Id |
Subject |
Object |
Predicate |
Lexical cue |
T131 |
0-2 |
Sentence |
denotes |
4. |
T132 |
3-24 |
Sentence |
denotes |
Materials and Methods |
T133 |
26-30 |
Sentence |
denotes |
4.1. |
T134 |
31-69 |
Sentence |
denotes |
Construction of the Expression Plasmid |
T135 |
70-357 |
Sentence |
denotes |
A bicistronic operon for the simultaneous expression of human Tα1 (UniProt P06454, residues 2–29) and the E. coli N-acetyltransferase RimJ (UniProt P0A948) flanked by the restriction sites NdeI and HindIII was prepared using gene synthesis (Thermofisher Scientific, Regensburg, Germany). |
T136 |
358-698 |
Sentence |
denotes |
To this end, the coding sequence of human Tα1 was codon-optimized for expression in E. coli and linked to the RimJ structural gene via the nucleotide sequence GCCTGAAGAGCAGAAAATAAA comprising a “GCC” alanine codon, the opal stop codon “TGA”, a SapI restriction site for insertion of the PAS gene cassette, and a ribosome-binding site (RBS). |
T137 |
699-878 |
Sentence |
denotes |
The entire gene fragment was subcloned via NdeI and HindIII on a derivative of pASK75 [36] for cytoplasmic expression under control of the tetracycline promoter/operator (tetp/o). |
T138 |
879-1169 |
Sentence |
denotes |
Subsequently, a substantially non-repetitive sequence-verified PAS gene cassette [34] encoding a PAS#1 polypeptide of 601 amino acids was inserted via the SapI restriction site to create the expression vector for the C-terminally PASylated thymosin α1 (Tα1-PAS), pASK75-Tα1-PAS#1(600)/RimJ. |
T139 |
1170-1432 |
Sentence |
denotes |
To construct a plasmid for the bacterial production of an N-terminally PASylated Tα1 (PAS-Tα1), the synthetic gene of human Tα1 was amplified via PCR using the primers THY-For (5’-AGCTCTTCTGCCAGTGATGCAGCAGTTGATACC) and THY-Rev (5’-GCTCAAGCTTAGTTCTCGGCTTCTTCCAC). |
T140 |
1433-1635 |
Sentence |
denotes |
The PCR product was digested with SapI and HindIII and inserted via these restriction sites downstream of the PAS#1(600) sequence preceded by Met and Pro encoded on a suitable pASK75 plasmid derivative. |
T141 |
1637-1641 |
Sentence |
denotes |
4.2. |
T142 |
1642-1691 |
Sentence |
denotes |
Bacterial Production of Recombinant PASylated Tα1 |
T143 |
1692-1889 |
Sentence |
denotes |
The BL21 derivative E. coli strain NEBexpress® (New England Biolabs, Frankfurt am Main, Germany) was transformed with the plasmids pASK75-Tα1-PAS#1(600)/RimJ or pASK75-MP-PAS#1(600)-Tα1 from above. |
T144 |
1890-2045 |
Sentence |
denotes |
Two milliliters of Terrific Broth supplemented with 100 µg/mL ampicillin (TBamp) was inoculated with a single colony and grown overnight at 37 °C, 170 rpm. |
T145 |
2046-2183 |
Sentence |
denotes |
This overnight culture was used to inoculate a 50 mL preculture, which was grown under the same conditions until OD550 = 1.1 was reached. |
T146 |
2184-2308 |
Sentence |
denotes |
Subsequently, the 50 mL preculture was transferred into 2 L TBamp and incubated in a 5 L baffled flask at 37 °C and 100 rpm. |
T147 |
2309-2457 |
Sentence |
denotes |
After reaching OD550 = 0.6, the temperature was decreased to 26 °C and the cells were subsequently induced at OD550 = 1 with 200 µg/mL aTc for 15 h. |
T148 |
2459-2463 |
Sentence |
denotes |
4.3. |
T149 |
2464-2493 |
Sentence |
denotes |
Purification of PASylated Tα1 |
T150 |
2494-2657 |
Sentence |
denotes |
Bacteria were harvested by centrifugation and disrupted in the presence of 100 mM citric acid using an EmulsiFlex C5 cell homogenizer (Avestin, Mannheim, Germany). |
T151 |
2658-2813 |
Sentence |
denotes |
After centrifugation for 20 min (39,200× g) at 16 °C, the supernatant was filter-sterilized using a 0.45 µm syringe filter (Sartorius, Göttingen, Germany). |
T152 |
2814-2958 |
Sentence |
denotes |
The clear filtrate was adjusted with ammonium sulfate to 30% saturation, stirred for 30 min at RT, and centrifuged for 30 min (39,200× g) at RT. |
T153 |
2959-3147 |
Sentence |
denotes |
The precipitate was solubilized in subtractive AEX buffer (sAEX; 20 mM Tris/HCl, 1 mM EDTA, pH 8.5), filter-sterilized, and dialyzed twice against a 100-fold volume of sAEX buffer at 4 °C. |
T154 |
3148-3297 |
Sentence |
denotes |
Subsequent chromatography steps were performed on an ÄKTA Explorer 100 system (GE Healthcare, Freiburg, Germany) operated at a flow rate of 5 mL/min. |
T155 |
3298-3466 |
Sentence |
denotes |
The dialyzed sample (Tα1-PAS or PAS-Tα1) was first applied to a 5 mL TOYOPEARL NH2-750F column (Tosoh Bioscience, Griesheim, Germany) equilibrated with the sAEX buffer. |
T156 |
3467-3625 |
Sentence |
denotes |
The flow-through containing the PASylated Tα1 was collected and dialyzed twice against a 100-fold volume of the CEX buffer (20 mM Na-citrate, pH 3.0) at 4 °C. |
T157 |
3626-3758 |
Sentence |
denotes |
The protein solution was then applied to an 85 mL TOYOPEARL Sulfate-650F column (Tosoh Bioscience) equilibrated with the CEX buffer. |
T158 |
3759-3903 |
Sentence |
denotes |
PAS-Tα1 quantitatively bound to the column and the pure protein was eluted using a NaCl concentration gradient (0–250 mM over 2 column volumes). |
T159 |
3904-4126 |
Sentence |
denotes |
In the case of Tα1-PAS, the CEX flow-through fraction contained the N-terminally acetylated protein, whereas the non-acetylated Tα1-PAS stayed bound to the column and could again be eluted in a NaCl concentration gradient. |
T160 |
4127-4398 |
Sentence |
denotes |
The acetylated Tα1-PAS fraction from the flow-through was dialyzed twice against AEX buffer (20 mM ethanolamine/HCl, pH 10) and then applied to a 100 mL Fractogel® EMD TMAE (M)strong anion exchanger (Merck Millipore, Burlington, MA, USA) equilibrated with the AEX buffer. |
T161 |
4399-4539 |
Sentence |
denotes |
This time, highly pure acetylated Tα1-PAS was eluted using a NaCl concentration gradient (0–200 mM over 2 column volumes) in the AEX buffer. |
T162 |
4540-4683 |
Sentence |
denotes |
Both purified PASylated peptides were dialyzed 5 times against a 200-fold volume of water, lyophilized, and stored at −20 °C until further use. |
T163 |
4685-4689 |
Sentence |
denotes |
4.4. |
T164 |
4690-4730 |
Sentence |
denotes |
Analytical Size Exclusion Chromatography |
T165 |
4731-4918 |
Sentence |
denotes |
Analytical SEC was performed on a 24 mL Superose® 6 10/300 GL column (GE Healthcare) using an ÄKTA Explorer 10 system operated at a flow rate of 0.5 mL/min with PBS as the running buffer. |
T166 |
4919-5373 |
Sentence |
denotes |
To determine the apparent molecular size, purified PAS-Tα1 or PAS-Tα1 (100 µL) was applied to the column and the elution volume was used for linear interpolation from a half-logarithmic calibration line obtained using the reference proteins thyroglobulin (octamer), thyroglobulin (tetramer), apoferritin, β-amylase, alcohol dehydrogenase (tetramer), transferrin, ovalbumin, and carboanhydrase as well as blue dextran (all from Merck, Darmstadt, Germany). |
T167 |
5375-5379 |
Sentence |
denotes |
4.5. |
T168 |
5380-5404 |
Sentence |
denotes |
Endotoxin Quantification |
T169 |
5405-5748 |
Sentence |
denotes |
Tα1-PAS samples were diluted to 1 mg/mL in endotoxin-free water (Veolia Water Technologies, Celle, Germany), heated to 90 °C for 5 min, and, after cooling down to RT, bacterial endotoxins were quantified using an Endosafe® system (Charles River Laboratories, Wilmington, MA, USA) with an FDA-licensed PTS™ cartridge (10–0.1 EU/mL sensitivity). |
T170 |
5750-5754 |
Sentence |
denotes |
4.6. |
T171 |
5755-5776 |
Sentence |
denotes |
Western Blot Analysis |
T172 |
5777-6087 |
Sentence |
denotes |
The whole cell protein extract was applied to a 4–12% SurePAGE™ Bis–Tris gradient gel (Genscript, Piscataway, NJ, USA) with 3-(N-morpholino)propanesulfonic acid (MOPS) as running buffer and electrotransferred onto a nitrocellulose membrane using an iBlot 1 dry blotting system (ThermoFisher, Waltham, MA, USA). |
T173 |
6088-6245 |
Sentence |
denotes |
After washing 3 times with PBS supplemented with 0.1% v/v Tween 20 (PBS/T), the membrane was incubated with 1 µg/mL anti-PAS antibody in PBS/T for 1 h at RT. |
T174 |
6246-6417 |
Sentence |
denotes |
The membrane was washed 3 times with PBS/T and incubated with a 1:5000 dilution of a goat anti-mouse IgG (Fc-specific) alkaline phosphatase (AP) conjugate (Merck) for 1 h. |
T175 |
6418-6644 |
Sentence |
denotes |
After washing twice with PBS/T and twice with PBS, the blot was developed by a chromogenic reaction using BCIP (37.5 µg/mL) and NBT (150 µg/mL) in alkaline phosphatase buffer (100 mM Tris/HCl, pH 8.8, 100 mM NaCl, 5 mM MgCl2). |
T176 |
6646-6650 |
Sentence |
denotes |
4.7. |
T177 |
6651-6711 |
Sentence |
denotes |
Reverse-Phase Chromatography (RPC) and ESI Mass Spectrometry |
T178 |
6712-6965 |
Sentence |
denotes |
Directly after the CEX chromatography, a 200 µl sample of PAS-Tα1 or PAS-Tα1 was adjusted to 2% v/v acetonitrile, 0.1% v/v formic acid and applied to a Resource RPC 1 mL column (GE Healthcare) equilibrated with 2% v/v acetonitrile, 0.1% v/v formic acid. |
T179 |
6966-7188 |
Sentence |
denotes |
The protein was eluted using a concentration gradient of up to 80% v/v acetonitrile, 0.1% v/v formic acid over 20 column volumes at a flow rate of 2 mL/min while spectrophotometrically monitoring protein elution at 225 nm. |
T180 |
7189-7367 |
Sentence |
denotes |
The eluted protein fraction was directly injected into a maXis quadrupole time of flight (Q-TOF) instrument (Bruker Daltonics, Bremen, Germany) operated in the positive ion mode. |
T181 |
7368-7441 |
Sentence |
denotes |
Raw data was deconvoluted using the MaxEntX algorithm (Bruker Daltonics). |
T182 |
7443-7447 |
Sentence |
denotes |
4.8. |
T183 |
7448-7480 |
Sentence |
denotes |
Pharmacokinetic Analysis in Rats |
T184 |
7481-7620 |
Sentence |
denotes |
A PK study in female Wistar rats at 8–9 weeks of age was conducted at the Aurigon Toxicological Research Center (ATRC, Dunakeszi, Hungary). |
T185 |
7621-7762 |
Sentence |
denotes |
Up to 3 animals per cage were housed in a controlled environment at 22 ± 3 °C with a relative humidity of 50 ± 20%, 12 h light and 12 h dark. |
T186 |
7763-7887 |
Sentence |
denotes |
Endotoxin-free purified Tα1-PAS (3.4 mg/kg) was administered subcutaneously via a single injection into the rat dorsal area. |
T187 |
7888-7965 |
Sentence |
denotes |
Blood samples (100 µL) were taken from 5 animals each at various time points. |
T188 |
7966-8225 |
Sentence |
denotes |
Following collection in tubes containing tri-potassium ethylenediaminetetraacetic acid (K3-EDTA) (Greiner Bio-One, Frickenhausen, Germany), samples were centrifuged at room temperature for 10 min (3000× g) and the resulting plasma was stored at −15 to −30 °C. |
T189 |
8226-8473 |
Sentence |
denotes |
Tα1-PAS in these samples was quantified using sandwich ELISA (see below) and the data were analyzed using the Phoenix WinNonlin 6.3 software (Certara, Princeton, NJ, USA) using a one-compartment model assuming 1st order absorption and elimination. |
T190 |
8475-8479 |
Sentence |
denotes |
4.9. |
T191 |
8480-8514 |
Sentence |
denotes |
Quantification of Purified Tα1-PAS |
T192 |
8515-8605 |
Sentence |
denotes |
Due to the absence of aromatic side chains, PASylated Tα1 does not absorb light at 280 nm. |
T193 |
8606-8728 |
Sentence |
denotes |
Thus, for reliable quantification via the peptide backbone absorption, an extinction coefficient at 225 nm was determined. |
T194 |
8729-8842 |
Sentence |
denotes |
To this end, highly pure Tα1-PAS was lyophilized from water, weighed, and dissolved in a defined volume of water. |
T195 |
8843-9077 |
Sentence |
denotes |
The concentration of this Tα1-PAS solution was additionally quantified by measuring the backbone peptide groups using UV absorption at 205 nm using a generic calculated extinction coefficient [75], which led to a fair agreement (±6%). |
T196 |
9078-9231 |
Sentence |
denotes |
The absorbance at 225 nm was measured for various dilutions of the gravimetrically prepared peptide stock solution and plotted against the concentration. |
T197 |
9232-9339 |
Sentence |
denotes |
The linear range was fitted by a straight line, resulting in an extinction coefficient of 253,057 M−1⋅cm−1. |
T198 |
9340-9444 |
Sentence |
denotes |
While most buffers strongly absorb light at 205 nm, such a spectral overlap is usually absent at 225 nm. |
T199 |
9446-9451 |
Sentence |
denotes |
4.10. |
T200 |
9452-9489 |
Sentence |
denotes |
ELISA Quantification of PASylated Tα1 |
T201 |
9490-9610 |
Sentence |
denotes |
A 96-well Nunc Maxisorb ELISA plate (ThermoFisher) was coated with 100 µg/mL anti-PAS antibody in PBS at 4 °C overnight. |
T202 |
9611-9751 |
Sentence |
denotes |
After washing twice with PBS/T, free binding sites were blocked with 3% w/v bovine serum albumin (BSA) in PBS/T at room temperature for 1 h. |
T203 |
9752-9974 |
Sentence |
denotes |
After washing 3 times with PBS/T, the rat plasma samples were applied in dilution series in PBS/T supplemented with 0.5% (v/v) plasma from an untreated animal (to maintain a constant proportion of rat plasma constituents). |
T204 |
9975-10123 |
Sentence |
denotes |
In the same manner, a standard curve was prepared using dilution series of purified Tα1-PAS (used for spiking rat plasma) at defined concentrations. |
T205 |
10124-10193 |
Sentence |
denotes |
After incubation for 1 h at RT, wells were washed 3 times with PBS/T. |
T206 |
10194-10456 |
Sentence |
denotes |
To detect bound Tα1-PAS, wells were incubated for 1 h with 50 µl of a 1 µg/mL PBS/T solution of the second anti-PAS antibody conjugated with alkaline phosphatase using the Lightning-Link alkaline phosphatase antibody labeling kit (BioTechne, Wiesbaden, Germany). |
T207 |
10457-10586 |
Sentence |
denotes |
After washing twice with PBS/T and twice with PBS, the enzymatic activity was detected using p-nitrophenyl phosphate (0.5 mg/mL). |
T208 |
10587-10877 |
Sentence |
denotes |
To this end, the plate was incubated for 20 min at 30 °C, the absorbance was measured at 405 nm using a SpectraMax M5e microtiter plate reader (Molecular Devices, Sunnyvale, CA, USA) and the Tα1-PAS concentrations in rat plasma samples were quantified by comparison with the standard curve. |