> top > docs > PMC:88885 > spans > 15573-16260 > annotations

PMC:88885 / 15573-16260 JSONTXT

Annnotations TAB JSON ListView MergeView

craft-sa-dev

Id Subject Object Predicate Lexical cue
T4015 0-5 NN denotes Mouse
T4016 22-28 NN denotes tissue
T4017 6-12 NN denotes embryo
T4018 13-21 JJ denotes multiple
T4019 21-22 HYPH denotes -
T4020 38-42 NN denotes blot
T4021 29-37 JJ denotes northern
T4022 89-96 NNS denotes filters
T4023 43-46 CC denotes and
T4024 47-52 NN denotes mouse
T4025 68-74 NN denotes tissue
T4026 53-58 JJ denotes adult
T4027 59-67 JJ denotes multiple
T4028 67-68 HYPH denotes -
T4029 84-88 NN denotes blot
T4030 75-83 JJ denotes northern
T4031 102-111 VBN denotes purchased
T4032 97-101 VBD denotes were
T4033 112-116 IN denotes from
T4034 117-125 NNP denotes Clontech
T4035 126-138 NNP denotes Laboratories
T4036 139-140 -LRB- denotes (
T4037 145-149 NNP denotes Alto
T4038 140-144 NNP denotes Palo
T4039 149-151 , denotes ,
T4040 151-153 NNP denotes CA
T4041 153-154 -RRB- denotes )
T4042 154-155 . denotes .
T4043 155-283 sentence denotes The filters were hybridized with the 32P-dATP labeled DNA fragment of Mcoln1 coding region corresponding to exon 2 (see above).
T4044 156-159 DT denotes The
T4045 160-167 NNS denotes filters
T4046 173-183 VBN denotes hybridized
T4047 168-172 VBD denotes were
T4048 184-188 IN denotes with
T4049 189-192 DT denotes the
T4050 214-222 NN denotes fragment
T4051 193-196 NN denotes 32P
T4052 197-201 NN denotes dATP
T4053 196-197 HYPH denotes -
T4054 202-209 JJ denotes labeled
T4055 210-213 NN denotes DNA
T4056 223-225 IN denotes of
T4057 226-232 NN denotes Mcoln1
T4058 240-246 NN denotes region
T4059 233-239 NN denotes coding
T4060 247-260 VBG denotes corresponding
T4061 261-263 IN denotes to
T4062 264-268 NN denotes exon
T4063 269-270 CD denotes 2
T4064 271-272 -LRB- denotes (
T4065 272-275 VB denotes see
T4066 276-281 RB denotes above
T4067 281-282 -RRB- denotes )
T4068 282-283 . denotes .
T4069 283-503 sentence denotes For the alternative transcript, a probe was generated in the region between exons 12 and 13 with primers 5'-GTGTCCACCACCTGAGAG-3' (forward) and 5'-GAAGTAGCATTCCTGCAGGC-3' (reverse) with an annealing temperature of 62°C.
T4070 284-287 IN denotes For
T4071 328-337 VBN denotes generated
T4072 288-291 DT denotes the
T4073 304-314 NN denotes transcript
T4074 292-303 JJ denotes alternative
T4075 314-316 , denotes ,
T4076 316-317 DT denotes a
T4077 318-323 NN denotes probe
T4078 324-327 VBD denotes was
T4079 338-340 IN denotes in
T4080 341-344 DT denotes the
T4081 345-351 NN denotes region
T4082 352-359 IN denotes between
T4083 360-365 NNS denotes exons
T4084 366-368 CD denotes 12
T4085 369-372 CC denotes and
T4086 373-375 CD denotes 13
T4087 376-380 IN denotes with
T4088 381-388 NNS denotes primers
T4089 411-412 NN denotes 3
T4090 389-390 NN denotes 5
T4091 390-391 SYM denotes '
T4092 391-392 HYPH denotes -
T4093 392-410 NN denotes GTGTCCACCACCTGAGAG
T4094 410-411 HYPH denotes -
T4095 412-413 SYM denotes '
T4096 414-415 -LRB- denotes (
T4097 415-422 RB denotes forward
T4098 422-423 -RRB- denotes )
T4099 424-427 CC denotes and
T4100 428-429 NN denotes 5
T4101 452-453 NN denotes 3
T4102 429-430 SYM denotes '
T4103 430-431 HYPH denotes -
T4104 431-451 NN denotes GAAGTAGCATTCCTGCAGGC
T4105 451-452 HYPH denotes -
T4106 453-454 SYM denotes '
T4107 455-456 -LRB- denotes (
T4108 456-463 RB denotes reverse
T4109 463-464 -RRB- denotes )
T4110 465-469 IN denotes with
T4111 470-472 DT denotes an
T4112 483-494 NN denotes temperature
T4113 473-482 JJ denotes annealing
T4114 495-497 IN denotes of
T4115 498-500 CD denotes 62
T4116 500-502 NNS denotes °C
T4117 502-503 . denotes .
T4118 503-557 sentence denotes The filters were then hybridized with β-actin probes.
T4119 504-507 DT denotes The
T4120 508-515 NNS denotes filters
T4121 526-536 VBN denotes hybridized
T4122 516-520 VBD denotes were
T4123 521-525 RB denotes then
T4124 537-541 IN denotes with
T4125 542-543 NN denotes β
T4126 544-549 NN denotes actin
T4127 543-544 HYPH denotes -
T4128 550-556 NNS denotes probes
T4129 556-557 . denotes .
T4130 557-687 sentence denotes Hybridizations and washes were carried out in standard conditions, with the stripping of previously bound probes in between [16].
T4131 558-572 NNS denotes Hybridizations
T4132 589-596 VBN denotes carried
T4133 573-576 CC denotes and
T4134 577-583 NNS denotes washes
T4135 584-588 VBD denotes were
T4136 597-600 RP denotes out
T4137 601-603 IN denotes in
T4138 604-612 JJ denotes standard
T4139 613-623 NNS denotes conditions
T4140 623-625 , denotes ,
T4141 625-629 IN denotes with
T4142 630-633 DT denotes the
T4143 634-643 NN denotes stripping
T4144 644-646 IN denotes of
T4145 647-657 RB denotes previously
T4146 658-663 VBN denotes bound
T4147 664-670 NNS denotes probes
T4148 671-673 RB denotes in
T4149 674-681 RB denotes between
T4150 682-683 -LRB- denotes [
T4151 683-685 CD denotes 16
T4152 685-686 -RRB- denotes ]
T4153 686-687 . denotes .
R2481 T4015 T4016 nmod Mouse,tissue
R2482 T4016 T4020 nmod tissue,blot
R2483 T4017 T4016 nmod embryo,tissue
R2484 T4018 T4016 amod multiple,tissue
R2485 T4019 T4016 punct -,tissue
R2486 T4020 T4022 nmod blot,filters
R2487 T4021 T4020 amod northern,blot
R2488 T4022 T4031 nsubjpass filters,purchased
R2489 T4023 T4020 cc and,blot
R2490 T4024 T4025 nmod mouse,tissue
R2491 T4025 T4029 nmod tissue,blot
R2492 T4026 T4025 amod adult,tissue
R2493 T4027 T4025 amod multiple,tissue
R2494 T4028 T4025 punct -,tissue
R2495 T4029 T4020 conj blot,blot
R2496 T4030 T4029 amod northern,blot
R2497 T4032 T4031 auxpass were,purchased
R2498 T4033 T4031 prep from,purchased
R2499 T4034 T4035 compound Clontech,Laboratories
R2500 T4035 T4033 pobj Laboratories,from
R2501 T4036 T4037 punct (,Alto
R2502 T4037 T4035 parataxis Alto,Laboratories
R2503 T4038 T4037 compound Palo,Alto
R2504 T4039 T4037 punct ", ",Alto
R2505 T4040 T4037 npadvmod CA,Alto
R2506 T4041 T4037 punct ),Alto
R2507 T4042 T4031 punct .,purchased
R2508 T4044 T4045 det The,filters
R2509 T4045 T4046 nsubjpass filters,hybridized
R2510 T4047 T4046 auxpass were,hybridized
R2511 T4048 T4046 prep with,hybridized
R2512 T4049 T4050 det the,fragment
R2513 T4050 T4048 pobj fragment,with
R2514 T4051 T4052 compound 32P,dATP
R2515 T4052 T4054 npadvmod dATP,labeled
R2516 T4053 T4052 punct -,dATP
R2517 T4054 T4050 amod labeled,fragment
R2518 T4055 T4050 compound DNA,fragment
R2519 T4056 T4050 prep of,fragment
R2520 T4057 T4058 compound Mcoln1,region
R2521 T4058 T4056 pobj region,of
R2522 T4059 T4058 compound coding,region
R2523 T4060 T4058 acl corresponding,region
R2524 T4061 T4060 prep to,corresponding
R2525 T4062 T4061 pobj exon,to
R2526 T4063 T4062 nummod 2,exon
R2527 T4064 T4065 punct (,see
R2528 T4065 T4046 parataxis see,hybridized
R2529 T4066 T4065 advmod above,see
R2530 T4067 T4065 punct ),see
R2531 T4068 T4046 punct .,hybridized
R2532 T4070 T4071 prep For,generated
R2533 T4072 T4073 det the,transcript
R2534 T4073 T4070 pobj transcript,For
R2535 T4074 T4073 amod alternative,transcript
R2536 T4075 T4071 punct ", ",generated
R2537 T4076 T4077 det a,probe
R2538 T4077 T4071 nsubjpass probe,generated
R2539 T4078 T4071 auxpass was,generated
R2540 T4079 T4071 prep in,generated
R2541 T4080 T4081 det the,region
R2542 T4081 T4079 pobj region,in
R2543 T4082 T4081 prep between,region
R2544 T4083 T4084 nmod exons,12
R2545 T4084 T4082 pobj 12,between
R2546 T4085 T4084 cc and,12
R2547 T4086 T4084 conj 13,12
R2548 T4087 T4071 prep with,generated
R2549 T4088 T4089 nmod primers,3
R2550 T4089 T4087 pobj 3,with
R2551 T4090 T4089 nmod 5,3
R2552 T4091 T4090 punct ',5
R2553 T4092 T4089 punct -,3
R2554 T4093 T4089 compound GTGTCCACCACCTGAGAG,3
R2555 T4094 T4089 punct -,3
R2556 T4095 T4089 punct ',3
R2557 T4096 T4097 punct (,forward
R2558 T4097 T4089 parataxis forward,3
R2559 T4098 T4097 punct ),forward
R2560 T4099 T4089 cc and,3
R2561 T4100 T4101 nmod 5,3
R2562 T4101 T4089 conj 3,3
R2563 T4102 T4100 punct ',5
R2564 T4103 T4101 punct -,3
R2565 T4104 T4101 compound GAAGTAGCATTCCTGCAGGC,3
R2566 T4105 T4101 punct -,3
R2567 T4106 T4101 punct ',3
R2568 T4107 T4108 punct (,reverse
R2569 T4108 T4101 parataxis reverse,3
R2570 T4109 T4108 punct ),reverse
R2571 T4110 T4071 prep with,generated
R2572 T4111 T4112 det an,temperature
R2573 T4112 T4110 pobj temperature,with
R2574 T4113 T4112 amod annealing,temperature
R2575 T4114 T4112 prep of,temperature
R2576 T4115 T4116 nummod 62,°C
R2577 T4116 T4114 pobj °C,of
R2578 T4117 T4071 punct .,generated
R2579 T4119 T4120 det The,filters
R2580 T4120 T4121 nsubjpass filters,hybridized
R2581 T4122 T4121 auxpass were,hybridized
R2582 T4123 T4121 advmod then,hybridized
R2583 T4124 T4121 prep with,hybridized
R2584 T4125 T4126 compound β,actin
R2585 T4126 T4128 compound actin,probes
R2586 T4127 T4126 punct -,actin
R2587 T4128 T4124 pobj probes,with
R2588 T4129 T4121 punct .,hybridized
R2589 T4131 T4132 nsubjpass Hybridizations,carried
R2590 T4133 T4131 cc and,Hybridizations
R2591 T4134 T4131 conj washes,Hybridizations
R2592 T4135 T4132 auxpass were,carried
R2593 T4136 T4132 prt out,carried
R2594 T4137 T4132 prep in,carried
R2595 T4138 T4139 amod standard,conditions
R2596 T4139 T4137 pobj conditions,in
R2597 T4140 T4132 punct ", ",carried
R2598 T4141 T4132 prep with,carried
R2599 T4142 T4143 det the,stripping
R2600 T4143 T4141 pobj stripping,with
R2601 T4144 T4143 prep of,stripping
R2602 T4145 T4146 advmod previously,bound
R2603 T4146 T4147 amod bound,probes
R2604 T4147 T4144 pobj probes,of
R2605 T4148 T4149 advmod in,between
R2606 T4149 T4143 advmod between,stripping
R2607 T4150 T4151 punct [,16
R2608 T4151 T4132 parataxis 16,carried
R2609 T4152 T4151 punct ],16
R2610 T4153 T4132 punct .,carried

craft-ca-core-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T3990 0-5 NCBITaxon:10088 denotes Mouse
T3991 6-12 UBERON:0000922 denotes embryo
T3992 22-28 UBERON:0000479 denotes tissue
T3993 47-52 NCBITaxon:10088 denotes mouse
T3994 53-58 UBERON:0007023 denotes adult
T3995 68-74 UBERON:0000479 denotes tissue
T3996 173-183 GO:0097617 denotes hybridized
T3997 193-196 CHEBI:37972 denotes 32P
T3998 214-225 _FRAGMENT denotes fragment of
T3999 233-246 SO:0001384 denotes coding region
T4000 226-232 PR:000010252 denotes Mcoln1
T4001 264-268 SO:0000147 denotes exon
T4002 304-314 SO:1001187 denotes transcript
T4003 360-365 SO:0000147 denotes exons
T4004 381-388 SO:0000112 denotes primers
T4005 415-422 SO:0001030 denotes forward
T4006 456-463 SO:0001031 denotes reverse
T4007 473-482 GO:0097617 denotes annealing
T4008 526-536 GO:0097617 denotes hybridized
T4009 542-549 PR:000003676 denotes β-actin
T4010 558-572 GO:0097617 denotes Hybridizations
R2478 T3999 T3998 _lexicallyChainedTo coding region,fragment of

craft-ca-core-ex-dev

Below, discontinuous spans are shown in the chain model. You can change it to the bag model.

Id Subject Object Predicate Lexical cue
T4154 0-5 NCBITaxon:10088 denotes Mouse
T4155 6-12 UBERON:0000922 denotes embryo
T4156 22-28 UBERON:0000479 denotes tissue
T4157 47-52 NCBITaxon:10088 denotes mouse
T4158 53-58 UBERON:0007023 denotes adult
T4159 68-74 UBERON:0000479 denotes tissue
T4160 173-183 GO:0097617 denotes hybridized
T4161 193-196 CHEBI:37972 denotes 32P
T4162 197-201 CHEBI_EXT:dATP denotes dATP
T4163 202-209 CHEBI_SO_EXT:molecular_label_or_mark_or_tag_process denotes labeled
T4164 210-213 CHEBI_SO_EXT:DNA denotes DNA
T4165 214-225 _FRAGMENT denotes fragment of
T4166 233-246 SO_EXT:0001384 denotes coding region
T4167 226-232 PR_EXT:000010252 denotes Mcoln1
T4168 264-268 SO_EXT:0000147 denotes exon
T4169 304-314 SO_EXT:1001187 denotes transcript
T4170 318-323 CHEBI_SO_EXT:molecular_probe denotes probe
T4171 360-365 SO_EXT:0000147 denotes exons
T4172 381-388 SO_EXT:0000112 denotes primers
T4173 415-422 SO:0001030 denotes forward
T4174 456-463 SO:0001031 denotes reverse
T4175 473-482 GO:0097617 denotes annealing
T4176 526-536 GO:0097617 denotes hybridized
T4177 542-549 PR_EXT:000003676 denotes β-actin
T4178 550-556 CHEBI_SO_EXT:molecular_probe denotes probes
T4179 558-572 GO:0097617 denotes Hybridizations
T4180 658-663 CHEMINF_GO_EXT:chemical_binding_or_bond_formation denotes bound
T4181 664-670 CHEBI_SO_EXT:molecular_probe denotes probes
R2611 T4166 T4165 _lexicallyChainedTo coding region,fragment of