R). Results: Table 1 shows unadjusted resistance rates. The final models for PEN-NS, TET-R and ERY-R included centre, age group, and year as a linear function. The final model for CIP-R included centre, age group, and year as a categorical variable. Sex, specimen type (sputum/other) and care setting (GP/nursing home/hospital) were not required in any of the models. Isolates with missing data (n = 25) were excluded. For PEN-NS, TET-R and ERY-R in Ireland, there was a significant linear trend of falling resistance. The odds ratios (OR) in Table 2 Conclusion: Trends in resistance in S. pneumoniae differed between Ireland and the UK, and between classes of antimicrobials. Resistance to penicillin, tetracycline and erythromycin decreased in Ireland but not to a similar extent in the UK, and there was no trend in ciprofloxacin resistance. Reasons for these differences should be sought. Influence of age on resistance in communityacquired lower respiratory tract isolates of S. pneumoniae from the UK and Ireland Objective: To examine the relationship between patient age and antimicrobial resistance in S. pneumoniae. Methods: 3584 lower respiratory tract isolates of Streptococcus pneumoniae were collected from a total of 27 laboratories in the UK and Ireland over the five winters from 1999-2000 to [2003] [2004] . Isolates were excluded if they were duplicates within 2 weeks, or from samples collected >48 hours after hospitalisation, or from patients with cystic fibrosis. MICs were determined centrally using the BSAC agar dilution method and interpreted by BSAC criteria. Logistic regression models for penicillin-nonsusceptibility and tetracycline-, erythromycin-and ciprofloxacin-resistance (PEN-NS, TET-R, ERY-R & CIP-R) were fitted, correcting for age, year and collecting laboratory. Results: Age was unknown for 4 patients. The median age was 62. PEN-NS, TET-R and ERY-R were modelled with age group as a categorical variable using the 40-49 group as baseline; resistance was least in this group and greater in both younger and older patients, as shown by the odds ratios (ORs) in Table 1 . CIP-R was modelled with a linear function of age; ORs corresponding to the median age within each age group are shown. Moxifloxacin-resistance (MXF-R, MIC > 1 mg/L) was too rare for logistic modelling, but was also strongly associated with age. Of the 29 MXF-R isolates (all with CIP MICs >8 mg/L), 25 (86%) were from patients aged ‡ 60 (Fisher's exact p < 0.001), and none was from a patient aged <50. Observed resistance rates for all isolates and for the baseline age group are shown in Table 2 . Conclusion: Patient age is a significant predictor of resistance in S. pneumoniae. Isolates from both young and elderly patients had increased risk of resistance to PEN, TET and ERY, but fluoroquinolone resistance increased linearly with age. Resistance to MXF was rare in the UK and Ireland, and was seen only in isolates from patients aged over 50. A. Oza, S. Murchan, R. Cunney (Dublin, IRL) Objectives: Aim of this presentation is to provide an update on a study investigating the factors that affect bacteraemia caused by key pathogens isolated in Irish hospitals. The study is primarily focused on those pathogens exhibiting antibiotic resistance and the results are used to supply timely feedback to contributing laboratories. Method: A sample of hospital laboratories participating in the European Antimicrobial Resistance Surveillance System (EARSS) provided additional information on bloodstream infections arising from EARSS pathogens on a quarterly basis from the start of 2004. The additional information included patient demographic and hospital administrative data, risk factors, primary source and secondary foci. This information was linked to the resistance data for each isolate and hospital activity denominator data were used to calculate rates. Results: Data for quarters 1 and 2 resulted in 433 matched records from 7 representative hospital laboratories. Analyses of this dataset AND data received for quarters 3 and 4 of 2004 will be presented. Preliminary results indicated that most infections occurred in the younger and older ( ‡65 years) age groups. Malignancies were identified in a third of the patients. Recent surgery, ICU-stay and haemodialysis were particularly associated with MRSA bacteraemia. Respiratory tract infection was the most common source for S. pneumoniae bacteraemia, urinary tract for E. coli, and intra-abdominal/gastrointestinal tract for both E. coli and enterococci (including VRE). Different predominant sources of S. aureus infection were associated with different levels of methicillin-resistance: skin/soft tissue (low proportion of MRSA), CVC (medium) and respiratory tract (high). The findings so far support the fact that hospital function can influence bacteraemia rates as a result of treating patients with different risk factor profiles. The analyses provided through this surveillance programme could be used to make informed and targeted infection control decisions. ANOVA showed that there was a linear relationship with resistance increasing by~1% per quarter (P = 0.014). Chi2 suggested that the increase was highly significant (P < 0.001). No significant trends were observed in resistance to 3rd-generation cephalosporins (2.5% of isolates) or gentamicin (3.7%). Conclusions: Methicillin resistance in S. aureus remains an important public health problem in Ireland and has increased over the past five years, although the increase is of doubtful significance. Ciprofloxacin resistance in E. coli has increased significantly since surveillance began in 2001. Further studies are warranted to understand the reasons for this. As part of any surveillance system, continued and appropriate analysis of the data for trends is essential. The data presented here highlight the changing profile of AMR in Ireland over time. Antimicrobial susceptibility in respiratory bacterial pathogens among children in Greenland: little antibiotic resistance in spite of high antibiotic use Objectives: In Alaskan natives the prevalence of penicillinresistant S. pneumoniae isolates is high. In Greenland respiratory tract infections in children are frequent, and antibiotic use is high. As local data on antimicrobial resistance hardly exist in Greenland, the objective of his study was to obtain such information. Methods: A population-based cohort of children aged 0-4 years was followed in Sisimiut, Greenland, for a two-year period (1996 -1998 . For the first time in 2003 two ampicillin-resistant beta-lactamase negative (0.6%) isolates were recovered. High rates of resistance were found for clarithromycin (36.9-25.7%) and co-trimoxazole (13.6-14.1%). The remaining drugs tested (ciprofloxacin, levofloxacin, moxifloxacin, azithromycin, telithromycin, amoxicillin-clavulanate, chloramphenicol, tetracycline, 2nd and 3rd generation cephalosporins) were highly active: 100-94.6% of susceptible strains. In M. catarrhalis the susceptibility rates ranged from 22.7-18.9% (ampicillin) and 77.3-81.1% (co-trimoxazole) to 100% (amoxicillin-clavulanate, ceftriaxone, cefixime, telithromycin, azithromycin, ciprofloxacin, levofloxacin and moxifloxacin). Against MSSA the most active drugs (100%-92% susceptibility) were teicoplanin, rifampin, co-trimoxazole, ceftriaxone, cefaclor, telithromycin and levofloxacin. Conclusions: Antibiotic resistance among community-acquired respiratory pathogens circulating in Italy is on the rise in comparison to the values described in previous National Surveys (1997) (1998) (1999) (2000) . Globally, telithromycin, levofloxacin, amoxicillinclavulanate and ceftriaxone are the most active drugs. Incidence and antibiotic susceptibility of pathogens causing severe community-acquired and nosocomial infections in Italy In total 116 strains were tested against erythromycin, 18 % of them were non susceptible to erythromycin. More than 22 % of the PNSP showed susceptibility to erythromycin. All tested strains were highly susceptible to the 3rd generation cephalosporins as well as to quinolones. Haemophilus influenzae: 60 % of the total isolates (n = 129) were resistant to ampicillin. 62.5% of the total isolates (n = 135) were b-lactamase negative. 6 isolates (2.5%) were b-lactamase negative, however, resistant to Ampicillin (BLNAR) and only 1 isolate (0.16%) was b-lactamase positive but resistant to Amox/clav (BLPACR).The prevalence of invasive S. pneumoniae was seasonal with clear peaks during winter. The percentage of penicillin non susceptible S. pneumoniae among these strains displayed no seasonality. The prevalence of invasive and penicillin non susceptible S. pneumoniae was highest in children 4 years and younger. This emphasizes the importance of prudent antimicrobial use of antibiotics and vaccination in this age group. The proportion of erythromycin resistance among Penicillin non susceptible S. pneumoniae was not very high in comparison to other studies done mainly in Europe (EARSS). PNSP are still in general highly susceptible to Levofloxacin, Cefotaxime, and Imipenem. The problem of Ampicillin resistance among our isolates of H. influenzae is important (60%) and is complicated by the b-lactamase-negative strains which were resistant to ampicillin (2.5%) by some other mechanism perhaps elaboration of altered penicillin-binding proteins. Exotic pets as possible reservoirs of ciprofloxacinresistant Salmonella typhimurium infecting children Objectives: Considering that high-level resistance to ciprofloxacin ( ‡2 mg/L; CipR) in human isolates of salmonellae is still rare in Europe, we analysed the molecular characteristics of 12 CipR strains isolated from seven children and one adult in order to explore a possible epidemiological relationship with two CipR strains isolated from a parrot and a snake. Pet animals of these species have been reported as reservoirs of salmonellae sporadically transmitted to humans. Methods: The strains were characterized by serotyping, phage typing, antimicrobial susceptibility testing, with or without an efflux pump inhibitor (EPI), and pulsed-field gel electrophoresis (PFGE). Polymerase chain reaction and DNA sequencing were used to identify integron-borne gene cassettes and mutations in the GyrA, GyrB, ParC and ParE genes. Results: All 14 S. enterica strains were of serotype Typhimurium and of a phage type 12 variant. All were resistant to multiple antibiotics (AmpStr/SpcTetCmpSul) including Cip ( ‡16 mg/L) and, with one exception, Gen and Tmp. CipR was associated in each case with mutations in GyrA (Ser83Phe, Asp87Asn), GyrB (Ser464Phe) and ParC (Ser80Arg) and moderately decreased quinolone efflux. The 13 Gen-, Tmp-resistant strains carried oxa-30 and had a ca. 2 kb integron with aadA2 and dfrXII cassettes, while the Gen-, Tmp-susceptible strain contained oxa-30 and aadA2 cassettes, also in a ca. 2 kb integron. Using XbaI, the PFGE profiles of all strains were indistinguishable, while the use of BlnI revealed 3 discrete subgroups (with 1-or 2-band differences): a) 3 isolates, from 2 children and the snake which was identified as the source of infection; b) 10 isolates, from 4 children, 1 adult and the parrot, without documented contact; c) the Gen-, Tmp-susceptible isolate from a child who had been in contact with a pet snake. Conclusion: While the food chain is the most common route of animal-to-human transmission of salmonellae which may be resistant to multiple antibiotics including fluoroquinolones, the present study raises the possibility that exotic pet animals may become a reservoir of such strains which may be transmitted especially to young children. Changes in antimicrobial associated resistance, susceptibility patterns and 'resistance load' in 35,956 consecutive UTI Escherichia coli 1993-2003 Objectives: Antimicrobial resistance is most often expressed as individual resistance rates for a species against a defined drug. The objective of this study was to present alternative models to describe resistance development. During 1993 During -2003 956 Escherichia coli from urinary tract infections were systematically categorised for susceptibility to a fluoroquinolone, trimethoprim, ampicillin, cefadroxil, mecillinam and nitrofurantoin using the methodology and interpretive criteria of the Swedish Reference Group of Antibiotics. Three models were analysed. 'Associated resistance' was presented as the resistance rate of each drug in the presence and absence of resistance to each of the other drugs as previously described (JAC, 2003; 52, 128) . 'Susceptibility pattern changes' were described as a change in rank order of patterns and in the number of different patterns over time. 'Resistance load' was expressed by transforming the susceptibility pattern of each strain into a numerical value: the susceptibility pattern SSSSSR corresponded to 2 (0 + 0 + 0 + 0 + 0 + 2) and the pattern RSSIRS to 5 (2 0 + 0 + 1 + 2 + 0). The minimum and maximum 'resistance load' were 0 and 12, respectively. Results: Associated resistance was high all through the observation period. As an example, trimethoprim resistance in E.coli resistant and sensitive to ampicillin was 28% versus 3% in 1993 and 43% versus 4% in 2003. The five most common is not yet standardized. The present study compared outcome of cut-off levels at 30 and 365 days on 14 years of surveillance data for E.coli and S.aureus. Materials and methods: All consecutive isolates of E. coli (n = 62380) and S. aureus (n = 24743) from routine susceptibility testing at our laboratory (1990) (1991) (1992) (1993) (1994) (1995) (1996) (1997) (1998) (1999) (2000) (2001) (2002) (2003) were included. Duplicates were identified and excluded based on a unique personal identification number, species and cut-off time (30 and 365 days) from first isolate. Susceptibility testing was performed as recommended by the Swedish Reference Group of Antibiotics and did not change over the years except for fluoroquinolones (norfloxacin 1990-1993, ciprofloxacin 1994-2000, nalidixic acid 2001-2003) . The effects on resistance rates of excluding duplicate isolates (DI) were small despite the fact that almost one third of the isolates were excluded through the 365 days exclusion algorithm. Except for fluoroquinolones, resistance rates in E. coli decreased when DI were excluded on the basis of 30 days but increased when DI were excluded on the basis of 365 days. Resistance in S. aureus tended to decrease when duplicates were excluded independent of cut-off time. Conclusion: E. coli and S. aureus are two of our most important pathogens and as such common in resistance surveillance. Although the effects on resistance rates of exclusion of duplicate isolates were minor and not statistically significant in the present study we suggest that the exclusion cut-offs should match the timeline, i.e. if rates are presented as yearly figures, the exclusion cut-off should be 365 days, and so on. We furthermore believe that the effect of excluding duplicates should be presented in conjunction with presentation of surveillance data. Our data suggests that E. coli re-infection (infection with the same species more than 30 days after the first incident) is mainly caused by new and less resistant strains whereas patients who have acquired resistant strains of S. aureus continue to be colonized with the same strain. Haemophilus influenzae antibiotics resistance in Greek patients ( Objectives: H. influenzae represents one of the commonest pathogens, in community-acquired respiratory infections. Recently, there is a great concern worldwide regarding the increased prevalence of beta-lactamase producing strains, the increasing incidence of resistance to ampicillin and macrolides, the emergence of ampicillin resistant non-beta-lactamase producing isolates (BLNAR), as well as the isolation of betalactamase producing strains resistant to amoxicillin+clavulanic acid (BLPACR 2001-2002, 194 in 2002-2003 and 118 in 2003-2004 . All isolates were tested for beta-lactamase production as well as for susceptibility to ampicillin, amoxicillin, amoxicillin + clavulanic acid (A/C), erythromycin, trimethoprime/sulfamethoxazole, ciprofloxacin and moxifloxacin, by the disk diffusion method, according to standard procedures. S. Corvallis with types of extended-spectrum beta-lactamases CTX-M3,TEM and SHV. All ESBLs producing strains were multiresistant to 9,10 and 11 antimicrobial agents.Bla-CTX-M3 and bla-TEM genes were successfully transferred into a recipient E. coli C1A strain simultaneously with genes coding for resistance to aminoglycosides and sulfonamides (for bla-CTX-M3)and genes coding for resistance to aminoglycosides and chloramphenicol (for bla-TEM.PCR amplification revealed bla-CTX-M3 gene in S.Enteritidis and bla-TEM in S.corvallis.Before 1999 all S. Enteritidis were susceptible to all antimicrobial agents tested. In this study salmonellae have revealed resistance to at least one antimicrobial agent, most frequently to Nalidixic acid and Trimethoprim/sulfamethoxazole.Resistance to Nalidixic acid combined with retained susceptibility to ciprofloxacin in S. enteritidis is suggestive for mutations in the chromosomal gyrA.Resistance to ampicillin in S.Enteritidis could be explained with widely distributed plasmids in European countries including Bulgaria.Selection of multiresistant bla-TEM producing S.Corvallis is probably unique for our country. Conclusions: Diversity of resistance genes are widely distributed among the leading causative agents of human salmonelloses in Bulgaria. Gram-positive bacteria from diabetic foot ulcers and resistance to currently used antibiotics in a Greek general hospital Objectives: To evaluate microbiological efficacy of antibiotics in patients with and without antibiotic pre-treatment of community acquired pneumonia (CAP). Methods: In patients hospitalized with CAP in 2000-2003 it was evaluated the sensitivity of pathogens to erythromycin (ERY), amoxicillin (AMO), azythromycin (AZY) and 3rd generation cephalosporins (CEPH, cefotaxime or ceftriaxon) in sputum or blood or bronchial aspirate. Only the probes received within 3 first days of hospitalization were analysed; pathogens from patients with destructive pneumonia were excluded; atypical pathogens were not investigated. The identification and sensitivity tests were performed according NCCLS for respective period by disc-diffusion method and at ATB Expression (Bio-Merieux). The patients' records were screened to evaluate the possible antibiotic treatment of current CAP before hospitalization. The records which do not contain clear statement for antibiotic pre-treatment or absence of such pre-treatment were excluded from analysis. The pathogens from patients with and without antibiotic pre-treatment were compared. The null hypothesis about absence of difference in antibiotics sensitivity in treated and non-treated patients was tested by Hi2. Results: The number of etiologically insignificant pathogens increased from 29% in non-treated group (NTG) to 42% in antibiotic treated group (TG). Among etiologically significant pathogens the frequency of Enterobacteriaceae spp. grows from 12% in NTG to 23% in TG, changes in other pathogens were not significant on available sample. Total number of strains sensitive to AMO and AZY were significantly higher in NTG (69.5% and 75.9% respectively) than in TG (54.2% and 66.7% respectively). The drop in sensitivity to ERY in NTG from 26.3% to 22.9% in TG and to CEPH from 89.5% to 87% in NTG and TG respectively were not significant. The investigated set of pathogens as well as their sensitivity could be shifted against other settings because the hospital admission policy facilitates the entrance of auto plant employees. The AMO and AZY could be acceptable empirical choice antibiotics in CAP in NTG of hospitalized patents while in TG preferential choice is CEPH. ERY and other macrolides without anti-Haemophilus activity do not poses sufficient microbiological efficacy even in non-treated patients. Microbiological efficacy of antibiotics in patients with different severity scores of communityacquired pneumonia Objectives: To evaluate microbiological efficacy of antibiotics in patients with different severity of community acquired pneumonia (CAP). Methods: In patients hospitalized with CAP in 2000-2003 it was evaluated the sensitivity of pathogens to erythromycin (ERY), amoxicillin (AMO), azythromycin (AZY) and 3rd generation cephalosporins (CEPH, cefotaxime or ceftriaxon) in sputum or blood or bronchial aspirate. Only the probes received within 3 first days of hospitalization were analysed; pathogens from patients with destructive pneumonia were excluded; atypical pathogens were not investigated. The identification and sensitivity tests were performed according NCCLS for respective period by discdiffusion method and at ATB Expression (BioMerieux). Modified Fine scores were used to evaluate the severity of pneumonia. The pathogens from patients with severity scores less than 70 (1st and 2nd classes) and more than 70 scores (3rd and 4th classes) were compared. The null hypothesis about absence of difference in antibiotics sensitivity in patients with different severity of CAP was tested by Hi2. Results: In lower severity group (LSG) the predominant pathogens were Haemophilus spp. (56%), in higher severity group (HSG) they drop to 34%. The frequency of Streptococcus spp., nonfermenting gram-negative bacteria and Staphylococcus spp. was increased from 10%, 5% and 10% in LSG to 17%, 10% and 18% respectively in HSG. Nevertheless on the available sample there were no significant differences in total number of sensitive strains between severity groups; in LSG sensitivity was 64.8% to AMO, 17.6% to ERY , 73.6% to AZY and 87.9% to CEPH, in HSG it was 55,8% to AMO, 26,3% to ERY , 60.0% to AZY , 83.2%to CEPH. The investigated set of pathogens as well as their sensitivity could be shifted against other settings because the hospital admission policy facilitates the entrance of auto plant employees. Conclusion: Fine severity scores could not predict microbiological efficacy of antibiotics in hospitalized patients with CAP. The total number of pathogens sensitive to AMO and macrolides without anti-Haemophilus activity are not sufficient to legitimize these antibiotics as a fist line treatment of hospitalized patients with CAP; sensitivity to AZY is marginally acceptable; CEPH provide the best microbiological efficacy. Objectives: In many countries, nontyphoidal Salmonella is a leading cause of food-borne illness in humans. Salmonellosis is usually self-limiting but antimicrobial treatment is recommended for severe illness, with fluoroquinolones and third-generation cephalosporins as drugs of choice. As concern was raised recently regarding poultry as a major source of fluoroquinoloneresistant Salmonella spp., a surveillance comprising two large EU regions was conducted. Methods: In one programme, caecal samples were randomly taken at a Belgian slaughterhouse from chickens raised in Belgium, France or the Netherlands. Caecal contents of 5 birds were pooled to provide a single sample per flock. In another, carcass meat samples were collected from chickens processed in several processing plants across Germany. In total, 2856 Salmonella strains were isolated. Standardized susceptibility testing to ciprofloxacin (CP) and nalidixic acid (NA) as well as non-quinolones including ampicillin (AM), cefotaxime (CT), chloramphenicol (CA), gentamicin (GM), streptomycin (S), tetracycline (TE) and trimethoprim/sulfadiazine (TS) was performed by agar dilution. Resistance was assessed, if applicable, using NCCLS criteria. Results: In all, 52 different serotypes were identified. The serotype prevalences differed strikingly between the two geographical areas as well as in time. In both programmes, resistance to CP was absent, except for one isolate (MIC 4 lg/ml). Decreased susceptibility was apparent but did not deteriorate, as indicated by stable CP MIC90 values around 0.25 lg/ml, and 32 and 9 % resistance to NA. Among the serotypes with decreased susceptibility S. hadar, S. virchow, S. blockley and S. paratyphi B were relatively the most frequent. In contrast, resistance to AM, S, TE and TS amounted to 46, 27, 33 and 18 % in the Belgian collection and to 16, 11, 16 and 12 % in Germany. CA resistance was 8 and 4%, respectively; GM resistance did not exceed 1 % in both programmes. Of 1832 isolates thus far tested for CT susceptibility, none have been resistant (MIC 50/90 of 0.12 to 0.25 lg/ml). Conclusions: Resistance among Salmonella spp. from chickens varied for non-quinolones from 0 % for CT to considerable higher rates for some older drugs, while resistance to CP, particularly important for treating invasive salmonellosis in humans, approached zero. Decreased CP susceptibility varied markedly with the different serotypes, which prevalences differed notably in site and in time. Integron class 1-determined antibiotic resistance in Enterobacteriaceae from blood stream infections in a Danish county N. Norskov-Lauritsen, D. Sandvang, H.C. Schonheyder (Aarhus, Copenhagen, Aalborg, DK) Objectives: To determine antibiotic resistance gene cassettes associated with class 1 integrons (Int1) in Enterobacteriaceae isolated from blood. Methods: Consecutive blood isolates 1996-1998 of Enterobacteriaceae (N = 1362) from the county of Northern Jutland were investigated. Isolates expressing resistance to sulphonamides (N = 351) were examined for presence of Int1 by PCR amplification of a conserved fragment. Gene cassettes inserted in class 1 integrons were PCR amplified with primers located up-and down-stream of the recombination site in Int1. Amplicons were allocated to types according to restriction fragment length polymorphism (RFLP) after digestion with MspI or HinfI. The gene cassettes were identified by sequencing of a representative from each type. Results: Resistance to sulphonamides were expressed in 295 of 940 isolates of Escherichia coli (30%). One hundred and twenty-five were positive for presence of Int1, and they could be divided into 13 RFLP types. Resistance to sulphonamides were expressed in 56 of 422 isolates of non-E. coli (13%). Twenty-three were positive for presence of Int1, and they could be divided into 13 RFLP types, six unique and seven which were also found in E. coli.A total of 19 distinct Int1 types with one to three gene cassettes were found in the 148 isolates. Four types accounted for 72% of the isolates, and two of these were associated only with E. coli.The predominant Int1-determined antibiotic resistance was directed towards streptomycin/spectinomycin (seven distinct genes in 127 isolates) and trimethoprim (eight distinct genes in 70 isolates). Six isolates carried a sat1 gene conferring resistance to the veterinary antibiotic streptotricin. The number of class 1 integrons carrying genes conferring resistance to ß-lactam antibiotics (four) or gentamicin (three) was conspicuously low. Conclusions: Presence of class 1 integrons and acquired resistance to sulphonamides were 2-3 times more prevalent in E. coli than in other representatives of Enterobacteriaceae. Int1-determined antibiotic resistance in this collection of isolates was predominantly directed towards streptomycin/spectinomycin and trimethoprim, i. e. antibiotics which has been in clinical use for a long time. Background: In a recent study, unexpectedly high resistance rates unrelated to heavy antimicrobials consumption were Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 detected in the commensal E. coli of the population of a very remote rural community in Bolivia. The purpose of this study was to analyse the molecular basis of the drug-resistance in isolates collected from that setting. Methods: 113 drug-resistant E. coli isolates, collected from 72 healthy individuals, were subjected to clonal analysis by means of RAPD. Isolates presenting the most common multi-drug resistance (MDR) pattern (ampicillin, tetracycline, chloramphenicol, and trimethoprim-sulfamethoxazole: A/T/C/S pattern) (n = 35) were investigated for the nature and transferability of resistance determinants, and for plasmid profiles. Results: RAPD results identified 19 clonal groups, with one largely prevalent (34 isolates). Intra-familial clonal clustering was often observed, and in one case the same MDR strain was detected in the fecal samples of all the members of a family (8 subjects). Heterogeneous resistance phenotypes were observed within most clonal groups, underlying a relevant role of transferable resistance determinants.Clonal and plasmid variability was observed in the 35 MDR isolates showing the A/T/C/S resistance pattern:i) 20 belonged to the most prevalent clonal group, showed colicin production and harboured the tetA gene. Transferability of resistance determinants could not be detected in these strains;ii) 7 belonged to a different clonal group and harboured a conjugative plasmid carrying the tetA gene linked to beta-lactam, chloramphenicol and trimethoprim-sulfamethoxazole resistance determinants and to genes involved in colicin production;iii) 8 belonged to further 5 different clonal groups, did not show colicin production and harboured tetB genes, often located on conjugative plasmids with different restriction profiles and different carriage of resistance determinants. Conclusions: The clonal and plasmid diversity suggests that the presence of MDR isolates in this particular setting is due to a mechanism more complex than simple dissemination of a single clone or a single resistance plasmid occasionally introduced into the community. Objectives: Zygomycosis is a life-threatening disease with increasing incidence in immunocompromised patients. Several fungi are responsible for these infections but identification to the species level remains difficult by conventional mycological techniques. The aim of this study was to investigate the usefulness of rDNA sequencing for species identification of zygomycetes. Methods: 34 isolates, mostly of clinical origin, belonging to the order Mucorales were tested. These included the 7 species (belonging to 5 genera) most commonly responsible for zygomycosis in humans. Mycelium was grown in liquid RPMI 1640 medium and complete genomic DNA was extracted with CTAB/Chloroform. PCR-amplification of the ITS1-5.8S-ITS2 rDNA region was performed with the primer set V9D (5'-3', TTAAGTCCCTGCCCTTTGTA) and LS266 (3'-5', GAG-TCGAGTTGTTTGGGAATGC). After amplification, both strands sequencing of the fungal DNA was performed and sequences were aligned and compared with ClustalW. Results: Sequences of ca. 600-800 bp were obtained and analysis showed that all species studied (except Absidia corymbifera) were homogeneous with ‡ 99% similarity between strains within a given species. In contrast, sequence variability between genera (similarities of £68%) and between species (similarities of £ 82%) allowed a precise identification to the species level. In particular it was possible to differentiate Rhizopus oryzae from R. microsporus and to discriminate between the different Mucor spp. Only the sequences for the 5 A. corymbifera were heterogeneous with 60 to 100% similarities between strains. Interestingly, none of the studied species owned the universal fungal primer sequence ITS 2 / ITS 3. The results showed that sequencing of the ITS1-5.8S-ITS2 region is a reliable molecular tool for identification of agents of zygomycosis to the species level. For strains identified as A. corymbifera, a higher number of isolates have to be studied. The molecular data obtained here are promising for development of new diagnosis methods of zygomycosis in patients. Objectives: Culture of infected tissues during zygomycosis is often negative. In these cases the only available diagnostic tool is histopathology demonstrating large, non-septated hyphae characteristic of zygomycetes. Nevertheless, identification at the genus or species level is not possible by conventional histopathology. The aim of this study was to evaluate the usefulness of rDNA sequencing for species identification in tissues of mice infected with various zygomycetes. Methods: Mice were infected intravenously with nine different species of the order Mucorales (Rhizopus oryzae, R. microsporus var rhizopodiformis, Absidia corymbifera, Mucor indicus, M. circinelloides, M. racemosus, Rhizomucor pusillus, Cunninghamella bertholletiae, and Syncephalastrum racemosum). Different inocula were tested ranging from 10 4 to 10 7 sporangiospores/mouse. Mice challenged with C. bertholletiae and S. racemosum received 100 mg*kg)1*d)1 of hydrocortisone subcutaneously before infection. Mice were sacrificed 3-4 days post infection. Brain and kidneys were aseptically removed, homogenized and complete genomic DNA was extracted with CTAB/Chloroform. Fungal DNA was PCR-amplified with the universal fungal primer set V9D (5'-3', TTAAGTCCCTGCCCTTTGTA) and LS266 (3'-5', GAGTCGAGTTGTTTGGGAATGC). After amplification, both strands sequencing of the fungal DNA was performed and sequences were aligned and compared with ClustalW. Results: Active infection demonstrated by the presence of hyphae in brain and kidneys was obtained for all tested species except for M. racemosus and fungal DNA was amplified directly from tissues with all the eight former species. Furthermore for six species, sequencing of the ITS1-5.8S-ITS2 region allowed identification of the infecting strain to the species level while technical problems impaired analysis of the sequences of C. bertholletiae and S. racemosum. Conclusions: We set-up animal models of zygomycosis for the most common species responsible for infections in humans and demonstrated that extraction, amplification and sequencing of fungal DNA is possible directly from infected tissues. Strains were cultured in liquid RPMI medium and DNA was extracted from the mycelium by DNEasy plant kit (Qiagen). ITS1-5.8S-ITS2 region DNA was then PCR amplified by using the universal fungal primers LS266 and V9D. Both strands sequencing was performed, sequences were aligned with Clu-stalW and both intra-and inter-species sequence similarities were assessed. Aligned sequences were also used to generate phylogenetic trees. Results: M. mycetomatis appeared to be a homogeneous species, with 91 to 100% homologies between strains (except for one strain that differed significantly and raises the issue of its identification). Similarly, few intra-species variations were found for C. lunata and E. jeanselmei, with 93 to 100% homologies between strains. L. senegalensis and L. tompkinsii showed intraspecies similarities of >99% but similarity between the two species was < 90%. In contrast, P. romeroi and M. grisea appeared heterogeneous with intra-species similarities of 40 to 100% and 53 to 100%, respectively. Inter-genera and inter-species variations were important (except between P. romeroi and M. grisea) with sequence homologies of < 80% between genera. Conclusions: P. romeroi and M. grisea are heterogeneous species whereas within the other species a high degree of sequence homologies are observed. These results show that sequencing of ITS region is a suitable tool for identification of black grains mycetoma agents usually difficult to identify by standard phenotypic methods. Rapid diagnosis of PCP and resistance to co-trimoxazole using real-time PCR Objectives: To compare conventional microbiological staining methods with conventional PCR and real-time PCR methods for diagnosis Pneumocystis jiroveci in patients suspected for pneumocystis pneumonia (PCP) and to assess positive samples for the presence of co-trimoxazole(Co-T) resistant mutations. Methods: Eighty-four sequential bronchoalveolar lavage samples from patients analysed by methanamine silver and Giemsa staining methods were stored at )70°C and subsequently analysed by PCRs. The BALs were collected over a 20-month period. The real-time PCR was designed to the dihydropteroate synthase (DHPS) to be specific for P. jiroveci and enable sequencing of the PCR product to determine resistance mutations at nucleotide positions 165 and 171. A conventional PCR to the mitochondrial large sub-unit rRNA described by Wakefield et al (Lancet. 1990; 336:451-3) was also performed on all 84 BALs. Results: The staining methods showed that 16/84 (19%) patients had PCP. The real-time PCR and the conventional PCR both detected P. jiroveci in 19/84 (22.6%). All the samples positive by the staining method were positive and the 3 additional positives were detected by both PCR methodologies. Using the staining methods as the 'Gold Standard', the sensitivity, specificity, positive predictive value and negative predictive value for the PCR methods were 100%, 96%, 84% and 100% respectively. The mean cycle threshold (Ct) value for the 16 stain positives was 31.5 and for the 3 stain negative/PCR positives was 41.5. Analysis of the clinical records and microbiological results of the 3 discrepant samples showed that no other microbiological agent was found and PCP was the most likely clinical diagnosis. The 19 positives were all sequenced and no resistance mutations were found. The time to perform the different methods was 2.5 hours, 3 hours and 5 hours for the staining methods, real-time PCR and conventional PCR. The sequencing could be performed directly after the real-time PCR and results were available in one working day. Conclusions: Real-time PCR for P.jiroveci can provide rapid, sensitive and specific diagnosis for PCP in BAL samples. Additionally the Ct value may be useful in determining the amount of infection. Using this method targeting the DHPS gene rapid results can also be obtained for resistance to Co-T. Identification of Trichosporon mucoides isolates using ID-32C tests (BioMérieux) and direct DNA sequencing of internally transcribed spacer (ITS) 1 and ITS2 of rDNA U. Nawrot, P-A Fonteyne, F. Fauche, N. Nolard (Wroclaw, PL; Brussels, B) Objectives: The identification system provided by BioMérieux distinguish three out of the 35 species published so far for to the genus Trichosporon. The aim of this study was to investigate the genetical homogeneity of the strains identified according to ID-32C as Trichosporon mucoides (Guého, 1992 Trichophyton rubrum (T. rubrum) is an cosmopolitan arthropophilic dermatophyte which causes skin and nail infection. The most of antifungal drugs available for clinical use are targeted four molecules including: beta-glucan, sterol-alpha-demethylase, ergosterol and DNA/RNA synthesis. The limited selection of effective antifungal agents combined with the emergence of drug resistance, has resulted in a critical need for development new drugs directed against novel molecular targets. In the present study we tried to Characterize the Gene encoded Beta-tubulin protein in this fungus which can be used as a potential molecular targets of novel drugs.Clinical isolated of T. rubrum were cultured on liquid medium and the Nucleic Acids (DNA & RNA) were isolated from obtained mycelial mass by standard methods. The sequences of known Beta-tubulin genes in other fungi were aligned and pairs of 21 nt primers were designed from highly conserved regions. Using mentioned primers, we amplified predicted molecules by using genomic DNA as well as cDNA of T.rubrum as PCR templates.By the time, 1200 nucleotides have been sequenced from this new gene which encodes a polypeptide with 400 amino acids. Nucleotide sequence comparison in gene data banks (NCBI, NIH) for both the partial DNA and its deduced amino acid sequence revealed significant homology with members of the eukaryotic Beta-tubulin genes. The amino acid sequence of the encoded protein was about 82% identical to the sequence of Beta-tubulin proteins from other fungi.Considering the role of Tubulin protein in formation of mitotic spindle structure in the cells, the Beta-tubulin gene may be applied in antifungal research fields. Moreover it can be used to determining the molecular action of some drugs including mitotic spindle structure in fungi, leading to metaphase arrest. The probable mechanisms of Beta-tubulin expression inhibition as well as definition of its possible role in the physiological function of T. rubrum are still under investigation. (8), C. krusei (1), C. glabrata (2), R. rubra (2) and 2 unidentifiable fungi. The same agent was detected repeatedly in 3 patients. In 2 patiens the agent isolated from second blood culture was different from that isolated from the first one. In 4 cases out of 10 the results corresponded well with results of detection of mannan antigen or antimannan antibodies in serum of the patients. In no cases the blood sample was positive by cultivation. The possible cause of negative cultivation was antifungal therapy in most of these patients which could supress the growth of yeasts in blood cultures. Our results suggest that the combination of PCR detection of fungal DNA with the proof of mannan antigen and antimannan antibodies can help in the diagnostics of fungal blood stream infections, especially in patients under antimycotic therapy. This work was supported by the grant agency IGA MZ NR/7980-3. immunosuppressed hosts. Early diagnosis is important to achieve the best outcome for these patients; however, definite proof often is difficult to obtain due to counterindicated invasive procedures. Serum galactomannan detection is considered to be a useful test for early diagnosis and follow -up of invasive aspergillosis. Methods: This study evaluated the specificity and sensitivity of the detection of galactomannan(GM) for the diagnostic of IA in 98 adult patients hospitalized in our Hematology unit. Patients were considered to have confirmed or probable invasive aspergillosis, based on clinical and radiological data. Serial screening of Aspergillus GM circulating antigen was evaluated using a double sandwich ELISA assay (Platelia Aspergillus, BioRad, France) on 760 sera. Test positivity was defined in accordance with the manufacturer's recommendations. Results: Among the patients studied, 10 (10.2%) presented with confirmed IA (n = 8 patients) or probable IA (n = 2 patients). Seven patients (7.1%) having a positive result (OD index >1.5) in two consecutive Platelia Aspergillus tests were considered galactomannan -positive cases. No antigens were detected in the sera from one patient with confirmed IA. Latex agglutination assay of galactomannan was positive in both patients with probable IA. In patients without IA, 9 of 88 had positive antigenemia. Sensitivity (70%), specificity (89%), were comparable to those of larger series. Circulating antigens were not detected in the control group, composed of healthy adults. The gradual rise in the antigen titer in consecutive samples is a very strong indication that an infection is present and should be taken into account when interpreting the results. Conclusion: The detection of the circulating Aspergillus galactomannan antigen by a sandwich enzyme-linked immunosorbent assay (ELISA) is one of the most promising method to diagnose IA in at-risk patients. The presence of antigen has a good diagnostic value mainly when there is an increase in the titer on two consecutive sera samples. A repeated negative result is a strong argument against the diagnosis of IA. Inhibition controls are not always necessary for PCR on human samples T. Barkham, V. Rajagopal (Singapore, SGP) Objective: To assess the need for inhibition controls in diagnostic PCR on human serum and on blood cultures in BactAlert FAN media. Methods: Dengue RT-PCR was performed daily for 6 months on RNA extracted from serum (Qiagen viral RNA minikit). The PCR kit (Artus GmbH Germany) included an internal control for every sample and was performed on a lightcycler (Roche). We performed an in-house multiplex gel based PCR assay with primers aimed at C.albicans, C. glabrata, C.tropicalis and C. parapsilosis. The PCR was applied, without DNA extraction, to the supernatant from BactAlert FAN bottles that had been left to stand to allow the charcoal particles to settle. These bottles had flagged positive and been shown to contain yeasts by Gram's stain. Neat and doubling dilutions in saline to 1:8 were tested. Results: The inhibition control was positive for all sera tested with the Artus Dengue RT-PCR kit, meaning that the PCR process was successful without significant inhibition in any of the samples. Inhibition was detected using neat broth from BactAlert FAN bottles but was not detected at a 1:2 dilution. Conclusion: Inhibition of PCR performed on sera is not common and it is unnecessary to control for inhibition. PCR on the supernatant from BactAlert FAN bottles is subject to inhibition. However, PCR was successful on all supernatants diluted 1:2. This assay was used on samples known to contain yeasts, demonstrated by Gram's stain, so an absent signal would suggest inhibition or a species not recognised by the primers. While a negative result might delay the identification to species level and refinement of antifungal chemotherapy, it would not delay the diagnosis of candidaemia. This data supports the view that inhibition controls are unnecessary for PCR applications validated to perform adequately. Furthermore, inhibition is a considerable problem with bacterial cultures but it is not standard practice to detect and report this inhibition, so it would be inconsistent to make inhibition controls obligatory for nucleic acid tests. Briefly, the EIA is a sandwich style system that uses rabbit polyclonal antibody to Histoplasma antigen as capture; plates are then blocked and allowed to dry. Test samples are added, allowed to incubate and washed off. Next, the same polyclonal antibody used as capture but containing a biotin label is added followed by streptavidin-horse radish peroxidase. After incubation, the conjugates are washed off, and (3,3',5,5'-tetramethyl benzidine) TMB is added as substrate. The reaction is stopped using 2N H 2 SO 4 , and the endpoint optical density (OD) is read at 450 nm-630 nm. Results: Intralaboratory correlation was good with a single sample of purified galactomannan antigen testing positive on day one and negative on day two in both SSI and MVD labs. Interlaboratory correlation was excellent, comparing results from both labs for day two, each of the 18 samples and controls resulted in an identical result interpretation according to these guidelines where results are expressed as EIA units (EU): <1.0 EU is negative (n = 8); >1.0 -<2.0 EU is weak positive (n = 1); >2.0 -<10.0 EU is moderate positive (n = 4); and >10.0 EU is high positive (n = 5). All results remained within these categories at both laboratories. Conclusion: The excellent correlation of results supports the feasibility of developing a Histoplasma antigen EIA test kit that can be used for reference testing at SSI. Blind subculture increases only marginally detection of fungaemia in high-risk patients M. Søgaard, U. Hjort, T. Højbjerg, H.C. Schønheyder (Aalborg, DK) Objectives: The ability to detect fungaemia with bacteriological blood culture (BC) media and an automated system may be questioned. We investigated retrospectively whether blind subculture on the 3rd day increased detection of fungaemia with the BacT/Alert system or accelerated the diagnosis in high risk patients. Methods: This historical cohort study was conducted at a university hospital and its affiliated hospitals. During a period of app. 5 years (Nov. 1998 to Dec. 2003 BCs were subcultured on the 3rd day of incubation if patients based on clinical and microbiological assessment were believed to be at high risk for fungaemia. For adult patients each BC set comprised one standard aerobic, one FAN aerobic and one standard anaerobic bottle (Bac T/Alert system, bioMérieux); aerobic bottles were vented at reception, and the incubation period was 6.7 days. All data were recorded in a departmental information system. Results: 79.165 BCs were drawn during the study period. 359 (0.45%; 95% confidence interval (CI): 0.41-0.50%) yielded growth of yeast species (C. albicans 62.8%, C. glabrata 14.9% , C. parapsilosis 9.0%, C. tropicalis 3.3%, C. krusei 3.3%, other yeast species 6.8%). A total of 2154 BCs were selected for subculture originating from 170 patients, 89 of whom were admitted to ICUs. 102 BCs (4.7%; 95% CI: 3.9-5.7%) from 51 patients turned out yeast positive. However, blind subculture was instrumental in detecting yeasts in only 26 BCs (25.5%). Eight BCs (7.8%) were negative on blind subculture, but one or more bottles were detected positive by the BacT/Alert system during continued incubation. In 68 BCs (66.7%) growth of yeasts was detected during the first three days of incubation. Contrary to our expectations, we found time to detection to be shorter in cases not selected for subculture. In this group 84.9% (95% CI: 79.9-89.1%) of the yeast positive BCs were detected within 3 days as compared to 66.7% (95% CI: 56.6-75.7%) for the subculture group as stated above. Conclusion: Patients believed to be at high risk and thus selected for the subculture group proved to have an approximately 10 times increased rate of yeast positive BCs. However, blind subculture on the 3rd day disclosed only a quarter of yeast positive BCs in this group. Due to the very limited increase in detection we do not recommend blind subculture as a precaution in patients at high risk for fungaemia. Conclusions: Echinococcosis is a parasitosis that presents a big problem for Public Health in Albania. Based in our data the incidence of infection is very consistent every year. The parasite can affect adults and children as well. Women are infected approximately two times more than men due to longer exposure to domestic animals and the parasite. There is not a clear difference between urban and rural areas in terms of where the prevalence of the disease is higher. The reason is probably a persistant migration of the population from one area to another. The laboratory diagnosis of Echinococcosis based on one or more serological tests has a great importance for the treatment of the patients. Evaluation of ImmunoCard STAT! immunoassay in the detection of Giardia lamblia and Cryptosporidium parvum specific antigens Conclusions: As compared to microscopy as gold standard for both Giardia and Cryptosporidium detection, sensitivity, specificity and NPV of the antigentest were very favourable. The rapid assay was easy to perform and less labour-intensive. Low PPV could be explained by the low prevalence of both pathogens in our population or by overrating of the false positives because of the use of a non-optimal gold standard. Yersinia outer membrane protein-and cell wall-specific antibodies in sera of healthy adult Hungarians Á . Sonnevend, É . Cziró k, T. Pál (Al Ain, UAE; Budapest, HUN) Objectives: The aim of the study was to investigate the presence of anti-Yop IgG and IgA antibodies in healthy blood donors in Hungary, i.e. in a country with a reportedly low incidence of yersiniosis (1.0-1.4/100.000/year) and to compare the data to the prevalence of cell wall-specific agglutinins. Methods: Sera of 112 healthy Hungarian blood donors were collected between December 1999 and January 2000. The specimens were tested by Yop-specific IgG and IgA ELISAs (Mikrogen, Germany). Samples were also subjected to tube agglutination using Y. enterocolitica O3, O9 and Y. pseudotubercolusis I-II-III-IV-V antigens. Specimens exhibiting agglutination with yersinia antigens were also tested with brucella and salmonella OB and OD antigens. Results: Of the 112 sera tested 46 (41%) exhibited a positive anti-Yop reaction in the IgG, and 17 (15.1 %) in the IgA class, while the boundary figures were 7 (6.2%) and 6 (5.3%), respectively. All the IgA positive and boundary samples were also positive for IgG. Objectives: Y. enterocolitica and Y. pseudotuberculosis infections are manifested as enterocolitis, mesenteric lymphadenitis, reactive arthritis and erythema nodosum. Important factors in the pathogenicity of the yersinias are associated with the presence of virulence plasmid coded for release proteins (Yersinia outer membrane proteins, YOPs). The detection of antibodies to these proteins is a highly specific and very sensitive method for the serological diagnosis of all forms of yersiniosis. The aim of this study was the use of an enzyme immunoassay (ELISA) in combination with a western blotting assay for the detection of antibodies against YOPs of pathogenic Yersinia strains in serodiagnosis of yersiniosis. Methods: A total number of 171 sera collected from equal number of children, aged from 5-12 years, referred as probable cases of yersiniosis were tested. These children were hospitalised in the Paediatric Clinic of University Hospital of Ioannina (NW Greece) during a 4-year period (2001) (2002) (2003) (2004) Objectives: Human visceral leishmaniasis (HVL) is endemic in several foci in IRAN, such as Ardebil and Fars provinces (in North western and south part of IRAN) and in some region as sporadic. Visceral leishmaniasis in Iran is Mediterranean type and the causative agent is leishmania infantum and its main reservoir is dog. Methods: In this study direct agglutination test (DAT) was compared with indirect fluorescent antibody test (IFAT) for the diagnosis of visceral leishmaniasis in patients suspected of kala-azar.A total of 70 serum samples collected from suspected kala-azar patients mainly in the kala-azar endemic areas. The leishmania infantum antigens (MHO/TN/80/IPTi) for these studies were prepared in Department of parasitology, school of medicine, Isfahan university of medical sciences. The principal phases of the procedure from making DAT antigen were mass production of promastigotes of leishmania in the RPMI1640 + fetal bovine serum, Trypsiniznation of parasites, staining with coomassie blue and fixing with formaldehyde. The human serum samples were tested by DAT, as well as, by IFAT, with the L.infantum antigen prepared in our laboratory. Results: The sero positive rate (SPR) with DAT in titers of ‡ 1:3200 was 91.4% and with IFAT in titers of ‡ 1:80 was 94.3%. Geometric means of reciprocal titers (GMRT) were 6309 for DAT and 692 for IFAT. Therefore, as the titers of ‡ 1:3200 are usually considered positive in DAT. The titers of ‡ 1:80 were regarded as positive in IFAT. The coincidence of the two tests were 92%. Conclusions: These results showed that a simple local laboratory with one or two trained technicians is quite sufficient for DAT, sero-diagnosis and serological survey of kala-azar in an endemic area. According to the results of these studies, it seems that in Kala azar endemic areas, the clinical symptoms of Visceral leishmaniasis, particularly among the children with DAT antibody titers equal or >1:3200 is a good indication for specific treatment of Kala-azar. Evaluation of three serodiagnostic methods: radioimmunoassay, indirect haemagglutination and immunoelectrodiffusion in human hydatidosis and the principal subclass specific immunoglobulin D. Dorostcar Moghaddam, A. Andalib, M. Amrollahei (Isfahan, IR) Objective: Several techniques have been developed for the serodiagnosis of hydatid disease. As emphasized by the scientists the percentage of positive results depends partly on technique utilized and the localization of the cyst. Approximately 10% of sera from patients with hydatidosis give false negative reactions. This relatively high figure necessitates the use and comparison of several diagnostic techniques for hydatidosis. In the present study we have attemped to investigate further a solid phase radioimmunoassay for the diagnosis and compare with indirect heamagglutination (IHA) and immunoelectrodiffusion (IED). Materials and Methods: Sera from 29 patients who had clinically confirmed hydatid disease were tested by radioimmunoassay (RIA), IHA and IED. In 21 patients the localization was hepatic, in 6 pulmonary, and in 2 both hepatic and pulmonary. In addition, 15 sera from patients with clinically confirmed hydatidosis, but which were negative by IHA and IED,were also tested By RIA. The 40 control sera were obtained from apparently healthy blood donors. Results: In the present study by RIA,IHA and IED approximately 80% of the patients with clinically suspected hydatid disease were confirmed serologicaly. The sensitivity of the three methods was similar. The Principal subclass of specific antihydatid immunoglobulin was IgG and high levels of specific anti-IgE found in two out of the five patients studied. Conclusion: It is concluded that for a satisfactory serodiagnosis of hydatid disease the RIA and IED should both be used and that fuether work should be done on the purification of hydatid antigens to improve the sensitivity of the Radioimmunoassay without loss of specificity. Objectives: Staphylococci, especially Staphylococcus epidermidis and Staphylococcus aureus, are important pathogens in the context of implanted medical device infections. The ability to establish multilayered biofilms on the surface of foreign bodies significantly contributes to the pathogenicity of these species. The polysaccharide intercellular adhesin (PIA), synthesized by icaADBC encoded proteins, mediates biofilm accumulation in S. epidermidis and S. aureus. Therefore, PIA appears to be a suitable antigen for novel diagnostic tools. In order to measure the humoral immune response appropriate systems for the specific detection of anti-PIA-antibodies are demanded. Results: We here describe the development of an enzymelinked immuno sorbent assay (ELISA) specifically detecting anti-PIA antibodies in human sera. 96-well Maxisorp plates (Nunc) were coated with purified PIA. Using these PIA-coated plates, an IgG titer of 1:8000 was detected in the serum of a rabbit immunized with purified PIA. In contrast, in the pre immune serum 16fold lower titers were detected. Absorption of the anti-PIA antiserum against PIA-positive S. epidermidis 1457 lead to an 84 % reduction of the serum reactivity, whereas absorption against PIA-negative 1457-M10 had no effect, demonstrating the specificity of the test. This was confirmed by competition ELISA experiments where purified PIA but not pneumococcal or meningococcal capsule polysaccharides specifically inhibited binding of the antibodies to immobilized PIA up to 68 %. Using this ELISA, in serum samples from 10 patients with endoprosthesis-associated infections due to clonally independent icaADBC-and PIA-positive S. epidermidis strains anti-PIA-antibody titers ranging from 1:20000 -1:36000 were detected. In contrast, in a collection of serum samples from patients with endoprosthesis-related infections due to icaADBCnegative S. epidermidis and from healthy blood donors IgG titers were only 1:2000-1:6000. Conclusions: Due to the widespread presence of icaADBC in pathogenic staphylococci PIA appears as a suitable antigen for novel diagnostic tools in foreign-body infections. Using specific ELISA anti-PIA-IgG titers in patients with icaADBC-positive S. epidermidis infections were significantly higher than in a control collective. Measurement of anti-PIA IgG appears as a suitable tool for improving the diagnosis of staphylococcal foreign-body infections. Objectives: The aims of this study were to continue and extend our previous investigations, in which the main ribotypes were determined at a local university hospital. In the present survey, we determined the prevalence of different ribotypes of C. difficile strains, and detected the distributions of these types in three Hungarian regions. Methods: 105 C. difficile strains were isolated in 5 Hungarian laboratories from diarrhoeal faeces of both inpatients and outpatients. The presence of toxin genes such as those of toxin A (tcdA), toxin B (tcdB) and actin-specific ADP-ribosyl-transferase (cdtA and cdtB) were detected by PCR in the Szeged laboratory. The ribotypes of these strains were determined by PCR ribotyping method at the ARL in Cardiff. Results: A total of 31 ribotypes were detected among the 105 tested C. difficile strains: 5 ribotypes were distinct from all previously described types, suggesting that these are new types. The most common types in Hungary were ribotype 014 (24.8%) and ribotype 002 (13.3%), while in the UK, the most predominant type was ribotype 001. The distributions of the examined ribotypes differed in the different Hungarian regions: ribotype 012 was frequent (20.7%) in South Hungary, at the same time in the Budapest region, this ribotype was rare, while in West Hungary, we did not detect this type during the examined period. In West Hungary and the Budapest region, the most frequent type was ribotype 014 (28.9% and 29% respectively). Conclusion: Numerous different methods have been used internationally to study C. difficile strains of different origins. Comparisons are therefore difficult. The most frequently applied and most useful typing method is the PCR amplification of rRNA intergenic spacer regions, which is a discriminative, reproducible and rapid technique for determination of the different types of C. difficile. Our present survey and previous studies have revealed that the presence and distribution of C. difficile ribotypes vary from country to country, and also depend on the site of isolation and the period in which the tested strains were isolated. We have now shown that there can additionally be regional differences within a given country. This work was supported by a Hungarian Eö tvö s Scholarship and grant TO32385 from the Hungarian National Research Foundation (OTKA). Tn916-Tn1545-like elements in Clostridium difficile clinical isolates P. Spigaglia, V. Carucci, F. Barbanti, P. Mastrantonio (Rome, I) Objectives: In C. difficile, tetracycline resistance is predominantly due to a tet(M) gene. This gene has been shown to be carried by Tn5397 in the clinical strain C. difficile 630, whereas by a Tn916-like element in the environmental strain C. difficile 42373. These two elements are related, but very different in their integration/excision module and can not be co-present in the same cell. The aim of the study was to examine Clostridium difficile clinical isolates for the presence of the Tn916 and Tn1545 like elements. Methods: Detection of tet(M), erythromycin resistant gene erm(B) and the integrase gene int (markers for the Tn916) was performed by PCR, as well as the analysis of the genetic arrangement of the elements. The amplified fragments were used as probes for hybridisation assays on genomic DNA of C. difficile isolates, after digestion with HindIII. The nucleotide sequence of tet(M) genes was also analysed. Antibiotic susceptibility of the strains was assessed by the E-test method. Results: Eighteen C. difficile isolates were positive for tet(M) and int and the signals obtained using these genes as probes overlapped. Ten isolates showed one hybridising band of either 6.3, 9.0 or 14 kb. Seven isolates showed two hybridising bands of 6.3 and 9.0 kb and one strain two banda of 6.0 and 9.0 kb, indicating the presence of two copies of a Tn916-Tn1545 like elements. Heterogeneity in these elements was observed. The E-test results indicated that isolates with two copies of tetracycline resistance elements were resistant (88%) or inducibly resistant to tetracycline (12%), whereas isolates with one copy were resistant (36%), inducibly resistant (18%) or susceptible (46%) to this antibiotic. Three isolates were also erm(B)positive and resistant to erythromycin. The bands obtained using tet(M) and erm(B) probes overlapped at 9.0 kb, indicating the presence of a Tn1545-like element. The association of these genes was also confirmed by PCR. Seven different alleles were identified sequencing the tet(M) gene of prototype strains among those examined. In the present study 75% of the specimens were positive for C. difficile TcdA/TcdB toxins, 31% were positive for CPEnt C. perfringens and 28% gave positive test results for both C. difficile and C. perfringens toxins. We were found relatively a small number of enterotoxigenic C. perfringens (CPEnt) strains. All strains C. difficile and C. perfringens were susceptible for metronidazole. The occurrence of C. perfringens (CPEnt) as etiologic agents of nosocomial diarrhoea is not known in Poland. In our laboratory, we have found a suprisingly significant number of C. perfringens enterotoxin (CPEnt) positive stools. We conclude that C. perfringens is a potential cause of AAD in Poland. Those willing to participate were instructed how to collect the specimen, and provided with a dacron swab, a sterile empty tube, and an envelope in which to place the tube. Subjects were asked to complete a short questionnaire on sexual practices and medical check-ups for sexually transmitted disease (STD). Specimens were returned to the laboratory within 36 h. C. trachomatis was detected using a previously validated inhouse PCR method. The tip of the swab was cut off using sterile scissors and placed into a 2-ml microcentrifuge tube to which 600 ‡of PBS (pH 7.4) was added. The tube was vortexed for 30 s, and then the swab pressed against the wall of the tube to squeeze out the fluid before discarding it using sterile forceps. The fluid was centrifuged at 13,000 rpm for 20 min, the supernatant discarded and the pellet resuspended PCR buffer containing proteinase K and Tween-20. It was incubated at 55°C for 1 h and then heated at 80°C to inactivate the proteinase K. Ten microlitres of the treated sample were used for PCR using primers for C. trachomatis. Thirty cycles of 30 s at 94°C followed by 1 min at 60°C and 1 min at 72°C were used for amplification, with final annealing of 7 min at 72°C and 7 min at 15°C. The amplified DNA was run on a 1% agarose gel and visualized with ethidium bromide. Positive and negative controls were used on each occasion. Results: Of 180 CSW invited to participate, specimens were collected from 163, none of whom were aware of a current infection with C. trachomatis. Nine specimens were positive, representing a 5% infection rate. Seventy per cent of the CSW reported usually using condoms with clients. The level of infection in CSW in Hong Kong was relatively low compared to other countries. This may reflect regular condom use. Self-collected vaginal swabs and anonymous screening were well-accepted by the CSW as many reported fear of stigmatization and possible legal repercussions if they attended STD clinics. The effect of freezing, washing and high-speed centrifugation on the outcome of BD ProbeTec Chlamydia analysis on urine samples G. Lisby, H. Westh (Hvidovre, DK) Objectives: When urine samples for Chlamydia trachomatis (CT) are not analysed immediately, it has been standard procedure to freeze the samples at -20°C until analysis. On known CTpositive and CT-negative patient samples, we valuated the impact of freezing, washing or not washing the unfrozen samples as well as the impact of centrifugating frozen samples at 10.000 xg prior to analysis. Methods: All urine samples were analysed (no freezing) with the BD ProbeTec system. The remaining sample was frozen at -20 C for inclusion in this study. We carried out three 'arms' of investigation: 'Arm 1': Frozen positive samples and frozen negative samples were thawed and reanalysed after washing. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 'Arm 2':Refrigerated positive and negative samples were analysed without washing. 'Arm 3': frozen positive and frozen negative samples were thawed and analysed after centrifugation at 10.000 xg and washing. We tested the effect of centrifugation at 10.000 xg to determine whether 10.000 xg is more efficient than the traditional 3,000 xg to sediment the CT organisms. Due to cellular lysis caused by the freeze/thaw cyclus, the intracellular CT will be found in the extracellular phase, and might not sediment completely at 3,000 xg. International external quality assessment for C. trachomatis using EIA and molecular methods C. trachomatis is a sexually transmitted pathogen that causes genital tract infections in both men and women. Clinical symptoms may be absent or silent, delaying treatment and leading to serious consequences such as infertility. In 1991, UK NEQAS for Microbiology introduced an international EQA scheme for the detection of C. trachomatis by EIA and since the use of molecular methods increased in clinical laboratories more challenging specimens were included in the distributions. Objective: To summarise results of an international EQA scheme for C. trachomatis and compare the performance of EIA and molecular methods used in the detection of C. trachomatis in specimens with varying EB/mL consistent with those found in urine samples. Methods: A total of 9 positive and 7 negative 0.5 mL specimens were produced in varying concentration of C. trachomatis (L2 strain in buffer solution with 0.05% Bronidox) and distributed to participants in 8 panels. Participants were instructed to examine 0.1 mL of each specimen for the presence of C. trachomatis and report results within 21 days. Results: Overall detection of C. trachomatis in the positive specimens by all methods varied from 32.3 to 83.6%. Detection by molecular methods (66.4-98.6%) was significantly higher than EIA methods (2.3 -69.2%). Risk difference analysis showed that all methods were significantly more likely to detect C. trachomatis when present at higher concentrations. Analysis of specific molecular assays indicated Abbott LCx â detected 72.7-100%, BDProbeTeET detected 31.4-100% and the Roche * methods detected 84.5-100%. Participants using the BDProb-eTecET were less likely to give positive results at dilutions of 1:1200 and greater, whereas Abbott LCx â was less likely to give positive results at dilution of 1:2500 and higher and the Roche methods were more likely to report a positive result on less concentrated specimens.False positive reporting was rare with the negative specimens (19/1985; 0.3-1.5%) and more common with EIA users. Objectives: To optimise and evaluate the use of an automated extraction on m1000 apparatus (Abbott) before performing realtime PCR using the RealArt C. trachomatis TM PCR kit (Abbott) for a rapid and sensitive detection of Chlamydia trachomatis (CT) in sperm and urine specimens. In France, the detection of CT in sperm is mandatory before assisted reproductive techniques are performed, justifying the need to have validated methods to test such specimens known to contain PCR inhibitors. Methods: An automated protocol was defined on the m1000 apparatus and applied to the extraction of urine and sperms previously tested positive by the Cobas Amplicor test (Roche Diagnostics) and kept frozen at -20°C. The quality of the extraction on sperm samples was evaluated by the quantification of the beta-globin gene by an in-house real-time PCR. The sensitivity of CT detection was evaluated on sperm samples spiked with dilutions of a positive cloned PCR product included in the PCR kit. In the final protocol, the internal control of the PCR kit was incorporated in the sample tube on the m1000 apparatus in order to control the whole extraction protocol. These extraction and PCR conditions were then evaluated in a prospective study involving 300 clinical specimens of sperm (n = 285) or urine (n = 15). Results: In the preliminary experiments, the specimens detected positive by Cobas Amplicor and kept frozen were all found positive by combining the automated extraction protocol and real-time PCR. The extraction protocol was found suitable either on crude sperms or on sperm pellets, with a reproducible quality of extraction on the m1000 apparatus, as evaluated after quantification of the human beta-globin gene. The sensitivity of detection in sperms was at least of 1 copy/microlitre elution volume of positive control. In the prospective study, 5 positive specimens were detected, one in urine (6.6%) and 4 in sperm (1.4%). The inhibition rate in sperm was 1.4% (4/285); a pretreatment of samples with proteinase K and SDS removed these inhibitors. The whole duration of the process, including automated extraction and real-time PCR testing, was 4 hours for at least 30 samples. Conclusion: The m1000 apparatus was found suitable and convenient for the rapid and automated extraction of DNA from sperm and urine specimens before detection of CT by real-time PCR. Simultaneous isolation of Chlamydia trachomatis, Neisseria I, Mycoplasma genitalium and Ureaplasma urealyticum from urine, using chlamCAP, an automated sample preparation system based on magnetic particle separation Objectives: Chlamydia trachomatis and Neisseria gonorrhoeae infections are a worldwide public health problem with a combined estimated incidence of over 75 million cases. For C. trachomatis alone approximately 4 mill new cases is registered every year. Sexually transmitted diseases are often caused by more than one microorganism. For instance, co-infections of C. trachomatis with N. gonohorroeae may be as high as 20% in certain countries. Of nonchlamydial, nongonococcal urethrisis, Mycoplasma genitalium and Ureaplasma urealyticum are considered to be the microorganisms most commonly involved. M. genitalium has been directly implicated in numerous genitourinary tract pathologies, and U. urealyticum has been associated with acute prostatatis and preterm delivery in connection with pregnancy. Methods: Here, we present a new system, chlamCAP, for simultaneous sample preparation of DNA for all four bacteria mentioned above from urine samples followed by four separate PCR amplifications using specific primers. With the new method, the bacteria is initially adsorbed to uniquely coated paramagnetic particles and magnetically separated from the sample. A rapid lysis at room temperature releases DNA, which is adsorbed onto the same magnetic particles. After washing, the robot transfers purified DNA to microwells for PCR analysis. Results: A C. trachomatis positive urine sample was spiked with N. gonorrhoeae, M. genitalium, U. urealyticum in all combinations of four different concentrations , with the highest concentration at approximately 10.000 CFU/ml. All samples were positive for C. trachomatis indicating that the presence of the other bacteria does not negatively interfere with the capture of this bacterium. In most samples, all four species could be detected. Moreover, increased concentration of N. gonorrhoeae had a positive effect on the detection of the other species, which can be described as interspecies hitchhiking. Conclusion: In summary, the results obtained demonstrate that the chlamCAP system can be used to simultaneously detect all these STD species. This new system represents a solution for analysis of the bacteria most frequent involved in STD using urine samples, and could be an important contribution to reduce their prevalence. A new flexible automated sample preparation method based on paramagnetic particles for the isolation of Chlamydia trachomatis from urine samples, for downstream analysis using three different naat systems Objectives: Chlamydia trachomatis is the leading cause of sexually transmitted disease worldwide. It is important to improve diagnostic methods using non-invasive sample collection to favor increased testing. With the current available methods, swab still prevails over urine sampling mainly due to higher NAAT inhibition and the necessity of centrifugation of urine samples. Method: A method avoiding centrifugation, chlamCAP (Genpoint, Norway), initially developed for C. trachomatis has been automated using a customized Tecan Miniprep 75 robotic system for DNA preparation from urine samples. A multi-centre study is presented where urine samples were analysed for C. trachomatis using the automated chlamCAP system combined with three different NAAT 1) BDProbeTec TM ET (Becton Dickinson), 2) validated in-house Taqman PCR and 3) Cobas Amplicor (Roche). Evaluation was performed using the results produced in parallel by the on-site reference DNA preparation methods and a third independent method was used to resolve discrepant results. With this new method, bacterial cells are initially adsorbed to uniquely coated paramagnetic particles and magnetically separated from the urine, removing NAAT inhibiting substances. After lysis at RT and washing, the robot transfers purified DNA, resuspended in the appropriate buffer, to the final NAAT recipient. Results: With the BDProbeTec TM ET SDA as downstream analysis system, specificity obtained for both sample preparations was 99.9 %, whereas a sensitivity of 98.8% and 97.6% was obtained for BDProbeTec TM ET and chlamCAP, respectively. No inhibition was observed using the magnetic particles. For the inhouse developed Taqman analysis sensitivity was 95% and 98.3% for on-site reference sample preparation and chlamCAP, respectively. For the Cobas Amplicor analysis, sensitivity was 93.1 and 98.3% and specificity at 99.7% and 100%, using Cobas Amplicor and chlamCAP procedure for DNA isolation, respectively. Conclusion: The clear improvements brought by this new automated DNA preparation method will help promote the choice of urine as sample material, alleviating the need of a physician for sample collection. Finally, its compatibility towards diverse NAAT and potential for DNA preparation of other STD organisms such as Neisseria gonorrhoeae, Mycoplasma genitalium and Ureaplasma urealyticum, enables the development of a universal automated DNA preparation platform suitable for most STD laboratories. Objectives: To estimate efficacy of the hepatitis B immunoprophylaxis in children with malignant diseases. Materials and methods: 250 children with different malignancy at the age from 0 to 16 years (median 6 years) which received the chemotherapy were included in the study. 124 patients received an active immunization by the recombinant vaccines «Engerix B» or «HB-Vax II» by scheme: 0-1-2-6 months, 10 mkg -21 patients, 20 mkg -92 patients. 13 patients received a combined immunoprophylaxis -specific antibody «Hepatekt» 20 MU/kg by scheme: 0-1-2-3-4-5 months along with «HB-Vax II», 0-1-2-6 months, 10 mkg. Vaccination was conducted in the children without serologic marker of the hepatitis B at the first 3-7 day after the diagnosis of malignancy. 113 children with malignancy not received the specific immunoprophylaxis, and formed a control group. Results: After the 6 months, the level of the protective antibodies (anti-HBs) was exceeded 10 mMU/ml (the titre median 15.3 mMU/ml) in 66% of children, which received 20 mkg vaccines, and in 25% of children, which received 10 mkg vaccines (g < 0.05). The titre of protective antibodies in 13 patients, which received a combined immunoprophylaxis, was revealed earlier (g < 0.05). The titre median of anti-HBs after 3, 6 and 12 months were accordingly 193.5 mMU/ml, 126.2 mMU/ ml and 47.4 mMU/ml. The contamination of the hepatitis B in group with specific immunoprophylaxis was 13.7%, in control group -41%, (g < 0.05). Conclusion: Vaccination in children with malignancy at the time of chemotherapy in the redoubled dose or combined immunoprophylaxis were effective. Quantification of serum HBV-DNA with Cobas Taqman for the diagnosis, monitoring and prognosis of chronic hepatitis B virus infection Methods: 400 sera from individuals with current or past HBV infection, chronic HDV infection and subjects unexposed to the hepatitis B virus were tested with the COBAS TaqMan HBV Test. The results were compared to the findings of the COBAS Amplicore HBV Monitor Test (Roche) and our in house Real Time PCR. Results: The TaqMan test correlated best with our PCR (r = 0.98, p < 0.001). Its specificity was very high, with the TaqMan Test being negative in the samples of persons unexposed to the virus. In samples from patients with low level viraemia, its sensitivity was much higher, picking up 69% of PCR negative and 94% of monitor negative samples. Among patients diagnosed as long-term inactive HBsAg carriers, 95% of the samples were positive with levels ranging from 32 to 106 copies/ml, whereas 16% and 20% of the samples were negative with PCR and monitor respectively. Low HBV viraemia levels were also picked up in patients with markers of past infection, who were negative by the compared PCR methods. All patients with HDV infection had detectable HBV-DNA with a maximum of 15,000 copies/ml. Data from serial samples of patients undergoing antiviral treatment showed that many individuals were wrongly classified as virologic responders on the basis of non detectability with the compared methods, when in fact HBV-DNA was positive or exhibited a breakthrough increase under therapy. The COBAS TaqMan HBV Test is a sensitive method for detection and quantification of HBV-DNA in serum and can be used for a better monitoring of treatment results. When sequential samples are tested, this method can predict earlier a subsequent breakthrough of the response to antiviral therapy. Introduction: HBV strains have been classified into seven genotypes designated A-G based on an intergenotypic nucleotide divergence exceeding 8% of the complete genome. HBV genotypes seem to have a characteristic geographic distribution. More over the majority of Greek patients with CHB are HBeAg (()/HBeAb(+). During the last decade Greece has hosted a great number of economic immigrants. Aim: Our intention is to assess the prevalence of HBVgenotypes and associate them with HBeAg status. Evaluation of two commercial HBsAg assays for low-end sensitivity to hepatitis B surface antigen J. van Helden, O. Lentzen (Mönchengladbach, D) Objectives: The development of immunoassays with the highest possible sensitivity for detecting those HBV infections most commonly encountered in the routine clinical setting is a major challenge for manufacturers. Currently, the diagnostic sensitivity of most commercial HBsAg tests is below 0.5 ng/ml. However, false negative results are still obtained. This may be due to the presence of HBsAg below the detection limit of the assay, which could occur in early acute disease or in chronic and convalescent phases of the disease. Mutant HBV strains with altered antigens have been shown to affect the reactivity of the antigens with some commercial HBsAg assays. The incidence of these viral variants appears to be limited to chronically infected individuals especially those under medically or naturally induced immune pressure. Methods: The present study was designed to evaluate the lowend sensitivity of two commercial HBsAg immunoassays, the Bayer ADVIA Centaur â HBsAg assay and Abbott AxSYM â HBsAg assay. The following materials were utilized to evaluate HBsAg assay sensitivity: PEI standards for HBsAg ad/ay subtypes, one BBI HBsAg (ad/ay) sensitivity panel, 3 low-titer and mixed-titer panels, BBI, BCP and NABI HBsAg seroconversion panels, and the Teragenix Hepatitis B Precore Mutant panel. Results: The Bayer ADVIA Centaur HBsAg assay has a better low-end sensitivity and detects the presence of HBsAg at an earlier stage than the Abbott AxSYM HBsAg assay, thus reducing the window period. The study results also indicate that both assays detect all HBV precore mutants. Results are summarised in Tables 1 and 2 . Conclusions: The improved low-end sensitivity of the ADVIA Centaur HBsAg provides a clinically important advantage for routine HBsAg testing. Eighteen chronic renal failure patients (creatinine clearance 12-27 ml/min/1.73 m 2 ) and 33 patients on haemodialysis received three doses of 40 mcg of Engerix with the short schedule. In non-responders, a fourth dose was administered six months after the third. Antibodies to HBsAg (anti-HBs) were measured with an immunoenzyme assay (Assxym, Abbott Diagnostics). More than 10 UI/l of anti-HBs two months after the first dose of vaccine was considered as protective. Results: Forty-three of the 56 patients (77%) vaccinated with the classic schedule seroconverted (>10 UI/l of anti-HBs). Eleven of the 18 patients (61%) with chronic renal failure and 10 (30%) of the 30 hemodialysis patients vaccinated with the short schedule seroconverted. Among hemodialysis patients, the response rate was lower in patients vaccinated with the short schedule (30% and 77%, p < 0.001). In 16 non-responders, 9 seroconverted after the fourth dose of vaccine. Conclusion: In chronic renal failure patients, the short schedule of vaccination against hepatitis B is less efficient than the standard 6-months schedule. A 4-week schedule may be indicated only in patients who have no time to receive a vaccination with a classic schedule. Our data indicate that a booster dose of HBV vaccine will be needed in most of chronic renal failure patients. A study of HBV vaccination among anti-HBs negative hospital health care workers Objective: Needle stick injury is not a rare accident among hospital health care workers. Hepatitis B virus (HBV) infection is one of the main infectious agent through needle stick injury. Therefore, HBV vaccination is strongly recommended for HBV exposure risk group. Through the surveillance we studied how many HCWs could get anti-HBs after vaccination and analysed the effects of HBV vaccination in Korean HCWs. Methods: We surveyed 571 hospital HCWs (doctors, nurses, aid-nurses and technicians) about previous HBV vaccination history and tested HBsAg, anti-HBs with titer and HBcAb,IgG using enzyme immunoassay. After that, we recommended HBV vaccinations according to 3 cycle schedules (0.1 and 2 months) in 118 cases of anti-HBs negative HCWs. Results: Of 571 persons, 118 showed anti-HBs negative results. Among them, 58 persons had completely finished 3 cycle HBV vaccination programme. The ratio of male to female was 11:47(19%:81%). The positive rate of anti-HBs were 65.5%(38), 81.0%(47) and 93.1%(54) after 1st, 2nd and 3rd cycle respectively. However, the anti-HBs titers were not associated with vaccination cycles. The 4 cases of anti-HBs negative persons had no previous vaccination histories and HBcAb were also negative. The HBcAb negative group showed remarkably higher anti-HBs titers compared with HBcAb positive group (622 IU/mL vs. 52 IU/mL) though their anti-HBs formation rates were lower than HBcAb positive group (92% vs. Objective: Needle stick injury associated with HBV is not a rare accident among hospital healthcare workers (HCWs). The prevalence of HBV infection was reported as 5-8% in Korea. Therefore basic data about prevalence of HBV viral markers (HBsAg, HbsAb and HBcAb) with vaccination histories in health care workers are very useful for the guideline of hospital infection control and HCW benefit. Methods: We tried to survey 725 HCWs including doctors, nurses, aid-nurses and technicians and 571 HCWs (123 male and 448 female) participated in the surveillance and answered about previous HBV vaccination histories. HBsAg, HBsAb (Elecsys 2010, Roche) and HBcAb, IgG (Centaur, Bayer) were analysed with enzyme immunoassay. Results: The positive rate of HBsAg and HBsAb was 2.4% and 76.8% respectively. HBsAg())/HBsAb()) cases were 20.7%. The range of HBsAb positive rates were 64.3%-79.6% according to the occupational divisions. The division of nurse was the most (80%) and group of doctors (64%) were the least prevalent HBsAb positive groups respectively. Of all cases, 24.2% did not have HBV vaccination histories and 68.8% had experienced more than 1 time of HBV vaccination. The HBsAb titers between 100 and <1000 IU/mL were most popular in HBsAb positive cases. Among 571 cases, 74.1% showed negative HBcAb, IgG and 76.1% of them had HBsAb. The cases showing positive HBcAb also represented 78.1% positive in HBsAb tests. Conclusion: The prevalence of HBsAg and HBsAb in HCWa in a Korean hospital was similar to general population on Korea. We need more education or announcement for the group of doctors about HBV vaccination. About 75% of hospital HCWs had not been exposed to HBV mainly because of HBV vaccinations. However, no difference was found between vaccination group and non-vaccination group in HBsAb positivity, suggest-ing Korea is still high prevalent area about HBV infection. Therefore, we need to practice HBV vaccination programme for about 20% of HCWs in case of HBV exposures, such as a needle stick injury. Short-term use of lamivudine for patients with severe acute hepatitis B, a series of cases A. Radulescu, D. Tatulescu, M. Turdean, V. Zanc (Cluj-Napoca, RO) Objectives: There are limited data on the use of lamivudine for patients with acute hepatitis B. We present our experience with the use of lamivudine in seven patients with severe acute hepatitis B. Short-term use of lamivudine was considered based on almost complete viral suppression within 2-3 weeks and on practical issues (prompt recovery and drug availability). Methods: Noncomparative prospective study on the use of lamivudine in severe hepatitis B. Diagnosis of fulminant hepatitis B was established based on accepted criteria: clinical signs, portal encephalopathy, high aminotransferases levels, prothrombin levels of less than 50%. Severe hepatitis B was diagnosed upon prolonged and worsening evolution. Serologic tests were performed for hepatitis B surface antigen, Ig M antibodies to hepatitis B core antigen also for hepatitis A and C. Lamivudine at a dose of 100 mg per day was introduced since hepatitis was severe and progressive under supportive treatment. Patients were monitored till hospital discharge and the routine follow-up was ensured. Results: Fulminant hepatitis B developed in three healthy individuals (27-50 years) and in two cases (50, 62 years), having liver injury due to isoniazid-rifampin and alcohol abuse, respectively. One severe cholestatic hepatitis B occurred in a 62-year-old patient at three months after surgery for cholelitiasis. After initiation of lamivudine astonishing clinical recovery occurred in six cases, the aminotransferases and billirubin levels decreased quickly and patients were discharged well in three weeks without lamivudine treatment excepting the two cases, with previous liver injury who continued the treatment for 3-6 months. After drug cessation, no clinical signs and biochemical tests suggested a rebound. AgHBs seroconversion was documented in three patients at 3 and 6 months, all six patients being well with normal biochemical findings. In a healthy 33-year-old woman, who developed aggressive fulminant hepatitis due to strenuous physical effort and use of anti-inflammatory drugs before onset lamivudine was postponed. No benefit was observed and she died before liver transplantation after seven days of treatment with lamivudine. Conclusion: Short-term use of lamivudine in severe hepatitis B induced a prompt recovery and sustained serological response. Our data encourage the use of this safe drug that seems to be effective in short regimens covering the period of hepatic failure. Methods: HBsAg testing was done with Vidas HbsAg and HbsAg-Ultra (bioMérieux), Advia Centaur HBsAg (Roche), Axsym HbsAg (V2) (Abbott), Abbott Prism HBsAg (Abbott) and Access AgHBs (Analis). HBV surface antibodies (HBsAb), HBV e antigen and antibody (HBeAg and HBeAb) were tested with Vidas (bioMérieux), HBV core antibodies (HBcAb) with Access (Analis). DNA was extracted from serum and amplification was done by real time PCR with primers directed to the precore/core gene of HBV.For analysis of the S-gene sequence, cycle sequencing was done with primers targeting the small S-gene. Results: Before HTx, the patient was HBsAg and HBV DNA negative but HBcAb and HbsAb positive. Three years after HTx, elevated liver tests were found repeatedly but serological investigation for HAV, HCV, CMV, HSV and EBV was negative. Real time PCR detected high load of HBV-DNA. None of the above mentioned serological assays was able to detect HBsAg in the serum of the HTx patient. However, HBcAb, HBsAb, HBeAg as well as HBeAb were positive.The HBV small surface antigen sequences were analysed by cycle sequencing and compared with NCBI Genbank sequences. This revealed the presence of multiple missense mutations: 15 mutations (compared to AY236162) were found in the major hydrophilic loop (aa 98-169), the most antigenic part of the small surface antigen. Conclusion: The virus escaped detection by all commercial serological HBsAg assays tested. The majority of the antibodies used in these assays are directed against the small surface antigen, and binding is strongly influenced by the presence of missense mutations at crucial loci present in the viral DNA. Future serological assays for detection of HBsAg should take mutations in the major hydrophilic loop into account in an attempt to detect as much HBV mutants as possible. Complete genome sequence and phylogenetic relatedness of hepatitis B virus isolates from Iran Objectives: To date, no study has been carried out by the hepatitis B virus (HBV) complete genome sequence from Iranian HBV infected patients. The objective of this study was to investigate phylogenetic analysis, genome organization and genotype characterization of HBV strains which obtained from Iranian chronic infected subjects and compared with HBV genotypes reported from the Middle East countries. Methods: HBsAg-positive sera were collected from the five Iranian chronic HBV carriers. The complete HBV genome was amplified using two novel primers that have introduced Hind III and EcoR I restriction enzyme cleavage sites. The HBV fulllength amplicon was cloned into pCR â 2.1 plasmid and then sequenced. The Iranian HBV genome sequences were compared with 23 human HBV genome sequences. Alignment was achieved using CLUSTALX software, genetic distance was estimated using the Kimura two-parameter algorithm and then phylogenetic trees were constructed by the neighborjoining method. Recombination was investigated using SimPlot, BootScanning programme and a web-based genotyping tool for viral sequences. Results: Results showed that the five strains were closely related to each other, with 97-100% nucleotide similarity. Phylogenetic analysis based on the complete genome sequence revealed that all stains were classified into genotype D. The S gene encoded Arg122, Pro127 and Lys160 corresponding to subtype ayw2. All strains had nucleotide lengths of 3182 bp except the IR-P4 strain with a unique 3185 bp and with a Phe89 insertion in the X gene. The intragenotypic divergence of the complete genome sequence of Iranian strains was 1.8% and the intergenotypic to the genotype D was 3.8% and to other genotypes was 7.9-15.4%. The Middle East countries HBV gene sequences analyses findings showed that HBV genotype D subtype ayw2 is the most dominant. Results showed that Saudi Arabia isolates has the most similarity to Iranian isolates and then Turkish, Egyptian and Yemeni isolates ranked next, respectively. Conclusion: This is the first report of the full-length nucleotide sequences and genome organization investigation of the HBV isolates from Iran. This study revealed that the HBV genotype D, subtype ayw2 is present in the Iranian infected patients. A unique amino acid insertion in the X gene of the one Iranian strain was detected with an unprecedented length of 3185 bp. The update Middle East HBV geographical genotypic distribution map was depicted. Autochthonous sporadic acute hepatitis E cases in Madrid, Spain Introduction: Hepatitis E virus (HEV) infection is an important cause of epidemic and acute sporadic hepatitis in developing countries where HEV is considered endemic. In Western Europe hepatitis E virus (HEV) infection is rare and only imported cases have been reported. Recently, autochthonous cases in some industrialized countries have emerged in patients who had never travelled to endemic areas .The aim of this study was to describe nine autochthonous sporadic cases of HEV infection in Madrid (Spain). Methods: From June 1999 to September 2004, nine patients with acute hepatitis and IgG anti-HEV antibodies in serum specimens were detected at our hospital. Viral markers for HAV, HBV and HCV were negative with an EIA assay (Assxym, Abbott Diagnostics). IgG and IgM anti-HEV antibodies were studied by EIA (Bioelisa HEV IgG and Bioelisa HEV IgM, Biokit; Barcelona, Spain). Detection of RNA-HVC and DNA-HVB was performed with TaqManR (Roche Diagnostics). All patients had increased aminotransferase levels and symptoms of acute hepatitis. Patients were questioned about epidemiological risk factors related to HEV infection such as travelling to endemic areas or contact with animals. Results: Anti-HEV IgG and IgM antibodies were found in all patients. Seven patients were males and two females, mean age 61.4 years (46-80) with mean ALT values of 1418 (84-5727). No risk factors for HEV infection were found except in two patients: one who worked in a slaughter-house and another who was an occasional horse rider. Patients denied to have travelled to endemic areas. Conclusions: In endemic areas, HEV infections are most frequently found in young adults. Our patients were older than those reported by other authors. Given that some animals may be reservoirs of HEV and animal-to-human transmission occurs, we think that two of our patients had a risk factor for HEV infection. Although HEV infection is very rare in non-endemic areas, it must be considered in the diagnosis of acute hepatitis with negative viral markers for HAV, HBV and HCV, even if patients have never been in endemic areas. HEV infection must be considered as emergent in our country because of the increasing immigration and geographical situation. J. Mossong, L. Putz, S. Patiny, F. Schneider (Luxembourg, LUX) Objectives: A prospective seroepidemiological survey was carried out in Luxembourg in 2000-2001 to determine the antibody status of the Luxembourg population against hepatitis A virus (HAV) and hepatitis B virus (HBV). One of the objectives of this survey was to assess the impact of the hepatitis B vaccination programme, which started in May 1996 and included a catch-up campaign for all adolescents aged 12-15. Methods: Venous blood from 2679 individuals were screened for the presence of antibodies to hepatitis A virus antigen and antibodies to hepatitis B surface antigen (HBsAg) using an enzyme immunoassay. Samples positive for HBsAg antibody were tested for antibody to hepatitis B core antigen (anti-HBc) using a chemiluminiscent microparticle immunoassay to distinguish between individuals with past exposure to vaccine or natural infection. Results: The estimated age-standardized anti-HAV seroprevalence was 42% in the population above four years of age. Seroprevalence was age-dependent and highest in adult immigrants from Portugal and former Yugoslavia. The age-standardized prevalence of anti-HBsAg and anti-HBc was estimated at 19.7% and 3.16%, respectively. Anti-HBsAg seroprevalence exceeding 50% was found in the cohorts targeted by the routine hepatitis B vaccination programme, which started in 1996. Conclusions: Our study illustrates that most young people in Luxembourg are susceptible to HAV infection. The hepatitis B vaccination programme is having a substantial impact on population immunity in children and teenagers. Hepatitis A outbreak in a school observed after an explosion in the sewer system Objectives: Hepatitis A is a classical example of infections transmitted by fecal-oral route and its prevalence is closely related with the socioeconomical status. In societies showing moderate endemicity, primary transmission route is personal contact, on the other hand water originated outbreaks may be seen. Methods and Results: In this study, a hepatitis A outbreak observed in a local school following an explosion in the sewer system in a street in Istanbul Sariyer on September 27th 2004, is investigated. 32 children attending this school and living at homes around had hepatitis A, clinically, the first case seen 25 days after the explosion. Age distribution of the children is 1-18 and the mean age is 8.4. The first case was detected on October 22nd and 21 cases were reported in the first 6 days and 32 cases were seen in 17 days. Water samples were taken and fecal contamination was searched at the school in order to find out the origin. The canteen and the toilets were also searched. All the students were checked up to find out new cases. Teachers and students were educated about the disease and hygiene by doctors of Health Group Presidency, continuity of education was provided by a doctor in charge throughout the outbreak and other schools around were checked and educated by cooperation with Directory of National Education. Origin research was also performed at homes of all cases and the families were informed about the disease and quarantine precautions. ISKI was quickly informed about the subject and controls by taking water examples and documentations were also done by ISKI. Conclusion: The dimensions of an outbreak of an infectious disease transmitted by water fecal-orally in a metropolis of 11 million population may be great. In our country report of hepatitis A is obligatory. Because of this, the origin of the disease is searched soon after reported cases and the isolation of the cases is provided. Hepatitis A vaccine is not included in the National Vaccination Programme of our country. If there is not a serious risk to have the disease in childhood, there is no need for passive immunization. All the contacts were evaluated in this respect, also. The outbreak was under control at the end of the first week by the precautions and education at the school with a population of 1400. Prevalence of anti-HAV antibodies in different age groups in Spain Introduction: The hepatitis A virus (HAV) usually spreads by the fecal-oral route, and is frequently associated with poor hygiene habits and conditions. The prevalence of HAV decreases when hygiene conditions improve. IgG antibodies against HAV last for years (frequently lifetime) in patients who have suffered hepatitis A, and seroprevalence can so be used to know the frequency of contact with the HAV in a group.We have studied the seroprevalence of IgG antibodies against HAV in sera from non-selected, healthy individuals, obtained in 1997 and 2004, in order to know the seroprevalence in different age groups and the evolution of seroprevalence. Methods: 250 sera samples obtained in 1997 and 250 sera obatined in 2004 from healthy patients were studied. Both sera groups were organized in 5 age group including 50 sera each, as follows: group 1: patients 18-25 years old, group 2: 26-35 years old, group 3: 36-45, group 4: 46-55 and group 5: 56-65. Sera were studied by EIA (HAV Liaison, Saluggia, Italy. Results: Appear in Table 1 . In 1997, more than 50% of patients between 26 and 35 years old, and almost all patients older than 36 years had anti-HAV antibodies, while only 28% of patients between 18 and 25 years were positive. In sera obtained in 2004, the seroprevalence has changed significantly. The seroprevalences in groups 1, 2 and 3 are much lower (8% vs. 28%, 22% vs. 56%, and 58% vs. 98%), while a seroprevalence of 100% remain in groups 4 and 5. Comments: Seroprevalence of anti-HAV antibodies has been very high in adult individuals in Spain, but is decreasing very fast. At this moment, seroprevalence remains around 100% only in patients older than 45 years, and is around 50% in patients between 36 and 45 years, but is becoming very infrequent in young adults. This situation shall be had in account in order to stablish vaccination protocols against HAV. Methods: Prospective study of elderly (>50 years) patients presenting to their general practitioner with acute HZ (rash <1 week). Personal and demographic data were registered from patients and pain was assessed using visual analogue scale and quality of life questionnaires. Blood samples were collected at baseline and one week later and analysed for IgA, IgG, and IgM. Pain was assessed at the initial visit and subsequently after 1, 2, 3, 4, 8, 12, and 26 weeks. Results: 270 patients were included. In 26 (10%) of them HZ could not be serologically confirmed. A significant association was found between titers of IgA and IgG at the initial visit and age and severity and duration of rash. There was no significant association between reported pain and titers of antibodies. Serological data did not contribute to the prediction of occurrence of PHN. The clinical diagnosis of HZ made by the general practitioner can be serologically confirmed in most cases. The titers of antibodies are correlated with the severity and duration of the rash. They are, however, not associated with the intensity of pain, neither are they predictive for the duration of pain. Herpes zoster in hospitalised Turkish children Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 age at presentation was 119.3 ± 55.5 months (ranges from 9 months to 15 years). Established underlying diseases for childhood herpes zoster were found in 17 (89%) of 19 cases. The most common underlying diseases were lymphoma (6 patients) and acute lymphoblastic leukaemia (5 patients). No history of varicella was recalled in 9 (47%) of 19 cases. The interval between varicella and herpes zoster ranged from 4 to 144 months. Involved dermatomes were thoracic (10 patients), servical (7 patients) and sacral (2 patients). Two dermatomal involvement was detected in only two children. Two children experienced mild pain during the eruption, without requiring specific therapy. In 3 (15%) of 19 cases, herpes zoster-associated complications including pneumonia, hepatitis and keratoconjunctivitis were noted. None of the patients was immunized against varicella. The mean period between the onset of rash and the initiation of acyclovir treatment was 2.4 ± 1.1 days (range 1-5 days). Eighteen of 19 cases received intravenous acyclovir treatment. Five of these patients had received sequential parenteral/oral acyclovir treatment, whereas only one patient received only oral treatment. Acyclovir treatment was discontinued because of renal toxicity in one child. The mean treatment period was 7.7 ± 1.0 days (range 7-10 days) in 18 patients. No cases with post herpetic neuralgia were recorded. Conclusion: Acyclovir treatment started on time, is very important for the prevention of progress of the disease. Acyclovir treatment is so effective that acyclovir prophylaxis seems unnecessary to prevent or modify clinical varicella in immunocompromised children. Varicella immunization is important for prevention of varicella and herpes zoster. Objectives: Herpesviruses are among the most 'successful' human pathogens. Inhibition of apoptosis is a common strategy of viral pathogenesis that favors virus replication and may contribute to oncogenesis. The herpes simplex viruses 1 and 2 (HSV1, HSV2) code for a variety of proteins that cooperate in blocking apoptosis triggered by virus infection. Nitric oxide (NO), a potentially toxic signal molecule, has been implicated in a wide range of diverse pathophysiological process. The crosstalk between cell destructive and protective signaling pathways, their activation or inhibition under the modulatory influence of NO will determine the possible role of NO in apoptotic cell death and/or survival. Acylovir's effect mechanism targets at the viral DNA polymerase, acts as a chain terminator. Its first phosphorylation step is catalyzed by the virus encoded thymidine kinase. Acyclovir's interactions with cell death and NO seem to be very important because of 'post treatmental cognitive functions'that may be encountered due to treatment processes for encephalitis, meningitis cases. Methods: HEp-2 cells were infected by HSV1 (KOS strain) (and UV-inactivated Mock of the same strain) and HSV2 (G strain) (and UV-inactivated Mock of the same strain). Infected cells were treated by non apoptotic doses of acyclovir (48.8; 24.4; 12.2; 6.1; 3; 1.5 lg/mL), respectively. Following 24 hours of infection cells were detected by Hoechst 33342 and propidium iodide for apoptosis/necrosis, and culture supernatants by Griess reagent for NO. Results: NO responses were significantly higher in HSV 1 infected cells in 48.4; 24.4; 12.2, but after 6.1, in 3 and in 1.5 NO responses were higher in HSV2 infected cells. Also in HSV1 infected cells with 48.4; 24.4; 12.2 doses of acyclovir, apoptotic responses were higher than HSV2. But necrosis responses were significantly higher in HSV2 infected cells (48.8; 24.4; 12.2; 6.1; 3 lg /mL). Conclusion: In this study, it is shown that there are significant differences between HSV 1 and 2 in apoptosis/necrosis, and NO responses. It is assumed that involvement of acyclovir in doses higher than 6 lg/mL may trigger the necrotic pathway in HSV2 infected cells, the same compound seems to cause statistically significant higher NO response in HSV1 infected cells in contrast to those infected with HSV2. These results deserve further studies in order to explain the effects of acyclovir in treatment processes especially in 'cognitive functions'. Clinical evaluation and significance of herpes viruses DNA amplification in the central nervous system of neurological patients ( and 1 HHV-6 (5.5%). Of the 38 patients, 22 (57.8%) were adults and 16 (42.2%) were children (<15 years); 26 (68.4%) were male and 12 (31.6%) female (p < 0.05). The definitive clinical diagnosis of the HSV-positive patients were: 10 (40%) encephalitis, 6 (24%) lymphocytic meningitis, 3 (12%) intracraneal hemorrhage, 2 (8%) tuberculosis meningitis, and 4 (16%) other neurological syndromes; in this group 4 (16%) patients were HIV-positive. Of the 10 CMV-positive patients, 3 (30%) presented with a congenital CMV infection, 3 (30%) were HIV-positive, 2 (20%) had a lymphocytic meningitis, and 2 (20%) other neurological syndromes. The 2 (100%) VZV-positive patients were children with a clinical post-varicella encephalitis. The only HHV-6 positive patient was a child of 4 years with exanthem subitum with neurological manifestations (convulsions). The correlation between Herpes viruses genome amplification in the CSF and the clinical study of the patients analysed (clinical significance) was 64% in the HSV, 80% in CMV and 100% in VZV and HHV-6, with an overall correlation of 71%. Of the CMV and HSV-positive patients, 30% and 16% respectively were HIV-positive (p < 0.05). The PCR is a highly sensitive technique although in some cases the results obtained are difficult to relate with clinical symptoms, especially in tuberculosis meningitis and cerebral hemorrhage (false positive). The crystal structure of HCMV UL44 and analysis of its interaction with UL54: new targets for drug discovery The human cytomegalovirus DNA polymerase is composed of a catalytic subunit, UL54, and an accessory protein, UL44, which has been proposed to act as a processing factor. We have solved the crystal structure of UL44 to 1.85 A resolution. Remarkably, the structure revealed a dimer of UL44 shaped like a C-clamp that could partially surround double-stranded DNA. Each monomer resembles herpes simplex virus UL42, with the dimer interface near the base of a region of UL44 identified in the crystal structure as the 'connector loop'. Analytical ultracentrifugation and gel filtration measurements demonstrated that UL44 also forms a dimer in solution, and substitution of large hydrophobic residues along the homodimer interface with alanine disrupted dimerization and decreased DNA binding. In addition, to define individual residues in UL44 and UL54 that are crucial for interacting with each other, we have engineered several mutations both in the C-terminal region of UL54 and in the connector loop of UL44. Substitution of alanine for Ile135 in UL44 and for Leu1227 or Phe1231 in UL54 greatly impaired both the UL54/UL44 interaction in pull-down assays and long-chain DNA synthesis, identifying these residues as crucial for subunit interaction. Using isothermal titration calorimetry, we quantitatively measured the binding of peptides corresponding to the extreme C-terminus of UL54 to UL44. We found that a peptide corresponding to last 22 residues of UL54 bound specifically UL44 in a 1:1 complex with a dissociation constant of approximately 0.7 lM, and that substitution at UL44 residue 135 completely abolished binding to the peptide. Thus, the results identify specific side chains that appear to be crucial for UL54/ UL44 interaction. This information and the structure of UL44 may aid in the rational design of new anti-HCMV compounds which act by disrupting the UL44/UL44 or the UL54/UL44 interaction. Development of a real-time NASBA for herpes simples virus 1+2 B. Deiman, F. Jacobs, S. Vermeer, C. Schrover, D. van Strijp (Boxtel, NL) Objectives: The aim was to develop and evaluate a Herpes simplex virus assay based on NASBA amplification and including real-time detection with molecular beacons. In this study, the performance of this new test is evaluated. Methods: HSV DNA is isolated using a semi automated magnetic extraction method and the NucliSens â miniMag. An internal control is added to the sample prior to nucleic acid extraction. Primers are directed against the POL-gene region of the HSV genome and both HSV 1 and 2 and the internal control are amplified with the same primer set. The assay includes three molecular beacon probes: two genotype-specific molecular beacon probes for the detection of HSV 1 and HSV 2 specifically, and one additional beacon for the detection of the internal control. Amplification reactions were performed in a NucliSens â EasyQ Analyser allowing real-time detection. Results: HSV 1, HSV 2 and IC are detected in one and the same reaction using a three-label approach. In co-infections, both HSV 1 and HSV 2 are detectable. Using serial dilutions of in vitro DNA, HSV detection is shown down to £10 copies in amplification for both HSV 1 and HSV 2. Good results are obtained with the QCMD panel: HSV was detectable down to 1-6 · 10 2 Geq/ml (lowest concentration) and the genotypes of the HSV samples were identified correctly. In addition, HSV is detectable in clinical samples (CSF, swabs). VZV and EBV are not detectable with this assay. With the real-time assay, HSV in CSF samples is detectable within approximately 3.0 hours. The data showed that the real-time and internally controlled HSV assay is a rapid, sensitive and specific qualitative assay for the detection of HSV 1 and HSV 2 in one and the same reaction. The use of standardized reagents offers considerable benefits in a routine setting for the clinical management of patients with HSV infections. This assay will bring same-day results, enabling early and accurate clinical intervention leading to better patient care and considerable overall health care cost savings. Development of type specific based glycoprotein G assay to identify of HSV-2 infection M. Jamalidoust, F. Fotouhi Chahooki, H. Soleimanjahi, M. Roostaee (Tehran, IR) Objective: Herpes Simplex Virus type-2 (HSV-2) is the main cause of genital herpes infection. Its prevalence is increasing worldwide and varies widely with generally higher rate in developing than developed countries and urban than rural areas. For studying prevalence and seroepidemology survey, HSV gG-2 was prepared in prokaryotic system to recognize asymptomic and unknown symptomic individuals. Methods: HSV-2 Iranian isolate was propagated in HeLa cell line. The viral genome was extracted by phenol-chloroform, and used as template in nested polymerase chain reactions (n-PCR) to amplify gG-2 gene. The amplified gene was cloned into a cloning vector (pTZ57R/T) after sequencing. In the next step competent E-coli DH5a was transformed with constructed plasmid. The resulted white colonies were selected in the presence of ampicilin; X-gal and IPTG. The recombinant plasmid (pTZ57R-gG2) was extracted and purified in the large scale after restriction enzyme analysis. The 1.1 Kb fragment was extracted and purified from LMP gel after treated with BamHI and HindIII enzymes. The isolated gene was subcloned into appropriate sites of pET32 (a) plasmid as an expression vector .The protein production was confirmed by SDS-PAGE and western blotting after induction by IPTG using a polyclonal antibody. Result: The HSV-2 gG gene was confirmed by sequencing. The results of western blotting analysis revealed that glycoprotein G of Herpes Simplex Virus type 2 was expressed efficiently in the prokaryotic system. Conclusion: The pure gG-2 can be used as a candidate antigen instead of crude whole HSV-2 in the serological tests such as ELISA. Objectives: Severe genital herpes may be the reason of infertility, recurrent pregnancy loss and IVF failures. Methods: 103 women (mean age 30.8 ± 0.82) with severe genital herpes (mean recurrence per year 7.5 ± 0.6) were included in study. We tested cervical samples for cytokines (IL-6, IL-10, TNF-alfa, IFN-gamma) and serum samples for CD69+, CD25+ and HLA-DR+ during recurrence, remission and after 8-month Valaciclovir treatment in the dose of 500 mg per Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 day. Control group was ten healthy women without genital herpes and HSV antibodies G and M in serum. Results: During herpes recurrence, the local levels of TNF-alfa increased twice and 8 times as much as compared to remission and the controls, IFN-gamma -1.5 and 2.3 times, CD69+ -1.4 and 3.3 times, CD25+ -1.4 and 2.5 times, HLA-DR+ -1.6 .and 2.5 times (p < 0.05). IL-10 decreased 4 and 3.3 times as less. After Valaciclovir treatment, the cervical levels of TNF-alfa decreased by 60%, CD69+ -26%, HLA-DR+ -23.6% (p < 0.05). Conclusion: very high levels of inflammatory markers in cervix and serum during severe genital herpes confirm an important role of HSV in genital inflammation, cervical and endometrial pathology, and allow to consider genital herpes as an inflammatory process. Herpes simplex virus -causative agent, or innocent bystander? The presence of HSV was tested using the nested PCR method at the National Reference Laboratory in Prague. Out of these patients, 6 cases of immunocompetent adults were identified, which themselves contained another etiological agent. The following data was collected: severity of the symptoms, the hospitalization length, permanent neurological sequels, and the results of neuroimaging methods including EEG. The clinical course of dual infections was then compared to all the imunocompetent adults hospitalized with neuroinfection in 2001, 185 in total. Results: 14 cases of HSV DNA were identified, including the 6 dual infections mentioned above. Among the 6 cases, 4 corresponded to the tick-born encephalitis agent (serologically confirmed), 1 case to neuroborreliosis, and 1 case to purulent meningitis. The 6 patients were 27-80 years old, with an average age of 58. All showed a substantial neurological involvement during the entrance examinations. The average hospitalization period for the dual infections was 14 days longer than in the 185 reference patients. Focal neurological sequels, typical for HSV encephalitis, were confirmed only in 1 case, the other 5 showed normal CT results. All 6 patients were treated with Acyclovir at least for 10 days. Despite the dual infection and severe entrance neurological involvement, the treatment showed positive results. Conclusion: The number of patients suffering from dual infections is underestimated. Reactivation of herpes viruses is one cause of the dual infections. Since dual infections have additive effects, it is desirable to identify these cases and to cure them causatively. Increasing evidence of primary cytomegalovirus infection in otherwise healthy adults R. Manfredi, L. Calza, F. Chiodo Bologna, I The increased availability of serology-biomolecular assays for acute Cytomegalovirosis (C),allows us to include these assays in the workout of fever of unknown origin (FUO) of immunocompetent adults. A retrospective survey of patients (p) diagnosed with primary C after referring to our centre because of a FUO associated with a broad spectrum of constitutional signs-symptoms was performed. Since the year 2001,103 p aged 14-42 years (64 females), were assessed for FUO.C serology was carried out in the 1st-step workout, together with haematological-biochemistry studies, and assays for collagen vascular and autoimmune disorders, thyroid function, and microbiology studies for mononucleosis, toxoplasmosis, HIV, communityacquired respiratory, urinary, and stool pathogens, and tuberculosis. All p underwent C serology for IgM-IgG search, a minority of p had viral DNA-antigen search. Results: Of 103 p,14 (13.6%) had a positive IgM search for C, confirmed in 4 cases by biomolecular-antigen assays.A crossreaction with EBV serology was found in 8 p, but IgM antibody titres against EBV were lower and rapidly declined during a 6-12 month follow-up. An altered leukocyte count and differential was always present,and lymphocyte subsets showed a transient imbalance of CD4/CD8 cell ratio, a decrease of rate and absolute number of CD4 cells (250-580/lL), and an expansion of CD8 subset. Underlying signs-symptoms included fever in all p associated with a mononucleosis-like syndrome in 11 p, usually characterized by a moderate lymphadenopathy and pharyngodinia. In 10 cases a moderate (2-4-fold) elevation of transaminases was present and hepatosplenomegaly was confirmed by ultrasonography. In 3 p only fever, fatigue and anorexia were the predominant signs and symptoms. A normalization of hepatic enzymes and leukocyte differential preceded the disappearance of lymphadenopathy and hepatosplenomegaly, while positive C IgM search lasted until 36 months in 1 p (mean time to disappearance:10-26 months). Discussion: Primary C is a self-limiting disease, whose apparent increase in frequency is probably attributable to the easier access to specific laboratory testing. Although no treatment is indicated in otherwise immunocompetent p, clinicians should maintain an elevated suspicion for primary C when a FUO is of concern, since C may last significantly and p with missed diagnosis are at risk of a vicious circle between an apparently unexplained disease, and the need of further examinations. Results: 27 out of 30 HHV-8-positive samples were positive on the novel EIA. Assay sensitivity was calculated at 90%. Coincidence with commercially available EIA was 98.21%. The percentages of positive reactivity in all investigated groups were as follows: 119 for health blood donors, 1.76 for children, 2.21 for STD-patients and 3.38 for HIV-infected. Specificity of the assay was around 98.2%-98.8% and there were no significant differences between health donors/children and groups at highest risk of acquiring HHV8 infection. The artificial mosaic protein used in this study demonstrated significant potential as diagnostic reagent. The new EIA is highly specific diagnostic assay for the detection of anti-HHV-8 activity in serum specimens and may be useful tool for studies of HHV-8 epidemiology.KSHV seroprevalence in the Russian European population is low both among health donors and HIV-infected people. Human herpes virus 8 infection and pulmonary hypertension in lung transplantation candidates E. Nicastri, C. Vizza, S. Cicalini, F. Carletti, R. Badagliacca, R. Poscia, F. Fedele, N. Petrosillo (Rome, I) Objectives: Human herpes virus-8 (HHV-8) has been detected in biological samples of patients affected by Kaposi Sarkoma, Castleman disease and primary-effusion B-cell lymphomas. HHV-8 has been recently described in the pathogenesis of idiopathic pulmonary arterial hypertension (IPAH). We conducted a seroprevalence study aimed at detecting antibodies to HHV-8 among a population of lung transplantation candidates; we assessed the HHV-8 antibodies seroprevalence among pulmonary hypertension (PH) patients with and without IPAH, and we compared them with non-PH patients. Methods: From January 2001 to February 2004, 75 patients referred to the Department of Cardiovascular and Respiratory Sciences of the University of Rome La Sapienza for clinical and serological evaluation for lung transplantation were consecutively enrolled in the study. The diagnosis of PH was based on international criteria. We performed assays for antibodies directed to lytic antigens of HHV-8 in plasma samples using an indirect immune fluorescent assay based on BCBL-1 cell line. Samples reactive at 1:40 dilution in the anti-lytic test were considered as positive. Results: Thirty-three patients out of 75 transplant candidates had significant PH (mean pulmonary arterial pressure >25 mmHg. Sixteen of them had IPAH, the ramining had secondary-PH. HHV-8 antibodies were detected in 9 out of 75 patients (11.5%). Three patients with HIV infection were HHV-8 Ab negative. A difference in the HHV-8 seroprevalence was found between the PH patients (3.0%) and the patients without PH (19.0%). Particularly, among the 33 patients with PH , one patient out of 16 with IPAH (6.3%) had serological HHV-8 antibodies, whereas no patient with secondary-PH had HHV-8 antibodies. Among the 42 patients with no clinical or diagnostic evidence of PH, five patients out of 29 with cystic fibrosis (17.2%), and three patients out of 13 with interstitial lung disease (23.1%) had HHV-8 antibodies, all of them affected by idiopathic pulmonary fibrosis. No difference in the HHV-8 seroprevalence rate was reported neither in patients with cystic fibrosis nor in patients with interstitial lung disease Conclusions: A 11.5% HHV-8 prevalence rate similar to that found in the Italian general population was reported among candidates to lung transplantation. No relationship between HHV-8 infection and PH, both idiopathic and secondary, was shown. Objectives: Since the discovery of Kaposi sarcoma herpesvirus (KSHV) in 1994, many questions arose about the origin, transmission and pathogenesis of KSHV. The ORF K1 gene is used to define five major subtypes A-E, with 15-30% of amino acid variability. There is not previous reports of ORF K1 Real Time assay. Methods: We analysed the K1 gene phylogenetically in 17 Cuban and 19 German KS tissues (most HIV+) by nested PCR and sequencing. In addition, we studied for the first time-24 PBMC specimens from Cuban asymptomatic sexual contacts of KS patients for the presence of circulating KSHV DNA by Real-Time PCR and also we sequenced those whose results. Moreover, we compared KSHV viral load between PBMC and KS tissues. Results: Ten of 24 (41.7%) PBMC samples showed KSHV infection by the K1 nested PCR, reinforcing that KSHV is sexually transmitted. Phylogenetic characterization revealed the majority of German samples belonging to subtypes C (n = 13) and A (n = 6), as has been previously described for European KSHV strains. Cuban samples showed a wide range of subtypes, including A (n = 17.4 were A5), C (n = 7) and B (n = 2), and one newly described subtype E. Subtypes A5 and B have previously been reported as African genotypes and E subtype has been recently found in Amerindians from Brazil and Ecuador. Furthermore, Real-time PCR detected 5 additional patients with very low KSHV viral load in PBMC that were not detectable with nested PCR. The KSHV viral load in KS tissues was much more higher than in PBMC of asymptomatic infected patients, there was also correlation among KSHV antibodies and the two DNA amplification methods. Conclusions: The subtype variability reflects the mixed ethnic background of Cubans. This new DNA amplification assay (Real Time PCR) represents a reliable technique to identify individuals at risk for developing KS lesions as well as following KSHV viral load during therapy. Objectives: Plectasin (NZ2000) is a newly discovered defensintype antimicrobial peptide of 40 amino acids isolated from the saprophytic ascomycete fungus Pseudoplectania nigrella. Plectasin is active against several Gram-positive bacteria including drug resistant strains but shows very poor activity against Gramnegative bacteria. In addition, Plectasin has shown activity in murine pneumonia and peritonitis models against clinical isolates of Streptococcus pneumoniae when the peptide is dosed intraveneously. Methods: Antimicrobial activity and spectrum were assessed by determining the minimum inhibitory and bactericidal concentrations in cationic-adjusted Mueller-Hinton broth using the NCCLS guidelines. Bactericidal activity was characterized by time kill experiments at several concentrations. Results: Purified Plectasin showed potent activity against a range of Gram-positive bacteria with MICs as low as 0.25 lg/ml against clinical isolates of S. pneumonia including penicillin, tetracycline, chloramphenicol and trimethoprim resistant isolates. Plectasin is cidal as demonstrated by MBCs that are equivalent to the MICs and has rapid kill kinetics in time kill experiments. After 24 hours incubation in 90% human serum, Plectasin is stable as measured by both ELISA and antimicrobial activity. Conclusions: Plectasin is a novel antimicrobial peptide that displays potent antimicrobial activity against Gram-positive bacteria including drug resistant organisms. The peptide is rapidly cidal against all Gram-positive bacteria but inactive towards Gram-negative bacteria. Results reported here on serum stability as well as in vivo animal models suggest that Plectasin may have potential as a systemic therapeutic agent against Gram-positive bacteria. In vitro evaluation of the peptide deformylase inhibitor LBM415 in combination with aztreonam to determine the synergistic potential against Gram-positive and Gram-negative pathogens These preliminary studies demonstrate that PDIs may display enhanced activity when tested in combination with a GN active agent and a complete lack of ANT in either GP or GN pathogens, potentially expanding the spectrum of activity of both agents. The unique mechanism of action of PDIs warrants further investigation into their potential role in combination therapy. Antimicrobial activity of LBM415 (NVP PDF-713) against a recent ( Objective: To evaluate the spectrum and potency of LBM415 (LBM; formerly NVP PDF-713) when tested against an international collection of common bacterial pathogens comprising the 2003 LBM surveillance programme. LBM is the first member of the peptide deformylase inhibitor (PDI) class being considered for clinical trials for treatment of communityacquired respiratory tract infections and serious infections caused by antimicrobial-resistant Gram-positive cocci. Methods: Non-duplicate, clinically-significant bacterial isolates (10,903 strains) were collected from more than 70 medical centres participating in the global surveillance programme, and originated from North America, Europe, South America and Asia geographic areas. All isolates were susceptibility (S) tested using NCCLS broth microdilution methods and interpretive criteria, where applicable. LBM was compared with representative agents used in the empiric or directed therapy of the targeted indications or species. Results: The antimicrobial activity of LBM is shown in the table: Antibiogram characteristics of the collection include: 28% oxacillin-resistant (OR) SA, 76% OR CoNS, 34% penicillin-nonsusceptible SPN, 22% vancomycin-R ENT, and 21% ampicillin-R HI. LBM was highly active against Staphylococci, Streptococci, Enterococci and MCAT, resulting in ‡99% inhibition at £4 mg/L, as well as 93% inhibition of HI strains at the same concentration. No differences were noted in the activity of LBM between S and R subsets of SA, CoNS, SPN, ENT and HI for antimicrobials such as oxacillin, penicillin, ampicillin, macrolides, vancomycin and fluoroquinolones. While regional differences were apparent with some comparator agents, activity of LBM did not vary between geographic samples. Conclusions: LBM displays a broad-spectrum of activity against the common Gram-positive pathogens, including R subsets, with no regional differences in potency. Some fastidious Gram-negative species (HI, MCAT) were also inhibited by LBM. As a class of antimicrobials, the PDI compounds exhibit a spectrum of activity and unique mode of action that promises to be a significant advance in chemotherapy. A baseline assessment of telavancin's activity against a collection of Gram-positive isolates, including resistant phenotypes Objectives: Akacid is a new member of the polymeric biguanide family of disinfectants. It was especially developed to enhance the antimicrobial activity of this class with significantly less toxicity. This paper describes the wide range of biocidal activity and low potential for induction of resistance of akacid. Methods: A total of 370 recent clinical isolates from patients with documented infections in hospitals located in Austria was studied. The organisms tested by reference methods included: Staphylococcus aureus (98) Conclusions: This study clearly demonstrates the excellent antimicrobial properties of akacid. Akacid was highly active against bacteria (including Mycobacterium spp. and L. pneumophila), spores and fungi, without being affected by the resistance profile of the strains. These properties, together with a very low potential to select for resistance, make akacid a promising tool for the battle against rising resistance and therapeutic failures. (4) M:Cu, X:ClO 4 , n = 0) and previously characterised for their thermal stability and the coordination geometry by a range of techniques, including elemental and thermal analysis, IR, EPR and electronic reflectance spectra were screened in vitro for their ability to inhibit the microbial growth. The modifications evidenced in IR spectra were correlated with the presence of DMBG as chelate through N1 and N4. The EPR and electronic spectra are typical for a square-planar surrounding of Ni (II) and respectively an distorted octahedral one for Cu (II Abstracts resistant to all of the metal complexes exhibiting MICs > 256 mcg/ml. Our studies demonstrated that among the multiple biological activities of biguanidine complex combinations, they could also exhibit some effective antimicrobial properties against selected bacterial strains. In vitro activity of human intestinal anaerobic bacteria against Nisin E. Wahlund, E. Sillerströ m, C.E. Nord (Stockholm, S) Objectives: Nisin is a new bacteriocin used as a food preservative. Resistance to Nisin is not associated with increased resistance to antibiotics. Nisin will be used in animal foods and it is therefore important to investigate if Nisin has an impact on the normal human intestinal microflora. The aim of the present investigation was to study the antimicrobial activity of Nisin against anaerobic bacteria isolated from the normal human intestinal microflora. (11) were susceptible to Nisin. The minimum inhibitory concentrations were 0.25-0.5 mg/l. Eleven Eggerthella lentum strains showed high susceptibility to Nisin with minimum inhibitory concentrations of 0.125 mg/l. The Nisin agent was active against Lactobacilli (10) with minimum inhibitory concentrations between 0.125-16 mg/ l. All Peptostreptococci (10) except one strain were highly susceptible to Nisin (0.064-1.0 mg/l). The Bacteroides fragilis strains (12) had high minimum inhibitory concentration values for Nisin (>256 mg/l). Most Fusobacteria (9) showed high minimum inhibitory concentration values for Nisin (>256 mg/l). Three strains had lower minimum inhibitory concentration values (0.5-16 mg/l). The present study showed that Nisin had good activities against anaerobic Gram-positive bacteria but was less active against anaerobic Gram-negative bacteria isolated from the human normal intestinal microflora. In vitro activity of tigecycline and comparative agents against Enterococci in Sweden In vitro activity of garenoxacin in comparison with other fluoroquinolones against isolates of E. coli, P. aeruginosa, and S. aureus, including genetically defined fluoroquinolone-resistant mutants A. Heisig, T. Claußen, P. Heisig (Hamburg, D) Objectives: Enhanced research activites aimed at overcoming the increasing incidence of fluoroquinolone (FQ) resistant bacterial pathogens and at extending the spectrum of activity to Grampositive pathogens have resulted in the development of the new 6-desfluoro-quinolone garenoxacin (GRN, former BMS-284756). Methods: To evaluate its in-vitro activity in comparison to 6fluoroquinolones levofloxacin (LVX), gatifloxacin (GAT), and ciprofloxacin (CIP), MICs of garenoxacin (GRN) were determined for susceptible isolates of E. coli, P. aeruginosa, and S. aureus and a series of isogenic mutants carrying different combinations of known resistance mutations that affect either target, DNA gyrase and topoisomerase IV, as well as multiple drug resistance (mdr) efflux pumps. Results: For susceptible isolates and most low-level resistant mutants of E. coli, the MICs of GRN and CIP were between 0.008/ 0.015 and 1/2 lg/ml, respectively, and thus, slightly lower than those of . The activity of GRN against highlevel resistant mutants of E. coli was comparable to CIP but higher to LVX, and GAT, while GRN (MIC 0.015-4 lg/ml) was superior to all tested FQs (MICs 0.03->256 lg/ml) against susceptible and resistant S. aureus. The susceptibility of wild-type P. aeruginosa for GRN and GAT was comparable (MIC 0.5-1 lg/ml), but higher for CIP and LVX (MICs 0.25 and 0.5 lg/ml). Overexpression of mdr efflux pumps MexAB, MexCD, and MexEF had a similar impact on all FQs and GRN increasing the MIC by 2-3 serial dilution steps. Conclusions: Garenoxacin is a promising new quinolone derivative that combines a high activity against both, Gram-positive and Gram-negative, pathogens including clinically relevant mutants of S. aureus with multiple resistance mutations. (1999) (2000) (2001) (2002) (2003) H. Sader, T. Fritsche, M. Stilwell, R. Jones (North Liberty, USA) Objective: To compare the activity of garenoxacin (GRN; formerly BMS284756) with selected antimicrobials against a worldwide collection of Enterobacteriaceae (ENT). GRN, unlike recently marketed fluoroquinolones (FQ), lacks fluorine at the C-6 position. Methods: The isolates were consecutively collected from >70 medical centres from bloodstream, respiratory, urinary and skin and soft tissue infections and tested by reference broth microdilution methods according to NCCLS guidelines. A GRN susceptible (S) breakpoint of £2 mg/L was applied for comparison purposes only. Results: The results of the major organism groups tested follows: GRN showed excellent activity against this large collection of ENT (MIC50, 0.06 mg/L) and 87% of isolates were inhibited at £2 mg/L. The in vitro activity of GRN was similar to that of ciprofloxacin (CIP) against most ENT species, the exceptions were Serratia and indole-positive Proteus where CIP was slightly more active. In general GRN and CIP showed higher potency and a broader spectrum than orally administered beta-lactams or TMP/SMX. GRN was also highly active against E. coli O157:H7 and Yersinia enterocolitica (MIC90, 0.25 mg/L for both). Conclusions: GRN in vitro activity was similar to that of the most commonly used FQs and superior to other listed orally administered antimicrobials when tested against over 50,000 global ENT isolates. Potency of garenoxacin, a new des-F(6)-quinolone, tested against communityacquired respiratory tract infection pathogens worldwide ( Potency and spectrum of garenoxacin tested against an international collection of skin and soft tissue infection pathogens: report from the SENTRY Antimicrobial Surveillance Programme (1999) (2000) (2001) (2002) (2003) T. Fritsche, H. Sader, R. Jones (North Liberty, USA) Objective: To evaluate the spectrum and potency of garenoxacin (GRN), a novel des-F(6)-quinolone, against a large international collection (9,227) of Gram-positive and -negative bacterial pathogens that cause skin and soft tissue infections (SSTI comprised of a distinct set of Gram-positive cocci and Gramnegative aerobic and facultative bacilli. GRN was the most potent agent tested against SA, and was at least 2-fold more potent than GATI (MIC50, 0.06 mg/L) and 8-fold more potent than either CIPRO or LEVO (MIC50, 0.25 mg/L). Furthermore, GRN was 4to 8-fold more potent than the FQ against BHS and viridans group Streptococci (VGS), and 2-to 4-fold more potent against ESP. GRN was comparable with CIPRO, LEVO and GATI against EC KSP and ASP, but less active than these agents against PSA. Antimicrobial susceptibility of 5,859 non-Enterobacteriaceae Gram-negative organisms other than Pseudomonas aeruginosa tested against the novel Des-F(6)-quinolone, garenoxacin (SENTRY Antimicrobial Surveillance Programme, 1999 -2003 H. Sader, T. Fritsche, M. Stilwell, R. Jones (North Liberty, USA) Objective: To compare the antimicrobial activity of garenoxacin (GRN) and selected antimicrobial agents against 5,859 nonenteric Gram-negative organisms other than P. aeruginosa collected as part of the SENTRY Antimicrobial Surveillance Programme (1999) (2000) (2001) (2002) (2003) . Methods: The isolates were consecutively collected at >70 medical centres on six continents from bloodstream, respiratory, urinary and skin and soft tissue infections and tested by NCCLS broth microdilution methods. A GRN susceptible (S) breakpoint of £2 mg/L was applied for comparison purposes only. Results: The results of major organism groups tested: Overall, GRN (MIC50, 1 mg/L; 59% S) was more active than ciprofloxacin (MIC50, 2 mg/L; 49% S), ceftazidime (MIC50, 8 mg/L; 56% S), piperacillin/tazobactam (MIC50, 32 mg/L; 45% S) and amikacin. GRN was the most active compound tested against Results: Results are summarised in Table 1 . At a fixed concentration of 4 mg/L, AVE1330A was a potent inhibitor of unclassified b-lactamases responsible for ceftazidime and aztreonam resistance in species of the Enterobacteriaceae including; Escherichia coli (n = 12), Citrobacter freundii (n = 6), Klebsiella pneumoniae (n = 12), Enterobacter cloacae (n = 13) and Morganella morganii (n = 2) with the great majority of isolates inhibited by £1 mg/L of either antimicrobial in combination with the inhibitor. AVE1330A inhibited the activity of TEM 6, 9, 10, and OXA 5 in ceftazidime-resistant Escherichia coli transformants expressing these enzymes, reducing MIC to £1 mg/L. AVE1330A restored the activity of ceftazidime and aztreonam (MIC £2 mg/L and £1 mg/L respectively) against isolates of Klebsiella spp expressing SHV-ESBL. Fixed ratio combinations of ceftazidime and AVE1330A at 4 : 1 and 4 : 2, respectively demonstrated similar inhibitory activity against the b-lactamase producing isolates. However, MIC were generally 2-8 fold higher when compared to those achieved with ceftazidime plus a 4 mg/L fixed concentration of AVE1330A. Conclusion: AVE1330A is a potent inhibitor of a wide range of b-lactamases, including SHV-ESBL and restores potent activity to ceftazidime and aztreonam against ceftazidime-resistant isolates of species of the Enterobacteriaceae. High affinity for PBP 2' enables RO490-8463 (CS-023), a unique guanidine-pyrrolidine carbapenem, to achieve good in vitro activity against MRSA, which is confirmed in murine infection models with a low G-C content. Journal of Bacteriology, 186). Genome analysis revealed a linear DNA genome of 127,395 base pairs, which encodes 118 putative ORFs. The gene encoding the lysin protein was identified and standard molecular biology techniques were utilized to clone the lysin protein. Results: Bioinformatic analysis of the bacteriophage lysin (lysK) gene indicated that it was interrupted by an intron. This observation was confirmed by RT-PCR, and the resulting cDNA was found to encode 495 amino acid protein. The lysK gene was heterologously over-expressed in both Escherichia coli (using the T7 promoter) and Lactococcus lactis (using a nisininducible promoter) with a view to generating cell factories for lysin production. Results from zymograms with dead staphylococcal cells indicated that active recombinant LysK product was generated in both cases exhibiting cell wall degrading activity against coagulase negative Staphylococci, MRSA strains, a VRSA and S. aureus associated with bovine infections. Conclusions: The bacteriophage lysin cloned in this study exhibits activity against drug resistant S. aureus. Thus it is a promising candidate as an antimicrobial for eliminating problematic S. aureus strains. Circumventing resistance to beta-lactam antibiotics in Staphylococcus aureus C. Fuda, S. Mobashery (Notre Dame, USA) Objective: Emergence of methicillin-resistant Staphylococcus aureus (MRSA) has created challenges in treatment of nosocominal infections. S. aureus normally produces four PBPs, which are susceptible to modification by b-lactam antibiotics, an event that leads to bacterial death. The gene product of mecA from MRSA is a penicillin-binding protein (PBP) designated PBP2a. PBP2a is refractory to the action of all available b-lactam antibiotics. Furthermore, PBP2a is capable of taking over the functions of the other PBPs of S. aureus in the face of the challenge by b-lactam antibiotics. The basis for resistance of PBP2a to inhibition by blactam antibiotics has been studied by us. These methodologies have been applied to investigations of three cephalosporins from ABRI (Antibiotic Research Institute, Vienna), Sandoz, which were specifically developed for inhibition of PBP2a in MRSA. Methods: The mecA gene was cloned and expressed in E. coli, and PBP2a was purified to homogeneity. Also, synthetic cell wall fragments have been produced for these studies. Results: The kinetic parameters for interactions of typical blactam antibiotics and PBP2a were evaluated. PBP2a manifests resistance to inhibition by available b-lactam antibiotics by attenuation of the microscopic rate constant for acylation (k2) and by elevation of the dissociation constants (Kd). The two factors working in concert result in drug resistance. The ABRI cephalosporins, developed for treatment of MRSA, exhibit lower Kd values and k2/Ks ratios were approximately one to two orders of magnitude higher than those of other b-lactams. We have documented that binding of portions of the cell wall outside of the active site of PBP2a facilitates the opening of the active site (from a closed conformation), such that PBP2a becomes more predisposed to modification by the ABRI antibiotics, manifesting in increases in k2/Ks of over 1000-fold compared to typical b-lactam antibiotics. Conclusions: The recent emergence of variants of MRSA resistant to oxazolidinone and glycopeptide antibiotics has created challenges in treatment of certain strains of S. aureus, a disconcerting situation clinically. The studies from our laboratory provide mechanistic details for the inhibition of PBP2a. The results with the ABRI cephalosporins demonstrate how the problem presented by this unique PBP can be circumvented, presenting opportunities in antibiotic design. Background: Tolevamer potassium-sodium (tolevamer) is a novel, high molecular weight, non-antibiotic polymer developed to treat Clostridium difficile associated diarrhoea (CDAD). The current form has been modified from an earlier compound, tolevamer sodium, by the addition of potassium to prevent the anionic polymer from exacerbating hypokalemia by binding and excreting intestinal potassium in the stool. Tolevamer sodium was shown to resolve the symptoms of CDAD with similar efficacy as vancomycin in a large Phase 2 study. Tolevamer is currently in Phase 3 development. Objective: To determine the safety and tolerability of liquid tolevamer given at four different dose levels (6.0 g, 9.0 g, 12.0 g, and 15.0 g) to healthy male volunteers. Methods: A randomized, double-blind, placebo-controlled, parallel-design, multiple dose study consisting of a screening period, a 9 day treatment period and a 1 week follow-up period was conducted. For each dose group, 10 subjects were randomized: 8 to active drug, and 2 to matching placebo. Half the subjects in each dose group received a loading dose (single dose equivalent to a total daily dose) Objectives: N-chlorotaurine (NCT) is a long-lived oxidant produced by human leukocytes during inflammation. Its crystalline sodium salt can be synthetized chemically, and it has broad spectrum antimicrobial activity against bacteria, fungi, and viruses. Because of mild activity and therefore low toxicity NCT is thought to be useful as an antiseptic applicable to different body sites. We performed three clinical phase II studies to evaluate efficacy and tolerability in otitis externa, epidemic keratoconjunctivitis, and chronic leg ulcers with a purulent coating. Methods: Aqueous 1% NCT (55 mM) solution was applied topically for 5-7 days in all three indications. All studies were designed with a randomized test (NCT) and control group (standard medication). The otitis externa and epidemic keratoconjunctivitis study were double-blind. Evaluation was done clinically using a scoring system for subjective and objective symptoms and microbiologically. Results: NCT was well tolerated in all indications, little burning in the eye for a few minutes in few patients like sweat and significantly less burning (P < 0.05) than by chloramine T in purulent crural ulcers were the only side effects. Granulation and re-epithelialization in ulcers appeared earlier in the NCT group (P < 0.05). NCT was equally effective in removal of the purulent coating than the stronger antiseptic chloramine T. The clinical symptoms of external otitis decreased 2 days earlier in the test group than in the control group treated with a combination of polymyxin B, neomycin, and hydrocortisone (P < 0.01). Regarding epidemic conjunctivitis, severe courses caused mainly by adenovirus type 8 showed a reduction of symptoms after 3-5 days, which was earlier than in the control group mock treated with gentamicin (P < 0.05). Conclusion: The mild antiseptic NCT is excellently tolerated and effective in infections of different body sites. As an endogenous amino acid derivative toxic and allergic side effects have never been observed, and it can be applied without additives. Because of these advantages NCT can be estimated as a very promising antimicrobial agent in human medicine. Ertapenem as initial antimicrobial monotherapy for patients with typical community-acquired pneumonia C. Petrogiannopoulos, G. Svoukas, K. Papamichael, A. Deliousis, K. Kanakis, P. Papasava, N. Kostakos, A. Zaharof (Athens, GR) Objectives: Ertapenem, a Group 1 carbapenem, is a once-a-day parenteral a-lactam antibiotic which is used as initial antimicrobial monotherapy for treatment of community-acquired pneumonia (CAP). The aim of our study was to evaluate the clinical response and the safety profile of ertapenem. Methods: We studied 64 patients (34 female, 30 male) of 61. mean age (range 18-9) with CAP that was proved clinically, radiographically and after blood test examinations. All blood cultures were negative, while sputum cultures were positive for Streptococcus pneumoniae in 6 patients and Klebsiella pneumoniae in 2 patients. The patients recieved 1 gr ertapenem intravenous (iv) daily, as initial antimicrobial therapy, for 5 days at least. Everyday, haematological and biochemical tests were made in order to evaluate the clinical response and the safety profile of ertapenem. Clinically improving patients were switched to oral antibiotic therapy after 5 days. Results: After 5 days therapy with ertapenem 61 patients (95,3%) had clinical and haematological improvment, concerning the reduction of fever, WBC from 14000 ± 1700-7800 ± 1200 and CRP value from 9.1 ± 1.1-2.2 ± 0.8. The most common drug-related adverse experiences reported during parenteral therapy in patients treated with ertapenem were diarrhoea (6.1%), infused vein complication (4.7%), nausea (3.1%) and headache (1.6%), while liver function tests were normal before and after treatment. Conclusion: These data provided evidence for the efficacy of ertapenem as initial antimicrobial monotherapy for patients with CAP. Ertapenem, given 1 gr once a day by iv infusion was generally well tolerated and had overall a very good safety and tolerability profile. Treatment of chronic MRSA infections using a novel aqueous extract of allicin (AB1000) R.R. Cutler, P.D. Josling, N.J. Bennett (London, Rye, UK) Allicin is recognised as the main bioactive agent from Allium sativum or garlic. This compound is highly active but generally unstable. Using a cold aqueous extraction method, we have obtained a novel extract of allicin (AB1000) that we have reported is stable and highly active in vitro against methicillin resistant Staphylococcus aureus (MRSA).Due to national publicity of AB1000, patients with long standing unresolved MRSA infections requested this agent for treatment. MRSA is commonly related to delayed closure for many chronic and acute wounds. This is associated with high levels of bacteria in tissues but they can also through toxin secretion. These toxins can cause local necrosis and disrupt the delicate balance of critical mediators such as cytokines and proteases necessary for healing progression. We present initial findings from three patients who have completed a course of treatment. These courses consisted of capsules (450 mg, 3 per day); spraying liquid AB1000 (1000 lg ml -1 ) onto the affected areas once per day and applying AB1000 Cream (500 lg ml )1 ) to the infected area once daily. Patients were screened, nasal and wound for MRSA prior and during treatment. All patients were nose and wound swab MRSA positive prior to treatment. All were over 60 years of age and had either major surgery or long term skin infections leading to the formation of ulcers infected by MRSA. Two of the MRSA infections were community acquired and one hospital acquired. The strains isolated from each patient were tested in vitro against AB1000 and all were susceptible.Patients reported an improvement in their condition after 2 and 6 weeks treatment and the infections resolved in 3-4 months. Although the timescales required for treatment may be longer than those normally required using antibiotics, the initial relief from weeping ulcers and pain was much quicker. It should be noted these the patients had been receiving unsuccessful treatment with antibiotics for months or years prior to treatment with AB1000. A possible reason for the initial relief from symptoms could relate to the reported activity of garlic extracts to neutralise bacterial exoenzymes in vitro. This could account for the findings that patients got relief from their symptoms before the MRSA were fully removed from the lesion site. Objectives: Targeted recombinant beta-lactamase (TRBL) has been designed to degrade beta-lactam antibiotic residues in the gastrointestinal tract and thereby inhibit the emergence of resistance. In the present study the changes in resistance rates and persistence of different intestinal Escherichia coli strains were followed in beagles during ampicillin treatment with or without TRBL. Methods: Eighteen laboratory beagles were randomised to receive ampicillin (AMP), ampicillin + TRBL (AMP/TRBL) or placebo (PLA). Susceptibility of 961 intestinal E. coli isolates, collected before during and after the treatment, was tested against 9 antimicrobial agents by the NCCLS disk diffusion method. Selected 402 isolates were typed using pulsed-field gel electrophoresis (PFGE) after XbaI restriction of total DNA. Results: Vast genetic heterogeneity, including 25 different PFGE types displaying 19 different resistance patterns, was detected. The beagles harboured on average 5 PFGE types during the study and shared several common clones. Although the number of resistant isolates increased and similar resistance patterns were detected in all treatment groups, no single ampicillin-resistant PFGE type was widely spread between groups. Ampicillin resistance was found in 6 PFGE types and in 9 different combinations of co-resistance. The proportion of resistant isolates (98%, 36% and 28%) and number of dogs (6, 5 and 3) carrying ampicillin-resistant strains during the treatment was higher in AMP group than in AMP/TRBL and PLA groups, respectively. New resistant PFGE types appeared and extensively replaced the previous types in the AMP group but there were 2 cases where a previously susceptible strain acquired resistance during the treatment. In the AMP/TRBL group the slight increase in resistance was due to enrichment of resistant strains in dogs that already carried resistance. In the PLA group new resistant PFGE types appeared but their proportions remained moderate. Conclusions: TRBL seems to inhibit the selection pressure by preserving the genetic diversity of intestinal E. coli populations. Increase in resistance is due to selection of heterogeneous resistant strains rather than emergence of resistance among previously susceptible strains. Pharmacokinetics/pharmacodynamics of anti-staphyloccal drugs Objective: To study the release of linezolid from polymethylmethacrylate (PMMA) beads loaded with three different concentrations of antimicrobial. Methods: PMMA beads were prepared loading Surgical Simplex P â radiopaque bone cement with 2.5%, 7.5% and 15% (w/w) linezolid. Each bead was placed in a continuous flow chamber with 1 ml Krebs Ringer buffer, flowing at 1 ml/h at 37°C for 48 h. The antimicrobial concentrations were determined in triplicate by disk diffusion antimicrobial bioassays (lower detection limit was 5 mcg/ml). The detection time, Cmax, Tmax, AUC0-infinity and per cent antimicrobial recovered from the beads were calculated. Results: Results are listed in the table as mean ± standard deviation of three values. No antimicrobial greater than the limit of detection of the assay was present for 2.5% linezolid loaded beads. Elution parameters of linezolid were similar for beads containing 7.5 and 15 % of antimicrobial. Objective: Polymethylmethacrylate (PMMA) is used as a local antimicrobial delivery in the treatment and prevention of bone/ joint infection. We developed an in vitro assay to determine release profiles of antimicrobial agents from PMMA. In this study we compared the in vitro release kinetics of daptomycin or vancomycin in a continuous flow chamber with in vivo release in a rat model. Methods: Daptomycin or vancomycin (7.5% w/w) was loaded into the powder component of PMMA; the liquid monomer added and mixed. Antimicrobial loaded PMMA was formed into 3 mm beads and allowed to polymerize for 24 h. The effect of PMMA components and polymerization on the activity of daptomycin or vancomycin was determined by homogenizing loaded beads in 2 ml of Kreb's Ringer buffer and assaying the buffer for antimicrobial activity. In vitro antimicrobial release kinetics were determined by placing a bead in a chamber containing 1 ml of Kreb's Ringer buffer, with 1 ml/h Kreb's Ringer buffer flowing through the chamber. Buffer eluted from the system was collected hourly and assayed for antimicrobic using a bioassay. Each bead/antimicrobial was tested in triplicate. In vivo antimicrobial release kinetics were performed by surgically implanting single beads into bone defects in the proximal left tibia of rats. Three rats with a daptomycin loaded bead and three with a vancomycin loaded bead were sacrificed at 2, 4, 6, 8, 10, 14, 18 and 21 d after placement. Bone tissue within 5 mm of the bead was recovered, homogenized in 2 ml Kreb's Ringer buffer, incubated 24 h, and assayed for antimicrobic. The per cent released listed is total antimicrobial detected in buffer or tissue/total amount of antimicrobial loaded into each bead. Results: 100% of daptomycin and 89% of vancomycin loaded into PMMA beads was detected immediately after polymerization. Pharmacokinetic results are shown the mean concentrations in the table. Conclusion: The peak daptomycin or vancomycin concentration observed in vivo was approximately three-fold the peak observed in vitro. Daptomycin loaded PMMA produced higher antimicrobial concentrations than did vancomycin loaded PMMA in vitro and in vivo. Objective: To compare the pharmacodynamics of daptomycin and vancomycin, killing kinetics of S. aureus were studied in five-day treatment courses over a wide range of ratios of the 24-h area under the curve (AUC) to MIC. Methods: A clinical isolate S. aureus 866 with MIC of daptomycin of 0.35 mg/L and MIC of vancomycin of 0.7 mg/L was exposed to once-daily daptomycin and twice-daily vancomycin for five consecutive days. Mono-exponential concentration-time profiles were simulated with half-lives of 9 h (daptomycin) and 6 h (vancomycin) over a 16-fold range of the AUC/MIC ratio: from 16-256 h. The antimicrobial effect was expressed by its intensity (IE-the area between the control growth curve in the absence of antibiotics and the time-kill/regrowth curve observed in the presence of antibiotic). The cumulative effect of each treatment was determined from time zero to the time the effect no longer could be detected, i.e. the time after the last antibiotic dose at which the number of antibiotic-exposed bacteria reached at least 9 LogCFU/ml. This value was the cutoff level used to determine IE. Results: With both daptomycin and vancomycin, bacterial regrowth followed initial killing over the entire range of the simulated AUC/MIC ratio. Background: The use of glycopeptides for febrile neutropenia has increased, following the prevalence of gram-positive (GP) infections among these patients. Withholding empirical glycopeptide treatment is ecologically wise stipulating that this does not result in increased mortality. We performed a systematic review and meta-analysis of trials assessing the addition of anti-GP treatment in febrile neutropenia. Methods: Included were randomised trials comparing one antibiotic regimen with or without placebo against the same regimen with additional antibiotics against GP infections. We searched Medline, Embase, the Cochrane Library, references and conference proceedings. No date, language, age or publication limits were imposed. Two reviewers extracted data independently. Relative risks and 95% confidence intervals were estimated using the fixed effect model. Values <1 favor the addition of anti-GP antibiotics. Results: Thirteen trials and 2392 participants were included. Antibiotics against gram-positive infections included glycopeptides in 9 studies. , cephalotin in 2, flucloxacillin and trimethoprim-sulphamethoxazole one each. Eleven studies randomised patients at onset of febrile neutropenia, and 2 studies randomised patients with persistent fever at 72-96 hours. No significant reduction in all-cause mortality was seen with the addition of antibiotics against gram-positive infections ( Objectives: Is to perform a nationwide survey to define the different practice in managing febrile neutropenia in haematology units. The design was a single round audit questionnaire was sent out to the selected haematologist of 220 haematology units in the UK. Questions were asked regarding both antimicrobial chemotherapy of choice and antimicrobial prophylaxis in managing febrile neutropenia. Results: Responses were received from 167 (76%) of the 220 haematology units providing care to patients with febrile neutropenia. Febrile neutropenia is empirically treated with piperacillin-tazobactam or carbapenem monotherapy by 10% of haematologists. Overall, dual therapy (i.e., an aminoglycoside plus a piperacillim-tazobactam) is prescribed by 72% of haematologists. When response to initial empirical therapy does not occur after 3-4 days, 32% of haematologists may add glycopetide (vancomycin or teicoplanin) or 29.1% may change to carbapenem and glycopeptide. Forty-eight per cent of haematologists will routinely add conventional amphotericin to the ongoing antibiotics in persistent neutropenia, compared to 39% using liposomal amphotericin. Granulocyte colony-stimulating factor is frequently used as an adjuvant in managing febrile neutropenia (47% of haematologists). For antifungal prophylaxis, fluconazole is prescribed by 57% of haematologist followed by itraconazole by 33%. Forty-seven of haematologists use antifungal prophylaxis in all neutropenic patients compared to 17% whom used antifungals only in patients with neutrophil less than 0.1 · 109/L. Conclusions: Rationalization of using antimicrobial chemotherapy in the management of febrile neutropenia, by adopting Study selection: RCTs comparing ciprofloxacin with an aminoglycoside as combination therapy to a beta lactam for the treatment of febrile neutropenia and reporting effectiveness, mortality, and/or toxicity data were included in the analysis. Studies that examined quinolones as monotherapy, the combination of a quinolone with an aminoglycoside, use of quinolones in the outpatient setting from the start of treatment, or quinolones other than ciprofloxacin were excluded. Data extraction: Data for 3 primary and 2 secondary outcomes were extracted by two investigators. Objectives: The aim of this study is to evaluate the frequency and susceptibility patterns of bacterial pathogens isolated from blood cultures in febrile neutropenic cancer patients hospitalized in an anticancer hospital over a two years period. Methods: A total number of 586 blood cultures were examined, using the automated Bact/Alert Microbial Detection System (aerobic FAN and anaerobic FN). After classic subculture methods, all isolates were characterized at species level by the Api 20 system. Minimal inhibitory concentrations were performed using the semi automated method Microscan according to NCCLS recommendations. All the investigated patients were neutropenic (WBC <1 · 10 to the power of 9 per liter) with fever (>38°C) and were under antimicrobial and antifungal therapy at the time of blood culture. Results: Over the two years period (2002) (2003) 586 blood cultures were performed on the basis of the physicians request from 81 patients hospitalized in the two oncology and one hematologist ward of our hospital. The mean length of neutropenia was 13 days. The pathogens were isolated from 64 blood cultures in 21 patients (25%). Among the 22 bacterial strains isolated from bloodstream infections, 72.7% were Gram negative strains (n = 16), 18,1% Gram positive cocci (n = 4), one strain L. monocytogenes and one strain C. kruzei. In the group of Gramnegative strains E. coli was dominant with an increase antibiotic resistance (7/9 resistant to Amoxicillin / Clavulanic acid and 5/9 resistant to Ciprofloxacin). All the Gram-negative rods were highly susceptible to Imipenem (15/16), Meropenem (16/16) and Piperacillin/tazobactam (16/16). In the group of Gram-positive bacteria glycopeptide resistant strains were no found. All the Staphylococci strains were susceptible to Methicillin. Conclusions: We observed rising trends in the number of Gram-negative isolates and in antibiotic resistance of all gramnegative rods. The empiric therapy with wide range antibiotics in febrile neutropenic cancer patients seems to be the optimal option, but the monitoring of antibiotic susceptibility of bacterial strains is still required. Varicella Zoster Virus (VZV) is frequently associated with mild hepatitis and rarely with acute liver failure. Immunologic impairment is a significant predisposing factor. Objectives: We report a 4 years-old girl with Acute Lymphoblatic Leukemia (ALL) and acute fatal liver necrosis after VZV infection. Methods/Results: She was the second child of the family, with a negative history of VZV disease or vaccination. ALL had diagnosed six months ago, the child was treated according to the ALL -BFM 2000 protocol and was then in complete remission. On the time of admission, she was three weeks on dexamethasone (10 mgr/m 2 /day) (re-induction). The child was first admitted in the Hematology/Ongology Department with severe abdominal pain, fever (38°C) and elevated transaminases. Next day, cutaneous lesions appeared on the chest and face, suggesting VZV infection, and antiviral therapy with acyclovir was immediately initiated. Two days later the patient was transferred to the PICU with severe clinical and laboratory deterioration, high fever, tachypnea with positive chest x-ray (right low lobe consolidation with pleural effusion), abdominal distention, liver enlargement, gross haematuria and GI bleeding, vesicular rash on the chest, face and scalp and generalized petechiae and echymoses. The patient had pancytopenia, marked elevated hepatic enzymes and bilirubin, hypoalbuminemia and severe disseminated intravascular coagulopathy. She was continuously transfused with FFP, RBC, PLT and cryoprecipitate. The child was intubated in hours, because of progressive respiratory and neurological deterioration. Renal failure was developed. Assistance was asked from a liver transplant team and the little girl was urgently transferred to a special department for emergency liver transplantation. Unfortunately, two days after transportation, the child developed deep coma and severe hypotension and died. VZV antibody levels were negative, but VZV DNA was detected from liver biopsy and blood specimen, with PCR. Conclusions: Immunocompromised children are potentially threatened of infections, such as highly contagious chickenpox. The mortality of VZV-induced hepatic failure is very high. Only few patients survived with liver transplantation. Usefulness of procalcitonin measurement in the diagnosis of febrile neutropenia Results: Among patients with bacteraemia caused by Gram (-) bacteria the PCT levels (ng/ml) were 2-10 ng/ml (n = 6) and >10 ng/ml (n = 10). In patients with bacteraemia caused by CNS the PCT levels were <0.5 ng/ml (n = 6) and 0.5-2 ng/ml (n = 6). By S. aureus the PCT levels were >10 ng/ml. By Enterococcus spp., Pneumoniococcus, Clostridium perfingens and Corynebacterium acnes the PCT levels were >2 ng/ml. Conclusion: Bacteraemia associated with CNS may fail to elevate serum procalcitonin levels while bacteraemia associated with Gram (-) bacteria elevate significantly. More studies are needed to confirm our findings. Procalcitonin measurement in post-surgical neonates: a guide to antibiotic management E. Broadis, J. Tong, C. Davis, C. Lucas, C. Williams (Glasgow, UK) Measurement of plasma C-reactive protein (CRP) has become an established means of monitoring response to antimicrobial therapy. However raised levels are indicative of inflammatory processes in general and do not specifically signal infection, this could result in a tendency to over-prescribe antibioticsIn adult patients Procalcitonin (PCT) measurement has specifically differentiated infection from other inflammatory processes but to date paediatric data, especially in neonates, is limited. Aim: to assess the potential for PCT as a guide to infection in post-surgical neonates. Objective: Leukocyte count, erythrocyte sedimentation rate (ESR) and C-reactive protein (CRP) are often obtained on patients with prosthetic joints prior to arthroplasty surgery. We evaluated the value of these parameters for the diagnosis of prosthetic joint infection (PJI). Methods: We prospectively analysed preoperative leukocyte count, ESR and CRP level in patients prior to revision or resection knee or hip arthroplasty at Mayo Clinic, Rochester, MN between January 1998 and November 2004. PJI was defined as growth of the same microorganism from at least two specimens, synovial fluid or periprosthetic purulence, acute inflammation on histopathologic evaluation, or the presence of a sinus tract. Sensitivity, specificity, positive predictive values (PPV) and negative predictive values (NPV) were calculated using 2 · 2 contingency tables. Results: 231 preoperative blood specimens from 227 patients prior to total knee (n = 192) or hip (n = 37) replacement were analysed. The median age was 70 years (range, 41-101 years); 55% were male. The primary diagnosis was osteoarthritis (n = 209), inflammatory joint disease (n = 13), trauma (n = 8) and osteonecrosis (n = 1). Causative organisms were coagulasenegative staphylococci (n = 26), Staphylococcus aureus (n = 8), enterococci (n = 3), Propionibacterium acnes (n = 3), corynebacteria (n = 3), viridans group streptococci (n = 2), mycobacteria (n = 2) and gram-negative bacilli (n = 2). Three infections were polymicrobial and 12 were culture-negative. 39 patients (61%) had received antimicrobial treatment in the month prior to surgery. Objectives: Neopterin is a sensitive indicator for activation of cell-mediated immune reactions and thus, determination of neopterin concentrations in various body fluids is of diagnostic marker in a variety of infectious diseases in which T lymphocytes and macrophages are involved. Cell mediated immune reactions play important roles in intracellular bacteria such as Mycobacterium tuberculosis and Brucella species. The aim of this study was to compare the serum neopterin levels in patients with active pulmonary tuberculosis, in patients with brucellosis and healthy subjects. Methods: Thirty-nine patients with active pulmonary tuberculosis ( 10 females, 29 males, mean age: 40.6) 16 patients with brucellosis (7 females, 9 males, mean age: 35.8) and 39 healthy subjects (16 females, 23 males, mean age: 41.2) were included in this study. The patients who had another infection, malignity, autoimmune disease , surgical intervention and recently blood transfusion were not included the study. Serum samples were collected from the patients and control groups and stored at )20°C until analysed. Neopterin concentrations were measured by ELISA according to the protocol of manufacturer by IBL (Hamburg, Germany). Results: Mean neopterin levels were 18.56 ± 14.23 nmol/L in patients with active pulmonary tuberculosis, 33.82 ± 22.27 nmol/L in patients with brucellosis and 9.87 ± 2.90 nmol/L in healthy subjects, respectively. Serum neopterin levels were found to be significantly higher in patients with active tuberculosis and in patients with brucellosis compared with healthy controls (p < 0.001). Besides, there were differences between patients with active pulmonary tuberculosis and patients with brucellosis (p < 0.001). Conclusion: This study showed that neopterin levels increased both in patients with active pulmonary tuberculosis and in patients with brucellosis. Neopterin can be used in follow up the patients who had chronic infectious diseases such as brucellosis and tuberculosis. Objective: A recently introduced automated generic RNA and DNA extraction system, m1000, enables a throughput of 48 samples in less than 2 hours. Several studies have shown that m1000 is a suitable automated extraction system for many different sample types feeding molecular diagnostics assays. Methods: Unlinked surplus specimens from the clinical routine were used. Cross contamination studies were designed with high titer samples interspersed between negative samples giving a checkerboard pattern on the m1000 subsystem. Diagnostic assays used during these studies were either commercially available or homebrew assays validated for the laboratory routine. Results: No cross-contamination was observed in using HIV RNA of 5-7 log copies/ml, HCV RNA of 5-7 log IU/ml, and polyomavirus DNA of 8 log copies/ml. A total of 437 serum or plasma samples were processed for RNA extraction using LCx HIV or HCV RNA Quantitative assays with 97.6-99.0% agreement to Cobas Amplicor Monitor HIV/HCV assays. Coextraction of HIV/HCV RNA from 28 serum or plasma samples revealed no impairment of LCx assay results when compared to monoextraction. Reaching a 100% agreement between manual and automated extraction on 53 initially positive urine samples on Cobas Amplicor Ct showed the feasibility of extracting bacterial DNA of C. trachomatis with m1000. Genomic DNA extraction from 31 whole blood samples for homebrew HLA-B27 typing revealed a 100% agreement to the manual extraction. Automated extraction of viral DNA of HBV from 25 serum or plasma samples revealed a correlation coefficient of r = 0.96 compared to the manual extraction. 2-7 replicates of HBV quantitation standards were tested with homebrew real-time PCR after automated extraction with excellent linearity and a 100% detection rate of all concentration levels down to 100 IU(ml. Viral DNA has been successfully extracted from spinal fluid, urine, cell culture supernatant, BAL, nasopharyngeal washing, breast milk, biopsy, leukocytes, and bone marrow samples for CMV, HSV, or polyomaviruses JC and BK testing with homebrew real-time PCR (n = 48). Conclusion: Taken together, these studies have shown that m1000 provides a versatile solution for automated extraction of viral RNA or DNA, and bacterial or genomic DNA from 12 different specimen types feeding 8 different molecular diagnostics assays in the field of hepatitis B/C, HIV, sexually transmitted diseases, transplantation, and HLA typing. Evaluation of automated extraction of RNA and DNA for high throughput 'in-house' quantitative real-time PCR assays K. Beuselinck, J. Van Eldere (Leuven, B) Objective: Nucleic acid (NA) extraction has become the most critical and labour intensive step in NA based diagnostics. The performance of NA based diagnostics is primarily dependent on the NA extraction yield, purity and the amount of sample that can be extracted. Recently, Abbott introduced the m1000, a fully automated generic RNA and DNA extraction system that uses magnetic micro-particle processing allowing extraction of up to 48 samples in 2 hours. Methods: In this study, the performance of the m1000 as a front-end extraction system for high throughput 'in-house' quantitative real-time PCR assays (HCV, HBV, CMV, EBV) was analysed and compared to manual extraction for plasma and serum samples (HCV and HBV) and EDTA-blood samples (CMV and EBV). automated HIV-1 viral load assay under development were both excellent. The assay internal control and chemical contamination control methods were effective. Evaluation of a new Dot Blot assay for confirmation of human immunodeficiency virus type 1 (HIV-1) and 2 (HIV-2) infections using recombinant p24, gp41, gp120 and gp36 antigens M. Ravanshad, F. Sabahi, F. Mahboudi , M. Roostaee, A. Kazemnejad (Tehran, IR) A Dot Blot assay using four recombinant proteins corresponding to human immunodeficiency virus type 1 (HIV-1) and type 2 (HIV-2) gene products was developed to confirm the presence of antibodies to HIV-1 and 2 in sera reactive in screening ELISAs. Serum samples for testing were obtained from healthy seronegative blood donors and from different categories of HIV-infected individuals (asymptomatic HIV-infected, and AIDS). A positive reaction was defined as reactivity against gag (p24) and at least one other env (either gp41 or gp120) HIV gene products; negative result was defined as no reaction with any antigen; and indeterminate result was defined as reactivity with gag (p24) or with env (gp41 or gp120) alone. None of the 180 serum samples from healthy seronegative blood donors gave a positive result, and only 4 of these samples (2.2%) gave indeterminate results. The recombinant HIV Dot blotting assay identified seropositive individuals with a high degree of accuracy; none of the 125 HIVseropositive subjects had a negative test result. Reactivity with these antigens, demonstrated 100% sensitivity and specificity in distinguishing seronegative from seropositive sera. All seronegative and seropositive samples were tested with the commercially available Western blot. The developed in-house HIV Dot blot assay accurately identified more seropositive and seronegative samples and had fewer indeterminate results than did commercial Western blot (as interpreted by CDC criteria). Hepatitis B virus DNA testing by nested-PCR, PCR-ELISA and hybrid capture II from a blood and blood products The purpose of this study is to establish Nested-PCR for the detection of hepatitis B virus (HBV) in blood and blood products. The primer pair set was designed to amplify 513 bp in S-region of HBV genome in the first PCR and 233 bp of first PCR amplicon with Rubisco (internal control) in the second PCR. To assess the specificity of PCR results, all the samples were tested cross-reactivity or interference in the assay. In case of HBV spiked blood products such as immunogloubulin and coagulation factors, this method could detect HBV DNA up to 62.5 IU/ml. Nested-PCR was compared with PCR-ELISA and hybrid capture II (HC-II), the PCR-ELISA showed a sensitivity of 96% (HC-II; 77%) and a specificity of 98% (HC-II; 100%) (p < 0.005). The results of the study show that Nested-PCR and PCR-ELISA could be used equally in the management for HBV detection in blood and blood products. Objectives: The genus Flavivirus comprises more than 70 viruses. Many of them cause severe human diseases. The genome of flavivirus, a single strand RNA molecule with positive polarity, is translated into a large polyprotein that is processed into structural and non-structural proteins by both viral and cellular proteases. The virus-encoded protease is a binary complex constituted by the NS3 protein and its co-factor, NS2B. As the viral protease plays a critical role in the virus replication cycle, it represents one of the main targets for antiviral therapy against members of the Flavivirus genus.The aim of this study was to develop an in vitro assay using the protease of several flaviviruses belonging to different groups in order to characterize their enzymatic properties, such as temperature, pH and salt-sensitivity and substrate specificity. Methods: Sequences encoding the viral proteinase were located on the genome of 8 flaviviruses. NS2B/NS3 proteinase were expressed as hexahistidine-tagged recombinant proteins and then purified by immobilized-metal affinity chromatography. Their enzymatic properties were characterized in vitro using BAPNA, a chromogenic substrate for trypsin-like proteases. Results: The protease moiety of the 8 flaviviruses were successfully produced and purified. 5 of them exhibited activity towards BAPNA. Effect of temperature, ionic strength and pH on enzymatic activity were determined. Our results suggest that the hydrophilic domain of NS2B is necessary for proteolytic activity. Conclusion: The system we developed will allow us to establish a screening test so as to identify or to design inhibitors active as antiviral drugs against one or more pathogenic flaviviruses. The lack of activity of 3 of the 8 proteases we assayed could indicate slight differences in flaviviral proteases' selectivity and activity. Diagnosis of dengue infection by enzyme-linked immunosorbent assay and reverse transcriptionnested polymerase chain reaction from dried urine spots on filter paper J. Pupaibool, N. Jaimchariyatam, S. Krajiw, K. Arunyingmongkol, P. Suandork, O. Prommalikit, R. Sittichai, A. Nisalak, C. Pancharoen, U. Thisyakorn, W. Kulwichit (Bangkok, TH) Objectives: Polymerase chain reaction (PCR) and enzymelinked immunosorbent assay (ELISA) from serum are used for diagnosis of dengue infection. However, in certain areas of the world, these are not readily available. Storage of specimens on filter paper to be tested later at a centre is an attractive way to confirm a clinical diagnosis or for an epidemiologic study. We performed a pilot study to see if urine spots on filter paper can be used for dengue diagnosis. Methods: Adults and children admitted to King Chulalongkorn Memorial Hospital suspected of dengue infection were enrolled. Final diagnosis of dengue infection was based on the standard serum ELISA assay. Patients with negative serology served as controls. Urine specimens were collected twice, 5 days to 3 weeks apart, spotted on filter paper and stored at 4 degrees for a minimum of 10 days before testing. RT-nested PCR and ELISA were performed on extracts from the spots. Our ELISA criteria for urine were single IgM > 10 units for primary dengue infection or single IgG > 10 units or 2-fold increase in IgG titer with the second titer >10 units for secondary dengue infection. Results: 139 patients were enrolled. 64 and 71 specimens were analysed by RT-PCR and ELISA, respectively. The results are summarised in the Table: If 3 primary dengue cases were excluded, the sensitivity of ELISA for secondary cases were 84.21%. Conclusions: This is the first study using dried urine samples on filter paper for dengue diagnosis. In this study, fresh urine was spotted onto filter paper in the laboratory, and cross contamination was possible. Realistically, this process would be done on a near-patient basis with vastly lower likelihood of such contamination and thus better results of RT-PCR. Collection of urine is less invasive than that of blood and is especially suitable for children. This method would be highly applicable in epidemiologic studies, such as during dengue outbreaks. Due to a low number of primary cases in an endemic area such as Thailand, a study elsewhere is needed to assess the utility of urine spots in such cases. A rapid sequencing based prototype assay for detection of high risk HPV strains in cervical samples Background: Human papillomavirus (HPV) is one of the most common causes of sexually transmitted diseases resulting in an estimated 288,000 deaths yearly from cervical cancer worldwide. Of more than 30 types found in the anogenital tract, at least 13 are considered high risk (HR), as they are significantly associated with progression to invasive cervical cancer. In an effort to accommodate high throughput screening for HR HPV types, we recently developed a prototype HPV assay using a Single Base Dye Primer Profiling (SBDPP) approach. In the present study, we evaluate prototype assay performance on 74 patient samples. Objective: To evaluate SBDPP assay for the detection of HR HPV strains in cervical samples. Methods: Genomic DNA purified from 74 retrospective cervical samples was used for this feasibility study. Fifty-four out of 74 were previously typed successfully with the Digene Hybrid Captureâ 2 (HC2) assay. The remaining 20 samples yielded inconclusive results with the HC2 assay. Using consensus PCR primer sequences conserved among HPV types, a fragment of the L1 region was amplified in the presence of an intercalating dye. HPV-positive samples were identified by amplification Ct values and dissociation curve melting profiles, sequenced with a rapid SBDPP protocol and analysed on the ABI PRISMâ 3100 Genetic Analyzer. HR HPV types were identified by their unique single base distribution profiles. In all cases the respective cervical samples were positive for the same HPV type. The HPV detection concordance was 14/21 (66.7%). The HPV detection concordance was better in histological diagnoses of cancer and high-grade lesions compared to low-grade lesions. The sensitivity of HPV detection in urine was similar to that in distilled water. Conclusions: This study is one of the few that examined the presence of HPV in urine samples from patients referred to a colposcopy unit. High HPV type-specific concordance between cervical and urine samples and good sensitivity of urine detection are reported. Only specimens with two or more epithelial cells in 400 · magnification are worth processing with the more expensive HPV detection method. This report supports the possibility that self-testing for HPV, using urine, will one day give to low-income groups and specific populations like young adolescents a good screening alternative. Objectives: Several diagnostic tests for the detection of SARS antibodies from serum have been previously evaluated, including ELISA and IIFT assays. This study evaluated a novel protein chip assay, the Coronavirus Protein Microarray (CoV-PM), that has been developed for the detection of antibodies to multiple coronaviruses, including SARS-CoV, comparing it to the currently accepted commercially available gold standard assay, the EUROIMMUN SARS-CoV IgG Indirect Immunofluorescence test (IIFT). Methods: The CoV-PM comprised of all the SARS-CoV proteins and protein fragments, along with proteins from 5 additional coronaviruses that infect human, cats, mice and cows. The arrays were used to probe a selection of 399 previously validated, challenge samples of human sera for antibodies to SARS-CoV that included samples from the same patients from different dates. These sera included 40 SARS-CoV IgG-negatives (neg) from acute SARS cases (ACUT), 164 SARS-CoV IgG positive (pos) from convalescent cases (CONV), 112 SARS-CoVneg from patients with other respiratory illness (RESP), and 84 from healthcare workers (HCW; 17 SARS-CoV IgG pos; 66 neg). Each grid on the CoV-PM was probed with 1 lL serum/patient, reacted with fluorescently labeled antibodies and signals were detected using a standard microarray scanner. Scans were analysed by two readers using a programme developed to predict the nature of each serum. Results: Of the 181 SARS-CoV-pos sera, 168 were read as positive by CoV-PM by both readers (93.3% sensitivity), while 8 CONV sera were read as CoV-PM pos by one reader but not by the other, whereas 16 and 7 were called neg and inconclusive by both readers. Interestingly, in the majority of cases, SARS-CoV pos sera that tested discrepant by CoV-PM were CoV-PM pos in other samples from the same patients from later dates. 64 HCW, 40 ACU and 100 RESP from 218 SARS-CoV-neg sera were CoV-PM-neg (specificity 99.1%), with SARS-CoV antibodies found in 1 HCW and 1 RESP while 2 others were inconclusive. Some of the SARS-CoV pos sera also reacted with 229E proteins, suggesting concurrent or prior infection with this coronavirus; some sera within this selection tested positive for 229E/OC43 by Western blot assay. Conclusions: The CoV-PM appears to be a sensitive and specific method for the detection of SARS-CoV antibodies from serum. The added value of its ability to detect antibodies to other coronaviruses requires further evaluation. The prevalence of respiratory viruses in hospitalised patients is rather unclear. Due to the rather large effort of reverse transcriptase (RT)-PCR methods, the poor sample quality of many specimens and the sensitivity of most rapid antigen detection tests, many viruses are not diagnosed. With nucleic acid tetection methods there is also question, whether there are acute replicating viruses or residual genetic material detected. In this presentation we describe our results from a study using a combined cell culture/PCR method suitable for detection of productive infection of different respiratory viruses. By cultivation of a total of 266 nasopharyngeal secretions and bronchioalveolar lavages (BAL) from children hospitalized in the local paediatrics department and from adult transplant patients on HEp-2 human larynx epithelial and MA-104 monkey kidney cells we were able to detect also slow growing viruses like human metapneumovirus (HMPV). The method was also able to detect Parainfluenza Virus or Rhinoviruses and to a certain extent Adenoviruses. Additionally Influenzaviruses, Respiratory-Syncytial Virus (RSV) and Adenoviruses were detected by commercial antigen detection assays. The epidemiology of respiratory viruses in Western Austria for the winter season 2003/04 reveals a Parainfluenza 1 outbreak as confirmed by sequencing right before the main Flu season, a relatively weak RSV season and many of HMPV isolations with some double infections as indicated below. Additionally the samples were also tested for 'exotic'agents like Mimiviridae. Mimiviruses are a new species which has been described most recently in water amoeba and their nearest relatives appear to be aquatic Phycodnaviruses. As replication of Mimivirus similar to the Leginella spp., which also replicate in amoeba, has been suggested to occur also in alveolar cells of humans we decided to test our patient samples using a 'suicide-PCR' protocol. Disappointingly enough we did neither detect this type of virus in our respiratory samples, nor in samples from water tanks containing amoeba species. Development of a real-time NASBA respiratory syncytial virus assay B. Deiman, F. Jacobs, C. Schrover, S. Vermeer (Boxtel, NL) Objective: The aim was to develop and evaluate a Respiratory Syncytial virus assay based on NASBA amplification and including real-time detection with molecular beacons. In this study the performance of this new test is evaluated. Methods: RSV RNA is isolated using a semi automated magnetic extraction method and the NucliSensâ miniMag. An internal control is added to the sample prior to nucleic acid extraction. Primers are directed against the F-gene region of the RSV genome and both RSV A and B and the internal control are amplified with the same primer set. One generic molecular beacon probe is designed to detect both RSV A and B. An additional beacon is designed for the detection of the internal control. Amplification reactions were performed in a Nucli-Sensâ EasyQ Analyser allowing real-time detection. Results: Using serial dilutions of in vitro RNA, the 95% hit rate of the real-time RSV assay was found to be 62 copies in isolation for both RSV A and RSV B. Using tissue culture samples, the assay sensitivity was approximately 0.01 TCID50 in isolation for RSV A and 0.1 TCID50 in isolation for RSV B. No cross reactivity was observed with PIV2, PIV3, hMPV A1, hMPV A2, hMPV B1, hMPV B2, or measles. With the real-time assay, RSV in nose swab samples is detectable within approximately 3,0 hours. The data showed that the real-time RSV assay is a rapid and sensitive qualitative assay for the detection of RSV. The use of standardized reagents offers considerable benefits in a routine setting for the clinical management of patients with RSV infections. Intrathecal synthesis of specific antibodies in facial nerve palsy J. Bednarova, P. Stourac, H. Stroblova, A. Sevcikova (Brno, CZ) Objectives: According to literature at least part of idiopathic facial nerve palsies is caused by herpetic viruses, for example varicella zoster virus in Ramsay-Hunt syndrome. The aim of our study was to detect intrathecal synthesis of specific IgG antibodies against varicella zoster virus in patients with idiopathic facial nerve palsy and to evaluate the importance of this examination for establishing the etiology of this disease and subsequent treatment. Methods: We investigated a cohort of 30 patients: 15 patients were diagnosed as idiopathic facial nerve palsy and 15 patients were diagnosed as neuroborreliosis (NB) with facial nerve palsy as a part of their clinical symptoms. Serum and CSF samples were analysed at each patient. We used the diagnostic kit of Human Company, Germany (Varicella-Zoster Virus Human ELISA IgG Antibody Test) and the diagnostic kit of Test-Line Company, Clinical Diagnostics, Czech Republic (EIA Borrelia garinii IgG) for the detection of specific IgG antibodies. The intrathecal synthesis was evaluated as specific antibody index -AI according to Reibeŕs method. Results: Intrathecal synthesis of IgG antibodies against varicella zoster virus was detected in 20% patients with idiopathic facial nerve palsy. All these patients had negative intrathecal antiborrelia antibody synthesis. In the NB subgroup all patients had negative intrathecal antibody synthesis against varicella zoster virus. The statistical significance of specific antibody intrathecal synthesis was confirmed by Spearman rank coefficient and Wilcoxon test. Conclusion: Our statistically supported data emphasize the importance of intrathecal synthesis of specific antibodies as a diagnostic method in patients with idiopathic facial nerve palsy. It reveals a subgroup of patients with viral ethiology who can thus profit from specific antiviral treatment. Methods: The panels were prepared in a pool of CSF specimens. Each panel consisted of 10 coded specimens: 4 negative specimens, 1 specimen containing cytomegalovirus (CMV), 3 specimens containing HSV type 1 at a concentration of 4.102 , 7.5, 102 and 3.75. 103 TCID50/ml on Vero cells and 2 specimens containing HSV type 2 at a concentration of 4.102 and 4.103 TCID50/ml. One specimen (containing HSV type1 at a concentration of 7.5. 102 TCID50/ml) was artificially inhibited by the addition of fraxiparine at a concentration of 356 U/ml. Panels were sent to 13 laboratories together with a questionnaire concerning the methods employed. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 Results: All laboratories sent their results and all but one laboratory answered the questionnaire. All used an 'in house' PCR. All but one laboratory used real-time PCR and all but two laboratories did monitor inhibition. Overall, 97% of the specimens were correctly reported All positive specimens were correctly identified. False positive results were reported in 6.6% of the negative specimens by 3/13 participants. Six laboratories had an assay that distinguishes between HSV type 1 and 2. The different types were correctly distinguished by all. The specimen containing CMV was never reported positive. Remarkably, the different assays seem to be influenced at varying degrees by inhibitory factors. Only 7/13 (54%) participants reported the specimen containing fraxiparine as positive despite the inhibition. Six of these labs used the same QiaAmp DNA kit (Qiagen) for extraction and one lab did not specify the extraction method. Five laboratories reported the fraxiparine containing specimen as inconclusive because inhibited and one participant who did not monitor inhibition reported this specimen as false negative. Only 1/6 labs used the QiaAmp DNA kit (Qiagen) for extraction. The results of this second quality control for the detection of HSV in CSF specimens were excellent. The most striking conclusion of this quality control was the difference in PCR results obtained with a positive specimen artificially inhibited, being probably a reflection of the different DNA extraction methods used. Rapid diagnosis herpes simplex genital infection using real-time PCR after automated extraction nucleic acid Objectives: Herpes simplex virus genital infections have been increased in the last years. A sensitive and specific method for detecting herpes simplex virus type 1 (HSV-1) and herpes simplex virus type 2 (HSV-2) is important for diagnosing genital infections and to avoid HSV-1 and HSV-2 transmission. The aim of these study is to show our short experience on the diagnosis of HSV-1 and HSV-2 genital infection using real-time PCR after automated extraction nucleic acid. Methods: A total of 86 specimens (44 genital ulceration/vesicle, 21 endocervical, 14 urethral and 7 rectal) were collected from 61 patients (33 women and 28 men). All of them ask for the begining of symptoms and none have risk factor. All the patients were followed at STD clinic, Seville, Spain. The sample were collected following the manufacters rules. Magnapure was used to extraction nucleid acid. These products were used for determinating genital infection by using Light-cycler real-time PCR. (Roche Diagnostic System LC HSV1/2 detection). Positive and negative controls were used in all cases. Results: Of the total of the samples, 37.2% (32/86) were positive to HSV. Genital lesions and vesicles were positive in 61% (27/ 44), 19% (4/21) endocervival swabs, 7.1% (1/14) urethral swabs. Of the all positive results in 23 cases were detected HSV-1 (71.8%), in 6 cases (18.8%) HSV-2, and in 3 cases (9.4%). All the patients with urethral and endocervical swabs positive have genital lesion positive too. All the HSV positive were in patients with primary infection. Conclusion: 1. Magnapure is an easy, effective, and non-time consuming method for automated extraction nucleid acid of the direct sample. 2. Real-time PCR using LC allows the detection of HSV1 y 2 on genital lesion and it is possible to distinguish between two types clearly.3. In our study the most profitable sample for the diagnosis of herpes simplex genital infection was genital ulcerations and vesicles. Human herpesvirus-6, Epstein-Barr virus and cytomegalovirus viral load in cases of sudden death in children. An approach with real-time PCR assay A. Fernández-Rodríguez, R. Á lvarez-Lafuente, M.P. Suárez-Mier, B. Aguilera, S. Ballesteros, G. Vallejo, J. Gó mez (Madrid, E) Objectives: The aim of this work was to determine the viral load of three ubiquitous viruses, Human Herpesvirus-6 (HHV-6), Epstein-Barr virus (EBV), and Cytomegalovirus (CMV), with a quantitative real-time polymerase chain reaction (PCR) assay, in 22 paraffin-embedded tissues from 9 cases of sudden children death (SCD) in which viruses had been previously detected by other techniques (serology, viral culture or nested PCR). Methods: The QIAamp DNA Mini Kit (Qiagen) was used for the extraction of DNA from 22 paraffin-embedded tissues from 9 cases of SCD, according to the manufacturer's protocol. DNA concentration was determined by reading the optical density at 260 nm. Two blank reactions were extracted together with each set of ten samples in order to evaluate a possible cross-reaction. For the detection of HHV-6, EBV and CMV genomes, quantitative real-time PCR was carried out with specific sets of primers and TaqMan probes; a beta-actin PCR was carried out as an internal control to assure the quality of the DNA of each sample and its suitability for PCR. Each sample was analysed in duplicate for each one of the viruses and the internal control. Results: The viral loads (in copies/lg of DNA) were as follows: Patient 1 (1.7 years) had HHV-6 in liver (19.3) and in spleen (25) and CMV in spleen (24.8), and was negative for the three herpesviruses in lung. Patient 2 (2.6 years) had CMV in liver (30.6), and was negative for the three herpesviruses in larynx and lung. Patient 3 (2 years) had EBV in amygdale (28.5), and CMV in amygdale (49.3) and kidney (34.3). Patients 4 (3 months) and 5 (a newborn) were negative for the three herpesviruses in lung. Patient 6 (3 months) had HHV-6 in spleen (2.1), and was negative for the three viruses in lung. Patient 7 (2.2 years) had HHV-6 in amygdale (34.8) and EBV in lung (36.8). Patient 8 (1.2 years) had CMV in spleen (78.1), and was negative for the three viruses in lung. Patient 9 (3 months) had HHV-6 in lymphoid tissue (45.4) and EBV in heart (24.9). Conclusion: We have shown that quantitative real-time PCR could be an important tool in the diagnosis of viral infections in SCD cases, since its sensitivity allowed us to find the presence of pathogens that other assays did not detect because of their low yields. We emphasise the need to establish a viral load threshold in order to make an accurate interpretation of the presence of herpesviruses in tissues. The contribution of IgG avidity in the diagnosis of CMV infection P. Koudounis, M. Pagkalou, G. Triantafillou, P. Rozi (Serres, GR) Objectives: The evaluation of measurement of Cytomegalovirus immunoglobulin G avidity for distinguishing recent CMV infection from the past. Methods: Blood samples were taken from 262 patients attending the Outpatient's Department or who were hospitalized in the General Hospital of Serres with symptoms and signs of recent CMV infection in 18 months (7/2002 to 12/2003) .The presence of specific CMV antibodies was determined using the microparticle enzyme immunoassay (ABBOTT-AXSYM system) and confirmed with the enzyme linked fluorescent assay suggesting non-acute infection. The sensitivity and specificity of the BioPlex CMV IgM assay increased to 97.7% and 100%, respectively, when the ten discrepant samples were resolved by the avidity test results. In the samples with low IgG avidities, the sensitivity of CMV IgM assay was 96.2% (25/26) for the BioPlex versus 73.1% (19/26) for the VIDAS. One of the low IgG avidity samples was IgM negative in both the VIDAS and BioPlex CMV IgM assay. In the samples with high IgG avidities, the sensitiv-ities of the VIDAS and BioPlex IgM assays were 19.4% (19/98) and 15.3% (15/98), respectively. Conclusion: The BioPlex 2200 CMV IgM assay described here is sensitive and specific for detecting CMV IgM antibody, and exhibited an ability to detect CMV IgM in specimens containing low avidity IgG antibodies. Biofilms: pathogenesis and antibiotic susceptibility The effect of atmosphere and inoculum size on Staphylococcus epidermidis biofilm density diluted 1:50 in fresh TSB, and 100 ll used to seed five columns of sterile flat-bottomed polystyrene 96-well cell culture plates (two strains per plate). Various concentrations of sterile filtered vancomycin in TSB were added to four columns per strain, with TSB alone added to the remaining column. Four different repeats of the experiment were performed, giving results for 1:100 dilutions of eight strains with 0 (control), 40, 20, 10, 5 lg/ ml vancomycin (1 set), 0, 8, 4, 2, 1 lg/ml (2 sets) and 0, 5, 4, 3, 2 lg/ml (1 set). Each set comprised of eight replicates of each condition. The plates were then incubated at 36°C for 20 hours before the wells were emptied by pipette, washed three times in 200 ll phosphate-buffered saline and air dried. They were then stained with 0.4% crystal violet solution for ten minutes before rinsing under gently running water. Biofilm density was measured as the optical density at 450 nm (OD > 0.12 taken as positive). Repeats of the same condition were combined by expressing the results as a multiple of the control condition. Statistical significance was assessed using the Mann-Whitney test (p < 0.5 taken as significant). Results: Five of the eight strains showed statistically significant increases in biofilm density in the presence of low vancomycin concentrations, resulting in biofilm-positive results in 95% of wells (see table) . This study has shown that the biofilm density of some strains of S. epidermidis increased in the presence of low concentrations of vancomycin. It is unknown whether this reflects increased biofilm-forming ability of less sensitive clones within a population, an effect on the cell wall of the organisms, or modulated gene expression. Regulation of biofilm formation by SigmaB is a common mechanism in Staphylococcus epidermidis and is not mediated by the SigmaB dependent sarA transcript Objectives: The alternative sigma factor SigmaB was identified as a major regulator of biofilm formation in Staphylococcus epidermidis 1457, whereas for S. aureus only a minor impact of SigmaB on biofilm formation could be observed. To exclude an individual behavior of S. epidermidis 1457 we further investigated in this study the influence of SigmaB on biofilm formation and sarA transcription in the methicillin susceptible clinical isolate S. epidermidis 8400 as well as in the methicillin resistant clinical strain 1057. Methods: Mutants with various deletions within the sigB operon were characterized phenotypically by a quantitative biofilm assay and by a PIA specific immunofluorescence assay. Transcription analysis of the genes icaA, icaR, sarA, and asp23 was performed using quantitative real-time PCR. Results: All mutants with dysfunctional SigmaB activity displayed a decreased biofilm formation, whereas for mutants with inactivation of the antisigmafactor RsbW an increased biofilm formation was observed. Transcriptional analysis revealed that icaA transcription was down-regulated in SigmaB negative mutants while icaR transcription was up-regulated. However, the observed differences of icaR transcription in these mutants did not always reach a significant level, indicating that additional SigmaB dependent regulators are involved in regulation of biofilm expression. Except for the mutant with inactivation of RsbW in S. epidermidis 8400, which displayed a significant increase of icaA transcription congruent with a strong increase of biofilm formation mutants with inactivation of the antisigmafactor displayed only minor transcriptional differences. Analysis of sarA transcription revealed no or only minor differences compared to the respective wild types. The similar influence on phenotypes as well as a comparable transcriptional regulation of icaR and icaA by the alternative sigma factor SigmaB in three independent genetic backgrounds of clinical S. epidermidis isolates suggests that regulation of biofilm formation by SigmaB is a general feature in S. epidermidis. Therefore, the SigmaB dependent regulatory pathway could be a promising target for new strategies to prevent foreign body-associated infections. The lack of significant differences of sarA transcription indicates that the SigmaB dependent sarA transcript is not involved in the observed phenotypic changes. Foreign body infection and 'wild type' Staphylococcus epidermidis -Potential of biofilm formation and antimicrobial resistance B. Parschalk, A. Grisold, F. Yassin, H. Adametz, W. Graninger, E. Presterl (Vienna, Graz, A) Objectives: Foreign body infections (FBI) due to Staphylococcus epidermidis have become major clinical problems associated with considerable morbidity and costs. Biofilm formation and resistance to multiple antibiotics are the major obstacles for a successful treatment. The aim of the study was to test Staphylococcus epidermidis isolates from patients with verified foreign body infections i) for their ability to form biofims and ii) for their susceptibility to 12 standard antibiotics, and compare these to 'wild type' Staphylococcus epidermidis isolated from the skin of healthy volunteers. Methods: Sixty patients with verified FBI were evaluated. Hundred and twenty-nine blood culture isolates from 60 patients with FBI, and 52-skin isolates from healthy, not hospital-associated, volunteers were analysed. Identification of Staphylococcus epidermidis was done using routine methods. To exclude doubles FBI isolates were genotyped by PFGE. The susceptibility testing was done using disk diffusion method according to the NCCLS. Antimicrobial agents tested were penicillin, oxacillin, erythromycin, clindamycin, gentamicin, amikacin, vancomycin, fosfomycin, fusidic acid, rifampicin, ciprofloxacin, trimethoprim and linezolid. Biofilm formation was tested using a microtiter plate biofilm model. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 significant). More than 30% of all FBI strains were resistant to penicillin, oxacillin, erythromycin, clindamycin, ciprofloxacin and trimethoprim. The 52 'wild type' Staphylococcus epidermidis were generally more susceptible than the clinical isolates (p < 0.05): However, 46.2 % of these controls were resistant to penicillin and to erythromycin, 17.3% were resistant to clindamycin. Conclusions: Biofilm formation is present to the same extent in both, FBI-associated and 'wild type' Staphylococcus epidermidis strains demonstrating the potential of skin flora to cause FBIs. Although it is well known that nosocomial Staphylococcus epidermidis are resistant to multiple antibiotics, the 'wild type' isolates show alarming resistance to erythromycin and clindamycin possibly reflecting the abundant use of macrolides for minor infections in the population. Objectives: Biofilm expression in Staphylococcus epidermidis is a major virulence factor and attachment to polymeric surfaces leads to reduced susceptibility against antimicrobial substances. The alternative sigma factor SigmaB is an important regulator of biofilm formation in S. epidermidis. However, biofilm formation is under influence of additional yet uncharacterized regulators, which were examined in this study. Methods: The Tn917 insertion of the biofilm-negative mutant M12 generated in the biofilm-positive genetic background of S. epidermidis 1457 was identified by arbitrary PCR. The transcription of the icaADBC locus, essential for biofilm formation as well as of the inactivated genes was investigated. The function of the inactivated genes was characterized by complementation studies under different environmental conditions. Results: In M12 Tn917 was inserted at the distal end of an orf homologous to the regulatory gene purR in Bacillus subtilis. The gene upstream of purR is conserved between S. epidermidis, B. subtilis, and S. aureus furthermore two additional orfs (orf3 and orf4) homologous to B. subtilis, and S. aureus are located downstream of the Tn917 insertion site. Within the purR genes of S. epidermidis, B. subtilis, and S. aureus a highly conserved motif homologous to the consensus sequence for SigmaB dependent promoters was identified upstream of Tn917. The SigmaB dependent transcription of the orf3 and orf4 could be demonstrated in mutants with inactivation of sigB. In M12 transcription of the biofilm associated genes icaADBC was abolished, whereas the transcription of their negative regulatory gene icaR was unaffected. Complementation with the single genes showed no effect in M12, whereas complementation of M12 with orf3 and orf4 together was able to restore biofilm formation under high osmotic conditions. Interestingly, under standard conditions used for biofilm formation as well as under biofilm induction with subinhibitory concentrations of ethanol no biofilm formation was observed in the complemented mutant. Conclusions: We identified two new regulators of S. epidermidis biofilm formation, which we designate now as biofilm accumulation regulators A and B (barAB). BarA and B act as positive regulators of icaADBC transcription independent of the regulatory gene icaR. BarAB is a SigmaB dependent gene locus, which is at least partially responsible for the NaCl induction of biofilm formation in S. epidermidis. Role of Fur and transferrin binding protein in Staphylococcus epidermidis during in vitro and in vivo biofilm formation C. Massonet, J. Van Eldere (Leuven, B) Objectives: To determine whether GADPH (transferrin binding protein-TBP) and its regulator (Fur) play a role in the biofilm formation by Staphylococcus epidermidis. Methods: A biofilm forming strain of S. epidermidis, isolated from a patient with proven catheter-related infection was used. RNA and DNA isolations were performed as described by S. Vandecasteele et al. (Biochem. Biophys. Res. Commun. 2002. 291:528-534) . For In vitro studies bacteria were grown overnight in BHI or RPMI, without iron (fRPMI) and re-incubated in fRPMI or fRPMI with 1 lm FeCl 3 or fRPMI with apotransferrin (iron free; 20 lg/ml) or fRPMI with holotransferrin (ironsaturated; 20 lg/ml). For in vivo studies a subcutaneous rat model was used. Samples were quantified through real-time PCR described by S. Vandecasteele et al. (Biochem. Biophys. Res. Commun. 2002. 291:528-534) . Results: During the growth of the bacteria, the expression of fur and tbp for planktonic bacteria was higher in an iron depleted medium and lower in an iron rich medium. In vitro studies in an iron depleted medium show a statistically significant (2-way ANOVA, Bonferonni, N = 12) up regulation of fur expression in sessile bacteria in comparison with planktonic bacteria. In an iron rich environment there is no variation in the expression of fur between sessile and planktonic bacteria. In fRPMI with holotransferrin or apotransferrin the expression of fur for sessile bacteria in comparison with that of planktonic bacteria is significantly up regulated in fRPMI with holotransferrin and down regulated in medium with apotransferrin. The results obtained for tbp are similar. In vivo, the expression of fur is down regulated in the beginning, followed by an increase of expression after one week. The expression of tbp is very low and stays constant over a period of two weeks. (Statistically significant: 1-way ANOVA, Bonferroni, N = 16). Conclusion: According to in vitro results, the lack of iron has a greater impact on sessile bacteria than on planktonic bacteria. Holotransferrin and apotransferrin also affect the expression of fur and tbp in sessile bacteria, but further investigation is required. In vivo results show that fur plays a role in the late stages of the biofilm. Effect of iron on iron-regulated genes in biofilmassociated Staphylococcus epidermidis Results: In vitro results show that in an iron-limited environment, the planktonic form of S. epidermidis produces siderophores and grows slower than in an iron-rich environment. In vitro, during an 18 hours observation period, the expression of sirR stays constant and is independent of iron concentration. The expression of sitA, sitB and sitC on the other hand is higher in medium with low iron content than in the medium with added iron. In vitro studies also indicate that sirR has a statistically (2-way ANOVA, Bonferroni, N = 12) significant higher expression in sessile bacteria compared to planktonic bacteria. The expression of sitC is significantly (2-way ANOVA, Bonferroni, N = 9) higher for sessile bacteria than for planktonic bacteria in an iron-limited medium. The expression of sitC in an iron-rich medium is identical for both forms. In vivo (1-way ANOVA, Bonferroni, N = 16), the expression of sirR is high and remains stable over a time period of two weeks. SitC, sitA and sitB are also highly expressed during this two weeks time period. Conclusion: The constant high in vivo expression of sitABC and the regulator sirR could indicate a role of these genes in the biofilm growth mode. In vitro results show an iron-regulated expression of sitABC. The expression of sirR (in vitro) is not iron-regulated but a specific regulation mechanism is not yet known. Role of virulence regulator genes in Staphylococcus epidermidis biofilm formation V. Pintens, S. Vandecasteele, R. Merckx, J. Van Eldere (Leuven, B) Objective: To monitor gene expression of Staphylococcus epidermidis regulator loci during early in vitro and in vivo biofilm formation. Methods: AgrA, RNAIII, sarA, rsbU, rsbV and sigB expression in vitro was examined at 0, 10, 30, 60, 120 and 180 min after inoculation in 0.9% NaCl in planktonic (n = 68) and sessile (n = 70) bacterial cultures. Gene expression during in vivo biofilm formation was evaluated over two weeks. Catheter fragments inoculated with S. epidermidis were implanted subcutaneous in rats as described by S. Vandecasteele et al. (Biochem Biophys Res Commun. 2002; 291: 528-534) . Catheters (n = 295) were explanted 0, 15, 30, 60, 90, 120, 240, 360, 720, 1440, 2880, 5760, 10080 and 20160 min after implantation. Expression was determined by TaqmanTM real-time PCR as described by S. Vandecasteele (Biochem Biophys Res Commun. 2002; 291: 528-534) . Results: In vitro expression of rsbU, the first gene of the sigB operon, is significant higher in sessile than in planktonic bacteria. Relative expression levels of RNAIII and sarA are higher in planktonic than in sessile bacteria. There is no significant difference between in vitro expression of agrA, sigB and rsbV in sessile versus planktonic bacteria. In vivo, expression of all genes reaches a peak level between 1 and 2 h after implantation (0.5-1.5 log 10 times the expression level at implantation) and subsequently decreases towards its lowest level at 6 h. For agrA, expression remains stable during the whole observation period; expression of RNAIII and sarA decreases and remains thereafter at a very low level. SigB expression remains at a high level for the whole observation period, whereas expression of rsbV and rsbU increases. RsbU is expressed to a significantly higher degree than the other sigB operon genes. Conclusion: In contrast to S. aureus, the sigB operon and particularly rsbU seem to be important factors in S. epidermidis biofilm formation. Staphylococcal biofilm as a target for linezolid, vancomycin, oxacillin and/or lysostaphin E. Walencka, B. Sadowska, S. Rozalska, W. Hryniewicz, B. Rozalska (Lodz, Warsaw, PL) Objectives: Medical device-associated infections, frequently caused by staphylococci, are related to biofilm formation. Chemotherapy of such infections is seldom fully effective, due to high biofilm resistance. A number of alternative approaches to antimicrobial treatment have been proposed. The aim was to study the activity of antibiotics in monotherapy or in combination with lysostaphin, towards S. aureus biofilm. Methods: S. aureus: ATCC29213 (MSSA), A3 (clinical MRSA), 1474/01 (clinical hVISA), were used as planktonic cultures or 24hour-old biofilm built in the wells of microplate, in the chambers of a LabTekII chamber slide or on the polyethylene catheter. MICs of linezolid, vancomycin, oxacillin and lysostaphin for planktonic bacteria were determined according to the standards of NCCLS. BIC/BEC (Biofilm Inhibitory/Eradicating Concentration) were estimated by the MTT assay measuring active metabolism of bacteria that survived a single or cyclical dose of antimicrobials (antibiotic alone or in combination with subMIC lysostaphin given earlier or together with antibiotic). The integrity of biofilm treated with antimicrobials was also examined: in catheter study: visually by TTC reduction assay, in chambers of a LabTekII chamber slide: by staining with FITC and confocal fluorescence microscopy. Results: We have demonstrated the effectiveness of lysostaphin in the treatment (3-24 hours) of biofilm built not only on the flat surface (wells of microplate, chambers of a LabTekII chamber slide) but also on catheter extra-and intraluminal surfaces. MIC/BIC of lysostaphin were 0.25, 8/16 mg/L for MSSA and MRSA, 0.06, 4/8 mg/L for hVISA, respectively. The synergistic effect of subMIC lysostaphin + oxacillin was observed for MSSA and MRSA biofilms (BICoxa/Lin dropped after 24 h from >128 to <4 mg/L) but such effect was not demonstrated for hVISA strain (BICOxa was still >128 mg/L). SubMIC lysostaphin +linezolid or + vancomycin, given as 3 cycles therapy, were effective in disruption of MSSA, MRSA, hVISA or MSSA and MRSA biofilms, respectively. Thus, lysostaphin in combination with antibiotics, was effective in preventing the biofilm rebuilding (BEC) in experiments lasting 5 days. Conclusions: Our study indicates that staphylococcal biofilm eradication could be achieved by treatment with lysostaphin alone or in combination with selected antibiotics. However, complete biofilm removal needs the cyclical therapy. Objective: Zinc compounds are used in the siliconized latex urinary catheters (SLUCs) manufacture. Studies in vitro have shown that Zn elutes from SLUCs and determines decreased susceptibility to carbapenems in planktonic Pseudomonas aeruginosa. This effect is associated with OprD loss. P. aeruginosa is able to adhere efficaciously to the surface of SLUC forming biofilms. The objective of this study was to evaluate the relevance of this phenomenon in P. aeruginosa forming biofilms on SLUCs. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 Methods: Biofilms of P. aeruginosa PAO1 were grown on 1 cm SLUCs segments in Mueller-Hinton broth for 24 hours. Bacterial biofilms were detached by sonication and Zn accumulation in biofilms was determined by inductively coupled plasma atomic emission spectrometry (ICP-AES). SLUC segments without biofilms were used as control. To study the outer membrane proteins (OMPs) of bacterial biofilms, cells were disrupted by sonication (40 kHz, two minutes in a sonication water bath) and OMPs were isolated as sodium-lauryl sarcosynate insoluble material and the proteins were resolved by SDS-PAGE. OMP pattern was compared to that expressed by planktonic bacteria grown in Mueller-Hinton broth supplemented or not with Zinc Chloride (40 mg of Zn/L). Results: P. aeruginosa PAO1 SLUC biofilms did not accumulate Zn. Zn values reached by bacterial biofilms (1.67 ± 0.32 lg/g of catheter) were similar to that those obtained with the control (1.88 ± 0.27 lg/g of catheter). P. aeruginosa PAO1 forming biofilms lost OprD2 and expressed OprD3, showing the same OMP profile as planktonic bacteria in the presence of Zn. Conclusion: P. aeruginosa PAO1 SLUC biofilms did not expressed OprD, the porin responsible for carbapenem entry into P. aeruginosa. Zn eluted from SLUCs did not accumulate by PAO1 biofilms. Diversity in adhesion, initial biofilm formation and motility abilities among clonal lineages of nosocomial strains of Pseudomonas aeruginosa A.P. Fonseca, P. Correia, A.F. Fonseca, R. Tenreiro, J.C. Sousa (Porto, Lisbon, P) Objectives: The objective of this study was to test for potential constraints of genotypes on several virulence parameters and to examine the extent of phenotypic diversity in the context of clonal lineages (CLs) among nosocomial strains of P. aeruginosa. Methods: A combination of two genomic typing systems, the minisatellite-primed PCR (MSP-PCR) and the enterobacterial repetitive consensus sequence PCR (ERIC-PCR), was used to discriminate the 96 strains collected at a Portuguese Central Hospital and isolated from 5 different sources. The data was analysed using BioNumerics software. Bacterial adhesion to polystyrene (PS2h) and initial biofilm formation (PS6h) were studied by growing bacteria in LB in a modified microtiter-plate assay. Strains were screened for their capacity to adhere to hydrophobic biomaterials such as silicone and hexadecane (CSH) using a biphasic separation method. The opportunistic P.aeruginosa were also screened for their capacity to swim (flagella) and twitch (pili). All tests were run in triplicate. Results: Our combined genotypic and phenotypic analysis revealed extensive diversity in all the parameters within CLs of P. aeruginosa strains and no significant differences among CLs. However, small clusters of strains with relatively high PS2h and PS6h abilities can be found; one specific group containing 2 strains of CL1 (similarity 70%) are worth mentioning; a group of 2 strains from CL7 (similarity 60%) had low PS2h and PS6h abilities. Positive correlations (Spearman's) were observed between PS2h and PS6h (0.748, P < 0.01), between PS2h and CSH (0.233, P < 0.05), between PS6h and CSH (0.228, P < 0.05) and between PS6h and twitching (0.220, P < 0.01). The strain with highest adhesion value was one of the most efficient initial biofilm producer and other strain had the same behavior but had the lowest value. The strain with highest CSH was also one of the most efficient in adhesion to silicone and the strain with lowest adhesion was the same for the two parameters. Conclusion: Our results suggest extensive diversity, namely by wide variations in virulence parameters among strains within a CL and no significant differences between CLs in all the virulence parameters. These results also suggest the importance of hydrophobicity in adhesion ability to abiotic surfaces, the importance of twitching in biofilm formation and the correlation between PS2h and PS6h ability. Acknowledgments: This study was supported by Fundação Calouste Gulbenkian. Comparative study of antibiotic susceptibility levels of some clinical strains of P. aeruginosa as planktonic and adherent growing in biofilms cells Background: Besides the well known genetic antibiotic resistance of Pseudomonas aeruginosa strains, the growing biofilms on medical implants are responsible for persistent infections, being much less susceptible to antimicrobial agents than are their planktonic counterparts. This recalcitrance could be due to selfaggregation and bacterial adherence to different substrata, generation of a protecting exopolysaccharidic mathrix limiting the antibiotic diffusion in the biofilm, underexpression of porins, overexpression of multidrug resistance pumps, the presence of persisters that survive in the presence of an antibiotic that inhibits their growth. For highlighting some of the abovementioned factors, we have investigated the antibiotic resistance levels of P. aeruginosa planktonic cells comparatively with cells growing in biofilms developed on central venous catheter pieces imersed in nutrient broth (original experimental model) or included in agar mimicking the biofilm mathrix. The study was performed on some P. aeruginosa strains isolated from central venous catheter related infections in patients admitted for cardiovascular surgery. The strains were firstly submitted to antimicrobial testings performed by standard disk diffusion method and 25 strains susceptible to aminoglycosides, beta-lactams and quinolones were further tested by two experiemental models for antibiotic susceptibility of bacterial cells included in biofilms formed in liquid and solid media. The strains were also studied for slime production and for cell hydrophobicity. Results: Our results showed that the P. aeruginosa cells growing in biofilms are significantly less susceptible to antibiotics, in a dose-response (increased MICs and MBCs) and time-dependent manner. This aspect was particularly evidenced and statistically confirmed for aminoglycosides, which poorly penetrate the biofilm, due to their policationic structure. The majority of the tested strains produced high amounts of slime, evidenced after safranin staining of the biofilm developed on glass tube walls, expressed both at 37°C and 4°C and well correlated with the presence of bacterial capsule. All the tested strains exhibited high hydrophobicity levels evidenced by decreased absorbance values of the aqueous phase of bacterial cultures in the presence of paraxilen and also by the ability to self-aggregate, raising the risk of colonizing the inert materials and of catheter related persistent infections. Biofilm formation of nosocomial Acinetobacter baumannii strains Acinetobacter baumannii an important nonocomial pathogen, usually found on various surfaces of the hospital environment. Biofilm formation is a virulence factor for A. baumannii. In this study, 17 blood isolates of A. baumannii were studied for the ability to form biofilms on the surface of polystyrene and ultrastructural cell wall properties of biofilm-formatted strains were evaluated. Methods: A total of 17 A. baumannii strains isolated from blood cultures of different patients in intensive care units between 2003 and 2004 were selected. The ability of Acinetobacter strains to form biofilm was determined on polystyrene microtiter plates using Brain Heart Infusion supplemented with 0.25% Glucose as a growth medium. Additionally, transmission electron microscopy of strains was performed for the presence of fimbria, cell wall thickness and, an amorphous material cover the cell described for some other bacteria. Results: Biofilm formation was detected in 9 (52.9%) of A. baumannii strains. Ultra structural analysis showed that fimbriae were found all of the isolates while the thickest layers of amorphous material was observed around the biofilmpositive strains. Conclusion: Biofilm formation of A. baumannii strains from patients with bacteriemia was found high. The results obtained in electron microscopy studies suggested that amorphous material covers the bacteria probably plays an important role of the maintenance of the bacterium in the hospital environment and protect it against the defense mechanisms of the host. Strains of Enterobacter cloacae isolated in hospital environment: ability to adherence to Hep-2 cell line and to biofilm forming Bacteria Enterobacter cloacae were observed as etiological agents of nosocomial infections in Poland, especially hospital-acquired pneumonia (9-11%) and urinary tract infections (3-7%). Moreover the majority of E. cloacae strains isolated from patients with HAP, hospitalized at ICUs showed resistance to ceftazidime. The aim of our study was the examination of virulence properties like: adherence to human cell line and forming biofilm of 15 strains of E. cloacae isolated from patients (infection or colonisation) and of 11 strains isolated from the body surface of German cockroaches collected in hospitals. The examination of ability to adherence to human cell line (Hep-2) was done according Knutton et al. method. Three patterns of adhesion were observed: A. aggregative; B. localized and C. diffuse adhesion. Moreover determination of activity of 3 selected chemical disinfectant to bacteria growing as a planctonic form (by evaluation MICs) and growing as a biofilm on catheter (effectiveness of working solution) was done. Patterns of adhesion to Hep-2 cell line varied among tested strains. The aggregative adhesion was observed among 2 strains of E. cloacae colonising patients and one isolated from infections. No one of 11 E. cloacae strains isolated from the surface of cockroaches showed this pattern of adhesion. According to statistical analysis the significant number of E.cloacae strains isolated from cockroaches presented lack of adhesion to Hep-2 cell line or diffuse adhesion in comparison to strains collected from patients. Totally 65% E. cloacae strains showed mannose-sensitive mechanism of adherence to Hep-2 cell line (71% of strains from the colonised patients, 62.5% of strains that caused infection and 63.6% of strains from the surface of cockroaches). 27% of the strains showed stronger adhesion in presence of mannose. Only one E. cloacae strain did not form the biofilm on catheter. The majority of tested strains growing 5 days on catheter were resistant to working solution of potassium persulfate, glucoprotamin and sodium dichloroisocyjanurate. However, E. cloacae strains that caused infection were the only resistant to all 3 disinfectants working solution, even if the MIC values were similar to the MICs of these strains from patient colonisation or from cockroaches. The study on virulence markers presented by E. cloacae hospital strains should be continued. The development of crystalline Proteus mirabilis biofilms on Foley catheters S.D. Morgan, D.J. Stickler (Cardiff, UK) Objective: The management of many patients undergoing longterm bladder catheterisation is complicated by the encrustation and blockage of their catheters. The problems result from infection by urease producing bacteria. The organisms colonize the catheters, the urease induces alkaline conditions under which calcium and magnesium phosphates precipitate and the resulting crystalline biofilm blocks the flow of urine. The aim of this study was to investigate the early stages of biofilm formation on a range of catheter types. Methods: A laboratory model of the catheterised bladder was supplied with urine and infected with Proteus mirabilis NSM6, a clinical isolate from an encrusted catheter. Models were fitted with five different types of catheters. After incubation for various periods up until the times they blocked, catheters were removed from the models for examination. Scanning electron microscopy and X-ray microanalysis were used to follow the colonization of catheters by bacteria and crystalline material. Results: All-silicone, hydrogel-coated latex and silicone-coated latex catheters all acquired a layer of crystalline material within 4 h. These deposits consisted predominantly of calcium phosphate. Subsequently, they become colonized by large numbers of bacilli and the rapidly developing crystalline biofilm blocked the catheters within 12.5 h-42.5 h. In the case of a nitrofurazoneimpregnated all-silicone catheter, although the initial process was slower, with the crystalline layers being first observed at 12 h, catheter blockage occurred at 29 h. Triclosan-impregnated silicone catheters however, showed little sign of encrustation or biofilm formation and were still draining urine freely at 7 days when the experiment was terminated. Conclusion: The catheters currently available for long-term bladder management were rapidly colonized by crystalline P. mirabilis biofilm. Triclosan-impregnated catheters however were able to resist encrustation and biofilm formation in vitro for up to 7 days. The role of capsules in Klebsiella pneumoniae biofilm formation C. Struve, S. Molin, K.A. Krogfelt (Copenhagen, DK) Objectives: K. pneumoniae is an important opportunistic pathogen and frequent cause of hospital infections. K. pneumoniae cells are characteristically surrounded by a pronounced polysaccharide capsule, which has been proven to be an important virulence factor for the bacteria. The ability of bacteria to form biofilms is recognized to play a role in the pathogenicity of many bacterial species. In biofilms bacteria are organised in microcolonies embedded in a matrix of exo-cellular polymeric substances (EPS). The EPS is considered to stabilize the biofilm structure and protect the bacteria against host defence mechanisms and the actions of antibiotics. In this study we investigate Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005 the role of the polysaccharide capsule on K. pneumoniae biofilm formation. Methods: The gene-cluster encoding the synthesis of the K16 capsule was cloned and sequenced from the clinical K. pneumoniae isolate 3091, and an isogenic non-capsulated mutant was constructed. The wildtype and mutant were tagged chromosomally with fluorescent markers and grown in continuous flowcell systems to characterize their biofilm formation using confocal laser scanning microscopy. Results: The wildtype stain was found to form thick irregularly shaped biofilms. The biofilms mainly consisted of loose clusters of bacteria, up to 40 lm thick. Although the biofilm covered most of the substratum, open areas were also present within and between the bacterial clusters. The non-capsulated mutant was also able to form biofilms; however the architecture differed from that of the wildtype. The non-capsulated mutant spread as a confluent thin layer of cells covering the substratum. The vast majority of the biofilm was less than 5 lm thick, and only occasionally thicker bacterial clusters resembling the wildtype biofilm phenotype were observed. Conclusions: K. pneumoniae cells are able to form thick biofilms when grown in continuous flow systems. The polysaccharide capsule was not found to be essential for biofilm formation per se but its absence significantly affected biofilm development and architecture. Future studies may reveal the influence of capsules on biofilm resistance against host defence systems and actions of antibiotics. Objectives: Klebsiella bacilli are frequently cases of nosocomial infections associates with usage urinary (CAUTI) and intravenous catheters (CR-BSI) due to its ability to biofilm formation on biomaterials. The aim of our study was the correlation between pathogenic properties in clinical Klebsiella strains (the capsule, the types of adhesins), the type of using biomaterials and degree of in vitro formation the biofilm structure on the catheters. Material and Methods: The 69 clinical Klebsiella strains producing several distinct types of fimbria were tested (30 isolated from UTI, 23 from blood and 16 from other clinical samples). Influence of capsule on ability of the biofilm formation was estimated using uncapsulated mutants and their capsulated variants. In the investigations the urinary catheters-polyvinyl chloride Nelaton, latex Foley, all-silicone Foley and venous catheter-polyurethan Cavafix were tested. In vitro biofilm formation was evaluated by Richard method. In this assay, soluble colourless TTC is reduced to insoluble red formazan by electron transfer associated with active oxidative bacterial metabolism and is precipitated intracellulary. This assay were validated by electron microscopy. Results: All investigated strains showed the ability of formation of the biofilm on the catheters after 24 hours incubation. For most of strains the value of fomazan reduction were evaluated like as intermediate or strong. The highest level of biofilm formation showed the strains to venous catheters from polyurethan and urinary catheters from polyvinyl chloride. The lowest adhesion rate was observed in case of all-silicone Foley catheters. The capsulated strains made the biofilm weaker then the uncapsulated strains. The presence of the characteristic biofilm structure on catheters was confirmed in electron microscopy. The level of adhesion in clinical Klebsiella bacilli to biomaterials was associated with the chemical type of catheters. The capsule absence leads in case of investigated strains to the stronger biofilm formation on the surface of biomaterials. The various Kebsiella strains showed in electron microskopy various structures of biofilms The correlation between the type of expressed fimbria and degree of biofilm formation was not observed in this investigation. Objectives: Biofilm is composed of surface-attached cells and excreted exopolymeric substances. Bacterial biofilm infections are particularly problematic because sessile bacteria are more resistant to antibiotics and host immune responses, leading to therapeutic difficulties. The objective of this study was to analyse the capacity of biofilm formation of E. coli clinical isolates causing different urinary tract infections (cystitis-CT, pyelonephritis-PNA, and prostatitis-PT). Methods: A total of 151 uropathogenic E. coli strains (44 from cystitis, 75 from pyelonephritis, and 32 from prostatitis) were analysed. Capacity of 'in vitro' biofilm formation was determined by bacterial growth in minimal glucose medium, stained with 1% violet crystal, and washed with PBS. The cells were dissolved with DMSO and the plate was automatically read in a spectrophotometer. The HC-91255 strain was used as a control strain and the experiments were made in duplicate. Results: Biofilm formation was noted in 19 (43%), 30 (40%), and 20 (63%) strains from patients with CT, PNA, and PT, respectively. The ability to form biofilm was significantly more frequent in PT than in PNA strains (p = 0.03), and showed a trend to be significantly more frequent than in CT strains (p = 0.09). No differences between CT and PNA strains regarding biofilm production were noted (p = 0.7). After pooling CT and PNA strains together, biofilm formation was the only characteristic which was significantly associated with strains causing PT in both univariate and multivariate analysis (OR = 2.38, 95% CI = 1.06-5.35, p = 0.03). Conclusions: Biofilm formation is significantly more prevalent among strains of E. coli involved in acute prostatitis than in those causing other urinary tract infections. Biofilm formation can be relevant in promoting persistent prostate infection; and given the high frequency of biofilm production among strains causing acute prostatitis, the treatment of these patients should be conducive to the eradication of microbial biofilms. Environmental maltose and glucose concentrations regulate biofilm formation in Enterococcus faecalis J. Huebner, A. Kropec, S. Koch, R. Creti (Freiburg, D; Boston, USA; Rome, I) Objectives: Biofilm formation in E. faecalis seems to play an important role in a number of enterococcal infections, but little is know regarding the underlying mechanisms. We wanted to identify environmental signals that regulate biofilm formation in enterococcus. We have recently identified a genetic locus involved in biofilm formation of E. faecalis. Biofilm formation was measured using a polystyrene plate assay and media supplemented with oligosaccharides. The expression of genes was measured by real-time PCR and the locus was sequenced. Homology was assessed using BLAST and related programmes. Results: The genetic locus identified by us is also involved in maltose uptake and metabolism. The expression of genes in this locus is regulated by maltose and glucose in the growth medium indicating that nutritional oligosaccharides may promote or inhibit biofilm formation. While the wild-type strain was able to produce biofilm in medium containing either glucose or maltose, two mutants (one transposon mutant and one deletion mutant) showed opposite effects. A transposon mutant showed a reduced biofilm formation when grown in medium containing 1% glucose while a deletion mutant produced more biofilm when grown in glucose, but was unable to form biofilm when maltose was added to the growth medium. The sugar-binding transcriptional regulator bopD seems to bind to an operator upstream of the bop locus and a consensus binding sequence shown to bind to the maltose repressor MalR is present in the non-coding region upstream of bopA. Conclusions: The biofilm-positive phenotype of the wild-type strain seems to facilitate colonization of enterococci in the gut and the presence of oligosaccharides in food may regulate biofilm formation and therefore colonization of enterococci in the gastrointestinal system. Biofilm formation and morphology of group A streptococci isolates of patients with sepsis or necrotising fasciitis Objectives: Group A streptococci may cause severe sepsis associated with multiorgan failure and high mortality. Additionally, they are the primary cause of necrotizing fasciitis. The objective of this study was to evaluate the ability to form biofilms and the morphology of these biofilms produced by GAS isolated from blood of patients with sepsis and from the tissue of patients with necrotizing fasciitis. Methods: Twenty-six GAS isolates from blood cultures of patients with sepsis and bacteraemia, and 26 isolates from tissue of patients with necrotizing cellulitis and fasciitis were collected. They were isolated and identified using routine methods, and frozen at -73°C in BHI broth with 3% glycerol. To test their ability to form biofilms, the isolates were grown in microtiter plates in tryptone soya broth for 24 or 48 hours. To examine the morphology of the biofilm formation the isolates were either examined unfixed or fixed with 2% glutaraldehyd using electrone microscope scanning (Philips XL30 ESEM). For quantification they were fixed with 2% glutaraldehyd and dyed with 1% crystal violet to measure the mean optical density (OD using a routine microtiter-plate-reader at 550 nm wavelength. To calculate differences in the frequency in the groups the Fisher's exact test and to calculated differences in the OD the Mann-WhitneyU-Test were used. Results: Seventeen out of 26 isolates from patients with sepsis and 14 out of 26 isolates fom patients with necrotizing fasciitis formed biofilms (difference not significant). Scanning electron studies confirmed biofilm formation however it looked somewhat scarce in isolates from necrotizing fasciitis. For the biofilm forming isolates, the OD of isolates from sepsis were significantly higher than the OD of isolates from necrotizing fasciitis (0.996 versus 0.578, p < 0.001). Conclusions: GAS isolates from both, bloodstream and tissue, had ability to form biofilms. Biofilms of blood stream isolates were significantly denser than biofilms of the tissue isolates. This surplus opacity of blood stream isolates was confirmed by the scanning electron microscopy studies which revealed a more scanty looking morphology of the tissue GAS isolates. The lesser density of the biofilms of GAS isolated from the tissue might be important for the pathogenesis of necrotizing fascitiis probably facilitating to the rapid spread of the bacteria within the tissue. Inhibition of Candida growth and biofilm formation on polyurethanes by fluconazole adsorption G. Donelli, I. Francolini, V. Ruggeri, E. Guaglianone, A. Piozzi (Rome, I) Objectives: Recent attempts to prevent device-related infections included several strategies among which catheter coating with antibiotics resulted to be one of the most promising. However, so far only sporadic studies were designed to prevent fungal colonization of devices presumably because of the only recently described ability of Candida species to form biofilms. In this study we report in vitro experiments on the efficacy of coating of newly synthesized polyurethanes with the antifungal drug fluconazole in preventing polymer colonization and biofilm formation by Candida albicans. Methods: Polymers used in this study are three synthesized urethane polymers having different functional groups in the side-chain: hydroxyl groups, primary amino groups and tertiary amino groups. Fluconazole was adsorbed on round shaped disks made of the above described polyurethanes. The kinetics of fluconazole release from polymers, either containing or not albumin as pore forming agent, was studied by keeping fluconazole-loaded polymeric disks in water for increasing times up to 8 days. The antifungal activity of polymers was studied by the Kirby-Bauer test and scanning electron microscopy. Results: Among the tested polymers, the most hydrophilic ones were able to adsorb higher drug amounts by establishing 'hydrogen bond' and 'van der Waals' interactions. The kinetics of fluconazole release from polymers was influenced by the degree of polymer swelling in water and resulted significantly improved by the albumin incorporation in polyurethanes which increased polymer porosity. In our best experimental in vitro model consisting of an hydrophilic polymeric disk (average weight 250 mg) impregnated with 62.5 mg albumin and 62.5 mg fluconazole, the Candida albicans growth was inhibited, as evidenced by the Kirby-Bauer test, and biofilm formation on polymeric surface was not observed up to 8 days, as evidenced by scanning electron microscopy. Conclusion: Overall, data obtained from our newly synthesized functionalized polyurethanes, treated with albumin and loaded with fluconazole, seem to be very promising in the perspective to develop medical devices refractory to Candida colonization. In vitro activity of caspofungin against Candida Candidiasis can be associated with the formation of biofilms on bioprosthetic surfaces and the intrinsic resistance of Candida albicans biofilms to the most commonly used antifungal agents has been demonstrated. Objectives: In this study, we report on the antifungal activity of two concentrations of caspofungin on C. albicans and C. parapsilosis biofilms with different ages of maturation. Methods: Fifteen strains of C. albicans (ten strains were susceptible to fluconazole in vitro and five strains were resistant to this antifungal agent) and six strains of C. parapsilosis (all were susceptible to fluconazole in vitro) were studied. The antifungal activity of caspofungin was assessed by looking for a significant inhibition of the metabolic activity of yeasts included in biofilms, after the antifungal treatment. Biofilms were obtained in vitro, on silicone catheters. Results: Caspofungin used at MIC did not modify the metabolic activity of yeasts, whatever the Candida species and the maturation age of biofilms. The use of a therapeutic concentration of caspofungin (2 mg/L) induced a significant decrease in the metabolism of the all tested strains of C. albicans and C. parapsilosis, independently of the maturation age of biofilms. This high antifungal potency of caspofungin on C. albicans biofilms was observed independently of the susceptibility of yeasts to fluconazole. Conclusion: This study demonstrated that caspofungin used at MIC was not efficient to reduce Candida biofilms but it suggested that caspofungin used at 2 mg/L could represent a good Candidate in the prevention of candidiasis associated with silicone medical devices. Our results also suggested that fluconazole resistance of yeasts did not modify caspofungin activity. Effect of short-time desiccation on biofilmassociated bacteria I. Turetgen, E.I. Sungur, A. Cotuk (Istanbul, TR) Objectives: Microorganisms tend to form biofilms consisting of cells embedded in a highly hydrated, extracellular polymeric matrix. Biofilms may be responsible for a wide variety of nosocomial infections. Sources of biofilm-related infections can include the surfaces of catheters, medical implants, dental unit water lines or other types of devices, as well as cooling towers, shower heads. The biofilm protects its inhabitants from antimicrobial agents, pH alterations, and confers protection against desiccation. It is possible to encounter desiccation in natural or man-made environments through evaporation, flowing-off or system shutdown. However biofilm-associated bacteria can survive for a while in the absence of water within systems. In this study the survival of heterotrophic bacteria, sulphate reducing bacteria (SRB) and amoeba were evaluated against short time desiccation. Methods: Biofilms were allowed to grow for 30 and 60 days on stainless steel coupons. For the desiccation experiment, coupons were taken out from the reactor and left air-dried. Desiccated cells were rehydrated in 10 ml of sterile phosphate buffer after 6, 24, 48, 72, 96, 168 hours and biofilm were removed from coupons. For enumeration of heterotrophic bacterial count, samples are plated on R2A agar for 10 days at 27°C. Postgate medium B was used for SRB cultures. For amoeba isolation biofilm homogenates were spread on non-nutrient agar plate overlaid with Eschericha coli. Results: After 72 h of desiccation of 30 d old biofilm, SRB growth was seen while no heterotrophic bacterial growth was observed. Whereas on 60 d old biofilm, heterotrophic bacterial growth was observed after 96 h, however SRB growth was seen after 168 h. No significant differences were found between zero time and 24 h counts regarding heterotrophic bacteria. Discussion: Heterotrophic bacteria are located at the biofilmwater interface; whereas anaerobic bacteria niched in the deeper layers of the biofilm. The ability of some pathogenic bacteria to survive within the cysts of amoebas is suggested as a possible mechanism by which the organism evades disinfection and spreads to colonize new environments. Bacterial resistance to desiccation has been reported frequently, but the maximal tolerance of microorganisms in the air-dried state is still unknown. The study showed that diurnal absence of water could not affect biofilm-associated microorganisms significantly. Effects of food preservatives on oral streptococci biofilm generated in a biofilm reactor Objectives: The aim of this laboratory study was to evaluate the influence of the preservatives sodium benzoate, potassium sorbate and sodium nitrite on mixed species biofilms generated by oral streptococci. Methods: A modified biofilm reactor (Bio Surfaces Technologies, Corp., Bozeman, USA) was used to build up a biofilm on bovine enamel slabs (BES). A mixture of six oral streptococci (S. mutans, S. mitis, S. oralis, S. sanguis, S. salivarius and S. sobrinus) was investigated to generate biofilms over a period of four days.Eight slabs each (with the adhering biofilms) were treated with one of the following solutions for one minute: a) Saline (0.9%, negative control), b) 0.2% chlorhexidine digluconate (CHX, positive control), c) 0.1% sodium benzoate (SB), d) 0.1% potassium sorbate (PS) and e) 0.06 sodium nitrite (SN). After treatment four slabs each were washed in saline and a vital-dead staining was conducted on the adhering biofilms. The slabs were then analysed in situ for biofilm thickness and vitality using confocal laser scanning microscopy (CLSM).From the other four slabs biofilms were dispersed in saline and the colony forming units (CFUs) on Columbia blood agar as well as total bacterial counts using DAPI-staining were determined. Results: The biofilm thickness of the different tested BES was between 12.3 and 35.8 lm in average. The vitality of the negative control was determined to be 86.14 ± 4.6% and 37.27 ± 8.11% for positive control. For sodium benzoate and potassium sorbate a vitality of 74.39 ± 8.08% and 71.11 ± 6.93% was measured, respectively. The treatment with sodium nitrite led to a vitality of 66.73 ± 6.36%.The mean log 10 CFUs of untreated biofilm was determined to be 7.83 ± 0.14 and 7.28 ± 0.33 for the biofilm treated with CHX. After treatment with SB and PS the mean log 10 CFUs was 7.20 ± 0.20 and 6.98 ± 0.24, respectively. For biofilm treated with SN a mean log 10 CFUs was determined to be 7.12 ± 0.40. The plating efficiency was determined as followed: 56. Chronic infections caused by biofilm-forming staphylococci represent serious medical problem. Their higher prevalence now-adays is associated with more frequent use of artificial implants and medical devices. Surface of these implants facilitates adhesion of bacteria, which than form biofilm. The knowledge of biofilm formation dynamics is fundamental for the understanding of processes running in the biofilm layer. The aim of this study was to determine with mathematical models the differences in biofilm formation in different conditions and to determine the minimum time and conditions necessary for the development of the homogenous and matured biofilm layer suitable for the antibiotic testing. The Staphylococcus epidermidis biofilm-positive strains were used in this study. As the positive control, strain CCM 7221 was used. The biofilm was grown on tissue culture microtiter plates. The strains were cultivated in different concentrations of glucose and at different temperatures. Each strain was cultivated simultaneously in 4 wells. In the first 48 hrs the data were collected every hour, than up to 96 hrs every 6 hrs. After cultivation the wells of microtiter plates were stained with crystal violet and the biofilm formation was assessed spectrophotometrically. Data were processed with the Multiple Analysis of Covariance (MANCOVA) and mathematical models were evaluated with Regression Analysis. For the image analysis and visualisation of the biofilm in different stages of formation, specific dyes (alcian blue, acridin orange, Rylux etc.) were also used. All tested strains showed better growth of the biofilm at the temperature of 37°C in the nutrientricher environment. The model can be simply described as follows: the first signs of bacterial adhesion were visible after 2-4 hrs of cultivation, the first homogenous but a very thin layer was visible after 5 hrs, after 7 hrs the biofilm layer was cca 3-times thicker. After 10 hrs the biofilm layer seemed to be mature-the changes in the thickness were not so evident after this time. After the cultivation longer than 34-42 hrs the parts of the biofilm layer started to detach, so the biofilm became unhomogenous. In the regression modelling, other nutrient and temperature conditions showed also different influence on the formation of biofilm. For the antibiotic testing, the biofilm cultivation for 12 hrs should be sufficient. Objective: Biliary stenting is a common treatment for the palliation of malignant obstructive jaundice. However, stent occlusion due to sludge adhesion remains an important clinical problem. For more understanding of the mechanism of such occlusion, the present work dealt with studying the bacteriological characteristics of bile samples. Methods: Taken from 40 patients with extra hepatic cholestasis before biliary decompression(group1). Also,bile samples and sludge material from13 patients presenting with recurrent jaundice due to late stent blockage (group2), were processed for microbiological and transmission electron microscopic study (TEM). Bacteriological analysis included isolation and identification of various bacterial species as well as detection of Bglucouronidase and several esterase activities (19enzymes)of the isolated species. Results: Bacteriological analysis disclosed a wider prevalence of monomicrobial Gram negative isolated (80.7%) than Gram positive isolates (19.3%) among patients of group1. The TEM examination of sludge material (group2) revealed the presence of clusters of Gram negative bacteria embedded in an amorphous matrix. The visualized microcolonies of bacterial growth were confined to the same morophotype for each case. Bacteriological analysis confirmed the TEM results and showed that the most frequent isolated species were Escherichia coli(E.coli) (41.6%), Samonella arizona (S. arizona) (25%) Klebsiella species (16.6%) and Enterobocter(8.3%) Although S. arizona isolated from blockage stents were the most abundant producers (14 out of 19) and they elaborated 4 out of 5 such enzymes, yet they recorded the longest patency duration among the blocked tudied stents. By TEM it was noticed that the biofilm matrix changed according to the type of bacteria detected. The biofilm matrix in S. arizona cases was shown to be fenestrated. It looked thick and more etectron dense when compared to the matrix of E. coli cases. The latter showed a clealr thin matrix, more electron lucent and detected fibres were mostly thin. Conclusion: The present work confirms the pivotal role of Gram negative bacteria in stent blockage therefore antibiotics against Gram negative bacteria are mandatory 24 hours before endoscopic retrogade cholangiopancreatography (ERCP). Also, the current study highlights the relation between the type of microorganism and the morphology of the formed biofilm matrix which may be an important underlying factor in stent blockage and its duration of patency. Lethal biofilm formation in a biliary stent H. Krogh Johansen, N. Høiby (Copenhagen, DK) Objective: Medical implants are widely used in a variety of clinical treatments, but they frequently become colonised by opportunistic bacteria, which form biofilm on the device surface. We describe this medical problem in a 57-yr old alcoholic man who had a biliary stent inserted because of intra-and extrahepatic bile stasis, probably caused by a cystic process in the pancreatic head that blocked the flow. Methods: A 7 cm long teflon coated polyurethane biliary stent was inserted endoscopically in the common bile duct. Antibiotic prophylaxis or treatment was not used and the patient was discharged in healthy condition after 5 days. Results: Two weeks after insertion of the biliary stent the patient was readmitted with sepsis, severe abdominal pain and increasing liver enzymes. Ultrasound scan revealed intrahepatic bile stasis, a large inflamed abscess in the pancreatic head, a fistula between the abscess and the common bile duct and blockage of the lumen of the stent. The stent was replaced by two 10 cm long stents. The patient was treated with ampicillin, metronidazole and gentamicin for only 3 days. Ampicillin susceptible E. coli were cultured from the blood. After 5 days the patient was discharged in healthy condition. Three weeks after the second stents were inserted the patient was admitted emergently with septic shock and treated with ceftriaxone, netilmicin and metronidazole. After 12 hours of intensive treatment the patient died. E. coli and K. oxytoca were cultured from the blood, pancreas, and the stents. Pulsed-field-gelelectrophoresis was performed and the E. coli cultured during the two septic episodes had the same pattern. This indicates that the bacteria escaped the brief antibiotic treatment probably because of biofilm formation. Conclusions: This case underlines the need for antibiotic prophylaxis when bile stents are inserted into infected areas and continuous antibiotic therapy when patients with a medical implant experience a septic episode. Clinical Microbiology and Infection, Volume 11, Supplement 2, 2005