> top > docs > PMC:7354481 > spans > 57200-58905 > annotations

PMC:7354481 / 57200-58905 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T375 71-77 Body_part denotes genome http://purl.org/sig/ont/fma/fma84116
T376 194-200 Body_part denotes genome http://purl.org/sig/ont/fma/fma84116
T377 279-286 Body_part denotes genomes http://purl.org/sig/ont/fma/fma84116

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T325 96-104 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T674 216-217 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T675 425-427 http://purl.obolibrary.org/obo/CLO_0001302 denotes 34
T676 428-431 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T677 480-483 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T678 545-548 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T679 600-603 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T680 656-659 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T681 740-743 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T682 801-804 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T683 868-871 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T684 927-930 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T685 983-986 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T686 1045-1048 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T687 1106-1109 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T688 1165-1168 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T689 1224-1227 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T690 1282-1285 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T691 1342-1345 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T692 1401-1404 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T693 1463-1466 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T694 1527-1530 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T695 1589-1592 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa
T696 1646-1649 http://purl.obolibrary.org/obo/PR_000001932 denotes hsa

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T47941 225-229 Chemical denotes base http://purl.obolibrary.org/obo/CHEBI_22695

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T425 0-296 Sentence denotes Table 3 The mutational comparison of selected miRs found on the Wuhan genome compared to other SARS-CoV-2 strains isolated from different geographical regions. % represents the number of viral genome sequences with a single base change in that miR sequence. n = number of viral genomes analysed.
T426 297-368 Sentence denotes miRs Alignment Wuhan/China Italy Spain France England USA India
T427 369-427 Sentence denotes n = 28 n = 44 n = 133 n = 104 n = 104 n = 104 n = 34
T428 428-479 Sentence denotes hsa-miR-8066 ccaaaagaucacauug 0 0 0 0 0 0 0
T429 480-544 Sentence denotes hsa-miR-5197-3p auucgaagacccagucccuacuu 0 0 0 0 0 0.9% 0
T430 545-599 Sentence denotes hsa-miR-3611 ugagaagcaagaaauucuu 0 0 0 0 0 0 0
T431 600-655 Sentence denotes hsa-miR-3934-3p ucagguuggacagcugg 0 0 0 0 0 0 0
T432 656-739 Sentence denotes hsa-miR-1307-3p accgaggccacgcggagu 3.5% 2.2% 8.27% 1.92% 2.88% 2.88% 38.23%
T433 740-800 Sentence denotes hsa-miR-3691-3p gagauguugacacagacuuugu 0 0 0 0 0 0 0
T434 801-867 Sentence denotes hsa-miR-1468-5p cucaguuugccuguuu 0 0 2.25% 0.96% 0 0 8.83%
T435 868-926 Sentence denotes hsa-miR-3120-5p uguagaggaggcaaagacag 0 0 0 0 0 0 0
T436 927-982 Sentence denotes hsa-miR-3914 caucucacuugcugguuccu 0 0 0 0 0 0 0
T437 983-1044 Sentence denotes hsa-miR-3672 ugagucucauggaaaaca 0 0 0.75% 0.96% 0 0 0
T438 1045-1105 Sentence denotes hsa-miR-378c acugggcauugauuuagaugagugg 0 0 0 0 0 0 0
T439 1106-1164 Sentence denotes hsa-miR-7107-3p ccaaaaagagaaagucaaca 0 0 0 0 0 0 0
T440 1165-1223 Sentence denotes hsa-miR-1287-5p acucaaaccacugaaacagc 0 0 0 0 0 0 0
T441 1224-1281 Sentence denotes hsa-miR-10397-5p uucuucaccugaugcugu 0 0 0 0 0 0 0
T442 1282-1341 Sentence denotes hsa-miR-584-3p gccugguuugccuggcac 0 0 0.75% 0 0 0 0
T443 1342-1400 Sentence denotes hsa-miR-3085-3p ucuggcuguuauggcc 0 0 0 0 0 0.96% 0
T444 1401-1462 Sentence denotes hsa-miR-3191-3p cugucuauccaguugcgucacca 0 0 0 0 0 0 0
T445 1463-1526 Sentence denotes hsa-miR-3529-3p uggcagacgggcgauuuuguu 0 0 0 0 0 0 2.94%
T446 1527-1588 Sentence denotes hsa-miR-3682-5p auagcacaaguagauguag 0 0 0 0 0 0.96% 0
T447 1589-1645 Sentence denotes hsa-miR-148b-3p aaguucuaugaugcacag 0 0 0 0 0 0 0
T448 1646-1705 Sentence denotes hsa-miR-129-2-3p ugauuuuuguggaaagggcu 0 0 0 0 0 0 0

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
1693 741-753 Gene denotes sa-miR-3691- Gene:100500900
1694 802-814 Gene denotes sa-miR-1468- Gene:100302115
1695 869-881 Gene denotes sa-miR-3120- Gene:100422882
1696 1046-1059 Gene denotes sa-miR-378c Gene:100422867
1697 1107-1119 Gene denotes sa-miR-7107- Gene:102465665
1698 1166-1178 Gene denotes sa-miR-1287- Gene:100302133
1699 1283-1294 Gene denotes sa-miR-584- Gene:693169
1700 1528-1540 Gene denotes sa-miR-3682- Gene:100500850
1701 1590-1602 Gene denotes sa-miR-148b- Gene:442892
1702 429-442 Gene denotes sa-miR-8066 Gene:102465868
1703 1464-1476 Gene denotes sa-miR-3529- Gene:100616238
1704 1402-1414 Gene denotes sa-miR-3191- Gene:100422832
1705 984-997 Gene denotes sa-miR-3672 Gene:100500869
1706 601-613 Gene denotes sa-miR-3934- Gene:100500873
1707 546-559 Gene denotes sa-miR-3611 Gene:100500890
1708 481-493 Gene denotes sa-miR-5197- Gene:100846991
1709 1651-1660 Gene denotes iR-129-2- Gene:100302138
1711 96-106 Species denotes SARS-CoV-2 Tax:2697049