> top > docs > PMC:7019868 > spans > 10602-11247 > annotations

PMC:7019868 / 10602-11247 JSONTXT

Annnotations TAB JSON ListView MergeView

LitCovid-PubTator

Id Subject Object Predicate Lexical cue tao:has_database_id tao:has_standard_notation
200 539-545 Species denotes stocks Tax:3724
201 474-481 Mutation denotes G19470T g.19470G>T

LitCovid-PD-FMA-UBERON

Id Subject Object Predicate Lexical cue fma_id
T54 245-249 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T55 401-408 Body_part denotes protein http://purl.org/sig/ont/fma/fma67257
T56 421-425 Body_part denotes gene http://purl.org/sig/ont/fma/fma74402
T57 582-587 Body_part denotes feces http://purl.org/sig/ont/fma/fma64183

LitCovid-PD-UBERON

Id Subject Object Predicate Lexical cue uberon_id
T3 582-587 Body_part denotes feces http://purl.obolibrary.org/obo/UBERON_0001988

LitCovid-PD-CLO

Id Subject Object Predicate Lexical cue
T124 245-249 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T125 421-425 http://purl.obolibrary.org/obo/OGG_0000000002 denotes gene
T126 443-444 http://purl.obolibrary.org/obo/CLO_0001020 denotes a
T127 530-532 http://purl.obolibrary.org/obo/CLO_0008285 denotes P1
T128 566-573 http://purl.obolibrary.org/obo/NCBITaxon_10239 denotes viruses

LitCovid-PD-CHEBI

Id Subject Object Predicate Lexical cue chebi_id
T49 86-88 Chemical denotes SF http://purl.obolibrary.org/obo/CHEBI_71029
T50 401-408 Chemical denotes protein http://purl.obolibrary.org/obo/CHEBI_36080
T51 530-532 Chemical denotes P1 http://purl.obolibrary.org/obo/CHEBI_60949
T52 592-597 Chemical denotes group http://purl.obolibrary.org/obo/CHEBI_24433

LitCovid-PD-GO-BP

Id Subject Object Predicate Lexical cue
T28 630-644 http://purl.obolibrary.org/obo/GO_0019076 denotes viral shedding

LitCovid-sentences

Id Subject Object Predicate Lexical cue
T78 0-645 Sentence denotes Sequence analysis was conducted as described previously [18,19] and two primer pairs (SF-7: ACTCTCGACTGGACATTC and 2R: CAGACTTCGAGACATCTTTG; 5FR-3: ATTAGAGCGATTCTCCATGAC and 5FR-6: TACACACATTGTGGTGCTATTGAG) targeting the C-terminal end of the S gene, which contained both naturally occurred and artificially introduced marker mutations (Figure 1, asterisks and Table 1), as well as the non-structural protein 15 (nsp 15) gene, which contained a naturally occurred mutation (G19470T) were used to verify the identities of the four P1 viral stocks and the recombinant viruses shed in feces per group at the time point of peak fecal viral shedding.