PMC:7296049 / 15530-16938 JSONTXT

{"target":"https://pubannotation.org/docs/sourcedb/PMC/sourceid/7296049","sourcedb":"PMC","sourceid":"7296049","source_url":"https://www.ncbi.nlm.nih.gov/pmc/7296049","text":"Quantitative Real-Time (qRT-)PCR\nTotal RNA was extracted from the white matter using TRIzol reagent (Tiangen Biotech, Beijing, China; cat. no. DP419) and quantified with a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA). An equal amount of RNA from each group was reverse transcribed into cDNA using a cDNA synthesis kit (Tiangen Biotech; cat. no. KR118) according to the manufacturer’s instructions. qRT-PCR was performed with SuperReal PreMix Plus (Tiangen Biotech; cat. no. FP205) on an ABI 7500 PCR System (Applied Biosystems, Foster City, CA, USA), with β-actin as an internal control. The reaction contained 2× SuperReal PreMix Plus (10 μl), 50× ROX Reference Dye (0.4 μl), forward and reverse primers (0.6 μl each), cDNA derived from 0.1 μg total RNA, and RNase-free double-distilled H2O (6.4 μl). All reactions were run in triplicate. The reaction conditions were as follows: 95°C for 15 min, followed by 40 cycles of 95°C for 10 s and 60°C for 32 s. Relative expression levels of target genes were determined with the 2−ΔΔCt method. The following forward and reverse primers were used: MBP, GCTGGCATGTCCCTGTGTCTG and CCCAATCGCAGTCCCTTGTGAG; Olig2, TTGGCTGAACGAACACTCCG and TCCAGGGATGGATGTACCCG; TNF-α, GCGTGTTCATCCGTTCTCTAC and CTTCAGCGTCTCGTGTGTTTC; SIRT1, AACCACCAAAGCGGAAAAAAAGAA and CACAGCAAGGCGAGCATAAATA; and β-actin, TGTCACCAACTGGGACGATA and GGGGTGTTGAAGGTCTCAAA.","divisions":[{"label":"title","span":{"begin":0,"end":32}}],"tracks":[]}