Id |
Subject |
Object |
Predicate |
Lexical cue |
T13310 |
0-3 |
DT |
denotes |
The |
T13311 |
24-32 |
NN |
denotes |
promoter |
T13312 |
4-7 |
CD |
denotes |
2.2 |
T13313 |
8-10 |
NN |
denotes |
kb |
T13314 |
7-8 |
HYPH |
denotes |
- |
T13315 |
11-17 |
JJ |
denotes |
murine |
T13316 |
18-23 |
NN |
denotes |
Snail |
T13317 |
37-46 |
VBN |
denotes |
generated |
T13318 |
33-36 |
VBD |
denotes |
was |
T13319 |
47-49 |
IN |
denotes |
by |
T13320 |
50-53 |
NN |
denotes |
PCR |
T13321 |
54-59 |
VBG |
denotes |
using |
T13322 |
60-61 |
DT |
denotes |
a |
T13323 |
70-76 |
NN |
denotes |
primer |
T13324 |
62-69 |
JJ |
denotes |
forward |
T13325 |
77-81 |
IN |
denotes |
with |
T13326 |
82-84 |
DT |
denotes |
an |
T13327 |
97-105 |
NN |
denotes |
sequence |
T13328 |
85-89 |
NN |
denotes |
XbaI |
T13329 |
90-96 |
NN |
denotes |
linker |
T13330 |
105-107 |
, |
denotes |
, |
T13331 |
107-108 |
CD |
denotes |
5 |
T13332 |
111-141 |
NN |
denotes |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
T13333 |
108-109 |
SYM |
denotes |
′ |
T13334 |
109-110 |
HYPH |
denotes |
- |
T13335 |
141-142 |
HYPH |
denotes |
- |
T13336 |
142-143 |
CD |
denotes |
3 |
T13337 |
143-144 |
SYM |
denotes |
′ |
T13338 |
144-146 |
, |
denotes |
, |
T13339 |
146-151 |
IN |
denotes |
along |
T13340 |
152-156 |
IN |
denotes |
with |
T13341 |
157-158 |
DT |
denotes |
a |
T13342 |
167-173 |
NN |
denotes |
primer |
T13343 |
159-166 |
JJ |
denotes |
reverse |
T13344 |
174-178 |
IN |
denotes |
with |
T13345 |
179-180 |
DT |
denotes |
a |
T13346 |
194-202 |
NN |
denotes |
sequence |
T13347 |
181-186 |
NN |
denotes |
BglII |
T13348 |
187-193 |
NN |
denotes |
linker |
T13349 |
202-204 |
, |
denotes |
, |
T13350 |
204-205 |
CD |
denotes |
5 |
T13351 |
235-239 |
NN |
denotes |
GTAG |
T13352 |
205-206 |
SYM |
denotes |
′ |
T13353 |
206-207 |
HYPH |
denotes |
- |
T13354 |
208-233 |
NN |
denotes |
AGATCTGTTGGCCAGAGCGACCTAG |
T13355 |
233-234 |
HYPH |
denotes |
- |
T13356 |
239-240 |
HYPH |
denotes |
- |
T13357 |
240-241 |
CD |
denotes |
3 |
T13358 |
241-242 |
SYM |
denotes |
′ |
T13359 |
242-244 |
, |
denotes |
, |
T13360 |
244-247 |
CC |
denotes |
and |
T13361 |
248-253 |
NN |
denotes |
mouse |
T13362 |
262-265 |
NN |
denotes |
DNA |
T13363 |
254-261 |
JJ |
denotes |
genomic |
T13364 |
266-268 |
IN |
denotes |
as |
T13365 |
269-270 |
DT |
denotes |
a |
T13366 |
271-279 |
NN |
denotes |
template |
T13367 |
279-280 |
. |
denotes |
. |
T13368 |
280-472 |
sentence |
denotes |
The PCR product was purified with the Gel Extraction Kit (Qiagen, Valencia, California, United States) and ligated into pCRII-TOPO TA vector (Invitrogen, Carlsbad, California, United States). |
T13369 |
281-284 |
DT |
denotes |
The |
T13370 |
289-296 |
NN |
denotes |
product |
T13371 |
285-288 |
NN |
denotes |
PCR |
T13372 |
301-309 |
VBN |
denotes |
purified |
T13373 |
297-300 |
VBD |
denotes |
was |
T13374 |
310-314 |
IN |
denotes |
with |
T13375 |
315-318 |
DT |
denotes |
the |
T13376 |
334-337 |
NN |
denotes |
Kit |
T13377 |
319-322 |
NN |
denotes |
Gel |
T13378 |
323-333 |
NN |
denotes |
Extraction |
T13379 |
338-339 |
-LRB- |
denotes |
( |
T13380 |
339-345 |
NNP |
denotes |
Qiagen |
T13381 |
345-347 |
, |
denotes |
, |
T13382 |
347-355 |
NNP |
denotes |
Valencia |
T13383 |
355-357 |
, |
denotes |
, |
T13384 |
357-367 |
NNP |
denotes |
California |
T13385 |
367-369 |
, |
denotes |
, |
T13386 |
369-375 |
NNP |
denotes |
United |
T13387 |
376-382 |
NNP |
denotes |
States |
T13388 |
382-383 |
-RRB- |
denotes |
) |
T13389 |
384-387 |
CC |
denotes |
and |
T13390 |
388-395 |
VBN |
denotes |
ligated |
T13391 |
396-400 |
IN |
denotes |
into |
T13392 |
401-406 |
NN |
denotes |
pCRII |
T13393 |
407-411 |
NN |
denotes |
TOPO |
T13394 |
406-407 |
HYPH |
denotes |
- |
T13395 |
415-421 |
NN |
denotes |
vector |
T13396 |
412-414 |
NN |
denotes |
TA |
T13397 |
422-423 |
-LRB- |
denotes |
( |
T13398 |
423-433 |
NNP |
denotes |
Invitrogen |
T13399 |
433-435 |
, |
denotes |
, |
T13400 |
435-443 |
NNP |
denotes |
Carlsbad |
T13401 |
443-445 |
, |
denotes |
, |
T13402 |
445-455 |
NNP |
denotes |
California |
T13403 |
455-457 |
, |
denotes |
, |
T13404 |
457-463 |
NNP |
denotes |
United |
T13405 |
464-470 |
NNP |
denotes |
States |
T13406 |
470-471 |
-RRB- |
denotes |
) |
T13407 |
471-472 |
. |
denotes |
. |
T13408 |
472-653 |
sentence |
denotes |
The promoter was verified by sequencing and digested with XbaI and BglII and subcloned into the pβ-gal BASIC vector (BD Biosciences Clontech, Palo Alto, California, United States). |
T13409 |
473-476 |
DT |
denotes |
The |
T13410 |
477-485 |
NN |
denotes |
promoter |
T13411 |
490-498 |
VBN |
denotes |
verified |
T13412 |
486-489 |
VBD |
denotes |
was |
T13413 |
499-501 |
IN |
denotes |
by |
T13414 |
502-512 |
NN |
denotes |
sequencing |
T13415 |
513-516 |
CC |
denotes |
and |
T13416 |
517-525 |
VBN |
denotes |
digested |
T13417 |
526-530 |
IN |
denotes |
with |
T13418 |
531-535 |
NN |
denotes |
XbaI |
T13419 |
536-539 |
CC |
denotes |
and |
T13420 |
540-545 |
NN |
denotes |
BglII |
T13421 |
546-549 |
CC |
denotes |
and |
T13422 |
550-559 |
VBN |
denotes |
subcloned |
T13423 |
560-564 |
IN |
denotes |
into |
T13424 |
565-568 |
DT |
denotes |
the |
T13425 |
582-588 |
NN |
denotes |
vector |
T13426 |
569-571 |
NN |
denotes |
pβ |
T13427 |
572-575 |
NN |
denotes |
gal |
T13428 |
571-572 |
HYPH |
denotes |
- |
T13429 |
576-581 |
NN |
denotes |
BASIC |
T13430 |
589-590 |
-LRB- |
denotes |
( |
T13431 |
605-613 |
NNP |
denotes |
Clontech |
T13432 |
590-592 |
NNP |
denotes |
BD |
T13433 |
593-604 |
NNP |
denotes |
Biosciences |
T13434 |
613-615 |
, |
denotes |
, |
T13435 |
615-619 |
NNP |
denotes |
Palo |
T13436 |
620-624 |
NNP |
denotes |
Alto |
T13437 |
624-626 |
, |
denotes |
, |
T13438 |
626-636 |
NNP |
denotes |
California |
T13439 |
636-638 |
, |
denotes |
, |
T13440 |
638-644 |
NNP |
denotes |
United |
T13441 |
645-651 |
NNP |
denotes |
States |
T13442 |
651-652 |
-RRB- |
denotes |
) |
T13443 |
652-653 |
. |
denotes |
. |
T13444 |
653-947 |
sentence |
denotes |
The point mutations in the SMAD binding element was generated with the Quik-Change Kit (Stratagene, La Jolla, California, United States) using the forward primer 5′- GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC-3′ and the reverse primer 5′- GCTTTT- CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC-3′. |
T13445 |
654-657 |
DT |
denotes |
The |
T13446 |
664-673 |
NNS |
denotes |
mutations |
T13447 |
658-663 |
NN |
denotes |
point |
T13448 |
706-715 |
VBN |
denotes |
generated |
T13449 |
674-676 |
IN |
denotes |
in |
T13450 |
677-680 |
DT |
denotes |
the |
T13451 |
694-701 |
NN |
denotes |
element |
T13452 |
681-685 |
NN |
denotes |
SMAD |
T13453 |
686-693 |
NN |
denotes |
binding |
T13454 |
702-705 |
VBD |
denotes |
was |
T13455 |
716-720 |
IN |
denotes |
with |
T13456 |
721-724 |
DT |
denotes |
the |
T13457 |
737-740 |
NNP |
denotes |
Kit |
T13458 |
725-729 |
NNP |
denotes |
Quik |
T13459 |
730-736 |
NNP |
denotes |
Change |
T13460 |
729-730 |
HYPH |
denotes |
- |
T13461 |
741-742 |
-LRB- |
denotes |
( |
T13462 |
742-752 |
NNP |
denotes |
Stratagene |
T13463 |
752-754 |
, |
denotes |
, |
T13464 |
754-756 |
NNP |
denotes |
La |
T13465 |
757-762 |
NNP |
denotes |
Jolla |
T13466 |
762-764 |
, |
denotes |
, |
T13467 |
764-774 |
NNP |
denotes |
California |
T13468 |
774-776 |
, |
denotes |
, |
T13469 |
776-782 |
NNP |
denotes |
United |
T13470 |
783-789 |
NNP |
denotes |
States |
T13471 |
789-790 |
-RRB- |
denotes |
) |
T13472 |
791-796 |
VBG |
denotes |
using |
T13473 |
797-800 |
DT |
denotes |
the |
T13474 |
809-815 |
NN |
denotes |
primer |
T13475 |
801-808 |
JJ |
denotes |
forward |
T13476 |
816-817 |
CD |
denotes |
5 |
T13477 |
820-865 |
NN |
denotes |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
T13478 |
817-818 |
SYM |
denotes |
′ |
T13479 |
818-819 |
HYPH |
denotes |
- |
T13480 |
865-866 |
HYPH |
denotes |
- |
T13481 |
866-867 |
CD |
denotes |
3 |
T13482 |
867-868 |
SYM |
denotes |
′ |
T13483 |
869-872 |
CC |
denotes |
and |
T13484 |
873-876 |
DT |
denotes |
the |
T13485 |
885-891 |
NN |
denotes |
primer |
T13486 |
877-884 |
JJ |
denotes |
reverse |
T13487 |
892-893 |
CD |
denotes |
5 |
T13488 |
904-943 |
NN |
denotes |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
T13489 |
893-894 |
SYM |
denotes |
′ |
T13490 |
894-895 |
HYPH |
denotes |
- |
T13491 |
896-902 |
NN |
denotes |
GCTTTT |
T13492 |
902-903 |
HYPH |
denotes |
- |
T13493 |
943-944 |
HYPH |
denotes |
- |
T13494 |
944-945 |
CD |
denotes |
3 |
T13495 |
945-946 |
SYM |
denotes |
′ |
T13496 |
946-947 |
. |
denotes |
. |
T13497 |
947-1180 |
sentence |
denotes |
The probes for the Snail in situ hybridization were generated against the 3′ UTR by PCR using the forward primer 5′- ACCTTCTCCCGCATGTCCTTGCTCC-3′ and the reverse primer 5′- CTGCTGAGGCATGGTTACAGCTGG-3′, and genomic DNA as a template. |
T13498 |
948-951 |
DT |
denotes |
The |
T13499 |
952-958 |
NNS |
denotes |
probes |
T13500 |
1000-1009 |
VBN |
denotes |
generated |
T13501 |
959-962 |
IN |
denotes |
for |
T13502 |
963-966 |
DT |
denotes |
the |
T13503 |
981-994 |
NN |
denotes |
hybridization |
T13504 |
967-972 |
NN |
denotes |
Snail |
T13505 |
973-975 |
FW |
denotes |
in |
T13506 |
976-980 |
FW |
denotes |
situ |
T13507 |
995-999 |
VBD |
denotes |
were |
T13508 |
1010-1017 |
IN |
denotes |
against |
T13509 |
1018-1021 |
DT |
denotes |
the |
T13510 |
1025-1028 |
NN |
denotes |
UTR |
T13511 |
1022-1023 |
CD |
denotes |
3 |
T13512 |
1023-1024 |
SYM |
denotes |
′ |
T13513 |
1029-1031 |
IN |
denotes |
by |
T13514 |
1032-1035 |
NN |
denotes |
PCR |
T13515 |
1036-1041 |
VBG |
denotes |
using |
T13516 |
1042-1045 |
DT |
denotes |
the |
T13517 |
1054-1060 |
NN |
denotes |
primer |
T13518 |
1046-1053 |
JJ |
denotes |
forward |
T13519 |
1061-1062 |
CD |
denotes |
5 |
T13520 |
1065-1090 |
NN |
denotes |
ACCTTCTCCCGCATGTCCTTGCTCC |
T13521 |
1062-1063 |
SYM |
denotes |
′ |
T13522 |
1063-1064 |
HYPH |
denotes |
- |
T13523 |
1090-1091 |
HYPH |
denotes |
- |
T13524 |
1091-1092 |
CD |
denotes |
3 |
T13525 |
1092-1093 |
SYM |
denotes |
′ |
T13526 |
1094-1097 |
CC |
denotes |
and |
T13527 |
1098-1101 |
DT |
denotes |
the |
T13528 |
1110-1116 |
NN |
denotes |
primer |
T13529 |
1102-1109 |
JJ |
denotes |
reverse |
T13530 |
1117-1118 |
CD |
denotes |
5 |
T13531 |
1121-1145 |
NN |
denotes |
CTGCTGAGGCATGGTTACAGCTGG |
T13532 |
1118-1119 |
SYM |
denotes |
′ |
T13533 |
1119-1120 |
HYPH |
denotes |
- |
T13534 |
1145-1146 |
HYPH |
denotes |
- |
T13535 |
1146-1147 |
CD |
denotes |
3 |
T13536 |
1147-1148 |
SYM |
denotes |
′ |
T13537 |
1148-1150 |
, |
denotes |
, |
T13538 |
1150-1153 |
CC |
denotes |
and |
T13539 |
1154-1161 |
JJ |
denotes |
genomic |
T13540 |
1162-1165 |
NN |
denotes |
DNA |
T13541 |
1166-1168 |
IN |
denotes |
as |
T13542 |
1169-1170 |
DT |
denotes |
a |
T13543 |
1171-1179 |
NN |
denotes |
template |
T13544 |
1179-1180 |
. |
denotes |
. |
T13545 |
1180-1252 |
sentence |
denotes |
The PCR product was gel purified and ligated into pCRII-TOPO TA vector. |
T13546 |
1181-1184 |
DT |
denotes |
The |
T13547 |
1189-1196 |
NN |
denotes |
product |
T13548 |
1185-1188 |
NN |
denotes |
PCR |
T13549 |
1205-1213 |
VBN |
denotes |
purified |
T13550 |
1197-1200 |
VBD |
denotes |
was |
T13551 |
1201-1204 |
NN |
denotes |
gel |
T13552 |
1214-1217 |
CC |
denotes |
and |
T13553 |
1218-1225 |
VBN |
denotes |
ligated |
T13554 |
1226-1230 |
IN |
denotes |
into |
T13555 |
1231-1236 |
NN |
denotes |
pCRII |
T13556 |
1237-1241 |
NN |
denotes |
TOPO |
T13557 |
1236-1237 |
HYPH |
denotes |
- |
T13558 |
1245-1251 |
NN |
denotes |
vector |
T13559 |
1242-1244 |
NN |
denotes |
TA |
T13560 |
1251-1252 |
. |
denotes |
. |
T13561 |
1252-1413 |
sentence |
denotes |
The pre-LIM domain of Ajuba was generated essentially as described [9], but was fused to GFP by subcloning from the pEGFP-N1 20 vector (BD Biosciences Clontech) |
T13562 |
1253-1256 |
DT |
denotes |
The |
T13563 |
1265-1271 |
NN |
denotes |
domain |
T13564 |
1257-1264 |
JJ |
denotes |
pre-LIM |
T13565 |
1285-1294 |
VBN |
denotes |
generated |
T13566 |
1272-1274 |
IN |
denotes |
of |
T13567 |
1275-1280 |
NN |
denotes |
Ajuba |
T13568 |
1281-1284 |
VBD |
denotes |
was |
T13569 |
1295-1306 |
RB |
denotes |
essentially |
T13570 |
1307-1309 |
IN |
denotes |
as |
T13571 |
1310-1319 |
VBN |
denotes |
described |
T13572 |
1320-1321 |
-LRB- |
denotes |
[ |
T13573 |
1321-1322 |
CD |
denotes |
9 |
T13574 |
1322-1323 |
-RRB- |
denotes |
] |
T13575 |
1323-1325 |
, |
denotes |
, |
T13576 |
1325-1328 |
CC |
denotes |
but |
T13577 |
1329-1332 |
VBD |
denotes |
was |
T13578 |
1333-1338 |
VBN |
denotes |
fused |
T13579 |
1339-1341 |
IN |
denotes |
to |
T13580 |
1342-1345 |
NN |
denotes |
GFP |
T13581 |
1346-1348 |
IN |
denotes |
by |
T13582 |
1349-1359 |
VBG |
denotes |
subcloning |
T13583 |
1360-1364 |
IN |
denotes |
from |
T13584 |
1365-1368 |
DT |
denotes |
the |
T13585 |
1381-1387 |
NN |
denotes |
vector |
T13586 |
1369-1374 |
NN |
denotes |
pEGFP |
T13587 |
1375-1377 |
NN |
denotes |
N1 |
T13588 |
1374-1375 |
HYPH |
denotes |
- |
T13589 |
1378-1380 |
CD |
denotes |
20 |
T13590 |
1388-1389 |
-LRB- |
denotes |
( |
T13591 |
1404-1412 |
NNP |
denotes |
Clontech |
T13592 |
1389-1391 |
NNP |
denotes |
BD |
T13593 |
1392-1403 |
NNP |
denotes |
Biosciences |
T13594 |
1412-1413 |
-RRB- |
denotes |
) |
R8600 |
T13310 |
T13311 |
det |
The,promoter |
R8601 |
T13311 |
T13317 |
nsubjpass |
promoter,generated |
R8602 |
T13312 |
T13313 |
nummod |
2.2,kb |
R8603 |
T13313 |
T13311 |
nmod |
kb,promoter |
R8604 |
T13314 |
T13313 |
punct |
-,kb |
R8605 |
T13315 |
T13311 |
amod |
murine,promoter |
R8606 |
T13316 |
T13311 |
compound |
Snail,promoter |
R8607 |
T13318 |
T13317 |
auxpass |
was,generated |
R8608 |
T13319 |
T13317 |
prep |
by,generated |
R8609 |
T13320 |
T13319 |
pobj |
PCR,by |
R8610 |
T13321 |
T13317 |
advcl |
using,generated |
R8611 |
T13322 |
T13323 |
det |
a,primer |
R8612 |
T13323 |
T13321 |
dobj |
primer,using |
R8613 |
T13324 |
T13323 |
amod |
forward,primer |
R8614 |
T13325 |
T13321 |
prep |
with,using |
R8615 |
T13326 |
T13327 |
det |
an,sequence |
R8616 |
T13327 |
T13325 |
pobj |
sequence,with |
R8617 |
T13328 |
T13327 |
compound |
XbaI,sequence |
R8618 |
T13329 |
T13327 |
compound |
linker,sequence |
R8619 |
T13330 |
T13327 |
punct |
", ",sequence |
R8620 |
T13331 |
T13332 |
nummod |
5,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8621 |
T13332 |
T13327 |
appos |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC,sequence |
R8622 |
T13333 |
T13331 |
punct |
′,5 |
R8623 |
T13334 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8624 |
T13335 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8625 |
T13336 |
T13332 |
nummod |
3,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8626 |
T13337 |
T13332 |
punct |
′,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8627 |
T13338 |
T13327 |
punct |
", ",sequence |
R8628 |
T13339 |
T13327 |
cc |
along,sequence |
R8629 |
T13340 |
T13339 |
dep |
with,along |
R8630 |
T13341 |
T13342 |
det |
a,primer |
R8631 |
T13342 |
T13327 |
conj |
primer,sequence |
R8632 |
T13343 |
T13342 |
amod |
reverse,primer |
R8633 |
T13344 |
T13342 |
prep |
with,primer |
R8634 |
T13345 |
T13346 |
det |
a,sequence |
R8635 |
T13346 |
T13344 |
pobj |
sequence,with |
R8636 |
T13347 |
T13346 |
compound |
BglII,sequence |
R8637 |
T13348 |
T13346 |
compound |
linker,sequence |
R8638 |
T13349 |
T13346 |
punct |
", ",sequence |
R8639 |
T13350 |
T13351 |
nummod |
5,GTAG |
R8640 |
T13351 |
T13346 |
appos |
GTAG,sequence |
R8641 |
T13352 |
T13350 |
punct |
′,5 |
R8642 |
T13353 |
T13351 |
punct |
-,GTAG |
R8643 |
T13354 |
T13351 |
compound |
AGATCTGTTGGCCAGAGCGACCTAG,GTAG |
R8644 |
T13355 |
T13351 |
punct |
-,GTAG |
R8645 |
T13356 |
T13351 |
punct |
-,GTAG |
R8646 |
T13357 |
T13351 |
nummod |
3,GTAG |
R8647 |
T13358 |
T13351 |
punct |
′,GTAG |
R8648 |
T13359 |
T13342 |
punct |
", ",primer |
R8649 |
T13360 |
T13342 |
cc |
and,primer |
R8650 |
T13361 |
T13362 |
nmod |
mouse,DNA |
R8651 |
T13362 |
T13342 |
conj |
DNA,primer |
R8652 |
T13363 |
T13362 |
amod |
genomic,DNA |
R8653 |
T13364 |
T13362 |
prep |
as,DNA |
R8654 |
T13365 |
T13366 |
det |
a,template |
R8655 |
T13366 |
T13364 |
pobj |
template,as |
R8656 |
T13367 |
T13317 |
punct |
.,generated |
R8657 |
T13369 |
T13370 |
det |
The,product |
R8658 |
T13370 |
T13372 |
nsubjpass |
product,purified |
R8659 |
T13371 |
T13370 |
compound |
PCR,product |
R8660 |
T13373 |
T13372 |
auxpass |
was,purified |
R8661 |
T13374 |
T13372 |
prep |
with,purified |
R8662 |
T13375 |
T13376 |
det |
the,Kit |
R8663 |
T13376 |
T13374 |
pobj |
Kit,with |
R8664 |
T13377 |
T13378 |
compound |
Gel,Extraction |
R8665 |
T13378 |
T13376 |
compound |
Extraction,Kit |
R8666 |
T13379 |
T13380 |
punct |
(,Qiagen |
R8667 |
T13380 |
T13376 |
parataxis |
Qiagen,Kit |
R8668 |
T13381 |
T13380 |
punct |
", ",Qiagen |
R8669 |
T13382 |
T13380 |
npadvmod |
Valencia,Qiagen |
R8670 |
T13383 |
T13380 |
punct |
", ",Qiagen |
R8671 |
T13384 |
T13380 |
npadvmod |
California,Qiagen |
R8672 |
T13385 |
T13380 |
punct |
", ",Qiagen |
R8673 |
T13386 |
T13387 |
compound |
United,States |
R8674 |
T13387 |
T13380 |
npadvmod |
States,Qiagen |
R8675 |
T13388 |
T13380 |
punct |
),Qiagen |
R8676 |
T13389 |
T13372 |
cc |
and,purified |
R8677 |
T13390 |
T13372 |
conj |
ligated,purified |
R8678 |
T13391 |
T13390 |
prep |
into,ligated |
R8679 |
T13392 |
T13393 |
compound |
pCRII,TOPO |
R8680 |
T13393 |
T13395 |
compound |
TOPO,vector |
R8681 |
T13394 |
T13393 |
punct |
-,TOPO |
R8682 |
T13395 |
T13391 |
pobj |
vector,into |
R8683 |
T13396 |
T13395 |
compound |
TA,vector |
R8684 |
T13397 |
T13398 |
punct |
(,Invitrogen |
R8685 |
T13398 |
T13395 |
parataxis |
Invitrogen,vector |
R8686 |
T13399 |
T13398 |
punct |
", ",Invitrogen |
R8687 |
T13400 |
T13398 |
npadvmod |
Carlsbad,Invitrogen |
R8688 |
T13401 |
T13398 |
punct |
", ",Invitrogen |
R8689 |
T13402 |
T13398 |
npadvmod |
California,Invitrogen |
R8690 |
T13403 |
T13398 |
punct |
", ",Invitrogen |
R8691 |
T13404 |
T13405 |
compound |
United,States |
R8692 |
T13405 |
T13398 |
npadvmod |
States,Invitrogen |
R8693 |
T13406 |
T13398 |
punct |
),Invitrogen |
R8694 |
T13407 |
T13372 |
punct |
.,purified |
R8695 |
T13409 |
T13410 |
det |
The,promoter |
R8696 |
T13410 |
T13411 |
nsubjpass |
promoter,verified |
R8697 |
T13412 |
T13411 |
auxpass |
was,verified |
R8698 |
T13413 |
T13411 |
prep |
by,verified |
R8699 |
T13414 |
T13413 |
pobj |
sequencing,by |
R8700 |
T13415 |
T13411 |
cc |
and,verified |
R8701 |
T13416 |
T13411 |
conj |
digested,verified |
R8702 |
T13417 |
T13416 |
prep |
with,digested |
R8703 |
T13418 |
T13417 |
pobj |
XbaI,with |
R8704 |
T13419 |
T13418 |
cc |
and,XbaI |
R8705 |
T13420 |
T13418 |
conj |
BglII,XbaI |
R8706 |
T13421 |
T13416 |
cc |
and,digested |
R8707 |
T13422 |
T13416 |
conj |
subcloned,digested |
R8708 |
T13423 |
T13422 |
prep |
into,subcloned |
R8709 |
T13424 |
T13425 |
det |
the,vector |
R8710 |
T13425 |
T13423 |
pobj |
vector,into |
R8711 |
T13426 |
T13427 |
compound |
pβ,gal |
R8712 |
T13427 |
T13425 |
compound |
gal,vector |
R8713 |
T13428 |
T13427 |
punct |
-,gal |
R8714 |
T13429 |
T13425 |
compound |
BASIC,vector |
R8715 |
T13430 |
T13431 |
punct |
(,Clontech |
R8716 |
T13431 |
T13425 |
parataxis |
Clontech,vector |
R8717 |
T13432 |
T13431 |
compound |
BD,Clontech |
R8718 |
T13433 |
T13431 |
compound |
Biosciences,Clontech |
R8719 |
T13434 |
T13431 |
punct |
", ",Clontech |
R8720 |
T13435 |
T13436 |
compound |
Palo,Alto |
R8721 |
T13436 |
T13431 |
npadvmod |
Alto,Clontech |
R8722 |
T13437 |
T13431 |
punct |
", ",Clontech |
R8723 |
T13438 |
T13431 |
npadvmod |
California,Clontech |
R8724 |
T13439 |
T13431 |
punct |
", ",Clontech |
R8725 |
T13440 |
T13441 |
compound |
United,States |
R8726 |
T13441 |
T13431 |
npadvmod |
States,Clontech |
R8727 |
T13442 |
T13431 |
punct |
),Clontech |
R8728 |
T13443 |
T13411 |
punct |
.,verified |
R8729 |
T13445 |
T13446 |
det |
The,mutations |
R8730 |
T13446 |
T13448 |
nsubjpass |
mutations,generated |
R8731 |
T13447 |
T13446 |
compound |
point,mutations |
R8732 |
T13449 |
T13446 |
prep |
in,mutations |
R8733 |
T13450 |
T13451 |
det |
the,element |
R8734 |
T13451 |
T13449 |
pobj |
element,in |
R8735 |
T13452 |
T13451 |
compound |
SMAD,element |
R8736 |
T13453 |
T13451 |
compound |
binding,element |
R8737 |
T13454 |
T13448 |
auxpass |
was,generated |
R8738 |
T13455 |
T13448 |
prep |
with,generated |
R8739 |
T13456 |
T13457 |
det |
the,Kit |
R8740 |
T13457 |
T13455 |
pobj |
Kit,with |
R8741 |
T13458 |
T13459 |
compound |
Quik,Change |
R8742 |
T13459 |
T13457 |
compound |
Change,Kit |
R8743 |
T13460 |
T13459 |
punct |
-,Change |
R8744 |
T13461 |
T13462 |
punct |
(,Stratagene |
R8745 |
T13462 |
T13457 |
parataxis |
Stratagene,Kit |
R8746 |
T13463 |
T13462 |
punct |
", ",Stratagene |
R8747 |
T13464 |
T13465 |
compound |
La,Jolla |
R8748 |
T13465 |
T13462 |
npadvmod |
Jolla,Stratagene |
R8749 |
T13466 |
T13462 |
punct |
", ",Stratagene |
R8750 |
T13467 |
T13462 |
npadvmod |
California,Stratagene |
R8751 |
T13468 |
T13462 |
punct |
", ",Stratagene |
R8752 |
T13469 |
T13470 |
compound |
United,States |
R8753 |
T13470 |
T13462 |
npadvmod |
States,Stratagene |
R8754 |
T13471 |
T13462 |
punct |
),Stratagene |
R8755 |
T13472 |
T13448 |
advcl |
using,generated |
R8756 |
T13473 |
T13474 |
det |
the,primer |
R8757 |
T13474 |
T13472 |
dobj |
primer,using |
R8758 |
T13475 |
T13474 |
amod |
forward,primer |
R8759 |
T13476 |
T13477 |
nummod |
5,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8760 |
T13477 |
T13474 |
appos |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC,primer |
R8761 |
T13478 |
T13476 |
punct |
′,5 |
R8762 |
T13479 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8763 |
T13480 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8764 |
T13481 |
T13477 |
nummod |
3,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8765 |
T13482 |
T13477 |
punct |
′,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8766 |
T13483 |
T13474 |
cc |
and,primer |
R8767 |
T13484 |
T13485 |
det |
the,primer |
R8768 |
T13485 |
T13474 |
conj |
primer,primer |
R8769 |
T13486 |
T13485 |
amod |
reverse,primer |
R8770 |
T13487 |
T13488 |
nummod |
5,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8771 |
T13488 |
T13485 |
appos |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC,primer |
R8772 |
T13489 |
T13487 |
punct |
′,5 |
R8773 |
T13490 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8774 |
T13491 |
T13488 |
compound |
GCTTTT,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8775 |
T13492 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8776 |
T13493 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8777 |
T13494 |
T13488 |
nummod |
3,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8778 |
T13495 |
T13488 |
punct |
′,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8779 |
T13496 |
T13448 |
punct |
.,generated |
R8780 |
T13498 |
T13499 |
det |
The,probes |
R8781 |
T13499 |
T13500 |
nsubjpass |
probes,generated |
R8782 |
T13501 |
T13499 |
prep |
for,probes |
R8783 |
T13502 |
T13503 |
det |
the,hybridization |
R8784 |
T13503 |
T13501 |
pobj |
hybridization,for |
R8785 |
T13504 |
T13503 |
nmod |
Snail,hybridization |
R8786 |
T13505 |
T13506 |
advmod |
in,situ |
R8787 |
T13506 |
T13503 |
amod |
situ,hybridization |
R8788 |
T13507 |
T13500 |
auxpass |
were,generated |
R8789 |
T13508 |
T13500 |
prep |
against,generated |
R8790 |
T13509 |
T13510 |
det |
the,UTR |
R8791 |
T13510 |
T13508 |
pobj |
UTR,against |
R8792 |
T13511 |
T13510 |
nummod |
3,UTR |
R8793 |
T13512 |
T13511 |
punct |
′,3 |
R8794 |
T13513 |
T13500 |
prep |
by,generated |
R8795 |
T13514 |
T13513 |
pobj |
PCR,by |
R8796 |
T13515 |
T13500 |
advcl |
using,generated |
R8797 |
T13516 |
T13517 |
det |
the,primer |
R8798 |
T13517 |
T13515 |
dobj |
primer,using |
R8799 |
T13518 |
T13517 |
amod |
forward,primer |
R8800 |
T13519 |
T13520 |
nummod |
5,ACCTTCTCCCGCATGTCCTTGCTCC |
R8801 |
T13520 |
T13517 |
appos |
ACCTTCTCCCGCATGTCCTTGCTCC,primer |
R8802 |
T13521 |
T13519 |
punct |
′,5 |
R8803 |
T13522 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
R8804 |
T13523 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
R8805 |
T13524 |
T13520 |
nummod |
3,ACCTTCTCCCGCATGTCCTTGCTCC |
R8806 |
T13525 |
T13520 |
punct |
′,ACCTTCTCCCGCATGTCCTTGCTCC |
R8807 |
T13526 |
T13517 |
cc |
and,primer |
R8808 |
T13527 |
T13528 |
det |
the,primer |
R8809 |
T13528 |
T13517 |
conj |
primer,primer |
R8810 |
T13529 |
T13528 |
amod |
reverse,primer |
R8811 |
T13530 |
T13531 |
nummod |
5,CTGCTGAGGCATGGTTACAGCTGG |
R8812 |
T13531 |
T13528 |
appos |
CTGCTGAGGCATGGTTACAGCTGG,primer |
R8813 |
T13532 |
T13530 |
punct |
′,5 |
R8814 |
T13533 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
R8815 |
T13534 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
R8816 |
T13535 |
T13531 |
nummod |
3,CTGCTGAGGCATGGTTACAGCTGG |
R8817 |
T13536 |
T13531 |
punct |
′,CTGCTGAGGCATGGTTACAGCTGG |
R8818 |
T13537 |
T13528 |
punct |
", ",primer |
R8819 |
T13538 |
T13528 |
cc |
and,primer |
R8820 |
T13539 |
T13540 |
amod |
genomic,DNA |
R8821 |
T13540 |
T13528 |
conj |
DNA,primer |
R8822 |
T13541 |
T13540 |
prep |
as,DNA |
R8823 |
T13542 |
T13543 |
det |
a,template |
R8824 |
T13543 |
T13541 |
pobj |
template,as |
R8825 |
T13544 |
T13500 |
punct |
.,generated |
R8826 |
T13546 |
T13547 |
det |
The,product |
R8827 |
T13547 |
T13549 |
nsubjpass |
product,purified |
R8828 |
T13548 |
T13547 |
compound |
PCR,product |
R8829 |
T13550 |
T13549 |
auxpass |
was,purified |
R8830 |
T13551 |
T13549 |
dep |
gel,purified |
R8831 |
T13552 |
T13549 |
cc |
and,purified |
R8832 |
T13553 |
T13549 |
conj |
ligated,purified |
R8833 |
T13554 |
T13553 |
prep |
into,ligated |
R8834 |
T13555 |
T13556 |
compound |
pCRII,TOPO |
R8835 |
T13556 |
T13558 |
compound |
TOPO,vector |
R8836 |
T13557 |
T13556 |
punct |
-,TOPO |
R8837 |
T13558 |
T13554 |
pobj |
vector,into |
R8838 |
T13559 |
T13558 |
compound |
TA,vector |
R8839 |
T13560 |
T13549 |
punct |
.,purified |
R8840 |
T13562 |
T13563 |
det |
The,domain |
R8841 |
T13563 |
T13565 |
nsubjpass |
domain,generated |
R8842 |
T13564 |
T13563 |
amod |
pre-LIM,domain |
R8843 |
T13566 |
T13563 |
prep |
of,domain |
R8844 |
T13567 |
T13566 |
pobj |
Ajuba,of |
R8845 |
T13568 |
T13565 |
auxpass |
was,generated |
R8846 |
T13569 |
T13565 |
advmod |
essentially,generated |
R8847 |
T13570 |
T13571 |
mark |
as,described |
R8848 |
T13571 |
T13565 |
advcl |
described,generated |
R8849 |
T13572 |
T13573 |
punct |
[,9 |
R8850 |
T13573 |
T13571 |
parataxis |
9,described |
R8851 |
T13574 |
T13573 |
punct |
],9 |
R8852 |
T13575 |
T13565 |
punct |
", ",generated |
R8853 |
T13576 |
T13565 |
cc |
but,generated |
R8854 |
T13577 |
T13578 |
auxpass |
was,fused |
R8855 |
T13578 |
T13565 |
conj |
fused,generated |
R8856 |
T13579 |
T13578 |
prep |
to,fused |
R8857 |
T13580 |
T13579 |
pobj |
GFP,to |
R8858 |
T13581 |
T13578 |
prep |
by,fused |
R8859 |
T13582 |
T13581 |
pcomp |
subcloning,by |
R8860 |
T13583 |
T13582 |
prep |
from,subcloning |
R8861 |
T13584 |
T13585 |
det |
the,vector |
R8862 |
T13585 |
T13583 |
pobj |
vector,from |
R8863 |
T13586 |
T13587 |
nmod |
pEGFP,N1 |
R8864 |
T13587 |
T13585 |
nmod |
N1,vector |
R8865 |
T13588 |
T13587 |
punct |
-,N1 |
R8866 |
T13589 |
T13585 |
nummod |
20,vector |
R8867 |
T13590 |
T13591 |
punct |
(,Clontech |
R8868 |
T13591 |
T13585 |
parataxis |
Clontech,vector |
R8869 |
T13592 |
T13591 |
compound |
BD,Clontech |
R8870 |
T13593 |
T13591 |
compound |
Biosciences,Clontech |
R8871 |
T13594 |
T13591 |
punct |
),Clontech |