CORD-19:05fc8f48129cdd80e0edf6734229c17f53a03076 JSONTXT 8 Projects

Supplemental material, tables S1 and S2a-c Adaptive evolution of virus-sensing toll-like receptor 8 in bats . Investigated bat species, sample accession numbers due to the IZW biobank and geographic origin. 1 872 R1c revers TGGAGGGAAGTGCTRGAGAGGTTG 1 1110 F3 forward TTGCAYTTAARRGGTTATGTGTTCCAG 3 1110 F3Rhi forward TTGCACTTAGAAGGTTATGTGTTCCAG 3 1110 F3Vesp forward TTGCATTTAAGAGGTTATGTGTTCCAG 3 1076 F3Vamp forward CCAAAACTTCTCTAATCTTACATCTC 3 1187 R2Rhi revers AAGTTAACACCCAAGTTGATAGTC 2 1187 R2Nyc revers AATAAAGTTAACGCCCAAGTTGATAGT 2 1187 R2Car revers AATGAAGTTCACGCCCAAGTCGATAGT 2 1192 R2 revers AATAAARTTAAYVCCCAAGTTGA 2 1196 R2Noc revers TTTGCTTAATGAAGTTCACGCCCAAG 2 1551 F4Rhi forward CAAGCATTAAATGGAACTGAATTTTCAG 4 1662 F4Noc forward TTTGCTTAATGAAGTTCACGCCCAAG 4 1692 F4 forward CACTATTTCMRAATMGCAGGGGT 4 1818 R3 revers CCACTRAAAACTAATTSTTYCAGGGA 3 1838 R3Rhi revers AATTGATCAAGGCAGTTGCCACT 3 2307 F5 forward AACCCYTTWGAMTGYACCTGTGAC 5 2307 F5Rhi forward AACCCTTTTGACTGTACTTGTGAC 5 2426 R4 revers AGCTCYAGAGTCAYAATRCTCTTC 4 2448 R4aRhi R5short revers CRTCAGTTAGTATTGCTTAATG 5 a nucleotide position according to the nucleotide sequence of Eidolon helvum, starting point is the 3' end of forward primers and the 5'end of revers primers b forward and revers primers were used in different combinations, overspanning different fragmentlengths in different bat species c according to sequencing analyses Table S3a . Nucleotide/amino acid sequence percent identities of the whole TLR8 sequences between investigated bat taxa § and between the equine and human orthologous.

Annnotations TAB TSV DIC JSON TextAE-old TextAE

  • Denotations: 0
  • Blocks: 0
  • Relations: 0