> top > docs > PMC:7075884 > spans > 30256-43788 > annotations

PMC:7075884 / 30256-43788 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
1091 892-899 Gene denotes insulin Gene:3630
1092 310-315 Species denotes HSV-1 Tax:10298
1093 408-421 Species denotes HSV-1 (strain Tax:10298
1094 683-688 Species denotes Human Tax:9606
1095 130-162 Chemical denotes Dulbecco’s Modified Eagle Medium
1096 164-168 Chemical denotes DMEM
1097 278-282 Chemical denotes DMEM
1098 532-536 Chemical denotes DMEM
1099 538-543 Chemical denotes cDMEM
1100 570-581 Chemical denotes L-glutamine MESH:D005973
1101 592-602 Chemical denotes penicillin MESH:D010406
1102 603-615 Chemical denotes streptomycin MESH:D013307
1103 627-632 Chemical denotes Hepes MESH:D006531
1104 657-660 Chemical denotes CO2 MESH:D002245
1105 806-819 Chemical denotes ascorbic acid MESH:D001205
1106 845-855 Chemical denotes gentamicin MESH:D005839
1107 866-880 Chemical denotes amphotericin B MESH:D000666
1108 914-925 Chemical denotes L-glutamine MESH:D005973
1109 31-35 CellLine denotes HEp2 CVCL:1906
1110 217-224 CellLine denotes HEK293T CVCL:0063
1111 229-233 CellLine denotes 293T CVCL:0063
1118 980-984 Species denotes HCMV Tax:10359
1119 1115-1119 Species denotes HCMV Tax:10359
1120 1136-1147 Chemical denotes ganciclovir MESH:D015774
1121 1149-1152 Chemical denotes GCV MESH:D015774
1122 1161-1165 Chemical denotes BI-6 MESH:C118647
1123 1184-1187 Chemical denotes GCV MESH:D015774
1134 2517-2523 Gene denotes dE1/E3 Gene:45300
1135 1324-1328 Species denotes ZIKV Tax:64320
1136 1915-1921 Species denotes stocks Tax:3724
1137 2493-2515 Species denotes Human Adenovirus Type5 Tax:28285
1138 1619-1624 Chemical denotes cDMEM
1139 1760-1777 Chemical denotes cellulose acetate MESH:C005062
1140 1471-1480 Disease denotes infection MESH:D007239
1141 1592-1601 Disease denotes infection MESH:D007239
1142 1797-1807 Disease denotes infections MESH:D007239
1143 1966-1974 Disease denotes infected MESH:D007239
1155 2598-2601 Gene denotes C17 Gene:54360
1156 2587-2590 Gene denotes C15 Gene:51316
1157 2580-2583 Gene denotes C13 Gene:3229
1158 2864-2870 Species denotes stocks Tax:3724
1159 2655-2657 Chemical denotes GA MESH:C112485
1160 2673-2681 Chemical denotes methanol MESH:D000432
1161 2685-2689 Chemical denotes DMSO MESH:D004121
1162 2730-2732 Chemical denotes GA MESH:C112485
1163 2821-2829 Chemical denotes methanol MESH:D000432
1164 2833-2837 Chemical denotes DMSO MESH:D004121
1165 2920-2922 Chemical denotes GA MESH:C112485
1175 3481-3485 Gene denotes US11 Gene:2703439
1176 3711-3718 Gene denotes β-actin Gene:728378
1177 2951-2956 Species denotes HSV-1 Tax:10298
1178 3875-3886 Species denotes horseradish Tax:3704
1179 3055-3058 Chemical denotes PBS MESH:D007854
1180 3304-3318 Chemical denotes polyacrylamide MESH:C016679
1181 3397-3406 Chemical denotes Tween PBS
1182 3934-3991 Chemical denotes 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium
1183 3509-3515 Disease denotes Cancer MESH:D009369
1185 4133-4145 Disease denotes Cytotoxicity MESH:D064420
1188 4232-4234 Chemical denotes GA MESH:C112485
1189 4339-4346 Chemical denotes DAL1025
1197 4649-4659 Chemical denotes penicillin MESH:D010406
1198 4660-4672 Chemical denotes streptomycin MESH:D013307
1199 4796-4799 Chemical denotes CO2 MESH:D002245
1200 4932-4936 Chemical denotes DPBS MESH:C012939
1201 4952-4956 Chemical denotes DMEM
1202 4547-4555 Disease denotes infected MESH:D007239
1203 4702-4711 Disease denotes infection MESH:D007239
1205 5731-5736 Species denotes HSV-1 Tax:10298
1219 6072-6077 Species denotes HSV-1 Tax:10298
1220 6479-6484 Species denotes human Tax:9606
1221 5750-5752 Chemical denotes GA MESH:C112485
1222 5904-5914 Chemical denotes penicillin MESH:D010406
1223 5915-5927 Chemical denotes streptomycin MESH:D013307
1224 6062-6066 Chemical denotes DPBS MESH:C012939
1225 6508-6512 Chemical denotes DMEM
1226 6514-6548 Chemical denotes Dulbecco’s Modified Eagle’s medium
1227 6582-6592 Chemical denotes penicillin MESH:D010406
1228 6593-6605 Chemical denotes streptomycin MESH:D013307
1229 6633-6636 Chemical denotes CO2 MESH:D002245
1230 6716-6724 Chemical denotes methanol MESH:D000432
1231 6812-6817 Chemical denotes water MESH:D014867
1233 6951-6955 Species denotes ZIKV Tax:64320
1248 8861-8866 Gene denotes GAPDH Gene:2597
1249 7464-7467 Gene denotes C15 Gene:51316
1250 6974-6978 Species denotes ZIKV Tax:64320
1251 7075-7079 Species denotes ZIKV Tax:64320
1252 7512-7516 Species denotes ZIKV Tax:64320
1253 7023-7025 Chemical denotes GA MESH:C112485
1254 7034-7038 Chemical denotes DMSO MESH:D004121
1255 7221-7225 Chemical denotes DPBS MESH:C012939
1256 7248-7252 Chemical denotes DMEM
1257 7603-7606 Chemical denotes AGM
1258 7624-7626 Chemical denotes GA MESH:C112485
1259 8507-8511 Chemical denotes SDS2
1260 7178-7186 Disease denotes infected MESH:D007239
1261 7498-7506 Disease denotes infected MESH:D007239
1269 9247-9252 Gene denotes GAPDH Gene:2597
1270 9030-9034 Species denotes ZIKV Tax:64320
1271 9057-9061 Species denotes ZIKV Tax:64320
1272 9096-9100 Species denotes ZIKV Tax:64320
1273 9163-9168 Species denotes human Tax:9606
1274 9211-9216 Gene denotes GAPDH Gene:2597
1275 9178-9183 Gene denotes GAPDH Gene:2597
1277 9310-9314 Species denotes HCMV Tax:10359
1290 9527-9531 Species denotes HCMV Tax:10359
1291 9625-9629 Species denotes HCMV Tax:10359
1292 10228-10230 Chemical denotes GA MESH:C112485
1293 10327-10329 Chemical denotes GA MESH:C112485
1294 10433-10437 Chemical denotes DMSO MESH:D004121
1295 10627-10629 Chemical denotes GA MESH:C112485
1296 9501-9509 Disease denotes infected MESH:D007239
1297 9673-9681 Disease denotes infected MESH:D007239
1298 10115-10130 Disease denotes Viral infection MESH:D001102
1299 9323-9326 CellLine denotes HFF CVCL:3285
1300 9714-9717 CellLine denotes HFF CVCL:3285
1301 9786-9789 CellLine denotes HFF CVCL:3285
1303 10884-10888 Species denotes HCMV Tax:10359
1307 10921-10925 Species denotes HCMV Tax:10359
1308 11099-11103 Species denotes HCMV Tax:10359
1309 10926-10934 Disease denotes infected MESH:D007239
1311 11278-11287 Disease denotes Infection MESH:D007239
1319 11505-11512 Gene denotes dE1/E3) Gene:45300
1320 11606-11609 Gene denotes C15 Gene:51316
1321 11397-11400 Gene denotes C15 Gene:51316
1322 11480-11503 Species denotes human adenovirus type 5 Tax:28285
1323 11544-11549 Species denotes HSV-1 Tax:10298
1324 11406-11410 Chemical denotes DMSO MESH:D004121
1325 11626-11635 Disease denotes Infection MESH:D007239
1333 11762-11766 Species denotes ZIKV Tax:64320
1334 11773-11777 Species denotes EBOV Tax:1570291
1335 11784-11788 Species denotes VEEV Tax:11036
1336 11790-11793 Species denotes VSV Tax:11276
1337 11795-11798 Species denotes SFV Tax:11033
1338 11803-11806 Species denotes EBV Tax:10376
1339 11779-11782 Disease denotes IVA MESH:C538167
1355 12576-12579 Gene denotes C17 Gene:54360
1356 12566-12569 Gene denotes C15 Gene:51316
1357 12559-12562 Gene denotes C13 Gene:3229
1358 12443-12446 Gene denotes C15 Gene:51316
1359 12385-12388 Gene denotes C15 Gene:51316
1360 12251-12255 Species denotes EBOV Tax:1570291
1361 12293-12297 Species denotes VEEV Tax:11036
1362 12342-12346 Species denotes EBOV Tax:1570291
1363 12269-12272 Species denotes SFV Tax:11033
1364 12283-12286 Species denotes IAV Tax:11320
1365 12301-12304 Species denotes VSV Tax:11276
1366 12310-12313 Species denotes EBV Tax:10376
1367 11987-11997 Chemical denotes Calcein-AM MESH:C085925
1368 12064-12094 Chemical denotes 7-amino-4-chloromethylcoumarin MESH:C453681
1369 12096-12100 Chemical denotes CMAC
1372 12609-12613 Species denotes HCMV Tax:10359
1373 12690-12693 Chemical denotes BI6 MESH:C118647
1375 13056-13060 Species denotes HCMV Tax:10359
1377 13288-13292 Species denotes ZIKV Tax:64320

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T241 9-14 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T242 36-41 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T243 204-209 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T244 235-240 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T245 477-482 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T246 572-581 Body_part denotes glutamine http://purl.org/sig/ont/fma/fma82752
T247 689-699 Body_part denotes Astrocytes http://purl.org/sig/ont/fma/fma54537
T248 732-741 Body_part denotes Astrocyte http://purl.org/sig/ont/fma/fma54537
T249 892-899 Body_part denotes insulin http://purl.org/sig/ont/fma/fma83365
T250 916-925 Body_part denotes glutamine http://purl.org/sig/ont/fma/fma82752
T251 1014-1018 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T252 1282-1289 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T253 1440-1445 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T254 1760-1769 Body_part denotes cellulose http://purl.org/sig/ont/fma/fma82748
T255 1856-1861 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T256 1980-1985 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T257 2157-2165 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T258 2211-2219 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T259 2304-2307 Body_part denotes IgG http://purl.org/sig/ont/fma/fma62872
T260 2849-2854 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T261 2958-2963 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T262 3178-3190 Body_part denotes g of protein http://purl.org/sig/ont/fma/fma61788
T263 3183-3190 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T264 3237-3245 Body_part denotes Proteins http://purl.org/sig/ont/fma/fma67257
T265 3469-3477 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T266 3552-3560 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T267 3627-3635 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T268 3699-3707 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T269 3713-3718 Body_part denotes actin http://purl.org/sig/ont/fma/fma67843
T270 3818-3826 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T271 3899-3906 Body_part denotes Protein http://purl.org/sig/ont/fma/fma67257
T272 4152-4157 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T273 4245-4249 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T274 4519-4524 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T275 4730-4734 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T276 4809-4814 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T277 4880-4884 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T278 4902-4907 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T279 4989-4994 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T280 5044-5049 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T281 5223-5227 Body_part denotes milk http://purl.org/sig/ont/fma/fma62100
T282 5243-5248 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T283 5354-5359 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T284 5400-5404 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T285 5801-5806 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T286 5891-5896 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T287 6029-6034 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T288 6128-6133 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T289 6305-6310 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T290 6398-6403 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T291 6441-6446 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T292 6485-6490 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T293 6689-6694 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T294 6964-6968 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T295 7104-7109 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T296 7187-7192 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T297 7348-7352 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T298 7364-7367 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T299 7654-7658 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T300 7743-7747 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T301 7801-7806 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T302 7843-7846 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T303 7891-7894 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T304 8024-8027 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T305 8154-8157 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T306 8309-8313 Body_part denotes Gene http://purl.org/sig/ont/fma/fma74402
T307 8767-8770 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T308 8965-8968 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T309 9495-9500 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T310 9682-9687 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T311 9755-9760 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T312 10199-10204 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T313 10889-10892 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T314 11005-11008 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T315 11060-11065 Body_part denotes Blood http://purl.org/sig/ont/fma/fma9670
T316 11104-11107 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T317 11176-11179 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T318 11333-11338 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T319 11424-11429 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T320 11679-11683 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T321 11684-11688 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T322 11734-11738 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T323 11739-11743 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T324 11768-11771 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T325 11829-11837 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T326 11913-11927 Body_part denotes Nucleated cell http://purl.org/sig/ont/fma/fma67513
T327 11923-11927 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T328 11928-11932 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T329 12023-12028 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T330 12051-12058 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T331 12125-12130 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T332 12203-12210 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T333 12373-12380 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T334 12497-12505 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T335 13061-13064 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T11 204-209 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T12 5223-5227 Body_part denotes milk http://purl.obolibrary.org/obo/UBERON_0001913
T13 5277-5281 Body_part denotes tube http://purl.obolibrary.org/obo/UBERON_0000025
T14 5891-5896 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T15 6485-6490 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T16 11060-11065 Body_part denotes Blood http://purl.obolibrary.org/obo/UBERON_0000178

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T76 757-760 Disease denotes AGM http://purl.obolibrary.org/obo/MONDO_0011096
T77 1471-1480 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T78 1592-1601 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T79 1797-1807 Disease denotes infections http://purl.obolibrary.org/obo/MONDO_0005550
T80 2060-2062 Disease denotes BD http://purl.obolibrary.org/obo/MONDO_0007191
T81 2430-2432 Disease denotes BD http://purl.obolibrary.org/obo/MONDO_0007191
T82 3509-3515 Disease denotes Cancer http://purl.obolibrary.org/obo/MONDO_0004992
T83 4702-4711 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T84 5215-5222 Disease denotes sterile http://purl.obolibrary.org/obo/MONDO_0005047
T85 5624-5631 Disease denotes sterile http://purl.obolibrary.org/obo/MONDO_0005047
T86 7603-7606 Disease denotes AGM http://purl.obolibrary.org/obo/MONDO_0011096
T87 10115-10130 Disease denotes Viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T88 10121-10130 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T89 11278-11287 Disease denotes Infection http://purl.obolibrary.org/obo/MONDO_0005550
T90 11626-11635 Disease denotes Infection http://purl.obolibrary.org/obo/MONDO_0005550
T91 11779-11782 Disease denotes IVA http://purl.obolibrary.org/obo/MONDO_0009475
T92 11995-11997 Disease denotes AM http://purl.obolibrary.org/obo/MONDO_0020320

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T460 9-14 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T461 16-23 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T462 31-35 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2
T463 31-35 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp2
T464 36-41 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T465 111-113 http://purl.obolibrary.org/obo/CLO_0007622 denotes MD
T466 229-233 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T467 229-233 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T468 229-233 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T469 235-240 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T470 326-327 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T471 404-407 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T472 431-432 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T473 472-476 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T474 472-476 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T475 477-482 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T476 683-688 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes Human
T477 689-699 http://purl.obolibrary.org/obo/CL_0000127 denotes Astrocytes
T478 732-741 http://purl.obolibrary.org/obo/CL_0000127 denotes Astrocyte
T479 879-880 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T480 892-899 http://purl.obolibrary.org/obo/PR_000009054 denotes insulin
T481 1014-1018 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T482 1317-1322 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T483 1435-1439 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T484 1435-1439 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T485 1440-1445 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T486 1481-1485 http://purl.obolibrary.org/obo/CLO_0001757 denotes at 1
T487 1734-1735 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T488 1778-1786 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membrane
T489 1851-1855 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T490 1851-1855 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T491 1856-1861 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T492 1909-1914 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T493 1923-1928 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T494 1944-1949 http://purl.obolibrary.org/obo/CLO_0009985 denotes focus
T495 1975-1979 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T496 1975-1979 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T497 1980-1985 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T498 2138-2139 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T499 2140-2145 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T500 2249-2260 http://purl.obolibrary.org/obo/CLO_0002662 denotes D1–4G2-4-15
T501 2298-2303 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T502 2493-2498 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes Human
T503 2521-2523 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T504 2598-2603 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T505 2640-2642 http://purl.obolibrary.org/obo/CLO_0009141 denotes St
T506 2640-2642 http://purl.obolibrary.org/obo/CLO_0050980 denotes St
T507 2651-2653 http://purl.obolibrary.org/obo/CLO_0007815 denotes MO
T508 2693-2694 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T509 2849-2854 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T510 2955-2963 http://purl.obolibrary.org/obo/CLO_0001757 denotes 1, cells
T511 3452-3457 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T512 3535-3540 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T513 3583-3584 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T514 3610-3615 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T515 3657-3658 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T516 3682-3687 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T517 3739-3740 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T518 3759-3768 http://purl.obolibrary.org/obo/UBERON_0000158 denotes Membranes
T519 3848-3868 http://purl.obolibrary.org/obo/PR_000023540 denotes alkaline phosphatase
T520 4146-4151 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T521 4152-4157 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T522 4173-4175 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T523 4245-4249 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T524 4369-4374 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T525 4411-4412 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T526 4514-4518 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T527 4514-4518 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T528 4519-4524 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T529 4684-4685 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T530 4730-4734 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T531 4809-4814 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T532 4829-4834 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T533 4880-4884 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T534 4897-4901 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T535 4897-4901 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T536 4902-4907 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T537 4989-4994 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T538 5044-5049 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T539 5243-5248 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T540 5269-5273 http://purl.obolibrary.org/obo/CLO_0001557 denotes a 15
T541 5277-5281 http://purl.obolibrary.org/obo/UBERON_0000025 denotes tube
T542 5307-5312 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T543 5349-5353 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T544 5349-5353 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T545 5354-5359 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T546 5400-5404 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T547 5481-5482 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T548 5579-5584 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T549 5796-5800 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T550 5796-5800 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T551 5801-5806 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T552 6029-6034 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T553 6068-6071 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T554 6128-6133 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T555 6300-6304 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T556 6300-6304 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T557 6305-6310 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T558 6338-6339 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T559 6368-6373 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T560 6398-6403 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T561 6441-6446 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T562 6479-6484 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T563 6689-6694 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T564 6964-6968 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T565 7099-7103 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T566 7099-7103 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T567 7104-7109 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T568 7187-7192 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T569 7318-7320 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T570 7348-7352 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T571 7654-7658 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T572 7743-7747 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T573 7801-7806 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T574 7886-7888 http://purl.obolibrary.org/obo/CLO_0007622 denotes MD
T575 7916-7917 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T576 8268-8272 http://purl.obolibrary.org/obo/CLO_0001564 denotes a 20
T577 8268-8272 http://purl.obolibrary.org/obo/CLO_0050194 denotes a 20
T578 8309-8313 http://purl.obolibrary.org/obo/OGG_0000000002 denotes Gene
T579 8601-8603 http://purl.obolibrary.org/obo/CLO_0053799 denotes 45
T580 9108-9113 http://purl.obolibrary.org/obo/CLO_0001417 denotes 5′/56
T581 9163-9168 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T582 9260-9265 http://purl.obolibrary.org/obo/CLO_0001417 denotes 5′/56
T583 9323-9326 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T584 9495-9500 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T585 9593-9598 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T586 9682-9687 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T587 9714-9717 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T588 9755-9760 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T589 9786-9789 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T590 9978-9983 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T591 10046-10049 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T592 10108-10113 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T593 10199-10204 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T594 10441-10442 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T595 10654-10655 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T596 11060-11065 http://purl.obolibrary.org/obo/UBERON_0000178 denotes Blood
T597 11060-11065 http://www.ebi.ac.uk/efo/EFO_0000296 denotes Blood
T598 11130-11131 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T599 11291-11294 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T600 11306-11313 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T601 11328-11332 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T602 11328-11332 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T603 11333-11338 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T604 11424-11429 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T605 11456-11457 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T606 11480-11485 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T607 11509-11511 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T608 11524-11527 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T609 11532-11535 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T610 11540-11543 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T611 11550-11555 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T612 11577-11578 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T613 11679-11683 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T614 11684-11688 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T615 11734-11738 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T616 11739-11743 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T617 11889-11891 http://purl.obolibrary.org/obo/CLO_0008922 denotes S2
T618 11889-11891 http://purl.obolibrary.org/obo/CLO_0050052 denotes S2
T619 11923-11927 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T620 11928-11932 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T621 12023-12028 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T622 12125-12130 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T623 12273-12275 http://purl.obolibrary.org/obo/CLO_0002857 denotes E1
T624 12276-12278 http://purl.obolibrary.org/obo/CLO_0002860 denotes E2
T625 12483-12489 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T626 12576-12581 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T627 12933-12938 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T628 12975-12976 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T629 13174-13175 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T630 13180-13186 http://purl.obolibrary.org/obo/UBERON_0002415 denotes tailed
T631 13189-13193 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T632 13337-13343 http://purl.obolibrary.org/obo/UBERON_0002415 denotes tailed
T633 13356-13360 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T634 13463-13464 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T635 13493-13494 http://purl.obolibrary.org/obo/CLO_0001020 denotes a

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T765 28-30 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T768 111-113 Chemical denotes MD http://purl.obolibrary.org/obo/CHEBI_74699
T769 570-581 Chemical denotes L-glutamine http://purl.obolibrary.org/obo/CHEBI_18050|http://purl.obolibrary.org/obo/CHEBI_30011|http://purl.obolibrary.org/obo/CHEBI_58359
T772 572-581 Chemical denotes glutamine http://purl.obolibrary.org/obo/CHEBI_28300
T773 592-602 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T775 603-615 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T777 627-632 Chemical denotes Hepes http://purl.obolibrary.org/obo/CHEBI_42334
T778 633-639 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T779 657-660 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T780 806-819 Chemical denotes ascorbic acid http://purl.obolibrary.org/obo/CHEBI_22652|http://purl.obolibrary.org/obo/CHEBI_29073
T782 815-819 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T783 866-880 Chemical denotes amphotericin B http://purl.obolibrary.org/obo/CHEBI_2682
T784 892-899 Chemical denotes insulin http://purl.obolibrary.org/obo/CHEBI_145810
T785 914-925 Chemical denotes L-glutamine http://purl.obolibrary.org/obo/CHEBI_18050|http://purl.obolibrary.org/obo/CHEBI_30011|http://purl.obolibrary.org/obo/CHEBI_58359
T788 916-925 Chemical denotes glutamine http://purl.obolibrary.org/obo/CHEBI_28300
T789 1120-1134 Chemical denotes antiviral drug http://purl.obolibrary.org/obo/CHEBI_36044
T790 1120-1129 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T791 1130-1134 Chemical denotes drug http://purl.obolibrary.org/obo/CHEBI_23888
T792 1136-1147 Chemical denotes ganciclovir http://purl.obolibrary.org/obo/CHEBI_465284
T793 1282-1289 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T794 1413-1415 Chemical denotes VA http://purl.obolibrary.org/obo/CHEBI_75008
T795 1744-1754 Chemical denotes surfactant http://purl.obolibrary.org/obo/CHEBI_35195
T796 1760-1777 Chemical denotes cellulose acetate http://purl.obolibrary.org/obo/CHEBI_145232
T797 1770-1777 Chemical denotes acetate http://purl.obolibrary.org/obo/CHEBI_30089|http://purl.obolibrary.org/obo/CHEBI_47622
T799 2196-2201 Chemical denotes group http://purl.obolibrary.org/obo/CHEBI_24433
T800 2211-2219 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T801 2310-2312 Chemical denotes PE http://purl.obolibrary.org/obo/CHEBI_16038|http://purl.obolibrary.org/obo/CHEBI_17553|http://purl.obolibrary.org/obo/CHEBI_74762
T804 2364-2366 Chemical denotes II http://purl.obolibrary.org/obo/CHEBI_74067
T805 2577-2579 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T808 2580-2585 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T809 2587-2592 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T810 2587-2590 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T811 2598-2603 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T812 2655-2657 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T815 2673-2681 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T816 2685-2689 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T817 2730-2732 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T820 2821-2829 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T821 2833-2837 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T822 2920-2922 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T825 3091-3097 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T826 3102-3121 Chemical denotes protease inhibitors http://purl.obolibrary.org/obo/CHEBI_37670|http://purl.obolibrary.org/obo/CHEBI_60258
T828 3111-3121 Chemical denotes inhibitors http://purl.obolibrary.org/obo/CHEBI_35222
T829 3183-3190 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T830 3304-3318 Chemical denotes polyacrylamide http://purl.obolibrary.org/obo/CHEBI_51135|http://purl.obolibrary.org/obo/CHEBI_53656|http://purl.obolibrary.org/obo/CHEBI_60766
T833 3353-3367 Chemical denotes nitrocellulose http://purl.obolibrary.org/obo/CHEBI_53325
T834 3899-3906 Chemical denotes Protein http://purl.obolibrary.org/obo/CHEBI_16541
T835 3936-3941 Chemical denotes bromo http://purl.obolibrary.org/obo/CHEBI_22927|http://purl.obolibrary.org/obo/CHEBI_47265
T837 3944-3950 Chemical denotes chloro http://purl.obolibrary.org/obo/CHEBI_47853
T838 4055-4063 Chemical denotes reagents http://purl.obolibrary.org/obo/CHEBI_33893
T839 4232-4234 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T842 4649-4659 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T844 4660-4672 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T846 4796-4799 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T847 5750-5752 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T850 5904-5914 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T852 5915-5927 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T854 6582-6592 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T856 6593-6605 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T858 6633-6636 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T859 6716-6724 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T860 6812-6817 Chemical denotes water http://purl.obolibrary.org/obo/CHEBI_15377
T861 7023-7025 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T864 7034-7038 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T865 7461-7463 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T868 7464-7469 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T869 7464-7467 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T870 7624-7626 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T873 7734-7742 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T874 7787-7789 Chemical denotes WI http://purl.obolibrary.org/obo/CHEBI_141448
T875 7886-7888 Chemical denotes MD http://purl.obolibrary.org/obo/CHEBI_74699
T876 8024-8027 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T877 8276-8284 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T878 8384-8389 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T879 8906-8911 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T880 8965-8968 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T881 9101-9106 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T882 9253-9258 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T883 10228-10230 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T886 10327-10329 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T889 10433-10437 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T890 10627-10629 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T893 10889-10892 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T894 11005-11008 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T895 11094-11096 Chemical denotes WI http://purl.obolibrary.org/obo/CHEBI_141448
T896 11104-11107 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T897 11176-11179 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T898 11394-11396 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T901 11397-11402 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T902 11397-11400 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T903 11406-11410 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T904 11603-11605 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T907 11606-11611 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T908 11606-11609 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T909 11829-11837 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T910 11889-11891 Chemical denotes S2 http://purl.obolibrary.org/obo/CHEBI_29387
T911 12014-12022 Chemical denotes effector http://purl.obolibrary.org/obo/CHEBI_35224
T912 12051-12058 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T913 12066-12071 Chemical denotes amino http://purl.obolibrary.org/obo/CHEBI_46882
T914 12142-12146 Chemical denotes dyes http://purl.obolibrary.org/obo/CHEBI_37958
T915 12203-12210 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T916 12347-12349 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T917 12373-12380 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T918 12385-12390 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T919 12385-12388 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T920 12391-12393 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T923 12443-12448 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T924 12443-12446 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T925 12449-12451 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T928 12497-12505 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T929 12556-12558 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T932 12559-12564 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T933 12566-12571 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T934 12566-12569 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T935 12576-12581 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T936 13061-13064 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T140 742-748 http://purl.obolibrary.org/obo/GO_0040007 denotes Growth
T141 3085-3090 http://purl.obolibrary.org/obo/GO_0019835 denotes lysis
T142 3857-3868 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T143 6653-6662 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T144 7743-7761 http://purl.obolibrary.org/obo/GO_0008283 denotes cell proliferation
T145 7960-7966 http://purl.obolibrary.org/obo/GO_0004530 denotes DNaseI
T146 8061-8067 http://purl.obolibrary.org/obo/GO_0004530 denotes DNaseI
T147 8309-8324 http://purl.obolibrary.org/obo/GO_0010467 denotes Gene Expression
T148 10115-10130 http://purl.obolibrary.org/obo/GO_0016032 denotes Viral infection
T149 11684-11695 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T150 11684-11695 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T151 11684-11695 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T152 11684-11695 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T153 11734-11750 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T154 11734-11750 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T155 11739-11750 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T156 11739-11750 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T157 11923-11939 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T158 11923-11939 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T159 11928-11939 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T160 11928-11939 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T214 0-7 Sentence denotes Methods
T215 9-30 Sentence denotes Cells, viruses and GA
T216 31-216 Sentence denotes HEp2 cells, obtained from the American Type Culture Collection (ATCC Rockville, MD), were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (FBS).
T217 217-309 Sentence denotes HEK293T/17 (293T) cells obtained from the ATCC were grown in DMEM supplemented with 10% FBS.
T218 310-403 Sentence denotes HSV-1 strain F, a limited-passage isolate, is the prototype strain used in this laboratory28.
T219 404-471 Sentence denotes GFP-HSV-1 (strain 17), was a generous gift from Dr. Peter O’Hare29.
T220 472-661 Sentence denotes Vero cells obtained from the ATCC were cultured in complete DMEM (cDMEM) containing 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, and 10 mM Hepes buffer at 37 °C with 5% CO2.
T221 662-926 Sentence denotes Fetal-derived Normal Human Astrocytes (NHA, Lonza) were maintained in Astrocyte Growth Medium (AGM, Lonza) supplemented with 0.3% FBS, 30 µl/mL ascorbic acid, 1 µl/mL rhEGF, 30 µg/mL gentamicin, 15 μg/mL amphotericin B, 2.5 µl/mL insulin, and 10 µl/mL L-glutamine.
T222 927-979 Sentence denotes Early passages (1–4) were used in these experiments.
T223 980-1078 Sentence denotes HCMV studies were performed using cell-associated low-passage clinical isolates CH1914 and BI-615.
T224 1079-1188 Sentence denotes CH19 is resistant to the first-line HCMV antiviral drug, ganciclovir (GCV), while BI-6 is susceptible to GCV.
T225 1189-1323 Sentence denotes Additional experiments were performed using CMVPT30-GFP16, which expresses green fluorescent protein and produces extracellular virus.
T226 1324-1546 Sentence denotes ZIKV strain PRVABC59 obtained from the American Type Culture Collection (ATCC; Manassas, VA) was propagated in Vero cells grown in T-150 flasks by infection at 1:50 dilution of viral stock (MOI 0.25) in the absence of FBS.
T227 1547-1625 Sentence denotes The medium was removed and replaced 6 h post-infection (hpi) with fresh cDMEM.
T228 1626-1787 Sentence denotes Supernatant was collected at 72 hpi, clarified by centrifugation at 350 × g for 5 min, and filtered through a 0.45-μm surfactant-free cellulose acetate membrane.
T229 1788-1922 Sentence denotes For mock infections, supernatant was collected from uninfected Vero cells and prepared by the same protocol used to make virus stocks.
T230 1923-1956 Sentence denotes Virus was titered by focus assay.
T231 1957-2331 Sentence denotes Briefly, infected Vero cells, 24 hpi were fixed and permeabilized using Cytofix/Cytoperm Solution Kit (BD Biosciences) according to the manufacturer’s instructions and stained with a mouse monoclonal antibody (mAb) specific for flavivirus group envelope proteins (1:250; EMD Millipore; clone D1–4G2-4-15) followed by incubation with an anti-mouse IgG - PE (1:1000 dilution).
T232 2332-2492 Sentence denotes Samples were run through an LSR II flow cytometer and data were collected with FACSDiva software (BD Biosciences) and analyzed using FlowJo Software (TreeStar).
T233 2493-2530 Sentence denotes Human Adenovirus Type5 (dE1/E3), Cat.
T234 2531-2535 Sentence denotes No.:
T235 2536-2576 Sentence denotes 1060, was purchased from Vector Biolabs.
T236 2577-2654 Sentence denotes GA C13:0, C15:1, and C17:1, were purchased from Sigma Aldrich, St. Louis, MO.
T237 2655-2718 Sentence denotes GA was diluted in methanol or DMSO to a concentration of 50 mM.
T238 2719-2848 Sentence denotes Effects of GA in all assays and models used in this study have been compared to vehicle-treated (i.e. methanol or DMSO) controls.
T239 2849-2923 Sentence denotes Cells or viral stocks were treated with the indicated concentration of GA.
T240 2925-2946 Sentence denotes Western blot analyses
T241 2947-3159 Sentence denotes For HSV-1, cells were harvested at the indicated times, collected by low-speed centrifugation and rinsed in PBS, then resuspended in RIPA lysis buffer and protease inhibitors (Complete Protease Inhibitor; Roche).
T242 3160-3236 Sentence denotes Approximately 60 μg of protein per sample was subjected to further analysis.
T243 3237-3447 Sentence denotes Proteins were electrophoretically separated on 8 to 10% denaturing polyacrylamide gels, electrically transferred to nitrocellulose sheets, blocked by 5% BSA in Tween PBS and reacted with the primary antibodies.
T244 3448-3605 Sentence denotes The mouse monoclonal antibody to US11 (Goodwin Institute for Cancer Research), and the mouse monoclonal antibody to ICP8, were used at a dilution of 1:1,000.
T245 3606-3677 Sentence denotes The mouse monoclonal antibody to ICP27 was used at a dilution of 1:250.
T246 3678-3758 Sentence denotes The mouse monoclonal antibody to β-actin (Sigma) was used at a 1:5,000 dilution.
T247 3759-3898 Sentence denotes Membranes were then reacted with the appropriate secondary antibody conjugated either to alkaline phosphatase or to horseradish peroxidase.
T248 3899-4131 Sentence denotes Protein bands were visualized with 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium (Denville Scientific, Inc.) or with ECL Western Blot detection reagents (Amersham Biosciences) according to the manufacturer’s instruction.
T249 4133-4151 Sentence denotes Cytotoxicity tests
T250 4152-4244 Sentence denotes Cells grown in 96 or 48 well plates were exposed to different concentrations of GA for 24 h.
T251 4245-4348 Sentence denotes Cell viability was determined by Alamarblue® assay (Thermo Fisher Scientific, Catalog number: DAL1025).
T252 4349-4450 Sentence denotes Pair-wise Student t-tests were used to compare the outcome of a treatment as compared to the control.
T253 4451-4478 Sentence denotes Error bars are SEM (n ≥ 3).
T254 4480-4503 Sentence denotes Viral stock preparation
T255 4504-4835 Sentence denotes Confluent Vero cells in 75-cm2 flasks were infected with HSV in 3 ml of 199V (Gibco; 199 medium supplemented with 1% heat-inactivated FBS and 1% penicillin/streptomycin) medium at a multiplicity of infection (MOI) of 0.01 pfu/cell and incubated by gentle shaking for 2 hours at 37 °C with 5% CO2 to allow cells to absorb the virus.
T256 4836-4937 Sentence denotes After 2 hours, 199 V was aspirated from the cell culture and Vero cells were gently washed with DPBS.
T257 4938-5082 Sentence denotes 3 ml of fresh DMEM/5% FBS medium was added and the cells were incubated for 2 to 3 days until 100% of the cells display cytopathic effect (CPE).
T258 5083-5238 Sentence denotes When 100% CPE was observed, the flask was placed at −80 °C for 15 min, then allowed to warm up at room temperature and 3 ml of cold sterile milk was added.
T259 5239-5298 Sentence denotes The cells were collected into a 15 ml tube and kept on ice.
T260 5299-5574 Sentence denotes To free virus particles from the cellular debris, Vero cells were sonicated three times (letting the cell suspension cool on ice for 1 min between sonications), for 30 seconds using a Branson Sonifier with microtip at an output setting of 4 (approximate Power Output of 15%).
T261 5575-5681 Sentence denotes The virus stock was aliquoted and transferred to sterile, screw-capped cryovials and was stored at −80 °C.
T262 5682-5729 Sentence denotes The viral titer was determined by plaque assay.
T263 5731-5749 Sentence denotes HSV-1 plaque assay
T264 5750-5970 Sentence denotes GA (10 µM) was incubated on the monolayers of Vero cells (6-well plate) with 199V (Gibco; supplemented with 1% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin) at 37 °C for 1 hour prior to inoculation.
T265 5971-6067 Sentence denotes Following incubation, the supernatants were aspirated and cells were washed two times with DPBS.
T266 6068-6166 Sentence denotes GFP-HSV-1 strain 17+29, at an MOI of 1 was incubated on the cells with 199V at 37 °C for 24 hours.
T267 6167-6209 Sentence denotes The supernatant was collected and titered.
T268 6210-6404 Sentence denotes Various 10-fold dilutions of collected supernatants were incubated on monolayers of fresh Vero cells (6-well plate) at 37 °C on a shaker for 2 h to allow the virus to attach and enter the cells.
T269 6405-6663 Sentence denotes The supernatants were aspirated and cells were incubated with 20 mg/mL of human serum (Sigma-H4522) in DMEM (Dulbecco’s Modified Eagle’s medium, supplemented with 5% FBS and 1% penicillin/streptomycin) for 3 days at 37 °C in 5% CO2 to allow plaque formation.
T270 6664-6850 Sentence denotes For plaque counting, the cells were fixed with 100% methanol for 5 min. at room temperature and stained with 10% KaryoMax Giemsa stain in distilled water for 20 min. at room temperature.
T271 6851-6949 Sentence denotes Viral titer was calculated through plaque counting and expressed as plaque-forming units (PFU)/ml.
T272 6951-6963 Sentence denotes ZIKV studies
T273 6964-7059 Sentence denotes Cell free ZIKV in 199V medium was pretreated with 10 µM/ml GA or with DMSO for 1 hour at 37 °C.
T274 7060-7173 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T275 7174-7278 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T276 7279-7394 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell-free viral RNA copy number determination.
T277 7395-7534 Sentence denotes NHA were grown in 24 well plates to >80% confluency, treated with GA C15:1 (0–20 µM) for 3 h, and then infected with ZIKV at an MOI of 0.3.
T278 7535-7653 Sentence denotes Supernatant was carefully removed and replaced at 12 hpi with fresh AGM replenished with GA at 0–20 µM concentrations.
T279 7654-7890 Sentence denotes Cell viability was assessed at 7 days post-inoculation by Celltiter Aqueous One solution cell proliferation assay (Promega, Madison, WI), and live cells were carefully harvested to extract RNA by the RNeasy kit (Qiagen, Germantown, MD).
T280 7891-8202 Sentence denotes RNA was quantified using a Nanodrop2000 (ThermoFisher), treated with DNaseI (Sigma-Aldrich) for 15 min at room temperature to remove DNA contamination, and subsequently, DNaseI was inactivated by heating at 70 °C for 15 min. cDNA was synthesized from 0.2–1 μg of RNA using Qscript supermix (Quanta Biosciences).
T281 8203-8390 Sentence denotes Quantitative real-time PCR (qRT-PCR) reactions were performed in a 20 μl solution containing 10 μl TaqMan Gene Expression Master Mix (Life Technologies), 500 nM primers, and 300 nM probe.
T282 8391-8523 Sentence denotes Reactions were performed in an Applied Biosystems 7900HT sequence detection system (Thermo Fisher Scientific) using SDS2.3 software.
T283 8524-8649 Sentence denotes The reaction conditions were, 50 °C for 2 min, 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
T284 8650-8751 Sentence denotes Samples were run in duplicate or triplicates, and template controls were included wherever necessary.
T285 8752-8889 Sentence denotes Fold change in RNA expression was calculated by relative quantification using the comparative CT method with GAPDH as endogenous control.
T286 8890-8983 Sentence denotes The primers and probe were designed using the PrimerQuest tool (Integrated DNA Technologies).
T287 8984-9029 Sentence denotes The sequences of the primers were as follows:
T288 9030-9308 Sentence denotes ZIKV-F-CGCTGCCCAACACAAGGT; ZIKV-R-, GCTCCCTTTGCCAAAAAGTCCACA, and ZIKV-probe, 5′/56-FAM/ACCTTGACA/ZEN/AGCAGTCAGACACTCAA/3IABkFQ; and human specific GAPDH-F-GGTGTGAACCATGAGAAGTATGA; GAPDH-R-GAGTCCTTCCACGATACCAAAG; and GAPDH-probe, 5′/56-FAM/AGATCATCA/ZEN/GCAATGCCTCCTGCA/3IABkFQ.
T289 9310-9322 Sentence denotes HCMV studies
T290 9323-9494 Sentence denotes HFF were grown in 24 well plates to 100% confluency in MEM with 10% FBS to establish viral inhibition of two low-passage clinical strains (BI-6 and CH19) via plaque assay.
T291 9495-9654 Sentence denotes Cells infected with low-passage HCMV clinical strains (CH19 and BI6) do not release extracellular virus, but they display typical HCMV cytopathic effect (CPE).
T292 9655-9729 Sentence denotes The percentage of infected cells was estimated visually in HFF monolayers.
T293 9730-9819 Sentence denotes Dilutions of trypsinized cells were used as inocula for HFF monolayers in 24 well plates.
T294 9820-9947 Sentence denotes After 7 days in culture, plaques were counted to determine the average number of plaques in 4-well replicates of each dilution.
T295 9948-10037 Sentence denotes The optimal dilution for each virus strain produced an average of 60–80 plaques per well.
T296 10038-10114 Sentence denotes CMVPT30-GFP having undergone multiple passages produces extracellular virus.
T297 10115-10198 Sentence denotes Viral infection was quantitatively determined by PRA of culture supernatant medium.
T298 10199-10393 Sentence denotes Cells were either exposed to GA for three hours prior to inoculation, or were inoculated prior to addition of medium containing GA at concentrations of 1, 2, 5, 10, and 20 µM in MEM with 1% FBS.
T299 10394-10459 Sentence denotes One set of four wells was treated with DMSO as a vehicle control.
T300 10460-10549 Sentence denotes For each experiment the remaining concentrations were represented in quadruplicate wells.
T301 10550-10739 Sentence denotes Plates were read beginning at 7 days post inoculation (dpi) to determine the GA concentration producing a reduction of 50% in the number of plaques relative to vehicle control wells (IC50).
T302 10740-10882 Sentence denotes Data were normalized to the vehicle controls, and probit analysis in SPSS was used to obtain 95% confidence intervals of the mean IC50 values.
T303 10884-10920 Sentence denotes HCMV DNA extraction and quantitation
T304 10921-11004 Sentence denotes HCMV infected monolayers were trypsinized and pooled at the termination of the PRA.
T305 11005-11098 Sentence denotes DNA was extracted from the pooled monolayers using the Blood gDNA kit (Promega, Madison, WI).
T306 11099-11193 Sentence denotes HCMV DNA was quantitated using a validated in-house assay, which targets the DNA polymerase30.
T307 11194-11276 Sentence denotes Reactions were performed on an Applied Biosystems 7500 (Thermo Fisher Scientific).
T308 11278-11313 Sentence denotes Infection of GFP-expressing viruses
T309 11314-11419 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T310 11420-11625 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T311 11626-11677 Sentence denotes Infection was evaluated by fluorescence microscopy.
T312 11679-11703 Sentence denotes Cell-cell fusion vectors
T313 11704-11807 Sentence denotes In these experiments, we used cell-cell fusion systems of ZIKV, HIV, EBOV, IVA, VEEV, VSV, SFV and EBV.
T314 11808-11892 Sentence denotes The plasmids, fusion proteins, and the related references are described in Table S2.
T315 11894-11912 Sentence denotes Fusion experiments
T316 11913-11986 Sentence denotes Nucleated cell-cell fusion, experiments were performed as described31,32.
T317 11987-12131 Sentence denotes Calcein-AM was loaded into effector cells expressing the fusion protein, and 7-amino-4-chloromethylcoumarin (CMAC) was loaded into target cells.
T318 12132-12168 Sentence denotes Mixing of dyes was scored as fusion.
T319 12169-12316 Sentence denotes Fusion experiments for each viral protein were performed as previously described: EBOV GP32; HIV33; SFV E1/E2 and IAV HA34; VEEV E, VSV, and EBV35.
T320 12317-12421 Sentence denotes Unless stated otherwise, EBOV GP was used as the fusion protein and C15:1 GA was used to inhibit fusion.
T321 12422-12506 Sentence denotes As shown in Fig. 2B, C15:1 GA inhibited fusion for the eight tested fusion proteins.
T322 12507-12582 Sentence denotes Figure 2C documents that fusion was blockaded by GA C13:0, C15:1, or C17:1.
T323 12584-12604 Sentence denotes Statistical analysis
T324 12605-12685 Sentence denotes For HCMV plaque assays, data were analyzed using one-way ANOVA analysis in SPSS.
T325 12686-12763 Sentence denotes For BI6 n = 25; degrees of freedom between groups = 4 and within groups = 20.
T326 12764-12786 Sentence denotes The F value is 68.827.
T327 12787-12865 Sentence denotes For CH19 n = 24; degrees of freedom between groups = 4 and within groups = 19.
T328 12866-12888 Sentence denotes The F value is 41.090.
T329 12889-13027 Sentence denotes For fusion experiments, Pair-wise Student t-tests were used to compare the outcome of a manipulation on fusion as compared to the control.
T330 13028-13055 Sentence denotes Error bars are SEM (n ≥ 3).
T331 13056-13110 Sentence denotes HCMV DNA copy numbers expressed as percent of control.
T332 13111-13144 Sentence denotes Significance was set at P < 0.05.
T333 13145-13194 Sentence denotes P values were obtained using a two-tailed t-test.
T334 13195-13240 Sentence denotes All measurements were performed in duplicate.
T335 13241-13283 Sentence denotes Standard curves were included on each run.
T336 13284-13401 Sentence denotes For ZIKV, the data were analyzed using unpaired, two tailed student’s t test and represented as mean± standard error.
T337 13402-13532 Sentence denotes Experiments were done independently at least three times and a value of p ≤ 0.05 indicated a statistically significant difference.

LitCovid-PD-HP

Id Subject Object Predicate Lexical cue hp_id
T8 3509-3515 Phenotype denotes Cancer http://purl.obolibrary.org/obo/HP_0002664

2_test

Id Subject Object Predicate Lexical cue
32179788-4300104-138463445 400-402 4300104 denotes 28
32179788-10196307-138463446 468-470 10196307 denotes 29
32179788-12198609-138463447 1062-1066 12198609 denotes 1914
32179788-23661800-138463448 1074-1077 23661800 denotes 615
32179788-17716703-138463449 1244-1246 17716703 denotes 16
32179788-10196307-138463450 6088-6090 10196307 denotes 29
32179788-26422187-138463451 11190-11192 26422187 denotes 30
32179788-10590134-138463452 11980-11982 10590134 denotes 31
32179788-26730950-138463453 11983-11985 26730950 denotes 32
32179788-26730950-138463454 12258-12260 26730950 denotes 32
32179788-11038187-138463455 12265-12267 11038187 denotes 33
32179788-17686870-138463456 12289-12291 17686870 denotes 34
32179788-24124539-138463457 12313-12315 24124539 denotes 35