PMC:8950092 / 13786-14570
Annnotations
{"target":"http://pubannotation.org/docs/sourcedb/PMC/sourceid/8950092","sourcedb":"PMC","sourceid":"8950092","source_url":"https://www.ncbi.nlm.nih.gov/pmc/8950092","text":"For total viral counts for all samples, whole cell qPCR (quantitative Polymerase Chain Reaction) was performed using BCoV specific oligonucleotides and probes [22,23]. The BCoV sample was added to the qPCR SYBR Green reaction mixture (Applied Biosystems, Warrington, UK), and amplified in an automated thermocycler/analyzer (AB StepOne RT-PCR System, AB, Foster City, CA, USA) as described previously [24]. Broadly reactive primer pairs IN-2 (+) 5′ GGGTTGGGACTATCCTAAGTGTGA 3′ and IN-4 (–) 5′ TAACACACAACICCATCATCA 3′ were used to identify the bovine coronavirus (GenBank Access NC_003045). Dilutions of a plasmid containing the BCoV target sequence were used to create a standard calibration curve for each analysis and allow for the calculation of total viral gene copy number [25].","tracks":[]}