> top > docs > PMC:7078824 > annotations

PMC:7078824 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T1 1760-1766 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T2 2026-2033 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T3 3137-3142 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T4 3379-3385 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T5 3902-3907 Body_part denotes Chest http://purl.org/sig/ont/fma/fma9576
T6 3918-3922 Body_part denotes lung http://purl.org/sig/ont/fma/fma7195
T7 4154-4160 Body_part denotes Throat http://purl.org/sig/ont/fma/fma228738
T8 4272-4277 Body_part denotes Stool http://purl.org/sig/ont/fma/fma64183
T9 4418-4424 Body_part denotes Throat http://purl.org/sig/ont/fma/fma228738
T10 4446-4451 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T11 4567-4572 Body_part denotes Chest http://purl.org/sig/ont/fma/fma9576
T12 4700-4706 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T13 4755-4761 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T14 4804-4810 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T15 4877-4882 Body_part denotes stool http://purl.org/sig/ont/fma/fma64183
T16 5061-5067 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T17 5276-5281 Body_part denotes Stool http://purl.org/sig/ont/fma/fma64183
T18 5441-5447 Body_part denotes Throat http://purl.org/sig/ont/fma/fma228738
T19 5527-5532 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T20 5628-5634 Body_part denotes Throat http://purl.org/sig/ont/fma/fma228738
T21 5720-5725 Body_part denotes Stool http://purl.org/sig/ont/fma/fma64183
T22 5762-5768 Body_part denotes Throat http://purl.org/sig/ont/fma/fma228738
T23 5790-5795 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T24 5911-5916 Body_part denotes Chest http://purl.org/sig/ont/fma/fma9576
T25 6002-6008 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T26 6057-6063 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T27 6106-6112 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T28 6295-6301 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T29 7106-7112 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T30 7122-7127 Body_part denotes stool http://purl.org/sig/ont/fma/fma64183
T31 7437-7460 Body_part denotes upper respiratory tract http://purl.org/sig/ont/fma/fma45661
T32 7566-7589 Body_part denotes lower respiratory tract http://purl.org/sig/ont/fma/fma45662
T33 7618-7628 Body_part denotes intestines http://purl.org/sig/ont/fma/fma7199
T34 7633-7638 Body_part denotes blood http://purl.org/sig/ont/fma/fma9670
T35 7683-7689 Body_part denotes throat http://purl.org/sig/ont/fma/fma228738
T36 7864-7869 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T37 8706-8719 Body_part denotes immune system http://purl.org/sig/ont/fma/fma9825
T38 8772-8776 Body_part denotes body http://purl.org/sig/ont/fma/fma256135
T39 8882-8887 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576
T40 9117-9122 Body_part denotes chest http://purl.org/sig/ont/fma/fma9576

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T1 1760-1766 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T2 3137-3142 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T3 3379-3385 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T4 3902-3907 Body_part denotes Chest http://purl.obolibrary.org/obo/UBERON_0001443
T5 3918-3922 Body_part denotes lung http://purl.obolibrary.org/obo/UBERON_0002048
T6 3951-3955 Body_part denotes lobe http://purl.obolibrary.org/obo/UBERON_3010752
T7 4154-4160 Body_part denotes Throat http://purl.obolibrary.org/obo/UBERON_0000341
T8 4272-4277 Body_part denotes Stool http://purl.obolibrary.org/obo/UBERON_0001988
T9 4418-4424 Body_part denotes Throat http://purl.obolibrary.org/obo/UBERON_0000341
T10 4446-4451 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T11 4567-4572 Body_part denotes Chest http://purl.obolibrary.org/obo/UBERON_0001443
T12 4700-4706 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T13 4755-4761 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T14 4804-4810 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T15 4877-4882 Body_part denotes stool http://purl.obolibrary.org/obo/UBERON_0001988
T16 5061-5067 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T17 5276-5281 Body_part denotes Stool http://purl.obolibrary.org/obo/UBERON_0001988
T18 5441-5447 Body_part denotes Throat http://purl.obolibrary.org/obo/UBERON_0000341
T19 5527-5532 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T20 5628-5634 Body_part denotes Throat http://purl.obolibrary.org/obo/UBERON_0000341
T21 5720-5725 Body_part denotes Stool http://purl.obolibrary.org/obo/UBERON_0001988
T22 5762-5768 Body_part denotes Throat http://purl.obolibrary.org/obo/UBERON_0000341
T23 5790-5795 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T24 5911-5916 Body_part denotes Chest http://purl.obolibrary.org/obo/UBERON_0001443
T25 6002-6008 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T26 6057-6063 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T27 6106-6112 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T28 6295-6301 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T29 7106-7112 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T30 7122-7127 Body_part denotes stool http://purl.obolibrary.org/obo/UBERON_0001988
T31 7437-7460 Body_part denotes upper respiratory tract http://purl.obolibrary.org/obo/UBERON_0001557
T32 7443-7460 Body_part denotes respiratory tract http://purl.obolibrary.org/obo/UBERON_0000065
T33 7566-7589 Body_part denotes lower respiratory tract http://purl.obolibrary.org/obo/UBERON_0001558
T34 7572-7589 Body_part denotes respiratory tract http://purl.obolibrary.org/obo/UBERON_0000065
T35 7618-7628 Body_part denotes intestines http://purl.obolibrary.org/obo/UBERON_0000160
T36 7633-7638 Body_part denotes blood http://purl.obolibrary.org/obo/UBERON_0000178
T37 7683-7689 Body_part denotes throat http://purl.obolibrary.org/obo/UBERON_0000341
T38 7864-7869 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T39 8706-8719 Body_part denotes immune system http://purl.obolibrary.org/obo/UBERON_0002405
T40 8882-8887 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443
T41 9117-9122 Body_part denotes chest http://purl.obolibrary.org/obo/UBERON_0001443

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T1 93-117 Disease denotes coronavirus disease 2019 http://purl.obolibrary.org/obo/MONDO_0100096
T2 119-127 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T3 275-299 Disease denotes coronavirus disease 2019 http://purl.obolibrary.org/obo/MONDO_0100096
T4 747-756 Disease denotes pneumonia http://purl.obolibrary.org/obo/MONDO_0005249
T5 929-937 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T6 979-987 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T7 1069-1078 Disease denotes pneumonia http://purl.obolibrary.org/obo/MONDO_0005249
T8 1079-1103 Disease denotes coronavirus disease 2019 http://purl.obolibrary.org/obo/MONDO_0100096
T9 1105-1113 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T10 1158-1166 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T11 1497-1505 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T12 1711-1719 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T13 1733-1741 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T14 1907-1915 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T15 2857-2870 Disease denotes Viral Disease http://purl.obolibrary.org/obo/MONDO_0005108
T16 3225-3233 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T17 3400-3408 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T18 3801-3809 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T19 3923-3932 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T20 3975-3977 Disease denotes he http://purl.obolibrary.org/obo/MONDO_0017319
T21 4176-4184 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T22 4287-4295 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T23 4484-4492 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T24 4916-4918 Disease denotes he http://purl.obolibrary.org/obo/MONDO_0017319
T25 5463-5471 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T26 5828-5836 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T27 6513-6521 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T28 7483-7492 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T29 7800-7808 Disease denotes SARS-CoV http://purl.obolibrary.org/obo/MONDO_0005091
T30 7889-7892 Disease denotes PCT http://purl.obolibrary.org/obo/MONDO_0008296|http://purl.obolibrary.org/obo/MONDO_0015104
T32 8213-8220 Disease denotes COVID19 http://purl.obolibrary.org/obo/MONDO_0100096
T33 9015-9023 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T1 41-46 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T2 564-565 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T3 609-613 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T4 893-900 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Viruses
T5 908-911 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T6 923-928 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T7 1021-1033 http://purl.obolibrary.org/obo/OBI_0000245 denotes Organization
T8 1040-1043 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T9 1054-1059 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T10 1140-1141 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T11 1443-1448 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T12 1954-1959 http://purl.obolibrary.org/obo/OGG_0000000002 denotes genes
T13 2347-2348 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T14 2406-2407 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T15 2456-2462 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T16 2479-2480 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T17 2536-2537 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T18 2547-2551 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T19 2559-2560 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T20 2601-2602 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T21 2612-2616 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T22 2671-2672 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T23 2691-2697 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T24 2733-2734 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T25 3137-3142 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T26 3377-3378 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T27 3391-3395 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T28 3482-3487 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T29 3748-3749 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T30 3750-3754 http://purl.obolibrary.org/obo/UBERON_0003101 denotes male
T31 3750-3754 http://www.ebi.ac.uk/efo/EFO_0000970 denotes male
T32 3902-3907 http://www.ebi.ac.uk/efo/EFO_0000965 denotes Chest
T33 3918-3922 http://purl.obolibrary.org/obo/UBERON_0002048 denotes lung
T34 3918-3922 http://www.ebi.ac.uk/efo/EFO_0000934 denotes lung
T35 3959-3961 http://purl.obolibrary.org/obo/CLO_0050510 denotes 18
T36 4052-4054 http://purl.obolibrary.org/obo/CLO_0050510 denotes 18
T37 4166-4171 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T38 4278-4283 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T39 4430-4435 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T40 4436-4441 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T41 4446-4451 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T42 4567-4572 http://www.ebi.ac.uk/efo/EFO_0000965 denotes Chest
T43 4599-4601 http://purl.obolibrary.org/obo/CLO_0050510 denotes 18
T44 4681-4686 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T45 4736-4741 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T46 4785-4790 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T47 4858-4863 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T48 5073-5078 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T49 5210-5212 http://purl.obolibrary.org/obo/CLO_0050510 denotes 18
T50 5263-5265 http://purl.obolibrary.org/obo/CLO_0050507 denotes 22
T51 5290-5296 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T52 5333-5334 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T53 5335-5341 http://purl.obolibrary.org/obo/UBERON_0003100 denotes female
T54 5453-5458 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T55 5527-5532 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T56 5640-5644 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T57 5734-5740 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T58 5774-5779 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T59 5780-5785 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T60 5790-5795 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T61 5911-5916 http://www.ebi.ac.uk/efo/EFO_0000965 denotes Chest
T62 5983-5988 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T63 6038-6043 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T64 6087-6092 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T65 6307-6312 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T66 6380-6382 http://purl.obolibrary.org/obo/CLO_0050510 denotes 18
T67 6444-6446 http://purl.obolibrary.org/obo/CLO_0050507 denotes 22
T68 6490-6491 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T69 6593-6600 http://purl.obolibrary.org/obo/UBERON_0000473 denotes testing
T70 6618-6623 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T71 6773-6778 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T72 6857-6862 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T73 6863-6870 http://purl.obolibrary.org/obo/UBERON_0000473 denotes testing
T74 7128-7133 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T75 7328-7329 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T76 7401-7406 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T77 7527-7532 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T78 7566-7589 http://purl.obolibrary.org/obo/UBERON_0001558 denotes lower respiratory tract
T79 7618-7628 http://purl.obolibrary.org/obo/UBERON_0000160 denotes intestines
T80 7618-7628 http://www.ebi.ac.uk/efo/EFO_0000834 denotes intestines
T81 7633-7638 http://purl.obolibrary.org/obo/UBERON_0000178 denotes blood
T82 7633-7638 http://www.ebi.ac.uk/efo/EFO_0000296 denotes blood
T83 7654-7659 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T84 7864-7869 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T85 8041-8042 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T86 8060-8061 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T87 8128-8129 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T88 8146-8151 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T89 8254-8255 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T90 8377-8381 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T91 8434-8436 http://purl.obolibrary.org/obo/CLO_0053733 denotes 11
T92 8454-8455 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T93 8687-8688 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T94 8706-8719 http://purl.obolibrary.org/obo/UBERON_0002405 denotes immune system
T95 8757-8764 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T96 8806-8811 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T97 8828-8832 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T98 8882-8887 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T99 8962-8963 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T100 8972-8973 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T101 9003-9004 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T102 9071-9072 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T103 9117-9122 http://www.ebi.ac.uk/efo/EFO_0000965 denotes chest
T104 9167-9168 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T105 9226-9231 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T106 9666-9668 http://purl.obolibrary.org/obo/CLO_0007815 denotes Mo

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T1 1744-1756 Chemical denotes nucleic acid http://purl.obolibrary.org/obo/CHEBI_33696
T2 1752-1756 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T3 2026-2033 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T4 2132-2137 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T5 2275-2280 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T6 2310-2315 Chemical denotes TAMRA http://purl.obolibrary.org/obo/CHEBI_52282
T7 3750-3754 Chemical denotes male http://purl.obolibrary.org/obo/CHEBI_30780
T8 9666-9668 Chemical denotes Mo http://purl.obolibrary.org/obo/CHEBI_28685

LitCovid-PD-HP

Id Subject Object Predicate Lexical cue hp_id
T1 747-756 Phenotype denotes pneumonia http://purl.obolibrary.org/obo/HP_0002090
T2 1069-1078 Phenotype denotes pneumonia http://purl.obolibrary.org/obo/HP_0002090
T3 3835-3840 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T4 3868-3875 Phenotype denotes fatigue http://purl.obolibrary.org/obo/HP_0012378
T5 5376-5384 Phenotype denotes headache http://purl.obolibrary.org/obo/HP_0002315
T6 5389-5401 Phenotype denotes pharyngalgia http://purl.obolibrary.org/obo/HP_0033050
T7 5409-5414 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T8 9073-9078 Phenotype denotes fever http://purl.obolibrary.org/obo/HP_0001945
T9 9083-9088 Phenotype denotes cough http://purl.obolibrary.org/obo/HP_0012735

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T1 0-161 Sentence denotes Post-discharge surveillance and positive virus detection in two medical staff recovered from coronavirus disease 2019 (COVID-19), China, January to February 2020
T2 163-171 Sentence denotes Abstract
T3 172-300 Sentence denotes Since December 2019, 62 medical staff of Zhongnan Hospital in Wuhan, China have been hospitalised with coronavirus disease 2019.
T4 301-419 Sentence denotes During the post-discharge surveillance after clinical recovery, swabs were positive in two asymptomatic cases (3.23%).
T5 420-548 Sentence denotes Case 1 had presented typical clinical and radiological manifestations on admission, while manifestation in Case 2 was very mild.
T6 549-710 Sentence denotes In conclusion, a small proportion of recovered patients may test positive after discharge, and post-discharge surveillance and isolation need to be strengthened.
T7 712-849 Sentence denotes Since early December 2019, several pneumonia cases of unknown aetiology have occurred in Wuhan and rapidly spread throughout China [1,2].
T8 850-992 Sentence denotes The International Committee on Taxonomy of Viruses (ICTV) has named this virus SARS-CoV-2, and it belongs to the same species as SARS-CoV [3].
T9 993-1119 Sentence denotes Meanwhile, the World Health Organization (WHO) has named the virus-infected pneumonia coronavirus disease 2019 (COVID-19) [4].
T10 1120-1239 Sentence denotes As at 5 March 2020, a total of 80,409 COVID-19 cases and 3,012 deaths (3.75%) have been reported in mainland China [5].
T11 1240-1334 Sentence denotes The 52,045 recovered cases (64.73%) were further quarantined at home for at least 2 weeks [5].
T12 1335-1409 Sentence denotes However, potential infectivity of these recovered cases was still unclear.
T13 1410-1591 Sentence denotes Thus, we implemented consecutive virus surveillance among medical staff recovered from COVID-19 at our hospital and aimed to investigate their potential infectivity after discharge.
T14 1593-1607 Sentence denotes Case follow-up
T15 1608-1876 Sentence denotes Since January 2020, 62 medical staff of Zhongnan Hospital of Wuhan University have been diagnosed with COVID-19 by detecting SARS-CoV-2 nucleic acid in throat swab samples according to the manufacturer’s protocol (Shanghai BioGerm Medical Technology, Shanghai, China).
T16 1877-2038 Sentence denotes Briefly, the RT-PCR assay for SARS-CoV-2 amplifies simultaneously two target genes: open reading frame 1ab (ORF1ab) and the ORF for the nucleocapsid protein (N).
T17 2039-2182 Sentence denotes Target 1 (ORF1ab): forward primer CCCTGTGGGTTTTACACTTAA; reverse primer ACGATTGTGCATCAGCTGA; probe 5’-VIC-CCGTCTGCGGTATGTGGAAAGGTTATGG-BHQ1-3’.
T18 2183-2319 Sentence denotes Target 2 (N): forward primer GGGGAACTTCTCCTGCTAGAAT; reverse primer CAGACATTTTGCTCTCAAGCTG; probe 5’-FAM- TTGCTGCTGCTTGACAGATT-TAMRA-3’.
T19 2320-2478 Sentence denotes Positive (pseudovirus with a fragment of ORF1ab and N) and negative (pseudovirus with a standard fragment) quality control samples were tested simultaneously.
T20 2479-2617 Sentence denotes A cycle threshold (Ct) value of less than 37 was defined a positive test, while a Ct value of more than 40 was defined as a negative test.
T21 2618-2767 Sentence denotes For the cases with an intermediate Ct value (37–40), a second sample was tested and weakly positive was defined as a recurrence of Ct value of 37–40.
T22 2768-2906 Sentence denotes The diagnostic criteria were based on the recommendation from the National Institute for Viral Disease Control and Prevention (China) [6].
T23 2907-2972 Sentence denotes All confirmed cases were hospitalised and isolated for treatment.
T24 2973-3260 Sentence denotes The discharge criteria were: (i) afebrile for at least 3 days, (ii) obvious alleviation of respiratory symptoms, (iii) improvement in radiological abnormalities on chest computed tomography (CT) or X-ray and (iv) two consecutive negative detections of SARS-CoV-2 at least 24 h apart [7].
T25 3261-3457 Sentence denotes After discharge, all cases were kept under surveillance and quarantined at home for at least 14 days; all cases had a throat swab test for SARS-CoV-2 every day or every other day at least 5 times.
T26 3458-3564 Sentence denotes For those with positive virus detection during this period, we extracted and analysed the medical records.
T27 3565-3728 Sentence denotes This study was approved by the ethics committee of Zhongnan Hospital of Wuhan University (Number 2020011), and written informed consent was obtained from patients.
T28 3730-3736 Sentence denotes Case 1
T29 3737-3819 Sentence denotes Case 1 was a male doctor in his 40s with an exposure history to COVID-19 patients.
T30 3820-3901 Sentence denotes He experienced fever (up to 39.3 °C), chill and fatigue on 15 January (Figure 1).
T31 3902-4019 Sentence denotes Chest CT showed lung infection in the lower left lobe on 18 January, and he was admitted to hospital on the same day.
T32 4020-4153 Sentence denotes During the hospitalisation from 18 January to 10 February, his condition first deteriorated and then reached remission on 28 January.
T33 4154-4271 Sentence denotes Throat swab tests for SARS-CoV-2 were positive on 28 January and 2 February, and turned negative on 7 and 9 February.
T34 4272-4369 Sentence denotes Stool tests of SARS-CoV-2, first conducted on 7 February, were also negative on 7 and 9 February.
T35 4370-4407 Sentence denotes The exact Ct values were unavailable.
T36 4408-4566 Sentence denotes Figure 1 Throat swab virus tests and chest computed tomography findings of COVID-19 Case 1 from symptom onset to post-discharge, China, January–February 2020
T37 4567-4666 Sentence denotes Chest CT showed worse status on 18, 20, 23 and 29 January and showed improved status on 4 February.
T38 4667-4883 Sentence denotes Red: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs; dates marked with an asterisk: negative virus detection in stool.
T39 4884-4971 Sentence denotes After discharge on 10 February, he was kept under surveillance and quarantined at home.
T40 4972-5033 Sentence denotes He did not experience discomfort during the follow-up period.
T41 5034-5275 Sentence denotes The results of consecutive throat swab tests were negative on 13 February, weakly positive on 14 February, positive on 15 February, negative on 16 February, weakly positive on 18 February, negative on 20 February and negative on 22 February.
T42 5276-5313 Sentence denotes Stool was not tested after discharge.
T43 5315-5321 Sentence denotes Case 2
T44 5322-5359 Sentence denotes Case 2 was a female nurse in her 20s.
T45 5360-5440 Sentence denotes She experienced headache and pharyngalgia but no fever on 29 January (Figure 2).
T46 5441-5517 Sentence denotes Throat swab tests for SARS-CoV-2 were positive on 31 January and 2 February.
T47 5518-5574 Sentence denotes However, chest CT showed no abnormalities on 2 February.
T48 5575-5627 Sentence denotes This patient was admitted to hospital on 5 February.
T49 5628-5719 Sentence denotes Throat swab test remained positive on 6 February and turned negative on 10 and 12 February.
T50 5720-5751 Sentence denotes Stool was not tested in Case 2.
T51 5752-5910 Sentence denotes Figure 2 Throat swab virus tests and chest computed tomography findings in COVID-19 Case 2 from symptom onset to post-discharge, China, January–February 2020
T52 5911-5968 Sentence denotes Chest CT showed no abnormalities on 2, 4 and 12 February.
T53 5969-6119 Sentence denotes Red: positive virus detection in throat swabs; pink: weakly positive virus detection in throat swabs; green: negative virus detection in throat swabs.
T54 6120-6211 Sentence denotes After discharge on 13 February, Case 2 was kept under surveillance and quarantined at home.
T55 6212-6267 Sentence denotes She did not experience discomfort during the follow-up.
T56 6268-6456 Sentence denotes The results of consecutive throat swab tests were weakly positive on 14 and 15 February, negative on 16, 17 and 18 February, positive on 19 February and negative on 20, 21 and 22 February.
T57 6458-6468 Sentence denotes Discussion
T58 6469-6628 Sentence denotes On 21 February 2020, a previously recovered COVID-19 patient in Chengdu (Sichuan province, China) was re-hospitalised after testing positive for the virus [8].
T59 6629-6805 Sentence denotes This aroused our great concern regarding potential infectivity of the recovered patients, especially for those asymptomatic cases with positive virus detection after discharge.
T60 6806-6948 Sentence denotes In our study, we conducted surveillance by regular virus testing and detected two positive cases (3.23%) among the 62 recovered medical staff.
T61 6949-7090 Sentence denotes Surprisingly, Case 1 showed typical clinical and radiological manifestations on admission, while the manifestation in Case 2 was not typical.
T62 7091-7177 Sentence denotes Moreover, both throat swab and stool tests turned negative in Case 1 before discharge.
T63 7178-7292 Sentence denotes During home isolation, none of the two cases experienced discomfort, indicating that disease relapse was unlikely.
T64 7293-7376 Sentence denotes Currently, it is difficult to find a reasonable explanation for these observations.
T65 7377-7493 Sentence denotes It was assumed that the virus can easily be detected in the upper respiratory tract at the stage of early infection.
T66 7494-7643 Sentence denotes When the disease progressed, the virus was more likely to appear in the lower respiratory tract and other locations such as intestines and blood [9].
T67 7644-7740 Sentence denotes Thus, the virus may not be detected in throat swabs, especially for cases without expectoration.
T68 7741-7950 Sentence denotes This may explain why some patients had negative RT-PCR for SARS-CoV-2 at initial presentation despite positive findings in chest CT, or positive RT-PCT and negative CT findings at initial presentation [10,11].
T69 7951-8176 Sentence denotes Moreover, our findings seem to indicate that after hospitalised treatment, there could be a possibility that a small proportion of clinically recovered patients may still carry a small amount of virus which is hard to detect.
T70 8177-8438 Sentence denotes The current standard for diagnosing COVID19, the RT-PCR-based method, showed a high accuracy of 97% and the specific primers and probes guaranteed its diagnostic specificity, although 3% of cases may test false-negative because of potential sampling error [11].
T71 8439-8607 Sentence denotes Both cases had a positive detection (including weakly positive) three times during the follow-up, which decreased the possibility of false positives in these two cases.
T72 8608-8781 Sentence denotes After fulfilling the Chinese current criteria for discharge, it may still take a few days for the immune system to completely eliminate the residual viruses in the body [7].
T73 8782-8915 Sentence denotes During this period, the virus may rebound and test positive, but the patients were asymptomatic and chest CT showed no deterioration.
T74 8916-8982 Sentence denotes If the patients’ immunity decreases, there is a risk of a relapse.
T75 8983-9154 Sentence denotes On 6 February 2020, a recovered COVID-19 patient in Changde (Hunan province, China) had a fever and cough 2 days after discharge, and chest CT showed worsened status [12].
T76 9156-9166 Sentence denotes Conclusion
T77 9167-9337 Sentence denotes A small proportion of recovered patients may have positive virus detection after discharge, and the positivity does not necessarily mean that the patient is transmissive.
T78 9338-9430 Sentence denotes These findings need further investigation and thus post-discharge surveillance is suggested.
T79 9432-9453 Sentence denotes Conflict of interest:
T80 9454-9468 Sentence denotes None declared.
T81 9469-9492 Sentence denotes Authors’ contributions:
T82 9493-9533 Sentence denotes All authors collected the clinical data.
T83 9534-9584 Sentence denotes Yuanyuan Xing and Fan Wang drafted the manuscript.
T84 9585-9641 Sentence denotes Yuanyuan Xing and Fan Wang revised the final manuscript.
T85 9642-9746 Sentence denotes Yongxi Zhang, Pingzheng Mo and Fan Wang were responsible for summarising all data related to this study.

2_test

Id Subject Object Predicate Lexical cue
32183934-32065057-29323225 7640-7641 32065057 denotes 9
32183934-32073353-29323226 7943-7945 32073353 denotes 10
32183934-32049601-29323227 7946-7948 32049601 denotes 11
32183934-32049601-29323228 8434-8436 32049601 denotes 11

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
2 93-117 Disease denotes coronavirus disease 2019 MESH:C000657245
3 119-127 Disease denotes COVID-19 MESH:C000657245
6 596-604 Species denotes patients Tax:9606
7 275-299 Disease denotes coronavirus disease 2019 MESH:C000657245
16 929-939 Species denotes SARS-CoV-2 Tax:2697049
17 979-987 Species denotes SARS-CoV Tax:694009
18 747-756 Disease denotes pneumonia MESH:D011014
19 1054-1103 Disease denotes virus-infected pneumonia coronavirus disease 2019 MESH:C000657245
20 1105-1113 Disease denotes COVID-19 MESH:C000657245
21 1158-1166 Disease denotes COVID-19 MESH:C000657245
22 1183-1189 Disease denotes deaths MESH:D003643
23 1497-1505 Disease denotes COVID-19 MESH:C000657245
34 1985-1991 Gene denotes ORF1ab Gene:43740578
35 2035-2036 Gene denotes N Gene:43740575
36 2049-2055 Gene denotes ORF1ab Gene:43740578
37 2361-2367 Gene denotes ORF1ab Gene:43740578
38 2372-2373 Gene denotes N Gene:43740575
39 2193-2194 Gene denotes N Gene:43740575
40 1733-1743 Species denotes SARS-CoV-2 Tax:2697049
41 1907-1917 Species denotes SARS-CoV-2 Tax:2697049
42 1711-1719 Disease denotes COVID-19 MESH:C000657245
43 2857-2870 Disease denotes Viral Disease MESH:D001102
47 3225-3235 Species denotes SARS-CoV-2 Tax:2697049
48 3400-3410 Species denotes SARS-CoV-2 Tax:2697049
49 3064-3084 Disease denotes respiratory symptoms MESH:D012818
51 3719-3727 Species denotes patients Tax:9606
59 3810-3818 Species denotes patients Tax:9606
60 4176-4186 Species denotes SARS-CoV-2 Tax:2697049
61 4287-4297 Species denotes SARS-CoV-2 Tax:2697049
62 3801-3809 Disease denotes COVID-19 MESH:C000657245
63 3835-3840 Disease denotes fever MESH:D005334
64 3868-3875 Disease denotes fatigue MESH:D005221
65 3918-3932 Disease denotes lung infection MESH:D012141
67 4484-4499 Gene denotes COVID-19 Case 1 Gene:9055
73 5463-5473 Species denotes SARS-CoV-2 Tax:2697049
74 5580-5587 Species denotes patient Tax:9606
75 5376-5384 Disease denotes headache MESH:D006261
76 5389-5401 Disease denotes pharyngalgia MESH:D010608
77 5409-5414 Disease denotes fever MESH:D005334
79 5828-5836 Disease denotes COVID-19 MESH:C000657245
83 6522-6529 Species denotes patient Tax:9606
84 6709-6717 Species denotes patients Tax:9606
85 6513-6521 Disease denotes COVID-19 MESH:C000657245
89 7767-7775 Species denotes patients Tax:9606
90 7800-7810 Species denotes SARS-CoV-2 Tax:2697049
91 7483-7492 Disease denotes infection MESH:D007239
94 8103-8111 Species denotes patients Tax:9606
95 8213-8220 Disease denotes COVID19 MESH:C000657245
102 8851-8859 Species denotes patients Tax:9606
103 8923-8931 Species denotes patients Tax:9606
104 9024-9031 Species denotes patient Tax:9606
105 9015-9023 Disease denotes COVID-19 MESH:C000657245
106 9073-9078 Disease denotes fever MESH:D005334
107 9083-9088 Disease denotes cough MESH:D003371
110 9199-9207 Species denotes patients Tax:9606
111 9313-9320 Species denotes patient Tax:9606
115 9552-9555 Gene denotes Fan Gene:8439
116 9673-9676 Gene denotes Fan Gene:8439
117 9603-9606 Gene denotes Fan Gene:8439

MyTest

Id Subject Object Predicate Lexical cue
32183934-32065057-29323225 7640-7641 32065057 denotes 9
32183934-32073353-29323226 7943-7945 32073353 denotes 10
32183934-32049601-29323227 7946-7948 32049601 denotes 11
32183934-32049601-29323228 8434-8436 32049601 denotes 11