PMC:5590178 / 7997-14091 JSONTXT

{"project":"2_test","denotations":[{"id":"28882119-24755947-12765636","span":{"begin":384,"end":386},"obj":"24755947"},{"id":"28882119-26865999-12765637","span":{"begin":388,"end":390},"obj":"26865999"},{"id":"28882119-21602908-12765638","span":{"begin":675,"end":677},"obj":"21602908"},{"id":"28882119-16765104-12765639","span":{"begin":941,"end":943},"obj":"16765104"},{"id":"28882119-16959904-12765640","span":{"begin":1022,"end":1024},"obj":"16959904"},{"id":"28882119-21602908-12765641","span":{"begin":3226,"end":3228},"obj":"21602908"},{"id":"28882119-8589427-12765642","span":{"begin":3935,"end":3937},"obj":"8589427"}],"text":"Methods\n\nReagents\nAll chemicals were purchased from Sigma (St. Louis, MO), unless indicated otherwise.\n\nDNA sequencing\nGenomic DNA (gDNA) was extracted from the peripheral blood of subjects using a Wizard Genomic DNA purification kit (Promega, Madison, WI), and all nine exons and exon–intron boundaries of the GFAP were PCR-amplified from the extracted gDNA as described previously [20, 26].\n\nDNA manipulation\nFor the expression study, human GFAP was PCR-amplified from GFAP cDNA (NCBI accession number BC013596, Dharmacon, Lafayette, CO) with specific primers (Table 1), and the resulting PCR product was cloned into the BamHI/EcoRV sites of the pCS4 + −3xFLAG-P2A vector [27]. p.Arg79Cys, p.Arg79His, p.Arg239Cys, p.Arg239His and p.Asp128Asn mutations were individually inserted into the WT GFAP construct by site-directed mutagenesis with specific primers (Table 1). For zebrafish study, the zebrafish gfap regulatory elements (7.4 kb) [25] were cloned into the BglII/SalI sites of a mini-Tol2 (T2AL200R150G) plasmid [28]. EGFP and human GFAP C-terminally fused to a FLAG epitope were then sequentially cloned into the resulting construct (Fig. 2b). All plasmids constructed were verified by DNA sequencing (Macrogen, Daejeon, Korea).\nTable 1 Sequences of primers (5′ → 3′) used to construct plasmids encoding various human GFAP alleles\nAllele Sequences\nWT Forward: TAGTAGGATCCATGGAGAGGAGACGCATCAC\nReverse: TAGTCGATATCATCATCACATCCTTGTGCTCCTGCTTG\np.Arg79Cys Forward: GAGATGATGGAGCTCAATGACtGCTTTGCCAGCTACATCGAG\nReverse: CTCGATGTAGCTGGCAAAGCaGTCATTGAGCTCCATCATCTC\np.Arg79His Forward: GAGATGATGGAGCTCAATGACCaCTTTGCCAGCTACATCGAG\nReverse: CTCGATGTAGCTGGCAAAGtGGTCATTGAGCTCCATCATCTC\np.Asp128Asn Forward: GAGAGCTGCGGCTGCGGCTCaATCAACTCACCGCCAACAG\nReverse: CTGTTGGCGGTGAGTTGATtGAGCCGCAGCCGCAGCTCTC\np.Asp157Asn Forward: GCAGAAGCTCCAGaATGAAACCAACCTG\nReverse: CAGGTTGGTTTCATtCTGGAGCTTCTGC\np.Arg239Cys Forward: CAGCCCTGAAAGAGATCtGCACGCAGTATGAGGCAATG\nReverse: CATTGCCTCATACTGCGTGCaGATCTCTTTCAGGGCTG\np.Arg239His Forward: CAGCCCTGAAAGAGATCCaCACGCAGTATGAGGCAATG\nReverse: CATTGCCTCATACTGCGTGtGGATCTCTTTCAGGGCTG\nLower case indicates mutated nucleotides\nFig. 2 Protein expression levels of mutant alleles were comparable to that of WT GFAP. a HEK293T cells were transfected with plasmid encoding EGFP or indicated alleles of GFAP C-terminally fused to a FLAG epitope, and processed for Western blotting with anti-FLAG antibody. Anti-GAPDH (glyceraldehyde-3-phosphate dehydrogenase) antibody was used as a loading control. b Quantitation of GFAP band intensity in (a) normalized to GAPDH band intensity (n = 3). NS: not significant\n\nCell culture and western blotting\nHEK293T cells were purchased from American Type Culture Collection (Manassas,VA), cultured in Dulbecco’s modified Eagle’s media (Welgene, Daegu, Korea) supplemented with 10% fetal bovine serum (Thermo Fisher Scientific Korea, Seoul, Korea), and transfected with plasmid using Lipofectamine 2000 (Thermo Fisher Scientific Korea) according to the manufacturer’s instructions. Subsequently, the cells were lysed with M-PER mammalian protein extraction reagent (Thermo Fisher Scientific Korea) at 48 h post-transfection, and processed for Western blotting as described previously [27]. The antibodies used were anti-FLAG antibody (1:2000, Sigma-Aldrich, catalog number F1804), anti-glyceraldehyde-3-phosphate dehydrogenase (anti-GAPDH) antibody (1:2000, Trevigen, Gaithersburg, MD, 2275-PC-100), HRP-conjugated goat anti-mouse antibody (1:4000, Santa Cruz Biotechnology, Dallas, TX, sc-2005), and HRP-conjugated goat anti-rabbit antibody (1:4000, Santa Cruz Biotechnology, sc-2004). Band intensity on the Western blots was analyzed using ImageJ.\n\nZebrafish study\nWild-type (WT) zebrafish (AB strain) were obtained from the Zebrafish International Resource Center (Eugene, OR), maintained using standard procedures [29] and staged in hours post-fertilization (hpf) as per standard criteria [30]. One-cell stage zebrafish embryos were microinjected with GFAP expression constructs (50 pg), anesthetized at 30 hpf in 0.02% tricane, mounted with 3% methylcellulose and imaged with an LSM 510 CLM (Zeiss, Hamburg, Germany). Z-series of images (15 images; interval thickness: 1.0 μm) were collected and presented as a stacking image. Resulting images were assembled using Adobe Photoshop (San Jose, CA), and aggregations were counted blindly.\n\nStatistical analysis\nP values [31] were determined with the two-tailed paired Student’s t test. P \u003c 0.05 was considered statistically significant.\n\nTransmission electron microscopy (TEM)\nTEM was performed in the Electron Microscopy Facility at Yonsei Biomedical Reseach Institute at Yonsei University College of Medicine. In brief, zebrafish embryos injected with expression plasmids encoding WT or p.Arg79Cys GFAP were fixed at 30 hpf in 0.1 M phosphate buffer (pH 7.4) with 2% glutaraldehyde (Merck, Darmstadt, Germany) and paraformaldehyde (Merck) for 12 h, washed in 0.1 M phosphate buffer, post-fixed with 1% OsO4 in 0.1 M phosphate buffer for 90 min, dehydrated with an ascending ethanol series (50%, 60%, 70%, 80%, 90%, 95% and 100%) for 10 min each, and infiltrated with propylene oxide for 10 min. Subsequently, specimens were embedded with a Poly/Bed 812 embedding kit (Polysciences, Warrington, PA), polymerized in an electron microscope oven (TD-700, DOSAKA, Kyoto, Japan) at 65 °C for 12 h, cut into 200 nm thick semi-thin sections using an EM UC7 ultramicrotome (Leica Microsystems, Wetzlar, Germany) with a diamond knife (DiATOME, Hatfield, PA), stained with toluidine blue and observed with a light microscope. The region of interest was then cut into 80 nm thick ultra-thin sections using the ultramicrotome, placed on copper grids, stained in 4% uranyl acetate (Electron Microscopy Sciences, Hatfield, PA) for 20 min followed by lead citrate (Thermo Fisher Scientific Korea) for 10 min, and imaged with a transmission electron microscope (JEM-1011, JEOL, Tokyo, Japan) equipped with a MegaView III CCD camera (Olympus Soft Imaging Solutions, Lakewood, CO) at the acceleration voltage of 80 kV."}