> top > docs > PMC:7075884 > annotations

PMC:7075884 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id
1 0-14 Chemical denotes Ginkgolic acid MESH:C112485
46 323-327 Gene denotes AMPK Gene:5564
47 364-373 Gene denotes amyloid-β Gene:351
48 375-377 Gene denotes Aβ Gene:351
49 652-671 Gene denotes fatty acid synthase Gene:2194
50 140-153 Species denotes Ginkgo biloba Tax:3311
51 454-470 Species denotes Escherichia coli Tax:562
52 475-496 Species denotes Staphylococcus aureus Tax:1280
53 782-809 Species denotes Herpes simplex virus type 1 Tax:10298
54 811-816 Species denotes HSV-1 Tax:10298
55 917-938 Species denotes human cytomegalovirus Tax:10359
56 969-979 Species denotes Zika virus Tax:64320
57 981-985 Species denotes ZIKV Tax:64320
58 1007-1012 Species denotes human Tax:9606
59 1138-1149 Species denotes Ebola virus Tax:1570291
60 1151-1155 Species denotes EBOV Tax:1570291
61 1158-1175 Species denotes influenza A virus Tax:11320
62 1263-1273 Species denotes adenovirus Tax:10508
63 1394-1399 Species denotes HSV-1 Tax:10298
64 1691-1702 Species denotes Coronavirus Tax:11118
65 1704-1708 Species denotes EBOV Tax:1570291
66 1710-1714 Species denotes ZIKV Tax:64320
67 1806-1811 Species denotes HSV-1 Tax:10298
68 1813-1818 Species denotes HSV-2 Tax:10310
69 1823-1845 Species denotes varicella-zoster virus Tax:10335
70 940-944 Species denotes HCMV Tax:10359
71 1177-1180 Species denotes IAV Tax:11320
72 1206-1209 Species denotes EBV Tax:10376
73 1716-1719 Species denotes IAV Tax:11320
74 1847-1850 Species denotes VZV Tax:10335
75 62-77 Chemical denotes Ginkgolic acids MESH:C112485
76 79-81 Chemical denotes GA MESH:C112485
77 87-98 Chemical denotes alkylphenol
78 155-157 Chemical denotes GA MESH:C112485
79 408-410 Chemical denotes GA MESH:C112485
80 770-772 Chemical denotes GA MESH:C112485
81 905-907 Chemical denotes GA MESH:C112485
82 1304-1306 Chemical denotes GA MESH:C112485
83 1426-1428 Chemical denotes GA MESH:C112485
84 1576-1578 Chemical denotes GA MESH:C112485
85 987-996 Disease denotes infection MESH:D007239
86 1450-1459 Disease denotes infection MESH:D007239
87 1582-1597 Disease denotes viral infection MESH:D001102
88 1614-1623 Disease denotes infection MESH:D007239
89 1674-1684 Disease denotes infections MESH:D007239
110 2553-2556 Gene denotes C17 Gene:54360
111 2542-2545 Gene denotes C15 Gene:51316
112 2535-2538 Gene denotes C13 Gene:3229
113 1941-1954 Species denotes Ginkgo biloba Tax:3311
114 1956-1969 Species denotes Ginkgo biloba Tax:3311
115 1868-1883 Chemical denotes Ginkgolic acids MESH:C112485
116 1888-1899 Chemical denotes alkylphenol
117 2115-2134 Chemical denotes terpine trilactones
118 2136-2157 Chemical denotes ginkgolide A, B, C, J
119 2163-2173 Chemical denotes bilobalide MESH:C073710
120 2176-2196 Chemical denotes flavonoid glycosides
121 2198-2207 Chemical denotes quercetin MESH:D011794
122 2212-2217 Chemical denotes rutin MESH:D012431
123 2231-2246 Chemical denotes Ginkgolic acids MESH:C112485
124 2249-2264 Chemical denotes Ginkgolic acids MESH:C112485
125 2290-2320 Chemical denotes 2-hydroxy-6-alkylbenzoic acids
126 2381-2388 Chemical denotes carbons MESH:D002244
127 2404-2410 Chemical denotes carbon MESH:D002244
128 2477-2491 Chemical denotes Ginkgolic acid MESH:C112485
129 2493-2495 Chemical denotes GA MESH:C112485
139 2740-2744 Gene denotes AMPK Gene:5564
140 2777-2786 Gene denotes amyloid-β Gene:351
141 2788-2790 Gene denotes Aβ Gene:351
142 3149-3168 Gene denotes fatty acid synthase Gene:2194
143 2944-2960 Species denotes Escherichia coli Tax:562
144 2965-2986 Species denotes Staphylococcus aureus Tax:1280
145 2572-2574 Chemical denotes GA MESH:C112485
146 2898-2900 Chemical denotes GA MESH:C112485
147 3011-3013 Chemical denotes GA MESH:C112485
170 3309-3331 Species denotes Herpes simplex virus 1 Tax:10298
171 3333-3338 Species denotes HSV-1 Tax:10298
172 3341-3362 Species denotes Human cytomegalovirus Tax:10359
173 3375-3385 Species denotes Zika virus Tax:64320
174 3387-3391 Species denotes ZIKV Tax:64320
175 3986-3991 Species denotes human Tax:9606
176 4024-4028 Species denotes ZIKV Tax:64320
177 4035-4039 Species denotes EBOV Tax:1570291
178 4045-4062 Species denotes influenza A virus Tax:11320
179 4081-4117 Species denotes Venezuelan equine encephalitis virus Tax:11036
180 4119-4123 Species denotes VEEV Tax:11036
181 4129-4149 Species denotes Semliki Forest virus Tax:11033
182 4173-4199 Species denotes vesicular stomatitis virus Tax:11276
183 3364-3368 Species denotes HCMV Tax:10359
184 3518-3528 Species denotes adenovirus Tax:10508
185 4064-4067 Species denotes IAV Tax:11320
186 4151-4154 Species denotes SFV Tax:11033
187 4201-4204 Species denotes VSV Tax:11276
188 4230-4233 Species denotes EBV Tax:10376
189 3273-3275 Chemical denotes GA MESH:C112485
190 4282-4284 Chemical denotes GA MESH:C112485
191 3796-3809 Disease denotes viral disease MESH:D001102
193 4417-4426 Disease denotes infection MESH:D007239
199 4800-4803 Gene denotes C15 Gene:51316
200 4738-4741 Gene denotes C17 Gene:54360
201 4725-4728 Gene denotes C13 Gene:3229
202 4597-4600 Gene denotes C15 Gene:51316
203 4722-4724 Chemical denotes GA MESH:C112485
230 6378-6381 Gene denotes C13 Gene:3229
231 6283-6286 Gene denotes C15 Gene:51316
232 5564-5567 Gene denotes C17 Gene:54360
233 5557-5560 Gene denotes C15 Gene:51316
234 5550-5553 Gene denotes C13 Gene:3229
235 5579-5583 Species denotes HCMV Tax:10359
236 5789-5793 Species denotes HCMV Tax:10359
237 5987-5991 Species denotes HCMV Tax:10359
238 6314-6318 Species denotes HCMV Tax:10359
239 6387-6391 Species denotes HCMV Tax:10359
240 6464-6468 Species denotes HCMV Tax:10359
241 5533-5548 Chemical denotes Ginkgolic Acids MESH:C112485
242 5804-5808 Chemical denotes BI-6 MESH:C118647
243 5908-5910 Chemical denotes GA MESH:C112485
244 6190-6192 Chemical denotes GA MESH:C112485
245 6307-6310 Chemical denotes GCV MESH:D015774
246 6375-6377 Chemical denotes GA MESH:C112485
247 6442-6448 Chemical denotes GA C17
248 5727-5735 Disease denotes infected MESH:D007239
249 5912-5927 Disease denotes Viral infection MESH:D001102
250 6196-6205 Disease denotes infection MESH:D007239
251 6333-6342 Disease denotes infection MESH:D007239
252 6396-6405 Disease denotes infection MESH:D007239
253 6473-6482 Disease denotes infection MESH:D007239
254 5660-5674 CellLine denotes human foreskin CVCL:3285
255 5688-5691 CellLine denotes HFF CVCL:3285
266 5043-5054 Species denotes HCMV strain Tax:10359
267 5272-5282 Chemical denotes MEM medium
268 5356-5366 Chemical denotes MEM medium
269 5450-5452 Chemical denotes GA MESH:C112485
270 4838-4846 Disease denotes toxicity MESH:D064420
271 5029-5037 Disease denotes infected MESH:D007239
272 5217-5225 Disease denotes toxicity MESH:D064420
273 5438-5446 Disease denotes toxicity MESH:D064420
274 4861-4866 CellLine denotes HEp-2 CVCL:1906
275 5240-5243 CellLine denotes HFF CVCL:3285
280 6534-6536 Chemical denotes GA MESH:C112485
281 6546-6560 Disease denotes HCMV infection MESH:D007239
282 6564-6578 CellLine denotes human foreskin CVCL:3285
283 6592-6595 CellLine denotes HFF CVCL:3285
297 6627-6631 Species denotes HCMV Tax:10359
298 6836-6840 Species denotes HCMV Tax:10359
299 6621-6623 Chemical denotes GA MESH:C112485
300 7039-7041 Chemical denotes GA MESH:C112485
301 7165-7167 Chemical denotes GA MESH:C112485
302 7191-7193 Chemical denotes BI MESH:D001729
303 6632-6641 Disease denotes infection MESH:D007239
304 6781-6789 Disease denotes infected MESH:D007239
305 6966-6974 Disease denotes infected MESH:D007239
306 7063-7078 Disease denotes Viral infection MESH:D001102
307 7178-7187 Disease denotes infection MESH:D007239
308 6705-6719 CellLine denotes human foreskin CVCL:3285
309 6733-6736 CellLine denotes HFF CVCL:3285
336 8707-8710 Gene denotes C15 Gene:51316
337 8611-8614 Gene denotes C13 Gene:3229
338 8598-8601 Gene denotes C17 Gene:54360
339 8132-8136 Species denotes HCMV Tax:10359
340 8301-8305 Species denotes HCMV Tax:10359
341 8670-8674 Species denotes HCMV Tax:10359
342 7302-7304 Chemical denotes GA MESH:C112485
343 7441-7443 Chemical denotes GA MESH:C112485
344 7954-7956 Chemical denotes GA MESH:C112485
345 8026-8028 Chemical denotes GA MESH:C112485
346 8089-8100 Chemical denotes ganciclovir MESH:D015774
347 8102-8105 Chemical denotes GCV MESH:D015774
348 8236-8239 Chemical denotes GCV MESH:D015774
349 8456-8458 Chemical denotes GA MESH:C112485
350 8623-8625 Chemical denotes GA MESH:C112485
351 8704-8706 Chemical denotes GA MESH:C112485
352 8738-8740 Chemical denotes GA MESH:C112485
353 7774-7782 Disease denotes infected MESH:D007239
354 7894-7914 Disease denotes secondary infections MESH:D060085
355 8013-8022 Disease denotes infection MESH:D007239
356 8407-8415 Disease denotes infected MESH:D007239
357 8485-8493 Disease denotes infected MESH:D007239
358 8675-8684 Disease denotes infection MESH:D007239
359 8759-8771 Disease denotes cytotoxicity MESH:D064420
360 7392-7395 CellLine denotes HFF CVCL:3285
361 8510-8513 CellLine denotes HFF CVCL:3285
366 8831-8836 Species denotes HSV-1 Tax:10298
367 8841-8845 Species denotes ZIKV Tax:64320
368 8819-8821 Chemical denotes GA MESH:C112485
369 8846-8855 Disease denotes infection MESH:D007239
394 11424-11428 Gene denotes US11 Gene:2703439
395 11433-11440 Gene denotes β-Actin Gene:728378
396 11766-11770 Gene denotes US11 Gene:2703439
397 11775-11782 Gene denotes β-Actin Gene:728378
398 11025-11034 Gene denotes Lanes 4–6
399 10997-11006 Gene denotes Lanes 1–3
400 10943-10948 Species denotes HSV-1 Tax:10298
401 11560-11565 Species denotes HSV-1 Tax:10298
402 11959-11964 Species denotes HSV-1 Tax:10298
403 11915-11918 Gene denotes C15 Gene:51316
404 11494-11497 Gene denotes C15 Gene:51316
405 10898-10900 Chemical denotes GA MESH:C112485
406 10993-10995 Chemical denotes GA MESH:C112485
407 11050-11054 Chemical denotes DMEM
408 11170-11172 Chemical denotes GA MESH:C112485
409 10910-10925 Disease denotes HSV-1 infection MESH:C536395
410 11225-11233 Disease denotes infected MESH:D007239
411 11546-11554 Disease denotes infected MESH:D007239
412 11941-11949 Disease denotes infected MESH:D007239
413 11084-11088 CellLine denotes HEp2 CVCL:1906
414 11092-11096 CellLine denotes 293T CVCL:0063
415 11193-11198 CellLine denotes HEp-2 CVCL:1906
416 11206-11210 CellLine denotes 293T CVCL:0063
417 11446-11450 CellLine denotes HEp2 CVCL:1906
454 9671-9675 Gene denotes US11 Gene:2703439
455 10282-10286 Gene denotes US11 Gene:2703439
456 10153-10156 Gene denotes C15 Gene:51316
457 8872-8877 Species denotes HSV-1 Tax:10298
458 8929-8933 Species denotes ZIKV Tax:64320
459 9026-9031 Species denotes HSV-1 Tax:10298
460 9061-9066 Species denotes HSV-1 Tax:10298
461 9203-9208 Species denotes HSV-1 Tax:10298
462 9616-9621 Species denotes HSV-1 Tax:10298
463 9767-9772 Species denotes HSV-1 Tax:10298
464 9957-9962 Species denotes HSV-1 Tax:10298
465 9989-9994 Species denotes HSV-1 Tax:10298
466 10043-10048 Species denotes HSV-1 Tax:10298
467 10222-10227 Species denotes HSV-1 Tax:10298
468 10259-10264 Species denotes HSV-1 Tax:10298
469 10473-10478 Species denotes HSV-1 Tax:10298
470 10667-10672 Species denotes HSV-1 Tax:10298
471 9018-9022 Species denotes HCMV Tax:10359
472 9049-9051 Chemical denotes GA MESH:C112485
473 9123-9125 Chemical denotes GA MESH:C112485
474 9246-9248 Chemical denotes GA MESH:C112485
475 9287-9291 Chemical denotes DMEM
476 9423-9425 Chemical denotes GA MESH:C112485
477 9535-9537 Chemical denotes GA MESH:C112485
478 10037-10039 Chemical denotes GA MESH:C112485
479 10184-10195 Chemical denotes 199V medium
480 10865-10867 Chemical denotes GA MESH:C112485
481 9562-9577 Disease denotes viral infection MESH:D001102
482 10684-10692 Disease denotes infected MESH:D007239
483 9169-9174 CellLine denotes HEp-2 CVCL:1906
484 9179-9183 CellLine denotes 293T CVCL:0063
485 9335-9339 CellLine denotes HEp2 CVCL:1906
486 9343-9347 CellLine denotes 293T CVCL:0063
487 9581-9585 CellLine denotes HEp2 CVCL:1906
488 9590-9594 CellLine denotes 293T CVCL:0063
489 10062-10066 CellLine denotes HEp2 CVCL:1906
509 13621-13625 Species denotes ZIKV Tax:64320
510 13672-13676 Species denotes ZIKV Tax:64320
511 13818-13822 Species denotes ZIKV Tax:64320
512 14119-14123 Species denotes ZIKV Tax:64320
513 14268-14272 Species denotes ZIKV Tax:64320
514 14366-14370 Species denotes ZIKV Tax:64320
515 13609-13611 Chemical denotes GA MESH:C112485
516 13694-13696 Chemical denotes GA MESH:C112485
517 13767-13769 Chemical denotes GA MESH:C112485
518 13783-13787 Chemical denotes DMSO MESH:D004121
519 14314-14316 Chemical denotes GA MESH:C112485
520 14325-14329 Chemical denotes DMSO MESH:D004121
521 14512-14516 Chemical denotes DPBS MESH:C012939
522 14539-14543 Chemical denotes DMEM
523 13626-13635 Disease denotes infection MESH:D007239
524 13658-13666 Disease denotes infected MESH:D007239
525 13804-13812 Disease denotes infected MESH:D007239
526 13949-13958 Disease denotes infection MESH:D007239
527 14469-14477 Disease denotes infected MESH:D007239
554 12005-12009 Species denotes ZIKV Tax:64320
555 12147-12151 Species denotes ZIKV Tax:64320
556 12471-12475 Species denotes ZIKV Tax:64320
557 12668-12672 Species denotes ZIKV Tax:64320
558 13055-13059 Species denotes ZIKV Tax:64320
559 13073-13077 Species denotes ZIKV Tax:64320
560 13379-13383 Species denotes ZIKV Tax:64320
561 13436-13440 Species denotes ZIKV Tax:64320
562 13492-13496 Species denotes ZIKV Tax:64320
563 13548-13552 Species denotes ZIKV Tax:64320
564 13579-13583 Species denotes ZIKV Tax:64320
565 12890-12894 Species denotes HCMV Tax:10359
566 11999-12001 Chemical denotes GA MESH:C112485
567 12087-12089 Chemical denotes GA MESH:C112485
568 12093-12097 Chemical denotes DMSO MESH:D004121
569 12254-12256 Chemical denotes GA MESH:C112485
570 12260-12264 Chemical denotes DMSO MESH:D004121
571 12303-12306 Chemical denotes CO2 MESH:D002245
572 12562-12564 Chemical denotes GA MESH:C112485
573 12707-12709 Chemical denotes GA MESH:C112485
574 12741-12743 Chemical denotes GA MESH:C112485
575 13049-13051 Chemical denotes GA MESH:C112485
576 13107-13109 Chemical denotes GA MESH:C112485
577 13368-13370 Chemical denotes GA MESH:C112485
578 12010-12019 Disease denotes infection MESH:D007239
579 12133-12141 Disease denotes infected MESH:D007239
581 14730-14732 Chemical denotes GA MESH:C112485
595 15960-15967 Gene denotes dE1/E3) Gene:45300
596 16041-16044 Gene denotes C15 Gene:51316
597 15857-15860 Gene denotes C15 Gene:51316
598 15655-15658 Gene denotes C15 Gene:51316
599 15540-15543 Gene denotes C15 Gene:51316
600 15435-15456 Species denotes human adenovirus. (A) Tax:129875
601 15596-15601 Species denotes HSV-1 Tax:10298
602 15935-15958 Species denotes human adenovirus type 5 Tax:28285
603 15409-15411 Chemical denotes GA MESH:C112485
604 15549-15553 Chemical denotes DMSO MESH:D004121
605 15866-15870 Chemical denotes DMSO MESH:D004121
606 15578-15586 Disease denotes infected MESH:D007239
607 15675-15684 Disease denotes Infection MESH:D007239
618 15102-15109 Gene denotes dE1/E3) Gene:45300
619 15203-15206 Gene denotes C15 Gene:51316
620 14994-14997 Gene denotes C15 Gene:51316
621 14861-14871 Species denotes adenovirus Tax:10508
622 15077-15100 Species denotes human adenovirus type 5 Tax:28285
623 15141-15146 Species denotes HSV-1 Tax:10298
624 15332-15337 Species denotes HSV-1 Tax:10298
625 15388-15398 Species denotes adenovirus Tax:10508
626 14793-14795 Chemical denotes GA MESH:C112485
627 15003-15007 Chemical denotes DMSO MESH:D004121
629 16164-16166 Chemical denotes GA MESH:C112485
640 16325-16328 Gene denotes C15 Gene:51316
641 16769-16773 Species denotes ZIKV Tax:64320
642 16780-16784 Species denotes EBOV Tax:1570291
643 16796-16800 Species denotes VEEV Tax:11036
644 16786-16789 Species denotes IAV Tax:11320
645 16791-16794 Species denotes SFV Tax:11033
646 16802-16805 Species denotes VSV Tax:11276
647 16810-16813 Species denotes EBV Tax:10376
648 16322-16324 Chemical denotes GA MESH:C112485
649 16671-16675 CellLine denotes COS7 CVCL:0224
675 18250-18277 Gene denotes Semliki forest virus) E1/E2
676 18189-18192 Gene denotes Env Gene:100616444
677 18454-18457 Gene denotes Env Gene:100616444
678 17922-17926 Species denotes EBOV Tax:1570291
679 18170-18174 Species denotes ZIKV Tax:64320
680 18194-18198 Species denotes EBOV Tax:1570291
681 18200-18205 Species denotes Ebola Tax:1570291
682 18279-18283 Species denotes VEEV Tax:11036
683 18285-18321 Species denotes Venezuelan Equine Encephalitis Virus Tax:11036
684 18346-18372 Species denotes Vesicular Stomatitis Virus Tax:11276
685 18382-18400 Species denotes Epstein Barr Virus Tax:10376
686 18216-18225 Species denotes Influenza Tax:11320
687 18211-18214 Species denotes IAV Tax:11320
688 18245-18248 Species denotes SFV Tax:11033
689 18341-18344 Species denotes VSV Tax:11276
690 18377-18380 Species denotes EBV Tax:10376
691 17425-17427 Chemical denotes GA MESH:C112485
692 17626-17628 Chemical denotes GA MESH:C112485
693 17700-17707 Chemical denotes calcein MESH:C007740
694 17740-17744 Chemical denotes CMAC
695 17843-17845 Chemical denotes GA MESH:C112485
696 18637-18639 Chemical denotes GA MESH:C112485
697 18680-18682 Chemical denotes GA MESH:C112485
698 18726-18728 Chemical denotes GA MESH:C112485
699 18824-18826 Chemical denotes GA MESH:C112485
714 17344-17347 Gene denotes C17 Gene:54360
715 17331-17334 Gene denotes C15 Gene:51316
716 17321-17324 Gene denotes C13 Gene:3229
717 17213-17216 Gene denotes C15 Gene:51316
718 17017-17021 Species denotes EBOV Tax:1570291
719 17274-17278 Species denotes EBOV Tax:1570291
720 16847-16857 Chemical denotes calcein AM MESH:C085925
721 16992-16996 Chemical denotes CMAC
722 17082-17084 Chemical denotes GA MESH:C112485
723 17328-17330 Chemical denotes GA MESH:C112485
724 17341-17343 Chemical denotes GA MESH:C112485
725 17374-17376 Chemical denotes GA MESH:C112485
726 16819-16823 CellLine denotes COS7 CVCL:0224
727 16871-16875 CellLine denotes 293T CVCL:0063
746 21116-21120 Species denotes EBOV Tax:1570291
747 20079-20081 Chemical denotes GA MESH:C112485
748 20117-20119 Chemical denotes GA MESH:C112485
749 20185-20187 Chemical denotes GA MESH:C112485
750 20205-20207 Chemical denotes GA MESH:C112485
751 20232-20234 Chemical denotes GA MESH:C112485
752 20363-20365 Chemical denotes GA MESH:C112485
753 20461-20463 Chemical denotes GA MESH:C112485
754 20577-20579 Chemical denotes GA MESH:C112485
755 20705-20707 Chemical denotes GA MESH:C112485
756 20757-20759 Chemical denotes GA MESH:C112485
757 20825-20827 Chemical denotes GA MESH:C112485
758 21015-21017 Chemical denotes GA MESH:C112485
759 21112-21114 Chemical denotes GA MESH:C112485
760 21221-21223 Chemical denotes GA MESH:C112485
761 21255-21265 Chemical denotes oleic acid MESH:D019301
762 21391-21393 Chemical denotes GA MESH:C112485
763 21443-21445 Chemical denotes GA MESH:C112485
774 18880-18882 Chemical denotes GA MESH:C112485
775 18950-18952 Chemical denotes GA MESH:C112485
776 19129-19134 Chemical denotes lipid MESH:D008055
777 19425-19427 Chemical denotes GA MESH:C112485
778 19608-19631 Chemical denotes lysophosphatidylcholine MESH:D008244
779 19633-19636 Chemical denotes LPC MESH:D008244
780 19736-19746 Chemical denotes oleic acid MESH:D019301
781 19945-19947 Chemical denotes GA MESH:C112485
782 19983-19985 Chemical denotes GA MESH:C112485
783 20013-20015 Chemical denotes GA MESH:C112485
785 21579-21581 Chemical denotes GA MESH:C112485
803 23151-23160 Gene denotes Lanes 1–4
804 23379-23386 Gene denotes β-Actin Gene:728378
805 23391-23395 Gene denotes US11 Gene:2703439
806 23174-23183 Gene denotes Lanes 5–8
807 22356-22361 Species denotes HSV-1 Tax:10298
808 23054-23059 Species denotes HSV-1 Tax:10298
809 22419-22423 Species denotes HCMV Tax:10359
810 22462-22466 Species denotes HCMV Tax:10359
811 22344-22346 Chemical denotes GA MESH:C112485
812 22456-22458 Chemical denotes GA MESH:C112485
813 22560-22562 Chemical denotes GA MESH:C112485
814 22794-22796 Chemical denotes GA MESH:C112485
815 23147-23149 Chemical denotes GA MESH:C112485
816 23040-23048 Disease denotes infected MESH:D007239
817 22651-22654 CellLine denotes HFF CVCL:3285
818 23013-23018 CellLine denotes HEp-2 CVCL:1906
819 23026-23030 CellLine denotes 293T CVCL:0063
829 21784-21788 Species denotes HCMV Tax:10359
830 21851-21855 Species denotes HCMV Tax:10359
831 22190-22194 Species denotes HCMV Tax:10359
832 21822-21824 Chemical denotes GA MESH:C112485
833 21928-21930 Chemical denotes GA MESH:C112485
834 22149-22151 Chemical denotes GA MESH:C112485
835 21789-21797 Disease denotes infected MESH:D007239
836 21826-21829 CellLine denotes HFF CVCL:3285
837 21984-21987 CellLine denotes HFF CVCL:3285
854 23595-23600 Species denotes HSV-1 Tax:10298
855 23821-23826 Species denotes HSV-1 Tax:10298
856 23531-23533 Chemical denotes GA MESH:C112485
857 23926-23928 Chemical denotes GA MESH:C112485
858 24028-24030 Chemical denotes GA MESH:C112485
859 23502-23514 Disease denotes HSV-infected MESH:C536395
860 23581-23589 Disease denotes infected MESH:D007239
861 23850-23859 Disease denotes infection MESH:D007239
862 23936-23944 Disease denotes infected MESH:D007239
863 24101-24121 Disease denotes secondary infections MESH:D060085
864 23555-23560 CellLine denotes HEp-2 CVCL:1906
865 23565-23569 CellLine denotes 293T CVCL:0063
866 23863-23868 CellLine denotes HEp-2 CVCL:1906
867 23873-23877 CellLine denotes 293T CVCL:0063
868 23945-23950 CellLine denotes HEp-2 CVCL:1906
869 23955-23959 CellLine denotes 293T CVCL:0063
887 24783-24802 Gene denotes fatty acid synthase Gene:2194
888 24898-24903 Gene denotes STAT3 Gene:6774
889 24936-24940 Gene denotes PTEN Gene:5728
890 24376-24379 Gene denotes C17 Gene:54360
891 24366-24369 Gene denotes C15 Gene:51316
892 24359-24362 Gene denotes C13 Gene:3229
893 24998-25000 Gene denotes Aβ Gene:351
894 24422-24428 Species denotes Ginkgo Tax:3311
895 24620-24636 Species denotes Escherichia coli Tax:562
896 24641-24662 Species denotes Staphylococcus aureus Tax:1280
897 24343-24358 Chemical denotes Ginkgolic acids MESH:C112485
898 24717-24719 Chemical denotes GA MESH:C112485
899 24951-24959 Chemical denotes Tyrosine MESH:D014443
900 24552-24574 Disease denotes cardiovascular disease MESH:D002318
901 24576-24589 Disease denotes HIV infection MESH:D015658
902 24591-24611 Disease denotes bacterial infections MESH:D001424
903 24673-24679 Disease denotes tumors MESH:D009369
911 25237-25253 Species denotes human adenovirus Tax:1907210
912 25125-25127 Chemical denotes GA MESH:C112485
913 25432-25434 Chemical denotes GA MESH:C112485
914 25505-25507 Chemical denotes GA MESH:C112485
915 25726-25728 Chemical denotes GA MESH:C112485
916 25675-25681 Disease denotes arrest MESH:D006323
917 25749-25755 Disease denotes cancer MESH:D009369
936 26127-26132 Species denotes HSV-1 Tax:10298
937 26138-26142 Species denotes ZIKV Tax:64320
938 26211-26216 Species denotes human Tax:9606
939 26246-26251 Species denotes human Tax:9606
940 26291-26296 Species denotes human Tax:9606
941 26121-26125 Species denotes HCMV Tax:10359
942 25915-25917 Chemical denotes GA MESH:C112485
943 25954-25956 Chemical denotes GA MESH:C112485
944 26022-26024 Chemical denotes GA MESH:C112485
945 26115-26117 Chemical denotes GA MESH:C112485
946 26158-26160 Chemical denotes GA MESH:C112485
947 26310-26312 Chemical denotes GA MESH:C112485
948 26228-26237 Disease denotes carcinoma MESH:D009369
949 26252-26268 Disease denotes embryonic kidney MESH:D007674
950 26392-26404 Disease denotes cytotoxicity MESH:D064420
951 26204-26209 CellLine denotes HEp-2 CVCL:1906
952 26240-26244 CellLine denotes 293T CVCL:0063
953 26271-26274 CellLine denotes HFF CVCL:3285
979 26511-26526 Species denotes Chinese hamster Tax:10029
980 26822-26827 Species denotes chick Tax:9031
981 26934-26945 Species denotes guinea pigs Tax:10141
982 26500-26502 Chemical denotes GA MESH:C112485
983 26607-26611 Chemical denotes DMEM
984 26656-26658 Chemical denotes GA MESH:C112485
985 26751-26753 Chemical denotes GA MESH:C112485
986 26857-26861 Chemical denotes DMEM
987 26928-26930 Chemical denotes GA MESH:C112485
988 26979-26981 Chemical denotes GA MESH:C112485
989 27103-27113 Chemical denotes MEM medium
990 27199-27201 Chemical denotes GA MESH:C112485
991 27270-27272 Chemical denotes GA MESH:C112485
992 27396-27398 Chemical denotes GA MESH:C112485
993 27471-27473 Chemical denotes GA MESH:C112485
994 27563-27565 Chemical denotes GA MESH:C112485
995 27735-27737 Chemical denotes GA MESH:C112485
996 26467-26479 Disease denotes cytotoxicity MESH:D064420
997 26580-26588 Disease denotes toxicity MESH:D064420
998 26762-26776 Disease denotes neuronal death MESH:D009410
999 27011-27028 Disease denotes allergic reaction MESH:D004342
1000 27032-27048 Disease denotes Viral infections MESH:D001102
1001 27187-27195 Disease denotes toxicity MESH:D064420
1002 27384-27392 Disease denotes toxicity MESH:D064420
1003 27719-27731 Disease denotes cytotoxicity MESH:D064420
1013 28192-28196 Species denotes EBOV Tax:1570291
1014 28727-28737 Species denotes adenovirus Tax:10508
1015 28882-28892 Species denotes adenovirus Tax:10508
1016 27739-27741 Chemical denotes GA MESH:C112485
1017 28167-28169 Chemical denotes GA MESH:C112485
1018 28246-28248 Chemical denotes GA MESH:C112485
1019 28761-28763 Chemical denotes GA MESH:C112485
1020 28772-28777 Chemical denotes lipid MESH:D008055
1021 28340-28357 Disease denotes rigid amphipathic MESH:D009127
1032 29265-29269 Species denotes EBOV Tax:1570291
1033 29282-29287 Species denotes HSV-1 Tax:10298
1034 29357-29373 Species denotes human adenovirus Tax:1907210
1035 29524-29529 Species denotes HSV-1 Tax:10298
1036 29289-29293 Species denotes HCMV Tax:10359
1037 29295-29298 Species denotes EBV Tax:10376
1038 29303-29306 Species denotes IAV Tax:11320
1039 29505-29509 Species denotes HCMV Tax:10359
1040 29175-29177 Chemical denotes GA MESH:C112485
1041 29479-29481 Chemical denotes GA MESH:C112485
1056 29739-29750 Species denotes Coronavirus Tax:11118
1057 29763-29767 Species denotes EBOV Tax:1570291
1058 29769-29773 Species denotes ZIKV Tax:64320
1059 29909-29914 Species denotes HSV-1 Tax:10298
1060 29916-29921 Species denotes HSV-2 Tax:10310
1061 29775-29778 Species denotes IAV Tax:11320
1062 29926-29929 Species denotes VZV Tax:10335
1063 29616-29618 Chemical denotes GA MESH:C112485
1064 29672-29674 Chemical denotes GA MESH:C112485
1065 29958-29960 Chemical denotes GA MESH:C112485
1066 29634-29650 Disease denotes viral infections MESH:D001102
1067 29716-29732 Disease denotes viral infections MESH:D001102
1068 29752-29760 Disease denotes COVID-19 MESH:C000657245
1069 29988-30003 Disease denotes virus infection MESH:D001102
1091 31148-31155 Gene denotes insulin Gene:3630
1092 30566-30571 Species denotes HSV-1 Tax:10298
1093 30664-30677 Species denotes HSV-1 (strain Tax:10298
1094 30939-30944 Species denotes Human Tax:9606
1095 30386-30418 Chemical denotes Dulbecco’s Modified Eagle Medium
1096 30420-30424 Chemical denotes DMEM
1097 30534-30538 Chemical denotes DMEM
1098 30788-30792 Chemical denotes DMEM
1099 30794-30799 Chemical denotes cDMEM
1100 30826-30837 Chemical denotes L-glutamine MESH:D005973
1101 30848-30858 Chemical denotes penicillin MESH:D010406
1102 30859-30871 Chemical denotes streptomycin MESH:D013307
1103 30883-30888 Chemical denotes Hepes MESH:D006531
1104 30913-30916 Chemical denotes CO2 MESH:D002245
1105 31062-31075 Chemical denotes ascorbic acid MESH:D001205
1106 31101-31111 Chemical denotes gentamicin MESH:D005839
1107 31122-31136 Chemical denotes amphotericin B MESH:D000666
1108 31170-31181 Chemical denotes L-glutamine MESH:D005973
1109 30287-30291 CellLine denotes HEp2 CVCL:1906
1110 30473-30480 CellLine denotes HEK293T CVCL:0063
1111 30485-30489 CellLine denotes 293T CVCL:0063
1118 31236-31240 Species denotes HCMV Tax:10359
1119 31371-31375 Species denotes HCMV Tax:10359
1120 31392-31403 Chemical denotes ganciclovir MESH:D015774
1121 31405-31408 Chemical denotes GCV MESH:D015774
1122 31417-31421 Chemical denotes BI-6 MESH:C118647
1123 31440-31443 Chemical denotes GCV MESH:D015774
1134 32773-32779 Gene denotes dE1/E3 Gene:45300
1135 31580-31584 Species denotes ZIKV Tax:64320
1136 32171-32177 Species denotes stocks Tax:3724
1137 32749-32771 Species denotes Human Adenovirus Type5 Tax:28285
1138 31875-31880 Chemical denotes cDMEM
1139 32016-32033 Chemical denotes cellulose acetate MESH:C005062
1140 31727-31736 Disease denotes infection MESH:D007239
1141 31848-31857 Disease denotes infection MESH:D007239
1142 32053-32063 Disease denotes infections MESH:D007239
1143 32222-32230 Disease denotes infected MESH:D007239
1155 32854-32857 Gene denotes C17 Gene:54360
1156 32843-32846 Gene denotes C15 Gene:51316
1157 32836-32839 Gene denotes C13 Gene:3229
1158 33120-33126 Species denotes stocks Tax:3724
1159 32911-32913 Chemical denotes GA MESH:C112485
1160 32929-32937 Chemical denotes methanol MESH:D000432
1161 32941-32945 Chemical denotes DMSO MESH:D004121
1162 32986-32988 Chemical denotes GA MESH:C112485
1163 33077-33085 Chemical denotes methanol MESH:D000432
1164 33089-33093 Chemical denotes DMSO MESH:D004121
1165 33176-33178 Chemical denotes GA MESH:C112485
1175 33737-33741 Gene denotes US11 Gene:2703439
1176 33967-33974 Gene denotes β-actin Gene:728378
1177 33207-33212 Species denotes HSV-1 Tax:10298
1178 34131-34142 Species denotes horseradish Tax:3704
1179 33311-33314 Chemical denotes PBS MESH:D007854
1180 33560-33574 Chemical denotes polyacrylamide MESH:C016679
1181 33653-33662 Chemical denotes Tween PBS
1182 34190-34247 Chemical denotes 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium
1183 33765-33771 Disease denotes Cancer MESH:D009369
1185 34389-34401 Disease denotes Cytotoxicity MESH:D064420
1188 34488-34490 Chemical denotes GA MESH:C112485
1189 34595-34602 Chemical denotes DAL1025
1197 34905-34915 Chemical denotes penicillin MESH:D010406
1198 34916-34928 Chemical denotes streptomycin MESH:D013307
1199 35052-35055 Chemical denotes CO2 MESH:D002245
1200 35188-35192 Chemical denotes DPBS MESH:C012939
1201 35208-35212 Chemical denotes DMEM
1202 34803-34811 Disease denotes infected MESH:D007239
1203 34958-34967 Disease denotes infection MESH:D007239
1205 35987-35992 Species denotes HSV-1 Tax:10298
1219 36328-36333 Species denotes HSV-1 Tax:10298
1220 36735-36740 Species denotes human Tax:9606
1221 36006-36008 Chemical denotes GA MESH:C112485
1222 36160-36170 Chemical denotes penicillin MESH:D010406
1223 36171-36183 Chemical denotes streptomycin MESH:D013307
1224 36318-36322 Chemical denotes DPBS MESH:C012939
1225 36764-36768 Chemical denotes DMEM
1226 36770-36804 Chemical denotes Dulbecco’s Modified Eagle’s medium
1227 36838-36848 Chemical denotes penicillin MESH:D010406
1228 36849-36861 Chemical denotes streptomycin MESH:D013307
1229 36889-36892 Chemical denotes CO2 MESH:D002245
1230 36972-36980 Chemical denotes methanol MESH:D000432
1231 37068-37073 Chemical denotes water MESH:D014867
1233 37207-37211 Species denotes ZIKV Tax:64320
1248 39117-39122 Gene denotes GAPDH Gene:2597
1249 37720-37723 Gene denotes C15 Gene:51316
1250 37230-37234 Species denotes ZIKV Tax:64320
1251 37331-37335 Species denotes ZIKV Tax:64320
1252 37768-37772 Species denotes ZIKV Tax:64320
1253 37279-37281 Chemical denotes GA MESH:C112485
1254 37290-37294 Chemical denotes DMSO MESH:D004121
1255 37477-37481 Chemical denotes DPBS MESH:C012939
1256 37504-37508 Chemical denotes DMEM
1257 37859-37862 Chemical denotes AGM
1258 37880-37882 Chemical denotes GA MESH:C112485
1259 38763-38767 Chemical denotes SDS2
1260 37434-37442 Disease denotes infected MESH:D007239
1261 37754-37762 Disease denotes infected MESH:D007239
1269 39503-39508 Gene denotes GAPDH Gene:2597
1270 39286-39290 Species denotes ZIKV Tax:64320
1271 39313-39317 Species denotes ZIKV Tax:64320
1272 39352-39356 Species denotes ZIKV Tax:64320
1273 39419-39424 Species denotes human Tax:9606
1274 39467-39472 Gene denotes GAPDH Gene:2597
1275 39434-39439 Gene denotes GAPDH Gene:2597
1277 39566-39570 Species denotes HCMV Tax:10359
1290 39783-39787 Species denotes HCMV Tax:10359
1291 39881-39885 Species denotes HCMV Tax:10359
1292 40484-40486 Chemical denotes GA MESH:C112485
1293 40583-40585 Chemical denotes GA MESH:C112485
1294 40689-40693 Chemical denotes DMSO MESH:D004121
1295 40883-40885 Chemical denotes GA MESH:C112485
1296 39757-39765 Disease denotes infected MESH:D007239
1297 39929-39937 Disease denotes infected MESH:D007239
1298 40371-40386 Disease denotes Viral infection MESH:D001102
1299 39579-39582 CellLine denotes HFF CVCL:3285
1300 39970-39973 CellLine denotes HFF CVCL:3285
1301 40042-40045 CellLine denotes HFF CVCL:3285
1303 41140-41144 Species denotes HCMV Tax:10359
1307 41177-41181 Species denotes HCMV Tax:10359
1308 41355-41359 Species denotes HCMV Tax:10359
1309 41182-41190 Disease denotes infected MESH:D007239
1311 41534-41543 Disease denotes Infection MESH:D007239
1319 41761-41768 Gene denotes dE1/E3) Gene:45300
1320 41862-41865 Gene denotes C15 Gene:51316
1321 41653-41656 Gene denotes C15 Gene:51316
1322 41736-41759 Species denotes human adenovirus type 5 Tax:28285
1323 41800-41805 Species denotes HSV-1 Tax:10298
1324 41662-41666 Chemical denotes DMSO MESH:D004121
1325 41882-41891 Disease denotes Infection MESH:D007239
1333 42018-42022 Species denotes ZIKV Tax:64320
1334 42029-42033 Species denotes EBOV Tax:1570291
1335 42040-42044 Species denotes VEEV Tax:11036
1336 42046-42049 Species denotes VSV Tax:11276
1337 42051-42054 Species denotes SFV Tax:11033
1338 42059-42062 Species denotes EBV Tax:10376
1339 42035-42038 Disease denotes IVA MESH:C538167
1355 42832-42835 Gene denotes C17 Gene:54360
1356 42822-42825 Gene denotes C15 Gene:51316
1357 42815-42818 Gene denotes C13 Gene:3229
1358 42699-42702 Gene denotes C15 Gene:51316
1359 42641-42644 Gene denotes C15 Gene:51316
1360 42507-42511 Species denotes EBOV Tax:1570291
1361 42549-42553 Species denotes VEEV Tax:11036
1362 42598-42602 Species denotes EBOV Tax:1570291
1363 42525-42528 Species denotes SFV Tax:11033
1364 42539-42542 Species denotes IAV Tax:11320
1365 42557-42560 Species denotes VSV Tax:11276
1366 42566-42569 Species denotes EBV Tax:10376
1367 42243-42253 Chemical denotes Calcein-AM MESH:C085925
1368 42320-42350 Chemical denotes 7-amino-4-chloromethylcoumarin MESH:C453681
1369 42352-42356 Chemical denotes CMAC
1372 42865-42869 Species denotes HCMV Tax:10359
1373 42946-42949 Chemical denotes BI6 MESH:C118647
1375 43312-43316 Species denotes HCMV Tax:10359
1377 43544-43548 Species denotes ZIKV Tax:64320

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T1 306-314 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T2 652-662 Body_part denotes fatty acid http://purl.org/sig/ont/fma/fma82738
T3 721-728 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T4 857-864 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T5 946-952 Body_part denotes genome http://purl.org/sig/ont/fma/fma84116
T6 1013-1023 Body_part denotes astrocytes http://purl.org/sig/ont/fma/fma54537
T7 1114-1122 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T8 1133-1136 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T9 1510-1517 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T10 1522-1525 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T11 2723-2731 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T12 2839-2842 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T13 2872-2875 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T14 3149-3159 Body_part denotes fatty acid http://purl.org/sig/ont/fma/fma82738
T15 3222-3229 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T16 4030-4033 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T17 4485-4490 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T18 4541-4547 Body_part denotes genome http://purl.org/sig/ont/fma/fma84116
T19 4558-4565 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T20 4867-4872 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T21 4914-4919 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T22 4988-4993 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T23 5023-5028 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T24 5170-5175 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T25 5244-5249 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T26 5472-5477 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T27 5666-5674 Body_part denotes foreskin http://purl.org/sig/ont/fma/fma19639
T28 5675-5686 Body_part denotes fibroblasts http://purl.org/sig/ont/fma/fma63877
T29 5721-5726 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T30 5752-5756 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T31 6213-6217 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T32 6323-6327 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T33 6454-6458 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T34 6570-6578 Body_part denotes foreskin http://purl.org/sig/ont/fma/fma19639
T35 6579-6590 Body_part denotes fibroblasts http://purl.org/sig/ont/fma/fma63877
T36 6711-6719 Body_part denotes foreskin http://purl.org/sig/ont/fma/fma19639
T37 6720-6731 Body_part denotes fibroblasts http://purl.org/sig/ont/fma/fma63877
T38 6799-6803 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T39 6975-6980 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T40 7373-7377 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T41 7763-7768 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T42 7813-7817 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T43 7821-7825 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T44 8287-8292 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T45 8336-8340 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T46 8344-8348 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T47 8494-8499 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T48 8556-8560 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T49 8561-8565 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T50 8911-8914 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T51 8938-8941 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T52 8966-8978 Body_part denotes glycoprotein http://purl.org/sig/ont/fma/fma62925
T53 9184-9189 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T54 9276-9281 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T55 9348-9353 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T56 9595-9600 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T57 9677-9685 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T58 9857-9864 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T59 9995-10002 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T60 10067-10071 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T61 10241-10248 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T62 10287-10295 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T63 10418-10426 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T64 10479-10487 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T65 10589-10593 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T66 10698-10703 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T67 10876-10880 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T68 11039-11044 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T69 11097-11102 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T70 11279-11284 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T71 11328-11332 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T72 11435-11440 Body_part denotes Actin http://purl.org/sig/ont/fma/fma67843
T73 11451-11455 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T74 11621-11626 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T75 11670-11674 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T76 11777-11782 Body_part denotes Actin http://purl.org/sig/ont/fma/fma67843
T77 11805-11812 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T78 11884-11889 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T79 12118-12123 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T80 12269-12274 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T81 12356-12360 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T82 12407-12412 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T83 12445-12448 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T84 12476-12479 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T85 12626-12631 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T86 12673-12676 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T87 12792-12796 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T88 12962-12975 Body_part denotes glycoproteins http://purl.org/sig/ont/fma/fma62925
T89 12994-12998 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T90 13187-13192 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T91 13280-13284 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T92 13296-13299 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T93 13426-13430 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T94 13441-13444 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T95 13584-13587 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T96 13986-13990 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T97 14032-14037 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T98 14057-14060 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T99 14124-14127 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T100 14258-14262 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T101 14395-14400 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T102 14478-14483 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T103 14639-14643 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T104 14655-14658 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T105 14930-14935 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T106 15021-15026 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T107 15243-15248 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T108 15476-15481 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T109 15567-15572 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T110 15790-15795 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T111 15884-15889 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T112 16176-16180 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T113 16233-16241 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T114 16283-16287 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T115 16340-16344 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T116 16369-16373 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T117 16398-16403 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T118 16428-16436 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T119 16447-16452 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T120 16454-16458 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T121 16459-16463 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T122 16621-16629 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T123 16676-16681 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T124 16738-16746 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T125 16775-16778 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T126 16824-16829 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T127 16883-16888 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T128 17088-17092 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T129 17093-17097 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T130 17170-17178 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T131 17194-17202 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T132 17437-17441 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T133 17488-17496 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T134 17654-17659 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T135 17720-17725 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T136 17755-17760 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T137 17799-17804 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T138 17944-17951 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T139 17996-18000 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T140 18001-18005 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T141 18051-18055 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T142 18056-18060 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T143 18086-18094 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T144 18130-18138 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T145 18144-18152 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T146 18185-18188 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T147 18415-18420 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T148 18450-18453 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T149 18490-18494 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T150 18526-18534 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T151 18583-18588 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T152 18701-18708 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T153 18769-18776 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T154 18857-18861 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T155 18862-18866 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T156 19035-19042 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T157 19129-19134 Body_part denotes lipid http://purl.org/sig/ont/fma/fma67264
T158 19318-19325 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T159 19380-19388 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T160 19730-19735 Body_part denotes lipid http://purl.org/sig/ont/fma/fma67264
T161 20305-20310 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T162 21139-21146 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T163 21201-21205 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T164 21206-21210 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T165 21650-21653 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T166 21658-21665 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T167 21767-21770 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T168 21798-21803 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T169 21943-21946 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T170 22073-22077 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T171 22079-22082 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T172 22195-22198 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T173 22318-22321 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T174 22397-22404 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T175 22427-22430 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T176 22467-22470 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T177 22598-22601 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T178 22610-22613 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T179 22718-22722 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T180 22724-22727 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T181 23234-23239 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T182 23283-23287 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T183 23381-23386 Body_part denotes Actin http://purl.org/sig/ont/fma/fma67843
T184 23418-23425 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T185 23466-23473 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T186 23515-23520 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T187 23570-23575 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T188 23677-23682 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T189 23827-23835 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T190 23878-23883 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T191 23960-23965 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T192 24165-24173 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T193 24308-24315 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T194 24576-24579 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T195 24783-24793 Body_part denotes fatty acid http://purl.org/sig/ont/fma/fma82738
T196 24852-24859 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T197 24951-24959 Body_part denotes Tyrosine http://purl.org/sig/ont/fma/fma82768
T198 25190-25198 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T199 25328-25331 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T200 25336-25343 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T201 25438-25441 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T202 25446-25453 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T203 25516-25519 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T204 25524-25531 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T205 25589-25593 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T206 25627-25631 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T207 25664-25668 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T208 25756-25761 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T209 25785-25790 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T210 25812-25815 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T211 25820-25827 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T212 25988-25993 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T213 26183-26187 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T214 26262-26268 Body_part denotes kidney http://purl.org/sig/ont/fma/fma7203
T215 26297-26307 Body_part denotes astrocytes http://purl.org/sig/ont/fma/fma54537
T216 26378-26383 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T217 26527-26531 Body_part denotes lung http://purl.org/sig/ont/fma/fma7195
T218 26532-26543 Body_part denotes fibroblasts http://purl.org/sig/ont/fma/fma63877
T219 26549-26554 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T220 26592-26597 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T221 26791-26798 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T222 26838-26845 Body_part denotes neurons http://purl.org/sig/ont/fma/fma54527
T223 27063-27068 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T224 27209-27214 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T225 27259-27264 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T226 27280-27285 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T227 27418-27423 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T228 27489-27494 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T229 27774-27781 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T230 27791-27795 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T231 27796-27800 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T232 28056-28063 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T233 28772-28777 Body_part denotes lipid http://purl.org/sig/ont/fma/fma67264
T234 28985-28988 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T235 28993-29000 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T236 29271-29274 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T237 29516-29519 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T238 29530-29537 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T239 29665-29670 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T240 30090-30096 Body_part denotes genome http://purl.org/sig/ont/fma/fma84116
T241 30265-30270 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T242 30292-30297 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T243 30460-30465 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T244 30491-30496 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T245 30733-30738 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T246 30828-30837 Body_part denotes glutamine http://purl.org/sig/ont/fma/fma82752
T247 30945-30955 Body_part denotes Astrocytes http://purl.org/sig/ont/fma/fma54537
T248 30988-30997 Body_part denotes Astrocyte http://purl.org/sig/ont/fma/fma54537
T249 31148-31155 Body_part denotes insulin http://purl.org/sig/ont/fma/fma83365
T250 31172-31181 Body_part denotes glutamine http://purl.org/sig/ont/fma/fma82752
T251 31270-31274 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T252 31538-31545 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T253 31696-31701 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T254 32016-32025 Body_part denotes cellulose http://purl.org/sig/ont/fma/fma82748
T255 32112-32117 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T256 32236-32241 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T257 32413-32421 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T258 32467-32475 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T259 32560-32563 Body_part denotes IgG http://purl.org/sig/ont/fma/fma62872
T260 33105-33110 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T261 33214-33219 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T262 33434-33446 Body_part denotes g of protein http://purl.org/sig/ont/fma/fma61788
T263 33439-33446 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T264 33493-33501 Body_part denotes Proteins http://purl.org/sig/ont/fma/fma67257
T265 33725-33733 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T266 33808-33816 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T267 33883-33891 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T268 33955-33963 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T269 33969-33974 Body_part denotes actin http://purl.org/sig/ont/fma/fma67843
T270 34074-34082 Body_part denotes antibody http://purl.org/sig/ont/fma/fma62871
T271 34155-34162 Body_part denotes Protein http://purl.org/sig/ont/fma/fma67257
T272 34408-34413 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T273 34501-34505 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T274 34775-34780 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T275 34986-34990 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T276 35065-35070 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T277 35136-35140 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T278 35158-35163 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T279 35245-35250 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T280 35300-35305 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T281 35479-35483 Body_part denotes milk http://purl.org/sig/ont/fma/fma62100
T282 35499-35504 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T283 35610-35615 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T284 35656-35660 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T285 36057-36062 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T286 36147-36152 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T287 36285-36290 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T288 36384-36389 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T289 36561-36566 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T290 36654-36659 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T291 36697-36702 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T292 36741-36746 Body_part denotes serum http://purl.org/sig/ont/fma/fma63083
T293 36945-36950 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T294 37220-37224 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T295 37360-37365 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T296 37443-37448 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T297 37604-37608 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T298 37620-37623 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T299 37910-37914 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T300 37999-38003 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T301 38057-38062 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T302 38099-38102 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T303 38147-38150 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T304 38280-38283 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T305 38410-38413 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T306 38565-38569 Body_part denotes Gene http://purl.org/sig/ont/fma/fma74402
T307 39023-39026 Body_part denotes RNA http://purl.org/sig/ont/fma/fma67095
T308 39221-39224 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T309 39751-39756 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T310 39938-39943 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T311 40011-40016 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T312 40455-40460 Body_part denotes Cells http://purl.org/sig/ont/fma/fma68646
T313 41145-41148 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T314 41261-41264 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T315 41316-41321 Body_part denotes Blood http://purl.org/sig/ont/fma/fma9670
T316 41360-41363 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T317 41432-41435 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412
T318 41589-41594 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T319 41680-41685 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T320 41935-41939 Body_part denotes Cell http://purl.org/sig/ont/fma/fma68646
T321 41940-41944 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T322 41990-41994 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T323 41995-41999 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T324 42024-42027 Body_part denotes HIV http://purl.org/sig/ont/fma/fma278683
T325 42085-42093 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T326 42169-42183 Body_part denotes Nucleated cell http://purl.org/sig/ont/fma/fma67513
T327 42179-42183 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T328 42184-42188 Body_part denotes cell http://purl.org/sig/ont/fma/fma68646
T329 42279-42284 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T330 42307-42314 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T331 42381-42386 Body_part denotes cells http://purl.org/sig/ont/fma/fma68646
T332 42459-42466 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T333 42629-42636 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T334 42753-42761 Body_part denotes proteins http://purl.org/sig/ont/fma/fma67257
T335 43317-43320 Body_part denotes DNA http://purl.org/sig/ont/fma/fma74412

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T1 4914-4919 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T2 5170-5175 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T3 5472-5477 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T4 9276-9281 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T5 11039-11044 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T6 12118-12123 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T7 26262-26268 Body_part denotes kidney http://purl.obolibrary.org/obo/UBERON_0002113
T8 26527-26531 Body_part denotes lung http://purl.obolibrary.org/obo/UBERON_0002048
T9 27418-27423 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T10 27489-27494 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T11 30460-30465 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T12 35479-35483 Body_part denotes milk http://purl.obolibrary.org/obo/UBERON_0001913
T13 35533-35537 Body_part denotes tube http://purl.obolibrary.org/obo/UBERON_0000025
T14 36147-36152 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T15 36741-36746 Body_part denotes serum http://purl.obolibrary.org/obo/UBERON_0001977
T16 41316-41321 Body_part denotes Blood http://purl.obolibrary.org/obo/UBERON_0000178

LitCovid_AGAC

Id Subject Object Predicate Lexical cue
p19157s17 262-271 NegReg denotes decreased
p19157s18 272-282 MPA denotes expression
p19178s17 2679-2688 NegReg denotes decreased
p19178s18 2689-2699 MPA denotes expression
p19431s18 25664-25681 CPA denotes cell cycle arrest

LitCovid-PD-MONDO

Id Subject Object Predicate Lexical cue mondo_id
T1 364-371 Disease denotes amyloid http://purl.obolibrary.org/obo/MONDO_0019065
T2 782-796 Disease denotes Herpes simplex http://purl.obolibrary.org/obo/MONDO_0004609
T3 969-973 Disease denotes Zika http://purl.obolibrary.org/obo/MONDO_0018661
T4 987-996 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T5 1138-1143 Disease denotes Ebola http://purl.obolibrary.org/obo/MONDO_0005737
T6 1158-1167 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T7 1450-1459 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T8 1582-1597 Disease denotes viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T9 1588-1597 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T10 1614-1623 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T11 1674-1684 Disease denotes infections http://purl.obolibrary.org/obo/MONDO_0005550
T12 1724-1731 Disease denotes measles http://purl.obolibrary.org/obo/MONDO_0004619
T13 1823-1832 Disease denotes varicella http://purl.obolibrary.org/obo/MONDO_0005700
T14 1833-1839 Disease denotes zoster http://purl.obolibrary.org/obo/MONDO_0005609
T15 2777-2784 Disease denotes amyloid http://purl.obolibrary.org/obo/MONDO_0019065
T16 3309-3323 Disease denotes Herpes simplex http://purl.obolibrary.org/obo/MONDO_0004609
T17 3375-3379 Disease denotes Zika http://purl.obolibrary.org/obo/MONDO_0018661
T18 3796-3809 Disease denotes viral disease http://purl.obolibrary.org/obo/MONDO_0005108
T19 4045-4054 Disease denotes influenza http://purl.obolibrary.org/obo/MONDO_0005812
T20 4081-4111 Disease denotes Venezuelan equine encephalitis http://purl.obolibrary.org/obo/MONDO_0006005
T21 4099-4111 Disease denotes encephalitis http://purl.obolibrary.org/obo/MONDO_0019956
T22 4173-4193 Disease denotes vesicular stomatitis http://purl.obolibrary.org/obo/MONDO_0025028
T23 4183-4193 Disease denotes stomatitis http://purl.obolibrary.org/obo/MONDO_0004842
T24 4417-4426 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T25 5912-5927 Disease denotes Viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T26 5918-5927 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T27 6196-6205 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T28 6333-6342 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T29 6396-6405 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T30 6473-6482 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T31 6546-6560 Disease denotes HCMV infection http://purl.obolibrary.org/obo/MONDO_0005132
T32 6551-6560 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T33 6627-6641 Disease denotes HCMV infection http://purl.obolibrary.org/obo/MONDO_0005132
T34 6632-6641 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T35 7063-7078 Disease denotes Viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T36 7069-7078 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T37 7178-7187 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T38 7904-7914 Disease denotes infections http://purl.obolibrary.org/obo/MONDO_0005550
T39 8013-8022 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T40 8670-8684 Disease denotes HCMV infection http://purl.obolibrary.org/obo/MONDO_0005132
T41 8675-8684 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T42 8846-8855 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T43 9562-9577 Disease denotes viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T44 9568-9577 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T45 10916-10925 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T46 12010-12019 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T47 12762-12766 Disease denotes Zika http://purl.obolibrary.org/obo/MONDO_0018661
T48 13626-13635 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T49 13928-13931 Disease denotes AGM http://purl.obolibrary.org/obo/MONDO_0011096
T50 13949-13958 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T51 15675-15684 Disease denotes Infection http://purl.obolibrary.org/obo/MONDO_0005550
T52 16855-16857 Disease denotes AM http://purl.obolibrary.org/obo/MONDO_0020320
T53 18176-18180 Disease denotes Zika http://purl.obolibrary.org/obo/MONDO_0018661
T54 18200-18205 Disease denotes Ebola http://purl.obolibrary.org/obo/MONDO_0005737
T55 18216-18225 Disease denotes Influenza http://purl.obolibrary.org/obo/MONDO_0005812
T56 18285-18315 Disease denotes Venezuelan Equine Encephalitis http://purl.obolibrary.org/obo/MONDO_0006005
T57 18346-18366 Disease denotes Vesicular Stomatitis http://purl.obolibrary.org/obo/MONDO_0025028
T58 18356-18366 Disease denotes Stomatitis http://purl.obolibrary.org/obo/MONDO_0004842
T59 23850-23859 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T60 24111-24121 Disease denotes infections http://purl.obolibrary.org/obo/MONDO_0005550
T61 24552-24574 Disease denotes cardiovascular disease http://purl.obolibrary.org/obo/MONDO_0004995
T62 24576-24589 Disease denotes HIV infection http://purl.obolibrary.org/obo/MONDO_0005109
T63 24580-24589 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T64 24591-24611 Disease denotes bacterial infections http://purl.obolibrary.org/obo/MONDO_0005113
T65 25749-25755 Disease denotes cancer http://purl.obolibrary.org/obo/MONDO_0004992
T66 25921-25931 Disease denotes infectious http://purl.obolibrary.org/obo/MONDO_0005550
T67 26217-26237 Disease denotes epithelial carcinoma http://purl.obolibrary.org/obo/MONDO_0004993
T68 27011-27019 Disease denotes allergic http://purl.obolibrary.org/obo/MONDO_0004980
T69 27032-27048 Disease denotes Viral infections http://purl.obolibrary.org/obo/MONDO_0005108
T70 29634-29650 Disease denotes viral infections http://purl.obolibrary.org/obo/MONDO_0005108
T71 29716-29732 Disease denotes viral infections http://purl.obolibrary.org/obo/MONDO_0005108
T72 29752-29760 Disease denotes COVID-19 http://purl.obolibrary.org/obo/MONDO_0100096
T73 29783-29790 Disease denotes measles http://purl.obolibrary.org/obo/MONDO_0004619
T74 29988-30003 Disease denotes virus infection http://purl.obolibrary.org/obo/MONDO_0005108
T75 29994-30003 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T76 31013-31016 Disease denotes AGM http://purl.obolibrary.org/obo/MONDO_0011096
T77 31727-31736 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T78 31848-31857 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T79 32053-32063 Disease denotes infections http://purl.obolibrary.org/obo/MONDO_0005550
T80 32316-32318 Disease denotes BD http://purl.obolibrary.org/obo/MONDO_0007191
T81 32686-32688 Disease denotes BD http://purl.obolibrary.org/obo/MONDO_0007191
T82 33765-33771 Disease denotes Cancer http://purl.obolibrary.org/obo/MONDO_0004992
T83 34958-34967 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T84 35471-35478 Disease denotes sterile http://purl.obolibrary.org/obo/MONDO_0005047
T85 35880-35887 Disease denotes sterile http://purl.obolibrary.org/obo/MONDO_0005047
T86 37859-37862 Disease denotes AGM http://purl.obolibrary.org/obo/MONDO_0011096
T87 40371-40386 Disease denotes Viral infection http://purl.obolibrary.org/obo/MONDO_0005108
T88 40377-40386 Disease denotes infection http://purl.obolibrary.org/obo/MONDO_0005550
T89 41534-41543 Disease denotes Infection http://purl.obolibrary.org/obo/MONDO_0005550
T90 41882-41891 Disease denotes Infection http://purl.obolibrary.org/obo/MONDO_0005550
T91 42035-42038 Disease denotes IVA http://purl.obolibrary.org/obo/MONDO_0009475
T92 42251-42253 Disease denotes AM http://purl.obolibrary.org/obo/MONDO_0020320

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T1 44-51 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T2 158-161 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T3 328-338 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T4 375-376 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T5 437-445 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T6 526-534 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T7 616-618 http://purl.obolibrary.org/obo/CLO_0002857 denotes E1
T8 707-717 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T9 797-802 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T10 917-922 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T11 974-979 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T12 1007-1012 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T13 1013-1023 http://purl.obolibrary.org/obo/CL_0000127 denotes astrocytes
T14 1039-1040 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T15 1144-1149 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T16 1168-1169 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T17 1170-1175 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T18 1199-1204 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T19 1247-1248 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T20 1469-1470 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T21 1785-1791 http://purl.obolibrary.org/obo/CLO_0001658 denotes active
T22 1840-1845 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T23 2147-2148 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T24 2150-2151 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T25 2269-2270 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T26 2553-2558 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T27 2566-2568 http://purl.obolibrary.org/obo/CLO_0050050 denotes S1
T28 2575-2578 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T29 2745-2755 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T30 2788-2789 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T31 2852-2860 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T32 2927-2935 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T33 3076-3084 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T34 3112-3114 http://purl.obolibrary.org/obo/CLO_0002857 denotes E1
T35 3208-3218 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T36 3292-3300 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T37 3324-3329 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T38 3341-3346 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes Human
T39 3380-3385 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T40 3480-3481 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T41 3638-3646 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T42 3878-3879 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T43 3986-3991 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T44 4002-4009 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T45 4055-4056 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T46 4057-4062 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T47 4092-4098 http://purl.obolibrary.org/obo/NCBITaxon_9796 denotes equine
T48 4112-4117 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T49 4144-4149 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T50 4194-4199 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T51 4223-4228 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T52 4447-4452 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T53 4485-4490 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T54 4715-4721 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T55 4738-4743 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T56 4861-4866 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T57 4861-4866 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T58 4867-4872 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T59 4988-4993 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T60 5023-5028 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T61 5196-5198 http://purl.obolibrary.org/obo/CLO_0053794 denotes 41
T62 5240-5243 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T63 5244-5249 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T64 5425-5433 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T65 5564-5569 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T66 5587-5588 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T67 5643-5644 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T68 5660-5665 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T69 5666-5686 http://purl.obolibrary.org/obo/CL_1001608 denotes foreskin fibroblasts
T70 5688-5691 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T71 5721-5726 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T72 5752-5756 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T73 5813-5814 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T74 6151-6152 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T75 6213-6217 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T76 6223-6228 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T77 6244-6247 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T78 6319-6322 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T79 6323-6327 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T80 6392-6395 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T81 6445-6450 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T82 6454-6458 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T83 6469-6472 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T84 6485-6486 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T85 6525-6531 http://purl.obolibrary.org/obo/UBERON_0007688 denotes fields
T86 6564-6569 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T87 6570-6590 http://purl.obolibrary.org/obo/CL_1001608 denotes foreskin fibroblasts
T88 6592-6595 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T89 6705-6710 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T90 6711-6731 http://purl.obolibrary.org/obo/CL_1001608 denotes foreskin fibroblasts
T91 6733-6736 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T92 6799-6803 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T93 6877-6882 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T94 6906-6911 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T95 6975-6980 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T96 7346-7349 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T97 7373-7377 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T98 7392-7395 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T99 7522-7525 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T100 7763-7768 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T101 7813-7817 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T102 7821-7825 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T103 7826-7831 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T104 7942-7943 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T105 8035-8036 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T106 8221-8226 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T107 8287-8292 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T108 8336-8340 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T109 8344-8348 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T110 8403-8406 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T111 8494-8499 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T112 8510-8513 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T113 8556-8560 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T114 8561-8565 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T115 8588-8594 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T116 8598-8603 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T117 8640-8641 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T118 8781-8787 http://purl.obolibrary.org/obo/CLO_0001658 denotes active
T119 8859-8865 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T120 8879-8880 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T121 8915-8920 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T122 8942-8947 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T123 8954-8957 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T124 9036-9040 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T125 9097-9101 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T126 9133-9138 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T127 9169-9174 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T128 9169-9174 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T129 9179-9183 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T130 9179-9183 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T131 9179-9183 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T132 9184-9189 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T133 9335-9339 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2
T134 9335-9339 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp2
T135 9343-9347 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T136 9343-9347 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T137 9343-9347 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T138 9348-9353 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T139 9391-9392 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T140 9430-9431 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T141 9445-9450 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T142 9542-9546 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T143 9581-9585 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2
T144 9581-9585 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp2
T145 9590-9594 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T146 9590-9594 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T147 9590-9594 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T148 9595-9600 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T149 9721-9723 http://purl.obolibrary.org/obo/CLO_0001236 denotes 2A
T150 9724-9725 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T151 9913-9914 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T152 10018-10022 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T153 10062-10071 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2 cell
T154 10115-10118 http://purl.obolibrary.org/obo/CLO_0001602 denotes a 6
T155 10115-10118 http://purl.obolibrary.org/obo/CLO_0001603 denotes a 6
T156 10115-10118 http://purl.obolibrary.org/obo/CLO_0050248 denotes a 6
T157 10115-10118 http://purl.obolibrary.org/obo/CLO_0052463 denotes a 6
T158 10589-10593 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T159 10663-10666 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T160 10693-10697 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T161 10693-10697 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T162 10698-10703 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T163 10812-10813 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T164 10876-10880 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T165 10928-10929 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T166 11084-11088 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2
T167 11084-11088 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp2
T168 11092-11096 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T169 11092-11096 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T170 11092-11096 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T171 11097-11102 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T172 11193-11198 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T173 11193-11198 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T174 11200-11201 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T175 11206-11210 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T176 11206-11210 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T177 11206-11210 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T178 11212-11213 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T179 11279-11284 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T180 11304-11305 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T181 11328-11332 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T182 11446-11455 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2 cell
T183 11578-11582 http://purl.obolibrary.org/obo/CLO_0001382 denotes 4, 8
T184 11621-11626 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T185 11646-11647 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T186 11670-11674 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T187 11879-11883 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T188 11879-11883 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T189 11884-11889 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T190 11955-11958 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T191 11980-11984 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T192 12057-12061 http://purl.obolibrary.org/obo/CLO_0001568 denotes a 24
T193 12269-12274 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T194 12297-12301 http://purl.obolibrary.org/obo/CLO_0002131 denotes C, 5
T195 12356-12360 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T196 12407-12412 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T197 12626-12631 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T198 12719-12720 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T199 12792-12796 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T200 12930-12937 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T201 12994-12998 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T202 13023-13027 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T203 13182-13186 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T204 13182-13186 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T205 13187-13192 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T206 13250-13252 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T207 13280-13284 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T208 13426-13430 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T209 13505-13506 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T210 13638-13639 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T211 13933-13938 http://purl.obolibrary.org/obo/PR_000001438 denotes (B) 7
T212 13986-13990 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T213 14032-14037 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T214 14225-14229 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T215 14258-14262 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T216 14390-14394 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T217 14390-14394 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T218 14395-14400 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T219 14478-14483 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T220 14609-14611 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T221 14639-14643 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T222 14742-14743 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T223 14813-14818 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T224 14828-14834 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T225 14849-14857 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T226 14925-14929 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T227 14925-14929 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T228 14930-14935 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T229 15021-15026 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T230 15053-15054 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T231 15077-15082 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T232 15106-15108 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T233 15121-15124 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T234 15129-15132 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T235 15137-15140 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T236 15147-15152 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T237 15174-15175 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T238 15238-15242 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T239 15238-15242 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T240 15243-15248 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T241 15435-15440 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T242 15454-15455 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T243 15471-15475 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T244 15471-15475 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T245 15476-15481 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T246 15567-15572 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T247 15592-15595 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T248 15602-15607 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T249 15768-15769 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T250 15785-15789 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T251 15785-15789 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T252 15790-15795 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T253 15884-15889 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T254 15911-15912 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T255 15935-15940 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T256 15964-15966 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T257 15979-15982 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T258 15987-15990 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T259 16012-16013 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T260 16176-16180 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T261 16277-16282 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T262 16283-16287 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T263 16310-16318 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T264 16334-16339 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T265 16340-16344 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T266 16363-16368 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T267 16369-16373 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T268 16398-16403 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T269 16447-16452 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T270 16454-16458 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T271 16459-16463 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T272 16608-16613 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T273 16671-16681 http://purl.obolibrary.org/obo/CLO_0051656 denotes COS7 cells
T274 16671-16681 http://purl.obolibrary.org/obo/CLO_0051657 denotes COS7 cells
T275 16671-16681 http://purl.obolibrary.org/obo/CLO_0051658 denotes COS7 cells
T276 16671-16675 http://purl.obolibrary.org/obo/CLO_0002597 denotes COS7
T277 16671-16675 http://purl.obolibrary.org/obo/CLO_0050508 denotes COS7
T278 16754-16756 http://purl.obolibrary.org/obo/CLO_0008922 denotes S2
T279 16754-16756 http://purl.obolibrary.org/obo/CLO_0050052 denotes S2
T280 16819-16829 http://purl.obolibrary.org/obo/CLO_0051656 denotes COS7 cells
T281 16819-16829 http://purl.obolibrary.org/obo/CLO_0051657 denotes COS7 cells
T282 16819-16829 http://purl.obolibrary.org/obo/CLO_0051658 denotes COS7 cells
T283 16819-16823 http://purl.obolibrary.org/obo/CLO_0002597 denotes COS7
T284 16819-16823 http://purl.obolibrary.org/obo/CLO_0050508 denotes COS7
T285 16871-16875 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T286 16871-16875 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T287 16871-16875 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T288 16883-16888 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T289 17054-17060 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T290 17088-17092 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T291 17093-17097 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T292 17344-17349 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T293 17437-17441 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T294 17499-17500 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T295 17654-17659 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T296 17720-17725 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T297 17755-17760 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T298 17799-17804 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T299 17996-18000 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T300 18001-18005 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T301 18038-18039 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T302 18051-18055 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T303 18056-18060 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T304 18265-18270 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T305 18272-18274 http://purl.obolibrary.org/obo/CLO_0002857 denotes E1
T306 18275-18277 http://purl.obolibrary.org/obo/CLO_0002860 denotes E2
T307 18296-18302 http://purl.obolibrary.org/obo/NCBITaxon_9796 denotes Equine
T308 18316-18321 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T309 18367-18372 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T310 18395-18400 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T311 18415-18420 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T312 18488-18489 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T313 18490-18499 http://purl.obolibrary.org/obo/CLO_0000031 denotes cell line
T314 18583-18588 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T315 18666-18673 http://purl.obolibrary.org/obo/CLO_0007225 denotes labeled
T316 18857-18861 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T317 18862-18866 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T318 18979-18980 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T319 19157-19166 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membranes
T320 19333-19342 http://www.ebi.ac.uk/efo/EFO_0000876 denotes extremely
T321 19752-19755 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T322 19756-19757 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T323 19779-19787 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membrane
T324 20033-20041 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membrane
T325 20122-20123 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T326 20305-20310 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T327 20420-20421 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T328 20755-20756 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T329 20835-20844 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membranes
T330 21180-21181 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T331 21201-21205 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T332 21206-21210 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T333 21606-21613 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T334 21713-21719 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T335 21798-21803 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T336 21826-21829 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T337 21984-21987 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T338 22073-22077 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T339 22106-22107 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T340 22273-22278 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T341 22443-22444 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T342 22651-22654 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T343 22718-22722 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T344 22751-22752 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T345 22872-22876 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T346 23013-23018 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T347 23013-23018 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T348 23020-23021 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T349 23026-23030 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T350 23026-23030 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T351 23026-23030 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T352 23196-23201 http://purl.obolibrary.org/obo/CLO_0001405 denotes 5, 11
T353 23234-23239 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T354 23259-23260 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T355 23283-23287 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T356 23515-23520 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T357 23555-23560 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T358 23555-23560 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T359 23565-23569 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T360 23565-23569 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T361 23565-23569 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T362 23570-23575 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T363 23677-23682 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T364 23863-23868 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T365 23863-23868 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T366 23873-23877 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T367 23873-23877 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T368 23873-23877 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T369 23878-23883 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T370 23945-23950 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T371 23945-23950 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T372 23955-23959 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T373 23955-23959 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T374 23955-23959 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T375 23960-23965 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T376 23980-23985 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T377 24194-24195 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T378 24259-24260 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T379 24376-24381 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T380 24455-24463 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T381 24470-24473 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T382 24693-24696 http://purl.obolibrary.org/obo/CLO_0051582 denotes has
T383 24838-24848 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T384 24904-24914 http://purl.obolibrary.org/obo/CLO_0001658 denotes activation
T385 24998-24999 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T386 25141-25148 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T387 25221-25222 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T388 25237-25242 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T389 25270-25271 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T390 25589-25593 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T391 25608-25616 http://purl.obolibrary.org/obo/CLO_0001658 denotes activate
T392 25627-25631 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T393 25632-25641 http://purl.obolibrary.org/obo/SO_0000418 denotes signaling
T394 25664-25668 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T395 25756-25761 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T396 25785-25790 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T397 25932-25939 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T398 25988-25993 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T399 26088-26089 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T400 26165-26171 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T401 26183-26193 http://purl.obolibrary.org/obo/CL_0000000 denotes cell types
T402 26204-26209 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp-2
T403 26204-26209 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp-2
T404 26211-26216 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T405 26217-26227 http://purl.obolibrary.org/obo/CL_0000066 denotes epithelial
T406 26240-26244 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T407 26240-26244 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T408 26240-26244 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T409 26246-26251 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T410 26252-26268 http://www.ebi.ac.uk/efo/EFO_0000927 denotes embryonic kidney
T411 26271-26274 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T412 26291-26296 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T413 26297-26307 http://purl.obolibrary.org/obo/CL_0000127 denotes astrocytes
T414 26331-26332 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T415 26371-26377 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T416 26378-26383 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T417 26416-26422 http://purl.obolibrary.org/obo/CLO_0001658 denotes active
T418 26506-26510 http://purl.obolibrary.org/obo/UBERON_0003101 denotes male
T419 26506-26510 http://www.ebi.ac.uk/efo/EFO_0000970 denotes male
T420 26519-26526 http://purl.obolibrary.org/obo/NCBITaxon_10026 denotes hamster
T421 26527-26531 http://purl.obolibrary.org/obo/UBERON_0002048 denotes lung
T422 26527-26531 http://www.ebi.ac.uk/efo/EFO_0000934 denotes lung
T423 26532-26543 http://purl.obolibrary.org/obo/CL_0000057 denotes fibroblasts
T424 26545-26554 http://purl.obolibrary.org/obo/CLO_0052476 denotes V79 cells
T425 26592-26597 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T426 26781-26790 http://purl.obolibrary.org/obo/CLO_0001658 denotes activated
T427 26934-26945 http://purl.obolibrary.org/obo/NCBITaxon_10141 denotes guinea pigs
T428 27063-27068 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T429 27163-27169 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T430 27174-27182 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T431 27209-27214 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T432 27259-27264 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T433 27280-27285 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T434 27335-27337 http://purl.obolibrary.org/obo/CLO_0050050 denotes S1
T435 27371-27379 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T436 27531-27539 http://purl.obolibrary.org/obo/CLO_0001658 denotes activity
T437 27641-27647 http://purl.obolibrary.org/obo/NCBITaxon_33208 denotes animal
T438 27791-27795 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T439 27796-27800 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T440 27851-27852 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T441 27906-27914 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membrane
T442 28328-28329 http://purl.obolibrary.org/obo/CLO_0001020 denotes A
T443 28852-28853 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T444 28868-28873 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T445 29103-29110 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T446 29141-29142 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T447 29195-29196 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T448 29218-29225 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T449 29341-29342 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T450 29357-29362 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T451 29390-29391 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T452 29443-29450 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T453 29551-29552 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T454 29665-29670 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T455 29888-29894 http://purl.obolibrary.org/obo/CLO_0001658 denotes active
T456 29988-29993 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T457 30084-30089 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T458 30189-30190 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T459 30246-30253 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T460 30265-30270 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T461 30272-30279 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T462 30287-30291 http://purl.obolibrary.org/obo/CLO_0003707 denotes HEp2
T463 30287-30291 http://purl.obolibrary.org/obo/CLO_0050927 denotes HEp2
T464 30292-30297 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T465 30367-30369 http://purl.obolibrary.org/obo/CLO_0007622 denotes MD
T466 30485-30489 http://purl.obolibrary.org/obo/CLO_0050894 denotes 293T
T467 30485-30489 http://purl.obolibrary.org/obo/CLO_0051650 denotes 293T
T468 30485-30489 http://purl.obolibrary.org/obo/CLO_0052052 denotes 293T
T469 30491-30496 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T470 30582-30583 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T471 30660-30663 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T472 30687-30688 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T473 30728-30732 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T474 30728-30732 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T475 30733-30738 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T476 30939-30944 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes Human
T477 30945-30955 http://purl.obolibrary.org/obo/CL_0000127 denotes Astrocytes
T478 30988-30997 http://purl.obolibrary.org/obo/CL_0000127 denotes Astrocyte
T479 31135-31136 http://purl.obolibrary.org/obo/CLO_0001021 denotes B
T480 31148-31155 http://purl.obolibrary.org/obo/PR_000009054 denotes insulin
T481 31270-31274 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T482 31573-31578 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T483 31691-31695 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T484 31691-31695 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T485 31696-31701 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T486 31737-31741 http://purl.obolibrary.org/obo/CLO_0001757 denotes at 1
T487 31990-31991 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T488 32034-32042 http://purl.obolibrary.org/obo/UBERON_0000158 denotes membrane
T489 32107-32111 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T490 32107-32111 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T491 32112-32117 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T492 32165-32170 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T493 32179-32184 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes Virus
T494 32200-32205 http://purl.obolibrary.org/obo/CLO_0009985 denotes focus
T495 32231-32235 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T496 32231-32235 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T497 32236-32241 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T498 32394-32395 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T499 32396-32401 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T500 32505-32516 http://purl.obolibrary.org/obo/CLO_0002662 denotes D1–4G2-4-15
T501 32554-32559 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T502 32749-32754 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes Human
T503 32777-32779 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T504 32854-32859 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T505 32896-32898 http://purl.obolibrary.org/obo/CLO_0009141 denotes St
T506 32896-32898 http://purl.obolibrary.org/obo/CLO_0050980 denotes St
T507 32907-32909 http://purl.obolibrary.org/obo/CLO_0007815 denotes MO
T508 32949-32950 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T509 33105-33110 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T510 33211-33219 http://purl.obolibrary.org/obo/CLO_0001757 denotes 1, cells
T511 33708-33713 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T512 33791-33796 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T513 33839-33840 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T514 33866-33871 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T515 33913-33914 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T516 33938-33943 http://purl.obolibrary.org/obo/CLO_0007836 denotes mouse
T517 33995-33996 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T518 34015-34024 http://purl.obolibrary.org/obo/UBERON_0000158 denotes Membranes
T519 34104-34124 http://purl.obolibrary.org/obo/PR_000023540 denotes alkaline phosphatase
T520 34402-34407 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T521 34408-34413 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T522 34429-34431 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T523 34501-34505 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T524 34625-34630 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T525 34667-34668 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T526 34770-34774 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T527 34770-34774 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T528 34775-34780 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T529 34940-34941 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T530 34986-34990 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T531 35065-35070 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T532 35085-35090 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T533 35136-35140 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T534 35153-35157 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T535 35153-35157 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T536 35158-35163 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T537 35245-35250 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T538 35300-35305 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T539 35499-35504 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T540 35525-35529 http://purl.obolibrary.org/obo/CLO_0001557 denotes a 15
T541 35533-35537 http://purl.obolibrary.org/obo/UBERON_0000025 denotes tube
T542 35563-35568 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T543 35605-35609 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T544 35605-35609 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T545 35610-35615 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T546 35656-35660 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T547 35737-35738 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T548 35835-35840 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T549 36052-36056 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T550 36052-36056 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T551 36057-36062 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T552 36285-36290 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T553 36324-36327 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T554 36384-36389 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T555 36556-36560 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T556 36556-36560 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T557 36561-36566 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T558 36594-36595 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T559 36624-36629 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T560 36654-36659 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T561 36697-36702 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T562 36735-36740 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T563 36945-36950 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T564 37220-37224 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T565 37355-37359 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T566 37355-37359 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T567 37360-37365 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T568 37443-37448 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T569 37574-37576 http://purl.obolibrary.org/obo/CLO_0001382 denotes 48
T570 37604-37608 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T571 37910-37914 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T572 37999-38003 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T573 38057-38062 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T574 38142-38144 http://purl.obolibrary.org/obo/CLO_0007622 denotes MD
T575 38172-38173 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T576 38524-38528 http://purl.obolibrary.org/obo/CLO_0001564 denotes a 20
T577 38524-38528 http://purl.obolibrary.org/obo/CLO_0050194 denotes a 20
T578 38565-38569 http://purl.obolibrary.org/obo/OGG_0000000002 denotes Gene
T579 38857-38859 http://purl.obolibrary.org/obo/CLO_0053799 denotes 45
T580 39364-39369 http://purl.obolibrary.org/obo/CLO_0001417 denotes 5′/56
T581 39419-39424 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T582 39516-39521 http://purl.obolibrary.org/obo/CLO_0001417 denotes 5′/56
T583 39579-39582 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T584 39751-39756 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T585 39849-39854 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T586 39938-39943 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T587 39970-39973 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T588 40011-40016 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T589 40042-40045 http://purl.obolibrary.org/obo/CLO_0052986 denotes HFF
T590 40234-40239 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T591 40302-40305 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T592 40364-40369 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T593 40455-40460 http://purl.obolibrary.org/obo/GO_0005623 denotes Cells
T594 40697-40698 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T595 40910-40911 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T596 41316-41321 http://purl.obolibrary.org/obo/UBERON_0000178 denotes Blood
T597 41316-41321 http://www.ebi.ac.uk/efo/EFO_0000296 denotes Blood
T598 41386-41387 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T599 41547-41550 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T600 41562-41569 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses
T601 41584-41588 http://purl.obolibrary.org/obo/CLO_0009524 denotes Vero
T602 41584-41588 http://purl.obolibrary.org/obo/CLO_0050515 denotes Vero
T603 41589-41594 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T604 41680-41685 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T605 41712-41713 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T606 41736-41741 http://purl.obolibrary.org/obo/NCBITaxon_9606 denotes human
T607 41765-41767 http://purl.obolibrary.org/obo/CLO_0002861 denotes E3
T608 41780-41783 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T609 41788-41791 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T610 41796-41799 http://purl.obolibrary.org/obo/CLO_0053478 denotes GFP
T611 41806-41811 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes virus
T612 41833-41834 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T613 41935-41939 http://purl.obolibrary.org/obo/GO_0005623 denotes Cell
T614 41940-41944 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T615 41990-41994 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T616 41995-41999 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T617 42145-42147 http://purl.obolibrary.org/obo/CLO_0008922 denotes S2
T618 42145-42147 http://purl.obolibrary.org/obo/CLO_0050052 denotes S2
T619 42179-42183 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T620 42184-42188 http://purl.obolibrary.org/obo/GO_0005623 denotes cell
T621 42279-42284 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T622 42381-42386 http://purl.obolibrary.org/obo/GO_0005623 denotes cells
T623 42529-42531 http://purl.obolibrary.org/obo/CLO_0002857 denotes E1
T624 42532-42534 http://purl.obolibrary.org/obo/CLO_0002860 denotes E2
T625 42739-42745 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tested
T626 42832-42837 http://purl.obolibrary.org/obo/CLO_0002099 denotes C17:1
T627 43189-43194 http://purl.obolibrary.org/obo/UBERON_0000473 denotes tests
T628 43231-43232 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T629 43430-43431 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T630 43436-43442 http://purl.obolibrary.org/obo/UBERON_0002415 denotes tailed
T631 43445-43449 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T632 43593-43599 http://purl.obolibrary.org/obo/UBERON_0002415 denotes tailed
T633 43612-43616 http://purl.obolibrary.org/obo/UBERON_0000473 denotes test
T634 43719-43720 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T635 43749-43750 http://purl.obolibrary.org/obo/CLO_0001020 denotes a

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T1 0-14 Chemical denotes Ginkgolic acid http://purl.obolibrary.org/obo/CHEBI_5354
T2 10-14 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T3 72-77 Chemical denotes acids http://purl.obolibrary.org/obo/CHEBI_37527
T4 79-81 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T7 155-157 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T10 306-314 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T11 408-410 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T14 652-662 Chemical denotes fatty acid http://purl.obolibrary.org/obo/CHEBI_35366
T15 658-662 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T16 721-728 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T17 770-772 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T20 857-864 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T21 905-907 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T24 1080-1082 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T27 1114-1122 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T28 1304-1306 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T31 1426-1428 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T34 1510-1517 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T35 1522-1525 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T36 1576-1578 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T39 1878-1883 Chemical denotes acids http://purl.obolibrary.org/obo/CHEBI_37527
T40 2136-2146 Chemical denotes ginkgolide http://purl.obolibrary.org/obo/CHEBI_136909
T41 2163-2173 Chemical denotes bilobalide http://purl.obolibrary.org/obo/CHEBI_3103
T42 2176-2185 Chemical denotes flavonoid http://purl.obolibrary.org/obo/CHEBI_47916|http://purl.obolibrary.org/obo/CHEBI_72544
T44 2186-2196 Chemical denotes glycosides http://purl.obolibrary.org/obo/CHEBI_24400
T45 2198-2207 Chemical denotes quercetin http://purl.obolibrary.org/obo/CHEBI_16243|http://purl.obolibrary.org/obo/CHEBI_57694
T47 2212-2217 Chemical denotes rutin http://purl.obolibrary.org/obo/CHEBI_28527
T48 2259-2264 Chemical denotes acids http://purl.obolibrary.org/obo/CHEBI_37527
T49 2271-2278 Chemical denotes mixture http://purl.obolibrary.org/obo/CHEBI_60004
T50 2292-2299 Chemical denotes hydroxy http://purl.obolibrary.org/obo/CHEBI_43176
T51 2315-2320 Chemical denotes acids http://purl.obolibrary.org/obo/CHEBI_37527
T52 2404-2410 Chemical denotes carbon http://purl.obolibrary.org/obo/CHEBI_27594|http://purl.obolibrary.org/obo/CHEBI_33415
T54 2477-2491 Chemical denotes Ginkgolic acid http://purl.obolibrary.org/obo/CHEBI_5354
T55 2487-2491 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T56 2493-2495 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T59 2535-2540 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T60 2542-2547 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T61 2542-2545 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T62 2553-2558 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T63 2572-2574 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T66 2723-2731 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T67 2898-2900 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T70 3011-3013 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T73 3149-3159 Chemical denotes fatty acid http://purl.obolibrary.org/obo/CHEBI_35366
T74 3155-3159 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T75 3222-3229 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T76 3273-3275 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T79 3282-3291 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T80 3534-3543 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T81 3628-3637 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T82 3919-3921 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T85 4077-4079 Chemical denotes II http://purl.obolibrary.org/obo/CHEBI_74067
T86 4282-4284 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T89 4558-4565 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T90 4594-4596 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T93 4597-4602 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T94 4597-4600 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T95 4615-4617 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T98 4722-4724 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T101 4725-4730 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T102 4735-4737 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T105 4738-4743 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T106 4797-4799 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T109 4800-4805 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T110 4800-4803 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T111 4817-4819 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T114 4855-4857 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T117 5189-5191 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T120 5234-5236 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T123 5450-5452 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T126 5550-5555 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T127 5557-5562 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T128 5557-5560 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T129 5564-5569 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T130 5836-5840 Chemical denotes drug http://purl.obolibrary.org/obo/CHEBI_23888
T131 5908-5910 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T134 6190-6192 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T137 6280-6282 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T140 6283-6288 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T141 6283-6286 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T142 6375-6377 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T145 6378-6383 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T146 6442-6444 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T149 6445-6450 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T150 6534-6536 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T153 6621-6623 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T156 6769-6771 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T159 7039-7041 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T162 7165-7167 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T165 7302-7304 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T168 7441-7443 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T171 7697-7706 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T172 7954-7956 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T175 8026-8028 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T178 8089-8100 Chemical denotes ganciclovir http://purl.obolibrary.org/obo/CHEBI_465284
T179 8122-8131 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T180 8137-8141 Chemical denotes drug http://purl.obolibrary.org/obo/CHEBI_23888
T181 8456-8458 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T184 8595-8597 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T187 8598-8603 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T188 8608-8610 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T191 8611-8616 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T192 8623-8625 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T195 8704-8706 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T198 8707-8712 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T199 8707-8710 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T200 8738-8740 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T203 8819-8821 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T206 8866-8868 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T209 8911-8914 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T210 8966-8978 Chemical denotes glycoprotein http://purl.obolibrary.org/obo/CHEBI_17089
T211 9049-9051 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T214 9123-9125 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T217 9246-9248 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T220 9423-9425 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T223 9535-9537 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T226 9677-9685 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T227 9857-9864 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T228 9925-9927 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T231 9968-9970 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T234 9995-10002 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T235 10037-10039 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T238 10150-10152 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T241 10153-10158 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T242 10153-10156 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T243 10241-10248 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T244 10287-10295 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T245 10418-10426 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T246 10479-10487 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T247 10621-10623 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T250 10865-10867 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T253 10898-10900 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T256 10993-10995 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T259 11170-11172 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T262 11491-11493 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T265 11494-11499 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T266 11494-11497 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T267 11805-11812 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T268 11912-11914 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T271 11915-11920 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T272 11915-11918 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T273 11999-12001 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T276 12087-12089 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T279 12093-12097 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T280 12254-12256 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T283 12260-12264 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T284 12303-12306 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T285 12562-12564 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T288 12707-12709 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T291 12741-12743 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T294 12898-12900 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T297 12962-12975 Chemical denotes glycoproteins http://purl.obolibrary.org/obo/CHEBI_17089
T298 13049-13051 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T301 13107-13109 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T304 13368-13370 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T307 13517-13519 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T310 13558-13560 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T313 13609-13611 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T316 13694-13696 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T319 13767-13769 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T322 13783-13787 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T323 14314-14316 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T326 14325-14329 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T327 14730-14732 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T330 14793-14795 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T333 14839-14848 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T334 14991-14993 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T337 14994-14999 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T338 14994-14997 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T339 15003-15007 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T340 15200-15202 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T343 15203-15208 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T344 15203-15206 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T345 15409-15411 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T348 15537-15539 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T351 15540-15545 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T352 15540-15543 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T353 15549-15553 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T354 15652-15654 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T357 15655-15660 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T358 15655-15658 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T359 15854-15856 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T362 15857-15862 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T363 15857-15860 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T364 15866-15870 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T365 16038-16040 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T368 16041-16046 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T369 16041-16044 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T370 16164-16166 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T373 16233-16241 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T374 16266-16268 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T377 16322-16324 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T380 16325-16330 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T381 16325-16328 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T382 16428-16436 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T383 16502-16518 Chemical denotes fluorescent dyes http://purl.obolibrary.org/obo/CHEBI_51121
T384 16514-16518 Chemical denotes dyes http://purl.obolibrary.org/obo/CHEBI_37958
T385 16621-16629 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T386 16738-16746 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T387 16754-16756 Chemical denotes S2 http://purl.obolibrary.org/obo/CHEBI_29387
T388 16847-16854 Chemical denotes calcein http://purl.obolibrary.org/obo/CHEBI_51903
T389 16988-16991 Chemical denotes dye http://purl.obolibrary.org/obo/CHEBI_37958
T390 17022-17024 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T391 17082-17084 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T394 17141-17143 Chemical denotes II http://purl.obolibrary.org/obo/CHEBI_74067
T395 17170-17178 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T396 17194-17202 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T397 17210-17212 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T400 17213-17218 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T401 17213-17216 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T402 17251-17253 Chemical denotes 5B http://purl.obolibrary.org/obo/CHEBI_27560
T403 17279-17281 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T404 17318-17320 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T407 17321-17326 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T408 17328-17330 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T411 17331-17336 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T412 17331-17334 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T413 17341-17343 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T416 17344-17349 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T417 17374-17376 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T420 17425-17427 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T423 17488-17496 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T424 17626-17628 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T427 17700-17707 Chemical denotes calcein http://purl.obolibrary.org/obo/CHEBI_51903
T428 17711-17719 Chemical denotes effector http://purl.obolibrary.org/obo/CHEBI_35224
T429 17843-17845 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T432 17927-17929 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T433 17944-17951 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T434 18086-18094 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T435 18130-18138 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T436 18144-18152 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T437 18206-18208 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T438 18226-18228 Chemical denotes HA http://purl.obolibrary.org/obo/CHEBI_73924
T439 18241-18243 Chemical denotes II http://purl.obolibrary.org/obo/CHEBI_74067
T440 18526-18534 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T441 18637-18639 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T444 18680-18682 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T447 18701-18708 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T448 18726-18728 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T451 18769-18776 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T452 18824-18826 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T455 18880-18882 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T458 18950-18952 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T461 19035-19042 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T462 19129-19134 Chemical denotes lipid http://purl.obolibrary.org/obo/CHEBI_18059
T463 19318-19325 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T464 19357-19359 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T467 19380-19388 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T468 19425-19427 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T471 19608-19631 Chemical denotes lysophosphatidylcholine http://purl.obolibrary.org/obo/CHEBI_60479
T472 19633-19636 Chemical denotes LPC http://purl.obolibrary.org/obo/CHEBI_11502|http://purl.obolibrary.org/obo/CHEBI_16728|http://purl.obolibrary.org/obo/CHEBI_17504|http://purl.obolibrary.org/obo/CHEBI_60479
T476 19730-19735 Chemical denotes lipid http://purl.obolibrary.org/obo/CHEBI_18059
T477 19736-19746 Chemical denotes oleic acid http://purl.obolibrary.org/obo/CHEBI_16196
T478 19742-19746 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T479 19748-19750 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T481 19928-19930 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T483 19945-19947 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T486 19983-19985 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T489 20013-20015 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T492 20062-20064 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T494 20079-20081 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T497 20117-20119 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T500 20185-20187 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T503 20205-20207 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T506 20232-20234 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T509 20363-20365 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T512 20390-20398 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T513 20429-20437 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T514 20461-20463 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T517 20520-20528 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T518 20577-20579 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T521 20705-20707 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T524 20730-20738 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T525 20757-20759 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T528 20776-20784 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T529 20825-20827 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T532 20876-20884 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T533 21015-21017 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T536 21087-21095 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T537 21112-21114 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T540 21121-21123 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T541 21139-21146 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T542 21221-21223 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T545 21255-21265 Chemical denotes oleic acid http://purl.obolibrary.org/obo/CHEBI_16196
T546 21261-21265 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T547 21267-21269 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T549 21294-21297 Chemical denotes dye http://purl.obolibrary.org/obo/CHEBI_37958
T550 21391-21393 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T553 21429-21431 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T555 21443-21445 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T558 21579-21581 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T561 21650-21653 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T562 21658-21665 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T563 21767-21770 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T564 21822-21824 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T567 21928-21930 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T570 21943-21946 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T571 22079-22082 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T572 22149-22151 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T575 22195-22198 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T576 22228-22230 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T579 22318-22321 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T580 22344-22346 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T583 22397-22404 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T584 22427-22430 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T585 22456-22458 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T588 22467-22470 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T589 22560-22562 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T592 22598-22601 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T593 22610-22613 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T594 22724-22727 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T595 22794-22796 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T598 23147-23149 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T601 23418-23425 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T602 23466-23473 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T603 23531-23533 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T606 23741-23743 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T609 23827-23835 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T610 23926-23928 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T613 24028-24030 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T616 24165-24173 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T617 24308-24315 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T618 24353-24358 Chemical denotes acids http://purl.obolibrary.org/obo/CHEBI_37527
T619 24359-24364 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T620 24366-24371 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T621 24366-24369 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T622 24376-24381 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T623 24467-24469 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T626 24717-24719 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T629 24783-24793 Chemical denotes fatty acid http://purl.obolibrary.org/obo/CHEBI_35366
T630 24789-24793 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T631 24852-24859 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T632 24951-24959 Chemical denotes Tyrosine http://purl.obolibrary.org/obo/CHEBI_17895|http://purl.obolibrary.org/obo/CHEBI_18186
T634 25125-25127 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T637 25190-25198 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T638 25328-25331 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T639 25336-25343 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T640 25432-25434 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T643 25438-25441 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T644 25446-25453 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T645 25505-25507 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T648 25516-25519 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T649 25524-25531 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T650 25726-25728 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T653 25812-25815 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T654 25820-25827 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T655 25915-25917 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T658 25954-25956 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T661 26022-26024 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T664 26115-26117 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T667 26158-26160 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T670 26310-26312 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T673 26500-26502 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T676 26506-26510 Chemical denotes male http://purl.obolibrary.org/obo/CHEBI_30780
T677 26656-26658 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T680 26751-26753 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T683 26791-26798 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T684 26928-26930 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T687 26979-26981 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T690 27199-27201 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T693 27270-27272 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T696 27396-27398 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T699 27471-27473 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T702 27521-27530 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T703 27563-27565 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T706 27698-27707 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T707 27735-27737 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T710 27774-27781 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T711 27878-27881 Chemical denotes LPC http://purl.obolibrary.org/obo/CHEBI_11502|http://purl.obolibrary.org/obo/CHEBI_16728|http://purl.obolibrary.org/obo/CHEBI_17504|http://purl.obolibrary.org/obo/CHEBI_60479
T715 28056-28063 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T716 28151-28153 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T718 28167-28169 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T721 28197-28199 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T722 28241-28244 Chemical denotes LPC http://purl.obolibrary.org/obo/CHEBI_11502|http://purl.obolibrary.org/obo/CHEBI_16728|http://purl.obolibrary.org/obo/CHEBI_17504|http://purl.obolibrary.org/obo/CHEBI_60479
T726 28246-28248 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T729 28365-28375 Chemical denotes inhibitors http://purl.obolibrary.org/obo/CHEBI_35222
T730 28593-28595 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T733 28648-28650 Chemical denotes OA http://purl.obolibrary.org/obo/CHEBI_138856|http://purl.obolibrary.org/obo/CHEBI_16196
T735 28761-28763 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T738 28772-28777 Chemical denotes lipid http://purl.obolibrary.org/obo/CHEBI_18059
T739 28926-28928 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T742 28985-28988 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T743 28993-29000 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T744 29175-29177 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T747 29479-29481 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T750 29516-29519 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T751 29530-29537 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T752 29596-29605 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T753 29616-29618 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T756 29672-29674 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T759 29844-29855 Chemical denotes application http://purl.obolibrary.org/obo/CHEBI_33232
T760 29958-29960 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T763 30162-30178 Chemical denotes antiviral agents http://purl.obolibrary.org/obo/CHEBI_22587
T764 30204-30214 Chemical denotes inhibitors http://purl.obolibrary.org/obo/CHEBI_35222
T765 30284-30286 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T768 30367-30369 Chemical denotes MD http://purl.obolibrary.org/obo/CHEBI_74699
T769 30826-30837 Chemical denotes L-glutamine http://purl.obolibrary.org/obo/CHEBI_18050|http://purl.obolibrary.org/obo/CHEBI_30011|http://purl.obolibrary.org/obo/CHEBI_58359
T772 30828-30837 Chemical denotes glutamine http://purl.obolibrary.org/obo/CHEBI_28300
T773 30848-30858 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T775 30859-30871 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T777 30883-30888 Chemical denotes Hepes http://purl.obolibrary.org/obo/CHEBI_42334
T778 30889-30895 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T779 30913-30916 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T780 31062-31075 Chemical denotes ascorbic acid http://purl.obolibrary.org/obo/CHEBI_22652|http://purl.obolibrary.org/obo/CHEBI_29073
T782 31071-31075 Chemical denotes acid http://purl.obolibrary.org/obo/CHEBI_37527
T783 31122-31136 Chemical denotes amphotericin B http://purl.obolibrary.org/obo/CHEBI_2682
T784 31148-31155 Chemical denotes insulin http://purl.obolibrary.org/obo/CHEBI_145810
T785 31170-31181 Chemical denotes L-glutamine http://purl.obolibrary.org/obo/CHEBI_18050|http://purl.obolibrary.org/obo/CHEBI_30011|http://purl.obolibrary.org/obo/CHEBI_58359
T788 31172-31181 Chemical denotes glutamine http://purl.obolibrary.org/obo/CHEBI_28300
T789 31376-31390 Chemical denotes antiviral drug http://purl.obolibrary.org/obo/CHEBI_36044
T790 31376-31385 Chemical denotes antiviral http://purl.obolibrary.org/obo/CHEBI_22587
T791 31386-31390 Chemical denotes drug http://purl.obolibrary.org/obo/CHEBI_23888
T792 31392-31403 Chemical denotes ganciclovir http://purl.obolibrary.org/obo/CHEBI_465284
T793 31538-31545 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T794 31669-31671 Chemical denotes VA http://purl.obolibrary.org/obo/CHEBI_75008
T795 32000-32010 Chemical denotes surfactant http://purl.obolibrary.org/obo/CHEBI_35195
T796 32016-32033 Chemical denotes cellulose acetate http://purl.obolibrary.org/obo/CHEBI_145232
T797 32026-32033 Chemical denotes acetate http://purl.obolibrary.org/obo/CHEBI_30089|http://purl.obolibrary.org/obo/CHEBI_47622
T799 32452-32457 Chemical denotes group http://purl.obolibrary.org/obo/CHEBI_24433
T800 32467-32475 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T801 32566-32568 Chemical denotes PE http://purl.obolibrary.org/obo/CHEBI_16038|http://purl.obolibrary.org/obo/CHEBI_17553|http://purl.obolibrary.org/obo/CHEBI_74762
T804 32620-32622 Chemical denotes II http://purl.obolibrary.org/obo/CHEBI_74067
T805 32833-32835 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T808 32836-32841 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T809 32843-32848 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T810 32843-32846 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T811 32854-32859 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T812 32911-32913 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T815 32929-32937 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T816 32941-32945 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T817 32986-32988 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T820 33077-33085 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T821 33089-33093 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T822 33176-33178 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T825 33347-33353 Chemical denotes buffer http://purl.obolibrary.org/obo/CHEBI_35225
T826 33358-33377 Chemical denotes protease inhibitors http://purl.obolibrary.org/obo/CHEBI_37670|http://purl.obolibrary.org/obo/CHEBI_60258
T828 33367-33377 Chemical denotes inhibitors http://purl.obolibrary.org/obo/CHEBI_35222
T829 33439-33446 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T830 33560-33574 Chemical denotes polyacrylamide http://purl.obolibrary.org/obo/CHEBI_51135|http://purl.obolibrary.org/obo/CHEBI_53656|http://purl.obolibrary.org/obo/CHEBI_60766
T833 33609-33623 Chemical denotes nitrocellulose http://purl.obolibrary.org/obo/CHEBI_53325
T834 34155-34162 Chemical denotes Protein http://purl.obolibrary.org/obo/CHEBI_16541
T835 34192-34197 Chemical denotes bromo http://purl.obolibrary.org/obo/CHEBI_22927|http://purl.obolibrary.org/obo/CHEBI_47265
T837 34200-34206 Chemical denotes chloro http://purl.obolibrary.org/obo/CHEBI_47853
T838 34311-34319 Chemical denotes reagents http://purl.obolibrary.org/obo/CHEBI_33893
T839 34488-34490 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T842 34905-34915 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T844 34916-34928 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T846 35052-35055 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T847 36006-36008 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T850 36160-36170 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T852 36171-36183 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T854 36838-36848 Chemical denotes penicillin http://purl.obolibrary.org/obo/CHEBI_17334|http://purl.obolibrary.org/obo/CHEBI_51356
T856 36849-36861 Chemical denotes streptomycin http://purl.obolibrary.org/obo/CHEBI_17076|http://purl.obolibrary.org/obo/CHEBI_58007
T858 36889-36892 Chemical denotes CO2 http://purl.obolibrary.org/obo/CHEBI_16526
T859 36972-36980 Chemical denotes methanol http://purl.obolibrary.org/obo/CHEBI_17790
T860 37068-37073 Chemical denotes water http://purl.obolibrary.org/obo/CHEBI_15377
T861 37279-37281 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T864 37290-37294 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T865 37717-37719 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T868 37720-37725 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T869 37720-37723 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T870 37880-37882 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T873 37990-37998 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T874 38043-38045 Chemical denotes WI http://purl.obolibrary.org/obo/CHEBI_141448
T875 38142-38144 Chemical denotes MD http://purl.obolibrary.org/obo/CHEBI_74699
T876 38280-38283 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T877 38532-38540 Chemical denotes solution http://purl.obolibrary.org/obo/CHEBI_75958
T878 38640-38645 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T879 39162-39167 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T880 39221-39224 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T881 39357-39362 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T882 39509-39514 Chemical denotes probe http://purl.obolibrary.org/obo/CHEBI_50406
T883 40484-40486 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T886 40583-40585 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T889 40689-40693 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T890 40883-40885 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T893 41145-41148 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T894 41261-41264 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T895 41350-41352 Chemical denotes WI http://purl.obolibrary.org/obo/CHEBI_141448
T896 41360-41363 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T897 41432-41435 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991
T898 41650-41652 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T901 41653-41658 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T902 41653-41656 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T903 41662-41666 Chemical denotes DMSO http://purl.obolibrary.org/obo/CHEBI_28262
T904 41859-41861 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T907 41862-41867 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T908 41862-41865 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T909 42085-42093 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T910 42145-42147 Chemical denotes S2 http://purl.obolibrary.org/obo/CHEBI_29387
T911 42270-42278 Chemical denotes effector http://purl.obolibrary.org/obo/CHEBI_35224
T912 42307-42314 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T913 42322-42327 Chemical denotes amino http://purl.obolibrary.org/obo/CHEBI_46882
T914 42398-42402 Chemical denotes dyes http://purl.obolibrary.org/obo/CHEBI_37958
T915 42459-42466 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T916 42603-42605 Chemical denotes GP http://purl.obolibrary.org/obo/CHEBI_70744
T917 42629-42636 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T918 42641-42646 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T919 42641-42644 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T920 42647-42649 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T923 42699-42704 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T924 42699-42702 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T925 42705-42707 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T928 42753-42761 Chemical denotes proteins http://purl.obolibrary.org/obo/CHEBI_36080
T929 42812-42814 Chemical denotes GA http://purl.obolibrary.org/obo/CHEBI_5206|http://purl.obolibrary.org/obo/CHEBI_73855|http://purl.obolibrary.org/obo/CHEBI_5354
T932 42815-42820 Chemical denotes C13:0 http://purl.obolibrary.org/obo/CHEBI_45919
T933 42822-42827 Chemical denotes C15:1 http://purl.obolibrary.org/obo/CHEBI_75088
T934 42822-42825 Chemical denotes C15 http://purl.obolibrary.org/obo/CHEBI_42504
T935 42832-42837 Chemical denotes C17:1 http://purl.obolibrary.org/obo/CHEBI_36001
T936 43317-43320 Chemical denotes DNA http://purl.obolibrary.org/obo/CHEBI_16991

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T1 249-260 http://purl.obolibrary.org/obo/GO_0008610 denotes lipogenesis
T2 323-327 http://purl.obolibrary.org/obo/GO_0050405 denotes AMPK
T3 323-327 http://purl.obolibrary.org/obo/GO_0047322 denotes AMPK
T4 323-327 http://purl.obolibrary.org/obo/GO_0004691 denotes AMPK
T5 566-577 http://purl.obolibrary.org/obo/GO_0016925 denotes SUMOylation
T6 599-608 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T7 729-740 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T8 851-874 http://purl.obolibrary.org/obo/GO_0019081 denotes viral protein synthesis
T9 857-874 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T10 865-874 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T11 1522-1535 http://purl.obolibrary.org/obo/GO_0071897 denotes DNA synthesis
T12 1526-1535 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T13 1582-1597 http://purl.obolibrary.org/obo/GO_0016032 denotes viral infection
T14 2666-2677 http://purl.obolibrary.org/obo/GO_0008610 denotes lipogenesis
T15 2740-2744 http://purl.obolibrary.org/obo/GO_0050405 denotes AMPK
T16 2740-2744 http://purl.obolibrary.org/obo/GO_0047322 denotes AMPK
T17 2740-2744 http://purl.obolibrary.org/obo/GO_0004691 denotes AMPK
T18 2843-2860 http://purl.obolibrary.org/obo/GO_0008233 denotes protease activity
T19 3053-3064 http://purl.obolibrary.org/obo/GO_0016925 denotes SUMOylation
T20 3095-3104 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T21 3230-3241 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T22 5631-5640 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T23 5912-5927 http://purl.obolibrary.org/obo/GO_0016032 denotes Viral infection
T24 7063-7078 http://purl.obolibrary.org/obo/GO_0016032 denotes Viral infection
T25 7315-7324 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T26 9562-9577 http://purl.obolibrary.org/obo/GO_0016032 denotes viral infection
T27 9800-9831 http://purl.obolibrary.org/obo/GO_1903901 denotes inhibition of viral replication
T28 9814-9831 http://purl.obolibrary.org/obo/GO_0019079 denotes viral replication
T29 9814-9831 http://purl.obolibrary.org/obo/GO_0019058 denotes viral replication
T30 9857-9874 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T31 9865-9874 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T32 10501-10532 http://purl.obolibrary.org/obo/GO_1903901 denotes inhibition of viral replication
T33 10515-10532 http://purl.obolibrary.org/obo/GO_0019079 denotes viral replication
T34 10515-10532 http://purl.obolibrary.org/obo/GO_0019058 denotes viral replication
T35 12356-12374 http://purl.obolibrary.org/obo/GO_0008283 denotes Cell Proliferation
T36 12792-12802 http://purl.obolibrary.org/obo/GO_0008219 denotes cell death
T37 14898-14909 http://purl.obolibrary.org/obo/GO_0006897 denotes endocytosis
T38 16176-16187 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T39 16176-16187 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T40 16176-16187 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T41 16176-16187 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T42 16283-16294 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T43 16283-16294 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T44 16283-16294 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T45 16283-16294 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T46 16340-16351 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T47 16340-16351 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T48 16340-16351 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T49 16340-16351 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T50 16369-16380 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T51 16369-16380 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T52 16369-16380 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T53 16369-16380 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T54 16459-16470 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T55 16459-16470 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T56 16459-16470 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T57 16459-16470 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T58 17088-17104 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T59 17088-17104 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T60 17093-17104 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T61 17093-17104 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T62 17437-17448 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T63 17437-17448 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T64 17437-17448 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T65 17437-17448 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T66 17996-18012 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T67 17996-18012 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T68 18001-18012 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T69 18001-18012 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T70 18051-18067 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T71 18051-18067 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T72 18056-18067 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T73 18056-18067 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T74 18857-18873 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T75 18857-18873 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T76 18862-18873 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T77 18862-18873 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T78 19779-19797 http://purl.obolibrary.org/obo/GO_0097753 denotes membrane curvature
T79 20033-20051 http://purl.obolibrary.org/obo/GO_0097753 denotes membrane curvature
T80 20686-20699 http://purl.obolibrary.org/obo/GO_0045851 denotes acidification
T81 21041-21054 http://purl.obolibrary.org/obo/GO_0045851 denotes acidification
T82 21201-21217 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T83 21201-21217 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T84 21206-21217 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T85 21206-21217 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T86 21658-21675 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T87 21666-21675 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T88 21767-21780 http://purl.obolibrary.org/obo/GO_0071897 denotes DNA synthesis
T89 21771-21780 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T90 22304-22333 http://purl.obolibrary.org/obo/GO_0008156 denotes inhibition of DNA replication
T91 22318-22333 http://purl.obolibrary.org/obo/GO_0006260 denotes DNA replication
T92 22377-22414 http://purl.obolibrary.org/obo/GO_1904972 denotes inhibition of viral protein synthesis
T93 22391-22414 http://purl.obolibrary.org/obo/GO_0019081 denotes viral protein synthesis
T94 22397-22414 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T95 22405-22414 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T96 22427-22440 http://purl.obolibrary.org/obo/GO_0071897 denotes DNA synthesis
T97 22431-22440 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T98 22467-22480 http://purl.obolibrary.org/obo/GO_0071897 denotes DNA synthesis
T99 22471-22480 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T100 22482-22499 http://purl.obolibrary.org/obo/GO_0019079 denotes Viral replication
T101 22482-22499 http://purl.obolibrary.org/obo/GO_0019058 denotes Viral replication
T102 23460-23483 http://purl.obolibrary.org/obo/GO_0019081 denotes Viral protein synthesis
T103 23466-23483 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T104 23474-23483 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T105 23760-23777 http://purl.obolibrary.org/obo/GO_0019079 denotes viral replication
T106 23760-23777 http://purl.obolibrary.org/obo/GO_0019058 denotes viral replication
T107 24147-24157 http://purl.obolibrary.org/obo/GO_0065007 denotes regulation
T108 24205-24222 http://purl.obolibrary.org/obo/GO_0019079 denotes viral replication
T109 24205-24222 http://purl.obolibrary.org/obo/GO_0019058 denotes viral replication
T110 24302-24325 http://purl.obolibrary.org/obo/GO_0019081 denotes viral protein synthesis
T111 24308-24325 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T112 24316-24325 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T113 24441-24463 http://purl.obolibrary.org/obo/GO_0016209 denotes antioxidative activity
T114 24860-24871 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T115 25336-25353 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T116 25344-25353 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T117 25524-25541 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T118 25532-25541 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T119 25632-25650 http://purl.obolibrary.org/obo/GO_0007165 denotes signaling pathways
T120 25632-25641 http://purl.obolibrary.org/obo/GO_0023052 denotes signaling
T121 25664-25681 http://purl.obolibrary.org/obo/GO_0007050 denotes cell cycle arrest
T122 25664-25674 http://purl.obolibrary.org/obo/GO_0007049 denotes cell cycle
T123 25820-25837 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T124 25828-25837 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T125 26762-26776 http://purl.obolibrary.org/obo/GO_0070997 denotes neuronal death
T126 26799-26810 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T127 27032-27048 http://purl.obolibrary.org/obo/GO_0016032 denotes Viral infections
T128 27299-27305 http://purl.obolibrary.org/obo/GO_0040007 denotes growth
T129 27791-27807 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T130 27791-27807 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T131 27796-27807 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T132 27796-27807 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T133 27906-27921 http://purl.obolibrary.org/obo/GO_0061025 denotes membrane fusion
T134 28993-29010 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T135 29001-29010 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T136 29530-29547 http://purl.obolibrary.org/obo/GO_0006412 denotes protein synthesis
T137 29538-29547 http://purl.obolibrary.org/obo/GO_0009058 denotes synthesis
T138 29634-29650 http://purl.obolibrary.org/obo/GO_0016032 denotes viral infections
T139 29716-29732 http://purl.obolibrary.org/obo/GO_0016032 denotes viral infections
T140 30998-31004 http://purl.obolibrary.org/obo/GO_0040007 denotes Growth
T141 33341-33346 http://purl.obolibrary.org/obo/GO_0019835 denotes lysis
T142 34113-34124 http://purl.obolibrary.org/obo/GO_0016791 denotes phosphatase
T143 36909-36918 http://purl.obolibrary.org/obo/GO_0009058 denotes formation
T144 37999-38017 http://purl.obolibrary.org/obo/GO_0008283 denotes cell proliferation
T145 38216-38222 http://purl.obolibrary.org/obo/GO_0004530 denotes DNaseI
T146 38317-38323 http://purl.obolibrary.org/obo/GO_0004530 denotes DNaseI
T147 38565-38580 http://purl.obolibrary.org/obo/GO_0010467 denotes Gene Expression
T148 40371-40386 http://purl.obolibrary.org/obo/GO_0016032 denotes Viral infection
T149 41940-41951 http://purl.obolibrary.org/obo/GO_0140253 denotes cell fusion
T150 41940-41951 http://purl.obolibrary.org/obo/GO_0045026 denotes cell fusion
T151 41940-41951 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T152 41940-41951 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T153 41990-42006 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T154 41990-42006 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T155 41995-42006 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T156 41995-42006 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion
T157 42179-42195 http://purl.obolibrary.org/obo/GO_0140253 denotes cell-cell fusion
T158 42179-42195 http://purl.obolibrary.org/obo/GO_0045026 denotes cell-cell fusion
T159 42184-42195 http://purl.obolibrary.org/obo/GO_0000768 denotes cell fusion
T160 42184-42195 http://purl.obolibrary.org/obo/GO_0000747 denotes cell fusion

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T1 0-51 Sentence denotes Ginkgolic acid inhibits fusion of enveloped viruses
T2 53-61 Sentence denotes Abstract
T3 62-154 Sentence denotes Ginkgolic acids (GA) are alkylphenol constituents of the leaves and fruits of Ginkgo biloba.
T4 155-407 Sentence denotes GA has shown pleiotropic effects in vitro, including: antitumor effects through inhibition of lipogenesis; decreased expression of invasion associated proteins through AMPK activation; and potential rescue of amyloid-β (Aβ) induced synaptic impairment.
T5 408-497 Sentence denotes GA was also reported to have activity against Escherichia coli and Staphylococcus aureus.
T6 498-749 Sentence denotes Several mechanisms for this activity have been suggested including: SUMOylation inhibition; blocking formation of the E1-SUMO intermediate; inhibition of fatty acid synthase; non-specific SIRT inhibition; and activation of protein phosphatase type-2C.
T7 750-875 Sentence denotes Here we report that GA inhibits Herpes simplex virus type 1 (HSV-1) by inhibition of both fusion and viral protein synthesis.
T8 876-1030 Sentence denotes Additionally, we report that GA inhibits human cytomegalovirus (HCMV) genome replication and Zika virus (ZIKV) infection of normal human astrocytes (NHA).
T9 1031-1211 Sentence denotes We show a broad spectrum of fusion inhibition by GA of all three classes of fusion proteins including HIV, Ebola virus (EBOV), influenza A virus (IAV) and Epstein Barr virus (EBV).
T10 1212-1274 Sentence denotes In addition, we show inhibition of a non-enveloped adenovirus.
T11 1275-1366 Sentence denotes Our experiments suggest that GA inhibits virion entry by blocking the initial fusion event.
T12 1367-1536 Sentence denotes Data showing inhibition of HSV-1 and CMV replication, when GA is administered post-infection, suggest a possible secondary mechanism targeting protein and DNA synthesis.
T13 1537-1853 Sentence denotes Thus, in light of the strong effect of GA on viral infection, even after the infection begins, it may potentially be used to treat acute infections (e.g. Coronavirus, EBOV, ZIKV, IAV and measles), and also topically for the successful treatment of active lesions (e.g. HSV-1, HSV-2 and varicella-zoster virus (VZV)).
T14 1855-1867 Sentence denotes Introduction
T15 1868-1955 Sentence denotes Ginkgolic acids are alkylphenol constituents of the leaves and fruits of Ginkgo biloba.
T16 1956-2080 Sentence denotes Ginkgo biloba extracts (GBE) have been used as herbal supplements since at least the 16th century and remain widely in use1.
T17 2081-2248 Sentence denotes Major constituents of GBE include terpine trilactones (ginkgolide A, B, C, J, and bilobalide), flavonoid glycosides (quercetin and rutin), as well as Ginkgolic acids2.
T18 2249-2389 Sentence denotes Ginkgolic acids are a mixture of several 2-hydroxy-6-alkylbenzoic acids in which the most common alkyl chains contain 13, 15, or 17 carbons.
T19 2390-2470 Sentence denotes The 15 and 17 carbon chains are unsaturated at positions 8 and 10, respectively.
T20 2471-2571 Sentence denotes The 3 Ginkgolic acid (GA) structures are, therefore, designated C13:0, C15:1, and C17:1 (Table S1)3.
T21 2572-2897 Sentence denotes GA has shown pleiotropic effects in vitro, including: antitumor effects through inhibition of lipogenesis; decreased expression of invasion associated proteins through AMPK activation; potential rescue of amyloid-β (Aβ) induced synaptic impairment; and inhibition of HIV protease activity as well as HIV viral replication4–7.
T22 2898-2988 Sentence denotes GA was also reported to have activity against Escherichia coli and Staphylococcus aureus8.
T23 2989-3252 Sentence denotes Several ways in which GA works have been suggested including by SUMOylation inhibition activity; blocking formation of the E1-SUMO intermediate9; inhibition of fatty acid synthase10; non-specific SIRT inhibition11; and activation of protein phosphatase type-2C12.
T24 3253-3435 Sentence denotes Here we report that GA shows antiviral activity against Herpes simplex virus 1 (HSV-1), Human cytomegalovirus (HCMV), and Zika virus (ZIKV) primarily through viral fusion inhibition.
T25 3436-3529 Sentence denotes In addition, we show inhibition of entry of a replication-defective non-enveloped adenovirus.
T26 3530-3596 Sentence denotes The antiviral effects were observed below the cytotoxic threshold.
T27 3597-3869 Sentence denotes We believe that broad spectrum antiviral activity is achieved through the inhibition of viral entry and that this effect could be therapeutically utilized systemically in the context of severe acute viral disease, or topically for the treatment of cutaneous viral lesions.
T28 3870-4236 Sentence denotes We show a broad spectrum of fusion inhibition by GA of all three classes of fusion proteins13 including: pathogenic human enveloped viruses from Class I (ZIKV, HIV, EBOV, and influenza A virus (IAV)), Class II (Venezuelan equine encephalitis virus (VEEV) and Semliki Forest virus (SFV)), and Class III (vesicular stomatitis virus (VSV) and Epstein Barr virus (EBV)).
T29 4237-4343 Sentence denotes Taken together, our experiments suggest that GA inhibits viral entry by blocking the initial fusion event.
T30 4345-4352 Sentence denotes Results
T31 4353-4577 Sentence denotes In reporting the results of our experiments, we apply the term “infection” to measurements of virus cytopathic effect in permissive cells, and the term “replication” to the measurement of genome copies or protein expression.
T32 4578-4697 Sentence denotes We chose to use GA C15:1 as the main GA type in our experiments because it is the one most used experimentally to date.
T33 4698-4771 Sentence denotes However, we also tested GA C13:0 and GA C17:1 in some of our experiments.
T34 4772-4815 Sentence denotes Unless stated otherwise, GA C15:1 was used.
T35 4817-4833 Sentence denotes GA IC50 vs. EC50
T36 4834-5019 Sentence denotes The toxicity EC50 of GA on HEp-2 cells in MEM supplemented with 1% fetal bovine serum (FBS) was 27.63 ± 2.21 μM (Fig. S1A) or 63.5 ± 3.2 μM (Fig. S1B) on cells supplemented with 5% FBS.
T37 5020-5212 Sentence denotes In cells infected with HCMV strain CH19 and supplemented with 1% FBS, the 50% inhibitory concentration (IC50) was 6.83 ± 1.08 μM, and with 10% bovine serum, the IC50 of GA was 41 μM (Fig. 1A).
T38 5213-5393 Sentence denotes The toxicity EC50 of GA on HFF cells was 14.00 μM ± 0.1 in MEM medium supplemented with 1% FBS (Fig. S1C), and 137.04 μM ± 10.44 (Fig. S1D) in MEM medium supplemented with 10% FBS.
T39 5394-5523 Sentence denotes The results indicated that the activity and toxicity of GA is affected by the serum concentration in the medium (see discussion).
T40 5524-5911 Sentence denotes Figure 1 Ginkgolic Acids (C13:0, C15:1, C17:1) inhibit HCMV in a dose-dependent manner and prevents plaque formation. (A) Monolayers of human foreskin fibroblasts (HFF) were inoculated with 50–100 cells infected with one of two cell-associated clinical isolates of HCMV (CH19 and BI-6) in a total of 4 wells per drug concentration followed by treatment with medium containing 0–10 µM GA.
T41 5912-6059 Sentence denotes Viral infection was allowed to progress for 7 days when the mean number of HCMV plaques per concentration was counted, and the IC50 was determined.
T42 6060-6532 Sentence denotes The effects of different concentrations of FBS and time delay on the IC50 are also shown. (B) Dose-dependent inhibitory effect of GA on infection by the cell-free virus strain PT30CMV-GFP. (C) Inhibitory effect of 10 µM GA C15:1 compared to 16 µM GCV on HCMV-GFP cell-free infection. (D) Inhibitory effect of 10 µM GA C13:0 on HCMV-GFP infection, and (E) Inhibitory effect of 10 µM GA C17:1 on cell-free HCMV-GFP infection. (B–E) representing average of 20 scanned fields.
T43 6534-6596 Sentence denotes GA inhibits HCMV infection in human foreskin fibroblasts (HFF)
T44 6597-6690 Sentence denotes To assess the effect of GA on HCMV infection, dilutions of 1 µM to 20 µM were made (Fig. 1A).
T45 6691-6860 Sentence denotes Monolayers of human foreskin fibroblasts (HFF) were incubated for 1 hour with GA and then infected with two cell-associated clinical isolates of HCMV: CH1914 and BI-615.
T46 6861-7062 Sentence denotes Because neither virus produces extracellular virus, plates for plaque assays were inoculated with 50–100 infected cells per well, and then treated with medium containing 1–20 µM GA, or vehicle control.
T47 7063-7164 Sentence denotes Viral infection was allowed to progress for 7 days, and then quantitated by plaque reduction assay14.
T48 7165-7269 Sentence denotes GA inhibited infection of BI-6 and CH19 with an IC50 of 7.26 ± 0.92 μM and 6.83 ± 1.08 μM, respectively.
T49 7270-7391 Sentence denotes To further assess the effect of GA on plaque formation, we used the CMVPT30-GFP strain, which produces cell-free virions.
T50 7392-7549 Sentence denotes HFF monolayers in 24-well plates pretreated with GA (1–20 µM) for 1 h were inoculated with 50–100 plaque-forming units of CMVPT30-GFP per well.16, (Fig. 1B).
T51 7550-7626 Sentence denotes The number of plaques were counted after 7 days and the IC50 was determined.
T52 7627-7727 Sentence denotes As predicted by the previously-determined IC50, at 5 and at 10 µM the antiviral effect was apparent.
T53 7728-7845 Sentence denotes Furthermore, at 10 µM, only single cells were infected, indicating that there was no cell-to-cell virus transmission.
T54 7846-7957 Sentence denotes These results may be explained as inhibition of secondary infections or that viral entry may be a target of GA.
T55 7958-8152 Sentence denotes To verify these results, we compared the inhibition of infection by GA using a plaque reduction assay (PRA) similar to the PRA for ganciclovir (GCV), the preferred antiviral HCMV drug of choice.
T56 8153-8377 Sentence denotes The results showed that although there was strong inhibition of the virus at 16 µM GCV, there were still visible plaques (>5 adjacent cells showing HCMV cytopathic effect) indicating cell-to-cell transmission of the virions.
T57 8378-8579 Sentence denotes On the contrary, CMVPT30-GFP infected monolayers that were treated with 10 µM GA only displayed individual infected cells in intact HFF monolayers, (Fig. 1C), thus indicating no cell-cell transmission.
T58 8580-8617 Sentence denotes We also tested GA C17:1 and GA C13:0.
T59 8618-8725 Sentence denotes Both GA compounds had a strong inhibitory effect on HCMV infection by PRA, similar to GA C15:1 (Fig. 1D,E).
T60 8726-8817 Sentence denotes None of the GA structures showed cytotoxicity at their active concentrations, respectively.
T61 8819-8855 Sentence denotes GA inhibits HSV-1 and ZIKV infection
T62 8856-9032 Sentence denotes We tested GA on HSV-1, a rapidly replicating and lytic DNA virus, and on ZIKV, an RNA virus which has neither glycoprotein conservation nor common receptors with HCMV or HSV-1.
T63 9033-9139 Sentence denotes To test whether GA inhibits HSV-1, we designed an experiment to test the direct effect of GA on the virus.
T64 9140-9190 Sentence denotes For this experiment, we used HEp-2 and 293T cells.
T65 9191-9426 Sentence denotes 1 × 107 PFU HSV-1 strain F was treated for 1 hour with GA (50 µM) or with vehicle in serum free DMEM and then each of these were used to infect HEp2 or 293T cells at an MOI of 0.5 in 199V medium with a final concentration of 2.5 µM GA.
T66 9427-9538 Sentence denotes As a control, the virus that was originally treated with the vehicle was then supplemented also with 2.5 µM GA.
T67 9539-9727 Sentence denotes To test for successful viral infection of HEp2 and 293T cells, production of HSV-1 immediate early (ICP27), early (ICP8), and late (US11) proteins was analyzed by Western Blot (Fig. 2A,B).
T68 9728-9875 Sentence denotes The results showed that in the treated HSV-1 F stock there was complete inhibition of viral replication, as indicated by lack of protein synthesis.
T69 9876-10014 Sentence denotes This implies that viral entry may be a target of GA, because direct treatment of HSV-1 with GA blocks downstream HSV-1 protein production.
T70 10015-10258 Sentence denotes To test the effect of GA on HSV-1 replication, HEp2 cell monolayers were grown to 90% confluency in a 6-well plate, treated with 10 µM GA C15:1 or vehicle for 1 hour in 199V medium, and then inoculated with HSV-1 strain F for protein analysis.
T71 10259-10336 Sentence denotes HSV-1 ICP27, ICP8, and US11 proteins were detected by Western Blot (Fig. 2C).
T72 10337-10427 Sentence denotes The results showed profound inhibition of immediate early, early, and late viral proteins.
T73 10428-10594 Sentence denotes The inhibition of the full temporal range of HSV-1 proteins implies that inhibition of viral replication occurs by blocking the entry of virions into the target cell.
T74 10595-10792 Sentence denotes To evaluate the effect of GA on progeny virions, the supernatant of GFP-HSV-1 strain 17+ infected Vero cells at an MOI of 1 was collected after 20 h and titered by plaque reduction assay (Fig. 2D).
T75 10793-10888 Sentence denotes The results showed a significant decrease of approximately 2 log in the GA-treated cell titers.
T76 10889-11173 Sentence denotes Figure 2 GA inhibits HSV-1 infection. (A) 1 × 107 PFU HSV-1 strain F were treated for 1 hour with 50 µM GA (Lanes 1–3) or with vehicle (Lanes 4–6) in serum free DMEM and then were used to infect HEp2 or 293T cells at an MOI of 0.5 in 199V medium with final concentration of 2.5 µM GA.
T77 11174-11783 Sentence denotes 6-well cultures of HEp-2 (A) or 293T (B) were then infected, and at 5, 10 and 29 hours post-inoculation, cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, US11 and β-Actin. (C) HEp2 cell monolayers were treated with 10 µM GA C15:1 or vehicle for 1 hour in 199V medium and then infected with HSV-1 strain F at 4, 8, 12, 24 and 32 hours post-inoculation cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, US11 and β-Actin.
T78 11784-11976 Sentence denotes Normalized ratios of protein expression are in the bar graph. (D) Titration by plaque assay of Vero cells pretreated with 10 µM GA C15:1 or vehicle and then infected with GFP-HSV-1 strain 17+.
T79 11977-12185 Sentence denotes To test the effect of GA on ZIKV infection, NHA were grown to 90% confluency in a 24-well plate, treated with GA or DMSO for 3 hours without serum and then infected with ZIKV strain PRVABC59 at an MOI of 0.3.
T80 12186-12307 Sentence denotes The next day, supernatant was replaced with fresh medium containing GA or DMSO and cells were incubated at 37 °C, 5% CO2.
T81 12308-12504 Sentence denotes On day 7, viability was determined with the MTS Cell Proliferation Assay (Promega), and then these cells were harvested to extract total RNA for quantification of ZIKV RNA by Taqman based qRT-PCR.
T82 12505-12632 Sentence denotes The results showed 70% to 80% viability at 5 µM to 20 µM GA, compared to less than 40% viability for the vehicle-treated cells.
T83 12633-12722 Sentence denotes Furthermore, an 80–90% decrease in ZIKV RNA was observed at 5 µM to 20 µM GA (Fig. 3A,B).
T84 12723-12803 Sentence denotes We concluded that GA inhibits entry of Zika virions and prevents NHA cell death.
T85 12804-13019 Sentence denotes This suggests that the mechanism of inhibition that appears to be targeted in HSV and HCMV by GA is conserved among enveloped viruses that have no homologous glycoproteins and use different cell receptors for entry.
T86 13020-13210 Sentence denotes To test the direct effect of GA on ZIKV, 5 × 105 PFU ZIKV were treated for 1 hour with GA (10 µM/ml) or with vehicle in 199V medium, and then were used to infect Vero cells at an MOI of 0.5.
T87 13211-13336 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell free viral RNA copy number determination (Fig. 3C).
T88 13337-13457 Sentence denotes The results indicated that the GA-treated ZIKV was completely inhibited, as indicated by cell free ZIKV RNA copy number.
T89 13458-13599 Sentence denotes This suggests that viral entry of ZIKV, may be a target of GA because direct treatment of ZIKV with GA blocks downstream ZIKV RNA production.
T90 13600-13697 Sentence denotes Figure 3 GA inhibits ZIKV infection. (A) Viability of NHA infected with ZIKV and treated with GA.
T91 13698-13856 Sentence denotes NHA were grown in 24-well plates to >80% confluency and treated with GA (0–20 µM) or DMSO for 3 hours and infected with ZIKV strain PRVABC59 at an MOI of 0.3.
T92 13857-14128 Sentence denotes At 12 hpi, supernatants were carefully removed and replaced with fresh AGM. (B) 7 days post infection, samples were analyzed for cell viability by the MTS assay and then live cells were harvested for RNA and processed with Taqman based real-time PCR to quantify ZIKV RNA.
T93 14129-14350 Sentence denotes Experiments were performed in duplicate three independent times and the data were analyzed by t-test (* indicates p ≤ 0.05). (C) Cell free ZIKV in 199V medium was pretreated with 10 µM GA or with DMSO for 1 hour at 37 °C.
T94 14351-14464 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T95 14465-14569 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T96 14570-14685 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell free viral RNA copy number determination.
T97 14686-14728 Sentence denotes Experiments were performed in triplicates.
T98 14730-14768 Sentence denotes GA inhibits a non-enveloped adenovirus
T99 14769-14910 Sentence denotes To assess the effect of GA on non-enveloped virus, we also tested its antiviral activity on adenovirus, which is internalized by endocytosis.
T100 14911-15016 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T101 15017-15222 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T102 15223-15300 Sentence denotes The inoculated Vero cells were evaluated by fluorescence microscopy (Fig. 4).
T103 15301-15399 Sentence denotes The results showed significant HSV-1 inhibition, as well as inhibition of entry of the adenovirus.
T104 15400-15562 Sentence denotes Figure 4 GA inhibits non-enveloped human adenovirus. (A) Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T105 15563-15674 Sentence denotes The cells were infected with GFP-HSV-1 virus at an MOI of 0.5 in medium containing 10 µM GA C15:1 for 24 hours.
T106 15675-15879 Sentence denotes Infection was evaluated by light (lower panels) and fluorescence (upper panels) microscopy. (B) Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM of GA C15:1 or DMSO vehicle.
T107 15880-16060 Sentence denotes The cells were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T108 16061-16162 Sentence denotes Inhibition of entry was evaluated by light (lower panels) and fluorescence (upper panels) microscopy.
T109 16164-16241 Sentence denotes GA inhibits cell fusion induced by all three classes of viral fusion proteins
T110 16242-16295 Sentence denotes Our data suggested that GA targets virus-cell fusion.
T111 16296-16453 Sentence denotes To assess the activity of GA C15:1 on virus-cell fusion we modeled virus-cell fusion by the fusion of cells expressing viral fusion proteins to target cells.
T112 16454-16519 Sentence denotes Cell-cell fusion was monitored by the spread of fluorescent dyes.
T113 16520-16661 Sentence denotes Based on crystallographically identified three-dimensional structures, the folds of all virus fusion proteins fall into one of three classes.
T114 16662-16814 Sentence denotes Effector COS7 cells were transfected to express all three classes of fusion proteins (Table S2), including ZIKV, HIV, EBOV, IAV, SFV, VEEV, VSV and EBV.
T115 16815-17050 Sentence denotes The COS7 cells were loaded with calcein AM and bound to 293T target cells that were either unlabeled or, for purposes of microscopic identification, loaded with the aqueous dye CMAC, as illustrated for EBOV GP-induced fusion (Fig. 5A).
T116 17051-17179 Sentence denotes We tested the effect of adding GA on cell-cell fusion mediated by four class I, two class II, and two class III fusion proteins.
T117 17180-17255 Sentence denotes For all eight proteins, 10 µM GA C15:1 completely blocked fusion (Fig. 5B).
T118 17256-17415 Sentence denotes Furthermore, when EBOV GP was treated with 5 µM or with 10 µM GA C13:0, GA C15:1, or GA C17:1 (Fig. 5C), 10 µM of all GA derivatives completely blocked fusion.
T119 17416-17647 Sentence denotes Figure 5 GA inhibits cell fusion induced by all three classes of fusion proteins. (A) In the two top panels, typical images used to visualize the extent of fusion in the absence (control, left) and presence of GA (right) are shown.
T120 17648-17798 Sentence denotes Fused cells (light blue, due to mixing of the green calcein in effector cells and dark blue CMAC in target cells) are marked by arrows in the control.
T121 17799-17846 Sentence denotes Cells did not fuse in the presence of 10 µM GA.
T122 17847-17900 Sentence denotes The extent of fusion is quantitated in the bar graph.
T123 17901-17961 Sentence denotes The experiments used EBOV GP as the fusion protein. (n = 3).
T124 17962-18139 Sentence denotes For all bars of experiments using cell-cell fusion, means ± SEM are shown. (B) Extent of cell-cell fusion induced by fusion proteins from three classes of viral fusion proteins.
T125 18140-18405 Sentence denotes The proteins for class I are: ZIKV (Zika E), HIV Env, EBOV (Ebola GP), IAV (Influenza HA); for class II: SFV (Semliki forest virus) E1/E2, VEEV (Venezuelan Equine Encephalitis Virus) E; for class III: VSV (Vesicular Stomatitis Virus) G, EBV (Epstein Barr Virus) gB.
T126 18406-18535 Sentence denotes Effector cells were transfected (except for HIV Env which was stably expressed in a cell line) with the indicated viral proteins.
T127 18536-18589 Sentence denotes Each was bound and allowed to fuse with target cells.
T128 18590-18683 Sentence denotes The reduction in fusion caused by adding 10 µM GA is shown as low grey bars labeled 10 µM GA.
T129 18684-18874 Sentence denotes For every fusion protein, the presence of GA abolished fusion. n = 3 for each fusion protein. (C) Effect of two different concentrations of GA with different side chains on cell-cell fusion.
T130 18875-18999 Sentence denotes When GA was removed, fusion was restored (Fig. 6A, Bar 4), indicating that GA interferes with fusion in a reversible manner.
T131 19000-19252 Sentence denotes Viral fusion, regardless of fusion protein, proceeds through the creation of hemifusion, an intermediate state in which proximal lipid monolayer leaflets of membranes, in contact with one another, have merged, but the distal monolayers remain distinct.
T132 19253-19400 Sentence denotes Because inhibition of fusion was universal, independent of viral protein, it is extremely unlikely that GA targeted the fusion proteins themselves.
T133 19401-19527 Sentence denotes This is consistent with GA inhibiting the creation of the hemifusion intermediate, and universal inhibition would be expected.
T134 19528-19703 Sentence denotes It is well known that agents conferring positive spontaneous curvature, such as lysophosphatidylcholine (LPC), inhibit fusion induced by viral and non-viral fusion proteins17.
T135 19704-19911 Sentence denotes Likewise, the cone-shaped lipid oleic acid (OA) has a negative spontaneous membrane curvature, which favors hemifusion when present in the outer bilayer, and its presence relieves the inhibition of fusion18.
T136 19912-20052 Sentence denotes The addition of OA together with GA abolished the inhibitory effect of GA (Fig. 6B), indicating that GA induces positive membrane curvature.
T137 20053-20188 Sentence denotes Figure 6 OA together with GA abolished the inhibitory effect of GA. (A) Dissecting the stages of fusion affected by the presence of GA.
T138 20189-20224 Sentence denotes Bar 1, control: GA was not present.
T139 20225-20277 Sentence denotes Bar 2: GA was maintained throughout the experiments.
T140 20278-20284 Sentence denotes Bar 3:
T141 20285-20366 Sentence denotes Effector and target cells were incubated for 30 min. in the presence of 10 µM GA.
T142 20367-20500 Sentence denotes The neutral pH bathing solution was then replaced by a pH 5.7 solution, which did not contain GA, and this was maintained for 10 min.
T143 20501-20605 Sentence denotes The low pH bathing solution was replaced by one at neutral pH, also without GA, and fusion was measured.
T144 20606-20612 Sentence denotes Bar 4:
T145 20613-20885 Sentence denotes The same protocol was followed as for experiments of bar 3, but prior to acidification, the GA-containing neutral pH solution was replaced by a GA-free neutral pH solution that was maintained for 10 min to allow GA in the membranes to dissociate into the aqueous solution.
T146 20886-20947 Sentence denotes This almost restored the extent of fusion to that of control.
T147 20948-20954 Sentence denotes Bar 5:
T148 20955-21055 Sentence denotes The same protocol as for experiments of bar 3 was used, but GA was maintained through acidification.
T149 21056-21115 Sentence denotes The subsequent neutral pH wash solution did not contain GA.
T150 21116-21271 Sentence denotes EBOV GP was the fusion protein for these experiments. (n = 3). (B) The inhibition of cell-cell fusion by GA is reversed by the presence of oleic acid (OA).
T151 21272-21285 Sentence denotes Upper panels:
T152 21286-21409 Sentence denotes Massive dye mixing was observed for control (left image), but none was observed in the presence of 10 µM GA (middle image).
T153 21410-21518 Sentence denotes Addition of 250 µM OA along with GA (right image), resulted in the same degree of fusion as for the control.
T154 21519-21577 Sentence denotes Extent of fusion is quantified in the bar graphs. (n = 3).
T155 21579-21675 Sentence denotes GA inhibition of enveloped viruses correlates with inhibition of viral DNA and protein synthesis
T156 21676-21825 Sentence denotes To validate the PRA observations, we tested whether there is an effect on downstream viral DNA synthesis in HCMV infected cells when treated with GA.
T157 21826-21942 Sentence denotes HFF were inoculated with HCMV for 3 hours, then washed and incubated with different concentrations of GA or vehicle.
T158 21943-22078 Sentence denotes DNA was extracted from 4 pooled wells of HFF at 7 days post inoculation, and then analyzed by qPCR targeting the viral polymerase gene.
T159 22079-22180 Sentence denotes DNA copies were reduced in a dose dependent manner by the addition of GA to culture medium (Fig. 7A).
T160 22181-22334 Sentence denotes Although HCMV DNA copy numbers were reduced by GA, this could be secondary to inhibition of virus entry rather than direct inhibition of DNA replication.
T161 22335-22481 Sentence denotes Figure 7 GA inhibits HSV-1 replication by inhibition of viral protein synthesis and HCMV by DNA synthesis. (A) Effect of GA on HCMV DNA synthesis.
T162 22482-22609 Sentence denotes Viral replication is inhibited in the presence of increasing concentration of GA, as determined by decreasing viral DNA copies.
T163 22610-22723 Sentence denotes DNA was extracted from 4 pooled wells of HFF at 7 dpi, then analyzed by qPCR targeting the viral polymerase gene.
T164 22724-22894 Sentence denotes DNA copies were reduced in a dose dependent manner by the addition of GA to culture medium as determined by ANOVA analysis with pairwise post-hoc t-test analysis in SPSS.
T165 22895-22993 Sentence denotes Data are presented as mean percent of control. (*5 µM p = 0.014, 8 µM p = 0.003, 10 µM p = 0.002).
T166 22994-23185 Sentence denotes 6 well cultures of HEp-2 (B) or 293T (C) were infected with HSV-1 strain F at an MOI of 1 for 2 hours, then washed with 199V and supplemented with 10 µM GA (Lanes 1–4) or vehicle (Lanes 5–8).
T167 23186-23396 Sentence denotes Mock (M), 5, 11 and 24 hours after inoculation, cells were collected and a fraction of the total cell lysate was subject to Western Blot analysis using antibodies directed against ICP8, ICP27, β-Actin and US11.
T168 23397-23459 Sentence denotes Normalized ratios of protein expression are in the bar graphs.
T169 23460-23544 Sentence denotes Viral protein synthesis was determined in HSV-infected cells following GA treatment.
T170 23545-23755 Sentence denotes Untreated HEp-2 and 293T cells were infected with HSV-1 F’ at an MOI of 1 for 2 hours, allowing the virions to internalize into the cells, then washed with 199V medium and supplemented with 10 µM GA or vehicle.
T171 23756-23836 Sentence denotes The viral replication was evaluated by Western Blot detection of HSV-1 proteins.
T172 23837-24043 Sentence denotes Although the infection of HEp-2 and 293T cells had been initiated, the addition of 10 µM GA to the infected HEp-2 and 293T cells inhibited the virus replication from the point of exposure to GA (Fig. 7B,C).
T173 24044-24122 Sentence denotes The observed effect could be the result of inhibition of secondary infections.
T174 24123-24326 Sentence denotes However, the early down regulation of HSV proteins, occurring prior to a complete viral replication cycle, suggests that there could be a secondary inhibitory mechanism targeting viral protein synthesis.
T175 24328-24338 Sentence denotes Discussion
T176 24339-24436 Sentence denotes The Ginkgolic acids C13:0, C15:1 and C17:1 are commercially available compounds of Ginkgo leaves.
T177 24437-24689 Sentence denotes The antioxidative activity of GA has been reported to have multiple therapeutic effects including the treatment of cardiovascular disease, HIV infection, bacterial infections such as Escherichia coli and Staphylococcus aureus, and some tumors7,8,19,20.
T178 24690-25050 Sentence denotes It has been suggested that GA may operate by several other pathways including: inhibition of fatty acid synthase10; non-specific SIRT inhibition11; activation of protein phosphatase type-2C12; suppression of STAT3 activation through induction of PTEN and SHP-1 Tyrosine Phosphatase21, and protection against Aβ-induced synaptic dysfunction in the hippocampus6.
T179 25051-25254 Sentence denotes In this study, we are the first to report the fusion inhibitory effect of GA on enveloped viruses representing the three classes of fusion proteins and the inhibition of a non-enveloped human adenovirus.
T180 25255-25354 Sentence denotes We also report a potential secondary mechanism of action involving viral DNA and protein synthesis.
T181 25355-25466 Sentence denotes Our results are consistent with previous reports of the inhibitory effect of GA on DNA and protein synthesis22.
T182 25467-25564 Sentence denotes The mechanism of action through which GA affects DNA and protein synthesis is not yet understood.
T183 25565-25762 Sentence denotes It may bind to the host cell receptors and activate different cell signaling pathways and/or cause cell cycle arrest, which may explain the inhibitory effect of GA on rapidly dividing cancer cells.
T184 25763-25838 Sentence denotes It may also enter the cells and work directly on DNA and protein synthesis.
T185 25839-25890 Sentence denotes Experiments to address these questions are ongoing.
T186 25891-25983 Sentence denotes To assess the effect of GA on infectious viruses, we performed GA dose-response experiments.
T187 25984-26071 Sentence denotes The cells were treated with different GA concentrations ranging between 1 µM and 20 µM.
T188 26072-26143 Sentence denotes We demonstrated a dose dependent effect of GA on HCMV, HSV-1, and ZIKV.
T189 26144-26309 Sentence denotes The effect of GA was tested in several cell types including HEp-2 (human epithelial carcinoma), 293T (human embryonic kidney), HFF and NHA (normal human astrocytes).
T190 26310-26440 Sentence denotes GA was shown to have a viral inhibitory effect in all of the tested cells with no cytotoxicity within the active inhibitory range.
T191 26441-26558 Sentence denotes Berg et al. evaluated the cytotoxicity and mutagenicity of GA in male Chinese hamster lung fibroblasts (V79 cells)23.
T192 26559-26712 Sentence denotes Their results showed toxicity on cells grown in DMEM supplemented with 10% FBS after 24 hours in GA concentrations above 50 µM, with no mutagenic effect.
T193 26713-26877 Sentence denotes Ahlemeyer et al. reported that 500 µM GA induced neuronal death and activated protein phosphatase type-2C in chick embryonic neurons growing in DMEM with 20% FBS12.
T194 26878-27031 Sentence denotes B.M Hausen, evaluated the sensitizing capacity of GA in guinea pigs, determining 1000 ppm (2.886 mM) GA as safe to avoid inducing an allergic reaction24.
T195 27032-27145 Sentence denotes Viral infections of permissive cells are regularly performed in 199 or MEM medium supplemented with 1% or 2% FBS.
T196 27146-27339 Sentence denotes However, when we tested the activity and toxicity of GA on the cells used in our research, we also incubated the cells with GA in the cells’ recommended growth medium (see results and Fig. S1).
T197 27340-27452 Sentence denotes The results indicated that the activity and toxicity of GA is affected by the serum concentration in the medium.
T198 27453-27614 Sentence denotes We concluded that GA interacts with serum factors, which lowers its antiviral activity, and researchers using GA should address this issue in future experiments.
T199 27615-27738 Sentence denotes In vivo experiments in an animal model are needed to assess the actual therapeutic antiviral effect and cytotoxicity of GA.
T200 27739-27877 Sentence denotes GA’s universal inhibition of viral protein-mediated cell-cell fusion indicates that its inhibitory effect is by a common fusion mechanism.
T201 27878-28006 Sentence denotes LPC also universally blocks membrane fusion; it does so by conferring spontaneous positive curvature, which prevents hemifusion.
T202 28007-28133 Sentence denotes This block can be relieved, regardless of fusion protein, by the addition of the negative spontaneous curvature agent OA25,26.
T203 28134-28327 Sentence denotes The finding that OA relieves the GA-induced inhibition of EBOV GP-mediated fusion implies that, similar to LPC, GA acts by producing positive spontaneous curvature and this prevents hemifusion.
T204 28328-28498 Sentence denotes A number of rigid amphipathic fusion inhibitors (RAFI) with positive spontaneous curvature have been shown to inhibit fusion induced by unrelated viral fusion proteins27.
T205 28499-28690 Sentence denotes In the future, it would be interesting to measure the values of the spontaneous curvatures of GA and RAFI and to relate them to the concentration of OA necessary to relieve fusion inhibition.
T206 28691-28893 Sentence denotes For the inhibition of non-enveloped adenovirus, we suggest that since GA affects lipid bilayer curvature, it would be predicted to affect the endocytic entry of a non-enveloped virus such as adenovirus.
T207 28894-29111 Sentence denotes In addition, as we report here, GA appears to have potential secondary mechanisms of viral DNA and protein synthesis inhibition, and these would be predicted to be targeted in both enveloped and non-enveloped viruses.
T208 29112-29307 Sentence denotes In conclusion, we have shown a consistent inhibitory effect of GA on the fusion of a variety of enveloped viruses, including important pathogens such as EBOV, HIV, ZIKA, HSV-1, HCMV, EBV and IAV.
T209 29308-29451 Sentence denotes We also have shown inhibition of a non-enveloped human adenovirus, which suggests a potential inhibitory effect on other non-enveloped viruses.
T210 29452-29573 Sentence denotes Furthermore, we found that GA might possibly inhibit HCMV viral DNA and HSV-1 protein synthesis by a secondary mechanism.
T211 29574-29931 Sentence denotes Thus, in light of the antiviral effect of GA on established viral infections of permissive cells, GA potentially could be used to treat acute viral infections (e.g. Coronavirus (COVID-19), EBOV, ZIKV, IAV and measles), and it might be determined to be useful in topical application for the successful treatment of active lesions (e.g. HSV-1, HSV-2 and VZV).
T212 29932-30109 Sentence denotes Finally, our approach for GA usage to inhibit enveloped virus infection is fundamentally different from traditional microbicidal strategies that target virus genome replication.
T213 30110-30254 Sentence denotes We anticipate that it could complement other direct antiviral agents and offer a new class of inhibitors of enveloped and non-enveloped viruses.
T214 30256-30263 Sentence denotes Methods
T215 30265-30286 Sentence denotes Cells, viruses and GA
T216 30287-30472 Sentence denotes HEp2 cells, obtained from the American Type Culture Collection (ATCC Rockville, MD), were grown in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 5% fetal bovine serum (FBS).
T217 30473-30565 Sentence denotes HEK293T/17 (293T) cells obtained from the ATCC were grown in DMEM supplemented with 10% FBS.
T218 30566-30659 Sentence denotes HSV-1 strain F, a limited-passage isolate, is the prototype strain used in this laboratory28.
T219 30660-30727 Sentence denotes GFP-HSV-1 (strain 17), was a generous gift from Dr. Peter O’Hare29.
T220 30728-30917 Sentence denotes Vero cells obtained from the ATCC were cultured in complete DMEM (cDMEM) containing 10% FBS, 2 mM L-glutamine, 100 U/mL penicillin/streptomycin, and 10 mM Hepes buffer at 37 °C with 5% CO2.
T221 30918-31182 Sentence denotes Fetal-derived Normal Human Astrocytes (NHA, Lonza) were maintained in Astrocyte Growth Medium (AGM, Lonza) supplemented with 0.3% FBS, 30 µl/mL ascorbic acid, 1 µl/mL rhEGF, 30 µg/mL gentamicin, 15 μg/mL amphotericin B, 2.5 µl/mL insulin, and 10 µl/mL L-glutamine.
T222 31183-31235 Sentence denotes Early passages (1–4) were used in these experiments.
T223 31236-31334 Sentence denotes HCMV studies were performed using cell-associated low-passage clinical isolates CH1914 and BI-615.
T224 31335-31444 Sentence denotes CH19 is resistant to the first-line HCMV antiviral drug, ganciclovir (GCV), while BI-6 is susceptible to GCV.
T225 31445-31579 Sentence denotes Additional experiments were performed using CMVPT30-GFP16, which expresses green fluorescent protein and produces extracellular virus.
T226 31580-31802 Sentence denotes ZIKV strain PRVABC59 obtained from the American Type Culture Collection (ATCC; Manassas, VA) was propagated in Vero cells grown in T-150 flasks by infection at 1:50 dilution of viral stock (MOI 0.25) in the absence of FBS.
T227 31803-31881 Sentence denotes The medium was removed and replaced 6 h post-infection (hpi) with fresh cDMEM.
T228 31882-32043 Sentence denotes Supernatant was collected at 72 hpi, clarified by centrifugation at 350 × g for 5 min, and filtered through a 0.45-μm surfactant-free cellulose acetate membrane.
T229 32044-32178 Sentence denotes For mock infections, supernatant was collected from uninfected Vero cells and prepared by the same protocol used to make virus stocks.
T230 32179-32212 Sentence denotes Virus was titered by focus assay.
T231 32213-32587 Sentence denotes Briefly, infected Vero cells, 24 hpi were fixed and permeabilized using Cytofix/Cytoperm Solution Kit (BD Biosciences) according to the manufacturer’s instructions and stained with a mouse monoclonal antibody (mAb) specific for flavivirus group envelope proteins (1:250; EMD Millipore; clone D1–4G2-4-15) followed by incubation with an anti-mouse IgG - PE (1:1000 dilution).
T232 32588-32748 Sentence denotes Samples were run through an LSR II flow cytometer and data were collected with FACSDiva software (BD Biosciences) and analyzed using FlowJo Software (TreeStar).
T233 32749-32786 Sentence denotes Human Adenovirus Type5 (dE1/E3), Cat.
T234 32787-32791 Sentence denotes No.:
T235 32792-32832 Sentence denotes 1060, was purchased from Vector Biolabs.
T236 32833-32910 Sentence denotes GA C13:0, C15:1, and C17:1, were purchased from Sigma Aldrich, St. Louis, MO.
T237 32911-32974 Sentence denotes GA was diluted in methanol or DMSO to a concentration of 50 mM.
T238 32975-33104 Sentence denotes Effects of GA in all assays and models used in this study have been compared to vehicle-treated (i.e. methanol or DMSO) controls.
T239 33105-33179 Sentence denotes Cells or viral stocks were treated with the indicated concentration of GA.
T240 33181-33202 Sentence denotes Western blot analyses
T241 33203-33415 Sentence denotes For HSV-1, cells were harvested at the indicated times, collected by low-speed centrifugation and rinsed in PBS, then resuspended in RIPA lysis buffer and protease inhibitors (Complete Protease Inhibitor; Roche).
T242 33416-33492 Sentence denotes Approximately 60 μg of protein per sample was subjected to further analysis.
T243 33493-33703 Sentence denotes Proteins were electrophoretically separated on 8 to 10% denaturing polyacrylamide gels, electrically transferred to nitrocellulose sheets, blocked by 5% BSA in Tween PBS and reacted with the primary antibodies.
T244 33704-33861 Sentence denotes The mouse monoclonal antibody to US11 (Goodwin Institute for Cancer Research), and the mouse monoclonal antibody to ICP8, were used at a dilution of 1:1,000.
T245 33862-33933 Sentence denotes The mouse monoclonal antibody to ICP27 was used at a dilution of 1:250.
T246 33934-34014 Sentence denotes The mouse monoclonal antibody to β-actin (Sigma) was used at a 1:5,000 dilution.
T247 34015-34154 Sentence denotes Membranes were then reacted with the appropriate secondary antibody conjugated either to alkaline phosphatase or to horseradish peroxidase.
T248 34155-34387 Sentence denotes Protein bands were visualized with 5-bromo-4-chloro-3-indolylphosphate–nitroblue tetrazolium (Denville Scientific, Inc.) or with ECL Western Blot detection reagents (Amersham Biosciences) according to the manufacturer’s instruction.
T249 34389-34407 Sentence denotes Cytotoxicity tests
T250 34408-34500 Sentence denotes Cells grown in 96 or 48 well plates were exposed to different concentrations of GA for 24 h.
T251 34501-34604 Sentence denotes Cell viability was determined by Alamarblue® assay (Thermo Fisher Scientific, Catalog number: DAL1025).
T252 34605-34706 Sentence denotes Pair-wise Student t-tests were used to compare the outcome of a treatment as compared to the control.
T253 34707-34734 Sentence denotes Error bars are SEM (n ≥ 3).
T254 34736-34759 Sentence denotes Viral stock preparation
T255 34760-35091 Sentence denotes Confluent Vero cells in 75-cm2 flasks were infected with HSV in 3 ml of 199V (Gibco; 199 medium supplemented with 1% heat-inactivated FBS and 1% penicillin/streptomycin) medium at a multiplicity of infection (MOI) of 0.01 pfu/cell and incubated by gentle shaking for 2 hours at 37 °C with 5% CO2 to allow cells to absorb the virus.
T256 35092-35193 Sentence denotes After 2 hours, 199 V was aspirated from the cell culture and Vero cells were gently washed with DPBS.
T257 35194-35338 Sentence denotes 3 ml of fresh DMEM/5% FBS medium was added and the cells were incubated for 2 to 3 days until 100% of the cells display cytopathic effect (CPE).
T258 35339-35494 Sentence denotes When 100% CPE was observed, the flask was placed at −80 °C for 15 min, then allowed to warm up at room temperature and 3 ml of cold sterile milk was added.
T259 35495-35554 Sentence denotes The cells were collected into a 15 ml tube and kept on ice.
T260 35555-35830 Sentence denotes To free virus particles from the cellular debris, Vero cells were sonicated three times (letting the cell suspension cool on ice for 1 min between sonications), for 30 seconds using a Branson Sonifier with microtip at an output setting of 4 (approximate Power Output of 15%).
T261 35831-35937 Sentence denotes The virus stock was aliquoted and transferred to sterile, screw-capped cryovials and was stored at −80 °C.
T262 35938-35985 Sentence denotes The viral titer was determined by plaque assay.
T263 35987-36005 Sentence denotes HSV-1 plaque assay
T264 36006-36226 Sentence denotes GA (10 µM) was incubated on the monolayers of Vero cells (6-well plate) with 199V (Gibco; supplemented with 1% heat-inactivated fetal bovine serum and 1% penicillin/streptomycin) at 37 °C for 1 hour prior to inoculation.
T265 36227-36323 Sentence denotes Following incubation, the supernatants were aspirated and cells were washed two times with DPBS.
T266 36324-36422 Sentence denotes GFP-HSV-1 strain 17+29, at an MOI of 1 was incubated on the cells with 199V at 37 °C for 24 hours.
T267 36423-36465 Sentence denotes The supernatant was collected and titered.
T268 36466-36660 Sentence denotes Various 10-fold dilutions of collected supernatants were incubated on monolayers of fresh Vero cells (6-well plate) at 37 °C on a shaker for 2 h to allow the virus to attach and enter the cells.
T269 36661-36919 Sentence denotes The supernatants were aspirated and cells were incubated with 20 mg/mL of human serum (Sigma-H4522) in DMEM (Dulbecco’s Modified Eagle’s medium, supplemented with 5% FBS and 1% penicillin/streptomycin) for 3 days at 37 °C in 5% CO2 to allow plaque formation.
T270 36920-37106 Sentence denotes For plaque counting, the cells were fixed with 100% methanol for 5 min. at room temperature and stained with 10% KaryoMax Giemsa stain in distilled water for 20 min. at room temperature.
T271 37107-37205 Sentence denotes Viral titer was calculated through plaque counting and expressed as plaque-forming units (PFU)/ml.
T272 37207-37219 Sentence denotes ZIKV studies
T273 37220-37315 Sentence denotes Cell free ZIKV in 199V medium was pretreated with 10 µM/ml GA or with DMSO for 1 hour at 37 °C.
T274 37316-37429 Sentence denotes The pretreated ZIKV was used to infect Vero cells grown in 6 well plates >80% confluency with 0.5 MOI for 1 hour.
T275 37430-37534 Sentence denotes The infected cells were washed twice with warm DPBS and supplemented with DMEM supplemented with 5% FBS.
T276 37535-37650 Sentence denotes Supernatant was collected at 4, 24 and 48 hours post-inoculation for cell-free viral RNA copy number determination.
T277 37651-37790 Sentence denotes NHA were grown in 24 well plates to >80% confluency, treated with GA C15:1 (0–20 µM) for 3 h, and then infected with ZIKV at an MOI of 0.3.
T278 37791-37909 Sentence denotes Supernatant was carefully removed and replaced at 12 hpi with fresh AGM replenished with GA at 0–20 µM concentrations.
T279 37910-38146 Sentence denotes Cell viability was assessed at 7 days post-inoculation by Celltiter Aqueous One solution cell proliferation assay (Promega, Madison, WI), and live cells were carefully harvested to extract RNA by the RNeasy kit (Qiagen, Germantown, MD).
T280 38147-38458 Sentence denotes RNA was quantified using a Nanodrop2000 (ThermoFisher), treated with DNaseI (Sigma-Aldrich) for 15 min at room temperature to remove DNA contamination, and subsequently, DNaseI was inactivated by heating at 70 °C for 15 min. cDNA was synthesized from 0.2–1 μg of RNA using Qscript supermix (Quanta Biosciences).
T281 38459-38646 Sentence denotes Quantitative real-time PCR (qRT-PCR) reactions were performed in a 20 μl solution containing 10 μl TaqMan Gene Expression Master Mix (Life Technologies), 500 nM primers, and 300 nM probe.
T282 38647-38779 Sentence denotes Reactions were performed in an Applied Biosystems 7900HT sequence detection system (Thermo Fisher Scientific) using SDS2.3 software.
T283 38780-38905 Sentence denotes The reaction conditions were, 50 °C for 2 min, 95 °C for 10 min, followed by 45 cycles of 95 °C for 15 s and 60 °C for 1 min.
T284 38906-39007 Sentence denotes Samples were run in duplicate or triplicates, and template controls were included wherever necessary.
T285 39008-39145 Sentence denotes Fold change in RNA expression was calculated by relative quantification using the comparative CT method with GAPDH as endogenous control.
T286 39146-39239 Sentence denotes The primers and probe were designed using the PrimerQuest tool (Integrated DNA Technologies).
T287 39240-39285 Sentence denotes The sequences of the primers were as follows:
T288 39286-39564 Sentence denotes ZIKV-F-CGCTGCCCAACACAAGGT; ZIKV-R-, GCTCCCTTTGCCAAAAAGTCCACA, and ZIKV-probe, 5′/56-FAM/ACCTTGACA/ZEN/AGCAGTCAGACACTCAA/3IABkFQ; and human specific GAPDH-F-GGTGTGAACCATGAGAAGTATGA; GAPDH-R-GAGTCCTTCCACGATACCAAAG; and GAPDH-probe, 5′/56-FAM/AGATCATCA/ZEN/GCAATGCCTCCTGCA/3IABkFQ.
T289 39566-39578 Sentence denotes HCMV studies
T290 39579-39750 Sentence denotes HFF were grown in 24 well plates to 100% confluency in MEM with 10% FBS to establish viral inhibition of two low-passage clinical strains (BI-6 and CH19) via plaque assay.
T291 39751-39910 Sentence denotes Cells infected with low-passage HCMV clinical strains (CH19 and BI6) do not release extracellular virus, but they display typical HCMV cytopathic effect (CPE).
T292 39911-39985 Sentence denotes The percentage of infected cells was estimated visually in HFF monolayers.
T293 39986-40075 Sentence denotes Dilutions of trypsinized cells were used as inocula for HFF monolayers in 24 well plates.
T294 40076-40203 Sentence denotes After 7 days in culture, plaques were counted to determine the average number of plaques in 4-well replicates of each dilution.
T295 40204-40293 Sentence denotes The optimal dilution for each virus strain produced an average of 60–80 plaques per well.
T296 40294-40370 Sentence denotes CMVPT30-GFP having undergone multiple passages produces extracellular virus.
T297 40371-40454 Sentence denotes Viral infection was quantitatively determined by PRA of culture supernatant medium.
T298 40455-40649 Sentence denotes Cells were either exposed to GA for three hours prior to inoculation, or were inoculated prior to addition of medium containing GA at concentrations of 1, 2, 5, 10, and 20 µM in MEM with 1% FBS.
T299 40650-40715 Sentence denotes One set of four wells was treated with DMSO as a vehicle control.
T300 40716-40805 Sentence denotes For each experiment the remaining concentrations were represented in quadruplicate wells.
T301 40806-40995 Sentence denotes Plates were read beginning at 7 days post inoculation (dpi) to determine the GA concentration producing a reduction of 50% in the number of plaques relative to vehicle control wells (IC50).
T302 40996-41138 Sentence denotes Data were normalized to the vehicle controls, and probit analysis in SPSS was used to obtain 95% confidence intervals of the mean IC50 values.
T303 41140-41176 Sentence denotes HCMV DNA extraction and quantitation
T304 41177-41260 Sentence denotes HCMV infected monolayers were trypsinized and pooled at the termination of the PRA.
T305 41261-41354 Sentence denotes DNA was extracted from the pooled monolayers using the Blood gDNA kit (Promega, Madison, WI).
T306 41355-41449 Sentence denotes HCMV DNA was quantitated using a validated in-house assay, which targets the DNA polymerase30.
T307 41450-41532 Sentence denotes Reactions were performed on an Applied Biosystems 7500 (Thermo Fisher Scientific).
T308 41534-41569 Sentence denotes Infection of GFP-expressing viruses
T309 41570-41675 Sentence denotes Monolayers of Vero cells were incubated for 1 hour with medium containing 10 µM GA C15:1 or DMSO vehicle.
T310 41676-41881 Sentence denotes The cells then were inoculated with a replication-defective human adenovirus type 5 (dE1/E3) containing GFP (Ad-GFP) or GFP-HSV-1 virus, at an MOI of 0.5 in a medium containing 10 µM GA C15:1 for 24 hours.
T311 41882-41933 Sentence denotes Infection was evaluated by fluorescence microscopy.
T312 41935-41959 Sentence denotes Cell-cell fusion vectors
T313 41960-42063 Sentence denotes In these experiments, we used cell-cell fusion systems of ZIKV, HIV, EBOV, IVA, VEEV, VSV, SFV and EBV.
T314 42064-42148 Sentence denotes The plasmids, fusion proteins, and the related references are described in Table S2.
T315 42150-42168 Sentence denotes Fusion experiments
T316 42169-42242 Sentence denotes Nucleated cell-cell fusion, experiments were performed as described31,32.
T317 42243-42387 Sentence denotes Calcein-AM was loaded into effector cells expressing the fusion protein, and 7-amino-4-chloromethylcoumarin (CMAC) was loaded into target cells.
T318 42388-42424 Sentence denotes Mixing of dyes was scored as fusion.
T319 42425-42572 Sentence denotes Fusion experiments for each viral protein were performed as previously described: EBOV GP32; HIV33; SFV E1/E2 and IAV HA34; VEEV E, VSV, and EBV35.
T320 42573-42677 Sentence denotes Unless stated otherwise, EBOV GP was used as the fusion protein and C15:1 GA was used to inhibit fusion.
T321 42678-42762 Sentence denotes As shown in Fig. 2B, C15:1 GA inhibited fusion for the eight tested fusion proteins.
T322 42763-42838 Sentence denotes Figure 2C documents that fusion was blockaded by GA C13:0, C15:1, or C17:1.
T323 42840-42860 Sentence denotes Statistical analysis
T324 42861-42941 Sentence denotes For HCMV plaque assays, data were analyzed using one-way ANOVA analysis in SPSS.
T325 42942-43019 Sentence denotes For BI6 n = 25; degrees of freedom between groups = 4 and within groups = 20.
T326 43020-43042 Sentence denotes The F value is 68.827.
T327 43043-43121 Sentence denotes For CH19 n = 24; degrees of freedom between groups = 4 and within groups = 19.
T328 43122-43144 Sentence denotes The F value is 41.090.
T329 43145-43283 Sentence denotes For fusion experiments, Pair-wise Student t-tests were used to compare the outcome of a manipulation on fusion as compared to the control.
T330 43284-43311 Sentence denotes Error bars are SEM (n ≥ 3).
T331 43312-43366 Sentence denotes HCMV DNA copy numbers expressed as percent of control.
T332 43367-43400 Sentence denotes Significance was set at P < 0.05.
T333 43401-43450 Sentence denotes P values were obtained using a two-tailed t-test.
T334 43451-43496 Sentence denotes All measurements were performed in duplicate.
T335 43497-43539 Sentence denotes Standard curves were included on each run.
T336 43540-43657 Sentence denotes For ZIKV, the data were analyzed using unpaired, two tailed student’s t test and represented as mean± standard error.
T337 43658-43788 Sentence denotes Experiments were done independently at least three times and a value of p ≤ 0.05 indicated a statistically significant difference.
T338 43790-43815 Sentence denotes Supplementary information
T339 43817-43843 Sentence denotes Supplementary Information.
T340 43845-43980 Sentence denotes Publisher’s note Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
T341 43982-44007 Sentence denotes Supplementary information
T342 44008-44066 Sentence denotes is available for this paper at 10.1038/s41598-020-61700-0.
T343 44068-44088 Sentence denotes Author contributions
T344 44089-44169 Sentence denotes R.B., E.S.G., N.S.L., F.S.C. and L.A.-H. conceived and designed the experiments.
T345 44170-44240 Sentence denotes R.B., B.A.H., R.M.M., S.D.N., M.B. and O.S. performed the experiments.
T346 44241-44332 Sentence denotes R.B., B.A.H., R.M.M., S.D.N., E.S.G., N.S.L., F.S.C., L.A.-H. and D.A.N. analyzed the data.
T347 44333-44398 Sentence denotes R.B., E.S.G., N.S.L., F.S.C., L.A.-H. and D.A.N. wrote the paper.
T348 44400-44417 Sentence denotes Data availability
T349 44418-44595 Sentence denotes All data generated or analyzed during this study are included in this published article and its supplementary information files, or they have been placed in public repositories.
T350 44597-44616 Sentence denotes Competing interests
T351 44617-44660 Sentence denotes The authors declare no competing interests.

LitCovid-PD-HP

Id Subject Object Predicate Lexical cue hp_id
T1 4099-4111 Phenotype denotes encephalitis http://purl.obolibrary.org/obo/HP_0002383
T2 4183-4193 Phenotype denotes stomatitis http://purl.obolibrary.org/obo/HP_0010280
T3 18303-18315 Phenotype denotes Encephalitis http://purl.obolibrary.org/obo/HP_0002383
T4 18356-18366 Phenotype denotes Stomatitis http://purl.obolibrary.org/obo/HP_0010280
T5 24552-24574 Phenotype denotes cardiovascular disease http://purl.obolibrary.org/obo/HP_0001626
T6 25749-25755 Phenotype denotes cancer http://purl.obolibrary.org/obo/HP_0002664
T7 26228-26237 Phenotype denotes carcinoma http://purl.obolibrary.org/obo/HP_0030731
T8 33765-33771 Phenotype denotes Cancer http://purl.obolibrary.org/obo/HP_0002664

2_test

Id Subject Object Predicate Lexical cue
32179788-26392712-138463415 2078-2079 26392712 denotes 1
32179788-19195661-138463416 2246-2247 19195661 denotes 2
32179788-10766484-138463417 2569-2570 10766484 denotes 3
32179788-25895130-138463418 2893-2894 25895130 denotes 4
32179788-29113214-138463418 2893-2894 29113214 denotes 4
32179788-27833555-138463418 2893-2894 27833555 denotes 4
32179788-22847190-138463418 2893-2894 22847190 denotes 4
32179788-24457153-138463419 2986-2987 24457153 denotes 8
32179788-19246003-138463420 3132-3133 19246003 denotes 9
32179788-22380770-138463421 3168-3170 22380770 denotes 10
32179788-24998427-138463422 3200-3202 24998427 denotes 11
32179788-11698056-138463423 3249-3251 11698056 denotes 12
32179788-25866377-138463424 3961-3963 25866377 denotes 13
32179788-12198609-138463425 6844-6848 12198609 denotes 1914
32179788-23661800-138463426 6856-6859 23661800 denotes 615
32179788-12198609-138463427 7161-7163 12198609 denotes 14
32179788-17716703-138463428 7535-7537 17716703 denotes 16
32179788-17043140-138463429 19700-19702 17043140 denotes 17
32179788-14527322-138463430 19908-19910 14527322 denotes 18
32179788-22847190-138463431 24679-24680 22847190 denotes 7
32179788-24457153-138463432 24681-24682 24457153 denotes 8
32179788-15592576-138463433 24683-24685 15592576 denotes 19
32179788-20948210-138463434 24686-24688 20948210 denotes 20
32179788-22380770-138463435 24802-24804 22380770 denotes 10
32179788-24998427-138463436 24834-24836 24998427 denotes 11
32179788-11698056-138463437 24879-24881 11698056 denotes 12
32179788-27833555-138463438 25048-25049 27833555 denotes 6
32179788-28088196-138463439 25463-25465 28088196 denotes 22
32179788-11698056-138463440 26874-26876 11698056 denotes 12
32179788-9744906-138463441 27028-27030 9744906 denotes 24
32179788-9008705-138463442 28127-28129 9008705 denotes 25
32179788-10931871-138463443 28130-28132 10931871 denotes 26
32179788-20823220-138463444 28495-28497 20823220 denotes 27
32179788-4300104-138463445 30656-30658 4300104 denotes 28
32179788-10196307-138463446 30724-30726 10196307 denotes 29
32179788-12198609-138463447 31318-31322 12198609 denotes 1914
32179788-23661800-138463448 31330-31333 23661800 denotes 615
32179788-17716703-138463449 31500-31502 17716703 denotes 16
32179788-10196307-138463450 36344-36346 10196307 denotes 29
32179788-26422187-138463451 41446-41448 26422187 denotes 30
32179788-10590134-138463452 42236-42238 10590134 denotes 31
32179788-26730950-138463453 42239-42241 26730950 denotes 32
32179788-26730950-138463454 42514-42516 26730950 denotes 32
32179788-11038187-138463455 42521-42523 11038187 denotes 33
32179788-17686870-138463456 42545-42547 17686870 denotes 34
32179788-24124539-138463457 42569-42571 24124539 denotes 35