PMC:7078824 / 1593-6456 JSON TXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

LitCovid-PD-UBERON

LitCovid-PD-MONDO

LitCovid-PD-CLO

LitCovid-PD-CHEBI

{"project":"LitCovid-PD-CHEBI","denotations":[{"id":"T1","span":{"begin":151,"end":163},"obj":"Chemical"},{"id":"T2","span":{"begin":159,"end":163},"obj":"Chemical"},{"id":"T3","span":{"begin":433,"end":440},"obj":"Chemical"},{"id":"T4","span":{"begin":539,"end":544},"obj":"Chemical"},{"id":"T5","span":{"begin":682,"end":687},"obj":"Chemical"},{"id":"T6","span":{"begin":717,"end":722},"obj":"Chemical"},{"id":"T7","span":{"begin":2157,"end":2161},"obj":"Chemical"}],"attributes":[{"id":"A1","pred":"chebi_id","subj":"T1","obj":"http://purl.obolibrary.org/obo/CHEBI_33696"},{"id":"A2","pred":"chebi_id","subj":"T2","obj":"http://purl.obolibrary.org/obo/CHEBI_37527"},{"id":"A3","pred":"chebi_id","subj":"T3","obj":"http://purl.obolibrary.org/obo/CHEBI_36080"},{"id":"A4","pred":"chebi_id","subj":"T4","obj":"http://purl.obolibrary.org/obo/CHEBI_50406"},{"id":"A5","pred":"chebi_id","subj":"T5","obj":"http://purl.obolibrary.org/obo/CHEBI_50406"},{"id":"A6","pred":"chebi_id","subj":"T6","obj":"http://purl.obolibrary.org/obo/CHEBI_52282"},{"id":"A7","pred":"chebi_id","subj":"T7","obj":"http://purl.obolibrary.org/obo/CHEBI_30780"}],"text":"Case follow-up\nSince January 2020, 62 medical staff of Zhongnan Hospital of Wuhan University have been diagnosed with COVID-19 by detecting SARS-CoV-2 nucleic acid in throat swab samples according to the manufacturer’s protocol (Shanghai BioGerm Medical Technology, Shanghai, China). Briefly, the RT-PCR assay for SARS-CoV-2 amplifies simultaneously two target genes: open reading frame 1ab (ORF1ab) and the ORF for the nucleocapsid protein (N). Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; probe 5’-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3’. Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; probe 5’-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3’. Positive (pseudovirus with a fragment of ORF1ab and N) and negative (pseudovirus with a standard fragment) quality control samples were tested simultaneously. A cycle threshold (Ct) value of less than 37 was defined a positive test, while a Ct value of more than 40 was defined as a negative test. For the cases with an intermediate Ct value (37–40), a second sample was tested and weakly positive was defined as a recurrence of Ct value of 37–40. The diagnostic criteria were based on the recommendation from the National Institute for Viral Disease Control and Prevention (China) [6].\nAll confirmed cases were hospitalised and isolated for treatment. The discharge criteria were: (i) afebrile for at least 3 days, (ii) obvious alleviation of respiratory symptoms, (iii) improvement in radiological abnormalities on chest computed tomography (CT) or X-ray and (iv) two consecutive negative detections of SARS-CoV-2 at least 24 h apart [7]. After discharge, all cases were kept under surveillance and quarantined at home for at least 14 days; all cases had a throat swab test for SARS-CoV-2 every day or every other day at least 5 times. For those with positive virus detection during this period, we extracted and analysed the medical records.\nThis study was approved by the ethics committee of Zhongnan Hospital of Wuhan University (Number 2020011), and written informed consent was obtained from patients.\n\nCase 1\nCase 1 was a male doctor in his 40s with an exposure history to COVID-19 patients. He experienced fever (up to 39.3 °C), chill and fatigue on 15 January (Figure 1). Chest CT showed lung infection in the lower left lobe on 18 January, and he was admitted to hospital on the same day. During the hospitalisation from 18 January to 10 February, his condition first deteriorated and then reached remission on 28 January. Throat swab tests for SARS-CoV-2 were positive on 28 January and 2 February, and turned negative on 7 and 9 February. Stool tests of SARS-CoV-2, first conducted on 7 February, were also negative on 7 and 9 February. The exact Ct values were unavailable.\nFigure 1 Throat swab virus tests and chest computed tomography findings of COVID-19 Case 1 from symptom onset to post-discharge, China, January–February 2020\nChest CT showed worse status on 18, 20, 23 and 29 January and showed improved status on 4 February.\nRed: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs; dates marked with an asterisk: negative virus detection in stool. After discharge on 10 February, he was kept under surveillance and quarantined at home. He did not experience discomfort during the follow-up period. The results of consecutive throat swab tests were negative on 13 February, weakly positive on 14 February, positive on 15 February, negative on 16 February, weakly positive on 18 February, negative on 20 February and negative on 22 February. Stool was not tested after discharge.\n\nCase 2\nCase 2 was a female nurse in her 20s. She experienced headache and pharyngalgia but no fever on 29 January (Figure 2). Throat swab tests for SARS-CoV-2 were positive on 31 January and 2 February. However, chest CT showed no abnormalities on 2 February. This patient was admitted to hospital on 5 February. Throat swab test remained positive on 6 February and turned negative on 10 and 12 February. Stool was not tested in Case 2.\nFigure 2 Throat swab virus tests and chest computed tomography findings in COVID-19 Case 2 from symptom onset to post-discharge, China, January–February 2020\nChest CT showed no abnormalities on 2, 4 and 12 February. Red: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs. After discharge on 13 February, Case 2 was kept under surveillance and quarantined at home. She did not experience discomfort during the follow-up. The results of consecutive throat swab tests were weakly positive on 14 and 15 February, negative on 16, 17 and 18 February, positive on 19 February and negative on 20, 21 and 22 February."}

LitCovid-PD-HP

{"project":"LitCovid-PD-HP","denotations":[{"id":"T3","span":{"begin":2242,"end":2247},"obj":"Phenotype"},{"id":"T4","span":{"begin":2275,"end":2282},"obj":"Phenotype"},{"id":"T5","span":{"begin":3783,"end":3791},"obj":"Phenotype"},{"id":"T6","span":{"begin":3796,"end":3808},"obj":"Phenotype"},{"id":"T7","span":{"begin":3816,"end":3821},"obj":"Phenotype"}],"attributes":[{"id":"A3","pred":"hp_id","subj":"T3","obj":"http://purl.obolibrary.org/obo/HP_0001945"},{"id":"A4","pred":"hp_id","subj":"T4","obj":"http://purl.obolibrary.org/obo/HP_0012378"},{"id":"A5","pred":"hp_id","subj":"T5","obj":"http://purl.obolibrary.org/obo/HP_0002315"},{"id":"A6","pred":"hp_id","subj":"T6","obj":"http://purl.obolibrary.org/obo/HP_0033050"},{"id":"A7","pred":"hp_id","subj":"T7","obj":"http://purl.obolibrary.org/obo/HP_0001945"}],"text":"Case follow-up\nSince January 2020, 62 medical staff of Zhongnan Hospital of Wuhan University have been diagnosed with COVID-19 by detecting SARS-CoV-2 nucleic acid in throat swab samples according to the manufacturer’s protocol (Shanghai BioGerm Medical Technology, Shanghai, China). Briefly, the RT-PCR assay for SARS-CoV-2 amplifies simultaneously two target genes: open reading frame 1ab (ORF1ab) and the ORF for the nucleocapsid protein (N). Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; probe 5’-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3’. Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; probe 5’-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3’. Positive (pseudovirus with a fragment of ORF1ab and N) and negative (pseudovirus with a standard fragment) quality control samples were tested simultaneously. A cycle threshold (Ct) value of less than 37 was defined a positive test, while a Ct value of more than 40 was defined as a negative test. For the cases with an intermediate Ct value (37–40), a second sample was tested and weakly positive was defined as a recurrence of Ct value of 37–40. The diagnostic criteria were based on the recommendation from the National Institute for Viral Disease Control and Prevention (China) [6].\nAll confirmed cases were hospitalised and isolated for treatment. The discharge criteria were: (i) afebrile for at least 3 days, (ii) obvious alleviation of respiratory symptoms, (iii) improvement in radiological abnormalities on chest computed tomography (CT) or X-ray and (iv) two consecutive negative detections of SARS-CoV-2 at least 24 h apart [7]. After discharge, all cases were kept under surveillance and quarantined at home for at least 14 days; all cases had a throat swab test for SARS-CoV-2 every day or every other day at least 5 times. For those with positive virus detection during this period, we extracted and analysed the medical records.\nThis study was approved by the ethics committee of Zhongnan Hospital of Wuhan University (Number 2020011), and written informed consent was obtained from patients.\n\nCase 1\nCase 1 was a male doctor in his 40s with an exposure history to COVID-19 patients. He experienced fever (up to 39.3 °C), chill and fatigue on 15 January (Figure 1). Chest CT showed lung infection in the lower left lobe on 18 January, and he was admitted to hospital on the same day. During the hospitalisation from 18 January to 10 February, his condition first deteriorated and then reached remission on 28 January. Throat swab tests for SARS-CoV-2 were positive on 28 January and 2 February, and turned negative on 7 and 9 February. Stool tests of SARS-CoV-2, first conducted on 7 February, were also negative on 7 and 9 February. The exact Ct values were unavailable.\nFigure 1 Throat swab virus tests and chest computed tomography findings of COVID-19 Case 1 from symptom onset to post-discharge, China, January–February 2020\nChest CT showed worse status on 18, 20, 23 and 29 January and showed improved status on 4 February.\nRed: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs; dates marked with an asterisk: negative virus detection in stool. After discharge on 10 February, he was kept under surveillance and quarantined at home. He did not experience discomfort during the follow-up period. The results of consecutive throat swab tests were negative on 13 February, weakly positive on 14 February, positive on 15 February, negative on 16 February, weakly positive on 18 February, negative on 20 February and negative on 22 February. Stool was not tested after discharge.\n\nCase 2\nCase 2 was a female nurse in her 20s. She experienced headache and pharyngalgia but no fever on 29 January (Figure 2). Throat swab tests for SARS-CoV-2 were positive on 31 January and 2 February. However, chest CT showed no abnormalities on 2 February. This patient was admitted to hospital on 5 February. Throat swab test remained positive on 6 February and turned negative on 10 and 12 February. Stool was not tested in Case 2.\nFigure 2 Throat swab virus tests and chest computed tomography findings in COVID-19 Case 2 from symptom onset to post-discharge, China, January–February 2020\nChest CT showed no abnormalities on 2, 4 and 12 February. Red: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs. After discharge on 13 February, Case 2 was kept under surveillance and quarantined at home. She did not experience discomfort during the follow-up. The results of consecutive throat swab tests were weakly positive on 14 and 15 February, negative on 16, 17 and 18 February, positive on 19 February and negative on 20, 21 and 22 February."}

LitCovid-sentences

LitCovid-PubTator

PMC:7078824 / 1593-6456 JSONTXT

Annnotations TAB JSON ListView MergeView

PMC:7078824 / 1593-6456 JSON TXT