PubMed:821949 JSONTXT

{"project":"sentences","denotations":[{"id":"T1","span":{"begin":0,"end":58},"obj":"Sentence"},{"id":"T2","span":{"begin":59,"end":139},"obj":"Sentence"},{"id":"T3","span":{"begin":140,"end":284},"obj":"Sentence"},{"id":"T4","span":{"begin":285,"end":297},"obj":"Sentence"},{"id":"T5","span":{"begin":298,"end":303},"obj":"Sentence"},{"id":"T6","span":{"begin":304,"end":309},"obj":"Sentence"},{"id":"T7","span":{"begin":310,"end":484},"obj":"Sentence"},{"id":"T8","span":{"begin":485,"end":1408},"obj":"Sentence"},{"id":"T1","span":{"begin":0,"end":58},"obj":"Sentence"},{"id":"T2","span":{"begin":59,"end":139},"obj":"Sentence"},{"id":"T3","span":{"begin":140,"end":284},"obj":"Sentence"},{"id":"T4","span":{"begin":285,"end":297},"obj":"Sentence"},{"id":"T5","span":{"begin":298,"end":303},"obj":"Sentence"},{"id":"T6","span":{"begin":304,"end":309},"obj":"Sentence"},{"id":"T7","span":{"begin":310,"end":484},"obj":"Sentence"},{"id":"T8","span":{"begin":485,"end":1408},"obj":"Sentence"}],"namespaces":[{"prefix":"_base","uri":"http://pubannotation.org/ontology/tao.owl#"}],"text":"Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.\nThe template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides."}

{"project":"NCBITAXON","denotations":[{"id":"T1","span":{"begin":0,"end":16},"obj":"OrganismTaxon"},{"id":"T2","span":{"begin":467,"end":483},"obj":"OrganismTaxon"}],"attributes":[{"id":"A1","pred":"db_id","subj":"T1","obj":"562"},{"id":"A2","pred":"db_id","subj":"T2","obj":"562"}],"text":"Escherichia coli tyrosine transfer ribonucleic acid genes. Nucleotide sequences of their promoters and of the regions adjoining C-C-A ends.\nThe template-dependent primer elongation method for determining DNA sequences of specific regions (e.g. Loewen, P., Sekiaya, T., and Khorana, H. G. (1974) J. Biol. Chem. 249, 217-226) has been applied to the determination of the sequences of the promoters and of the regions beyond the C-C-A ends of the tyrosine tRNA genes in Escherichia coli. The following results have been obtained. (a) The promoter of the tRNA1Tyr (su+) gene in the bacteriophage phi80psu+III (the singlet strain) and phi80psu+-III (the doublet strain) and, significantly, the promoter of the tRNA2Tyr gene in the bacteriophage lambdah80dglyTsu+36 all have the following identical sequence in the first 59 nucleotides: (see article) Transcription begins at the underlined terminal nucleotide and proceeds to the right. (b) tRNA1Tyr (su+) as present in the singlet strain phi80psu+III and the tRNA1Tyr (su-), the second gene in the doublet strain phi80psu+-III, have the following identical sequence beyond the C-C-A sequences: (5') TCACTTCAAAAGTCCTGAACT (3') (c) tRNA1Tyr (su+), the first gene in the doublet strain phi80psu+-III, has the sequence (5') TAATTCACCACAGGG (CA) (3'), and tRNA2Tyr in lambdah80dglyTsu+36 has the sequence (5') ATTTCGGCCACGCGA (TGCGG) (3') beyond the C-C-A nucleotides."}