|
article-title
|
Non-Coding RNAs in Psychiatric Disorders and Suicidal Behavior
|
|
abstract
|
It is well known that only a small proportion of the human genome code for proteins; the rest belong to the family of RNAs that do not code for protein and are known as non-coding RNAs (ncRNAs). ncRNAs are further divided into two subclasses based on size: 1) long non-coding RNAs (lncRNAs; >200 nucleotides) and 2) small RNAs (<200 nucleotides). Small RNAs contain various family members that include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). The roles of ncRNAs, especially lncRNAs and miRNAs, are well documented in brain development, homeostasis, stress responses, and neural plasticity. It has also been reported that ncRNAs can influence the development of psychiatric disorders including schizophrenia, major depressive disorder, and bipolar disorder. More recently, their roles are being investigated in suicidal behavior. In this article, we have comprehensively reviewed the findings of lncRNA and miRNA expression changes and their functions in various psychiatric disorders including suicidal behavior. We primarily focused on studies that have been done in postmortem human brain. In addition, we have briefly reviewed the role of other small RNAs (e.g. piwiRNA, siRNA, snRNA, and snoRNAs) and their expression changes in psychiatric illnesses.
|
|
p
|
It is well known that only a small proportion of the human genome code for proteins; the rest belong to the family of RNAs that do not code for protein and are known as non-coding RNAs (ncRNAs). ncRNAs are further divided into two subclasses based on size: 1) long non-coding RNAs (lncRNAs; >200 nucleotides) and 2) small RNAs (<200 nucleotides). Small RNAs contain various family members that include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). The roles of ncRNAs, especially lncRNAs and miRNAs, are well documented in brain development, homeostasis, stress responses, and neural plasticity. It has also been reported that ncRNAs can influence the development of psychiatric disorders including schizophrenia, major depressive disorder, and bipolar disorder. More recently, their roles are being investigated in suicidal behavior. In this article, we have comprehensively reviewed the findings of lncRNA and miRNA expression changes and their functions in various psychiatric disorders including suicidal behavior. We primarily focused on studies that have been done in postmortem human brain. In addition, we have briefly reviewed the role of other small RNAs (e.g. piwiRNA, siRNA, snRNA, and snoRNAs) and their expression changes in psychiatric illnesses.
|
|
body
|
Introduction
Non-coding RNAs (ncRNAs) are defined as RNAs that are not translated into protein. Protein-coding genes occupy only a small proportion (<3%) of the entire genome (1). However, the remaining non-protein coding genes are not a simple transcriptional noise (1, 2); instead, ~80% of them are transcriptionally active with elaborate regulatory roles. A majority of them are now considered non-coding RNA genes (3–6). Based on the size of the nucleotides, ncRNAs are divided into small ncRNAs and long ncRNAs (lncRNAs). ncRNAs that contain <200 nucleotides (nt) belong to small ncRNA family. On the other hand, those containing more >200 nt belong to long lncRNA family. Small RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). ncRNAs function via interactions with RNA, DNA, and protein. They regulate the transcription of mRNAs and participate in alternative splicing and epigenetic modifications such as chromatin and RNA editing (7, 8). These regulatory functions can target either neighboring transcripts (cis) or loci that are distant from their own transcription (trans). Collectively, ncRNAs constitute a unique layer of gene regulation where they function as key intermediate regulators in conveying the message from genotype to phenotype states (9).
A large number of ncRNAs are abundantly expressed in the brain (10–12). In addition, the expressions of ncRNAs are brain region- and cell type-specific (13–16). Several studies have shown the role of ncRNAs in brain evolution, development, homeostasis, stress response, and neuroplasticity (14, 17–25). Brain expressed ncRNAs can also influence the development of psychiatric disorders such as schizophrenia (SCZ), major depressive disorder (MDD), and bipolar disorder (BD) as well as neurodegenerative disorders (11, 19, 23, 26, 27). More recently, their role in suicidal behavior has been postulated (28–30). The effects of ncRNA expression changes are not restricted to the type of psychiatric disorders but, to a large extent, to different brain regions. Recent evidence suggests the inability of brain regions to act independently. Instead, they act in a coordinated manner via functional networks. In various neuropsychiatric disorders, voxel based neuroimaging has demonstrated specific roles of brain regions such as cortex (prefrontal, anterior cingulate), hippocampus, and amygdala (31). Although each of these brain regions has important roles, such as amygdala and prefrontal cortex in emotion (32) and prefrontal cortex and hippocampus in stress response (33), these brain regions crosstalk to each other via complex gene networks which could be mediated vis ncRNAs.
Earlier published reviews have primarily focused on miRNAs in psychiatric illnesses (34–36). This review comprehensively summarizes the relationship between various ncRNAs. Although the emphasis is given to lncRNAs and miRNAs, a range of other ncRNAs are also included to provide a glimpse into where the field stands and what should be the course of direction for future research. The review is restricted to studies in human postmortem brain, given that the role of peripheral ncRNAs is not very well established. We have discussed a few peripheral blood cell studies which are relevant to suicidal behavior. The criteria for selecting literature search are as follows: Electronic search was done using PubMed with search terms ncRNAs (microRNA, small interfering RNA, piwi-interacting RNA, small nucleolar RNA, and small nuclear RNA) AND psychiatric disorders (schizophrenia, major depressive disorder, and bipolar disorder). Each combination was performed separately. Additionally, postmortem research for non-suicide studies, and both postmortem brain and peripheral tissue research for suicide studies, were included in the search criteria.
Long Non-Coding RNAs
Long Non-Coding RNAs in Brain Functions
Long non-coding RNAs (lncRNAs) are defined as RNAs having >200 nucleotides with low (in the form of short peptide) or no protein coding potential (37). LncRNAs are transcribed by RNA Polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs (38). LncRNAs’ lengths span ~100 kilo base-pairs (bp) and are shorter than mRNAs but have longer exons (39–41). They were originally considered to be the products of heterochronic genes (4) that control the temporal dimension of development; however, there are limitations to fully understand the function of lncRNAs from this point of view. Interestingly, the genomic structure of lncRNAs is strongly related to their function (42). In the early nineties, the X-inactive specific transcripts (Xist) and H19 were first discovered as non-protein coding RNAs by exploring cDNA libraries (43, 44). Since then, over 100,000 lncRNA genes have been found and their number is still increasing (45). Recently, several lncRNA functions have been revealed. For example, they participate in chromatin modifications (46, 47); act as ‘sponges’ that prevent miRNA functions (48); act as scaffolds that provide docking sites for proteins (49); serve as activators and suppressors of mRNA transcription (50); and act as regulators of splicing patterns (50). The functions of lncRNAs are depicted in Figure 1 .
Figure 1 Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.In terms of functions in the brain, lncRNAs are strongly related to brain development (51). In this capacity, lncRNAs participate in spatiotemporal regulation of proliferation and differentiation of pluripotent stem cells (21, 52). High-resolution and high-throughput technologies, such as microarray and RNA-sequencing, have helped in examining the number and pattern of lncRNA expression in the brain. Microarray detects the expression of a large number of RNAs simultaneously, whereas RNA-seq detects both known and novel transcripts and quantifies a large dynamic range of expression levels with absolute rather than relative values. Ramos et al. (53) reported that more than 3,600 lncRNAs are expressed among three different brain regions: subventricular zone, olfactory bulb, and dentate gyrus. Clustering analysis revealed that lncRNAs have a tissue-specific expression pattern (39, 54). A study, using microarray analysis, investigated differential lncRNA expression in the temporal cortex ranging from infancy to adulthood (0.92–43.5 years old) and concluded that the expression pattern of lncRNA changes with age (55). At functional levels, several lncRNAs are involved in regulating neuronal development. This occurs through complex interactions between lncRNAs and other factors in transitioning neural stem cell to progenitors and eventually to differentiated neurons. Some of the lncRNAs that promote the differentiation of neural stem cells include Brn1b, RMST, and TUNA (56–58). EVF2, the first found central nervous system-specific lncRNA, regulates the differentiation of GABAergic neurons (18). The GABA system has been shown to be consistently involved in several psychiatric disorders such as SCZ (59–61), MDD (62), and BD (63). Another lncRNA, Pnky, promotes neural proliferation (64, 65). A recent study has shown that antisense lncRNAs also regulate key proteins related to psychiatric disorders. An inhibition of brain-derived neurotrophic factor (BDNF) antisense RNA (BDNF-AS) causes two- to sevenfold increase in BDNF protein level, which leads to neuronal outgrowth, differentiation, survival, and proliferation (66). An interaction between BDNF and neuropsychiatric disorders is well documented (67, 68). In addition, the mechanism of action of antidepressants (69) and electroconvulsive therapy (70) also involve changes in the levels of BDNF, both centrally and peripherally. Not only do lncRNAs impact BDNF, but changes in the expression of a large number of lncRNAs have been shown following 1 h BDNF treatment in cultured neuronal cells (71). This shows that under neuronal environment, a feed forward and feedback loop might exist between neurotrophin signaling and lncRNA expression with the potential to develop effective therapeutic strategy in psychiatric conditions.
Long Non-Coding RNAs in Psychiatric Disorders
Examining the role of ncRNAs in psychiatric illnesses is an emerging field. Two recent studies used amygdala from SCZ subjects to decipher the role of lncRNAs in this disorder ( Table 1 ). Tian et al. (72) examined lncRNA expression by RNA-seq using 21 SCZ and 24 healthy control subjects. They found alterations in the expression of 345 lncRNAs (104 up- and six downregulated) in SCZ subjects. Subsequently, they divided 21 SCZ subjects into nine undifferentiated, seven disorganized, and five paranoid. Individually, they found 155 up- and 17 downregulated lncRNAs in the undifferentiated SCZ group, 39 up- and six downregulated lncRNAs in the disorganized SCZ subjects, and no significant alteration in paranoid SCZ subjects when compared with control subjects. They performed gene set enrichment analysis to reveal the gene ontology terms associated with dysregulated lncRNAs (all SCZ vs control subjects) and found that dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways. In another amygdala study, Liu et al. (73) used RNA-seq for detecting dysregulation of lncRNAs in 22 SCZ subjects and 24 healthy controls. Transcriptome data identified 250 lncRNAs that showed significant expression differences between SCZ and control subjects. The study further focused on two specific lncRNAs (upregulated RP11-724N1.1 and downregulated RP11-677M14.2), which were shown to be associated with SCZ based on previous genome-wide association study (GWAS). Additional analysis by dividing SCZ subjects into three subtypes revealed the dysregulation of RP11-724N1.1 in the undifferentiated subtype and RP11-677M14.2 in the paranoid subtype. RP11-724N1.1 overlaps the CNNM2 gene locus, which has a key role in the neurodevelopmental process (74). On the other hand, RP11-677M14.2 overlaps the neurogranin (NRGN) gene locus. Several SNPs of the NRGN gene have been associated with onset (75–77), intellectual disability (75), and anterior cingulate cortex (ACC) volume (78) in SCZ subjects. These amygdala studies suggest that not only are lncRNAs involved in SCZ pathophysiology, but they can also differentiate subtypes of SCZ.
Table 1 LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
lncRNAs and Suicidal Behavior
There are four studies that show a relationship between suicidal behavior and lncRNA expression changes. Of them, three studies explored lncRNA expression in the brain (one in ACC and two in the dorsolateral prefrontal cortex [dlPFC]), and one in the blood ( Table 2 ). Zhou et al. (79) compared lncRNA expression levels in rostral ACC between 26 MDD suicide and 24 healthy control subjects by RNA-seq. After considering nominal p values (p < 0.05), without multiple testing, 364 out of 2,670 lncRNAs were differentially regulated; of them, 60% (217 lncRNAs) were downregulated. After genome-wide multiple testing, 15 upregulated and eight downregulated lncRNAs reached statistical significance. Potential cis-targets for significantly dysregulated 23 lncRNAs based on RNA-seq data showed that six lncRNAs (RP11-326I11.3 vs IRF2; RP11-273G15.2 vs LY6E; CTD-2647L4.4 vs HMOBX1; CTC-487M23.5 vs REEP5; RP1-269M15.3 vs PTPRT; RP11-96D1.10 vs NFATC3) were significantly correlated with one antisense or overlapping gene. All of them were found to be nominally differentially expressed except REEP5. With an additional qPCR approach, the authors validated three out of five genes (IRF2, LY6E, and HMBOX1). These genes are functionally related to interferon signaling, which plays a key role in CNS homeostasis and in psychiatric disorders (81).
Table 2 LncRNA expression changes in postmortem brain of suicide subjects.
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.Punzi et al. (80) revealed a correlation between violent suicide and lncRNA LOC28758 expression in dlPFC of SCZ subjects that included 77 non-suicides, 13 non-violent suicides, and 16 violent suicides. LOC28758 is located in the MARCKS gene, which was also found to be significantly highly expressed in violent suicides than non-suicides and non-violent suicides. In a recent study, the authors also examined lncRNA expression changes in dlPFC by RNA-seq (28). LINC01268 expression was significantly higher in suicide subjects compared to non-suicide subjects. Note that both suicide and non-suicide groups included three psychiatric disorders (SCZ, MDD, and BD). Subsequently, they divided the suicide groups into violent suicide and non-violent suicide (poisoning or asphyxia = nonviolent; others = violent). The violent suicide group had higher expression of LINC01268 than the non-suicide group, but the non-violent group did not show any change. Additionally, they explored quantitative trait locus (eQTL) of LINC01268 by genotyping 23 SNPs located within 100 kb up and downstream of the gene coordinates. Of those, only rs7747961 could regulate the LINC01268 expression (C-carriers > non-C-carriers). Based on the Brown–Goodwin questionnaire score, they revealed that LINC01268 expression was higher in the aggressive group than in the non-aggressive group. Lastly, weighted correlation network analysis (WGCNA) was performed with RNA-seq data to verify the relationship between LINC01268 and the co-expression gene set. WGCNA is a systems biology method for detecting the modules correlated with clinical traits by a soft-threshold algorithm. A module including 224 genes and LINC01268 was created. It was found that among 224 genes, P2RY13, a purinergic receptor present in both the peripheral immune system and in the brain, had a strong correlation with LINC01268.
One peripheral blood mononuclear cell (PBMC) study was conducted to identify change in lncRNAs in MDD suicide subjects (63 MDD no-suicidal ideation, 57 MDD with suicidal ideation, and 63 control subjects) by qPCR method (30). qPCR method identifies amplified fragments during the PCR process, but only a smaller number of genes can be measured at once compared to RNA-seq or microarray. Six lncRNAs (TCONS_00019174, NST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, and NONHSAT142707), previously confirmed to be downregulated in MDD subjects, were selected for this study. All six lncRNAs were downregulated in MDD with suicidal ideation, compared with MDD no suicidal ideation and control groups. The authors concluded that six lncRNAs may possibly serve as biomarker for suicidal ideation among MDD patients. Another study showed that decreased expression of TCONS_00019174 was associated with depression and expression change was rescued by antidepressant treatment (82). Additionally, an in vitro experiment showed that TCONS_00019174 was negatively correlated with phosphorylated-GSK3β (p-GSK3β) protein and β-catenin. Further, the overexpression of NONHSAG045500 inhibited the expression of serotonin transporter (SERT), while siRNA interference of NONHSAG045500 induced the upregulation of SERT (83). These studies indicate that the peripheral expression change of lncRNAs can have functional relevance and may be worth pursuing in the brain.
microRNAs
MicroRNAs (miRNAs) are the best studied ncRNAs in terms of functionality and relevance to psychiatric illnesses. Averaging 22 nucleotides in length, miRNAs are synthesized via several enzymatic processes. Initially, primary miRNA (pri-miRNA) is transcribed from an encoded gene. Next, RNase III enzyme Drosha generates precursor miRNA (pre-miRNA) by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then translocated to cytoplasm with the help of Exportin-5 (XPO5). In the cytoplasm, dicer, a double-stranded RNA endoribonuclease, converts pre-miRNA into double-stranded mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor (84–88). Finally, one strand of miRNA/miRNA* duplex loads into Argonaute homologue protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complexes mainly work as suppressors of mRNA expression ( Figure 2 ).
Figure 2 MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.Several miRNAs play a key role in modulating synaptic functions and neural structures. Overexpression of miR-125b can disrupt spine structure, whereas sponging of endogenous miR-125b can induce the prolongation of dendritic protrusions (89). Introduction of miR-132 in hippocampal neurons can induce dendrite morphogenesis, which is caused by the regulation of GTPase-activating protein (p250GAP) (90, 91). At the behavioral level, transgenic miR-132 mice show altered cognitive functions through repression of MeCP2 translation, which is implicated in Rett Syndrom and mental retardation (92). The role of miRNAs in various psychiatric illnesses has been studied extensively. A summary of the human postmortem brain miRNA findings in psychiatric illnesses is provided in Table 3 . Below, we discuss miRNA studies in human brain pertaining to SCZ, MDD, and BD as well as suicidal behavior.
Table 3 miRNA expression changes in psychiatric disorders based on postmortem brain studies.
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Up-regulation Down-regulation
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
miRNAs and Schizophrenia
MiR-137 is a well-known miRNA in schizophrenia studies (110). The first report of the involvement of miR-137 came from a GWAS study which linked a risk variant rs1625579 within miR-137 to SCZ (111). A previous study had reported that target genes for miR-137 are associated with activation in the dlPFC (112). Guella et al. (102) subsequently examined miR-137 and its target genes in the dlPFC of SCZ and BD subjects. MiR-137 expression in the dlPFC was not different between diagnoses. Interestingly, when the genotype of rs1625579 was considered, significantly lower miR-137 expression was found along with higher expression of TCF4, a target gene of miR-137, in the homozygous TT subjects compared to TG and GG subjects within the control group. The miR-137 expression was region specific with amygdala and hippocampus having the highest levels. These results suggest that miR-137 and associated TCF4 gene may be risk factors for SCZ. Using miRNA-seq, one amygdala study showed seven upregulated and 11 downregulated miRNAs (73); of them, miR-1307 was located on a locus previously found to be associated with SCZ risk allele rs11191419 in GWAS (113).
Using custom microarray, Perkins et al. (93) studied miRNA expression in BA9 of subjects with SCZ or schizoaffective disorder and compared them with psychiatrically unaffected individuals. The study found 15 downregulated and one upregulated miRNA in these subjects. They further examined sequences in the pri-miRNA motifs of those dysregulated miRNAs and found that several miRNAs shared the same sequence. For example, miR26b, miR-30a, miR-30b, and miR-7-1 had UGAGNCUU upstream sequences, whereas miRNAs miR-9-1, miR-9-2, miR-9-3, miR-7-3, and miR-30e had GUCNCUUC upstream sequences in their corresponding pre-miRNAs. This suggests the possibility that the processing of pri-miRNA to pre-miRNA might be affected, which could eventually be related to miRNA expression changes. Moreau et al. (94) reported that 19% of miRNAs in BA9 were altered based on diagnostic classification among SCZ, BD, and control subjects. Interestingly, all of the downregulated miRNAs in SCZ were downregulated in BD subjects, supporting the similarity of the genetic background between SCZ and BD. Banigan et al. (95) explored miRNA expressions in exosomes of BA9. Based on the microarray data, they validated the upregulation of miR-497. Several studies have shown that exosomes in the CNS may play a role in neuronal communications, nerve regeneration, synaptic plasticity, and immune response (114, 115).
Beveridge et al. (96) detected 25 upregulated miRNAs in BA9 of SCZ subjects; of them, 10 miRNAs (let-7d, miR-128a, miR-16, miR-181b, miR-181a, miR-20a, miR-219, miR-27a, miR-29c, and miR-7) were validated with qPCR. They also revealed that the biogenesis of miR-181b was perturbed in SCZ possibly due to the altered expression of pri- and pre-miR-181b and miRNA biogenesis-related enzymes DGCR8, DROSHA, and DICER1. Kim et al. (97) detected 7 upregulated miRNAs in another prefrontal cortical area BA46 of SCZ subjects. Of them, miR-132 was highly expressed in the forebrain and was regulated by cAMP response element-binding (CREB) and extracellular signal regulated kinase (ERK) signaling. Both CREB and ERK are targets of antipsychotic drugs (91, 116). On the contrary, Miller et al. (101) reported downregulation of miR-132 in dlPFC of SCZ subjects. The authors found that NMDA antagonist, when administered to adult mice, resulted in lower expression of miR-132 in the prefrontal cortex. Since miR-132 is highly expressed in the postnatal period, a period of synaptic pruning thought to be related to the mechanism of neurodevelopmental susceptibility to SCZ through NMDAR signaling (91), it was concluded that dysregulation in miR-132 and associated target genes may contribute to the neurodevelopmental and morphological abnormalities shown in SCZ.
Santarelli et al. (98) investigated miRNA expression in BA 46 of subjects with SCZ and schizoaffective disorder. They found differential regulation of 28 miRNA in the SCZ group compared to controls. Of them, six miRNAs (miR-17, miR-107, miR-134, miR-328, miR-382, and miR-652) were validated by qPCR. They also found increased expressions of miRNA biogenesis enzymes DGCR8, DROSHA, and DICER1 and concluded that miRNA changes may occur due to disruption in mRNA biogenesis. In another study, Zhu et al. (99) found lower expression of miR-346 in BA46 of SCZ subjects. Interestingly, miR-346 is positioned in intron 2 of the glutamate receptor ionotropic delta 1 (GRID1) gene, which was found to be downregulated in SCZ subjects. GRID1 is an important gene related to SCZ susceptibility (117). Recently, temporal dynamics of miRNA expression in dlPFC as well and their dysregulation was studied in SCZ subjects (100). It was found that miRNAs that were enriched in infants were upregulated, and those enriched in prepuberty were downregulated in SCZ. The targets of these miRNAs included genes encoding for synaptic proteins and were found to be altered in SCZ subjects. In addition, a significant upregulation in the expression of miR-3162 and miR-936 was noted. These results suggest the miRNAs may participate in the development of dlPFC. In addition, miRNAs that are enriched in infancy and prepuberty may be critical in the deployment of SCZ pathology.
Two other reports which used superior temporal gyrus (STG) also linked miRNA abnormalities to SCZ (96, 103). Both studies showed upregulation of miR-181b in SCZ subjects. Using reporter assay, one study revealed that miR-181b could regulate VSNL1 and GRIA2 genes (103). Expression changes in GRIA2 have been reported in BA46 (118) and the medial temporal lobe (119, 120) of SCZ subjects.
miRNAs and Major Depressive Disorder
A number of studies have linked miRNA changes to major depressive disorder (MDD) pathophysiology. Azevedo et al. (104) analyzed select 29 miRNAs by qPCR in ACC of subjects with MDD, BD, and control subjects. They found that miR-132, miR-133a, and miR-212 were differentially regulated in BD, miR-184 in MDD, and miR-34a in both MDD and BD. None of the miRNAs survived significance after multiple corrections. In silico analysis identified NCOA1, NCOA2, and PDE4B as a target of miR-34a, while NCOA2 and PDE4B were targeted by miR-184. Further qPCR analyses showed that NCOA1 had an inverse relationship with miR-34a in BD, while NCOR2 had a positive relationship with MDD. It is pertinent to mention that both NCOA1 and NCOR2 regulate the GR-mediated transcription of corticotropin-releasing hormone, a risk gene for stress-related psychiatric illnesses (121).
Lopez et al. (105) studied miRNA expression in the ventrolateral prefrontal cortex (vmPFC) of depressed individuals and found that primate-specific and human brain enriched miR-1202 was the most differentially regulated miRNA in MDD subjects. They found that miR-1202 regulated the expression of gene encoding metabotropic glutamate receptor-4 (GRM4). A recent report suggests that GRM4 3′ UTR variant (rs2229901) is associated with MDD risk (122). Interestingly, the antidepressant treatment induced miR-1202 expression and downregulated GRM4 expression (105). These results suggest that miR-1202 may be associated with MDD and may serve as target for new drug development.
It has been reported that miR-124-3p is highly expressed specifically in the brain (123), and has neuron-specific expression (124–126). Our group reported a significant upregulation in miR-124-3p expression in BA46 of depressed individuals (106). In silico prediction suggested that AMPA/NMDA receptors are major targets of miR-124-3p. Of them, expression changes for GRIA2 in dlPFC (127), GRIA3 in dentate gyrus (128) and PFC (129), and GRIA4 in PFC (129, 130) have been found in depressed individuals.
miRNAs and Bipolar Disorder
Compared to MDD, postmortem brain studies of miRNAs in bipolar disorder are limited. Azevedo et al. (104) reported downregulation of 4 miRNAs (miR-34a, miR-132, miR-133a, and miR-212) in ACC of BD subjects. miR-34a was correlated with PDE4B expression in BD. PDE4B expression changes have been found in several psychiatric disorders including SCZ (131, 132), MDD (133), and BD (134). Another ACC (BA24) study conducted by Choi et al. (107) explored expression changes in five miRNAs (miR-29c, miR-31, miR-15b, miR-497, miR-219, and miR-149) in glial exosomes. They found that miR-149 was significantly upregulated in BD subjects. Since miR-149 inhibits glial proliferation, an increase in miR-149 may be associated with previously reported reduced glial cell numbers in BA24 of patients diagnosed with BD (135).
Banigan et al. (95) explored exosomal miRNA expression in BA9 of patients diagnosed with BD and found that miR-29c expression was significantly increased. miR-29c regulates canonical Wnt signaling (136). Wnt signaling is linked to BD pathogenesis such that lithium impairs GSK-3β expression, a component of Wnt signaling system (137). Kim et al. (97) investigated the expression of 667 miRNAs in the PFC of individuals with SCZ and BD using Taqman Low Density Array system. They found downregulation of seven miRNAs in SCZ and 15 miRNAs in BD. These miRNAs targeted genes within the networks overrepresented for neurodevelopment, behavior, and SCZ and BD development (97).
Genetic similarities between SCZ and BD have been well documented (138). The overlapping miRNA changes between SCZ and BD may explain the genetic similarity. In the study by Kim et al. (97), miR-154* showed downregulation in PFC of both SCZ and BD subjects. Kohen et al. (108) investigated transcriptomic changes in the dentate gyrus (DG) granule cells of hippocampus in subjects with SCZ, MDD, BD, and nonpsychiatric controls. One miRNA that stood out was miR-182. MiR-182 is involved in several biological processes such as immune response (139), DNA repair (140), and the regeneration of peripheral nerves after injury (141, 142), which play key roles in BD pathogenesis. Carriers of different genotypes among subjects with SCZ and MDD had a loss of DG miR-182 signaling. Interestingly, carriers of high (C/C) vs low-expressing genotype (C/T or T/T) of rs76481776 in both controls and BD subjects, which is located in miR-182, had different levels of miR-182 target gene expression. This suggests that miR-182 may play a critical role in shaping the DG transcriptome based on genotype. Bavamian et al. (109) studied miRNA expression changes in cerebellum and reported an increased expression of miR-34a in BD subjects. In addition, they showed an upregulation of miR-34a in induced neurons derived from BD human fibroblast collected from another cohort. Subsequently, they validated the BD risk genes ankyrin-3 (ANK3) and voltage-dependent L-type calcium channel subunit (CACNB3) as direct targets of miR-34a with luciferase reporter assay. Functionally, enhanced miR-34a expression reduced neuronal differentiation and altered neuronal morphology as well as expression of synaptic proteins. On the other hand, reduced miR-34a expression improved dendritic elaboration.
The studies mentioned above suggest that BD patients have a distinct miRNA expression profile; however, there is a significant overlap with SCZ. This is quite relevant. In the future, miRNA profiling may be useful in identifying commonality and distinction between these disorders, both functionally and at pathophysiological levels.
miRNAs and Suicide
MiRNA studies related to suicide are summarized in Table 4 . Using Taqman Low Density Array system, our group was the first to examine miRNA expression changes in BA9 of 18 MDD suicides and 17 nonpsychiatric control subjects (143). We found a global downregulation of miRNAs in MDD subjects. Altogether, we found significant downregulation in 21 miRNAs. Additional 29 miRNAs were also found to be downregulated by >30%; however, they did not reach statistical significance. When the regulation of these downregulated miRNAs was studied in detail, it was observed that many of them were encoded at the same or nearby chromosomal loci. In addition, they shared 5′-seed sequences. This suggests that miRNAs that were downregulated in MDD subjects had overlapping mRNA targets. Several instances were noted where miRNAs were found to be targeting the same genes. Some of the validated target genes included transcription factors, transmembrane and signaling proteins, growth factors, epigenetic modifiers, and apoptotic regulatory proteins. Predicted targets included ubiquitin ligases, CAMK2G, splicing factor NOVA1, and the GABA-A receptor subunit GABRA4. DNMT3b was another protein that was found to be targeted and further validated. DNMT3b is a key gene in epigenetic modifications and has been shown to be involved in MDD pathophysiology (152).
Table 4 miRNA expression changes in postmortem brain and blood samples of suicide subjects.
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Upregulation Downregulation
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.Gorinski et al. (144) examined whether 5-HT1A receptor (5HT1AR) palmitoylation is a mechanism involved in MDD and suicidality. They found that miR-30e expression was increased, while ZDHHC21 expression, which they identified as a major palmitoyl acyltransferase involved in palmitoylation of 5-HT1AR, was reduced in PFC of MDD suicide subjects, suggesting that 5-HT1AR palmitoylation may be key to MDD pathogenesis and treatment. Another mechanistic study by Torres-Berrio et al. (147) examined whether the expression of Netrin-1 guidance cue receptor DCC (deleted in colorectal cancer) gene was associated with resiliency or susceptibility to PFC dysfunctions in MDD suicide via miRNAs. They found a significant correlation between the decreased expression of miR-218 in BA44 of MDD suicide subjects and the elevated expression of DCC. By conducting an animal study, they concluded that miR-218 was associated with susceptibility versus resiliency to stress-related disorders through regulation of DCC expression.
Our group assessed miRNA expression in the synaptosome of BA10 from a cohort of SCZ, MDD, and BD subjects (145). Altogether, eight out of 14 BD subjects, seven out of 15 MDD subjects, and three out of 14 SCZ subjects had died by suicide. The result of comparison between all suicides (across diagnostic categories) and all non-suicide groups showed two upregulated miRNAs (miR-376a and miR-625) and six downregulated miRNAs (miR-152, miR-181a, miR-330-3p, miR-34a, and miR-133b). Based on significance values, miR-152 was found to be strongly associated with suicide. Distinct set of miRNAs were found in all three disorders; however, several miRNAs showed overlapping changes in SCZ and BD subjects. Discrete changes were also noted in MDD and suicide groups. Interestingly, downregulated miRNAs in SCZ group were enriched within the synapse. Follow-up studies in purified synaptosomes by deep sequencing in SCZ group suggested that there was a significant loss of small RNA expression in synaptosomes only for certain sequence lengths within the miRNA range. In addition, a large number of miRNAs (n = 73) were significantly downregulated and only one miRNA was upregulated. Remarkably, greater fold change of miRNAs in SCZ was associated with lower synaptic enrichment ratio in control subjects and vice-versa. Overall, synaptic miRNAs were generally downregulated in SCZ; however, highly synaptically enriched miRNAs showed greater down-regulation. It was concluded that there may be a deficit in synthesis, transport, or processing of miRNAs in SCZ; however, this process may be more selective for those miRNAs that are localized predominantly in the synaptic compartment.
Maussion et al. (146) examined miRNA expression changes in BA10 from 38 suicide subjects across SCZ, MDD, BD, and control subjects. miR-185* and miR-491-3p were found to be upregulated in suicide subjects compared to control subjects. TrkB-T1, one of the transcript variants of TrkB, expression was significantly lowered in suicide subjects and correlated with miR-185* expression. This was specific only for TrkB-T1, but not for TrkB-T2 or TrkB-FL. TrkB has been shown to be involved in suicidal behavior as has been reported by us previously (67). In an effort to reveal the regulation of polyamine system and suicidal behavior, Lopez et al. (153) examined the expression of SAT1 and SMOX in BA44 and found them to be lower in MDD suicide subjects. They selected 10 miRNAs which were predicted to regulate SAT1 and SMOX genes. Of those, four miRNAs (miR-34c-5p, miR-320c, miR-139-5p, and miR-320c) were significantly upregulated and correlated with the polyamine stress response genes (miR-34c-5p and miR-320c with SAT1; miR-139-5p and miR-320c with SMOX). They concluded that polyamine stress response genes including SAT1 and SMOX may be linked to alterations in miRNA networks that are responsive to stress in MDD suicide subjects. In another study, Lopez et al. (150) noted upregulation of miR-425-3p, miR-146-5p, miR-24-3p, and miR-425-3p in ventrolateral prefrontal cortex (vPFC) of MDD suicide subjects. Resulting from in silico prediction and in vitro experiments, they concluded that all four miRNAs were related to the MAPK/Wnt signaling pathways. These signaling systems have been implicated in suicidal behavior (154).
In an effort to examine the regulation of pro-inflammatory cytokine genes in suicidal behavior, we examined the relationship between TNF-α and its regulatory miRNAs (29). We found an increased expression of miR-19a-3p in BA46 of MDD individuals who had died by suicide. The increased expression of miR-19a-3p was also found in PBMC of MDD subjects who had suicidal ideation. Mechanistically, we found that RNA-binding protein HuR helped in stabilizing TNF-α transcript. This occurred apparently by sequestering its 3′ untranslated region from miR-19a-3p-mediated inhibition. The study suggests that miR-19a-3p may be involved in cytokine dysregulation in suicidal individuals. Recently, we also explored miRNA changes in the locus coeruleus (LC) of MDD suicide subjects (148). A total of 10 upregulated and three downregulated miRNAs were detected in these subjects. Based on target gene prediction using the upregulated miRNAs, we narrowed our study to those genes with a strong neuropsychiatric background. We focused on RELN, GSK-3β, MAOA, CHRM1, PLCB1, and GRIK1 and found reduced expression levels for RELN, GSK-3β, and MAOA.
Maheu et al. (149) examined glial cell line-derived neurotrophic factor in MDD suicide subjects and found an isoform-specific decrease in GDNF family receptor alpha 1 (GFRA1) mRNA, which was associated with lower GFRα1a protein levels in basolateral amygdala. They found upregulation in several miRNAs that may target GFRA1 gene. One of them was miR-511. Under the condition of miR-511 overexpression in neural progenitor cells (NPC), they observed that protein expression of GFRα1 was significantly decreased and concluded that GFRα1 is regulated by miR-511 and may be associated with suicidality.
In terms of blood studies associated with suicidality, only one study is available. Sun et al. (151) reported downregulation of miR-34b-5p and miR-369-3p in MDD subjects with suicidal ideation compared to MDD without suicidal ideation. These changes were consistent with our previous postmortem study conducted in BA9 of MDD suicide subjects (143).
Piwi-Interacting RNAs
Piwi-interacting RNAs (piRNA) are the large small non-coding RNAs (26–32 nucleotide), which are preferentially expressed in nuclei and cytoplasm (155). Piwi proteins are recognized as one domain of argonaute (Ago) protein and bind to piRNA (156–159). The functions of Piwi/piRNA are unclear; however, they are highly expressed in germlines such as testes (156) and ovaries (160). Several studies show their role in epigenetic regulation of transposable elements in germlines (161–163). The existence of piRNA in mouse hippocampal neuron was reported by Lee et al. (164). In an Aplysia study, Rajasethupathy et al. (24) found that neuronal piRNA has a role in regulating memory-related synaptic plasticity. They found that the Piwi/piRNA complex may enable serotonin-dependent methylation of a CREB2 promoter CpG island in neurons, leading to the enhancement of long-term synaptic facilitation, learning-related synaptic plasticity and memory storage in Aplysia. More recently, Nandi et al. (165) reported that piRNA of Mili, the mouse ortholog of Piwi, exhibited behavioral deficits such as hyperactivity and less anxiety (165).
There is limited direct evidence of piRNA in psychiatric disorders. One study identified 37 piRNAs in ACC of SCZ subjects and one piRNA was correlated with antipsychotic medication (166). However, the authors did not mention the expression change between SCZ and control subjects because most of piRNAs were expressed only in a small number of samples.
Small Interfering RNAs
Small interfering RNAs (siRNA) are short (~20-24 nucleotide) double-stranded RNAs (dsRNAs) and interfere in the translation of proteins. Dicer enzyme cleaves long dsRNA and small hairpin RNAs into siRNAs (167, 168). SiRNAs have a role in mRNA cleavage by guiding RNA-induced silencing complex (RISC) to its complementary target mRNAs. Initially, siRNAs are loaded into Ago2 as duplexes. Subsequently, passenger strand of siRNAs is cleaved by Ago2; then, guide strand from siRNA duplex is liberated and produces active RISC, which has the capability to cleave target mRNAs (169, 170). Mainly, siRNAs are used for suppressing target genes as a scientific experimental method. To our knowledge, there is no report about siRNA expression changes in psychiatric disorders.
Small Nuclear RNAs
Small nuclear RNAs (snRNA), averaging about 150 nucleotides in length, are one of the components of spliceosomes. Five snRNAs (U1, U2, U4, U5, and U6) have been identified. snRNAs form ribonucleoprotein complexes (snRNPs) that can target and bind to specific sequences on pre-mRNAs (171). Spliceosomes have key roles in nuclear pre-mRNA splicing that remove the pre-mRNA regions (intron) that do not code for functional molecules. Initially, U1 snRNA binds to its associated proteins at the 5′ splice end of the hnRNA (172). Subsequently, U2 snRNP is recruited to the spliceosome binding site for making complex A. Bai et al. (173) reported that unique U1 snRNP pathology is involved in abnormal RNA splicing in Alzheimer’s disease (AD) that leads to the alteration in amyloid precursor protein (APP) expression and Aβ levels. Their group also showed U1 snRNP pathologic changes in postmortem brain of early onset AD (174). In addition, the small nuclear ribonucleoprotein U1-70K is aggregated in AD brain (175) and might contribute to neuronal toxicity in conjunction with N-terminal truncation (N40K) fragment derived from cleavage (176). In a mouse study, it is reported that dysfunction of U2 snRNA causes neurodegeneration through distortion of pre-mRNA splicing (177). A positron emission tomography study showed that amyloid accumulation is found in the brain of late-life MDD patients (178). At this stage, amyloid deposition may occur during the preclinical phase of dementia in patients who have depressive symptoms (179, 180), although MDD itself is a risk factor for the onset of AD (181). It is possible that Aβ changes through snRNAs may occur in late-life MDD patients even though the relationship between MDD and Aβ is unclear. One study, using ACC, found that 149 snRNAs were expressed in both SCZ and control subjects, and 35 snRNAs were expressed specifically for SCZ subjects (166). However, their biological impact on SCZ pathogenesis is unclear.
Small Nucleolar RNAs
Small nucleolar RNAs (snoRNAs) are generally responsible for guiding modifications in rRNAs, tRNAs, and snRNAs. snoRNAs are divided into two main classes: 1) box C/D and 2) box H/ACA. Box C/D snoRNAs, averaging 60–90 nucleotides, have a role in catalyzing 2′-O-ribose methylation. Box H/ACA snoRNA, averaging 120–140 nucleotides, guide pseudouridylation (182, 183). In 2002, brain specific C/D box snoRNAs HBII-52 (SNORD115) and HBII 85 (SNORD116) and H/ACA box snoRNA HBI-36 were detected (184). Prader–Willi syndrome (PWS) is a neurodevelopmental disorder caused by imprinted gene clusters at human chromosome region 15q11q13. It was reported that SNORD115 and SNORD116 are partially responsible for the development of PWS (185, 186). Moreover, HBI-52 and HBI-36 snoRNAs are thought to regulate 5-HT2c mRNA expression (184). 5-HT2c has a role in MDD pathogenesis. Indeed, several antidepressants work as an antagonist to 5-HT2c (187–189). In terms of schizophrenia, it is considered that 5HT-2c relates to SCZ pathogenesis through the dopaminergic pathway (190, 191) and by causing side effects to antipsychotic treatment (192). Actually, clozapine, a drug used for refractory schizophrenia, has high affinity to 5-HT2c (192). SnoRNAs may influence psychiatric disorders directly or through 5-HT2c receptors. Epigenetic changes have also been found in SNORD115 and SNORD116 in monozygotic twin study of SCZ. Hypermethylation in 12 regions on SNORD115 and five regions on SNORD116 regions were found in affected individuals (193).
In PFC synaptosomes from SCZ subjects, we noted ~50% decrease in a set of sequences that were derived from a C/D box snoRNA and SNORD85 (145). A 27-mer sequence TTCACTGATGAGAGCATTGTTCTGAGC was the most abundant one that incorporated a C/D box and terminated four bases before the 3′ end of the host snoRNA. Our study, for the first time, showed that not only is this novel class of small ncRNAs expressed in humans, and more so in synaptosomes, but they may be significantly altered in a psychiatric disorders. Another study also showed expression change in snoRNAs in SCZ (166). A total of 343 snoRNAs were expressed in both SCZ and control subjects and six snoRNAs were expressed specifically in SCZ subjects. However, none of the snoRNAs were significantly changed in SCZ compared to controls.
Limitations
There are a several limitations to ncRNA studies in neuropsychiatric disorders: 1) Several studies show changes in expression of expression lncRNAs and miRNAs; however, they are inconsistent even when studied in the same brain region with the same diagnosis. This could be attributed to several factors. For example, confounding variables such as PMI, brain pH, freeze–thaw cycle, age, and sex vary between studies. In addition, most of the studies use whole tissue. As mentioned earlier, the expression of lncRNAs and miRNAs are brain region and cell type specific. This cellular heterogeneity may affect ncRNA expressions. Thus, studying their expression patterns in neurons and glial cells (oligodendrocytes, astrocytes, and microglia) may delineate these discrepancies. Even within neurons, specific neuronal population needs to be studied. In this regard, single cell study will be helpful. 2) In recent years, many studies have focused on miRNAs and to a certain extent lncRNAs; however, the role of siRNAs, piRNAs, snoRNAs, and snRNAs are understudied. Given their important roles (e.g. epigenetic regulation of transposable elements; mRNA cleavage by guiding RISC), future research will be needed to explore their functional significance in psychiatric disorders. 3) Correct identification of new snRNAs and snoRNAs and their epigenetic roles needs to be studied (194, 195). New technologies like nanopore sequencing and structure prediction algorithms are emerging that can be helpful in this regard. 4) Although new members of ncRNA are being discovered regularly, the functions of these novel ncRNAs are not well understood. More in-vivo functional studies followed by high-throughput sequencing after chemical cross-linking or photoactivatable cross-linking and immunoprecipitation (PAR-CLIP) will be effective in probing the functional roles of novel ncRNAs at the cellular level (196). These assays can be also performed in human postmortem brain samples, but by minimizing the loss of tissue integrity and maximizing the likeliness of capturing the interaction at the molecular level. 5) Most of the studies have shown the temporal changes in ncRNA expression. Although it is very difficult to measure ncRNA expressions at different time points in postmortem samples, it is relatively easy to measure them in peripheral tissue samples. Using longitudinal studies, it will be possible to explore the diagnosis/therapeutic/disease state biomarkers for psychiatric illnesses.
Conclusions
ncRNAs are gaining traction for their role in various psychiatric illnesses. A schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality is depicted in Figure 3 . Both long-non-coding RNAs and miRNAs have been extensively studied in MDD, SCZ, and BD. As can be seen in Tables 1 – 4 , a large number of miRNAs and lncRNAs have been implicated in SCZ, MDD, and BD. There were several miRNAs that showed overlapping changes between SCZ and BD, suggesting that these two disorders may share common susceptibility factors as has been demonstrated in several genetic studies.
Figure 3 Schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality. Risk factors for mental illnesses include early life adversity, current or recurrent life events that along with gene environment interaction can lead to epigenetic modifications mediated by ncRNAs. These modifications can give rise to neuropathology mediated by changes at cellular and/or molecular levels, which can subsequently alter neural circuitry. Phenotypic changes can arise from circuitry changes that can mediate the development of psychiatric illnesses such as major depression, bipolar disorder and schizophrenia. Suicidal behavior could be a manifestation of psychiatric illnesses or may be independent of psychiatric illnesses. ncRNAs, non-coding RNA.The population-based studies have explored the expression changes of lncRNA and miRNA among psychiatric patients who have suicidal ideation. A couple of postmortem brain studies have also explored suicide associated ncRNAs. Interestingly, both lncRNAs and miRNAs were specifically changed in psychiatric patients who died by suicide even though the sample size and number of studies are quite small. The results are encouraging and need further exploration.
In terms of other small RNAs, the studies are quite limited; nevertheless, they appear to be promising. piRNAs and snoRNAs show interesting results in SCZ patients that may shed light on their role in regulating other RNAs and their role in this psychiatric illness. These studies need to be expanded in order to understand their precise role in regulatory mechanisms that can be involved in the pathogenesis of psychiatric disorders.
Author Contributions
YD conceptualized, outlined, and edited the paper. YY reviewed literature and co-wrote the paper.
Funding
This work was supported by funding from the National Institutes of Health (R01MH082802; R01MH101890; R01MH100616; R01MH107183; R01MH118884) to YD.
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
|
sec
|
Introduction
Non-coding RNAs (ncRNAs) are defined as RNAs that are not translated into protein. Protein-coding genes occupy only a small proportion (<3%) of the entire genome (1). However, the remaining non-protein coding genes are not a simple transcriptional noise (1, 2); instead, ~80% of them are transcriptionally active with elaborate regulatory roles. A majority of them are now considered non-coding RNA genes (3–6). Based on the size of the nucleotides, ncRNAs are divided into small ncRNAs and long ncRNAs (lncRNAs). ncRNAs that contain <200 nucleotides (nt) belong to small ncRNA family. On the other hand, those containing more >200 nt belong to long lncRNA family. Small RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). ncRNAs function via interactions with RNA, DNA, and protein. They regulate the transcription of mRNAs and participate in alternative splicing and epigenetic modifications such as chromatin and RNA editing (7, 8). These regulatory functions can target either neighboring transcripts (cis) or loci that are distant from their own transcription (trans). Collectively, ncRNAs constitute a unique layer of gene regulation where they function as key intermediate regulators in conveying the message from genotype to phenotype states (9).
A large number of ncRNAs are abundantly expressed in the brain (10–12). In addition, the expressions of ncRNAs are brain region- and cell type-specific (13–16). Several studies have shown the role of ncRNAs in brain evolution, development, homeostasis, stress response, and neuroplasticity (14, 17–25). Brain expressed ncRNAs can also influence the development of psychiatric disorders such as schizophrenia (SCZ), major depressive disorder (MDD), and bipolar disorder (BD) as well as neurodegenerative disorders (11, 19, 23, 26, 27). More recently, their role in suicidal behavior has been postulated (28–30). The effects of ncRNA expression changes are not restricted to the type of psychiatric disorders but, to a large extent, to different brain regions. Recent evidence suggests the inability of brain regions to act independently. Instead, they act in a coordinated manner via functional networks. In various neuropsychiatric disorders, voxel based neuroimaging has demonstrated specific roles of brain regions such as cortex (prefrontal, anterior cingulate), hippocampus, and amygdala (31). Although each of these brain regions has important roles, such as amygdala and prefrontal cortex in emotion (32) and prefrontal cortex and hippocampus in stress response (33), these brain regions crosstalk to each other via complex gene networks which could be mediated vis ncRNAs.
Earlier published reviews have primarily focused on miRNAs in psychiatric illnesses (34–36). This review comprehensively summarizes the relationship between various ncRNAs. Although the emphasis is given to lncRNAs and miRNAs, a range of other ncRNAs are also included to provide a glimpse into where the field stands and what should be the course of direction for future research. The review is restricted to studies in human postmortem brain, given that the role of peripheral ncRNAs is not very well established. We have discussed a few peripheral blood cell studies which are relevant to suicidal behavior. The criteria for selecting literature search are as follows: Electronic search was done using PubMed with search terms ncRNAs (microRNA, small interfering RNA, piwi-interacting RNA, small nucleolar RNA, and small nuclear RNA) AND psychiatric disorders (schizophrenia, major depressive disorder, and bipolar disorder). Each combination was performed separately. Additionally, postmortem research for non-suicide studies, and both postmortem brain and peripheral tissue research for suicide studies, were included in the search criteria.
|
|
title
|
Introduction
|
|
p
|
Non-coding RNAs (ncRNAs) are defined as RNAs that are not translated into protein. Protein-coding genes occupy only a small proportion (<3%) of the entire genome (1). However, the remaining non-protein coding genes are not a simple transcriptional noise (1, 2); instead, ~80% of them are transcriptionally active with elaborate regulatory roles. A majority of them are now considered non-coding RNA genes (3–6). Based on the size of the nucleotides, ncRNAs are divided into small ncRNAs and long ncRNAs (lncRNAs). ncRNAs that contain <200 nucleotides (nt) belong to small ncRNA family. On the other hand, those containing more >200 nt belong to long lncRNA family. Small RNAs include microRNAs (miRNAs), small interfering RNAs (siRNAs), piwi-interacting RNAs (piRNAs), small nucleolar RNAs (snoRNAs), and small nuclear RNAs (snRNAs). ncRNAs function via interactions with RNA, DNA, and protein. They regulate the transcription of mRNAs and participate in alternative splicing and epigenetic modifications such as chromatin and RNA editing (7, 8). These regulatory functions can target either neighboring transcripts (cis) or loci that are distant from their own transcription (trans). Collectively, ncRNAs constitute a unique layer of gene regulation where they function as key intermediate regulators in conveying the message from genotype to phenotype states (9).
|
|
p
|
A large number of ncRNAs are abundantly expressed in the brain (10–12). In addition, the expressions of ncRNAs are brain region- and cell type-specific (13–16). Several studies have shown the role of ncRNAs in brain evolution, development, homeostasis, stress response, and neuroplasticity (14, 17–25). Brain expressed ncRNAs can also influence the development of psychiatric disorders such as schizophrenia (SCZ), major depressive disorder (MDD), and bipolar disorder (BD) as well as neurodegenerative disorders (11, 19, 23, 26, 27). More recently, their role in suicidal behavior has been postulated (28–30). The effects of ncRNA expression changes are not restricted to the type of psychiatric disorders but, to a large extent, to different brain regions. Recent evidence suggests the inability of brain regions to act independently. Instead, they act in a coordinated manner via functional networks. In various neuropsychiatric disorders, voxel based neuroimaging has demonstrated specific roles of brain regions such as cortex (prefrontal, anterior cingulate), hippocampus, and amygdala (31). Although each of these brain regions has important roles, such as amygdala and prefrontal cortex in emotion (32) and prefrontal cortex and hippocampus in stress response (33), these brain regions crosstalk to each other via complex gene networks which could be mediated vis ncRNAs.
|
|
p
|
Earlier published reviews have primarily focused on miRNAs in psychiatric illnesses (34–36). This review comprehensively summarizes the relationship between various ncRNAs. Although the emphasis is given to lncRNAs and miRNAs, a range of other ncRNAs are also included to provide a glimpse into where the field stands and what should be the course of direction for future research. The review is restricted to studies in human postmortem brain, given that the role of peripheral ncRNAs is not very well established. We have discussed a few peripheral blood cell studies which are relevant to suicidal behavior. The criteria for selecting literature search are as follows: Electronic search was done using PubMed with search terms ncRNAs (microRNA, small interfering RNA, piwi-interacting RNA, small nucleolar RNA, and small nuclear RNA) AND psychiatric disorders (schizophrenia, major depressive disorder, and bipolar disorder). Each combination was performed separately. Additionally, postmortem research for non-suicide studies, and both postmortem brain and peripheral tissue research for suicide studies, were included in the search criteria.
|
|
sec
|
Long Non-Coding RNAs
Long Non-Coding RNAs in Brain Functions
Long non-coding RNAs (lncRNAs) are defined as RNAs having >200 nucleotides with low (in the form of short peptide) or no protein coding potential (37). LncRNAs are transcribed by RNA Polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs (38). LncRNAs’ lengths span ~100 kilo base-pairs (bp) and are shorter than mRNAs but have longer exons (39–41). They were originally considered to be the products of heterochronic genes (4) that control the temporal dimension of development; however, there are limitations to fully understand the function of lncRNAs from this point of view. Interestingly, the genomic structure of lncRNAs is strongly related to their function (42). In the early nineties, the X-inactive specific transcripts (Xist) and H19 were first discovered as non-protein coding RNAs by exploring cDNA libraries (43, 44). Since then, over 100,000 lncRNA genes have been found and their number is still increasing (45). Recently, several lncRNA functions have been revealed. For example, they participate in chromatin modifications (46, 47); act as ‘sponges’ that prevent miRNA functions (48); act as scaffolds that provide docking sites for proteins (49); serve as activators and suppressors of mRNA transcription (50); and act as regulators of splicing patterns (50). The functions of lncRNAs are depicted in Figure 1 .
Figure 1 Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.In terms of functions in the brain, lncRNAs are strongly related to brain development (51). In this capacity, lncRNAs participate in spatiotemporal regulation of proliferation and differentiation of pluripotent stem cells (21, 52). High-resolution and high-throughput technologies, such as microarray and RNA-sequencing, have helped in examining the number and pattern of lncRNA expression in the brain. Microarray detects the expression of a large number of RNAs simultaneously, whereas RNA-seq detects both known and novel transcripts and quantifies a large dynamic range of expression levels with absolute rather than relative values. Ramos et al. (53) reported that more than 3,600 lncRNAs are expressed among three different brain regions: subventricular zone, olfactory bulb, and dentate gyrus. Clustering analysis revealed that lncRNAs have a tissue-specific expression pattern (39, 54). A study, using microarray analysis, investigated differential lncRNA expression in the temporal cortex ranging from infancy to adulthood (0.92–43.5 years old) and concluded that the expression pattern of lncRNA changes with age (55). At functional levels, several lncRNAs are involved in regulating neuronal development. This occurs through complex interactions between lncRNAs and other factors in transitioning neural stem cell to progenitors and eventually to differentiated neurons. Some of the lncRNAs that promote the differentiation of neural stem cells include Brn1b, RMST, and TUNA (56–58). EVF2, the first found central nervous system-specific lncRNA, regulates the differentiation of GABAergic neurons (18). The GABA system has been shown to be consistently involved in several psychiatric disorders such as SCZ (59–61), MDD (62), and BD (63). Another lncRNA, Pnky, promotes neural proliferation (64, 65). A recent study has shown that antisense lncRNAs also regulate key proteins related to psychiatric disorders. An inhibition of brain-derived neurotrophic factor (BDNF) antisense RNA (BDNF-AS) causes two- to sevenfold increase in BDNF protein level, which leads to neuronal outgrowth, differentiation, survival, and proliferation (66). An interaction between BDNF and neuropsychiatric disorders is well documented (67, 68). In addition, the mechanism of action of antidepressants (69) and electroconvulsive therapy (70) also involve changes in the levels of BDNF, both centrally and peripherally. Not only do lncRNAs impact BDNF, but changes in the expression of a large number of lncRNAs have been shown following 1 h BDNF treatment in cultured neuronal cells (71). This shows that under neuronal environment, a feed forward and feedback loop might exist between neurotrophin signaling and lncRNA expression with the potential to develop effective therapeutic strategy in psychiatric conditions.
Long Non-Coding RNAs in Psychiatric Disorders
Examining the role of ncRNAs in psychiatric illnesses is an emerging field. Two recent studies used amygdala from SCZ subjects to decipher the role of lncRNAs in this disorder ( Table 1 ). Tian et al. (72) examined lncRNA expression by RNA-seq using 21 SCZ and 24 healthy control subjects. They found alterations in the expression of 345 lncRNAs (104 up- and six downregulated) in SCZ subjects. Subsequently, they divided 21 SCZ subjects into nine undifferentiated, seven disorganized, and five paranoid. Individually, they found 155 up- and 17 downregulated lncRNAs in the undifferentiated SCZ group, 39 up- and six downregulated lncRNAs in the disorganized SCZ subjects, and no significant alteration in paranoid SCZ subjects when compared with control subjects. They performed gene set enrichment analysis to reveal the gene ontology terms associated with dysregulated lncRNAs (all SCZ vs control subjects) and found that dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways. In another amygdala study, Liu et al. (73) used RNA-seq for detecting dysregulation of lncRNAs in 22 SCZ subjects and 24 healthy controls. Transcriptome data identified 250 lncRNAs that showed significant expression differences between SCZ and control subjects. The study further focused on two specific lncRNAs (upregulated RP11-724N1.1 and downregulated RP11-677M14.2), which were shown to be associated with SCZ based on previous genome-wide association study (GWAS). Additional analysis by dividing SCZ subjects into three subtypes revealed the dysregulation of RP11-724N1.1 in the undifferentiated subtype and RP11-677M14.2 in the paranoid subtype. RP11-724N1.1 overlaps the CNNM2 gene locus, which has a key role in the neurodevelopmental process (74). On the other hand, RP11-677M14.2 overlaps the neurogranin (NRGN) gene locus. Several SNPs of the NRGN gene have been associated with onset (75–77), intellectual disability (75), and anterior cingulate cortex (ACC) volume (78) in SCZ subjects. These amygdala studies suggest that not only are lncRNAs involved in SCZ pathophysiology, but they can also differentiate subtypes of SCZ.
Table 1 LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
lncRNAs and Suicidal Behavior
There are four studies that show a relationship between suicidal behavior and lncRNA expression changes. Of them, three studies explored lncRNA expression in the brain (one in ACC and two in the dorsolateral prefrontal cortex [dlPFC]), and one in the blood ( Table 2 ). Zhou et al. (79) compared lncRNA expression levels in rostral ACC between 26 MDD suicide and 24 healthy control subjects by RNA-seq. After considering nominal p values (p < 0.05), without multiple testing, 364 out of 2,670 lncRNAs were differentially regulated; of them, 60% (217 lncRNAs) were downregulated. After genome-wide multiple testing, 15 upregulated and eight downregulated lncRNAs reached statistical significance. Potential cis-targets for significantly dysregulated 23 lncRNAs based on RNA-seq data showed that six lncRNAs (RP11-326I11.3 vs IRF2; RP11-273G15.2 vs LY6E; CTD-2647L4.4 vs HMOBX1; CTC-487M23.5 vs REEP5; RP1-269M15.3 vs PTPRT; RP11-96D1.10 vs NFATC3) were significantly correlated with one antisense or overlapping gene. All of them were found to be nominally differentially expressed except REEP5. With an additional qPCR approach, the authors validated three out of five genes (IRF2, LY6E, and HMBOX1). These genes are functionally related to interferon signaling, which plays a key role in CNS homeostasis and in psychiatric disorders (81).
Table 2 LncRNA expression changes in postmortem brain of suicide subjects.
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.Punzi et al. (80) revealed a correlation between violent suicide and lncRNA LOC28758 expression in dlPFC of SCZ subjects that included 77 non-suicides, 13 non-violent suicides, and 16 violent suicides. LOC28758 is located in the MARCKS gene, which was also found to be significantly highly expressed in violent suicides than non-suicides and non-violent suicides. In a recent study, the authors also examined lncRNA expression changes in dlPFC by RNA-seq (28). LINC01268 expression was significantly higher in suicide subjects compared to non-suicide subjects. Note that both suicide and non-suicide groups included three psychiatric disorders (SCZ, MDD, and BD). Subsequently, they divided the suicide groups into violent suicide and non-violent suicide (poisoning or asphyxia = nonviolent; others = violent). The violent suicide group had higher expression of LINC01268 than the non-suicide group, but the non-violent group did not show any change. Additionally, they explored quantitative trait locus (eQTL) of LINC01268 by genotyping 23 SNPs located within 100 kb up and downstream of the gene coordinates. Of those, only rs7747961 could regulate the LINC01268 expression (C-carriers > non-C-carriers). Based on the Brown–Goodwin questionnaire score, they revealed that LINC01268 expression was higher in the aggressive group than in the non-aggressive group. Lastly, weighted correlation network analysis (WGCNA) was performed with RNA-seq data to verify the relationship between LINC01268 and the co-expression gene set. WGCNA is a systems biology method for detecting the modules correlated with clinical traits by a soft-threshold algorithm. A module including 224 genes and LINC01268 was created. It was found that among 224 genes, P2RY13, a purinergic receptor present in both the peripheral immune system and in the brain, had a strong correlation with LINC01268.
One peripheral blood mononuclear cell (PBMC) study was conducted to identify change in lncRNAs in MDD suicide subjects (63 MDD no-suicidal ideation, 57 MDD with suicidal ideation, and 63 control subjects) by qPCR method (30). qPCR method identifies amplified fragments during the PCR process, but only a smaller number of genes can be measured at once compared to RNA-seq or microarray. Six lncRNAs (TCONS_00019174, NST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, and NONHSAT142707), previously confirmed to be downregulated in MDD subjects, were selected for this study. All six lncRNAs were downregulated in MDD with suicidal ideation, compared with MDD no suicidal ideation and control groups. The authors concluded that six lncRNAs may possibly serve as biomarker for suicidal ideation among MDD patients. Another study showed that decreased expression of TCONS_00019174 was associated with depression and expression change was rescued by antidepressant treatment (82). Additionally, an in vitro experiment showed that TCONS_00019174 was negatively correlated with phosphorylated-GSK3β (p-GSK3β) protein and β-catenin. Further, the overexpression of NONHSAG045500 inhibited the expression of serotonin transporter (SERT), while siRNA interference of NONHSAG045500 induced the upregulation of SERT (83). These studies indicate that the peripheral expression change of lncRNAs can have functional relevance and may be worth pursuing in the brain.
microRNAs
MicroRNAs (miRNAs) are the best studied ncRNAs in terms of functionality and relevance to psychiatric illnesses. Averaging 22 nucleotides in length, miRNAs are synthesized via several enzymatic processes. Initially, primary miRNA (pri-miRNA) is transcribed from an encoded gene. Next, RNase III enzyme Drosha generates precursor miRNA (pre-miRNA) by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then translocated to cytoplasm with the help of Exportin-5 (XPO5). In the cytoplasm, dicer, a double-stranded RNA endoribonuclease, converts pre-miRNA into double-stranded mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor (84–88). Finally, one strand of miRNA/miRNA* duplex loads into Argonaute homologue protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complexes mainly work as suppressors of mRNA expression ( Figure 2 ).
Figure 2 MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.Several miRNAs play a key role in modulating synaptic functions and neural structures. Overexpression of miR-125b can disrupt spine structure, whereas sponging of endogenous miR-125b can induce the prolongation of dendritic protrusions (89). Introduction of miR-132 in hippocampal neurons can induce dendrite morphogenesis, which is caused by the regulation of GTPase-activating protein (p250GAP) (90, 91). At the behavioral level, transgenic miR-132 mice show altered cognitive functions through repression of MeCP2 translation, which is implicated in Rett Syndrom and mental retardation (92). The role of miRNAs in various psychiatric illnesses has been studied extensively. A summary of the human postmortem brain miRNA findings in psychiatric illnesses is provided in Table 3 . Below, we discuss miRNA studies in human brain pertaining to SCZ, MDD, and BD as well as suicidal behavior.
Table 3 miRNA expression changes in psychiatric disorders based on postmortem brain studies.
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Up-regulation Down-regulation
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
miRNAs and Schizophrenia
MiR-137 is a well-known miRNA in schizophrenia studies (110). The first report of the involvement of miR-137 came from a GWAS study which linked a risk variant rs1625579 within miR-137 to SCZ (111). A previous study had reported that target genes for miR-137 are associated with activation in the dlPFC (112). Guella et al. (102) subsequently examined miR-137 and its target genes in the dlPFC of SCZ and BD subjects. MiR-137 expression in the dlPFC was not different between diagnoses. Interestingly, when the genotype of rs1625579 was considered, significantly lower miR-137 expression was found along with higher expression of TCF4, a target gene of miR-137, in the homozygous TT subjects compared to TG and GG subjects within the control group. The miR-137 expression was region specific with amygdala and hippocampus having the highest levels. These results suggest that miR-137 and associated TCF4 gene may be risk factors for SCZ. Using miRNA-seq, one amygdala study showed seven upregulated and 11 downregulated miRNAs (73); of them, miR-1307 was located on a locus previously found to be associated with SCZ risk allele rs11191419 in GWAS (113).
Using custom microarray, Perkins et al. (93) studied miRNA expression in BA9 of subjects with SCZ or schizoaffective disorder and compared them with psychiatrically unaffected individuals. The study found 15 downregulated and one upregulated miRNA in these subjects. They further examined sequences in the pri-miRNA motifs of those dysregulated miRNAs and found that several miRNAs shared the same sequence. For example, miR26b, miR-30a, miR-30b, and miR-7-1 had UGAGNCUU upstream sequences, whereas miRNAs miR-9-1, miR-9-2, miR-9-3, miR-7-3, and miR-30e had GUCNCUUC upstream sequences in their corresponding pre-miRNAs. This suggests the possibility that the processing of pri-miRNA to pre-miRNA might be affected, which could eventually be related to miRNA expression changes. Moreau et al. (94) reported that 19% of miRNAs in BA9 were altered based on diagnostic classification among SCZ, BD, and control subjects. Interestingly, all of the downregulated miRNAs in SCZ were downregulated in BD subjects, supporting the similarity of the genetic background between SCZ and BD. Banigan et al. (95) explored miRNA expressions in exosomes of BA9. Based on the microarray data, they validated the upregulation of miR-497. Several studies have shown that exosomes in the CNS may play a role in neuronal communications, nerve regeneration, synaptic plasticity, and immune response (114, 115).
Beveridge et al. (96) detected 25 upregulated miRNAs in BA9 of SCZ subjects; of them, 10 miRNAs (let-7d, miR-128a, miR-16, miR-181b, miR-181a, miR-20a, miR-219, miR-27a, miR-29c, and miR-7) were validated with qPCR. They also revealed that the biogenesis of miR-181b was perturbed in SCZ possibly due to the altered expression of pri- and pre-miR-181b and miRNA biogenesis-related enzymes DGCR8, DROSHA, and DICER1. Kim et al. (97) detected 7 upregulated miRNAs in another prefrontal cortical area BA46 of SCZ subjects. Of them, miR-132 was highly expressed in the forebrain and was regulated by cAMP response element-binding (CREB) and extracellular signal regulated kinase (ERK) signaling. Both CREB and ERK are targets of antipsychotic drugs (91, 116). On the contrary, Miller et al. (101) reported downregulation of miR-132 in dlPFC of SCZ subjects. The authors found that NMDA antagonist, when administered to adult mice, resulted in lower expression of miR-132 in the prefrontal cortex. Since miR-132 is highly expressed in the postnatal period, a period of synaptic pruning thought to be related to the mechanism of neurodevelopmental susceptibility to SCZ through NMDAR signaling (91), it was concluded that dysregulation in miR-132 and associated target genes may contribute to the neurodevelopmental and morphological abnormalities shown in SCZ.
Santarelli et al. (98) investigated miRNA expression in BA 46 of subjects with SCZ and schizoaffective disorder. They found differential regulation of 28 miRNA in the SCZ group compared to controls. Of them, six miRNAs (miR-17, miR-107, miR-134, miR-328, miR-382, and miR-652) were validated by qPCR. They also found increased expressions of miRNA biogenesis enzymes DGCR8, DROSHA, and DICER1 and concluded that miRNA changes may occur due to disruption in mRNA biogenesis. In another study, Zhu et al. (99) found lower expression of miR-346 in BA46 of SCZ subjects. Interestingly, miR-346 is positioned in intron 2 of the glutamate receptor ionotropic delta 1 (GRID1) gene, which was found to be downregulated in SCZ subjects. GRID1 is an important gene related to SCZ susceptibility (117). Recently, temporal dynamics of miRNA expression in dlPFC as well and their dysregulation was studied in SCZ subjects (100). It was found that miRNAs that were enriched in infants were upregulated, and those enriched in prepuberty were downregulated in SCZ. The targets of these miRNAs included genes encoding for synaptic proteins and were found to be altered in SCZ subjects. In addition, a significant upregulation in the expression of miR-3162 and miR-936 was noted. These results suggest the miRNAs may participate in the development of dlPFC. In addition, miRNAs that are enriched in infancy and prepuberty may be critical in the deployment of SCZ pathology.
Two other reports which used superior temporal gyrus (STG) also linked miRNA abnormalities to SCZ (96, 103). Both studies showed upregulation of miR-181b in SCZ subjects. Using reporter assay, one study revealed that miR-181b could regulate VSNL1 and GRIA2 genes (103). Expression changes in GRIA2 have been reported in BA46 (118) and the medial temporal lobe (119, 120) of SCZ subjects.
miRNAs and Major Depressive Disorder
A number of studies have linked miRNA changes to major depressive disorder (MDD) pathophysiology. Azevedo et al. (104) analyzed select 29 miRNAs by qPCR in ACC of subjects with MDD, BD, and control subjects. They found that miR-132, miR-133a, and miR-212 were differentially regulated in BD, miR-184 in MDD, and miR-34a in both MDD and BD. None of the miRNAs survived significance after multiple corrections. In silico analysis identified NCOA1, NCOA2, and PDE4B as a target of miR-34a, while NCOA2 and PDE4B were targeted by miR-184. Further qPCR analyses showed that NCOA1 had an inverse relationship with miR-34a in BD, while NCOR2 had a positive relationship with MDD. It is pertinent to mention that both NCOA1 and NCOR2 regulate the GR-mediated transcription of corticotropin-releasing hormone, a risk gene for stress-related psychiatric illnesses (121).
Lopez et al. (105) studied miRNA expression in the ventrolateral prefrontal cortex (vmPFC) of depressed individuals and found that primate-specific and human brain enriched miR-1202 was the most differentially regulated miRNA in MDD subjects. They found that miR-1202 regulated the expression of gene encoding metabotropic glutamate receptor-4 (GRM4). A recent report suggests that GRM4 3′ UTR variant (rs2229901) is associated with MDD risk (122). Interestingly, the antidepressant treatment induced miR-1202 expression and downregulated GRM4 expression (105). These results suggest that miR-1202 may be associated with MDD and may serve as target for new drug development.
It has been reported that miR-124-3p is highly expressed specifically in the brain (123), and has neuron-specific expression (124–126). Our group reported a significant upregulation in miR-124-3p expression in BA46 of depressed individuals (106). In silico prediction suggested that AMPA/NMDA receptors are major targets of miR-124-3p. Of them, expression changes for GRIA2 in dlPFC (127), GRIA3 in dentate gyrus (128) and PFC (129), and GRIA4 in PFC (129, 130) have been found in depressed individuals.
miRNAs and Bipolar Disorder
Compared to MDD, postmortem brain studies of miRNAs in bipolar disorder are limited. Azevedo et al. (104) reported downregulation of 4 miRNAs (miR-34a, miR-132, miR-133a, and miR-212) in ACC of BD subjects. miR-34a was correlated with PDE4B expression in BD. PDE4B expression changes have been found in several psychiatric disorders including SCZ (131, 132), MDD (133), and BD (134). Another ACC (BA24) study conducted by Choi et al. (107) explored expression changes in five miRNAs (miR-29c, miR-31, miR-15b, miR-497, miR-219, and miR-149) in glial exosomes. They found that miR-149 was significantly upregulated in BD subjects. Since miR-149 inhibits glial proliferation, an increase in miR-149 may be associated with previously reported reduced glial cell numbers in BA24 of patients diagnosed with BD (135).
Banigan et al. (95) explored exosomal miRNA expression in BA9 of patients diagnosed with BD and found that miR-29c expression was significantly increased. miR-29c regulates canonical Wnt signaling (136). Wnt signaling is linked to BD pathogenesis such that lithium impairs GSK-3β expression, a component of Wnt signaling system (137). Kim et al. (97) investigated the expression of 667 miRNAs in the PFC of individuals with SCZ and BD using Taqman Low Density Array system. They found downregulation of seven miRNAs in SCZ and 15 miRNAs in BD. These miRNAs targeted genes within the networks overrepresented for neurodevelopment, behavior, and SCZ and BD development (97).
Genetic similarities between SCZ and BD have been well documented (138). The overlapping miRNA changes between SCZ and BD may explain the genetic similarity. In the study by Kim et al. (97), miR-154* showed downregulation in PFC of both SCZ and BD subjects. Kohen et al. (108) investigated transcriptomic changes in the dentate gyrus (DG) granule cells of hippocampus in subjects with SCZ, MDD, BD, and nonpsychiatric controls. One miRNA that stood out was miR-182. MiR-182 is involved in several biological processes such as immune response (139), DNA repair (140), and the regeneration of peripheral nerves after injury (141, 142), which play key roles in BD pathogenesis. Carriers of different genotypes among subjects with SCZ and MDD had a loss of DG miR-182 signaling. Interestingly, carriers of high (C/C) vs low-expressing genotype (C/T or T/T) of rs76481776 in both controls and BD subjects, which is located in miR-182, had different levels of miR-182 target gene expression. This suggests that miR-182 may play a critical role in shaping the DG transcriptome based on genotype. Bavamian et al. (109) studied miRNA expression changes in cerebellum and reported an increased expression of miR-34a in BD subjects. In addition, they showed an upregulation of miR-34a in induced neurons derived from BD human fibroblast collected from another cohort. Subsequently, they validated the BD risk genes ankyrin-3 (ANK3) and voltage-dependent L-type calcium channel subunit (CACNB3) as direct targets of miR-34a with luciferase reporter assay. Functionally, enhanced miR-34a expression reduced neuronal differentiation and altered neuronal morphology as well as expression of synaptic proteins. On the other hand, reduced miR-34a expression improved dendritic elaboration.
The studies mentioned above suggest that BD patients have a distinct miRNA expression profile; however, there is a significant overlap with SCZ. This is quite relevant. In the future, miRNA profiling may be useful in identifying commonality and distinction between these disorders, both functionally and at pathophysiological levels.
miRNAs and Suicide
MiRNA studies related to suicide are summarized in Table 4 . Using Taqman Low Density Array system, our group was the first to examine miRNA expression changes in BA9 of 18 MDD suicides and 17 nonpsychiatric control subjects (143). We found a global downregulation of miRNAs in MDD subjects. Altogether, we found significant downregulation in 21 miRNAs. Additional 29 miRNAs were also found to be downregulated by >30%; however, they did not reach statistical significance. When the regulation of these downregulated miRNAs was studied in detail, it was observed that many of them were encoded at the same or nearby chromosomal loci. In addition, they shared 5′-seed sequences. This suggests that miRNAs that were downregulated in MDD subjects had overlapping mRNA targets. Several instances were noted where miRNAs were found to be targeting the same genes. Some of the validated target genes included transcription factors, transmembrane and signaling proteins, growth factors, epigenetic modifiers, and apoptotic regulatory proteins. Predicted targets included ubiquitin ligases, CAMK2G, splicing factor NOVA1, and the GABA-A receptor subunit GABRA4. DNMT3b was another protein that was found to be targeted and further validated. DNMT3b is a key gene in epigenetic modifications and has been shown to be involved in MDD pathophysiology (152).
Table 4 miRNA expression changes in postmortem brain and blood samples of suicide subjects.
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Upregulation Downregulation
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.Gorinski et al. (144) examined whether 5-HT1A receptor (5HT1AR) palmitoylation is a mechanism involved in MDD and suicidality. They found that miR-30e expression was increased, while ZDHHC21 expression, which they identified as a major palmitoyl acyltransferase involved in palmitoylation of 5-HT1AR, was reduced in PFC of MDD suicide subjects, suggesting that 5-HT1AR palmitoylation may be key to MDD pathogenesis and treatment. Another mechanistic study by Torres-Berrio et al. (147) examined whether the expression of Netrin-1 guidance cue receptor DCC (deleted in colorectal cancer) gene was associated with resiliency or susceptibility to PFC dysfunctions in MDD suicide via miRNAs. They found a significant correlation between the decreased expression of miR-218 in BA44 of MDD suicide subjects and the elevated expression of DCC. By conducting an animal study, they concluded that miR-218 was associated with susceptibility versus resiliency to stress-related disorders through regulation of DCC expression.
Our group assessed miRNA expression in the synaptosome of BA10 from a cohort of SCZ, MDD, and BD subjects (145). Altogether, eight out of 14 BD subjects, seven out of 15 MDD subjects, and three out of 14 SCZ subjects had died by suicide. The result of comparison between all suicides (across diagnostic categories) and all non-suicide groups showed two upregulated miRNAs (miR-376a and miR-625) and six downregulated miRNAs (miR-152, miR-181a, miR-330-3p, miR-34a, and miR-133b). Based on significance values, miR-152 was found to be strongly associated with suicide. Distinct set of miRNAs were found in all three disorders; however, several miRNAs showed overlapping changes in SCZ and BD subjects. Discrete changes were also noted in MDD and suicide groups. Interestingly, downregulated miRNAs in SCZ group were enriched within the synapse. Follow-up studies in purified synaptosomes by deep sequencing in SCZ group suggested that there was a significant loss of small RNA expression in synaptosomes only for certain sequence lengths within the miRNA range. In addition, a large number of miRNAs (n = 73) were significantly downregulated and only one miRNA was upregulated. Remarkably, greater fold change of miRNAs in SCZ was associated with lower synaptic enrichment ratio in control subjects and vice-versa. Overall, synaptic miRNAs were generally downregulated in SCZ; however, highly synaptically enriched miRNAs showed greater down-regulation. It was concluded that there may be a deficit in synthesis, transport, or processing of miRNAs in SCZ; however, this process may be more selective for those miRNAs that are localized predominantly in the synaptic compartment.
Maussion et al. (146) examined miRNA expression changes in BA10 from 38 suicide subjects across SCZ, MDD, BD, and control subjects. miR-185* and miR-491-3p were found to be upregulated in suicide subjects compared to control subjects. TrkB-T1, one of the transcript variants of TrkB, expression was significantly lowered in suicide subjects and correlated with miR-185* expression. This was specific only for TrkB-T1, but not for TrkB-T2 or TrkB-FL. TrkB has been shown to be involved in suicidal behavior as has been reported by us previously (67). In an effort to reveal the regulation of polyamine system and suicidal behavior, Lopez et al. (153) examined the expression of SAT1 and SMOX in BA44 and found them to be lower in MDD suicide subjects. They selected 10 miRNAs which were predicted to regulate SAT1 and SMOX genes. Of those, four miRNAs (miR-34c-5p, miR-320c, miR-139-5p, and miR-320c) were significantly upregulated and correlated with the polyamine stress response genes (miR-34c-5p and miR-320c with SAT1; miR-139-5p and miR-320c with SMOX). They concluded that polyamine stress response genes including SAT1 and SMOX may be linked to alterations in miRNA networks that are responsive to stress in MDD suicide subjects. In another study, Lopez et al. (150) noted upregulation of miR-425-3p, miR-146-5p, miR-24-3p, and miR-425-3p in ventrolateral prefrontal cortex (vPFC) of MDD suicide subjects. Resulting from in silico prediction and in vitro experiments, they concluded that all four miRNAs were related to the MAPK/Wnt signaling pathways. These signaling systems have been implicated in suicidal behavior (154).
In an effort to examine the regulation of pro-inflammatory cytokine genes in suicidal behavior, we examined the relationship between TNF-α and its regulatory miRNAs (29). We found an increased expression of miR-19a-3p in BA46 of MDD individuals who had died by suicide. The increased expression of miR-19a-3p was also found in PBMC of MDD subjects who had suicidal ideation. Mechanistically, we found that RNA-binding protein HuR helped in stabilizing TNF-α transcript. This occurred apparently by sequestering its 3′ untranslated region from miR-19a-3p-mediated inhibition. The study suggests that miR-19a-3p may be involved in cytokine dysregulation in suicidal individuals. Recently, we also explored miRNA changes in the locus coeruleus (LC) of MDD suicide subjects (148). A total of 10 upregulated and three downregulated miRNAs were detected in these subjects. Based on target gene prediction using the upregulated miRNAs, we narrowed our study to those genes with a strong neuropsychiatric background. We focused on RELN, GSK-3β, MAOA, CHRM1, PLCB1, and GRIK1 and found reduced expression levels for RELN, GSK-3β, and MAOA.
Maheu et al. (149) examined glial cell line-derived neurotrophic factor in MDD suicide subjects and found an isoform-specific decrease in GDNF family receptor alpha 1 (GFRA1) mRNA, which was associated with lower GFRα1a protein levels in basolateral amygdala. They found upregulation in several miRNAs that may target GFRA1 gene. One of them was miR-511. Under the condition of miR-511 overexpression in neural progenitor cells (NPC), they observed that protein expression of GFRα1 was significantly decreased and concluded that GFRα1 is regulated by miR-511 and may be associated with suicidality.
In terms of blood studies associated with suicidality, only one study is available. Sun et al. (151) reported downregulation of miR-34b-5p and miR-369-3p in MDD subjects with suicidal ideation compared to MDD without suicidal ideation. These changes were consistent with our previous postmortem study conducted in BA9 of MDD suicide subjects (143).
|
|
title
|
Long Non-Coding RNAs
|
|
sec
|
Long Non-Coding RNAs in Brain Functions
Long non-coding RNAs (lncRNAs) are defined as RNAs having >200 nucleotides with low (in the form of short peptide) or no protein coding potential (37). LncRNAs are transcribed by RNA Polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs (38). LncRNAs’ lengths span ~100 kilo base-pairs (bp) and are shorter than mRNAs but have longer exons (39–41). They were originally considered to be the products of heterochronic genes (4) that control the temporal dimension of development; however, there are limitations to fully understand the function of lncRNAs from this point of view. Interestingly, the genomic structure of lncRNAs is strongly related to their function (42). In the early nineties, the X-inactive specific transcripts (Xist) and H19 were first discovered as non-protein coding RNAs by exploring cDNA libraries (43, 44). Since then, over 100,000 lncRNA genes have been found and their number is still increasing (45). Recently, several lncRNA functions have been revealed. For example, they participate in chromatin modifications (46, 47); act as ‘sponges’ that prevent miRNA functions (48); act as scaffolds that provide docking sites for proteins (49); serve as activators and suppressors of mRNA transcription (50); and act as regulators of splicing patterns (50). The functions of lncRNAs are depicted in Figure 1 .
Figure 1 Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.In terms of functions in the brain, lncRNAs are strongly related to brain development (51). In this capacity, lncRNAs participate in spatiotemporal regulation of proliferation and differentiation of pluripotent stem cells (21, 52). High-resolution and high-throughput technologies, such as microarray and RNA-sequencing, have helped in examining the number and pattern of lncRNA expression in the brain. Microarray detects the expression of a large number of RNAs simultaneously, whereas RNA-seq detects both known and novel transcripts and quantifies a large dynamic range of expression levels with absolute rather than relative values. Ramos et al. (53) reported that more than 3,600 lncRNAs are expressed among three different brain regions: subventricular zone, olfactory bulb, and dentate gyrus. Clustering analysis revealed that lncRNAs have a tissue-specific expression pattern (39, 54). A study, using microarray analysis, investigated differential lncRNA expression in the temporal cortex ranging from infancy to adulthood (0.92–43.5 years old) and concluded that the expression pattern of lncRNA changes with age (55). At functional levels, several lncRNAs are involved in regulating neuronal development. This occurs through complex interactions between lncRNAs and other factors in transitioning neural stem cell to progenitors and eventually to differentiated neurons. Some of the lncRNAs that promote the differentiation of neural stem cells include Brn1b, RMST, and TUNA (56–58). EVF2, the first found central nervous system-specific lncRNA, regulates the differentiation of GABAergic neurons (18). The GABA system has been shown to be consistently involved in several psychiatric disorders such as SCZ (59–61), MDD (62), and BD (63). Another lncRNA, Pnky, promotes neural proliferation (64, 65). A recent study has shown that antisense lncRNAs also regulate key proteins related to psychiatric disorders. An inhibition of brain-derived neurotrophic factor (BDNF) antisense RNA (BDNF-AS) causes two- to sevenfold increase in BDNF protein level, which leads to neuronal outgrowth, differentiation, survival, and proliferation (66). An interaction between BDNF and neuropsychiatric disorders is well documented (67, 68). In addition, the mechanism of action of antidepressants (69) and electroconvulsive therapy (70) also involve changes in the levels of BDNF, both centrally and peripherally. Not only do lncRNAs impact BDNF, but changes in the expression of a large number of lncRNAs have been shown following 1 h BDNF treatment in cultured neuronal cells (71). This shows that under neuronal environment, a feed forward and feedback loop might exist between neurotrophin signaling and lncRNA expression with the potential to develop effective therapeutic strategy in psychiatric conditions.
|
|
title
|
Long Non-Coding RNAs in Brain Functions
|
|
p
|
Long non-coding RNAs (lncRNAs) are defined as RNAs having >200 nucleotides with low (in the form of short peptide) or no protein coding potential (37). LncRNAs are transcribed by RNA Polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs (38). LncRNAs’ lengths span ~100 kilo base-pairs (bp) and are shorter than mRNAs but have longer exons (39–41). They were originally considered to be the products of heterochronic genes (4) that control the temporal dimension of development; however, there are limitations to fully understand the function of lncRNAs from this point of view. Interestingly, the genomic structure of lncRNAs is strongly related to their function (42). In the early nineties, the X-inactive specific transcripts (Xist) and H19 were first discovered as non-protein coding RNAs by exploring cDNA libraries (43, 44). Since then, over 100,000 lncRNA genes have been found and their number is still increasing (45). Recently, several lncRNA functions have been revealed. For example, they participate in chromatin modifications (46, 47); act as ‘sponges’ that prevent miRNA functions (48); act as scaffolds that provide docking sites for proteins (49); serve as activators and suppressors of mRNA transcription (50); and act as regulators of splicing patterns (50). The functions of lncRNAs are depicted in Figure 1 .
|
|
figure
|
Figure 1 Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.
|
|
label
|
Figure 1
|
|
caption
|
Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.
|
|
p
|
Long non-coding RNA biogenesis and functions. Long non-coding RNAs are transcribed by RNA polymerase II and are processed to mature RNA by the same method as protein-coding mRNAs as detailed in the text. The considerable functions of lncRNAs are: chromatin modification, transcriptional activation/suppression, sponge, and scaffold. The functions of lncRNAs depend on the type of lncRNAs. lncRNA, long non-coding RNA; RNP, ribonucleoprotein.
|
|
p
|
In terms of functions in the brain, lncRNAs are strongly related to brain development (51). In this capacity, lncRNAs participate in spatiotemporal regulation of proliferation and differentiation of pluripotent stem cells (21, 52). High-resolution and high-throughput technologies, such as microarray and RNA-sequencing, have helped in examining the number and pattern of lncRNA expression in the brain. Microarray detects the expression of a large number of RNAs simultaneously, whereas RNA-seq detects both known and novel transcripts and quantifies a large dynamic range of expression levels with absolute rather than relative values. Ramos et al. (53) reported that more than 3,600 lncRNAs are expressed among three different brain regions: subventricular zone, olfactory bulb, and dentate gyrus. Clustering analysis revealed that lncRNAs have a tissue-specific expression pattern (39, 54). A study, using microarray analysis, investigated differential lncRNA expression in the temporal cortex ranging from infancy to adulthood (0.92–43.5 years old) and concluded that the expression pattern of lncRNA changes with age (55). At functional levels, several lncRNAs are involved in regulating neuronal development. This occurs through complex interactions between lncRNAs and other factors in transitioning neural stem cell to progenitors and eventually to differentiated neurons. Some of the lncRNAs that promote the differentiation of neural stem cells include Brn1b, RMST, and TUNA (56–58). EVF2, the first found central nervous system-specific lncRNA, regulates the differentiation of GABAergic neurons (18). The GABA system has been shown to be consistently involved in several psychiatric disorders such as SCZ (59–61), MDD (62), and BD (63). Another lncRNA, Pnky, promotes neural proliferation (64, 65). A recent study has shown that antisense lncRNAs also regulate key proteins related to psychiatric disorders. An inhibition of brain-derived neurotrophic factor (BDNF) antisense RNA (BDNF-AS) causes two- to sevenfold increase in BDNF protein level, which leads to neuronal outgrowth, differentiation, survival, and proliferation (66). An interaction between BDNF and neuropsychiatric disorders is well documented (67, 68). In addition, the mechanism of action of antidepressants (69) and electroconvulsive therapy (70) also involve changes in the levels of BDNF, both centrally and peripherally. Not only do lncRNAs impact BDNF, but changes in the expression of a large number of lncRNAs have been shown following 1 h BDNF treatment in cultured neuronal cells (71). This shows that under neuronal environment, a feed forward and feedback loop might exist between neurotrophin signaling and lncRNA expression with the potential to develop effective therapeutic strategy in psychiatric conditions.
|
|
sec
|
Long Non-Coding RNAs in Psychiatric Disorders
Examining the role of ncRNAs in psychiatric illnesses is an emerging field. Two recent studies used amygdala from SCZ subjects to decipher the role of lncRNAs in this disorder ( Table 1 ). Tian et al. (72) examined lncRNA expression by RNA-seq using 21 SCZ and 24 healthy control subjects. They found alterations in the expression of 345 lncRNAs (104 up- and six downregulated) in SCZ subjects. Subsequently, they divided 21 SCZ subjects into nine undifferentiated, seven disorganized, and five paranoid. Individually, they found 155 up- and 17 downregulated lncRNAs in the undifferentiated SCZ group, 39 up- and six downregulated lncRNAs in the disorganized SCZ subjects, and no significant alteration in paranoid SCZ subjects when compared with control subjects. They performed gene set enrichment analysis to reveal the gene ontology terms associated with dysregulated lncRNAs (all SCZ vs control subjects) and found that dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways. In another amygdala study, Liu et al. (73) used RNA-seq for detecting dysregulation of lncRNAs in 22 SCZ subjects and 24 healthy controls. Transcriptome data identified 250 lncRNAs that showed significant expression differences between SCZ and control subjects. The study further focused on two specific lncRNAs (upregulated RP11-724N1.1 and downregulated RP11-677M14.2), which were shown to be associated with SCZ based on previous genome-wide association study (GWAS). Additional analysis by dividing SCZ subjects into three subtypes revealed the dysregulation of RP11-724N1.1 in the undifferentiated subtype and RP11-677M14.2 in the paranoid subtype. RP11-724N1.1 overlaps the CNNM2 gene locus, which has a key role in the neurodevelopmental process (74). On the other hand, RP11-677M14.2 overlaps the neurogranin (NRGN) gene locus. Several SNPs of the NRGN gene have been associated with onset (75–77), intellectual disability (75), and anterior cingulate cortex (ACC) volume (78) in SCZ subjects. These amygdala studies suggest that not only are lncRNAs involved in SCZ pathophysiology, but they can also differentiate subtypes of SCZ.
Table 1 LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
|
|
title
|
Long Non-Coding RNAs in Psychiatric Disorders
|
|
p
|
Examining the role of ncRNAs in psychiatric illnesses is an emerging field. Two recent studies used amygdala from SCZ subjects to decipher the role of lncRNAs in this disorder ( Table 1 ). Tian et al. (72) examined lncRNA expression by RNA-seq using 21 SCZ and 24 healthy control subjects. They found alterations in the expression of 345 lncRNAs (104 up- and six downregulated) in SCZ subjects. Subsequently, they divided 21 SCZ subjects into nine undifferentiated, seven disorganized, and five paranoid. Individually, they found 155 up- and 17 downregulated lncRNAs in the undifferentiated SCZ group, 39 up- and six downregulated lncRNAs in the disorganized SCZ subjects, and no significant alteration in paranoid SCZ subjects when compared with control subjects. They performed gene set enrichment analysis to reveal the gene ontology terms associated with dysregulated lncRNAs (all SCZ vs control subjects) and found that dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways. In another amygdala study, Liu et al. (73) used RNA-seq for detecting dysregulation of lncRNAs in 22 SCZ subjects and 24 healthy controls. Transcriptome data identified 250 lncRNAs that showed significant expression differences between SCZ and control subjects. The study further focused on two specific lncRNAs (upregulated RP11-724N1.1 and downregulated RP11-677M14.2), which were shown to be associated with SCZ based on previous genome-wide association study (GWAS). Additional analysis by dividing SCZ subjects into three subtypes revealed the dysregulation of RP11-724N1.1 in the undifferentiated subtype and RP11-677M14.2 in the paranoid subtype. RP11-724N1.1 overlaps the CNNM2 gene locus, which has a key role in the neurodevelopmental process (74). On the other hand, RP11-677M14.2 overlaps the neurogranin (NRGN) gene locus. Several SNPs of the NRGN gene have been associated with onset (75–77), intellectual disability (75), and anterior cingulate cortex (ACC) volume (78) in SCZ subjects. These amygdala studies suggest that not only are lncRNAs involved in SCZ pathophysiology, but they can also differentiate subtypes of SCZ.
|
|
table-wrap
|
Table 1 LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
|
|
label
|
Table 1
|
|
caption
|
LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
|
|
p
|
LncRNA expression changes in psychiatric disorders based on postmortem brain studies.
|
|
table
|
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
|
|
tr
|
Brain areas Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
|
|
th
|
Brain areas
|
|
th
|
Sample size
|
|
th
|
Methods
|
|
th
|
lncRNA expression changes
|
|
th
|
lncRNA functions and roles in disease conditions
|
|
th
|
Citations
|
|
tr
|
Upregulation Downregulation
|
|
th
|
Upregulation
|
|
th
|
Downregulation
|
|
tr
|
Amygdala 21 SCZ and 24 Controls RNA-seq 104 lncRNAs AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5 Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways (72)
|
|
td
|
Amygdala
|
|
td
|
21 SCZ and 24 Controls
|
|
td
|
RNA-seq
|
|
td
|
104 lncRNAs
|
|
td
|
AC140542.2,AP001347.6,LINC01011,SOCS2-AS1,AP003774.4,AC004540.5
|
|
td
|
Dysregulated lncRNAs were associated with protein synthesis, blood vessel development, nervous system pathways, and immune system pathways
|
|
td
|
(72)
|
|
tr
|
Amygdala 22 SCZ and 24 Controls RNA-seq 170 lncRNAs 80 lncRNAs Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included (73)
|
|
td
|
Amygdala
|
|
td
|
22 SCZ and 24 Controls
|
|
td
|
RNA-seq
|
|
td
|
170 lncRNAs
|
|
td
|
80 lncRNAs
|
|
td
|
Two important lncRNAs (RP11-724N1.1 and RP11-677M14.2) located in the regions previously associated with SCZ based on GWAS are included
|
|
td
|
(73)
|
|
table-wrap-foot
|
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
|
|
p
|
lncRNA, long non-coding RNA; SCZ, Schizophrenia.
|
|
sec
|
lncRNAs and Suicidal Behavior
There are four studies that show a relationship between suicidal behavior and lncRNA expression changes. Of them, three studies explored lncRNA expression in the brain (one in ACC and two in the dorsolateral prefrontal cortex [dlPFC]), and one in the blood ( Table 2 ). Zhou et al. (79) compared lncRNA expression levels in rostral ACC between 26 MDD suicide and 24 healthy control subjects by RNA-seq. After considering nominal p values (p < 0.05), without multiple testing, 364 out of 2,670 lncRNAs were differentially regulated; of them, 60% (217 lncRNAs) were downregulated. After genome-wide multiple testing, 15 upregulated and eight downregulated lncRNAs reached statistical significance. Potential cis-targets for significantly dysregulated 23 lncRNAs based on RNA-seq data showed that six lncRNAs (RP11-326I11.3 vs IRF2; RP11-273G15.2 vs LY6E; CTD-2647L4.4 vs HMOBX1; CTC-487M23.5 vs REEP5; RP1-269M15.3 vs PTPRT; RP11-96D1.10 vs NFATC3) were significantly correlated with one antisense or overlapping gene. All of them were found to be nominally differentially expressed except REEP5. With an additional qPCR approach, the authors validated three out of five genes (IRF2, LY6E, and HMBOX1). These genes are functionally related to interferon signaling, which plays a key role in CNS homeostasis and in psychiatric disorders (81).
Table 2 LncRNA expression changes in postmortem brain of suicide subjects.
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.Punzi et al. (80) revealed a correlation between violent suicide and lncRNA LOC28758 expression in dlPFC of SCZ subjects that included 77 non-suicides, 13 non-violent suicides, and 16 violent suicides. LOC28758 is located in the MARCKS gene, which was also found to be significantly highly expressed in violent suicides than non-suicides and non-violent suicides. In a recent study, the authors also examined lncRNA expression changes in dlPFC by RNA-seq (28). LINC01268 expression was significantly higher in suicide subjects compared to non-suicide subjects. Note that both suicide and non-suicide groups included three psychiatric disorders (SCZ, MDD, and BD). Subsequently, they divided the suicide groups into violent suicide and non-violent suicide (poisoning or asphyxia = nonviolent; others = violent). The violent suicide group had higher expression of LINC01268 than the non-suicide group, but the non-violent group did not show any change. Additionally, they explored quantitative trait locus (eQTL) of LINC01268 by genotyping 23 SNPs located within 100 kb up and downstream of the gene coordinates. Of those, only rs7747961 could regulate the LINC01268 expression (C-carriers > non-C-carriers). Based on the Brown–Goodwin questionnaire score, they revealed that LINC01268 expression was higher in the aggressive group than in the non-aggressive group. Lastly, weighted correlation network analysis (WGCNA) was performed with RNA-seq data to verify the relationship between LINC01268 and the co-expression gene set. WGCNA is a systems biology method for detecting the modules correlated with clinical traits by a soft-threshold algorithm. A module including 224 genes and LINC01268 was created. It was found that among 224 genes, P2RY13, a purinergic receptor present in both the peripheral immune system and in the brain, had a strong correlation with LINC01268.
One peripheral blood mononuclear cell (PBMC) study was conducted to identify change in lncRNAs in MDD suicide subjects (63 MDD no-suicidal ideation, 57 MDD with suicidal ideation, and 63 control subjects) by qPCR method (30). qPCR method identifies amplified fragments during the PCR process, but only a smaller number of genes can be measured at once compared to RNA-seq or microarray. Six lncRNAs (TCONS_00019174, NST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, and NONHSAT142707), previously confirmed to be downregulated in MDD subjects, were selected for this study. All six lncRNAs were downregulated in MDD with suicidal ideation, compared with MDD no suicidal ideation and control groups. The authors concluded that six lncRNAs may possibly serve as biomarker for suicidal ideation among MDD patients. Another study showed that decreased expression of TCONS_00019174 was associated with depression and expression change was rescued by antidepressant treatment (82). Additionally, an in vitro experiment showed that TCONS_00019174 was negatively correlated with phosphorylated-GSK3β (p-GSK3β) protein and β-catenin. Further, the overexpression of NONHSAG045500 inhibited the expression of serotonin transporter (SERT), while siRNA interference of NONHSAG045500 induced the upregulation of SERT (83). These studies indicate that the peripheral expression change of lncRNAs can have functional relevance and may be worth pursuing in the brain.
|
|
title
|
lncRNAs and Suicidal Behavior
|
|
p
|
There are four studies that show a relationship between suicidal behavior and lncRNA expression changes. Of them, three studies explored lncRNA expression in the brain (one in ACC and two in the dorsolateral prefrontal cortex [dlPFC]), and one in the blood ( Table 2 ). Zhou et al. (79) compared lncRNA expression levels in rostral ACC between 26 MDD suicide and 24 healthy control subjects by RNA-seq. After considering nominal p values (p < 0.05), without multiple testing, 364 out of 2,670 lncRNAs were differentially regulated; of them, 60% (217 lncRNAs) were downregulated. After genome-wide multiple testing, 15 upregulated and eight downregulated lncRNAs reached statistical significance. Potential cis-targets for significantly dysregulated 23 lncRNAs based on RNA-seq data showed that six lncRNAs (RP11-326I11.3 vs IRF2; RP11-273G15.2 vs LY6E; CTD-2647L4.4 vs HMOBX1; CTC-487M23.5 vs REEP5; RP1-269M15.3 vs PTPRT; RP11-96D1.10 vs NFATC3) were significantly correlated with one antisense or overlapping gene. All of them were found to be nominally differentially expressed except REEP5. With an additional qPCR approach, the authors validated three out of five genes (IRF2, LY6E, and HMBOX1). These genes are functionally related to interferon signaling, which plays a key role in CNS homeostasis and in psychiatric disorders (81).
|
|
table-wrap
|
Table 2 LncRNA expression changes in postmortem brain of suicide subjects.
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.
|
|
label
|
Table 2
|
|
caption
|
LncRNA expression changes in postmortem brain of suicide subjects.
|
|
p
|
LncRNA expression changes in postmortem brain of suicide subjects.
|
|
table
|
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
Upregulation Downregulation
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
|
|
tr
|
Brain areas and blood source Sample size Methods lncRNA expression changes lncRNA functions and roles in disease conditions Citations
|
|
th
|
Brain areas and blood source
|
|
th
|
Sample size
|
|
th
|
Methods
|
|
th
|
lncRNA expression changes
|
|
th
|
lncRNA functions and roles in disease conditions
|
|
th
|
Citations
|
|
tr
|
Upregulation Downregulation
|
|
th
|
Upregulation
|
|
th
|
Downregulation
|
|
tr
|
ACC 26 MDD suicide and 24 Controls RNA-seq and qPCR validation SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5 The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR (79)
|
|
td
|
ACC
|
|
td
|
26 MDD suicide and 24 Controls
|
|
td
|
RNA-seq and qPCR validation
|
|
td
|
SNORD3C, LLNLF-65H9.1, RP1-269M15.3, AC006003.3, AC012507.3, AC013460.1, C9orf106, DYX1C1-CCPG1, RP1-63G5.5, RP11-1186N24.5, RP11-1391J7.1, RP11-143K11.5, RP11-273G15.2, RP11-434C1.1 ZNF833P
|
|
td
|
RP11-453F18_B.1, RP11-96D1.10, AC004019.18, CTC-487M23.5, CTD-2647L4.4, RP11-326G21.1, RP11-326I11.3, RP11-326I11.5
|
|
td
|
The target genes Interferon regulatory factor 2 (IRF2, NM_002199), Lymphocyte antigen 6E (LY6E, NM_002346), and heme oxygenase (decycling) 1 (HMBOX1, NM_002133) (RP11-326I11.3, RP11-273G15.2, and CTD-2647L4.4) were successfully validated by qPCR
|
|
td
|
(79)
|
|
tr
|
dlPFC 101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD) RNA-seq LINC01268 Violent suicide group and aggressiveness group had higher expression of LINC01268 (28)
|
|
td
|
dlPFC
|
|
td
|
101 non-suicide, 50 non-violent suicide, 77 violent suicide (SCZ, MDD, and BD)
|
|
td
|
RNA-seq
|
|
td
|
LINC01268
|
|
td
|
Violent suicide group and aggressiveness group had higher expression of LINC01268
|
|
td
|
(28)
|
|
tr
|
dlPFC 77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ) RNA-seq LOC285758 expression was associated with violent suicide (80)
|
|
td
|
dlPFC
|
|
td
|
77 non-suicide, 13 non-violent suicide, and 16 violent suicide (SCZ)
|
|
td
|
RNA-seq
|
|
td
|
LOC285758 expression was associated with violent suicide
|
|
td
|
(80)
|
|
tr
|
PBMC 63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls qPCR TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707 (30)
|
|
td
|
PBMC
|
|
td
|
63 MDD non-suicidal ideation, 57 MDD suicidal ideation, and 63 Controls
|
|
td
|
qPCR
|
|
td
|
TCONS_00019174, ENST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, NONHSAT142707
|
|
td
|
(30)
|
|
table-wrap-foot
|
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.
|
|
p
|
ACC, Anterior Cingulate Cortex; BD, Bipolar Disorder; dlPFC, dorsolateral prefrontal cortex; lncRNA, long non-coding RNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cell; SCZ, Schizophrenia.
|
|
p
|
Punzi et al. (80) revealed a correlation between violent suicide and lncRNA LOC28758 expression in dlPFC of SCZ subjects that included 77 non-suicides, 13 non-violent suicides, and 16 violent suicides. LOC28758 is located in the MARCKS gene, which was also found to be significantly highly expressed in violent suicides than non-suicides and non-violent suicides. In a recent study, the authors also examined lncRNA expression changes in dlPFC by RNA-seq (28). LINC01268 expression was significantly higher in suicide subjects compared to non-suicide subjects. Note that both suicide and non-suicide groups included three psychiatric disorders (SCZ, MDD, and BD). Subsequently, they divided the suicide groups into violent suicide and non-violent suicide (poisoning or asphyxia = nonviolent; others = violent). The violent suicide group had higher expression of LINC01268 than the non-suicide group, but the non-violent group did not show any change. Additionally, they explored quantitative trait locus (eQTL) of LINC01268 by genotyping 23 SNPs located within 100 kb up and downstream of the gene coordinates. Of those, only rs7747961 could regulate the LINC01268 expression (C-carriers > non-C-carriers). Based on the Brown–Goodwin questionnaire score, they revealed that LINC01268 expression was higher in the aggressive group than in the non-aggressive group. Lastly, weighted correlation network analysis (WGCNA) was performed with RNA-seq data to verify the relationship between LINC01268 and the co-expression gene set. WGCNA is a systems biology method for detecting the modules correlated with clinical traits by a soft-threshold algorithm. A module including 224 genes and LINC01268 was created. It was found that among 224 genes, P2RY13, a purinergic receptor present in both the peripheral immune system and in the brain, had a strong correlation with LINC01268.
|
|
p
|
One peripheral blood mononuclear cell (PBMC) study was conducted to identify change in lncRNAs in MDD suicide subjects (63 MDD no-suicidal ideation, 57 MDD with suicidal ideation, and 63 control subjects) by qPCR method (30). qPCR method identifies amplified fragments during the PCR process, but only a smaller number of genes can be measured at once compared to RNA-seq or microarray. Six lncRNAs (TCONS_00019174, NST00000566208, NONHSAG045500, ENST00000517573, NONHSAT034045, and NONHSAT142707), previously confirmed to be downregulated in MDD subjects, were selected for this study. All six lncRNAs were downregulated in MDD with suicidal ideation, compared with MDD no suicidal ideation and control groups. The authors concluded that six lncRNAs may possibly serve as biomarker for suicidal ideation among MDD patients. Another study showed that decreased expression of TCONS_00019174 was associated with depression and expression change was rescued by antidepressant treatment (82). Additionally, an in vitro experiment showed that TCONS_00019174 was negatively correlated with phosphorylated-GSK3β (p-GSK3β) protein and β-catenin. Further, the overexpression of NONHSAG045500 inhibited the expression of serotonin transporter (SERT), while siRNA interference of NONHSAG045500 induced the upregulation of SERT (83). These studies indicate that the peripheral expression change of lncRNAs can have functional relevance and may be worth pursuing in the brain.
|
|
sec
|
microRNAs
MicroRNAs (miRNAs) are the best studied ncRNAs in terms of functionality and relevance to psychiatric illnesses. Averaging 22 nucleotides in length, miRNAs are synthesized via several enzymatic processes. Initially, primary miRNA (pri-miRNA) is transcribed from an encoded gene. Next, RNase III enzyme Drosha generates precursor miRNA (pre-miRNA) by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then translocated to cytoplasm with the help of Exportin-5 (XPO5). In the cytoplasm, dicer, a double-stranded RNA endoribonuclease, converts pre-miRNA into double-stranded mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor (84–88). Finally, one strand of miRNA/miRNA* duplex loads into Argonaute homologue protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complexes mainly work as suppressors of mRNA expression ( Figure 2 ).
Figure 2 MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.Several miRNAs play a key role in modulating synaptic functions and neural structures. Overexpression of miR-125b can disrupt spine structure, whereas sponging of endogenous miR-125b can induce the prolongation of dendritic protrusions (89). Introduction of miR-132 in hippocampal neurons can induce dendrite morphogenesis, which is caused by the regulation of GTPase-activating protein (p250GAP) (90, 91). At the behavioral level, transgenic miR-132 mice show altered cognitive functions through repression of MeCP2 translation, which is implicated in Rett Syndrom and mental retardation (92). The role of miRNAs in various psychiatric illnesses has been studied extensively. A summary of the human postmortem brain miRNA findings in psychiatric illnesses is provided in Table 3 . Below, we discuss miRNA studies in human brain pertaining to SCZ, MDD, and BD as well as suicidal behavior.
Table 3 miRNA expression changes in psychiatric disorders based on postmortem brain studies.
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Up-regulation Down-regulation
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
|
|
title
|
microRNAs
|
|
p
|
MicroRNAs (miRNAs) are the best studied ncRNAs in terms of functionality and relevance to psychiatric illnesses. Averaging 22 nucleotides in length, miRNAs are synthesized via several enzymatic processes. Initially, primary miRNA (pri-miRNA) is transcribed from an encoded gene. Next, RNase III enzyme Drosha generates precursor miRNA (pre-miRNA) by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then translocated to cytoplasm with the help of Exportin-5 (XPO5). In the cytoplasm, dicer, a double-stranded RNA endoribonuclease, converts pre-miRNA into double-stranded mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor (84–88). Finally, one strand of miRNA/miRNA* duplex loads into Argonaute homologue protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complexes mainly work as suppressors of mRNA expression ( Figure 2 ).
|
|
figure
|
Figure 2 MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.
|
|
label
|
Figure 2
|
|
caption
|
MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.
|
|
p
|
MiRNA biogenesis and functions. Primary miRNA is transcribed from encoded gene. RNase III enzyme Drosha generates precursor miRNA by removing the flanking segments and -11 bp stem region of pri-miRNA. Drosha requires DiGeorge syndrome critical region 8 (DGCR8) to complete this process. pre-miRNAs are then transported from nucleus to cytoplasm by a transporter Exportin-5 (XPO5) in a Ran-GTP-dependent manner. In the cytoplasm, Dicer converts pre-miRNA into double-strand mature miRNA. Dicer requires TAR RNA-binding protein (TRBP) as a cofactor. Finally, one strand of miRNA/miRNA* duplex loads onto Argonaute homolog protein (Ago) to make RNA-induced silencing complex (RISC). RISC/miRNA complex mainly works as suppressor of mRNA expression through translational blockage, transcript degradation, and deadenylation.
|
|
p
|
Several miRNAs play a key role in modulating synaptic functions and neural structures. Overexpression of miR-125b can disrupt spine structure, whereas sponging of endogenous miR-125b can induce the prolongation of dendritic protrusions (89). Introduction of miR-132 in hippocampal neurons can induce dendrite morphogenesis, which is caused by the regulation of GTPase-activating protein (p250GAP) (90, 91). At the behavioral level, transgenic miR-132 mice show altered cognitive functions through repression of MeCP2 translation, which is implicated in Rett Syndrom and mental retardation (92). The role of miRNAs in various psychiatric illnesses has been studied extensively. A summary of the human postmortem brain miRNA findings in psychiatric illnesses is provided in Table 3 . Below, we discuss miRNA studies in human brain pertaining to SCZ, MDD, and BD as well as suicidal behavior.
|
|
table-wrap
|
Table 3 miRNA expression changes in psychiatric disorders based on postmortem brain studies.
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Up-regulation Down-regulation
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
|
|
label
|
Table 3
|
|
caption
|
miRNA expression changes in psychiatric disorders based on postmortem brain studies.
|
|
p
|
miRNA expression changes in psychiatric disorders based on postmortem brain studies.
|
|
table
|
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Up-regulation Down-regulation
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
|
|
tr
|
Disease Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
|
|
th
|
Disease
|
|
th
|
Brain areas
|
|
th
|
Sample size
|
|
th
|
Methods
|
|
th
|
miRNA expression changes
|
|
th
|
Successfully validated miRNAs by qPCR
|
|
th
|
miRNA roles and other findings
|
|
th
|
Citations
|
|
tr
|
Up-regulation Down-regulation
|
|
th
|
Up-regulation
|
|
th
|
Down-regulation
|
|
tr
|
SCZ Amygdala 22 SCZ and 24 Controls miRNA-seq miR-196a-2, -1975, -34c, -451, -34a, -375, -144 miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307 miR-1307 locus included rs11191419 previously reported in GWAS (73)
|
|
td
|
SCZ
|
|
td
|
Amygdala
|
|
td
|
22 SCZ and 24 Controls
|
|
td
|
miRNA-seq
|
|
td
|
miR-196a-2, -1975, -34c, -451, -34a, -375, -144
|
|
td
|
miR-663, -639, -132, -124-2, -212, -483, -886, -585, -424, -520d, -1307
|
|
td
|
miR-1307 locus included rs11191419 previously reported in GWAS
|
|
td
|
(73)
|
|
tr
|
BA9 13 SCZ, 2 schizoaffective, and 21 Controls Microarray miR-106b miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p miR-26b, -30b, -92, -24, -30e (93)
|
|
td
|
BA9
|
|
td
|
13 SCZ, 2 schizoaffective, and 21 Controls
|
|
td
|
Microarray
|
|
td
|
miR-106b
|
|
td
|
miR-26b, -30b, -29b, -195, -92, -30a-5p, -30d, -20b, -29c, -29a, -212, -7, -24, -30e, -9-3p
|
|
td
|
miR-26b, -30b, -92, -24, -30e
|
|
td
|
(93)
|
|
tr
|
BA9 35 SCZ, 33 BD, and 33 Controls qPCR 19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD (94)
|
|
td
|
BA9
|
|
td
|
35 SCZ, 33 BD, and 33 Controls
|
|
td
|
qPCR
|
|
td
|
19% of 234 miRNAs and 18 small nucleolar RNAs were changed due to SCZ or BD
|
|
td
|
(94)
|
|
tr
|
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-497 miR-497 Exosome sample (95)
|
|
td
|
BA9
|
|
td
|
8 SCZ, 9 BD, and 13 Controls
|
|
td
|
Microarray
|
|
td
|
miR-497
|
|
td
|
miR-497
|
|
td
|
Exosome sample
|
|
td
|
(95)
|
|
tr
|
BA9 15 SCZ and 15 Controls Microarray Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7 Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7 Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered (96)
|
|
td
|
BA9
|
|
td
|
15 SCZ and 15 Controls
|
|
td
|
Microarray
|
|
td
|
Let-7d, miR-101, -105, -126*, -128a, -153, -16, -181a, -181d, -184, -199a, -20a, -219, -223, -27a, -29c, -302a*, -302b*, -31, -33, -338, -409-3p, -512-3p, -519b, -7
|
|
td
|
Let-7d, miR-128a, -16, -181b, -181a, -20a, -219, -27a, -29c, -7
|
|
td
|
Primary- and precursor-miR-181b and miRNA biogenesis-related enzymes were altered
|
|
td
|
(96)
|
|
tr
|
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-34a, -132, -132*, -212, -544, -7, -154* (97)
|
|
td
|
BA46
|
|
td
|
35 SCZ, 35 BD, and 35 Controls
|
|
td
|
TLDA
|
|
td
|
miR-34a, -132, -132*, -212, -544, -7, -154*
|
|
td
|
(97)
|
|
tr
|
BA46 37 SCZ/schizoaffective and 37 Controls Microarray miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222 miR-512-3p, -423, -193a miR-17, -107, -134, -328, -382, -652 miRNA biogenesis-related enzymes were upregulated (98)
|
|
td
|
BA46
|
|
td
|
37 SCZ/schizoaffective and 37 Controls
|
|
td
|
Microarray
|
|
td
|
miR-519c, -489-3p, -652, -382, -532, -199a*, -17-5p, -542-3p, -199b, -592, -495, 487a, -425-5p, -152, -148b, -134, -150, -105, -187, -154, -767-5p, -548b, -590, -502, -452*, -25, -328, -92b, -433, -222
|
|
td
|
miR-512-3p, -423, -193a
|
|
td
|
miR-17, -107, -134, -328, -382, -652
|
|
td
|
miRNA biogenesis-related enzymes were upregulated
|
|
td
|
(98)
|
|
tr
|
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 (99)
|
|
td
|
BA46
|
|
td
|
35 SCZ, 32 BD, and 34 Controls
|
|
td
|
qPCR
|
|
td
|
miR-346
|
|
td
|
(99)
|
|
tr
|
BA46 34 SCZ and 109 Controls miRNA-seq miR-3162, -936 The correlation-based hierarchical clustering analysis made nine miRNA groups (100)
|
|
td
|
BA46
|
|
td
|
34 SCZ and 109 Controls
|
|
td
|
miRNA-seq
|
|
td
|
miR-3162, -936
|
|
td
|
The correlation-based hierarchical clustering analysis made nine miRNA groups
|
|
td
|
(100)
|
|
tr
|
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-132, -132* miR-132 was downregulated by NMDA antagonist in mice study (101)
|
|
td
|
dlPFC
|
|
td
|
35 SCZ, 31 BD, and 34 Controls
|
|
td
|
Microarray
|
|
td
|
miR-132, -132*
|
|
td
|
miR-132 was downregulated by NMDA antagonist in mice study
|
|
td
|
(101)
|
|
tr
|
dlPFC and several regions 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
|
|
td
|
dlPFC and several regions
|
|
td
|
1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls)
|
|
td
|
qPCR
|
|
td
|
miR-137 was not significantly changed
|
|
td
|
(102)
|
|
tr
|
STG 15 SCZ and 15 Controls Microarray 59 of 274 (21%) miRNAs let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a (96)
|
|
td
|
STG
|
|
td
|
15 SCZ and 15 Controls
|
|
td
|
Microarray
|
|
td
|
59 of 274 (21%) miRNAs
|
|
td
|
let-7e, miR-107, -15a, -15b, -16, -195, -181b, -20a, -26b, -19a
|
|
td
|
(96)
|
|
tr
|
STG 21 SCZ and 21 Controls Microarray let-7g, miR-181b miR-181b Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b (103)
|
|
td
|
STG
|
|
td
|
21 SCZ and 21 Controls
|
|
td
|
Microarray
|
|
td
|
let-7g, miR-181b
|
|
td
|
miR-181b
|
|
td
|
Visinin-like protein 1 (VSNL1, NM_003385) and Glutamate ionotropic receptor AMPA type subunit 2 (GRIA2, NM_000826) genes are potential target of miR-181b
|
|
td
|
(103)
|
|
tr
|
MDD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -184 (104)
|
|
td
|
MDD
|
|
td
|
ACC
|
|
td
|
15 MDD, 8 BD, and 14 Controls
|
|
td
|
qPCR
|
|
td
|
miR-34a, -184
|
|
td
|
(104)
|
|
tr
|
BA44 14 MDD and 11 Controls qPCR miR-1202 miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response (105)
|
|
td
|
BA44
|
|
td
|
14 MDD and 11 Controls
|
|
td
|
qPCR
|
|
td
|
miR-1202
|
|
td
|
miR-1202 regulates the expression of Metabotropic glutamate receptor 4 (GRM4, NM_000841) and predicts antidepressant response
|
|
td
|
(105)
|
|
tr
|
BA46 15 MDD and 15 Controls qPCR miR-124-3p (106)
|
|
td
|
BA46
|
|
td
|
15 MDD and 15 Controls
|
|
td
|
qPCR
|
|
td
|
miR-124-3p
|
|
td
|
(106)
|
|
tr
|
BD ACC 15 MDD, 8 BD, and 14 Controls qPCR miR-34a, -132 -133a, -212 There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a (104)
|
|
td
|
BD
|
|
td
|
ACC
|
|
td
|
15 MDD, 8 BD, and 14 Controls
|
|
td
|
qPCR
|
|
td
|
miR-34a, -132 -133a, -212
|
|
td
|
There was inverse correlation between nuclear receptor coactivator 1 (NCOA1, NM_003743) and miRNA-34a
|
|
td
|
(104)
|
|
tr
|
ACC 5 BD and 6 Controls qPCR miR-149 Glial cell derived exosome samples (107)
|
|
td
|
ACC
|
|
td
|
5 BD and 6 Controls
|
|
td
|
qPCR
|
|
td
|
miR-149
|
|
td
|
Glial cell derived exosome samples
|
|
td
|
(107)
|
|
tr
|
BA9 8 SCZ, 9 BD, and 13 Controls Microarray miR-29c miR-29c Exosome samples (95)
|
|
td
|
BA9
|
|
td
|
8 SCZ, 9 BD, and 13 Controls
|
|
td
|
Microarray
|
|
td
|
miR-29c
|
|
td
|
miR-29c
|
|
td
|
Exosome samples
|
|
td
|
(95)
|
|
tr
|
BA46 35 SCZ, 35 BD, and 35 Controls TLDA miR-22, -133b, -145, -145*, -154*, -504, -889 miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874 (97)
|
|
td
|
BA46
|
|
td
|
35 SCZ, 35 BD, and 35 Controls
|
|
td
|
TLDA
|
|
td
|
miR-22, -133b, -145, -145*, -154*, -504, -889
|
|
td
|
miR-29a, -32, -140-3p, -454*, -520c-3p, -573, -767-5p, -874
|
|
td
|
(97)
|
|
tr
|
BA46 35 SCZ, 32 BD, and 34 Controls qPCR miR-346 was not significantly changed (99)
|
|
td
|
BA46
|
|
td
|
35 SCZ, 32 BD, and 34 Controls
|
|
td
|
qPCR
|
|
td
|
miR-346 was not significantly changed
|
|
td
|
(99)
|
|
tr
|
BA46 1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls) qPCR miR-137 was not significantly changed (102)
|
|
td
|
BA46
|
|
td
|
1st set (7 SCZ, 9 BD, and 10 Controls)2nd set (35 SCZ, 34 BD, and 35 Controls)
|
|
td
|
qPCR
|
|
td
|
miR-137 was not significantly changed
|
|
td
|
(102)
|
|
tr
|
dlPFC 35 SCZ, 31 BD, and 34 Controls Microarray miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p (101)
|
|
td
|
dlPFC
|
|
td
|
35 SCZ, 31 BD, and 34 Controls
|
|
td
|
Microarray
|
|
td
|
miR-32, -188-5p, -187, -196b, -297, -383, -490-5p, -449b, -513-5p, -876-3p
|
|
td
|
(101)
|
|
tr
|
Hippocampus dentate gyrus granule cells 15 SCZ, 15 MDD, 15 BD, and 15 Controls RNA-seq miR-182 was not significantly changed Genotype of rs76481776 affects the miR-1842 expression (108)
|
|
td
|
Hippocampus dentate gyrus granule cells
|
|
td
|
15 SCZ, 15 MDD, 15 BD, and 15 Controls
|
|
td
|
RNA-seq
|
|
td
|
miR-182 was not significantly changed
|
|
td
|
Genotype of rs76481776 affects the miR-1842 expression
|
|
td
|
(108)
|
|
tr
|
Cerebellum 29 BD and 34 Controls qPCR miR-34a Upregulation was also confirmed in induced neurons from human fibroblast (109)
|
|
td
|
Cerebellum
|
|
td
|
29 BD and 34 Controls
|
|
td
|
qPCR
|
|
td
|
miR-34a
|
|
td
|
Upregulation was also confirmed in induced neurons from human fibroblast
|
|
td
|
(109)
|
|
table-wrap-foot
|
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
|
|
p
|
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; dlPFC, Dorsolateral Prefrontal Cortex; miRNA, microRNA; MDD, Major Depressive Disorder; SCZ, Schizophrenia; STG, Superior Temporal Gyrus; TLDA, TaqMan Low Density Arrays.
|
|
sec
|
miRNAs and Schizophrenia
MiR-137 is a well-known miRNA in schizophrenia studies (110). The first report of the involvement of miR-137 came from a GWAS study which linked a risk variant rs1625579 within miR-137 to SCZ (111). A previous study had reported that target genes for miR-137 are associated with activation in the dlPFC (112). Guella et al. (102) subsequently examined miR-137 and its target genes in the dlPFC of SCZ and BD subjects. MiR-137 expression in the dlPFC was not different between diagnoses. Interestingly, when the genotype of rs1625579 was considered, significantly lower miR-137 expression was found along with higher expression of TCF4, a target gene of miR-137, in the homozygous TT subjects compared to TG and GG subjects within the control group. The miR-137 expression was region specific with amygdala and hippocampus having the highest levels. These results suggest that miR-137 and associated TCF4 gene may be risk factors for SCZ. Using miRNA-seq, one amygdala study showed seven upregulated and 11 downregulated miRNAs (73); of them, miR-1307 was located on a locus previously found to be associated with SCZ risk allele rs11191419 in GWAS (113).
Using custom microarray, Perkins et al. (93) studied miRNA expression in BA9 of subjects with SCZ or schizoaffective disorder and compared them with psychiatrically unaffected individuals. The study found 15 downregulated and one upregulated miRNA in these subjects. They further examined sequences in the pri-miRNA motifs of those dysregulated miRNAs and found that several miRNAs shared the same sequence. For example, miR26b, miR-30a, miR-30b, and miR-7-1 had UGAGNCUU upstream sequences, whereas miRNAs miR-9-1, miR-9-2, miR-9-3, miR-7-3, and miR-30e had GUCNCUUC upstream sequences in their corresponding pre-miRNAs. This suggests the possibility that the processing of pri-miRNA to pre-miRNA might be affected, which could eventually be related to miRNA expression changes. Moreau et al. (94) reported that 19% of miRNAs in BA9 were altered based on diagnostic classification among SCZ, BD, and control subjects. Interestingly, all of the downregulated miRNAs in SCZ were downregulated in BD subjects, supporting the similarity of the genetic background between SCZ and BD. Banigan et al. (95) explored miRNA expressions in exosomes of BA9. Based on the microarray data, they validated the upregulation of miR-497. Several studies have shown that exosomes in the CNS may play a role in neuronal communications, nerve regeneration, synaptic plasticity, and immune response (114, 115).
Beveridge et al. (96) detected 25 upregulated miRNAs in BA9 of SCZ subjects; of them, 10 miRNAs (let-7d, miR-128a, miR-16, miR-181b, miR-181a, miR-20a, miR-219, miR-27a, miR-29c, and miR-7) were validated with qPCR. They also revealed that the biogenesis of miR-181b was perturbed in SCZ possibly due to the altered expression of pri- and pre-miR-181b and miRNA biogenesis-related enzymes DGCR8, DROSHA, and DICER1. Kim et al. (97) detected 7 upregulated miRNAs in another prefrontal cortical area BA46 of SCZ subjects. Of them, miR-132 was highly expressed in the forebrain and was regulated by cAMP response element-binding (CREB) and extracellular signal regulated kinase (ERK) signaling. Both CREB and ERK are targets of antipsychotic drugs (91, 116). On the contrary, Miller et al. (101) reported downregulation of miR-132 in dlPFC of SCZ subjects. The authors found that NMDA antagonist, when administered to adult mice, resulted in lower expression of miR-132 in the prefrontal cortex. Since miR-132 is highly expressed in the postnatal period, a period of synaptic pruning thought to be related to the mechanism of neurodevelopmental susceptibility to SCZ through NMDAR signaling (91), it was concluded that dysregulation in miR-132 and associated target genes may contribute to the neurodevelopmental and morphological abnormalities shown in SCZ.
Santarelli et al. (98) investigated miRNA expression in BA 46 of subjects with SCZ and schizoaffective disorder. They found differential regulation of 28 miRNA in the SCZ group compared to controls. Of them, six miRNAs (miR-17, miR-107, miR-134, miR-328, miR-382, and miR-652) were validated by qPCR. They also found increased expressions of miRNA biogenesis enzymes DGCR8, DROSHA, and DICER1 and concluded that miRNA changes may occur due to disruption in mRNA biogenesis. In another study, Zhu et al. (99) found lower expression of miR-346 in BA46 of SCZ subjects. Interestingly, miR-346 is positioned in intron 2 of the glutamate receptor ionotropic delta 1 (GRID1) gene, which was found to be downregulated in SCZ subjects. GRID1 is an important gene related to SCZ susceptibility (117). Recently, temporal dynamics of miRNA expression in dlPFC as well and their dysregulation was studied in SCZ subjects (100). It was found that miRNAs that were enriched in infants were upregulated, and those enriched in prepuberty were downregulated in SCZ. The targets of these miRNAs included genes encoding for synaptic proteins and were found to be altered in SCZ subjects. In addition, a significant upregulation in the expression of miR-3162 and miR-936 was noted. These results suggest the miRNAs may participate in the development of dlPFC. In addition, miRNAs that are enriched in infancy and prepuberty may be critical in the deployment of SCZ pathology.
Two other reports which used superior temporal gyrus (STG) also linked miRNA abnormalities to SCZ (96, 103). Both studies showed upregulation of miR-181b in SCZ subjects. Using reporter assay, one study revealed that miR-181b could regulate VSNL1 and GRIA2 genes (103). Expression changes in GRIA2 have been reported in BA46 (118) and the medial temporal lobe (119, 120) of SCZ subjects.
|
|
title
|
miRNAs and Schizophrenia
|
|
p
|
MiR-137 is a well-known miRNA in schizophrenia studies (110). The first report of the involvement of miR-137 came from a GWAS study which linked a risk variant rs1625579 within miR-137 to SCZ (111). A previous study had reported that target genes for miR-137 are associated with activation in the dlPFC (112). Guella et al. (102) subsequently examined miR-137 and its target genes in the dlPFC of SCZ and BD subjects. MiR-137 expression in the dlPFC was not different between diagnoses. Interestingly, when the genotype of rs1625579 was considered, significantly lower miR-137 expression was found along with higher expression of TCF4, a target gene of miR-137, in the homozygous TT subjects compared to TG and GG subjects within the control group. The miR-137 expression was region specific with amygdala and hippocampus having the highest levels. These results suggest that miR-137 and associated TCF4 gene may be risk factors for SCZ. Using miRNA-seq, one amygdala study showed seven upregulated and 11 downregulated miRNAs (73); of them, miR-1307 was located on a locus previously found to be associated with SCZ risk allele rs11191419 in GWAS (113).
|
|
p
|
Using custom microarray, Perkins et al. (93) studied miRNA expression in BA9 of subjects with SCZ or schizoaffective disorder and compared them with psychiatrically unaffected individuals. The study found 15 downregulated and one upregulated miRNA in these subjects. They further examined sequences in the pri-miRNA motifs of those dysregulated miRNAs and found that several miRNAs shared the same sequence. For example, miR26b, miR-30a, miR-30b, and miR-7-1 had UGAGNCUU upstream sequences, whereas miRNAs miR-9-1, miR-9-2, miR-9-3, miR-7-3, and miR-30e had GUCNCUUC upstream sequences in their corresponding pre-miRNAs. This suggests the possibility that the processing of pri-miRNA to pre-miRNA might be affected, which could eventually be related to miRNA expression changes. Moreau et al. (94) reported that 19% of miRNAs in BA9 were altered based on diagnostic classification among SCZ, BD, and control subjects. Interestingly, all of the downregulated miRNAs in SCZ were downregulated in BD subjects, supporting the similarity of the genetic background between SCZ and BD. Banigan et al. (95) explored miRNA expressions in exosomes of BA9. Based on the microarray data, they validated the upregulation of miR-497. Several studies have shown that exosomes in the CNS may play a role in neuronal communications, nerve regeneration, synaptic plasticity, and immune response (114, 115).
|
|
p
|
Beveridge et al. (96) detected 25 upregulated miRNAs in BA9 of SCZ subjects; of them, 10 miRNAs (let-7d, miR-128a, miR-16, miR-181b, miR-181a, miR-20a, miR-219, miR-27a, miR-29c, and miR-7) were validated with qPCR. They also revealed that the biogenesis of miR-181b was perturbed in SCZ possibly due to the altered expression of pri- and pre-miR-181b and miRNA biogenesis-related enzymes DGCR8, DROSHA, and DICER1. Kim et al. (97) detected 7 upregulated miRNAs in another prefrontal cortical area BA46 of SCZ subjects. Of them, miR-132 was highly expressed in the forebrain and was regulated by cAMP response element-binding (CREB) and extracellular signal regulated kinase (ERK) signaling. Both CREB and ERK are targets of antipsychotic drugs (91, 116). On the contrary, Miller et al. (101) reported downregulation of miR-132 in dlPFC of SCZ subjects. The authors found that NMDA antagonist, when administered to adult mice, resulted in lower expression of miR-132 in the prefrontal cortex. Since miR-132 is highly expressed in the postnatal period, a period of synaptic pruning thought to be related to the mechanism of neurodevelopmental susceptibility to SCZ through NMDAR signaling (91), it was concluded that dysregulation in miR-132 and associated target genes may contribute to the neurodevelopmental and morphological abnormalities shown in SCZ.
|
|
p
|
Santarelli et al. (98) investigated miRNA expression in BA 46 of subjects with SCZ and schizoaffective disorder. They found differential regulation of 28 miRNA in the SCZ group compared to controls. Of them, six miRNAs (miR-17, miR-107, miR-134, miR-328, miR-382, and miR-652) were validated by qPCR. They also found increased expressions of miRNA biogenesis enzymes DGCR8, DROSHA, and DICER1 and concluded that miRNA changes may occur due to disruption in mRNA biogenesis. In another study, Zhu et al. (99) found lower expression of miR-346 in BA46 of SCZ subjects. Interestingly, miR-346 is positioned in intron 2 of the glutamate receptor ionotropic delta 1 (GRID1) gene, which was found to be downregulated in SCZ subjects. GRID1 is an important gene related to SCZ susceptibility (117). Recently, temporal dynamics of miRNA expression in dlPFC as well and their dysregulation was studied in SCZ subjects (100). It was found that miRNAs that were enriched in infants were upregulated, and those enriched in prepuberty were downregulated in SCZ. The targets of these miRNAs included genes encoding for synaptic proteins and were found to be altered in SCZ subjects. In addition, a significant upregulation in the expression of miR-3162 and miR-936 was noted. These results suggest the miRNAs may participate in the development of dlPFC. In addition, miRNAs that are enriched in infancy and prepuberty may be critical in the deployment of SCZ pathology.
|
|
p
|
Two other reports which used superior temporal gyrus (STG) also linked miRNA abnormalities to SCZ (96, 103). Both studies showed upregulation of miR-181b in SCZ subjects. Using reporter assay, one study revealed that miR-181b could regulate VSNL1 and GRIA2 genes (103). Expression changes in GRIA2 have been reported in BA46 (118) and the medial temporal lobe (119, 120) of SCZ subjects.
|
|
sec
|
miRNAs and Major Depressive Disorder
A number of studies have linked miRNA changes to major depressive disorder (MDD) pathophysiology. Azevedo et al. (104) analyzed select 29 miRNAs by qPCR in ACC of subjects with MDD, BD, and control subjects. They found that miR-132, miR-133a, and miR-212 were differentially regulated in BD, miR-184 in MDD, and miR-34a in both MDD and BD. None of the miRNAs survived significance after multiple corrections. In silico analysis identified NCOA1, NCOA2, and PDE4B as a target of miR-34a, while NCOA2 and PDE4B were targeted by miR-184. Further qPCR analyses showed that NCOA1 had an inverse relationship with miR-34a in BD, while NCOR2 had a positive relationship with MDD. It is pertinent to mention that both NCOA1 and NCOR2 regulate the GR-mediated transcription of corticotropin-releasing hormone, a risk gene for stress-related psychiatric illnesses (121).
Lopez et al. (105) studied miRNA expression in the ventrolateral prefrontal cortex (vmPFC) of depressed individuals and found that primate-specific and human brain enriched miR-1202 was the most differentially regulated miRNA in MDD subjects. They found that miR-1202 regulated the expression of gene encoding metabotropic glutamate receptor-4 (GRM4). A recent report suggests that GRM4 3′ UTR variant (rs2229901) is associated with MDD risk (122). Interestingly, the antidepressant treatment induced miR-1202 expression and downregulated GRM4 expression (105). These results suggest that miR-1202 may be associated with MDD and may serve as target for new drug development.
It has been reported that miR-124-3p is highly expressed specifically in the brain (123), and has neuron-specific expression (124–126). Our group reported a significant upregulation in miR-124-3p expression in BA46 of depressed individuals (106). In silico prediction suggested that AMPA/NMDA receptors are major targets of miR-124-3p. Of them, expression changes for GRIA2 in dlPFC (127), GRIA3 in dentate gyrus (128) and PFC (129), and GRIA4 in PFC (129, 130) have been found in depressed individuals.
|
|
title
|
miRNAs and Major Depressive Disorder
|
|
p
|
A number of studies have linked miRNA changes to major depressive disorder (MDD) pathophysiology. Azevedo et al. (104) analyzed select 29 miRNAs by qPCR in ACC of subjects with MDD, BD, and control subjects. They found that miR-132, miR-133a, and miR-212 were differentially regulated in BD, miR-184 in MDD, and miR-34a in both MDD and BD. None of the miRNAs survived significance after multiple corrections. In silico analysis identified NCOA1, NCOA2, and PDE4B as a target of miR-34a, while NCOA2 and PDE4B were targeted by miR-184. Further qPCR analyses showed that NCOA1 had an inverse relationship with miR-34a in BD, while NCOR2 had a positive relationship with MDD. It is pertinent to mention that both NCOA1 and NCOR2 regulate the GR-mediated transcription of corticotropin-releasing hormone, a risk gene for stress-related psychiatric illnesses (121).
|
|
p
|
Lopez et al. (105) studied miRNA expression in the ventrolateral prefrontal cortex (vmPFC) of depressed individuals and found that primate-specific and human brain enriched miR-1202 was the most differentially regulated miRNA in MDD subjects. They found that miR-1202 regulated the expression of gene encoding metabotropic glutamate receptor-4 (GRM4). A recent report suggests that GRM4 3′ UTR variant (rs2229901) is associated with MDD risk (122). Interestingly, the antidepressant treatment induced miR-1202 expression and downregulated GRM4 expression (105). These results suggest that miR-1202 may be associated with MDD and may serve as target for new drug development.
|
|
p
|
It has been reported that miR-124-3p is highly expressed specifically in the brain (123), and has neuron-specific expression (124–126). Our group reported a significant upregulation in miR-124-3p expression in BA46 of depressed individuals (106). In silico prediction suggested that AMPA/NMDA receptors are major targets of miR-124-3p. Of them, expression changes for GRIA2 in dlPFC (127), GRIA3 in dentate gyrus (128) and PFC (129), and GRIA4 in PFC (129, 130) have been found in depressed individuals.
|
|
sec
|
miRNAs and Bipolar Disorder
Compared to MDD, postmortem brain studies of miRNAs in bipolar disorder are limited. Azevedo et al. (104) reported downregulation of 4 miRNAs (miR-34a, miR-132, miR-133a, and miR-212) in ACC of BD subjects. miR-34a was correlated with PDE4B expression in BD. PDE4B expression changes have been found in several psychiatric disorders including SCZ (131, 132), MDD (133), and BD (134). Another ACC (BA24) study conducted by Choi et al. (107) explored expression changes in five miRNAs (miR-29c, miR-31, miR-15b, miR-497, miR-219, and miR-149) in glial exosomes. They found that miR-149 was significantly upregulated in BD subjects. Since miR-149 inhibits glial proliferation, an increase in miR-149 may be associated with previously reported reduced glial cell numbers in BA24 of patients diagnosed with BD (135).
Banigan et al. (95) explored exosomal miRNA expression in BA9 of patients diagnosed with BD and found that miR-29c expression was significantly increased. miR-29c regulates canonical Wnt signaling (136). Wnt signaling is linked to BD pathogenesis such that lithium impairs GSK-3β expression, a component of Wnt signaling system (137). Kim et al. (97) investigated the expression of 667 miRNAs in the PFC of individuals with SCZ and BD using Taqman Low Density Array system. They found downregulation of seven miRNAs in SCZ and 15 miRNAs in BD. These miRNAs targeted genes within the networks overrepresented for neurodevelopment, behavior, and SCZ and BD development (97).
Genetic similarities between SCZ and BD have been well documented (138). The overlapping miRNA changes between SCZ and BD may explain the genetic similarity. In the study by Kim et al. (97), miR-154* showed downregulation in PFC of both SCZ and BD subjects. Kohen et al. (108) investigated transcriptomic changes in the dentate gyrus (DG) granule cells of hippocampus in subjects with SCZ, MDD, BD, and nonpsychiatric controls. One miRNA that stood out was miR-182. MiR-182 is involved in several biological processes such as immune response (139), DNA repair (140), and the regeneration of peripheral nerves after injury (141, 142), which play key roles in BD pathogenesis. Carriers of different genotypes among subjects with SCZ and MDD had a loss of DG miR-182 signaling. Interestingly, carriers of high (C/C) vs low-expressing genotype (C/T or T/T) of rs76481776 in both controls and BD subjects, which is located in miR-182, had different levels of miR-182 target gene expression. This suggests that miR-182 may play a critical role in shaping the DG transcriptome based on genotype. Bavamian et al. (109) studied miRNA expression changes in cerebellum and reported an increased expression of miR-34a in BD subjects. In addition, they showed an upregulation of miR-34a in induced neurons derived from BD human fibroblast collected from another cohort. Subsequently, they validated the BD risk genes ankyrin-3 (ANK3) and voltage-dependent L-type calcium channel subunit (CACNB3) as direct targets of miR-34a with luciferase reporter assay. Functionally, enhanced miR-34a expression reduced neuronal differentiation and altered neuronal morphology as well as expression of synaptic proteins. On the other hand, reduced miR-34a expression improved dendritic elaboration.
The studies mentioned above suggest that BD patients have a distinct miRNA expression profile; however, there is a significant overlap with SCZ. This is quite relevant. In the future, miRNA profiling may be useful in identifying commonality and distinction between these disorders, both functionally and at pathophysiological levels.
|
|
title
|
miRNAs and Bipolar Disorder
|
|
p
|
Compared to MDD, postmortem brain studies of miRNAs in bipolar disorder are limited. Azevedo et al. (104) reported downregulation of 4 miRNAs (miR-34a, miR-132, miR-133a, and miR-212) in ACC of BD subjects. miR-34a was correlated with PDE4B expression in BD. PDE4B expression changes have been found in several psychiatric disorders including SCZ (131, 132), MDD (133), and BD (134). Another ACC (BA24) study conducted by Choi et al. (107) explored expression changes in five miRNAs (miR-29c, miR-31, miR-15b, miR-497, miR-219, and miR-149) in glial exosomes. They found that miR-149 was significantly upregulated in BD subjects. Since miR-149 inhibits glial proliferation, an increase in miR-149 may be associated with previously reported reduced glial cell numbers in BA24 of patients diagnosed with BD (135).
|
|
p
|
Banigan et al. (95) explored exosomal miRNA expression in BA9 of patients diagnosed with BD and found that miR-29c expression was significantly increased. miR-29c regulates canonical Wnt signaling (136). Wnt signaling is linked to BD pathogenesis such that lithium impairs GSK-3β expression, a component of Wnt signaling system (137). Kim et al. (97) investigated the expression of 667 miRNAs in the PFC of individuals with SCZ and BD using Taqman Low Density Array system. They found downregulation of seven miRNAs in SCZ and 15 miRNAs in BD. These miRNAs targeted genes within the networks overrepresented for neurodevelopment, behavior, and SCZ and BD development (97).
|
|
p
|
Genetic similarities between SCZ and BD have been well documented (138). The overlapping miRNA changes between SCZ and BD may explain the genetic similarity. In the study by Kim et al. (97), miR-154* showed downregulation in PFC of both SCZ and BD subjects. Kohen et al. (108) investigated transcriptomic changes in the dentate gyrus (DG) granule cells of hippocampus in subjects with SCZ, MDD, BD, and nonpsychiatric controls. One miRNA that stood out was miR-182. MiR-182 is involved in several biological processes such as immune response (139), DNA repair (140), and the regeneration of peripheral nerves after injury (141, 142), which play key roles in BD pathogenesis. Carriers of different genotypes among subjects with SCZ and MDD had a loss of DG miR-182 signaling. Interestingly, carriers of high (C/C) vs low-expressing genotype (C/T or T/T) of rs76481776 in both controls and BD subjects, which is located in miR-182, had different levels of miR-182 target gene expression. This suggests that miR-182 may play a critical role in shaping the DG transcriptome based on genotype. Bavamian et al. (109) studied miRNA expression changes in cerebellum and reported an increased expression of miR-34a in BD subjects. In addition, they showed an upregulation of miR-34a in induced neurons derived from BD human fibroblast collected from another cohort. Subsequently, they validated the BD risk genes ankyrin-3 (ANK3) and voltage-dependent L-type calcium channel subunit (CACNB3) as direct targets of miR-34a with luciferase reporter assay. Functionally, enhanced miR-34a expression reduced neuronal differentiation and altered neuronal morphology as well as expression of synaptic proteins. On the other hand, reduced miR-34a expression improved dendritic elaboration.
|
|
p
|
The studies mentioned above suggest that BD patients have a distinct miRNA expression profile; however, there is a significant overlap with SCZ. This is quite relevant. In the future, miRNA profiling may be useful in identifying commonality and distinction between these disorders, both functionally and at pathophysiological levels.
|
|
sec
|
miRNAs and Suicide
MiRNA studies related to suicide are summarized in Table 4 . Using Taqman Low Density Array system, our group was the first to examine miRNA expression changes in BA9 of 18 MDD suicides and 17 nonpsychiatric control subjects (143). We found a global downregulation of miRNAs in MDD subjects. Altogether, we found significant downregulation in 21 miRNAs. Additional 29 miRNAs were also found to be downregulated by >30%; however, they did not reach statistical significance. When the regulation of these downregulated miRNAs was studied in detail, it was observed that many of them were encoded at the same or nearby chromosomal loci. In addition, they shared 5′-seed sequences. This suggests that miRNAs that were downregulated in MDD subjects had overlapping mRNA targets. Several instances were noted where miRNAs were found to be targeting the same genes. Some of the validated target genes included transcription factors, transmembrane and signaling proteins, growth factors, epigenetic modifiers, and apoptotic regulatory proteins. Predicted targets included ubiquitin ligases, CAMK2G, splicing factor NOVA1, and the GABA-A receptor subunit GABRA4. DNMT3b was another protein that was found to be targeted and further validated. DNMT3b is a key gene in epigenetic modifications and has been shown to be involved in MDD pathophysiology (152).
Table 4 miRNA expression changes in postmortem brain and blood samples of suicide subjects.
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Upregulation Downregulation
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.Gorinski et al. (144) examined whether 5-HT1A receptor (5HT1AR) palmitoylation is a mechanism involved in MDD and suicidality. They found that miR-30e expression was increased, while ZDHHC21 expression, which they identified as a major palmitoyl acyltransferase involved in palmitoylation of 5-HT1AR, was reduced in PFC of MDD suicide subjects, suggesting that 5-HT1AR palmitoylation may be key to MDD pathogenesis and treatment. Another mechanistic study by Torres-Berrio et al. (147) examined whether the expression of Netrin-1 guidance cue receptor DCC (deleted in colorectal cancer) gene was associated with resiliency or susceptibility to PFC dysfunctions in MDD suicide via miRNAs. They found a significant correlation between the decreased expression of miR-218 in BA44 of MDD suicide subjects and the elevated expression of DCC. By conducting an animal study, they concluded that miR-218 was associated with susceptibility versus resiliency to stress-related disorders through regulation of DCC expression.
Our group assessed miRNA expression in the synaptosome of BA10 from a cohort of SCZ, MDD, and BD subjects (145). Altogether, eight out of 14 BD subjects, seven out of 15 MDD subjects, and three out of 14 SCZ subjects had died by suicide. The result of comparison between all suicides (across diagnostic categories) and all non-suicide groups showed two upregulated miRNAs (miR-376a and miR-625) and six downregulated miRNAs (miR-152, miR-181a, miR-330-3p, miR-34a, and miR-133b). Based on significance values, miR-152 was found to be strongly associated with suicide. Distinct set of miRNAs were found in all three disorders; however, several miRNAs showed overlapping changes in SCZ and BD subjects. Discrete changes were also noted in MDD and suicide groups. Interestingly, downregulated miRNAs in SCZ group were enriched within the synapse. Follow-up studies in purified synaptosomes by deep sequencing in SCZ group suggested that there was a significant loss of small RNA expression in synaptosomes only for certain sequence lengths within the miRNA range. In addition, a large number of miRNAs (n = 73) were significantly downregulated and only one miRNA was upregulated. Remarkably, greater fold change of miRNAs in SCZ was associated with lower synaptic enrichment ratio in control subjects and vice-versa. Overall, synaptic miRNAs were generally downregulated in SCZ; however, highly synaptically enriched miRNAs showed greater down-regulation. It was concluded that there may be a deficit in synthesis, transport, or processing of miRNAs in SCZ; however, this process may be more selective for those miRNAs that are localized predominantly in the synaptic compartment.
Maussion et al. (146) examined miRNA expression changes in BA10 from 38 suicide subjects across SCZ, MDD, BD, and control subjects. miR-185* and miR-491-3p were found to be upregulated in suicide subjects compared to control subjects. TrkB-T1, one of the transcript variants of TrkB, expression was significantly lowered in suicide subjects and correlated with miR-185* expression. This was specific only for TrkB-T1, but not for TrkB-T2 or TrkB-FL. TrkB has been shown to be involved in suicidal behavior as has been reported by us previously (67). In an effort to reveal the regulation of polyamine system and suicidal behavior, Lopez et al. (153) examined the expression of SAT1 and SMOX in BA44 and found them to be lower in MDD suicide subjects. They selected 10 miRNAs which were predicted to regulate SAT1 and SMOX genes. Of those, four miRNAs (miR-34c-5p, miR-320c, miR-139-5p, and miR-320c) were significantly upregulated and correlated with the polyamine stress response genes (miR-34c-5p and miR-320c with SAT1; miR-139-5p and miR-320c with SMOX). They concluded that polyamine stress response genes including SAT1 and SMOX may be linked to alterations in miRNA networks that are responsive to stress in MDD suicide subjects. In another study, Lopez et al. (150) noted upregulation of miR-425-3p, miR-146-5p, miR-24-3p, and miR-425-3p in ventrolateral prefrontal cortex (vPFC) of MDD suicide subjects. Resulting from in silico prediction and in vitro experiments, they concluded that all four miRNAs were related to the MAPK/Wnt signaling pathways. These signaling systems have been implicated in suicidal behavior (154).
In an effort to examine the regulation of pro-inflammatory cytokine genes in suicidal behavior, we examined the relationship between TNF-α and its regulatory miRNAs (29). We found an increased expression of miR-19a-3p in BA46 of MDD individuals who had died by suicide. The increased expression of miR-19a-3p was also found in PBMC of MDD subjects who had suicidal ideation. Mechanistically, we found that RNA-binding protein HuR helped in stabilizing TNF-α transcript. This occurred apparently by sequestering its 3′ untranslated region from miR-19a-3p-mediated inhibition. The study suggests that miR-19a-3p may be involved in cytokine dysregulation in suicidal individuals. Recently, we also explored miRNA changes in the locus coeruleus (LC) of MDD suicide subjects (148). A total of 10 upregulated and three downregulated miRNAs were detected in these subjects. Based on target gene prediction using the upregulated miRNAs, we narrowed our study to those genes with a strong neuropsychiatric background. We focused on RELN, GSK-3β, MAOA, CHRM1, PLCB1, and GRIK1 and found reduced expression levels for RELN, GSK-3β, and MAOA.
Maheu et al. (149) examined glial cell line-derived neurotrophic factor in MDD suicide subjects and found an isoform-specific decrease in GDNF family receptor alpha 1 (GFRA1) mRNA, which was associated with lower GFRα1a protein levels in basolateral amygdala. They found upregulation in several miRNAs that may target GFRA1 gene. One of them was miR-511. Under the condition of miR-511 overexpression in neural progenitor cells (NPC), they observed that protein expression of GFRα1 was significantly decreased and concluded that GFRα1 is regulated by miR-511 and may be associated with suicidality.
In terms of blood studies associated with suicidality, only one study is available. Sun et al. (151) reported downregulation of miR-34b-5p and miR-369-3p in MDD subjects with suicidal ideation compared to MDD without suicidal ideation. These changes were consistent with our previous postmortem study conducted in BA9 of MDD suicide subjects (143).
|
|
title
|
miRNAs and Suicide
|
|
p
|
MiRNA studies related to suicide are summarized in Table 4 . Using Taqman Low Density Array system, our group was the first to examine miRNA expression changes in BA9 of 18 MDD suicides and 17 nonpsychiatric control subjects (143). We found a global downregulation of miRNAs in MDD subjects. Altogether, we found significant downregulation in 21 miRNAs. Additional 29 miRNAs were also found to be downregulated by >30%; however, they did not reach statistical significance. When the regulation of these downregulated miRNAs was studied in detail, it was observed that many of them were encoded at the same or nearby chromosomal loci. In addition, they shared 5′-seed sequences. This suggests that miRNAs that were downregulated in MDD subjects had overlapping mRNA targets. Several instances were noted where miRNAs were found to be targeting the same genes. Some of the validated target genes included transcription factors, transmembrane and signaling proteins, growth factors, epigenetic modifiers, and apoptotic regulatory proteins. Predicted targets included ubiquitin ligases, CAMK2G, splicing factor NOVA1, and the GABA-A receptor subunit GABRA4. DNMT3b was another protein that was found to be targeted and further validated. DNMT3b is a key gene in epigenetic modifications and has been shown to be involved in MDD pathophysiology (152).
|
|
table-wrap
|
Table 4 miRNA expression changes in postmortem brain and blood samples of suicide subjects.
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Upregulation Downregulation
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.
|
|
label
|
Table 4
|
|
caption
|
miRNA expression changes in postmortem brain and blood samples of suicide subjects.
|
|
p
|
miRNA expression changes in postmortem brain and blood samples of suicide subjects.
|
|
table
|
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
Upregulation Downregulation
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
|
|
tr
|
Brain areas Sample size Methods miRNA expression changes Successfully validated miRNAs by qPCR miRNA roles and other findings Citations
|
|
th
|
Brain areas
|
|
th
|
Sample size
|
|
th
|
Methods
|
|
th
|
miRNA expression changes
|
|
th
|
Successfully validated miRNAs by qPCR
|
|
th
|
miRNA roles and other findings
|
|
th
|
Citations
|
|
tr
|
Upregulation Downregulation
|
|
th
|
Upregulation
|
|
th
|
Downregulation
|
|
tr
|
BA9 18 MDD suicide and 17 Controls TLDA miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression (143)
|
|
td
|
BA9
|
|
td
|
18 MDD suicide and 17 Controls
|
|
td
|
TLDA
|
|
td
|
miR-142-5p, -137, -489, -148b, -101, -324-5p, -301a, -146a, -335, -494, -20b, -376a*, -190, -155, -660, -130a, -27a, -497, -10a, -20a, -142-3p
|
|
td
|
DNA (cytosine-5-)-methyltransferase 3 beta (DNMT3b) protein expression was significantly correlated with miR-148b expression
|
|
td
|
(143)
|
|
tr
|
BA9 10 MDD suicide and 9 Controls qPCR miR-30a, -30e miR-200a (144)
|
|
td
|
BA9
|
|
td
|
10 MDD suicide and 9 Controls
|
|
td
|
qPCR
|
|
td
|
miR-30a, -30e
|
|
td
|
miR-200a
|
|
td
|
(144)
|
|
tr
|
BA10 15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls TLDA miR-376a, -625 miR-152, -181a, -330-3p, -34a, -133b miR-17-5p, -145-5p, -219-2-3p Synaptosome samples (145)
|
|
td
|
BA10
|
|
td
|
15 SCZ (4 suicide), 15 MDD (7 suicide), 15 BD (9 suicide), and 15 Controls
|
|
td
|
TLDA
|
|
td
|
miR-376a, -625
|
|
td
|
miR-152, -181a, -330-3p, -34a, -133b
|
|
td
|
miR-17-5p, -145-5p, -219-2-3p
|
|
td
|
Synaptosome samples
|
|
td
|
(145)
|
|
tr
|
BA10 38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls qPCR miR-185*, 491-3p TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments (146)
|
|
td
|
BA10
|
|
td
|
38 suicide (4 SCZ, 23 MDD, 1 BD, and 6 subjects who did not have psychopathology) and 17 Controls
|
|
td
|
qPCR
|
|
td
|
miR-185*, 491-3p
|
|
td
|
TrkB-T1 (TrkB isoform) is a potential target of miR-185* validated by in vitro experiments
|
|
td
|
(146)
|
|
tr
|
BA44 15 MDD suicide and 16 Controls qPCR miR-139-5p, -195, -320c, -34c-5p There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691]) (105)
|
|
td
|
BA44
|
|
td
|
15 MDD suicide and 16 Controls
|
|
td
|
qPCR
|
|
td
|
miR-139-5p, -195, -320c, -34c-5p
|
|
td
|
There were significantly correlations (miR-34c-5p and miR-320c vs Diamine acetyltransferase 1 [SAT1, NM_002970]; miR-139-5p and miR-320c vs Spermine oxidase [SMOX, NM_001270691])
|
|
td
|
(105)
|
|
tr
|
BA44 1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls) qPCR miR-218 Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218 (147)
|
|
td
|
BA44
|
|
td
|
1st set (24 MDD suicide and 35 Controls)2nd set (11 MDD suicide and 12 Controls)
|
|
td
|
qPCR
|
|
td
|
miR-218
|
|
td
|
Deleted in Colorectal Carcinoma (DCC, NM_005215) is a potential target of miR-218
|
|
td
|
(147)
|
|
tr
|
BA46 12 MDD non-suicide, 14 MDD suicide, and 12 Controls qPCR miR-19a-3p The upregulation of miR-19a-3p was also found in PBMC (29)
|
|
td
|
BA46
|
|
td
|
12 MDD non-suicide, 14 MDD suicide, and 12 Controls
|
|
td
|
qPCR
|
|
td
|
miR-19a-3p
|
|
td
|
The upregulation of miR-19a-3p was also found in PBMC
|
|
td
|
(29)
|
|
tr
|
LC 9 MDD suicide and 10 Controls TLDA miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179 let-7g-3p, miR-409-5p, -1197 (148)
|
|
td
|
LC
|
|
td
|
9 MDD suicide and 10 Controls
|
|
td
|
TLDA
|
|
td
|
miR-17-5p, -20b-5p, -106a-5p, -330-3p, -541-3p, -582-5p, -890, -99-3p, -550-5p, -1179
|
|
td
|
let-7g-3p, miR-409-5p, -1197
|
|
td
|
(148)
|
|
tr
|
Edinger-Westphal nucleus 16 MDD suicide and 21 Controls qPCR miR-511 GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment (149)
|
|
td
|
Edinger-Westphal nucleus
|
|
td
|
16 MDD suicide and 21 Controls
|
|
td
|
qPCR
|
|
td
|
miR-511
|
|
td
|
GDNF family receptor alpha-1 (GFRα1, NM_001145453) is a potential target of miR-511 validated by in vitro experiment
|
|
td
|
(149)
|
|
tr
|
vPFC 32 MDD suicide and 20 Controls qPCR miR-425-3p, -146-5p, -24-3p, -425-3p Four miRNAs are associated with MAPK/Wnt signaling pathways (150)
|
|
td
|
vPFC
|
|
td
|
32 MDD suicide and 20 Controls
|
|
td
|
qPCR
|
|
td
|
miR-425-3p, -146-5p, -24-3p, -425-3p
|
|
td
|
Four miRNAs are associated with MAPK/Wnt signaling pathways
|
|
td
|
(150)
|
|
tr
|
Leukocytes 10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls qPCR miR-34b-5p and -369-3p (151)
|
|
td
|
Leukocytes
|
|
td
|
10 MDD with suicidal ideation, 22 MDD without ideation, and 32 Controls
|
|
td
|
qPCR
|
|
td
|
miR-34b-5p and -369-3p
|
|
td
|
(151)
|
|
table-wrap-foot
|
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.
|
|
p
|
ACC, Anterior Cingulate Cortex; BA, Brodmann area; BD, Bipolar Disorder; LC, Locus Coeruleus; miRNA, microRNA; MDD, Major Depressive Disorder; PBMC, Peripheral Blood Mononuclear Cells; SCZ, Schizophrenia; TLDA, TaqMan Low Density Arrays; vPFC, Ventrolateral Prefrontal Cortex.
|
|
p
|
Gorinski et al. (144) examined whether 5-HT1A receptor (5HT1AR) palmitoylation is a mechanism involved in MDD and suicidality. They found that miR-30e expression was increased, while ZDHHC21 expression, which they identified as a major palmitoyl acyltransferase involved in palmitoylation of 5-HT1AR, was reduced in PFC of MDD suicide subjects, suggesting that 5-HT1AR palmitoylation may be key to MDD pathogenesis and treatment. Another mechanistic study by Torres-Berrio et al. (147) examined whether the expression of Netrin-1 guidance cue receptor DCC (deleted in colorectal cancer) gene was associated with resiliency or susceptibility to PFC dysfunctions in MDD suicide via miRNAs. They found a significant correlation between the decreased expression of miR-218 in BA44 of MDD suicide subjects and the elevated expression of DCC. By conducting an animal study, they concluded that miR-218 was associated with susceptibility versus resiliency to stress-related disorders through regulation of DCC expression.
|
|
p
|
Our group assessed miRNA expression in the synaptosome of BA10 from a cohort of SCZ, MDD, and BD subjects (145). Altogether, eight out of 14 BD subjects, seven out of 15 MDD subjects, and three out of 14 SCZ subjects had died by suicide. The result of comparison between all suicides (across diagnostic categories) and all non-suicide groups showed two upregulated miRNAs (miR-376a and miR-625) and six downregulated miRNAs (miR-152, miR-181a, miR-330-3p, miR-34a, and miR-133b). Based on significance values, miR-152 was found to be strongly associated with suicide. Distinct set of miRNAs were found in all three disorders; however, several miRNAs showed overlapping changes in SCZ and BD subjects. Discrete changes were also noted in MDD and suicide groups. Interestingly, downregulated miRNAs in SCZ group were enriched within the synapse. Follow-up studies in purified synaptosomes by deep sequencing in SCZ group suggested that there was a significant loss of small RNA expression in synaptosomes only for certain sequence lengths within the miRNA range. In addition, a large number of miRNAs (n = 73) were significantly downregulated and only one miRNA was upregulated. Remarkably, greater fold change of miRNAs in SCZ was associated with lower synaptic enrichment ratio in control subjects and vice-versa. Overall, synaptic miRNAs were generally downregulated in SCZ; however, highly synaptically enriched miRNAs showed greater down-regulation. It was concluded that there may be a deficit in synthesis, transport, or processing of miRNAs in SCZ; however, this process may be more selective for those miRNAs that are localized predominantly in the synaptic compartment.
|
|
p
|
Maussion et al. (146) examined miRNA expression changes in BA10 from 38 suicide subjects across SCZ, MDD, BD, and control subjects. miR-185* and miR-491-3p were found to be upregulated in suicide subjects compared to control subjects. TrkB-T1, one of the transcript variants of TrkB, expression was significantly lowered in suicide subjects and correlated with miR-185* expression. This was specific only for TrkB-T1, but not for TrkB-T2 or TrkB-FL. TrkB has been shown to be involved in suicidal behavior as has been reported by us previously (67). In an effort to reveal the regulation of polyamine system and suicidal behavior, Lopez et al. (153) examined the expression of SAT1 and SMOX in BA44 and found them to be lower in MDD suicide subjects. They selected 10 miRNAs which were predicted to regulate SAT1 and SMOX genes. Of those, four miRNAs (miR-34c-5p, miR-320c, miR-139-5p, and miR-320c) were significantly upregulated and correlated with the polyamine stress response genes (miR-34c-5p and miR-320c with SAT1; miR-139-5p and miR-320c with SMOX). They concluded that polyamine stress response genes including SAT1 and SMOX may be linked to alterations in miRNA networks that are responsive to stress in MDD suicide subjects. In another study, Lopez et al. (150) noted upregulation of miR-425-3p, miR-146-5p, miR-24-3p, and miR-425-3p in ventrolateral prefrontal cortex (vPFC) of MDD suicide subjects. Resulting from in silico prediction and in vitro experiments, they concluded that all four miRNAs were related to the MAPK/Wnt signaling pathways. These signaling systems have been implicated in suicidal behavior (154).
|
|
p
|
In an effort to examine the regulation of pro-inflammatory cytokine genes in suicidal behavior, we examined the relationship between TNF-α and its regulatory miRNAs (29). We found an increased expression of miR-19a-3p in BA46 of MDD individuals who had died by suicide. The increased expression of miR-19a-3p was also found in PBMC of MDD subjects who had suicidal ideation. Mechanistically, we found that RNA-binding protein HuR helped in stabilizing TNF-α transcript. This occurred apparently by sequestering its 3′ untranslated region from miR-19a-3p-mediated inhibition. The study suggests that miR-19a-3p may be involved in cytokine dysregulation in suicidal individuals. Recently, we also explored miRNA changes in the locus coeruleus (LC) of MDD suicide subjects (148). A total of 10 upregulated and three downregulated miRNAs were detected in these subjects. Based on target gene prediction using the upregulated miRNAs, we narrowed our study to those genes with a strong neuropsychiatric background. We focused on RELN, GSK-3β, MAOA, CHRM1, PLCB1, and GRIK1 and found reduced expression levels for RELN, GSK-3β, and MAOA.
|
|
p
|
Maheu et al. (149) examined glial cell line-derived neurotrophic factor in MDD suicide subjects and found an isoform-specific decrease in GDNF family receptor alpha 1 (GFRA1) mRNA, which was associated with lower GFRα1a protein levels in basolateral amygdala. They found upregulation in several miRNAs that may target GFRA1 gene. One of them was miR-511. Under the condition of miR-511 overexpression in neural progenitor cells (NPC), they observed that protein expression of GFRα1 was significantly decreased and concluded that GFRα1 is regulated by miR-511 and may be associated with suicidality.
|
|
p
|
In terms of blood studies associated with suicidality, only one study is available. Sun et al. (151) reported downregulation of miR-34b-5p and miR-369-3p in MDD subjects with suicidal ideation compared to MDD without suicidal ideation. These changes were consistent with our previous postmortem study conducted in BA9 of MDD suicide subjects (143).
|
|
sec
|
Piwi-Interacting RNAs
Piwi-interacting RNAs (piRNA) are the large small non-coding RNAs (26–32 nucleotide), which are preferentially expressed in nuclei and cytoplasm (155). Piwi proteins are recognized as one domain of argonaute (Ago) protein and bind to piRNA (156–159). The functions of Piwi/piRNA are unclear; however, they are highly expressed in germlines such as testes (156) and ovaries (160). Several studies show their role in epigenetic regulation of transposable elements in germlines (161–163). The existence of piRNA in mouse hippocampal neuron was reported by Lee et al. (164). In an Aplysia study, Rajasethupathy et al. (24) found that neuronal piRNA has a role in regulating memory-related synaptic plasticity. They found that the Piwi/piRNA complex may enable serotonin-dependent methylation of a CREB2 promoter CpG island in neurons, leading to the enhancement of long-term synaptic facilitation, learning-related synaptic plasticity and memory storage in Aplysia. More recently, Nandi et al. (165) reported that piRNA of Mili, the mouse ortholog of Piwi, exhibited behavioral deficits such as hyperactivity and less anxiety (165).
There is limited direct evidence of piRNA in psychiatric disorders. One study identified 37 piRNAs in ACC of SCZ subjects and one piRNA was correlated with antipsychotic medication (166). However, the authors did not mention the expression change between SCZ and control subjects because most of piRNAs were expressed only in a small number of samples.
|
|
title
|
Piwi-Interacting RNAs
|
|
p
|
Piwi-interacting RNAs (piRNA) are the large small non-coding RNAs (26–32 nucleotide), which are preferentially expressed in nuclei and cytoplasm (155). Piwi proteins are recognized as one domain of argonaute (Ago) protein and bind to piRNA (156–159). The functions of Piwi/piRNA are unclear; however, they are highly expressed in germlines such as testes (156) and ovaries (160). Several studies show their role in epigenetic regulation of transposable elements in germlines (161–163). The existence of piRNA in mouse hippocampal neuron was reported by Lee et al. (164). In an Aplysia study, Rajasethupathy et al. (24) found that neuronal piRNA has a role in regulating memory-related synaptic plasticity. They found that the Piwi/piRNA complex may enable serotonin-dependent methylation of a CREB2 promoter CpG island in neurons, leading to the enhancement of long-term synaptic facilitation, learning-related synaptic plasticity and memory storage in Aplysia. More recently, Nandi et al. (165) reported that piRNA of Mili, the mouse ortholog of Piwi, exhibited behavioral deficits such as hyperactivity and less anxiety (165).
|
|
p
|
There is limited direct evidence of piRNA in psychiatric disorders. One study identified 37 piRNAs in ACC of SCZ subjects and one piRNA was correlated with antipsychotic medication (166). However, the authors did not mention the expression change between SCZ and control subjects because most of piRNAs were expressed only in a small number of samples.
|
|
sec
|
Small Interfering RNAs
Small interfering RNAs (siRNA) are short (~20-24 nucleotide) double-stranded RNAs (dsRNAs) and interfere in the translation of proteins. Dicer enzyme cleaves long dsRNA and small hairpin RNAs into siRNAs (167, 168). SiRNAs have a role in mRNA cleavage by guiding RNA-induced silencing complex (RISC) to its complementary target mRNAs. Initially, siRNAs are loaded into Ago2 as duplexes. Subsequently, passenger strand of siRNAs is cleaved by Ago2; then, guide strand from siRNA duplex is liberated and produces active RISC, which has the capability to cleave target mRNAs (169, 170). Mainly, siRNAs are used for suppressing target genes as a scientific experimental method. To our knowledge, there is no report about siRNA expression changes in psychiatric disorders.
|
|
title
|
Small Interfering RNAs
|
|
p
|
Small interfering RNAs (siRNA) are short (~20-24 nucleotide) double-stranded RNAs (dsRNAs) and interfere in the translation of proteins. Dicer enzyme cleaves long dsRNA and small hairpin RNAs into siRNAs (167, 168). SiRNAs have a role in mRNA cleavage by guiding RNA-induced silencing complex (RISC) to its complementary target mRNAs. Initially, siRNAs are loaded into Ago2 as duplexes. Subsequently, passenger strand of siRNAs is cleaved by Ago2; then, guide strand from siRNA duplex is liberated and produces active RISC, which has the capability to cleave target mRNAs (169, 170). Mainly, siRNAs are used for suppressing target genes as a scientific experimental method. To our knowledge, there is no report about siRNA expression changes in psychiatric disorders.
|
|
sec
|
Small Nuclear RNAs
Small nuclear RNAs (snRNA), averaging about 150 nucleotides in length, are one of the components of spliceosomes. Five snRNAs (U1, U2, U4, U5, and U6) have been identified. snRNAs form ribonucleoprotein complexes (snRNPs) that can target and bind to specific sequences on pre-mRNAs (171). Spliceosomes have key roles in nuclear pre-mRNA splicing that remove the pre-mRNA regions (intron) that do not code for functional molecules. Initially, U1 snRNA binds to its associated proteins at the 5′ splice end of the hnRNA (172). Subsequently, U2 snRNP is recruited to the spliceosome binding site for making complex A. Bai et al. (173) reported that unique U1 snRNP pathology is involved in abnormal RNA splicing in Alzheimer’s disease (AD) that leads to the alteration in amyloid precursor protein (APP) expression and Aβ levels. Their group also showed U1 snRNP pathologic changes in postmortem brain of early onset AD (174). In addition, the small nuclear ribonucleoprotein U1-70K is aggregated in AD brain (175) and might contribute to neuronal toxicity in conjunction with N-terminal truncation (N40K) fragment derived from cleavage (176). In a mouse study, it is reported that dysfunction of U2 snRNA causes neurodegeneration through distortion of pre-mRNA splicing (177). A positron emission tomography study showed that amyloid accumulation is found in the brain of late-life MDD patients (178). At this stage, amyloid deposition may occur during the preclinical phase of dementia in patients who have depressive symptoms (179, 180), although MDD itself is a risk factor for the onset of AD (181). It is possible that Aβ changes through snRNAs may occur in late-life MDD patients even though the relationship between MDD and Aβ is unclear. One study, using ACC, found that 149 snRNAs were expressed in both SCZ and control subjects, and 35 snRNAs were expressed specifically for SCZ subjects (166). However, their biological impact on SCZ pathogenesis is unclear.
|
|
title
|
Small Nuclear RNAs
|
|
p
|
Small nuclear RNAs (snRNA), averaging about 150 nucleotides in length, are one of the components of spliceosomes. Five snRNAs (U1, U2, U4, U5, and U6) have been identified. snRNAs form ribonucleoprotein complexes (snRNPs) that can target and bind to specific sequences on pre-mRNAs (171). Spliceosomes have key roles in nuclear pre-mRNA splicing that remove the pre-mRNA regions (intron) that do not code for functional molecules. Initially, U1 snRNA binds to its associated proteins at the 5′ splice end of the hnRNA (172). Subsequently, U2 snRNP is recruited to the spliceosome binding site for making complex A. Bai et al. (173) reported that unique U1 snRNP pathology is involved in abnormal RNA splicing in Alzheimer’s disease (AD) that leads to the alteration in amyloid precursor protein (APP) expression and Aβ levels. Their group also showed U1 snRNP pathologic changes in postmortem brain of early onset AD (174). In addition, the small nuclear ribonucleoprotein U1-70K is aggregated in AD brain (175) and might contribute to neuronal toxicity in conjunction with N-terminal truncation (N40K) fragment derived from cleavage (176). In a mouse study, it is reported that dysfunction of U2 snRNA causes neurodegeneration through distortion of pre-mRNA splicing (177). A positron emission tomography study showed that amyloid accumulation is found in the brain of late-life MDD patients (178). At this stage, amyloid deposition may occur during the preclinical phase of dementia in patients who have depressive symptoms (179, 180), although MDD itself is a risk factor for the onset of AD (181). It is possible that Aβ changes through snRNAs may occur in late-life MDD patients even though the relationship between MDD and Aβ is unclear. One study, using ACC, found that 149 snRNAs were expressed in both SCZ and control subjects, and 35 snRNAs were expressed specifically for SCZ subjects (166). However, their biological impact on SCZ pathogenesis is unclear.
|
|
sec
|
Small Nucleolar RNAs
Small nucleolar RNAs (snoRNAs) are generally responsible for guiding modifications in rRNAs, tRNAs, and snRNAs. snoRNAs are divided into two main classes: 1) box C/D and 2) box H/ACA. Box C/D snoRNAs, averaging 60–90 nucleotides, have a role in catalyzing 2′-O-ribose methylation. Box H/ACA snoRNA, averaging 120–140 nucleotides, guide pseudouridylation (182, 183). In 2002, brain specific C/D box snoRNAs HBII-52 (SNORD115) and HBII 85 (SNORD116) and H/ACA box snoRNA HBI-36 were detected (184). Prader–Willi syndrome (PWS) is a neurodevelopmental disorder caused by imprinted gene clusters at human chromosome region 15q11q13. It was reported that SNORD115 and SNORD116 are partially responsible for the development of PWS (185, 186). Moreover, HBI-52 and HBI-36 snoRNAs are thought to regulate 5-HT2c mRNA expression (184). 5-HT2c has a role in MDD pathogenesis. Indeed, several antidepressants work as an antagonist to 5-HT2c (187–189). In terms of schizophrenia, it is considered that 5HT-2c relates to SCZ pathogenesis through the dopaminergic pathway (190, 191) and by causing side effects to antipsychotic treatment (192). Actually, clozapine, a drug used for refractory schizophrenia, has high affinity to 5-HT2c (192). SnoRNAs may influence psychiatric disorders directly or through 5-HT2c receptors. Epigenetic changes have also been found in SNORD115 and SNORD116 in monozygotic twin study of SCZ. Hypermethylation in 12 regions on SNORD115 and five regions on SNORD116 regions were found in affected individuals (193).
In PFC synaptosomes from SCZ subjects, we noted ~50% decrease in a set of sequences that were derived from a C/D box snoRNA and SNORD85 (145). A 27-mer sequence TTCACTGATGAGAGCATTGTTCTGAGC was the most abundant one that incorporated a C/D box and terminated four bases before the 3′ end of the host snoRNA. Our study, for the first time, showed that not only is this novel class of small ncRNAs expressed in humans, and more so in synaptosomes, but they may be significantly altered in a psychiatric disorders. Another study also showed expression change in snoRNAs in SCZ (166). A total of 343 snoRNAs were expressed in both SCZ and control subjects and six snoRNAs were expressed specifically in SCZ subjects. However, none of the snoRNAs were significantly changed in SCZ compared to controls.
|
|
title
|
Small Nucleolar RNAs
|
|
p
|
Small nucleolar RNAs (snoRNAs) are generally responsible for guiding modifications in rRNAs, tRNAs, and snRNAs. snoRNAs are divided into two main classes: 1) box C/D and 2) box H/ACA. Box C/D snoRNAs, averaging 60–90 nucleotides, have a role in catalyzing 2′-O-ribose methylation. Box H/ACA snoRNA, averaging 120–140 nucleotides, guide pseudouridylation (182, 183). In 2002, brain specific C/D box snoRNAs HBII-52 (SNORD115) and HBII 85 (SNORD116) and H/ACA box snoRNA HBI-36 were detected (184). Prader–Willi syndrome (PWS) is a neurodevelopmental disorder caused by imprinted gene clusters at human chromosome region 15q11q13. It was reported that SNORD115 and SNORD116 are partially responsible for the development of PWS (185, 186). Moreover, HBI-52 and HBI-36 snoRNAs are thought to regulate 5-HT2c mRNA expression (184). 5-HT2c has a role in MDD pathogenesis. Indeed, several antidepressants work as an antagonist to 5-HT2c (187–189). In terms of schizophrenia, it is considered that 5HT-2c relates to SCZ pathogenesis through the dopaminergic pathway (190, 191) and by causing side effects to antipsychotic treatment (192). Actually, clozapine, a drug used for refractory schizophrenia, has high affinity to 5-HT2c (192). SnoRNAs may influence psychiatric disorders directly or through 5-HT2c receptors. Epigenetic changes have also been found in SNORD115 and SNORD116 in monozygotic twin study of SCZ. Hypermethylation in 12 regions on SNORD115 and five regions on SNORD116 regions were found in affected individuals (193).
|
|
p
|
In PFC synaptosomes from SCZ subjects, we noted ~50% decrease in a set of sequences that were derived from a C/D box snoRNA and SNORD85 (145). A 27-mer sequence TTCACTGATGAGAGCATTGTTCTGAGC was the most abundant one that incorporated a C/D box and terminated four bases before the 3′ end of the host snoRNA. Our study, for the first time, showed that not only is this novel class of small ncRNAs expressed in humans, and more so in synaptosomes, but they may be significantly altered in a psychiatric disorders. Another study also showed expression change in snoRNAs in SCZ (166). A total of 343 snoRNAs were expressed in both SCZ and control subjects and six snoRNAs were expressed specifically in SCZ subjects. However, none of the snoRNAs were significantly changed in SCZ compared to controls.
|
|
sec
|
Limitations
There are a several limitations to ncRNA studies in neuropsychiatric disorders: 1) Several studies show changes in expression of expression lncRNAs and miRNAs; however, they are inconsistent even when studied in the same brain region with the same diagnosis. This could be attributed to several factors. For example, confounding variables such as PMI, brain pH, freeze–thaw cycle, age, and sex vary between studies. In addition, most of the studies use whole tissue. As mentioned earlier, the expression of lncRNAs and miRNAs are brain region and cell type specific. This cellular heterogeneity may affect ncRNA expressions. Thus, studying their expression patterns in neurons and glial cells (oligodendrocytes, astrocytes, and microglia) may delineate these discrepancies. Even within neurons, specific neuronal population needs to be studied. In this regard, single cell study will be helpful. 2) In recent years, many studies have focused on miRNAs and to a certain extent lncRNAs; however, the role of siRNAs, piRNAs, snoRNAs, and snRNAs are understudied. Given their important roles (e.g. epigenetic regulation of transposable elements; mRNA cleavage by guiding RISC), future research will be needed to explore their functional significance in psychiatric disorders. 3) Correct identification of new snRNAs and snoRNAs and their epigenetic roles needs to be studied (194, 195). New technologies like nanopore sequencing and structure prediction algorithms are emerging that can be helpful in this regard. 4) Although new members of ncRNA are being discovered regularly, the functions of these novel ncRNAs are not well understood. More in-vivo functional studies followed by high-throughput sequencing after chemical cross-linking or photoactivatable cross-linking and immunoprecipitation (PAR-CLIP) will be effective in probing the functional roles of novel ncRNAs at the cellular level (196). These assays can be also performed in human postmortem brain samples, but by minimizing the loss of tissue integrity and maximizing the likeliness of capturing the interaction at the molecular level. 5) Most of the studies have shown the temporal changes in ncRNA expression. Although it is very difficult to measure ncRNA expressions at different time points in postmortem samples, it is relatively easy to measure them in peripheral tissue samples. Using longitudinal studies, it will be possible to explore the diagnosis/therapeutic/disease state biomarkers for psychiatric illnesses.
|
|
title
|
Limitations
|
|
p
|
There are a several limitations to ncRNA studies in neuropsychiatric disorders: 1) Several studies show changes in expression of expression lncRNAs and miRNAs; however, they are inconsistent even when studied in the same brain region with the same diagnosis. This could be attributed to several factors. For example, confounding variables such as PMI, brain pH, freeze–thaw cycle, age, and sex vary between studies. In addition, most of the studies use whole tissue. As mentioned earlier, the expression of lncRNAs and miRNAs are brain region and cell type specific. This cellular heterogeneity may affect ncRNA expressions. Thus, studying their expression patterns in neurons and glial cells (oligodendrocytes, astrocytes, and microglia) may delineate these discrepancies. Even within neurons, specific neuronal population needs to be studied. In this regard, single cell study will be helpful. 2) In recent years, many studies have focused on miRNAs and to a certain extent lncRNAs; however, the role of siRNAs, piRNAs, snoRNAs, and snRNAs are understudied. Given their important roles (e.g. epigenetic regulation of transposable elements; mRNA cleavage by guiding RISC), future research will be needed to explore their functional significance in psychiatric disorders. 3) Correct identification of new snRNAs and snoRNAs and their epigenetic roles needs to be studied (194, 195). New technologies like nanopore sequencing and structure prediction algorithms are emerging that can be helpful in this regard. 4) Although new members of ncRNA are being discovered regularly, the functions of these novel ncRNAs are not well understood. More in-vivo functional studies followed by high-throughput sequencing after chemical cross-linking or photoactivatable cross-linking and immunoprecipitation (PAR-CLIP) will be effective in probing the functional roles of novel ncRNAs at the cellular level (196). These assays can be also performed in human postmortem brain samples, but by minimizing the loss of tissue integrity and maximizing the likeliness of capturing the interaction at the molecular level. 5) Most of the studies have shown the temporal changes in ncRNA expression. Although it is very difficult to measure ncRNA expressions at different time points in postmortem samples, it is relatively easy to measure them in peripheral tissue samples. Using longitudinal studies, it will be possible to explore the diagnosis/therapeutic/disease state biomarkers for psychiatric illnesses.
|
|
sec
|
Conclusions
ncRNAs are gaining traction for their role in various psychiatric illnesses. A schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality is depicted in Figure 3 . Both long-non-coding RNAs and miRNAs have been extensively studied in MDD, SCZ, and BD. As can be seen in Tables 1 – 4 , a large number of miRNAs and lncRNAs have been implicated in SCZ, MDD, and BD. There were several miRNAs that showed overlapping changes between SCZ and BD, suggesting that these two disorders may share common susceptibility factors as has been demonstrated in several genetic studies.
Figure 3 Schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality. Risk factors for mental illnesses include early life adversity, current or recurrent life events that along with gene environment interaction can lead to epigenetic modifications mediated by ncRNAs. These modifications can give rise to neuropathology mediated by changes at cellular and/or molecular levels, which can subsequently alter neural circuitry. Phenotypic changes can arise from circuitry changes that can mediate the development of psychiatric illnesses such as major depression, bipolar disorder and schizophrenia. Suicidal behavior could be a manifestation of psychiatric illnesses or may be independent of psychiatric illnesses. ncRNAs, non-coding RNA.The population-based studies have explored the expression changes of lncRNA and miRNA among psychiatric patients who have suicidal ideation. A couple of postmortem brain studies have also explored suicide associated ncRNAs. Interestingly, both lncRNAs and miRNAs were specifically changed in psychiatric patients who died by suicide even though the sample size and number of studies are quite small. The results are encouraging and need further exploration.
In terms of other small RNAs, the studies are quite limited; nevertheless, they appear to be promising. piRNAs and snoRNAs show interesting results in SCZ patients that may shed light on their role in regulating other RNAs and their role in this psychiatric illness. These studies need to be expanded in order to understand their precise role in regulatory mechanisms that can be involved in the pathogenesis of psychiatric disorders.
|
|
title
|
Conclusions
|
|
p
|
ncRNAs are gaining traction for their role in various psychiatric illnesses. A schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality is depicted in Figure 3 . Both long-non-coding RNAs and miRNAs have been extensively studied in MDD, SCZ, and BD. As can be seen in Tables 1 – 4 , a large number of miRNAs and lncRNAs have been implicated in SCZ, MDD, and BD. There were several miRNAs that showed overlapping changes between SCZ and BD, suggesting that these two disorders may share common susceptibility factors as has been demonstrated in several genetic studies.
|
|
figure
|
Figure 3 Schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality. Risk factors for mental illnesses include early life adversity, current or recurrent life events that along with gene environment interaction can lead to epigenetic modifications mediated by ncRNAs. These modifications can give rise to neuropathology mediated by changes at cellular and/or molecular levels, which can subsequently alter neural circuitry. Phenotypic changes can arise from circuitry changes that can mediate the development of psychiatric illnesses such as major depression, bipolar disorder and schizophrenia. Suicidal behavior could be a manifestation of psychiatric illnesses or may be independent of psychiatric illnesses. ncRNAs, non-coding RNA.
|
|
label
|
Figure 3
|
|
caption
|
Schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality. Risk factors for mental illnesses include early life adversity, current or recurrent life events that along with gene environment interaction can lead to epigenetic modifications mediated by ncRNAs. These modifications can give rise to neuropathology mediated by changes at cellular and/or molecular levels, which can subsequently alter neural circuitry. Phenotypic changes can arise from circuitry changes that can mediate the development of psychiatric illnesses such as major depression, bipolar disorder and schizophrenia. Suicidal behavior could be a manifestation of psychiatric illnesses or may be independent of psychiatric illnesses. ncRNAs, non-coding RNA.
|
|
p
|
Schematic diagram of the non-coding RNAs’ impact on psychiatric illnesses and suicidality. Risk factors for mental illnesses include early life adversity, current or recurrent life events that along with gene environment interaction can lead to epigenetic modifications mediated by ncRNAs. These modifications can give rise to neuropathology mediated by changes at cellular and/or molecular levels, which can subsequently alter neural circuitry. Phenotypic changes can arise from circuitry changes that can mediate the development of psychiatric illnesses such as major depression, bipolar disorder and schizophrenia. Suicidal behavior could be a manifestation of psychiatric illnesses or may be independent of psychiatric illnesses. ncRNAs, non-coding RNA.
|
|
p
|
The population-based studies have explored the expression changes of lncRNA and miRNA among psychiatric patients who have suicidal ideation. A couple of postmortem brain studies have also explored suicide associated ncRNAs. Interestingly, both lncRNAs and miRNAs were specifically changed in psychiatric patients who died by suicide even though the sample size and number of studies are quite small. The results are encouraging and need further exploration.
|
|
p
|
In terms of other small RNAs, the studies are quite limited; nevertheless, they appear to be promising. piRNAs and snoRNAs show interesting results in SCZ patients that may shed light on their role in regulating other RNAs and their role in this psychiatric illness. These studies need to be expanded in order to understand their precise role in regulatory mechanisms that can be involved in the pathogenesis of psychiatric disorders.
|
|
sec
|
Author Contributions
YD conceptualized, outlined, and edited the paper. YY reviewed literature and co-wrote the paper.
|
|
title
|
Author Contributions
|
|
p
|
YD conceptualized, outlined, and edited the paper. YY reviewed literature and co-wrote the paper.
|
|
sec
|
Funding
This work was supported by funding from the National Institutes of Health (R01MH082802; R01MH101890; R01MH100616; R01MH107183; R01MH118884) to YD.
|
|
title
|
Funding
|
|
p
|
This work was supported by funding from the National Institutes of Health (R01MH082802; R01MH101890; R01MH100616; R01MH107183; R01MH118884) to YD.
|
|
sec
|
Conflict of Interest
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
|
title
|
Conflict of Interest
|
|
p
|
The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
|
|
back
|
Glossary
ncRNA Non-coding RNA
lncRNA Long non-coding RNA
Nt Nucleotide
miRNA microRNA
siRNA Small interfering RNA
piRNA Piwi-interacting RNA
snoRNA Small nucleolar RNA
snRNA Small nuclear RNA
SCZ Schizophrenia
MDD Major depressive disorder
BD Bipolar disorder
bp Base-pair
Xist X-inactive specific transcripts
cDNA Complementary DNA
Brn 1b Brain-specific homeobox/POU domain protein 1b transcript
RMST Rhabdomyosarcoma 2 associated transcript
TUNA Tcl1 upstream neuron-associated transcript
Evf2 Erwinia virulence factor 2 transcript
GABA Gamma aminobutyric acid
Pnky Pinky
Bdnf Brain-derived neurotrophic factor
BDNF-AS Brain-derived neurotrophic factor antisense RNA
GWAS Genome-wide association study
CNNM2 Cyclin and CBS domain divalent metal cation transport mediator 2
ACC Anterior cingulate cortex
dlPFC Dorsolateral prefrontal cortex
RNA-seq RNA sequencing
IRF2 Interferon regulatory factor 2
LY6E Lymphocyte antigen 6E precursor
HMOBX1 Homeobox containing 1
REEP5 Receptor accessory protein 5
PTPRT Protein tyrosine phosphatase receptor type T
NFATC3 Nuclear factor of activated T cells 3
CNS Central nervous system
MARCKS Myristoylated alanine-rich C-kinase substrate
eQTL Expression quantitative trait locus
WGCNA Weighted correlation network analysis
P2RY13 Purinergic receptor P2Y13
PBMC Peripheral blood mononuclear cell
qPCR Quantitative polymerase chain reaction
p-GSK3β Phosphorylated glycogen synthase kinase 3 beta
SERT Serotonin transporter
pri-miRNA primary microRNA
pre-miRNA precursor microRNA
DGCR8 DiGeorge syndrome critical region 8
XPO5 Exportin-5
TRBP TAR RNA-binding protein
Ago Argonaute
RISC RNA-induced silencing complex
p250GAP p250 GTPase-activating protein
MeCP2 methyl CpG binding protein 2
TCF4 Transcription factor 4
BA Brodmann area
CREB cAMP response element-binding
ERK Extracellular signal regulated kinase
NMDA N-methyl-D-aspartate receptor
GRID1 Glutamate receptor ionotropic delta 1
STG Superior temporal gyrus
VSNL1 Visinin like 1
GRIA2 Glutamate ionotropic receptor AMPA type subunit 2
GRIA3 Glutamate ionotropic receptor AMPA type subunit 3
GRIA4 Glutamate ionotropic receptor AMPA type subunit 4
NCOA1 Nuclear receptor coactivator 1
NCOA2 Nuclear receptor coactivator 2
PDE4B Phosphodiesterase 4B
NCOR2 Nuclear receptor corepressor 2
GR Glucocorticoid receptor
vmPFC Ventromedial prefrontal cortex
GRM4 Glutamate receptor-4
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
DG Dentate gyrus
ANK3 Ankyrin-3
CACNB3 Calcium voltage-gated channel auxiliary subunit beta 3
CAMK2G Calcium/Calmodulin dependent protein kinase II gamma
NOVA1 Neuro-oncological ventral antigen 1
GABA-A Gamma-aminobutyric acid type A receptor subunit alpha
GABRA4 Gamma-aminobutyric acid type A receptor subunit alpha 4
DNMT3b DNA (cytosine-5-)-methyltransferase 3 beta
5HT1AR 5-Hydroxytryptamine receptor 1A
ZDHHC21 Zinc Finger DHHC-type palmitoyltransferase 21
DCC Deleted in colorectal carcinoma netrin 1 Receptor
TrkB Tropomyosin receptor kinase B
TrkB-T1 Tropomyosin receptor kinase B transcript isoform 1
TrkB-T2 Tropomyosin receptor kinase B transcript isoform 2
TrkB-FL Tropomyosin receptor kinase B full-length isoform
SAT1 Spermidine/Spermine N1-acetyltransferase 1
SMOX Spermine oxidase
vPFC Ventrolateral prefrontal cortex
MAPK Mitogen-activated protein kinase
Wnt Wingless and Int-1
TNF-α Tumor necrosis factor alpha
HuR Human antigen R
LC Locus coeruleus
RELN Reelin
MAOA Monoamine oxidase A
CHRM1 Cholinergic receptor muscarinic 1
PLCB1 Phospholipase C beta 1
GRIK1 Glutamate ionotropic receptor kainate type subunit 1
GFRA1 GDNF family receptor alpha 1
CREB2 Cyclic AMP response element-binding protein 2
Mili Miwi like; Piwil2
dsRNAs Double-stranded RNAs
Ago2 Argonaute 2
snRNPs Small nuclear ribonucleoprotein complexes
AD Alzheimer’s disease
APP Amyloid precursor protein
Aβ Amyloid beta
N40K N-terminal truncation fragment
HBII-52 C/D box snoRNA 52
HBII-85 C/D box snoRNA 85
HBI-36 H/ACA box snoRNA 36
PWS Prader–Willi syndrome
5-HT2c 5-Hydroxytryptamine receptor 2C
PMI Postmortem interval
PAR-CLIP Photoactivatable cross-linking and immunoprecipitation
|
|
appendix
|
Glossary
ncRNA Non-coding RNA
lncRNA Long non-coding RNA
Nt Nucleotide
miRNA microRNA
siRNA Small interfering RNA
piRNA Piwi-interacting RNA
snoRNA Small nucleolar RNA
snRNA Small nuclear RNA
SCZ Schizophrenia
MDD Major depressive disorder
BD Bipolar disorder
bp Base-pair
Xist X-inactive specific transcripts
cDNA Complementary DNA
Brn 1b Brain-specific homeobox/POU domain protein 1b transcript
RMST Rhabdomyosarcoma 2 associated transcript
TUNA Tcl1 upstream neuron-associated transcript
Evf2 Erwinia virulence factor 2 transcript
GABA Gamma aminobutyric acid
Pnky Pinky
Bdnf Brain-derived neurotrophic factor
BDNF-AS Brain-derived neurotrophic factor antisense RNA
GWAS Genome-wide association study
CNNM2 Cyclin and CBS domain divalent metal cation transport mediator 2
ACC Anterior cingulate cortex
dlPFC Dorsolateral prefrontal cortex
RNA-seq RNA sequencing
IRF2 Interferon regulatory factor 2
LY6E Lymphocyte antigen 6E precursor
HMOBX1 Homeobox containing 1
REEP5 Receptor accessory protein 5
PTPRT Protein tyrosine phosphatase receptor type T
NFATC3 Nuclear factor of activated T cells 3
CNS Central nervous system
MARCKS Myristoylated alanine-rich C-kinase substrate
eQTL Expression quantitative trait locus
WGCNA Weighted correlation network analysis
P2RY13 Purinergic receptor P2Y13
PBMC Peripheral blood mononuclear cell
qPCR Quantitative polymerase chain reaction
p-GSK3β Phosphorylated glycogen synthase kinase 3 beta
SERT Serotonin transporter
pri-miRNA primary microRNA
pre-miRNA precursor microRNA
DGCR8 DiGeorge syndrome critical region 8
XPO5 Exportin-5
TRBP TAR RNA-binding protein
Ago Argonaute
RISC RNA-induced silencing complex
p250GAP p250 GTPase-activating protein
MeCP2 methyl CpG binding protein 2
TCF4 Transcription factor 4
BA Brodmann area
CREB cAMP response element-binding
ERK Extracellular signal regulated kinase
NMDA N-methyl-D-aspartate receptor
GRID1 Glutamate receptor ionotropic delta 1
STG Superior temporal gyrus
VSNL1 Visinin like 1
GRIA2 Glutamate ionotropic receptor AMPA type subunit 2
GRIA3 Glutamate ionotropic receptor AMPA type subunit 3
GRIA4 Glutamate ionotropic receptor AMPA type subunit 4
NCOA1 Nuclear receptor coactivator 1
NCOA2 Nuclear receptor coactivator 2
PDE4B Phosphodiesterase 4B
NCOR2 Nuclear receptor corepressor 2
GR Glucocorticoid receptor
vmPFC Ventromedial prefrontal cortex
GRM4 Glutamate receptor-4
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
DG Dentate gyrus
ANK3 Ankyrin-3
CACNB3 Calcium voltage-gated channel auxiliary subunit beta 3
CAMK2G Calcium/Calmodulin dependent protein kinase II gamma
NOVA1 Neuro-oncological ventral antigen 1
GABA-A Gamma-aminobutyric acid type A receptor subunit alpha
GABRA4 Gamma-aminobutyric acid type A receptor subunit alpha 4
DNMT3b DNA (cytosine-5-)-methyltransferase 3 beta
5HT1AR 5-Hydroxytryptamine receptor 1A
ZDHHC21 Zinc Finger DHHC-type palmitoyltransferase 21
DCC Deleted in colorectal carcinoma netrin 1 Receptor
TrkB Tropomyosin receptor kinase B
TrkB-T1 Tropomyosin receptor kinase B transcript isoform 1
TrkB-T2 Tropomyosin receptor kinase B transcript isoform 2
TrkB-FL Tropomyosin receptor kinase B full-length isoform
SAT1 Spermidine/Spermine N1-acetyltransferase 1
SMOX Spermine oxidase
vPFC Ventrolateral prefrontal cortex
MAPK Mitogen-activated protein kinase
Wnt Wingless and Int-1
TNF-α Tumor necrosis factor alpha
HuR Human antigen R
LC Locus coeruleus
RELN Reelin
MAOA Monoamine oxidase A
CHRM1 Cholinergic receptor muscarinic 1
PLCB1 Phospholipase C beta 1
GRIK1 Glutamate ionotropic receptor kainate type subunit 1
GFRA1 GDNF family receptor alpha 1
CREB2 Cyclic AMP response element-binding protein 2
Mili Miwi like; Piwil2
dsRNAs Double-stranded RNAs
Ago2 Argonaute 2
snRNPs Small nuclear ribonucleoprotein complexes
AD Alzheimer’s disease
APP Amyloid precursor protein
Aβ Amyloid beta
N40K N-terminal truncation fragment
HBII-52 C/D box snoRNA 52
HBII-85 C/D box snoRNA 85
HBI-36 H/ACA box snoRNA 36
PWS Prader–Willi syndrome
5-HT2c 5-Hydroxytryptamine receptor 2C
PMI Postmortem interval
PAR-CLIP Photoactivatable cross-linking and immunoprecipitation
|
|
title
|
Glossary
|
|
table-wrap
|
ncRNA Non-coding RNA
lncRNA Long non-coding RNA
Nt Nucleotide
miRNA microRNA
siRNA Small interfering RNA
piRNA Piwi-interacting RNA
snoRNA Small nucleolar RNA
snRNA Small nuclear RNA
SCZ Schizophrenia
MDD Major depressive disorder
BD Bipolar disorder
bp Base-pair
Xist X-inactive specific transcripts
cDNA Complementary DNA
Brn 1b Brain-specific homeobox/POU domain protein 1b transcript
RMST Rhabdomyosarcoma 2 associated transcript
TUNA Tcl1 upstream neuron-associated transcript
Evf2 Erwinia virulence factor 2 transcript
GABA Gamma aminobutyric acid
Pnky Pinky
Bdnf Brain-derived neurotrophic factor
BDNF-AS Brain-derived neurotrophic factor antisense RNA
GWAS Genome-wide association study
CNNM2 Cyclin and CBS domain divalent metal cation transport mediator 2
ACC Anterior cingulate cortex
dlPFC Dorsolateral prefrontal cortex
RNA-seq RNA sequencing
IRF2 Interferon regulatory factor 2
LY6E Lymphocyte antigen 6E precursor
HMOBX1 Homeobox containing 1
REEP5 Receptor accessory protein 5
PTPRT Protein tyrosine phosphatase receptor type T
NFATC3 Nuclear factor of activated T cells 3
CNS Central nervous system
MARCKS Myristoylated alanine-rich C-kinase substrate
eQTL Expression quantitative trait locus
WGCNA Weighted correlation network analysis
P2RY13 Purinergic receptor P2Y13
PBMC Peripheral blood mononuclear cell
qPCR Quantitative polymerase chain reaction
p-GSK3β Phosphorylated glycogen synthase kinase 3 beta
SERT Serotonin transporter
pri-miRNA primary microRNA
pre-miRNA precursor microRNA
DGCR8 DiGeorge syndrome critical region 8
XPO5 Exportin-5
TRBP TAR RNA-binding protein
Ago Argonaute
RISC RNA-induced silencing complex
p250GAP p250 GTPase-activating protein
MeCP2 methyl CpG binding protein 2
TCF4 Transcription factor 4
BA Brodmann area
CREB cAMP response element-binding
ERK Extracellular signal regulated kinase
NMDA N-methyl-D-aspartate receptor
GRID1 Glutamate receptor ionotropic delta 1
STG Superior temporal gyrus
VSNL1 Visinin like 1
GRIA2 Glutamate ionotropic receptor AMPA type subunit 2
GRIA3 Glutamate ionotropic receptor AMPA type subunit 3
GRIA4 Glutamate ionotropic receptor AMPA type subunit 4
NCOA1 Nuclear receptor coactivator 1
NCOA2 Nuclear receptor coactivator 2
PDE4B Phosphodiesterase 4B
NCOR2 Nuclear receptor corepressor 2
GR Glucocorticoid receptor
vmPFC Ventromedial prefrontal cortex
GRM4 Glutamate receptor-4
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
DG Dentate gyrus
ANK3 Ankyrin-3
CACNB3 Calcium voltage-gated channel auxiliary subunit beta 3
CAMK2G Calcium/Calmodulin dependent protein kinase II gamma
NOVA1 Neuro-oncological ventral antigen 1
GABA-A Gamma-aminobutyric acid type A receptor subunit alpha
GABRA4 Gamma-aminobutyric acid type A receptor subunit alpha 4
DNMT3b DNA (cytosine-5-)-methyltransferase 3 beta
5HT1AR 5-Hydroxytryptamine receptor 1A
ZDHHC21 Zinc Finger DHHC-type palmitoyltransferase 21
DCC Deleted in colorectal carcinoma netrin 1 Receptor
TrkB Tropomyosin receptor kinase B
TrkB-T1 Tropomyosin receptor kinase B transcript isoform 1
TrkB-T2 Tropomyosin receptor kinase B transcript isoform 2
TrkB-FL Tropomyosin receptor kinase B full-length isoform
SAT1 Spermidine/Spermine N1-acetyltransferase 1
SMOX Spermine oxidase
vPFC Ventrolateral prefrontal cortex
MAPK Mitogen-activated protein kinase
Wnt Wingless and Int-1
TNF-α Tumor necrosis factor alpha
HuR Human antigen R
LC Locus coeruleus
RELN Reelin
MAOA Monoamine oxidase A
CHRM1 Cholinergic receptor muscarinic 1
PLCB1 Phospholipase C beta 1
GRIK1 Glutamate ionotropic receptor kainate type subunit 1
GFRA1 GDNF family receptor alpha 1
CREB2 Cyclic AMP response element-binding protein 2
Mili Miwi like; Piwil2
dsRNAs Double-stranded RNAs
Ago2 Argonaute 2
snRNPs Small nuclear ribonucleoprotein complexes
AD Alzheimer’s disease
APP Amyloid precursor protein
Aβ Amyloid beta
N40K N-terminal truncation fragment
HBII-52 C/D box snoRNA 52
HBII-85 C/D box snoRNA 85
HBI-36 H/ACA box snoRNA 36
PWS Prader–Willi syndrome
5-HT2c 5-Hydroxytryptamine receptor 2C
PMI Postmortem interval
PAR-CLIP Photoactivatable cross-linking and immunoprecipitation
|
|
table
|
ncRNA Non-coding RNA
lncRNA Long non-coding RNA
Nt Nucleotide
miRNA microRNA
siRNA Small interfering RNA
piRNA Piwi-interacting RNA
snoRNA Small nucleolar RNA
snRNA Small nuclear RNA
SCZ Schizophrenia
MDD Major depressive disorder
BD Bipolar disorder
bp Base-pair
Xist X-inactive specific transcripts
cDNA Complementary DNA
Brn 1b Brain-specific homeobox/POU domain protein 1b transcript
RMST Rhabdomyosarcoma 2 associated transcript
TUNA Tcl1 upstream neuron-associated transcript
Evf2 Erwinia virulence factor 2 transcript
GABA Gamma aminobutyric acid
Pnky Pinky
Bdnf Brain-derived neurotrophic factor
BDNF-AS Brain-derived neurotrophic factor antisense RNA
GWAS Genome-wide association study
CNNM2 Cyclin and CBS domain divalent metal cation transport mediator 2
ACC Anterior cingulate cortex
dlPFC Dorsolateral prefrontal cortex
RNA-seq RNA sequencing
IRF2 Interferon regulatory factor 2
LY6E Lymphocyte antigen 6E precursor
HMOBX1 Homeobox containing 1
REEP5 Receptor accessory protein 5
PTPRT Protein tyrosine phosphatase receptor type T
NFATC3 Nuclear factor of activated T cells 3
CNS Central nervous system
MARCKS Myristoylated alanine-rich C-kinase substrate
eQTL Expression quantitative trait locus
WGCNA Weighted correlation network analysis
P2RY13 Purinergic receptor P2Y13
PBMC Peripheral blood mononuclear cell
qPCR Quantitative polymerase chain reaction
p-GSK3β Phosphorylated glycogen synthase kinase 3 beta
SERT Serotonin transporter
pri-miRNA primary microRNA
pre-miRNA precursor microRNA
DGCR8 DiGeorge syndrome critical region 8
XPO5 Exportin-5
TRBP TAR RNA-binding protein
Ago Argonaute
RISC RNA-induced silencing complex
p250GAP p250 GTPase-activating protein
MeCP2 methyl CpG binding protein 2
TCF4 Transcription factor 4
BA Brodmann area
CREB cAMP response element-binding
ERK Extracellular signal regulated kinase
NMDA N-methyl-D-aspartate receptor
GRID1 Glutamate receptor ionotropic delta 1
STG Superior temporal gyrus
VSNL1 Visinin like 1
GRIA2 Glutamate ionotropic receptor AMPA type subunit 2
GRIA3 Glutamate ionotropic receptor AMPA type subunit 3
GRIA4 Glutamate ionotropic receptor AMPA type subunit 4
NCOA1 Nuclear receptor coactivator 1
NCOA2 Nuclear receptor coactivator 2
PDE4B Phosphodiesterase 4B
NCOR2 Nuclear receptor corepressor 2
GR Glucocorticoid receptor
vmPFC Ventromedial prefrontal cortex
GRM4 Glutamate receptor-4
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
DG Dentate gyrus
ANK3 Ankyrin-3
CACNB3 Calcium voltage-gated channel auxiliary subunit beta 3
CAMK2G Calcium/Calmodulin dependent protein kinase II gamma
NOVA1 Neuro-oncological ventral antigen 1
GABA-A Gamma-aminobutyric acid type A receptor subunit alpha
GABRA4 Gamma-aminobutyric acid type A receptor subunit alpha 4
DNMT3b DNA (cytosine-5-)-methyltransferase 3 beta
5HT1AR 5-Hydroxytryptamine receptor 1A
ZDHHC21 Zinc Finger DHHC-type palmitoyltransferase 21
DCC Deleted in colorectal carcinoma netrin 1 Receptor
TrkB Tropomyosin receptor kinase B
TrkB-T1 Tropomyosin receptor kinase B transcript isoform 1
TrkB-T2 Tropomyosin receptor kinase B transcript isoform 2
TrkB-FL Tropomyosin receptor kinase B full-length isoform
SAT1 Spermidine/Spermine N1-acetyltransferase 1
SMOX Spermine oxidase
vPFC Ventrolateral prefrontal cortex
MAPK Mitogen-activated protein kinase
Wnt Wingless and Int-1
TNF-α Tumor necrosis factor alpha
HuR Human antigen R
LC Locus coeruleus
RELN Reelin
MAOA Monoamine oxidase A
CHRM1 Cholinergic receptor muscarinic 1
PLCB1 Phospholipase C beta 1
GRIK1 Glutamate ionotropic receptor kainate type subunit 1
GFRA1 GDNF family receptor alpha 1
CREB2 Cyclic AMP response element-binding protein 2
Mili Miwi like; Piwil2
dsRNAs Double-stranded RNAs
Ago2 Argonaute 2
snRNPs Small nuclear ribonucleoprotein complexes
AD Alzheimer’s disease
APP Amyloid precursor protein
Aβ Amyloid beta
N40K N-terminal truncation fragment
HBII-52 C/D box snoRNA 52
HBII-85 C/D box snoRNA 85
HBI-36 H/ACA box snoRNA 36
PWS Prader–Willi syndrome
5-HT2c 5-Hydroxytryptamine receptor 2C
PMI Postmortem interval
PAR-CLIP Photoactivatable cross-linking and immunoprecipitation
|
|
tr
|
ncRNA Non-coding RNA
|
|
td
|
ncRNA
|
|
td
|
Non-coding RNA
|
|
tr
|
lncRNA Long non-coding RNA
|
|
td
|
lncRNA
|
|
td
|
Long non-coding RNA
|
|
tr
|
Nt Nucleotide
|
|
td
|
Nt
|
|
td
|
Nucleotide
|
|
tr
|
miRNA microRNA
|
|
td
|
miRNA
|
|
td
|
microRNA
|
|
tr
|
siRNA Small interfering RNA
|
|
td
|
siRNA
|
|
td
|
Small interfering RNA
|
|
tr
|
piRNA Piwi-interacting RNA
|
|
td
|
piRNA
|
|
td
|
Piwi-interacting RNA
|
|
tr
|
snoRNA Small nucleolar RNA
|
|
td
|
snoRNA
|
|
td
|
Small nucleolar RNA
|
|
tr
|
snRNA Small nuclear RNA
|
|
td
|
snRNA
|
|
td
|
Small nuclear RNA
|
|
tr
|
SCZ Schizophrenia
|
|
td
|
SCZ
|
|
td
|
Schizophrenia
|
|
tr
|
MDD Major depressive disorder
|
|
td
|
MDD
|
|
td
|
Major depressive disorder
|
|
tr
|
BD Bipolar disorder
|
|
td
|
BD
|
|
td
|
Bipolar disorder
|
|
tr
|
bp Base-pair
|
|
td
|
bp
|
|
td
|
Base-pair
|
|
tr
|
Xist X-inactive specific transcripts
|
|
td
|
Xist
|
|
td
|
X-inactive specific transcripts
|
|
tr
|
cDNA Complementary DNA
|
|
td
|
cDNA
|
|
td
|
Complementary DNA
|
|
tr
|
Brn 1b Brain-specific homeobox/POU domain protein 1b transcript
|
|
td
|
Brn 1b
|
|
td
|
Brain-specific homeobox/POU domain protein 1b transcript
|
|
tr
|
RMST Rhabdomyosarcoma 2 associated transcript
|
|
td
|
RMST
|
|
td
|
Rhabdomyosarcoma 2 associated transcript
|
|
tr
|
TUNA Tcl1 upstream neuron-associated transcript
|
|
td
|
TUNA
|
|
td
|
Tcl1 upstream neuron-associated transcript
|
|
tr
|
Evf2 Erwinia virulence factor 2 transcript
|
|
td
|
Evf2
|
|
td
|
Erwinia virulence factor 2 transcript
|
|
tr
|
GABA Gamma aminobutyric acid
|
|
td
|
GABA
|
|
td
|
Gamma aminobutyric acid
|
|
tr
|
Pnky Pinky
|
|
td
|
Pnky
|
|
td
|
Pinky
|
|
tr
|
Bdnf Brain-derived neurotrophic factor
|
|
td
|
Bdnf
|
|
td
|
Brain-derived neurotrophic factor
|
|
tr
|
BDNF-AS Brain-derived neurotrophic factor antisense RNA
|
|
td
|
BDNF-AS
|
|
td
|
Brain-derived neurotrophic factor antisense RNA
|
|
tr
|
GWAS Genome-wide association study
|
|
td
|
GWAS
|
|
td
|
Genome-wide association study
|
|
tr
|
CNNM2 Cyclin and CBS domain divalent metal cation transport mediator 2
|
|
td
|
CNNM2
|
|
td
|
Cyclin and CBS domain divalent metal cation transport mediator 2
|
|
tr
|
ACC Anterior cingulate cortex
|
|
td
|
ACC
|
|
td
|
Anterior cingulate cortex
|
|
tr
|
dlPFC Dorsolateral prefrontal cortex
|
|
td
|
dlPFC
|
|
td
|
Dorsolateral prefrontal cortex
|
|
tr
|
RNA-seq RNA sequencing
|
|
td
|
RNA-seq
|
|
td
|
RNA sequencing
|
|
tr
|
IRF2 Interferon regulatory factor 2
|
|
td
|
IRF2
|
|
td
|
Interferon regulatory factor 2
|
|
tr
|
LY6E Lymphocyte antigen 6E precursor
|
|
td
|
LY6E
|
|
td
|
Lymphocyte antigen 6E precursor
|
|
tr
|
HMOBX1 Homeobox containing 1
|
|
td
|
HMOBX1
|
|
td
|
Homeobox containing 1
|
|
tr
|
REEP5 Receptor accessory protein 5
|
|
td
|
REEP5
|
|
td
|
Receptor accessory protein 5
|
|
tr
|
PTPRT Protein tyrosine phosphatase receptor type T
|
|
td
|
PTPRT
|
|
td
|
Protein tyrosine phosphatase receptor type T
|
|
tr
|
NFATC3 Nuclear factor of activated T cells 3
|
|
td
|
NFATC3
|
|
td
|
Nuclear factor of activated T cells 3
|
|
tr
|
CNS Central nervous system
|
|
td
|
CNS
|
|
td
|
Central nervous system
|
|
tr
|
MARCKS Myristoylated alanine-rich C-kinase substrate
|
|
td
|
MARCKS
|
|
td
|
Myristoylated alanine-rich C-kinase substrate
|
|
tr
|
eQTL Expression quantitative trait locus
|
|
td
|
eQTL
|
|
td
|
Expression quantitative trait locus
|
|
tr
|
WGCNA Weighted correlation network analysis
|
|
td
|
WGCNA
|
|
td
|
Weighted correlation network analysis
|
|
tr
|
P2RY13 Purinergic receptor P2Y13
|
|
td
|
P2RY13
|
|
td
|
Purinergic receptor P2Y13
|
|
tr
|
PBMC Peripheral blood mononuclear cell
|
|
td
|
PBMC
|
|
td
|
Peripheral blood mononuclear cell
|
|
tr
|
qPCR Quantitative polymerase chain reaction
|
|
td
|
qPCR
|
|
td
|
Quantitative polymerase chain reaction
|
|
tr
|
p-GSK3β Phosphorylated glycogen synthase kinase 3 beta
|
|
td
|
p-GSK3β
|
|
td
|
Phosphorylated glycogen synthase kinase 3 beta
|
|
tr
|
SERT Serotonin transporter
|
|
td
|
SERT
|
|
td
|
Serotonin transporter
|
|
tr
|
pri-miRNA primary microRNA
|
|
td
|
pri-miRNA
|
|
td
|
primary microRNA
|
|
tr
|
pre-miRNA precursor microRNA
|
|
td
|
pre-miRNA
|
|
td
|
precursor microRNA
|
|
tr
|
DGCR8 DiGeorge syndrome critical region 8
|
|
td
|
DGCR8
|
|
td
|
DiGeorge syndrome critical region 8
|
|
tr
|
XPO5 Exportin-5
|
|
td
|
XPO5
|
|
td
|
Exportin-5
|
|
tr
|
TRBP TAR RNA-binding protein
|
|
td
|
TRBP
|
|
td
|
TAR RNA-binding protein
|
|
tr
|
Ago Argonaute
|
|
td
|
Ago
|
|
td
|
Argonaute
|
|
tr
|
RISC RNA-induced silencing complex
|
|
td
|
RISC
|
|
td
|
RNA-induced silencing complex
|
|
tr
|
p250GAP p250 GTPase-activating protein
|
|
td
|
p250GAP
|
|
td
|
p250 GTPase-activating protein
|
|
tr
|
MeCP2 methyl CpG binding protein 2
|
|
td
|
MeCP2
|
|
td
|
methyl CpG binding protein 2
|
|
tr
|
TCF4 Transcription factor 4
|
|
td
|
TCF4
|
|
td
|
Transcription factor 4
|
|
tr
|
BA Brodmann area
|
|
td
|
BA
|
|
td
|
Brodmann area
|
|
tr
|
CREB cAMP response element-binding
|
|
td
|
CREB
|
|
td
|
cAMP response element-binding
|
|
tr
|
ERK Extracellular signal regulated kinase
|
|
td
|
ERK
|
|
td
|
Extracellular signal regulated kinase
|
|
tr
|
NMDA N-methyl-D-aspartate receptor
|
|
td
|
NMDA
|
|
td
|
N-methyl-D-aspartate receptor
|
|
tr
|
GRID1 Glutamate receptor ionotropic delta 1
|
|
td
|
GRID1
|
|
td
|
Glutamate receptor ionotropic delta 1
|
|
tr
|
STG Superior temporal gyrus
|
|
td
|
STG
|
|
td
|
Superior temporal gyrus
|
|
tr
|
VSNL1 Visinin like 1
|
|
td
|
VSNL1
|
|
td
|
Visinin like 1
|
|
tr
|
GRIA2 Glutamate ionotropic receptor AMPA type subunit 2
|
|
td
|
GRIA2
|
|
td
|
Glutamate ionotropic receptor AMPA type subunit 2
|
|
tr
|
GRIA3 Glutamate ionotropic receptor AMPA type subunit 3
|
|
td
|
GRIA3
|
|
td
|
Glutamate ionotropic receptor AMPA type subunit 3
|
|
tr
|
GRIA4 Glutamate ionotropic receptor AMPA type subunit 4
|
|
td
|
GRIA4
|
|
td
|
Glutamate ionotropic receptor AMPA type subunit 4
|
|
tr
|
NCOA1 Nuclear receptor coactivator 1
|
|
td
|
NCOA1
|
|
td
|
Nuclear receptor coactivator 1
|
|
tr
|
NCOA2 Nuclear receptor coactivator 2
|
|
td
|
NCOA2
|
|
td
|
Nuclear receptor coactivator 2
|
|
tr
|
PDE4B Phosphodiesterase 4B
|
|
td
|
PDE4B
|
|
td
|
Phosphodiesterase 4B
|
|
tr
|
NCOR2 Nuclear receptor corepressor 2
|
|
td
|
NCOR2
|
|
td
|
Nuclear receptor corepressor 2
|
|
tr
|
GR Glucocorticoid receptor
|
|
td
|
GR
|
|
td
|
Glucocorticoid receptor
|
|
tr
|
vmPFC Ventromedial prefrontal cortex
|
|
td
|
vmPFC
|
|
td
|
Ventromedial prefrontal cortex
|
|
tr
|
GRM4 Glutamate receptor-4
|
|
td
|
GRM4
|
|
td
|
Glutamate receptor-4
|
|
tr
|
AMPA α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
|
|
td
|
AMPA
|
|
td
|
α-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid receptor
|
|
tr
|
DG Dentate gyrus
|
|
td
|
DG
|
|
td
|
Dentate gyrus
|
|
tr
|
ANK3 Ankyrin-3
|
|
td
|
ANK3
|
|
td
|
Ankyrin-3
|
|
tr
|
CACNB3 Calcium voltage-gated channel auxiliary subunit beta 3
|
|
td
|
CACNB3
|
|
td
|
Calcium voltage-gated channel auxiliary subunit beta 3
|
|
tr
|
CAMK2G Calcium/Calmodulin dependent protein kinase II gamma
|
|
td
|
CAMK2G
|
|
td
|
Calcium/Calmodulin dependent protein kinase II gamma
|
|
tr
|
NOVA1 Neuro-oncological ventral antigen 1
|
|
td
|
NOVA1
|
|
td
|
Neuro-oncological ventral antigen 1
|
|
tr
|
GABA-A Gamma-aminobutyric acid type A receptor subunit alpha
|
|
td
|
GABA-A
|
|
td
|
Gamma-aminobutyric acid type A receptor subunit alpha
|
|
tr
|
GABRA4 Gamma-aminobutyric acid type A receptor subunit alpha 4
|
|
td
|
GABRA4
|
|
td
|
Gamma-aminobutyric acid type A receptor subunit alpha 4
|
|
tr
|
DNMT3b DNA (cytosine-5-)-methyltransferase 3 beta
|
|
td
|
DNMT3b
|
|
td
|
DNA (cytosine-5-)-methyltransferase 3 beta
|
|
tr
|
5HT1AR 5-Hydroxytryptamine receptor 1A
|
|
td
|
5HT1AR
|
|
td
|
5-Hydroxytryptamine receptor 1A
|
|
tr
|
ZDHHC21 Zinc Finger DHHC-type palmitoyltransferase 21
|
|
td
|
ZDHHC21
|
|
td
|
Zinc Finger DHHC-type palmitoyltransferase 21
|
|
tr
|
DCC Deleted in colorectal carcinoma netrin 1 Receptor
|
|
td
|
DCC
|
|
td
|
Deleted in colorectal carcinoma netrin 1 Receptor
|
|
tr
|
TrkB Tropomyosin receptor kinase B
|
|
td
|
TrkB
|
|
td
|
Tropomyosin receptor kinase B
|
|
tr
|
TrkB-T1 Tropomyosin receptor kinase B transcript isoform 1
|
|
td
|
TrkB-T1
|
|
td
|
Tropomyosin receptor kinase B transcript isoform 1
|
|
tr
|
TrkB-T2 Tropomyosin receptor kinase B transcript isoform 2
|
|
td
|
TrkB-T2
|
|
td
|
Tropomyosin receptor kinase B transcript isoform 2
|
|
tr
|
TrkB-FL Tropomyosin receptor kinase B full-length isoform
|
|
td
|
TrkB-FL
|
|
td
|
Tropomyosin receptor kinase B full-length isoform
|
|
tr
|
SAT1 Spermidine/Spermine N1-acetyltransferase 1
|
|
td
|
SAT1
|
|
td
|
Spermidine/Spermine N1-acetyltransferase 1
|
|
tr
|
SMOX Spermine oxidase
|
|
td
|
SMOX
|
|
td
|
Spermine oxidase
|
|
tr
|
vPFC Ventrolateral prefrontal cortex
|
|
td
|
vPFC
|
|
td
|
Ventrolateral prefrontal cortex
|
|
tr
|
MAPK Mitogen-activated protein kinase
|
|
td
|
MAPK
|
|
td
|
Mitogen-activated protein kinase
|
|
tr
|
Wnt Wingless and Int-1
|
|
td
|
Wnt
|
|
td
|
Wingless and Int-1
|
|
tr
|
TNF-α Tumor necrosis factor alpha
|
|
td
|
TNF-α
|
|
td
|
Tumor necrosis factor alpha
|
|
tr
|
HuR Human antigen R
|
|
td
|
HuR
|
|
td
|
Human antigen R
|
|
tr
|
LC Locus coeruleus
|
|
td
|
LC
|
|
td
|
Locus coeruleus
|
|
tr
|
RELN Reelin
|
|
td
|
RELN
|
|
td
|
Reelin
|
|
tr
|
MAOA Monoamine oxidase A
|
|
td
|
MAOA
|
|
td
|
Monoamine oxidase A
|
|
tr
|
CHRM1 Cholinergic receptor muscarinic 1
|
|
td
|
CHRM1
|
|
td
|
Cholinergic receptor muscarinic 1
|
|
tr
|
PLCB1 Phospholipase C beta 1
|
|
td
|
PLCB1
|
|
td
|
Phospholipase C beta 1
|
|
tr
|
GRIK1 Glutamate ionotropic receptor kainate type subunit 1
|
|
td
|
GRIK1
|
|
td
|
Glutamate ionotropic receptor kainate type subunit 1
|
|
tr
|
GFRA1 GDNF family receptor alpha 1
|
|
td
|
GFRA1
|
|
td
|
GDNF family receptor alpha 1
|
|
tr
|
CREB2 Cyclic AMP response element-binding protein 2
|
|
td
|
CREB2
|
|
td
|
Cyclic AMP response element-binding protein 2
|
|
tr
|
Mili Miwi like; Piwil2
|
|
td
|
Mili
|
|
td
|
Miwi like; Piwil2
|
|
tr
|
dsRNAs Double-stranded RNAs
|
|
td
|
dsRNAs
|
|
td
|
Double-stranded RNAs
|
|
tr
|
Ago2 Argonaute 2
|
|
td
|
Ago2
|
|
td
|
Argonaute 2
|
|
tr
|
snRNPs Small nuclear ribonucleoprotein complexes
|
|
td
|
snRNPs
|
|
td
|
Small nuclear ribonucleoprotein complexes
|
|
tr
|
AD Alzheimer’s disease
|
|
td
|
AD
|
|
td
|
Alzheimer’s disease
|
|
tr
|
APP Amyloid precursor protein
|
|
td
|
APP
|
|
td
|
Amyloid precursor protein
|
|
tr
|
Aβ Amyloid beta
|
|
td
|
Aβ
|
|
td
|
Amyloid beta
|
|
tr
|
N40K N-terminal truncation fragment
|
|
td
|
N40K
|
|
td
|
N-terminal truncation fragment
|
|
tr
|
HBII-52 C/D box snoRNA 52
|
|
td
|
HBII-52
|
|
td
|
C/D box snoRNA 52
|
|
tr
|
HBII-85 C/D box snoRNA 85
|
|
td
|
HBII-85
|
|
td
|
C/D box snoRNA 85
|
|
tr
|
HBI-36 H/ACA box snoRNA 36
|
|
td
|
HBI-36
|
|
td
|
H/ACA box snoRNA 36
|
|
tr
|
PWS Prader–Willi syndrome
|
|
td
|
PWS
|
|
td
|
Prader–Willi syndrome
|
|
tr
|
5-HT2c 5-Hydroxytryptamine receptor 2C
|
|
td
|
5-HT2c
|
|
td
|
5-Hydroxytryptamine receptor 2C
|
|
tr
|
PMI Postmortem interval
|
|
td
|
PMI
|
|
td
|
Postmortem interval
|
|
tr
|
PAR-CLIP Photoactivatable cross-linking and immunoprecipitation
|
|
td
|
PAR-CLIP
|
|
td
|
Photoactivatable cross-linking and immunoprecipitation
|
