Id |
Subject |
Object |
Predicate |
Lexical cue |
T12464 |
57858-57862 |
NNS |
denotes |
Mice |
T12465 |
57862-58065 |
sentence |
denotes |
The K14-Snail Tg mouse was generated by digesting the pcDNA3-mm Snail-HA plasmid (G. de Herreros, Universitat Pompeu, Fabra, Barcelona, Spain) with BamHI and NotI and subcloned into the K14 vector [49]. |
T12466 |
57863-57866 |
DT |
denotes |
The |
T12467 |
57880-57885 |
NN |
denotes |
mouse |
T12468 |
57867-57870 |
NN |
denotes |
K14 |
T12469 |
57871-57876 |
NN |
denotes |
Snail |
T12470 |
57870-57871 |
HYPH |
denotes |
- |
T12471 |
57877-57879 |
NN |
denotes |
Tg |
T12472 |
57890-57899 |
VBN |
denotes |
generated |
T12473 |
57886-57889 |
VBD |
denotes |
was |
T12474 |
57900-57902 |
IN |
denotes |
by |
T12475 |
57903-57912 |
VBG |
denotes |
digesting |
T12476 |
57913-57916 |
DT |
denotes |
the |
T12477 |
57936-57943 |
NN |
denotes |
plasmid |
T12478 |
57917-57923 |
NN |
denotes |
pcDNA3 |
T12479 |
57924-57926 |
NN |
denotes |
mm |
T12480 |
57923-57924 |
HYPH |
denotes |
- |
T12481 |
57927-57932 |
NN |
denotes |
Snail |
T12482 |
57933-57935 |
NN |
denotes |
HA |
T12483 |
57932-57933 |
HYPH |
denotes |
- |
T12484 |
57944-57945 |
-LRB- |
denotes |
( |
T12485 |
57951-57959 |
NNP |
denotes |
Herreros |
T12486 |
57945-57947 |
NNP |
denotes |
G. |
T12487 |
57948-57950 |
NNP |
denotes |
de |
T12488 |
57959-57961 |
, |
denotes |
, |
T12489 |
57961-57972 |
NNP |
denotes |
Universitat |
T12490 |
57973-57979 |
NNP |
denotes |
Pompeu |
T12491 |
57979-57981 |
, |
denotes |
, |
T12492 |
57981-57986 |
NNP |
denotes |
Fabra |
T12493 |
57986-57988 |
, |
denotes |
, |
T12494 |
57988-57997 |
NNP |
denotes |
Barcelona |
T12495 |
57997-57999 |
, |
denotes |
, |
T12496 |
57999-58004 |
NNP |
denotes |
Spain |
T12497 |
58004-58005 |
-RRB- |
denotes |
) |
T12498 |
58006-58010 |
IN |
denotes |
with |
T12499 |
58011-58016 |
NN |
denotes |
BamHI |
T12500 |
58017-58020 |
CC |
denotes |
and |
T12501 |
58021-58025 |
NN |
denotes |
NotI |
T12502 |
58026-58029 |
CC |
denotes |
and |
T12503 |
58030-58039 |
VBN |
denotes |
subcloned |
T12504 |
58040-58044 |
IN |
denotes |
into |
T12505 |
58045-58048 |
DT |
denotes |
the |
T12506 |
58053-58059 |
NN |
denotes |
vector |
T12507 |
58049-58052 |
NN |
denotes |
K14 |
T12508 |
58060-58061 |
-LRB- |
denotes |
[ |
T12509 |
58061-58063 |
CD |
denotes |
49 |
T12510 |
58063-58064 |
-RRB- |
denotes |
] |
T12511 |
58064-58065 |
. |
denotes |
. |
T12512 |
58065-58146 |
sentence |
denotes |
The linearized construct was injected into the nucleus of embryos from CD1 mice. |
T12513 |
58066-58069 |
DT |
denotes |
The |
T12514 |
58081-58090 |
NN |
denotes |
construct |
T12515 |
58070-58080 |
VBN |
denotes |
linearized |
T12516 |
58095-58103 |
VBN |
denotes |
injected |
T12517 |
58091-58094 |
VBD |
denotes |
was |
T12518 |
58104-58108 |
IN |
denotes |
into |
T12519 |
58109-58112 |
DT |
denotes |
the |
T12520 |
58113-58120 |
NN |
denotes |
nucleus |
T12521 |
58121-58123 |
IN |
denotes |
of |
T12522 |
58124-58131 |
NNS |
denotes |
embryos |
T12523 |
58132-58136 |
IN |
denotes |
from |
T12524 |
58137-58140 |
NN |
denotes |
CD1 |
T12525 |
58141-58145 |
NNS |
denotes |
mice |
T12526 |
58145-58146 |
. |
denotes |
. |
T12527 |
58146-58204 |
sentence |
denotes |
The K14-Smad 2 Tg mouse was reported in Ito et al., 2001. |
T12528 |
58147-58150 |
DT |
denotes |
The |
T12529 |
58165-58170 |
NN |
denotes |
mouse |
T12530 |
58151-58154 |
NN |
denotes |
K14 |
T12531 |
58155-58159 |
NN |
denotes |
Smad |
T12532 |
58154-58155 |
HYPH |
denotes |
- |
T12533 |
58160-58161 |
CD |
denotes |
2 |
T12534 |
58162-58164 |
NN |
denotes |
Tg |
T12535 |
58175-58183 |
VBN |
denotes |
reported |
T12536 |
58171-58174 |
VBD |
denotes |
was |
T12537 |
58184-58186 |
IN |
denotes |
in |
T12538 |
58187-58190 |
NNP |
denotes |
Ito |
T12539 |
58191-58193 |
FW |
denotes |
et |
T12540 |
58194-58197 |
FW |
denotes |
al. |
T12541 |
58197-58199 |
, |
denotes |
, |
T12542 |
58199-58203 |
CD |
denotes |
2001 |
T12543 |
58203-58204 |
. |
denotes |
. |
T12544 |
58204-58258 |
sentence |
denotes |
The TGF-β2 knockout (KO) mouse was described in [34]. |
T12545 |
58205-58208 |
DT |
denotes |
The |
T12546 |
58230-58235 |
NN |
denotes |
mouse |
T12547 |
58209-58212 |
NN |
denotes |
TGF |
T12548 |
58213-58215 |
NN |
denotes |
β2 |
T12549 |
58212-58213 |
HYPH |
denotes |
- |
T12550 |
58216-58224 |
NN |
denotes |
knockout |
T12551 |
58225-58226 |
-LRB- |
denotes |
( |
T12552 |
58226-58228 |
NN |
denotes |
KO |
T12553 |
58228-58229 |
-RRB- |
denotes |
) |
T12554 |
58240-58249 |
VBN |
denotes |
described |
T12555 |
58236-58239 |
VBD |
denotes |
was |
T12556 |
58250-58252 |
IN |
denotes |
in |
T12557 |
58253-58254 |
-LRB- |
denotes |
[ |
T12558 |
58254-58256 |
NN |
denotes |
34 |
T12559 |
58256-58257 |
-RRB- |
denotes |
] |
T12560 |
58257-58258 |
. |
denotes |
. |
T12561 |
58258-58333 |
sentence |
denotes |
The shh KO mouse [38] and TOPGal mouse [20] have previously been reported. |
T12562 |
58259-58262 |
DT |
denotes |
The |
T12563 |
58270-58275 |
NN |
denotes |
mouse |
T12564 |
58263-58266 |
NN |
denotes |
shh |
T12565 |
58267-58269 |
NN |
denotes |
KO |
T12566 |
58324-58332 |
VBN |
denotes |
reported |
T12567 |
58276-58277 |
-LRB- |
denotes |
[ |
T12568 |
58277-58279 |
CD |
denotes |
38 |
T12569 |
58279-58280 |
-RRB- |
denotes |
] |
T12570 |
58281-58284 |
CC |
denotes |
and |
T12571 |
58285-58291 |
NN |
denotes |
TOPGal |
T12572 |
58292-58297 |
NN |
denotes |
mouse |
T12573 |
58298-58299 |
-LRB- |
denotes |
[ |
T12574 |
58299-58301 |
CD |
denotes |
20 |
T12575 |
58301-58302 |
-RRB- |
denotes |
] |
T12576 |
58303-58307 |
VBP |
denotes |
have |
T12577 |
58308-58318 |
RB |
denotes |
previously |
T12578 |
58319-58323 |
VBN |
denotes |
been |
T12579 |
58332-58333 |
. |
denotes |
. |
T12687 |
58335-58342 |
NNP |
denotes |
Western |
T12688 |
58343-58347 |
NN |
denotes |
blot |
T12689 |
58348-58351 |
CC |
denotes |
and |
T12690 |
58352-58371 |
NN |
denotes |
immunoprecipitation |
T12691 |
58371-58677 |
sentence |
denotes |
Protein extracts from primary keratinocytes were generated either by lysing cells in lysis buffer (1% NP-40, 1% sodium deoxycholate, 20 mM Tris-Cl [pH 7.4], 140 mM NaCl containing 1 mM sodium vanadate, 2 mM phenylmethylsulfonyl fluoride, and protease inhibitors) or directly in Laemmli bβuffer and boiled. |
T12692 |
58372-58379 |
NN |
denotes |
Protein |
T12693 |
58380-58388 |
NNS |
denotes |
extracts |
T12694 |
58421-58430 |
VBN |
denotes |
generated |
T12695 |
58389-58393 |
IN |
denotes |
from |
T12696 |
58394-58401 |
JJ |
denotes |
primary |
T12697 |
58402-58415 |
NNS |
denotes |
keratinocytes |
T12698 |
58416-58420 |
VBD |
denotes |
were |
T12699 |
58431-58437 |
CC |
denotes |
either |
T12700 |
58438-58440 |
IN |
denotes |
by |
T12701 |
58441-58447 |
VBG |
denotes |
lysing |
T12702 |
58448-58453 |
NNS |
denotes |
cells |
T12703 |
58454-58456 |
IN |
denotes |
in |
T12704 |
58457-58462 |
NN |
denotes |
lysis |
T12705 |
58463-58469 |
NN |
denotes |
buffer |
T12706 |
58470-58471 |
-LRB- |
denotes |
( |
T12707 |
58474-58476 |
NN |
denotes |
NP |
T12708 |
58471-58472 |
CD |
denotes |
1 |
T12709 |
58472-58473 |
NN |
denotes |
% |
T12710 |
58476-58477 |
HYPH |
denotes |
- |
T12711 |
58477-58479 |
CD |
denotes |
40 |
T12712 |
58479-58481 |
, |
denotes |
, |
T12713 |
58481-58482 |
CD |
denotes |
1 |
T12714 |
58482-58483 |
NN |
denotes |
% |
T12715 |
58491-58503 |
NN |
denotes |
deoxycholate |
T12716 |
58484-58490 |
NN |
denotes |
sodium |
T12717 |
58503-58505 |
, |
denotes |
, |
T12718 |
58505-58507 |
CD |
denotes |
20 |
T12719 |
58508-58510 |
NN |
denotes |
mM |
T12720 |
58516-58518 |
NN |
denotes |
Cl |
T12721 |
58511-58515 |
NN |
denotes |
Tris |
T12722 |
58515-58516 |
HYPH |
denotes |
- |
T12723 |
58519-58520 |
-LRB- |
denotes |
[ |
T12724 |
58520-58522 |
NN |
denotes |
pH |
T12725 |
58523-58526 |
CD |
denotes |
7.4 |
T12726 |
58526-58527 |
-RRB- |
denotes |
] |
T12727 |
58527-58529 |
, |
denotes |
, |
T12728 |
58529-58532 |
CD |
denotes |
140 |
T12729 |
58533-58535 |
NN |
denotes |
mM |
T12730 |
58536-58540 |
NN |
denotes |
NaCl |
T12731 |
58541-58551 |
VBG |
denotes |
containing |
T12732 |
58552-58553 |
CD |
denotes |
1 |
T12733 |
58554-58556 |
NN |
denotes |
mM |
T12734 |
58564-58572 |
NN |
denotes |
vanadate |
T12735 |
58557-58563 |
NN |
denotes |
sodium |
T12736 |
58572-58574 |
, |
denotes |
, |
T12737 |
58574-58575 |
CD |
denotes |
2 |
T12738 |
58576-58578 |
NN |
denotes |
mM |
T12739 |
58600-58608 |
NN |
denotes |
fluoride |
T12740 |
58579-58599 |
NN |
denotes |
phenylmethylsulfonyl |
T12741 |
58608-58610 |
, |
denotes |
, |
T12742 |
58610-58613 |
CC |
denotes |
and |
T12743 |
58614-58622 |
NN |
denotes |
protease |
T12744 |
58623-58633 |
NNS |
denotes |
inhibitors |
T12745 |
58633-58634 |
-RRB- |
denotes |
) |
T12746 |
58635-58637 |
CC |
denotes |
or |
T12747 |
58638-58646 |
RB |
denotes |
directly |
T12748 |
58647-58649 |
IN |
denotes |
in |
T12749 |
58650-58657 |
NNP |
denotes |
Laemmli |
T12750 |
58658-58665 |
NN |
denotes |
bβuffer |
T12751 |
58666-58669 |
CC |
denotes |
and |
T12752 |
58670-58676 |
VBN |
denotes |
boiled |
T12753 |
58676-58677 |
. |
denotes |
. |
T12754 |
58677-58826 |
sentence |
denotes |
For skin tissue: Frozen tissue was pulverized in a liquid nitrogen-cooled Gevebesmascher and the powder scraped into a chilled microcentrifuge tube. |
T12755 |
58678-58681 |
IN |
denotes |
For |
T12756 |
58713-58723 |
VBN |
denotes |
pulverized |
T12757 |
58682-58686 |
NN |
denotes |
skin |
T12758 |
58687-58693 |
NN |
denotes |
tissue |
T12759 |
58693-58695 |
: |
denotes |
: |
T12760 |
58695-58701 |
JJ |
denotes |
Frozen |
T12761 |
58702-58708 |
NN |
denotes |
tissue |
T12762 |
58709-58712 |
VBD |
denotes |
was |
T12763 |
58724-58726 |
IN |
denotes |
in |
T12764 |
58727-58728 |
DT |
denotes |
a |
T12765 |
58752-58766 |
NN |
denotes |
Gevebesmascher |
T12766 |
58729-58735 |
JJ |
denotes |
liquid |
T12767 |
58736-58744 |
NN |
denotes |
nitrogen |
T12768 |
58745-58751 |
VBN |
denotes |
cooled |
T12769 |
58744-58745 |
HYPH |
denotes |
- |
T12770 |
58767-58770 |
CC |
denotes |
and |
T12771 |
58771-58774 |
DT |
denotes |
the |
T12772 |
58775-58781 |
NN |
denotes |
powder |
T12773 |
58782-58789 |
VBN |
denotes |
scraped |
T12774 |
58790-58794 |
IN |
denotes |
into |
T12775 |
58795-58796 |
DT |
denotes |
a |
T12776 |
58821-58825 |
NN |
denotes |
tube |
T12777 |
58797-58804 |
JJ |
denotes |
chilled |
T12778 |
58805-58820 |
NN |
denotes |
microcentrifuge |
T12779 |
58825-58826 |
. |
denotes |
. |
T12780 |
58826-58983 |
sentence |
denotes |
RIPA buffer (1% Triton X-100 in PBS with 10 mM EDTA, 150 mN NaCl, 1% sodium deoxycholate, and 0.1% SDS) and protease inhibitors or Laemmli buffer was added. |
T12781 |
58827-58831 |
NN |
denotes |
RIPA |
T12782 |
58832-58838 |
NN |
denotes |
buffer |
T12783 |
58977-58982 |
VBN |
denotes |
added |
T12784 |
58839-58840 |
-LRB- |
denotes |
( |
T12785 |
58850-58851 |
NN |
denotes |
X |
T12786 |
58840-58841 |
CD |
denotes |
1 |
T12787 |
58841-58842 |
NN |
denotes |
% |
T12788 |
58843-58849 |
NN |
denotes |
Triton |
T12789 |
58851-58852 |
HYPH |
denotes |
- |
T12790 |
58852-58855 |
CD |
denotes |
100 |
T12791 |
58856-58858 |
IN |
denotes |
in |
T12792 |
58859-58862 |
NN |
denotes |
PBS |
T12793 |
58863-58867 |
IN |
denotes |
with |
T12794 |
58868-58870 |
CD |
denotes |
10 |
T12795 |
58871-58873 |
NN |
denotes |
mM |
T12796 |
58874-58878 |
NN |
denotes |
EDTA |
T12797 |
58878-58880 |
, |
denotes |
, |
T12798 |
58880-58883 |
CD |
denotes |
150 |
T12799 |
58884-58886 |
NN |
denotes |
mN |
T12800 |
58887-58891 |
NN |
denotes |
NaCl |
T12801 |
58891-58893 |
, |
denotes |
, |
T12802 |
58893-58894 |
CD |
denotes |
1 |
T12803 |
58894-58895 |
NN |
denotes |
% |
T12804 |
58903-58915 |
NN |
denotes |
deoxycholate |
T12805 |
58896-58902 |
NN |
denotes |
sodium |
T12806 |
58915-58917 |
, |
denotes |
, |
T12807 |
58917-58920 |
CC |
denotes |
and |
T12808 |
58921-58924 |
CD |
denotes |
0.1 |
T12809 |
58924-58925 |
NN |
denotes |
% |
T12810 |
58926-58929 |
NN |
denotes |
SDS |
T12811 |
58929-58930 |
-RRB- |
denotes |
) |
T12812 |
58931-58934 |
CC |
denotes |
and |
T12813 |
58935-58943 |
NN |
denotes |
protease |
T12814 |
58944-58954 |
NNS |
denotes |
inhibitors |
T12815 |
58955-58957 |
CC |
denotes |
or |
T12816 |
58958-58965 |
NNP |
denotes |
Laemmli |
T12817 |
58966-58972 |
NN |
denotes |
buffer |
T12818 |
58973-58976 |
VBD |
denotes |
was |
T12819 |
58982-58983 |
. |
denotes |
. |
T12820 |
58983-59077 |
sentence |
denotes |
The cell suspension was sonicated three times for 15 s and centrifuged at 14,000 rpm at 4 °C. |
T12821 |
58984-58987 |
DT |
denotes |
The |
T12822 |
58993-59003 |
NN |
denotes |
suspension |
T12823 |
58988-58992 |
NN |
denotes |
cell |
T12824 |
59008-59017 |
VBN |
denotes |
sonicated |
T12825 |
59004-59007 |
VBD |
denotes |
was |
T12826 |
59018-59023 |
CD |
denotes |
three |
T12827 |
59024-59029 |
NNS |
denotes |
times |
T12828 |
59030-59033 |
IN |
denotes |
for |
T12829 |
59034-59036 |
CD |
denotes |
15 |
T12830 |
59037-59038 |
NN |
denotes |
s |
T12831 |
59039-59042 |
CC |
denotes |
and |
T12832 |
59043-59054 |
VBN |
denotes |
centrifuged |
T12833 |
59055-59057 |
IN |
denotes |
at |
T12834 |
59058-59064 |
CD |
denotes |
14,000 |
T12835 |
59065-59068 |
NN |
denotes |
rpm |
T12836 |
59069-59071 |
IN |
denotes |
at |
T12837 |
59072-59073 |
CD |
denotes |
4 |
T12838 |
59074-59076 |
NN |
denotes |
°C |
T12839 |
59076-59077 |
. |
denotes |
. |
T12840 |
59077-59152 |
sentence |
denotes |
The supernatant was separated from the pellet and used in the experiments. |
T12841 |
59078-59081 |
DT |
denotes |
The |
T12842 |
59082-59093 |
NN |
denotes |
supernatant |
T12843 |
59098-59107 |
VBN |
denotes |
separated |
T12844 |
59094-59097 |
VBD |
denotes |
was |
T12845 |
59108-59112 |
IN |
denotes |
from |
T12846 |
59113-59116 |
DT |
denotes |
the |
T12847 |
59117-59123 |
NN |
denotes |
pellet |
T12848 |
59124-59127 |
CC |
denotes |
and |
T12849 |
59128-59132 |
VBN |
denotes |
used |
T12850 |
59133-59135 |
IN |
denotes |
in |
T12851 |
59136-59139 |
DT |
denotes |
the |
T12852 |
59140-59151 |
NNS |
denotes |
experiments |
T12853 |
59151-59152 |
. |
denotes |
. |
T12854 |
59152-59343 |
sentence |
denotes |
Extracts subjected to immunoprecipitation were precleared with Protein G Sepharose (Amersham, Piscataway, New York, United States) and incubated with antibody with rocking overnight at 4 °C. |
T12855 |
59153-59161 |
NNS |
denotes |
Extracts |
T12856 |
59200-59210 |
VBN |
denotes |
precleared |
T12857 |
59162-59171 |
VBN |
denotes |
subjected |
T12858 |
59172-59174 |
IN |
denotes |
to |
T12859 |
59175-59194 |
NN |
denotes |
immunoprecipitation |
T12860 |
59195-59199 |
VBD |
denotes |
were |
T12861 |
59211-59215 |
IN |
denotes |
with |
T12862 |
59216-59223 |
NN |
denotes |
Protein |
T12863 |
59224-59225 |
NN |
denotes |
G |
T12864 |
59226-59235 |
NN |
denotes |
Sepharose |
T12865 |
59236-59237 |
-LRB- |
denotes |
( |
T12866 |
59237-59245 |
NNP |
denotes |
Amersham |
T12867 |
59245-59247 |
, |
denotes |
, |
T12868 |
59247-59257 |
NNP |
denotes |
Piscataway |
T12869 |
59257-59259 |
, |
denotes |
, |
T12870 |
59259-59262 |
NNP |
denotes |
New |
T12871 |
59263-59267 |
NNP |
denotes |
York |
T12872 |
59267-59269 |
, |
denotes |
, |
T12873 |
59269-59275 |
NNP |
denotes |
United |
T12874 |
59276-59282 |
NNP |
denotes |
States |
T12875 |
59282-59283 |
-RRB- |
denotes |
) |
T12876 |
59284-59287 |
CC |
denotes |
and |
T12877 |
59288-59297 |
VBN |
denotes |
incubated |
T12878 |
59298-59302 |
IN |
denotes |
with |
T12879 |
59303-59311 |
NN |
denotes |
antibody |
T12880 |
59312-59316 |
IN |
denotes |
with |
T12881 |
59317-59324 |
NN |
denotes |
rocking |
T12882 |
59325-59334 |
RB |
denotes |
overnight |
T12883 |
59335-59337 |
IN |
denotes |
at |
T12884 |
59338-59339 |
CD |
denotes |
4 |
T12885 |
59340-59342 |
NN |
denotes |
°C |
T12886 |
59342-59343 |
. |
denotes |
. |
T12887 |
59343-59430 |
sentence |
denotes |
Protein G Sepharose was added and samples were incubated for 1 h at 4 °C with rocking. |
T12888 |
59344-59351 |
NN |
denotes |
Protein |
T12889 |
59352-59353 |
NN |
denotes |
G |
T12890 |
59354-59363 |
NN |
denotes |
Sepharose |
T12891 |
59368-59373 |
VBN |
denotes |
added |
T12892 |
59364-59367 |
VBD |
denotes |
was |
T12893 |
59374-59377 |
CC |
denotes |
and |
T12894 |
59378-59385 |
NNS |
denotes |
samples |
T12895 |
59391-59400 |
VBN |
denotes |
incubated |
T12896 |
59386-59390 |
VBD |
denotes |
were |
T12897 |
59401-59404 |
IN |
denotes |
for |
T12898 |
59405-59406 |
CD |
denotes |
1 |
T12899 |
59407-59408 |
NN |
denotes |
h |
T12900 |
59409-59411 |
IN |
denotes |
at |
T12901 |
59412-59413 |
CD |
denotes |
4 |
T12902 |
59414-59416 |
NN |
denotes |
°C |
T12903 |
59417-59421 |
IN |
denotes |
with |
T12904 |
59422-59429 |
NN |
denotes |
rocking |
T12905 |
59429-59430 |
. |
denotes |
. |
T12906 |
59430-59603 |
sentence |
denotes |
Samples were washed three times for 5 min each in lysis buffer, and the Protein G Sepharose-antibody-antigen pellet was resuspended in Laemmli buffer and boiled for 10 min. |
T12907 |
59431-59438 |
NNS |
denotes |
Samples |
T12908 |
59444-59450 |
VBN |
denotes |
washed |
T12909 |
59439-59443 |
VBD |
denotes |
were |
T12910 |
59451-59456 |
CD |
denotes |
three |
T12911 |
59457-59462 |
NNS |
denotes |
times |
T12912 |
59463-59466 |
IN |
denotes |
for |
T12913 |
59467-59468 |
CD |
denotes |
5 |
T12914 |
59469-59472 |
NN |
denotes |
min |
T12915 |
59473-59477 |
RB |
denotes |
each |
T12916 |
59478-59480 |
IN |
denotes |
in |
T12917 |
59481-59486 |
NN |
denotes |
lysis |
T12918 |
59487-59493 |
NN |
denotes |
buffer |
T12919 |
59493-59495 |
, |
denotes |
, |
T12920 |
59495-59498 |
CC |
denotes |
and |
T12921 |
59499-59502 |
DT |
denotes |
the |
T12922 |
59540-59546 |
NN |
denotes |
pellet |
T12923 |
59503-59510 |
NN |
denotes |
Protein |
T12924 |
59511-59512 |
NN |
denotes |
G |
T12925 |
59532-59539 |
NN |
denotes |
antigen |
T12926 |
59513-59522 |
NN |
denotes |
Sepharose |
T12927 |
59522-59523 |
HYPH |
denotes |
- |
T12928 |
59523-59531 |
NN |
denotes |
antibody |
T12929 |
59531-59532 |
HYPH |
denotes |
- |
T12930 |
59551-59562 |
VBN |
denotes |
resuspended |
T12931 |
59547-59550 |
VBD |
denotes |
was |
T12932 |
59563-59565 |
IN |
denotes |
in |
T12933 |
59566-59573 |
NNP |
denotes |
Laemmli |
T12934 |
59574-59580 |
NN |
denotes |
buffer |
T12935 |
59581-59584 |
CC |
denotes |
and |
T12936 |
59585-59591 |
VBN |
denotes |
boiled |
T12937 |
59592-59595 |
IN |
denotes |
for |
T12938 |
59596-59598 |
CD |
denotes |
10 |
T12939 |
59599-59602 |
NN |
denotes |
min |
T12940 |
59602-59603 |
. |
denotes |
. |
T12941 |
59603-59749 |
sentence |
denotes |
Samples were run on SDS-PAGE and transferred to nitrocellulose membrane (Schleicher and Schuell Bioscience, Keene, New Hampshire, United States). |
T12942 |
59604-59611 |
NNS |
denotes |
Samples |
T12943 |
59617-59620 |
VBN |
denotes |
run |
T12944 |
59612-59616 |
VBD |
denotes |
were |
T12945 |
59621-59623 |
IN |
denotes |
on |
T12946 |
59624-59627 |
NN |
denotes |
SDS |
T12947 |
59628-59632 |
NN |
denotes |
PAGE |
T12948 |
59627-59628 |
HYPH |
denotes |
- |
T12949 |
59633-59636 |
CC |
denotes |
and |
T12950 |
59637-59648 |
VBN |
denotes |
transferred |
T12951 |
59649-59651 |
IN |
denotes |
to |
T12952 |
59652-59666 |
NN |
denotes |
nitrocellulose |
T12953 |
59667-59675 |
NN |
denotes |
membrane |
T12954 |
59676-59677 |
-LRB- |
denotes |
( |
T12955 |
59700-59710 |
NNP |
denotes |
Bioscience |
T12956 |
59677-59687 |
NNP |
denotes |
Schleicher |
T12957 |
59688-59691 |
CC |
denotes |
and |
T12958 |
59692-59699 |
NNP |
denotes |
Schuell |
T12959 |
59710-59712 |
, |
denotes |
, |
T12960 |
59712-59717 |
NNP |
denotes |
Keene |
T12961 |
59717-59719 |
, |
denotes |
, |
T12962 |
59719-59722 |
NNP |
denotes |
New |
T12963 |
59723-59732 |
NNP |
denotes |
Hampshire |
T12964 |
59732-59734 |
, |
denotes |
, |
T12965 |
59734-59740 |
NNP |
denotes |
United |
T12966 |
59741-59747 |
NNP |
denotes |
States |
T12967 |
59747-59748 |
-RRB- |
denotes |
) |
T12968 |
59748-59749 |
. |
denotes |
. |
T12969 |
59749-59840 |
sentence |
denotes |
Western blot signals were developed using the enhanced chemiluminescence kit from Amersham |
T12970 |
59750-59757 |
NNP |
denotes |
Western |
T12971 |
59758-59762 |
NN |
denotes |
blot |
T12972 |
59763-59770 |
NNS |
denotes |
signals |
T12973 |
59776-59785 |
VBN |
denotes |
developed |
T12974 |
59771-59775 |
VBD |
denotes |
were |
T12975 |
59786-59791 |
VBG |
denotes |
using |
T12976 |
59792-59795 |
DT |
denotes |
the |
T12977 |
59823-59826 |
NN |
denotes |
kit |
T12978 |
59796-59804 |
VBN |
denotes |
enhanced |
T12979 |
59805-59822 |
NN |
denotes |
chemiluminescence |
T12980 |
59827-59831 |
IN |
denotes |
from |
T12981 |
59832-59840 |
NNP |
denotes |
Amersham |
T13041 |
59842-59846 |
NN |
denotes |
Cell |
T13042 |
59847-59854 |
NN |
denotes |
culture |
T13043 |
59854-59940 |
sentence |
denotes |
Primary keratinocytes were culture in low-calcium medium as previously described [4]. |
T13044 |
59855-59862 |
JJ |
denotes |
Primary |
T13045 |
59863-59876 |
NNS |
denotes |
keratinocytes |
T13046 |
59882-59889 |
VBN |
denotes |
culture |
T13047 |
59877-59881 |
VBD |
denotes |
were |
T13048 |
59890-59892 |
IN |
denotes |
in |
T13049 |
59893-59896 |
JJ |
denotes |
low |
T13050 |
59897-59904 |
NN |
denotes |
calcium |
T13051 |
59896-59897 |
HYPH |
denotes |
- |
T13052 |
59905-59911 |
NN |
denotes |
medium |
T13053 |
59912-59914 |
IN |
denotes |
as |
T13054 |
59926-59935 |
VBN |
denotes |
described |
T13055 |
59915-59925 |
RB |
denotes |
previously |
T13056 |
59936-59937 |
-LRB- |
denotes |
[ |
T13057 |
59937-59938 |
CD |
denotes |
4 |
T13058 |
59938-59939 |
-RRB- |
denotes |
] |
T13059 |
59939-59940 |
. |
denotes |
. |
T13060 |
59940-60090 |
sentence |
denotes |
Transient transfections were carried out with FuGENE6 reagent (Roche, Indianapolis, Indiana, United States) according to the manufacturer's protocol. |
T13061 |
59941-59950 |
JJ |
denotes |
Transient |
T13062 |
59951-59964 |
NNS |
denotes |
transfections |
T13063 |
59970-59977 |
VBN |
denotes |
carried |
T13064 |
59965-59969 |
VBD |
denotes |
were |
T13065 |
59978-59981 |
RP |
denotes |
out |
T13066 |
59982-59986 |
IN |
denotes |
with |
T13067 |
59987-59994 |
NN |
denotes |
FuGENE6 |
T13068 |
59995-60002 |
NN |
denotes |
reagent |
T13069 |
60003-60004 |
-LRB- |
denotes |
( |
T13070 |
60004-60009 |
NNP |
denotes |
Roche |
T13071 |
60009-60011 |
, |
denotes |
, |
T13072 |
60011-60023 |
NNP |
denotes |
Indianapolis |
T13073 |
60023-60025 |
, |
denotes |
, |
T13074 |
60025-60032 |
NNP |
denotes |
Indiana |
T13075 |
60032-60034 |
, |
denotes |
, |
T13076 |
60034-60040 |
NNP |
denotes |
United |
T13077 |
60041-60047 |
NNP |
denotes |
States |
T13078 |
60047-60048 |
-RRB- |
denotes |
) |
T13079 |
60049-60058 |
VBG |
denotes |
according |
T13080 |
60059-60061 |
IN |
denotes |
to |
T13081 |
60062-60065 |
DT |
denotes |
the |
T13082 |
60066-60078 |
NN |
denotes |
manufacturer |
T13083 |
60081-60089 |
NN |
denotes |
protocol |
T13084 |
60078-60080 |
POS |
denotes |
's |
T13085 |
60089-60090 |
. |
denotes |
. |
T13086 |
60090-60352 |
sentence |
denotes |
Measurement of β-galactosidase or luciferase levels in promoter activity studies were carried out with the Galacto-Lite assay kit (TROPIX, Bedford, Massachusetts, United States) and the Dual luciferase (Promega, Madison, Wisconsin, United States), respectively. |
T13087 |
60091-60102 |
NN |
denotes |
Measurement |
T13088 |
60177-60184 |
VBN |
denotes |
carried |
T13089 |
60103-60105 |
IN |
denotes |
of |
T13090 |
60106-60107 |
NN |
denotes |
β |
T13091 |
60108-60121 |
NN |
denotes |
galactosidase |
T13092 |
60107-60108 |
HYPH |
denotes |
- |
T13093 |
60136-60142 |
NNS |
denotes |
levels |
T13094 |
60122-60124 |
CC |
denotes |
or |
T13095 |
60125-60135 |
NN |
denotes |
luciferase |
T13096 |
60143-60145 |
IN |
denotes |
in |
T13097 |
60146-60154 |
NN |
denotes |
promoter |
T13098 |
60155-60163 |
NN |
denotes |
activity |
T13099 |
60164-60171 |
NNS |
denotes |
studies |
T13100 |
60172-60176 |
VBD |
denotes |
were |
T13101 |
60185-60188 |
RP |
denotes |
out |
T13102 |
60189-60193 |
IN |
denotes |
with |
T13103 |
60194-60197 |
DT |
denotes |
the |
T13104 |
60217-60220 |
NN |
denotes |
kit |
T13105 |
60198-60205 |
NNP |
denotes |
Galacto |
T13106 |
60206-60210 |
NNP |
denotes |
Lite |
T13107 |
60205-60206 |
HYPH |
denotes |
- |
T13108 |
60211-60216 |
NN |
denotes |
assay |
T13109 |
60221-60222 |
-LRB- |
denotes |
( |
T13110 |
60222-60228 |
NNP |
denotes |
TROPIX |
T13111 |
60228-60230 |
, |
denotes |
, |
T13112 |
60230-60237 |
NNP |
denotes |
Bedford |
T13113 |
60237-60239 |
, |
denotes |
, |
T13114 |
60239-60252 |
NNP |
denotes |
Massachusetts |
T13115 |
60252-60254 |
, |
denotes |
, |
T13116 |
60254-60260 |
NNP |
denotes |
United |
T13117 |
60261-60267 |
NNP |
denotes |
States |
T13118 |
60267-60268 |
-RRB- |
denotes |
) |
T13119 |
60269-60272 |
CC |
denotes |
and |
T13120 |
60273-60276 |
DT |
denotes |
the |
T13121 |
60282-60292 |
NN |
denotes |
luciferase |
T13122 |
60277-60281 |
JJ |
denotes |
Dual |
T13123 |
60293-60294 |
-LRB- |
denotes |
( |
T13124 |
60294-60301 |
NNP |
denotes |
Promega |
T13125 |
60301-60303 |
, |
denotes |
, |
T13126 |
60303-60310 |
NNP |
denotes |
Madison |
T13127 |
60310-60312 |
, |
denotes |
, |
T13128 |
60312-60321 |
NNP |
denotes |
Wisconsin |
T13129 |
60321-60323 |
, |
denotes |
, |
T13130 |
60323-60329 |
NNP |
denotes |
United |
T13131 |
60330-60336 |
NNP |
denotes |
States |
T13132 |
60336-60337 |
-RRB- |
denotes |
) |
T13133 |
60337-60339 |
, |
denotes |
, |
T13134 |
60339-60351 |
RB |
denotes |
respectively |
T13135 |
60351-60352 |
. |
denotes |
. |
T13136 |
60352-60440 |
sentence |
denotes |
Runella luciferase was cotransfected into cells to correct for transfection efficiency. |
T13137 |
60353-60360 |
NN |
denotes |
Runella |
T13138 |
60361-60371 |
NN |
denotes |
luciferase |
T13139 |
60376-60389 |
VBN |
denotes |
cotransfected |
T13140 |
60372-60375 |
VBD |
denotes |
was |
T13141 |
60390-60394 |
IN |
denotes |
into |
T13142 |
60395-60400 |
NNS |
denotes |
cells |
T13143 |
60401-60403 |
TO |
denotes |
to |
T13144 |
60404-60411 |
VB |
denotes |
correct |
T13145 |
60412-60415 |
IN |
denotes |
for |
T13146 |
60416-60428 |
NN |
denotes |
transfection |
T13147 |
60429-60439 |
NN |
denotes |
efficiency |
T13148 |
60439-60440 |
. |
denotes |
. |
T13149 |
60440-60511 |
sentence |
denotes |
Experiments were done in triplicate and repeated at least three times. |
T13150 |
60441-60452 |
NNS |
denotes |
Experiments |
T13151 |
60458-60462 |
VBN |
denotes |
done |
T13152 |
60453-60457 |
VBD |
denotes |
were |
T13153 |
60463-60465 |
IN |
denotes |
in |
T13154 |
60466-60476 |
NN |
denotes |
triplicate |
T13155 |
60477-60480 |
CC |
denotes |
and |
T13156 |
60481-60489 |
VBN |
denotes |
repeated |
T13157 |
60490-60492 |
RB |
denotes |
at |
T13158 |
60499-60504 |
CD |
denotes |
three |
T13159 |
60493-60498 |
RBS |
denotes |
least |
T13160 |
60505-60510 |
NNS |
denotes |
times |
T13161 |
60510-60511 |
. |
denotes |
. |
T13162 |
60511-60606 |
sentence |
denotes |
Measurements were done on a luminometer (MGM Instruments, Hamden, Connecticut, United States). |
T13163 |
60512-60524 |
NNS |
denotes |
Measurements |
T13164 |
60530-60534 |
VBN |
denotes |
done |
T13165 |
60525-60529 |
VBD |
denotes |
were |
T13166 |
60535-60537 |
IN |
denotes |
on |
T13167 |
60538-60539 |
DT |
denotes |
a |
T13168 |
60540-60551 |
NN |
denotes |
luminometer |
T13169 |
60552-60553 |
-LRB- |
denotes |
( |
T13170 |
60557-60568 |
NNP |
denotes |
Instruments |
T13171 |
60553-60556 |
NNP |
denotes |
MGM |
T13172 |
60568-60570 |
, |
denotes |
, |
T13173 |
60570-60576 |
NNP |
denotes |
Hamden |
T13174 |
60576-60578 |
, |
denotes |
, |
T13175 |
60578-60589 |
NNP |
denotes |
Connecticut |
T13176 |
60589-60591 |
, |
denotes |
, |
T13177 |
60591-60597 |
NNP |
denotes |
United |
T13178 |
60598-60604 |
NNP |
denotes |
States |
T13179 |
60604-60605 |
-RRB- |
denotes |
) |
T13180 |
60605-60606 |
. |
denotes |
. |
T13181 |
60606-60766 |
sentence |
denotes |
For experiments measuring phosphorylation of MAPK, keratinocytes were serum starved for 3 h prior to harvesting of cells by incubation in medium lacking serum. |
T13182 |
60607-60610 |
IN |
denotes |
For |
T13183 |
60683-60690 |
VBN |
denotes |
starved |
T13184 |
60611-60622 |
NNS |
denotes |
experiments |
T13185 |
60623-60632 |
VBG |
denotes |
measuring |
T13186 |
60633-60648 |
NN |
denotes |
phosphorylation |
T13187 |
60649-60651 |
IN |
denotes |
of |
T13188 |
60652-60656 |
NN |
denotes |
MAPK |
T13189 |
60656-60658 |
, |
denotes |
, |
T13190 |
60658-60671 |
NNS |
denotes |
keratinocytes |
T13191 |
60672-60676 |
VBD |
denotes |
were |
T13192 |
60677-60682 |
NN |
denotes |
serum |
T13193 |
60691-60694 |
IN |
denotes |
for |
T13194 |
60695-60696 |
CD |
denotes |
3 |
T13195 |
60697-60698 |
NN |
denotes |
h |
T13196 |
60699-60704 |
JJ |
denotes |
prior |
T13197 |
60705-60707 |
IN |
denotes |
to |
T13198 |
60708-60718 |
NN |
denotes |
harvesting |
T13199 |
60719-60721 |
IN |
denotes |
of |
T13200 |
60722-60727 |
NNS |
denotes |
cells |
T13201 |
60728-60730 |
IN |
denotes |
by |
T13202 |
60731-60741 |
NN |
denotes |
incubation |
T13203 |
60742-60744 |
IN |
denotes |
in |
T13204 |
60745-60751 |
NN |
denotes |
medium |
T13205 |
60752-60759 |
VBG |
denotes |
lacking |
T13206 |
60760-60765 |
NN |
denotes |
serum |
T13207 |
60765-60766 |
. |
denotes |
. |
T13208 |
60766-60855 |
sentence |
denotes |
Treatment of cells with Wnt- and noggin-conditioned medium was previously described [4]. |
T13209 |
60767-60776 |
NN |
denotes |
Treatment |
T13210 |
60841-60850 |
VBN |
denotes |
described |
T13211 |
60777-60779 |
IN |
denotes |
of |
T13212 |
60780-60785 |
NNS |
denotes |
cells |
T13213 |
60786-60790 |
IN |
denotes |
with |
T13214 |
60791-60794 |
NN |
denotes |
Wnt |
T13215 |
60807-60818 |
VBN |
denotes |
conditioned |
T13216 |
60794-60795 |
HYPH |
denotes |
- |
T13217 |
60796-60799 |
CC |
denotes |
and |
T13218 |
60800-60806 |
NN |
denotes |
noggin |
T13219 |
60806-60807 |
HYPH |
denotes |
- |
T13220 |
60819-60825 |
NN |
denotes |
medium |
T13221 |
60826-60829 |
VBD |
denotes |
was |
T13222 |
60830-60840 |
RB |
denotes |
previously |
T13223 |
60851-60852 |
-LRB- |
denotes |
[ |
T13224 |
60852-60853 |
CD |
denotes |
4 |
T13225 |
60853-60854 |
-RRB- |
denotes |
] |
T13226 |
60854-60855 |
. |
denotes |
. |
T13308 |
60857-60867 |
NNS |
denotes |
Constructs |
T13309 |
60867-61148 |
sentence |
denotes |
The 2.2-kb murine Snail promoter was generated by PCR using a forward primer with an XbaI linker sequence, 5′- TCTAGAATTGTTTGCTGCTGTATGGTCTTC-3′, along with a reverse primer with a BglII linker sequence, 5′- AGATCTGTTGGCCAGAGCGACCTAG- GTAG-3′, and mouse genomic DNA as a template. |
T13310 |
60868-60871 |
DT |
denotes |
The |
T13311 |
60892-60900 |
NN |
denotes |
promoter |
T13312 |
60872-60875 |
CD |
denotes |
2.2 |
T13313 |
60876-60878 |
NN |
denotes |
kb |
T13314 |
60875-60876 |
HYPH |
denotes |
- |
T13315 |
60879-60885 |
JJ |
denotes |
murine |
T13316 |
60886-60891 |
NN |
denotes |
Snail |
T13317 |
60905-60914 |
VBN |
denotes |
generated |
T13318 |
60901-60904 |
VBD |
denotes |
was |
T13319 |
60915-60917 |
IN |
denotes |
by |
T13320 |
60918-60921 |
NN |
denotes |
PCR |
T13321 |
60922-60927 |
VBG |
denotes |
using |
T13322 |
60928-60929 |
DT |
denotes |
a |
T13323 |
60938-60944 |
NN |
denotes |
primer |
T13324 |
60930-60937 |
JJ |
denotes |
forward |
T13325 |
60945-60949 |
IN |
denotes |
with |
T13326 |
60950-60952 |
DT |
denotes |
an |
T13327 |
60965-60973 |
NN |
denotes |
sequence |
T13328 |
60953-60957 |
NN |
denotes |
XbaI |
T13329 |
60958-60964 |
NN |
denotes |
linker |
T13330 |
60973-60975 |
, |
denotes |
, |
T13331 |
60975-60976 |
CD |
denotes |
5 |
T13332 |
60979-61009 |
NN |
denotes |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
T13333 |
60976-60977 |
SYM |
denotes |
′ |
T13334 |
60977-60978 |
HYPH |
denotes |
- |
T13335 |
61009-61010 |
HYPH |
denotes |
- |
T13336 |
61010-61011 |
CD |
denotes |
3 |
T13337 |
61011-61012 |
SYM |
denotes |
′ |
T13338 |
61012-61014 |
, |
denotes |
, |
T13339 |
61014-61019 |
IN |
denotes |
along |
T13340 |
61020-61024 |
IN |
denotes |
with |
T13341 |
61025-61026 |
DT |
denotes |
a |
T13342 |
61035-61041 |
NN |
denotes |
primer |
T13343 |
61027-61034 |
JJ |
denotes |
reverse |
T13344 |
61042-61046 |
IN |
denotes |
with |
T13345 |
61047-61048 |
DT |
denotes |
a |
T13346 |
61062-61070 |
NN |
denotes |
sequence |
T13347 |
61049-61054 |
NN |
denotes |
BglII |
T13348 |
61055-61061 |
NN |
denotes |
linker |
T13349 |
61070-61072 |
, |
denotes |
, |
T13350 |
61072-61073 |
CD |
denotes |
5 |
T13351 |
61103-61107 |
NN |
denotes |
GTAG |
T13352 |
61073-61074 |
SYM |
denotes |
′ |
T13353 |
61074-61075 |
HYPH |
denotes |
- |
T13354 |
61076-61101 |
NN |
denotes |
AGATCTGTTGGCCAGAGCGACCTAG |
T13355 |
61101-61102 |
HYPH |
denotes |
- |
T13356 |
61107-61108 |
HYPH |
denotes |
- |
T13357 |
61108-61109 |
CD |
denotes |
3 |
T13358 |
61109-61110 |
SYM |
denotes |
′ |
T13359 |
61110-61112 |
, |
denotes |
, |
T13360 |
61112-61115 |
CC |
denotes |
and |
T13361 |
61116-61121 |
NN |
denotes |
mouse |
T13362 |
61130-61133 |
NN |
denotes |
DNA |
T13363 |
61122-61129 |
JJ |
denotes |
genomic |
T13364 |
61134-61136 |
IN |
denotes |
as |
T13365 |
61137-61138 |
DT |
denotes |
a |
T13366 |
61139-61147 |
NN |
denotes |
template |
T13367 |
61147-61148 |
. |
denotes |
. |
T13368 |
61148-61340 |
sentence |
denotes |
The PCR product was purified with the Gel Extraction Kit (Qiagen, Valencia, California, United States) and ligated into pCRII-TOPO TA vector (Invitrogen, Carlsbad, California, United States). |
T13369 |
61149-61152 |
DT |
denotes |
The |
T13370 |
61157-61164 |
NN |
denotes |
product |
T13371 |
61153-61156 |
NN |
denotes |
PCR |
T13372 |
61169-61177 |
VBN |
denotes |
purified |
T13373 |
61165-61168 |
VBD |
denotes |
was |
T13374 |
61178-61182 |
IN |
denotes |
with |
T13375 |
61183-61186 |
DT |
denotes |
the |
T13376 |
61202-61205 |
NN |
denotes |
Kit |
T13377 |
61187-61190 |
NN |
denotes |
Gel |
T13378 |
61191-61201 |
NN |
denotes |
Extraction |
T13379 |
61206-61207 |
-LRB- |
denotes |
( |
T13380 |
61207-61213 |
NNP |
denotes |
Qiagen |
T13381 |
61213-61215 |
, |
denotes |
, |
T13382 |
61215-61223 |
NNP |
denotes |
Valencia |
T13383 |
61223-61225 |
, |
denotes |
, |
T13384 |
61225-61235 |
NNP |
denotes |
California |
T13385 |
61235-61237 |
, |
denotes |
, |
T13386 |
61237-61243 |
NNP |
denotes |
United |
T13387 |
61244-61250 |
NNP |
denotes |
States |
T13388 |
61250-61251 |
-RRB- |
denotes |
) |
T13389 |
61252-61255 |
CC |
denotes |
and |
T13390 |
61256-61263 |
VBN |
denotes |
ligated |
T13391 |
61264-61268 |
IN |
denotes |
into |
T13392 |
61269-61274 |
NN |
denotes |
pCRII |
T13393 |
61275-61279 |
NN |
denotes |
TOPO |
T13394 |
61274-61275 |
HYPH |
denotes |
- |
T13395 |
61283-61289 |
NN |
denotes |
vector |
T13396 |
61280-61282 |
NN |
denotes |
TA |
T13397 |
61290-61291 |
-LRB- |
denotes |
( |
T13398 |
61291-61301 |
NNP |
denotes |
Invitrogen |
T13399 |
61301-61303 |
, |
denotes |
, |
T13400 |
61303-61311 |
NNP |
denotes |
Carlsbad |
T13401 |
61311-61313 |
, |
denotes |
, |
T13402 |
61313-61323 |
NNP |
denotes |
California |
T13403 |
61323-61325 |
, |
denotes |
, |
T13404 |
61325-61331 |
NNP |
denotes |
United |
T13405 |
61332-61338 |
NNP |
denotes |
States |
T13406 |
61338-61339 |
-RRB- |
denotes |
) |
T13407 |
61339-61340 |
. |
denotes |
. |
T13408 |
61340-61521 |
sentence |
denotes |
The promoter was verified by sequencing and digested with XbaI and BglII and subcloned into the pβ-gal BASIC vector (BD Biosciences Clontech, Palo Alto, California, United States). |
T13409 |
61341-61344 |
DT |
denotes |
The |
T13410 |
61345-61353 |
NN |
denotes |
promoter |
T13411 |
61358-61366 |
VBN |
denotes |
verified |
T13412 |
61354-61357 |
VBD |
denotes |
was |
T13413 |
61367-61369 |
IN |
denotes |
by |
T13414 |
61370-61380 |
NN |
denotes |
sequencing |
T13415 |
61381-61384 |
CC |
denotes |
and |
T13416 |
61385-61393 |
VBN |
denotes |
digested |
T13417 |
61394-61398 |
IN |
denotes |
with |
T13418 |
61399-61403 |
NN |
denotes |
XbaI |
T13419 |
61404-61407 |
CC |
denotes |
and |
T13420 |
61408-61413 |
NN |
denotes |
BglII |
T13421 |
61414-61417 |
CC |
denotes |
and |
T13422 |
61418-61427 |
VBN |
denotes |
subcloned |
T13423 |
61428-61432 |
IN |
denotes |
into |
T13424 |
61433-61436 |
DT |
denotes |
the |
T13425 |
61450-61456 |
NN |
denotes |
vector |
T13426 |
61437-61439 |
NN |
denotes |
pβ |
T13427 |
61440-61443 |
NN |
denotes |
gal |
T13428 |
61439-61440 |
HYPH |
denotes |
- |
T13429 |
61444-61449 |
NN |
denotes |
BASIC |
T13430 |
61457-61458 |
-LRB- |
denotes |
( |
T13431 |
61473-61481 |
NNP |
denotes |
Clontech |
T13432 |
61458-61460 |
NNP |
denotes |
BD |
T13433 |
61461-61472 |
NNP |
denotes |
Biosciences |
T13434 |
61481-61483 |
, |
denotes |
, |
T13435 |
61483-61487 |
NNP |
denotes |
Palo |
T13436 |
61488-61492 |
NNP |
denotes |
Alto |
T13437 |
61492-61494 |
, |
denotes |
, |
T13438 |
61494-61504 |
NNP |
denotes |
California |
T13439 |
61504-61506 |
, |
denotes |
, |
T13440 |
61506-61512 |
NNP |
denotes |
United |
T13441 |
61513-61519 |
NNP |
denotes |
States |
T13442 |
61519-61520 |
-RRB- |
denotes |
) |
T13443 |
61520-61521 |
. |
denotes |
. |
T13444 |
61521-61815 |
sentence |
denotes |
The point mutations in the SMAD binding element was generated with the Quik-Change Kit (Stratagene, La Jolla, California, United States) using the forward primer 5′- GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC-3′ and the reverse primer 5′- GCTTTT- CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC-3′. |
T13445 |
61522-61525 |
DT |
denotes |
The |
T13446 |
61532-61541 |
NNS |
denotes |
mutations |
T13447 |
61526-61531 |
NN |
denotes |
point |
T13448 |
61574-61583 |
VBN |
denotes |
generated |
T13449 |
61542-61544 |
IN |
denotes |
in |
T13450 |
61545-61548 |
DT |
denotes |
the |
T13451 |
61562-61569 |
NN |
denotes |
element |
T13452 |
61549-61553 |
NN |
denotes |
SMAD |
T13453 |
61554-61561 |
NN |
denotes |
binding |
T13454 |
61570-61573 |
VBD |
denotes |
was |
T13455 |
61584-61588 |
IN |
denotes |
with |
T13456 |
61589-61592 |
DT |
denotes |
the |
T13457 |
61605-61608 |
NNP |
denotes |
Kit |
T13458 |
61593-61597 |
NNP |
denotes |
Quik |
T13459 |
61598-61604 |
NNP |
denotes |
Change |
T13460 |
61597-61598 |
HYPH |
denotes |
- |
T13461 |
61609-61610 |
-LRB- |
denotes |
( |
T13462 |
61610-61620 |
NNP |
denotes |
Stratagene |
T13463 |
61620-61622 |
, |
denotes |
, |
T13464 |
61622-61624 |
NNP |
denotes |
La |
T13465 |
61625-61630 |
NNP |
denotes |
Jolla |
T13466 |
61630-61632 |
, |
denotes |
, |
T13467 |
61632-61642 |
NNP |
denotes |
California |
T13468 |
61642-61644 |
, |
denotes |
, |
T13469 |
61644-61650 |
NNP |
denotes |
United |
T13470 |
61651-61657 |
NNP |
denotes |
States |
T13471 |
61657-61658 |
-RRB- |
denotes |
) |
T13472 |
61659-61664 |
VBG |
denotes |
using |
T13473 |
61665-61668 |
DT |
denotes |
the |
T13474 |
61677-61683 |
NN |
denotes |
primer |
T13475 |
61669-61676 |
JJ |
denotes |
forward |
T13476 |
61684-61685 |
CD |
denotes |
5 |
T13477 |
61688-61733 |
NN |
denotes |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
T13478 |
61685-61686 |
SYM |
denotes |
′ |
T13479 |
61686-61687 |
HYPH |
denotes |
- |
T13480 |
61733-61734 |
HYPH |
denotes |
- |
T13481 |
61734-61735 |
CD |
denotes |
3 |
T13482 |
61735-61736 |
SYM |
denotes |
′ |
T13483 |
61737-61740 |
CC |
denotes |
and |
T13484 |
61741-61744 |
DT |
denotes |
the |
T13485 |
61753-61759 |
NN |
denotes |
primer |
T13486 |
61745-61752 |
JJ |
denotes |
reverse |
T13487 |
61760-61761 |
CD |
denotes |
5 |
T13488 |
61772-61811 |
NN |
denotes |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
T13489 |
61761-61762 |
SYM |
denotes |
′ |
T13490 |
61762-61763 |
HYPH |
denotes |
- |
T13491 |
61764-61770 |
NN |
denotes |
GCTTTT |
T13492 |
61770-61771 |
HYPH |
denotes |
- |
T13493 |
61811-61812 |
HYPH |
denotes |
- |
T13494 |
61812-61813 |
CD |
denotes |
3 |
T13495 |
61813-61814 |
SYM |
denotes |
′ |
T13496 |
61814-61815 |
. |
denotes |
. |
T13497 |
61815-62048 |
sentence |
denotes |
The probes for the Snail in situ hybridization were generated against the 3′ UTR by PCR using the forward primer 5′- ACCTTCTCCCGCATGTCCTTGCTCC-3′ and the reverse primer 5′- CTGCTGAGGCATGGTTACAGCTGG-3′, and genomic DNA as a template. |
T13498 |
61816-61819 |
DT |
denotes |
The |
T13499 |
61820-61826 |
NNS |
denotes |
probes |
T13500 |
61868-61877 |
VBN |
denotes |
generated |
T13501 |
61827-61830 |
IN |
denotes |
for |
T13502 |
61831-61834 |
DT |
denotes |
the |
T13503 |
61849-61862 |
NN |
denotes |
hybridization |
T13504 |
61835-61840 |
NN |
denotes |
Snail |
T13505 |
61841-61843 |
FW |
denotes |
in |
T13506 |
61844-61848 |
FW |
denotes |
situ |
T13507 |
61863-61867 |
VBD |
denotes |
were |
T13508 |
61878-61885 |
IN |
denotes |
against |
T13509 |
61886-61889 |
DT |
denotes |
the |
T13510 |
61893-61896 |
NN |
denotes |
UTR |
T13511 |
61890-61891 |
CD |
denotes |
3 |
T13512 |
61891-61892 |
SYM |
denotes |
′ |
T13513 |
61897-61899 |
IN |
denotes |
by |
T13514 |
61900-61903 |
NN |
denotes |
PCR |
T13515 |
61904-61909 |
VBG |
denotes |
using |
T13516 |
61910-61913 |
DT |
denotes |
the |
T13517 |
61922-61928 |
NN |
denotes |
primer |
T13518 |
61914-61921 |
JJ |
denotes |
forward |
T13519 |
61929-61930 |
CD |
denotes |
5 |
T13520 |
61933-61958 |
NN |
denotes |
ACCTTCTCCCGCATGTCCTTGCTCC |
T13521 |
61930-61931 |
SYM |
denotes |
′ |
T13522 |
61931-61932 |
HYPH |
denotes |
- |
T13523 |
61958-61959 |
HYPH |
denotes |
- |
T13524 |
61959-61960 |
CD |
denotes |
3 |
T13525 |
61960-61961 |
SYM |
denotes |
′ |
T13526 |
61962-61965 |
CC |
denotes |
and |
T13527 |
61966-61969 |
DT |
denotes |
the |
T13528 |
61978-61984 |
NN |
denotes |
primer |
T13529 |
61970-61977 |
JJ |
denotes |
reverse |
T13530 |
61985-61986 |
CD |
denotes |
5 |
T13531 |
61989-62013 |
NN |
denotes |
CTGCTGAGGCATGGTTACAGCTGG |
T13532 |
61986-61987 |
SYM |
denotes |
′ |
T13533 |
61987-61988 |
HYPH |
denotes |
- |
T13534 |
62013-62014 |
HYPH |
denotes |
- |
T13535 |
62014-62015 |
CD |
denotes |
3 |
T13536 |
62015-62016 |
SYM |
denotes |
′ |
T13537 |
62016-62018 |
, |
denotes |
, |
T13538 |
62018-62021 |
CC |
denotes |
and |
T13539 |
62022-62029 |
JJ |
denotes |
genomic |
T13540 |
62030-62033 |
NN |
denotes |
DNA |
T13541 |
62034-62036 |
IN |
denotes |
as |
T13542 |
62037-62038 |
DT |
denotes |
a |
T13543 |
62039-62047 |
NN |
denotes |
template |
T13544 |
62047-62048 |
. |
denotes |
. |
T13545 |
62048-62120 |
sentence |
denotes |
The PCR product was gel purified and ligated into pCRII-TOPO TA vector. |
T13546 |
62049-62052 |
DT |
denotes |
The |
T13547 |
62057-62064 |
NN |
denotes |
product |
T13548 |
62053-62056 |
NN |
denotes |
PCR |
T13549 |
62073-62081 |
VBN |
denotes |
purified |
T13550 |
62065-62068 |
VBD |
denotes |
was |
T13551 |
62069-62072 |
NN |
denotes |
gel |
T13552 |
62082-62085 |
CC |
denotes |
and |
T13553 |
62086-62093 |
VBN |
denotes |
ligated |
T13554 |
62094-62098 |
IN |
denotes |
into |
T13555 |
62099-62104 |
NN |
denotes |
pCRII |
T13556 |
62105-62109 |
NN |
denotes |
TOPO |
T13557 |
62104-62105 |
HYPH |
denotes |
- |
T13558 |
62113-62119 |
NN |
denotes |
vector |
T13559 |
62110-62112 |
NN |
denotes |
TA |
T13560 |
62119-62120 |
. |
denotes |
. |
T13561 |
62120-62281 |
sentence |
denotes |
The pre-LIM domain of Ajuba was generated essentially as described [9], but was fused to GFP by subcloning from the pEGFP-N1 20 vector (BD Biosciences Clontech) |
T13562 |
62121-62124 |
DT |
denotes |
The |
T13563 |
62133-62139 |
NN |
denotes |
domain |
T13564 |
62125-62132 |
JJ |
denotes |
pre-LIM |
T13565 |
62153-62162 |
VBN |
denotes |
generated |
T13566 |
62140-62142 |
IN |
denotes |
of |
T13567 |
62143-62148 |
NN |
denotes |
Ajuba |
T13568 |
62149-62152 |
VBD |
denotes |
was |
T13569 |
62163-62174 |
RB |
denotes |
essentially |
T13570 |
62175-62177 |
IN |
denotes |
as |
T13571 |
62178-62187 |
VBN |
denotes |
described |
T13572 |
62188-62189 |
-LRB- |
denotes |
[ |
T13573 |
62189-62190 |
CD |
denotes |
9 |
T13574 |
62190-62191 |
-RRB- |
denotes |
] |
T13575 |
62191-62193 |
, |
denotes |
, |
T13576 |
62193-62196 |
CC |
denotes |
but |
T13577 |
62197-62200 |
VBD |
denotes |
was |
T13578 |
62201-62206 |
VBN |
denotes |
fused |
T13579 |
62207-62209 |
IN |
denotes |
to |
T13580 |
62210-62213 |
NN |
denotes |
GFP |
T13581 |
62214-62216 |
IN |
denotes |
by |
T13582 |
62217-62227 |
VBG |
denotes |
subcloning |
T13583 |
62228-62232 |
IN |
denotes |
from |
T13584 |
62233-62236 |
DT |
denotes |
the |
T13585 |
62249-62255 |
NN |
denotes |
vector |
T13586 |
62237-62242 |
NN |
denotes |
pEGFP |
T13587 |
62243-62245 |
NN |
denotes |
N1 |
T13588 |
62242-62243 |
HYPH |
denotes |
- |
T13589 |
62246-62248 |
CD |
denotes |
20 |
T13590 |
62256-62257 |
-LRB- |
denotes |
( |
T13591 |
62272-62280 |
NNP |
denotes |
Clontech |
T13592 |
62257-62259 |
NNP |
denotes |
BD |
T13593 |
62260-62271 |
NNP |
denotes |
Biosciences |
T13594 |
62280-62281 |
-RRB- |
denotes |
) |
T13649 |
62283-62285 |
FW |
denotes |
In |
T13650 |
62286-62290 |
FW |
denotes |
situ |
T13651 |
62291-62304 |
NN |
denotes |
hybridization |
T13652 |
62304-62467 |
sentence |
denotes |
The pCRII-TOPO TA vector containing a region of the 3′ UTR of Snail was used as a template to generate digoxigenin-labeled sense and antisense riboprobes (Roche). |
T13653 |
62305-62308 |
DT |
denotes |
The |
T13654 |
62323-62329 |
NN |
denotes |
vector |
T13655 |
62309-62314 |
NN |
denotes |
pCRII |
T13656 |
62315-62319 |
NN |
denotes |
TOPO |
T13657 |
62314-62315 |
HYPH |
denotes |
- |
T13658 |
62320-62322 |
NN |
denotes |
TA |
T13659 |
62377-62381 |
VBN |
denotes |
used |
T13660 |
62330-62340 |
VBG |
denotes |
containing |
T13661 |
62341-62342 |
DT |
denotes |
a |
T13662 |
62343-62349 |
NN |
denotes |
region |
T13663 |
62350-62352 |
IN |
denotes |
of |
T13664 |
62353-62356 |
DT |
denotes |
the |
T13665 |
62360-62363 |
NN |
denotes |
UTR |
T13666 |
62357-62358 |
CD |
denotes |
3 |
T13667 |
62358-62359 |
SYM |
denotes |
′ |
T13668 |
62364-62366 |
IN |
denotes |
of |
T13669 |
62367-62372 |
NN |
denotes |
Snail |
T13670 |
62373-62376 |
VBD |
denotes |
was |
T13671 |
62382-62384 |
IN |
denotes |
as |
T13672 |
62385-62386 |
DT |
denotes |
a |
T13673 |
62387-62395 |
NN |
denotes |
template |
T13674 |
62396-62398 |
TO |
denotes |
to |
T13675 |
62399-62407 |
VB |
denotes |
generate |
T13676 |
62408-62419 |
NN |
denotes |
digoxigenin |
T13677 |
62420-62427 |
VBN |
denotes |
labeled |
T13678 |
62419-62420 |
HYPH |
denotes |
- |
T13679 |
62448-62458 |
NNS |
denotes |
riboprobes |
T13680 |
62428-62433 |
NN |
denotes |
sense |
T13681 |
62434-62437 |
CC |
denotes |
and |
T13682 |
62438-62447 |
NN |
denotes |
antisense |
T13683 |
62459-62460 |
-LRB- |
denotes |
( |
T13684 |
62460-62465 |
NNP |
denotes |
Roche |
T13685 |
62465-62466 |
-RRB- |
denotes |
) |
T13686 |
62466-62467 |
. |
denotes |
. |
T13687 |
62467-62533 |
sentence |
denotes |
The respective probes were obtained by XhoI and BamH1 digestions. |
T13688 |
62468-62471 |
DT |
denotes |
The |
T13689 |
62483-62489 |
NNS |
denotes |
probes |
T13690 |
62472-62482 |
JJ |
denotes |
respective |
T13691 |
62495-62503 |
VBN |
denotes |
obtained |
T13692 |
62490-62494 |
VBD |
denotes |
were |
T13693 |
62504-62506 |
IN |
denotes |
by |
T13694 |
62507-62511 |
NN |
denotes |
XhoI |
T13695 |
62522-62532 |
NNS |
denotes |
digestions |
T13696 |
62512-62515 |
CC |
denotes |
and |
T13697 |
62516-62521 |
NN |
denotes |
BamH1 |
T13698 |
62532-62533 |
. |
denotes |
. |
T13699 |
62533-62619 |
sentence |
denotes |
In situ hybridizations were performed on 10-μm thick sections of E17.5 mouse embryos. |
T13700 |
62534-62536 |
FW |
denotes |
In |
T13701 |
62537-62541 |
FW |
denotes |
situ |
T13702 |
62542-62556 |
NNS |
denotes |
hybridizations |
T13703 |
62562-62571 |
VBN |
denotes |
performed |
T13704 |
62557-62561 |
VBD |
denotes |
were |
T13705 |
62572-62574 |
IN |
denotes |
on |
T13706 |
62575-62577 |
CD |
denotes |
10 |
T13707 |
62578-62580 |
NN |
denotes |
μm |
T13708 |
62577-62578 |
HYPH |
denotes |
- |
T13709 |
62581-62586 |
JJ |
denotes |
thick |
T13710 |
62587-62595 |
NNS |
denotes |
sections |
T13711 |
62596-62598 |
IN |
denotes |
of |
T13712 |
62599-62604 |
NN |
denotes |
E17.5 |
T13713 |
62611-62618 |
NNS |
denotes |
embryos |
T13714 |
62605-62610 |
NN |
denotes |
mouse |
T13715 |
62618-62619 |
. |
denotes |
. |
T13716 |
62619-62902 |
sentence |
denotes |
The sections were fixed with 4% PFA for 10 min at room temperature, prehybridized at room temperature for 4.5 h, hybridized with the probe (2 μg/ml) at 55 °C for 12–14 h, blocked with 10% NGS, and treated with anti-dig Fab-AP antibody (Roche #1093274) at a 1:2,500 dilution for 3 h. |
T13717 |
62620-62623 |
DT |
denotes |
The |
T13718 |
62624-62632 |
NNS |
denotes |
sections |
T13719 |
62638-62643 |
VBN |
denotes |
fixed |
T13720 |
62633-62637 |
VBD |
denotes |
were |
T13721 |
62644-62648 |
IN |
denotes |
with |
T13722 |
62649-62650 |
CD |
denotes |
4 |
T13723 |
62650-62651 |
NN |
denotes |
% |
T13724 |
62652-62655 |
NN |
denotes |
PFA |
T13725 |
62656-62659 |
IN |
denotes |
for |
T13726 |
62660-62662 |
CD |
denotes |
10 |
T13727 |
62663-62666 |
NN |
denotes |
min |
T13728 |
62667-62669 |
IN |
denotes |
at |
T13729 |
62670-62674 |
NN |
denotes |
room |
T13730 |
62675-62686 |
NN |
denotes |
temperature |
T13731 |
62686-62688 |
, |
denotes |
, |
T13732 |
62688-62701 |
VBN |
denotes |
prehybridized |
T13733 |
62702-62704 |
IN |
denotes |
at |
T13734 |
62705-62709 |
NN |
denotes |
room |
T13735 |
62710-62721 |
NN |
denotes |
temperature |
T13736 |
62722-62725 |
IN |
denotes |
for |
T13737 |
62726-62729 |
CD |
denotes |
4.5 |
T13738 |
62730-62731 |
NN |
denotes |
h |
T13739 |
62731-62733 |
, |
denotes |
, |
T13740 |
62733-62743 |
VBN |
denotes |
hybridized |
T13741 |
62744-62748 |
IN |
denotes |
with |
T13742 |
62749-62752 |
DT |
denotes |
the |
T13743 |
62753-62758 |
NN |
denotes |
probe |
T13744 |
62759-62760 |
-LRB- |
denotes |
( |
T13745 |
62762-62764 |
NN |
denotes |
μg |
T13746 |
62760-62761 |
CD |
denotes |
2 |
T13747 |
62764-62765 |
SYM |
denotes |
/ |
T13748 |
62765-62767 |
NN |
denotes |
ml |
T13749 |
62767-62768 |
-RRB- |
denotes |
) |
T13750 |
62769-62771 |
IN |
denotes |
at |
T13751 |
62772-62774 |
CD |
denotes |
55 |
T13752 |
62775-62777 |
NN |
denotes |
°C |
T13753 |
62778-62781 |
IN |
denotes |
for |
T13754 |
62782-62784 |
CD |
denotes |
12 |
T13755 |
62785-62787 |
CD |
denotes |
14 |
T13756 |
62784-62785 |
SYM |
denotes |
– |
T13757 |
62788-62789 |
NN |
denotes |
h |
T13758 |
62789-62791 |
, |
denotes |
, |
T13759 |
62791-62798 |
VBN |
denotes |
blocked |
T13760 |
62799-62803 |
IN |
denotes |
with |
T13761 |
62804-62806 |
CD |
denotes |
10 |
T13762 |
62806-62807 |
NN |
denotes |
% |
T13763 |
62808-62811 |
NN |
denotes |
NGS |
T13764 |
62811-62813 |
, |
denotes |
, |
T13765 |
62813-62816 |
CC |
denotes |
and |
T13766 |
62817-62824 |
VBN |
denotes |
treated |
T13767 |
62825-62829 |
IN |
denotes |
with |
T13768 |
62830-62838 |
JJ |
denotes |
anti-dig |
T13769 |
62846-62854 |
NN |
denotes |
antibody |
T13770 |
62839-62842 |
NN |
denotes |
Fab |
T13771 |
62843-62845 |
NN |
denotes |
AP |
T13772 |
62842-62843 |
HYPH |
denotes |
- |
T13773 |
62855-62856 |
-LRB- |
denotes |
( |
T13774 |
62856-62861 |
NNP |
denotes |
Roche |
T13775 |
62862-62863 |
SYM |
denotes |
# |
T13776 |
62863-62870 |
CD |
denotes |
1093274 |
T13777 |
62870-62871 |
-RRB- |
denotes |
) |
T13778 |
62872-62874 |
IN |
denotes |
at |
T13779 |
62875-62876 |
DT |
denotes |
a |
T13780 |
62885-62893 |
NN |
denotes |
dilution |
T13781 |
62877-62878 |
CD |
denotes |
1 |
T13782 |
62879-62884 |
CD |
denotes |
2,500 |
T13783 |
62878-62879 |
SYM |
denotes |
: |
T13784 |
62894-62897 |
IN |
denotes |
for |
T13785 |
62898-62899 |
CD |
denotes |
3 |
T13786 |
62900-62901 |
NN |
denotes |
h |
T13787 |
62901-62902 |
. |
denotes |
. |
T13788 |
62902-62984 |
sentence |
denotes |
The sections were incubated with NBT and BCIP until adequate signal was detected. |
T13789 |
62903-62906 |
DT |
denotes |
The |
T13790 |
62907-62915 |
NNS |
denotes |
sections |
T13791 |
62921-62930 |
VBN |
denotes |
incubated |
T13792 |
62916-62920 |
VBD |
denotes |
were |
T13793 |
62931-62935 |
IN |
denotes |
with |
T13794 |
62936-62939 |
NN |
denotes |
NBT |
T13795 |
62940-62943 |
CC |
denotes |
and |
T13796 |
62944-62948 |
NN |
denotes |
BCIP |
T13797 |
62949-62954 |
IN |
denotes |
until |
T13798 |
62975-62983 |
VBN |
denotes |
detected |
T13799 |
62955-62963 |
JJ |
denotes |
adequate |
T13800 |
62964-62970 |
NN |
denotes |
signal |
T13801 |
62971-62974 |
VBD |
denotes |
was |
T13802 |
62983-62984 |
. |
denotes |
. |
T13828 |
62986-63004 |
NN |
denotes |
Immunofluorescence |
T13829 |
63005-63008 |
CC |
denotes |
and |
T13830 |
63009-63029 |
NN |
denotes |
immunohistochemistry |
T13831 |
63029-63127 |
sentence |
denotes |
Tissue samples for immunofluorescence were frozen in OCT and sectioned 10 μm thick on a cryostat. |
T13832 |
63030-63036 |
NN |
denotes |
Tissue |
T13833 |
63037-63044 |
NNS |
denotes |
samples |
T13834 |
63073-63079 |
VBN |
denotes |
frozen |
T13835 |
63045-63048 |
IN |
denotes |
for |
T13836 |
63049-63067 |
NN |
denotes |
immunofluorescence |
T13837 |
63068-63072 |
VBD |
denotes |
were |
T13838 |
63080-63082 |
IN |
denotes |
in |
T13839 |
63083-63086 |
NN |
denotes |
OCT |
T13840 |
63087-63090 |
CC |
denotes |
and |
T13841 |
63091-63100 |
VBN |
denotes |
sectioned |
T13842 |
63101-63103 |
CD |
denotes |
10 |
T13843 |
63104-63106 |
NN |
denotes |
μm |
T13844 |
63107-63112 |
JJ |
denotes |
thick |
T13845 |
63113-63115 |
IN |
denotes |
on |
T13846 |
63116-63117 |
DT |
denotes |
a |
T13847 |
63118-63126 |
NN |
denotes |
cryostat |
T13848 |
63126-63127 |
. |
denotes |
. |
T13849 |
63127-63240 |
sentence |
denotes |
Sections were fixed in 4% paraformaldehyde for 10 min at room temperature, blocked, and stained with antibodies. |
T13850 |
63128-63136 |
NNS |
denotes |
Sections |
T13851 |
63142-63147 |
VBN |
denotes |
fixed |
T13852 |
63137-63141 |
VBD |
denotes |
were |
T13853 |
63148-63150 |
IN |
denotes |
in |
T13854 |
63151-63152 |
CD |
denotes |
4 |
T13855 |
63152-63153 |
NN |
denotes |
% |
T13856 |
63154-63170 |
NN |
denotes |
paraformaldehyde |
T13857 |
63171-63174 |
IN |
denotes |
for |
T13858 |
63175-63177 |
CD |
denotes |
10 |
T13859 |
63178-63181 |
NN |
denotes |
min |
T13860 |
63182-63184 |
IN |
denotes |
at |
T13861 |
63185-63189 |
NN |
denotes |
room |
T13862 |
63190-63201 |
NN |
denotes |
temperature |
T13863 |
63201-63203 |
, |
denotes |
, |
T13864 |
63203-63210 |
VBN |
denotes |
blocked |
T13865 |
63210-63212 |
, |
denotes |
, |
T13866 |
63212-63215 |
CC |
denotes |
and |
T13867 |
63216-63223 |
VBN |
denotes |
stained |
T13868 |
63224-63228 |
IN |
denotes |
with |
T13869 |
63229-63239 |
NNS |
denotes |
antibodies |
T13870 |
63239-63240 |
. |
denotes |
. |
T13871 |
63240-63353 |
sentence |
denotes |
Tissue samples for immunohistochemistry were fixed in 4% paraformaldehyde, dehydrated, and embedded in paraffin. |
T13872 |
63241-63247 |
NN |
denotes |
Tissue |
T13873 |
63248-63255 |
NNS |
denotes |
samples |
T13874 |
63286-63291 |
VBN |
denotes |
fixed |
T13875 |
63256-63259 |
IN |
denotes |
for |
T13876 |
63260-63280 |
NN |
denotes |
immunohistochemistry |
T13877 |
63281-63285 |
VBD |
denotes |
were |
T13878 |
63292-63294 |
IN |
denotes |
in |
T13879 |
63295-63296 |
CD |
denotes |
4 |
T13880 |
63296-63297 |
NN |
denotes |
% |
T13881 |
63298-63314 |
NN |
denotes |
paraformaldehyde |
T13882 |
63314-63316 |
, |
denotes |
, |
T13883 |
63316-63326 |
VBN |
denotes |
dehydrated |
T13884 |
63326-63328 |
, |
denotes |
, |
T13885 |
63328-63331 |
CC |
denotes |
and |
T13886 |
63332-63340 |
VBN |
denotes |
embedded |
T13887 |
63341-63343 |
IN |
denotes |
in |
T13888 |
63344-63352 |
NN |
denotes |
paraffin |
T13889 |
63352-63353 |
. |
denotes |
. |
T13890 |
63353-63453 |
sentence |
denotes |
Samples were sectioned on a microtome (10 μm thick) and rehydrated prior to staining with antibody. |
T13891 |
63354-63361 |
NNS |
denotes |
Samples |
T13892 |
63367-63376 |
VBN |
denotes |
sectioned |
T13893 |
63362-63366 |
VBD |
denotes |
were |
T13894 |
63377-63379 |
IN |
denotes |
on |
T13895 |
63380-63381 |
DT |
denotes |
a |
T13896 |
63382-63391 |
NN |
denotes |
microtome |
T13897 |
63392-63393 |
-LRB- |
denotes |
( |
T13898 |
63399-63404 |
JJ |
denotes |
thick |
T13899 |
63393-63395 |
CD |
denotes |
10 |
T13900 |
63396-63398 |
NN |
denotes |
μm |
T13901 |
63404-63405 |
-RRB- |
denotes |
) |
T13902 |
63406-63409 |
CC |
denotes |
and |
T13903 |
63410-63420 |
VBD |
denotes |
rehydrated |
T13904 |
63421-63426 |
IN |
denotes |
prior |
T13905 |
63427-63429 |
IN |
denotes |
to |
T13906 |
63430-63438 |
VBG |
denotes |
staining |
T13907 |
63439-63443 |
IN |
denotes |
with |
T13908 |
63444-63452 |
NN |
denotes |
antibody |
T13909 |
63452-63453 |
. |
denotes |
. |
T13910 |
63453-63639 |
sentence |
denotes |
Samples stained with Snail, pMAPK, pSmad2, and cyclin D were antigen unmasked with 10 mM sodium citrate (pH 6) in an Antigen Retriever 2100 (Pickcell Laboratories, Leiden, Netherlands). |
T13911 |
63454-63461 |
NNS |
denotes |
Samples |
T13912 |
63523-63531 |
VBN |
denotes |
unmasked |
T13913 |
63462-63469 |
VBN |
denotes |
stained |
T13914 |
63470-63474 |
IN |
denotes |
with |
T13915 |
63475-63480 |
NN |
denotes |
Snail |
T13916 |
63480-63482 |
, |
denotes |
, |
T13917 |
63482-63487 |
NN |
denotes |
pMAPK |
T13918 |
63487-63489 |
, |
denotes |
, |
T13919 |
63489-63495 |
NN |
denotes |
pSmad2 |
T13920 |
63495-63497 |
, |
denotes |
, |
T13921 |
63497-63500 |
CC |
denotes |
and |
T13922 |
63501-63507 |
NN |
denotes |
cyclin |
T13923 |
63508-63509 |
NN |
denotes |
D |
T13924 |
63510-63514 |
VBD |
denotes |
were |
T13925 |
63515-63522 |
NN |
denotes |
antigen |
T13926 |
63532-63536 |
IN |
denotes |
with |
T13927 |
63537-63539 |
CD |
denotes |
10 |
T13928 |
63540-63542 |
NN |
denotes |
mM |
T13929 |
63550-63557 |
NN |
denotes |
citrate |
T13930 |
63543-63549 |
NN |
denotes |
sodium |
T13931 |
63558-63559 |
-LRB- |
denotes |
( |
T13932 |
63559-63561 |
NN |
denotes |
pH |
T13933 |
63562-63563 |
CD |
denotes |
6 |
T13934 |
63563-63564 |
-RRB- |
denotes |
) |
T13935 |
63565-63567 |
IN |
denotes |
in |
T13936 |
63568-63570 |
DT |
denotes |
an |
T13937 |
63579-63588 |
NNP |
denotes |
Retriever |
T13938 |
63571-63578 |
NNP |
denotes |
Antigen |
T13939 |
63589-63593 |
CD |
denotes |
2100 |
T13940 |
63594-63595 |
-LRB- |
denotes |
( |
T13941 |
63604-63616 |
NNP |
denotes |
Laboratories |
T13942 |
63595-63603 |
NNP |
denotes |
Pickcell |
T13943 |
63616-63618 |
, |
denotes |
, |
T13944 |
63618-63624 |
NNP |
denotes |
Leiden |
T13945 |
63624-63626 |
, |
denotes |
, |
T13946 |
63626-63637 |
NNP |
denotes |
Netherlands |
T13947 |
63637-63638 |
-RRB- |
denotes |
) |
T13948 |
63638-63639 |
. |
denotes |
. |
T13949 |
63639-63748 |
sentence |
denotes |
The DAB substrate kit (Vector Labs) was used according to manufacturer's instructions to develop the signal. |
T13950 |
63640-63643 |
DT |
denotes |
The |
T13951 |
63658-63661 |
NN |
denotes |
kit |
T13952 |
63644-63647 |
NN |
denotes |
DAB |
T13953 |
63648-63657 |
NN |
denotes |
substrate |
T13954 |
63680-63684 |
VBN |
denotes |
used |
T13955 |
63662-63663 |
-LRB- |
denotes |
( |
T13956 |
63670-63674 |
NNPS |
denotes |
Labs |
T13957 |
63663-63669 |
NNP |
denotes |
Vector |
T13958 |
63674-63675 |
-RRB- |
denotes |
) |
T13959 |
63676-63679 |
VBD |
denotes |
was |
T13960 |
63685-63694 |
VBG |
denotes |
according |
T13961 |
63695-63697 |
IN |
denotes |
to |
T13962 |
63698-63710 |
NN |
denotes |
manufacturer |
T13963 |
63713-63725 |
NNS |
denotes |
instructions |
T13964 |
63710-63712 |
POS |
denotes |
's |
T13965 |
63726-63728 |
TO |
denotes |
to |
T13966 |
63729-63736 |
VB |
denotes |
develop |
T13967 |
63737-63740 |
DT |
denotes |
the |
T13968 |
63741-63747 |
NN |
denotes |
signal |
T13969 |
63747-63748 |
. |
denotes |
. |
T14009 |
63753-63756 |
NN |
denotes |
PCR |
T14010 |
63752-63753 |
HYPH |
denotes |
- |
T14011 |
63756-63875 |
sentence |
denotes |
RNA was extracted from keratinocytes or skin tissue with Trizol (Invitrogen) according to the manufacturer's protocol. |
T14012 |
63757-63760 |
NN |
denotes |
RNA |
T14013 |
63765-63774 |
VBN |
denotes |
extracted |
T14014 |
63761-63764 |
VBD |
denotes |
was |
T14015 |
63775-63779 |
IN |
denotes |
from |
T14016 |
63780-63793 |
NNS |
denotes |
keratinocytes |
T14017 |
63794-63796 |
CC |
denotes |
or |
T14018 |
63797-63801 |
NN |
denotes |
skin |
T14019 |
63802-63808 |
NN |
denotes |
tissue |
T14020 |
63809-63813 |
IN |
denotes |
with |
T14021 |
63814-63820 |
NN |
denotes |
Trizol |
T14022 |
63821-63822 |
-LRB- |
denotes |
( |
T14023 |
63822-63832 |
NNP |
denotes |
Invitrogen |
T14024 |
63832-63833 |
-RRB- |
denotes |
) |
T14025 |
63834-63843 |
VBG |
denotes |
according |
T14026 |
63844-63846 |
IN |
denotes |
to |
T14027 |
63847-63850 |
DT |
denotes |
the |
T14028 |
63851-63863 |
NN |
denotes |
manufacturer |
T14029 |
63866-63874 |
NN |
denotes |
protocol |
T14030 |
63863-63865 |
POS |
denotes |
's |
T14031 |
63874-63875 |
. |
denotes |
. |
T14032 |
63875-63958 |
sentence |
denotes |
cDNA was generated using oligo-dT primers and the Superscript II kit (Invitrogen). |
T14033 |
63876-63880 |
NN |
denotes |
cDNA |
T14034 |
63885-63894 |
VBN |
denotes |
generated |
T14065 |
64029-64030 |
CD |
denotes |
3 |
T14066 |
64030-64031 |
SYM |
denotes |
′ |
T14067 |
64031-64032 |
: |
denotes |
; |
T14068 |
64033-64038 |
NN |
denotes |
Snail |
T14069 |
64039-64046 |
NN |
denotes |
reverse |
T14070 |
64046-64048 |
: |
denotes |
: |
T14071 |
64048-64049 |
CD |
denotes |
5 |
T14072 |
64052-64070 |
NN |
denotes |
GCGAGGGCCTCCGGAGCA |
T14073 |
64049-64050 |
SYM |
denotes |
′ |
T14074 |
64050-64051 |
HYPH |
denotes |
- |
T14075 |
64070-64071 |
HYPH |
denotes |
- |
T14076 |
64071-64072 |
CD |
denotes |
3 |
T14077 |
64072-64073 |
SYM |
denotes |
′ |
T14078 |
64073-64074 |
: |
denotes |
; |
T14079 |
64075-64080 |
NN |
denotes |
GAPDH |
T14080 |
64081-64088 |
NN |
denotes |
forward |
T14081 |
64089-64090 |
CD |
denotes |
5 |
T14082 |
64093-64117 |
NN |
denotes |
CGTAGACAAAATGGTGAAGGTCGG |
T14083 |
64090-64091 |
SYM |
denotes |
′ |
T14084 |
64091-64092 |
HYPH |
denotes |
- |
T14085 |
64117-64118 |
HYPH |
denotes |
- |
T14086 |
64118-64119 |
CD |
denotes |
3 |
T14087 |
64119-64120 |
SYM |
denotes |
′ |
T14088 |
64120-64121 |
: |
denotes |
; |
T14089 |
64122-64125 |
CC |
denotes |
and |
T14090 |
64126-64131 |
NN |
denotes |
GAPDH |
T14091 |
64132-64139 |
NN |
denotes |
reverse |
T14092 |
64139-64141 |
: |
denotes |
: |
T14093 |
64141-64142 |
CD |
denotes |
5 |
T14094 |
64145-64167 |
NN |
denotes |
AAGCAGTTGGTGGTGCAGGATG |
T14095 |
64142-64143 |
SYM |
denotes |
′ |
T14096 |
64143-64144 |
HYPH |
denotes |
- |
T14097 |
64167-64168 |
HYPH |
denotes |
- |
T14098 |
64168-64169 |
CD |
denotes |
3 |
T14099 |
64169-64170 |
SYM |
denotes |
′ |
T14100 |
64170-64171 |
. |
denotes |
. |
T147 |
12-19 |
NN |
denotes |
Pathway |
T148 |
0-77 |
sentence |
denotes |
A Signaling Pathway Involving TGF-β2 and Snail in Hair Follicle Morphogenesis |
T149 |
2-11 |
NN |
denotes |
Signaling |
T150 |
20-29 |
VBG |
denotes |
Involving |
T151 |
30-33 |
NN |
denotes |
TGF |
T152 |
34-36 |
NN |
denotes |
β2 |
T153 |
33-34 |
HYPH |
denotes |
- |
T154 |
37-40 |
CC |
denotes |
and |
T155 |
41-46 |
NN |
denotes |
Snail |
T156 |
47-49 |
IN |
denotes |
in |
T157 |
50-54 |
NN |
denotes |
Hair |
T158 |
55-63 |
NN |
denotes |
Follicle |
T159 |
64-77 |
NN |
denotes |
Morphogenesis |
T160 |
77-78 |
sentence |
denotes |
|
T161 |
129-288 |
sentence |
denotes |
In a common theme of organogenesis, certain cells within a multipotent epithelial sheet exchange signals with their neighbors and develop into a bud structure. |
T162 |
129-131 |
IN |
denotes |
In |
T163 |
217-225 |
VB |
denotes |
exchange |
T164 |
132-133 |
DT |
denotes |
a |
T165 |
141-146 |
NN |
denotes |
theme |
T166 |
134-140 |
JJ |
denotes |
common |
T167 |
147-149 |
IN |
denotes |
of |
T168 |
150-163 |
NN |
denotes |
organogenesis |
T169 |
163-165 |
, |
denotes |
, |
T170 |
165-172 |
JJ |
denotes |
certain |
T171 |
173-178 |
NNS |
denotes |
cells |
T172 |
179-185 |
IN |
denotes |
within |
T173 |
186-187 |
DT |
denotes |
a |
T174 |
211-216 |
NN |
denotes |
sheet |
T175 |
188-199 |
JJ |
denotes |
multipotent |
T176 |
200-210 |
JJ |
denotes |
epithelial |
T177 |
226-233 |
NNS |
denotes |
signals |
T178 |
234-238 |
IN |
denotes |
with |
T179 |
239-244 |
PRP$ |
denotes |
their |
T180 |
245-254 |
NNS |
denotes |
neighbors |
T181 |
255-258 |
CC |
denotes |
and |
T182 |
259-266 |
VBP |
denotes |
develop |
T183 |
267-271 |
IN |
denotes |
into |
T184 |
272-273 |
DT |
denotes |
a |
T185 |
278-287 |
NN |
denotes |
structure |
T186 |
274-277 |
NN |
denotes |
bud |
T187 |
287-288 |
. |
denotes |
. |
T188 |
288-544 |
sentence |
denotes |
Using hair bud morphogenesis as a paradigm, we employed mutant mouse models and cultured keratinocytes to dissect the contributions of multiple extracellular cues in orchestrating adhesion dynamics and proliferation to shape the cluster of cells involved. |
T189 |
289-294 |
VBG |
denotes |
Using |
T190 |
336-344 |
VBD |
denotes |
employed |
T191 |
295-299 |
NN |
denotes |
hair |
T192 |
300-303 |
NN |
denotes |
bud |
T193 |
304-317 |
NN |
denotes |
morphogenesis |
T194 |
318-320 |
IN |
denotes |
as |
T195 |
321-322 |
DT |
denotes |
a |
T196 |
323-331 |
NN |
denotes |
paradigm |
T197 |
331-333 |
, |
denotes |
, |
T198 |
333-335 |
PRP |
denotes |
we |
T199 |
345-351 |
NN |
denotes |
mutant |
T200 |
352-357 |
NN |
denotes |
mouse |
T201 |
358-364 |
NNS |
denotes |
models |
T202 |
365-368 |
CC |
denotes |
and |
T203 |
369-377 |
VBN |
denotes |
cultured |
T204 |
378-391 |
NNS |
denotes |
keratinocytes |
T205 |
392-394 |
TO |
denotes |
to |
T206 |
395-402 |
VB |
denotes |
dissect |
T207 |
403-406 |
DT |
denotes |
the |
T208 |
407-420 |
NNS |
denotes |
contributions |
T209 |
421-423 |
IN |
denotes |
of |
T210 |
424-432 |
JJ |
denotes |
multiple |
T211 |
447-451 |
NNS |
denotes |
cues |
T212 |
433-446 |
JJ |
denotes |
extracellular |
T213 |
452-454 |
IN |
denotes |
in |
T214 |
455-468 |
VBG |
denotes |
orchestrating |
T215 |
469-477 |
NN |
denotes |
adhesion |
T216 |
478-486 |
NNS |
denotes |
dynamics |
T217 |
487-490 |
CC |
denotes |
and |
T218 |
491-504 |
NN |
denotes |
proliferation |
T219 |
505-507 |
TO |
denotes |
to |
T220 |
508-513 |
VB |
denotes |
shape |
T221 |
514-517 |
DT |
denotes |
the |
T222 |
518-525 |
NN |
denotes |
cluster |
T223 |
526-528 |
IN |
denotes |
of |
T224 |
529-534 |
NNS |
denotes |
cells |
T225 |
535-543 |
VBN |
denotes |
involved |
T226 |
543-544 |
. |
denotes |
. |
T227 |
544-745 |
sentence |
denotes |
We found that transforming growth factor β2 signaling is necessary to transiently induce the transcription factor Snail and activate the Ras-mitogen-activated protein kinase (MAPK) pathway in the bud. |
T228 |
545-547 |
PRP |
denotes |
We |
T229 |
548-553 |
VBD |
denotes |
found |
T230 |
554-558 |
IN |
denotes |
that |
T231 |
599-601 |
VBZ |
denotes |
is |
T232 |
559-571 |
VBG |
denotes |
transforming |
T233 |
572-578 |
NN |
denotes |
growth |
T234 |
586-588 |
NN |
denotes |
β2 |
T235 |
579-585 |
NN |
denotes |
factor |
T236 |
589-598 |
NN |
denotes |
signaling |
T237 |
602-611 |
JJ |
denotes |
necessary |
T238 |
612-614 |
TO |
denotes |
to |
T239 |
627-633 |
VB |
denotes |
induce |
T240 |
615-626 |
RB |
denotes |
transiently |
T241 |
634-637 |
DT |
denotes |
the |
T242 |
659-664 |
NN |
denotes |
Snail |
T243 |
638-651 |
NN |
denotes |
transcription |
T244 |
652-658 |
NN |
denotes |
factor |
T245 |
665-668 |
CC |
denotes |
and |
T246 |
669-677 |
VB |
denotes |
activate |
T247 |
678-681 |
DT |
denotes |
the |
T248 |
726-733 |
NN |
denotes |
pathway |
T249 |
682-685 |
NN |
denotes |
Ras |
T250 |
712-718 |
NN |
denotes |
kinase |
T251 |
685-686 |
HYPH |
denotes |
- |
T252 |
686-693 |
NN |
denotes |
mitogen |
T253 |
694-703 |
VBN |
denotes |
activated |
T254 |
693-694 |
HYPH |
denotes |
- |
T255 |
704-711 |
NN |
denotes |
protein |
T256 |
719-720 |
-LRB- |
denotes |
( |
T257 |
720-724 |
NN |
denotes |
MAPK |
T258 |
724-725 |
-RRB- |
denotes |
) |
T259 |
734-736 |
IN |
denotes |
in |
T260 |
737-740 |
DT |
denotes |
the |
T261 |
741-744 |
NN |
denotes |
bud |
T262 |
744-745 |
. |
denotes |
. |
T263 |
745-854 |
sentence |
denotes |
In the epidermis, Snail misexpression leads to hyperproliferation and a reduction in intercellular adhesion. |
T264 |
746-748 |
IN |
denotes |
In |
T265 |
784-789 |
VBZ |
denotes |
leads |
T266 |
749-752 |
DT |
denotes |
the |
T267 |
753-762 |
NN |
denotes |
epidermis |
T268 |
762-764 |
, |
denotes |
, |
T269 |
764-769 |
NN |
denotes |
Snail |
T270 |
770-783 |
NN |
denotes |
misexpression |
T271 |
790-792 |
IN |
denotes |
to |
T272 |
793-811 |
NN |
denotes |
hyperproliferation |
T273 |
812-815 |
CC |
denotes |
and |
T274 |
816-817 |
DT |
denotes |
a |
T275 |
818-827 |
NN |
denotes |
reduction |
T276 |
828-830 |
IN |
denotes |
in |
T277 |
831-844 |
JJ |
denotes |
intercellular |
T278 |
845-853 |
NN |
denotes |
adhesion |
T279 |
853-854 |
. |
denotes |
. |
T280 |
854-1068 |
sentence |
denotes |
When E-cadherin is transcriptionally down-regulated, associated adhesion proteins with dual functions in signaling are released from cell-cell contacts, a process which we demonstrate leads to Ras-MAPK activation. |
T281 |
855-859 |
WRB |
denotes |
When |
T282 |
897-906 |
VBN |
denotes |
regulated |
T283 |
860-861 |
NN |
denotes |
E |
T284 |
862-870 |
NN |
denotes |
cadherin |
T285 |
861-862 |
HYPH |
denotes |
- |
T286 |
871-873 |
VBZ |
denotes |
is |
T287 |
874-891 |
RB |
denotes |
transcriptionally |
T288 |
892-896 |
RB |
denotes |
down |
T289 |
896-897 |
HYPH |
denotes |
- |
T290 |
974-982 |
VBN |
denotes |
released |
T291 |
906-908 |
, |
denotes |
, |
T292 |
908-918 |
VBN |
denotes |
associated |
T293 |
928-936 |
NN |
denotes |
proteins |
T294 |
919-927 |
NN |
denotes |
adhesion |
T295 |
937-941 |
IN |
denotes |
with |
T296 |
942-946 |
JJ |
denotes |
dual |
T297 |
947-956 |
NNS |
denotes |
functions |
T298 |
957-959 |
IN |
denotes |
in |
T299 |
960-969 |
NN |
denotes |
signaling |
T300 |
970-973 |
VBP |
denotes |
are |
T301 |
983-987 |
IN |
denotes |
from |
T302 |
988-992 |
NN |
denotes |
cell |
T303 |
993-997 |
NN |
denotes |
cell |
T304 |
992-993 |
HYPH |
denotes |
- |
T305 |
998-1006 |
NNS |
denotes |
contacts |
T306 |
1006-1008 |
, |
denotes |
, |
T307 |
1008-1009 |
DT |
denotes |
a |
T308 |
1010-1017 |
NN |
denotes |
process |
T309 |
1018-1023 |
WDT |
denotes |
which |
T310 |
1027-1038 |
VBP |
denotes |
demonstrate |
T311 |
1024-1026 |
PRP |
denotes |
we |
T312 |
1039-1044 |
VBZ |
denotes |
leads |
T313 |
1045-1047 |
IN |
denotes |
to |
T314 |
1048-1051 |
NN |
denotes |
Ras |
T315 |
1052-1056 |
NN |
denotes |
MAPK |
T316 |
1051-1052 |
HYPH |
denotes |
- |
T317 |
1057-1067 |
NN |
denotes |
activation |
T318 |
1067-1068 |
. |
denotes |
. |
T319 |
1068-1263 |
sentence |
denotes |
These studies provide insights into how multipotent cells within a sheet are stimulated to undergo transcriptional changes that result in proliferation, junctional remodeling, and bud formation. |
T320 |
1069-1074 |
DT |
denotes |
These |
T321 |
1075-1082 |
NNS |
denotes |
studies |
T322 |
1083-1090 |
VBP |
denotes |
provide |
T323 |
1091-1099 |
NNS |
denotes |
insights |
T324 |
1100-1104 |
IN |
denotes |
into |
T325 |
1105-1108 |
WRB |
denotes |
how |
T326 |
1146-1156 |
VBN |
denotes |
stimulated |
T327 |
1109-1120 |
JJ |
denotes |
multipotent |
T328 |
1121-1126 |
NNS |
denotes |
cells |
T329 |
1127-1133 |
IN |
denotes |
within |
T330 |
1134-1135 |
DT |
denotes |
a |
T331 |
1136-1141 |
NN |
denotes |
sheet |
T332 |
1142-1145 |
VBP |
denotes |
are |
T333 |
1157-1159 |
TO |
denotes |
to |
T334 |
1160-1167 |
VB |
denotes |
undergo |
T335 |
1168-1183 |
JJ |
denotes |
transcriptional |
T336 |
1184-1191 |
NNS |
denotes |
changes |
T337 |
1192-1196 |
WDT |
denotes |
that |
T338 |
1197-1203 |
VBP |
denotes |
result |
T339 |
1204-1206 |
IN |
denotes |
in |
T340 |
1207-1220 |
NN |
denotes |
proliferation |
T341 |
1220-1222 |
, |
denotes |
, |
T342 |
1222-1232 |
JJ |
denotes |
junctional |
T343 |
1233-1243 |
NN |
denotes |
remodeling |
T344 |
1243-1245 |
, |
denotes |
, |
T345 |
1245-1248 |
CC |
denotes |
and |
T346 |
1249-1252 |
NN |
denotes |
bud |
T347 |
1253-1262 |
NN |
denotes |
formation |
T348 |
1262-1263 |
. |
denotes |
. |
T349 |
1263-1444 |
sentence |
denotes |
This novel signaling pathway further weaves together the web of different morphogens and downstream transcriptional events that guide hair bud formation within the developing skin. |
T350 |
1264-1268 |
DT |
denotes |
This |
T351 |
1285-1292 |
NN |
denotes |
pathway |
T352 |
1269-1274 |
JJ |
denotes |
novel |
T353 |
1275-1284 |
NN |
denotes |
signaling |
T354 |
1301-1307 |
VBZ |
denotes |
weaves |
T355 |
1293-1300 |
RB |
denotes |
further |
T356 |
1308-1316 |
RP |
denotes |
together |
T357 |
1317-1320 |
DT |
denotes |
the |
T358 |
1321-1324 |
NN |
denotes |
web |
T359 |
1325-1327 |
IN |
denotes |
of |
T360 |
1328-1337 |
JJ |
denotes |
different |
T361 |
1338-1348 |
NNS |
denotes |
morphogens |
T362 |
1349-1352 |
CC |
denotes |
and |
T363 |
1353-1363 |
JJ |
denotes |
downstream |
T364 |
1380-1386 |
NNS |
denotes |
events |
T365 |
1364-1379 |
JJ |
denotes |
transcriptional |
T366 |
1387-1391 |
WDT |
denotes |
that |
T367 |
1392-1397 |
VBP |
denotes |
guide |
T368 |
1398-1402 |
NN |
denotes |
hair |
T369 |
1403-1406 |
NN |
denotes |
bud |
T370 |
1407-1416 |
NN |
denotes |
formation |
T371 |
1417-1423 |
IN |
denotes |
within |
T372 |
1424-1427 |
DT |
denotes |
the |
T373 |
1439-1443 |
NN |
denotes |
skin |
T374 |
1428-1438 |
VBG |
denotes |
developing |
T375 |
1443-1444 |
. |
denotes |
. |
T1019 |
1640-1649 |
JJ |
denotes |
Mammalian |
T1020 |
1650-1661 |
NN |
denotes |
development |
T1021 |
1662-1670 |
VBZ |
denotes |
involves |
T1022 |
1671-1674 |
DT |
denotes |
the |
T1023 |
1675-1688 |
NN |
denotes |
morphogenesis |
T1024 |
1689-1691 |
IN |
denotes |
of |
T1025 |
1692-1699 |
JJ |
denotes |
complex |
T1026 |
1718-1728 |
NNS |
denotes |
structures |
T1027 |
1700-1705 |
CD |
denotes |
three |
T1028 |
1706-1717 |
JJ |
denotes |
dimensional |
T1029 |
1705-1706 |
HYPH |
denotes |
- |
T1030 |
1729-1733 |
IN |
denotes |
from |
T1031 |
1734-1743 |
RB |
denotes |
seemingly |
T1032 |
1744-1751 |
JJ |
denotes |
uniform |
T1033 |
1752-1758 |
NNS |
denotes |
sheets |
T1034 |
1759-1761 |
CC |
denotes |
or |
T1035 |
1762-1768 |
NNS |
denotes |
masses |
T1036 |
1769-1771 |
IN |
denotes |
of |
T1037 |
1772-1777 |
NNS |
denotes |
cells |
T1038 |
1777-1778 |
. |
denotes |
. |
T1039 |
1778-1916 |
sentence |
denotes |
A simple bud-like structure initiates the formation of many organs, including lungs, spinal cord, mammary glands, and hair follicles [1]. |
T1040 |
1779-1780 |
DT |
denotes |
A |
T1041 |
1797-1806 |
NN |
denotes |
structure |
T1042 |
1781-1787 |
JJ |
denotes |
simple |
T1043 |
1788-1791 |
NN |
denotes |
bud |
T1044 |
1792-1796 |
JJ |
denotes |
like |
T1045 |
1791-1792 |
HYPH |
denotes |
- |
T1046 |
1807-1816 |
VBZ |
denotes |
initiates |
T1047 |
1817-1820 |
DT |
denotes |
the |
T1048 |
1821-1830 |
NN |
denotes |
formation |
T1049 |
1831-1833 |
IN |
denotes |
of |
T1050 |
1834-1838 |
JJ |
denotes |
many |
T1051 |
1839-1845 |
NNS |
denotes |
organs |
T1052 |
1845-1847 |
, |
denotes |
, |
T1053 |
1847-1856 |
VBG |
denotes |
including |
T1054 |
1857-1862 |
NNS |
denotes |
lungs |
T1055 |
1862-1864 |
, |
denotes |
, |
T1056 |
1864-1870 |
JJ |
denotes |
spinal |
T1057 |
1871-1875 |
NN |
denotes |
cord |
T1058 |
1875-1877 |
, |
denotes |
, |
T1059 |
1877-1884 |
JJ |
denotes |
mammary |
T1060 |
1885-1891 |
NNS |
denotes |
glands |
T1061 |
1891-1893 |
, |
denotes |
, |
T1062 |
1893-1896 |
CC |
denotes |
and |
T1063 |
1897-1901 |
NN |
denotes |
hair |
T1064 |
1902-1911 |
NNS |
denotes |
follicles |
T1065 |
1912-1913 |
-LRB- |
denotes |
[ |
T1066 |
1913-1914 |
CD |
denotes |
1 |
T1067 |
1914-1915 |
-RRB- |
denotes |
] |
T1068 |
1915-1916 |
. |
denotes |
. |
T1069 |
1916-2094 |
sentence |
denotes |
The multipotent, adhering epithelial cells are typically attached to an underlying basal lamina that polarizes the epithelial sheet and separates it from surrounding mesenchyme. |
T1070 |
1917-1920 |
DT |
denotes |
The |
T1071 |
1954-1959 |
NNS |
denotes |
cells |
T1072 |
1921-1932 |
JJ |
denotes |
multipotent |
T1073 |
1932-1934 |
, |
denotes |
, |
T1074 |
1934-1942 |
VBG |
denotes |
adhering |
T1075 |
1943-1953 |
JJ |
denotes |
epithelial |
T1076 |
1974-1982 |
VBN |
denotes |
attached |
T1077 |
1960-1963 |
VBP |
denotes |
are |
T1078 |
1964-1973 |
RB |
denotes |
typically |
T1079 |
1983-1985 |
IN |
denotes |
to |
T1080 |
1986-1988 |
DT |
denotes |
an |
T1081 |
2006-2012 |
NN |
denotes |
lamina |
T1082 |
1989-1999 |
VBG |
denotes |
underlying |
T1083 |
2000-2005 |
JJ |
denotes |
basal |
T1084 |
2013-2017 |
WDT |
denotes |
that |
T1085 |
2018-2027 |
VBZ |
denotes |
polarizes |
T1086 |
2028-2031 |
DT |
denotes |
the |
T1087 |
2043-2048 |
NN |
denotes |
sheet |
T1088 |
2032-2042 |
JJ |
denotes |
epithelial |
T1089 |
2049-2052 |
CC |
denotes |
and |
T1090 |
2053-2062 |
VBZ |
denotes |
separates |
T1091 |
2063-2065 |
PRP |
denotes |
it |
T1092 |
2066-2070 |
IN |
denotes |
from |
T1093 |
2071-2082 |
VBG |
denotes |
surrounding |
T1094 |
2083-2093 |
NN |
denotes |
mesenchyme |
T1095 |
2093-2094 |
. |
denotes |
. |
T1096 |
2094-2274 |
sentence |
denotes |
Budding morphogenesis is guided by a reciprocal exchange of signals between epithelium and mesenchyme to specify the identity of the organ that will form and to govern its growth. |
T1097 |
2095-2102 |
VBG |
denotes |
Budding |
T1098 |
2103-2116 |
NN |
denotes |
morphogenesis |
T1099 |
2120-2126 |
VBN |
denotes |
guided |
T1100 |
2117-2119 |
VBZ |
denotes |
is |
T1101 |
2127-2129 |
IN |
denotes |
by |
T1102 |
2130-2131 |
DT |
denotes |
a |
T1103 |
2143-2151 |
NN |
denotes |
exchange |
T1104 |
2132-2142 |
JJ |
denotes |
reciprocal |
T1105 |
2152-2154 |
IN |
denotes |
of |
T1106 |
2155-2162 |
NNS |
denotes |
signals |
T1107 |
2163-2170 |
IN |
denotes |
between |
T1108 |
2171-2181 |
NN |
denotes |
epithelium |
T1109 |
2182-2185 |
CC |
denotes |
and |
T1110 |
2186-2196 |
NN |
denotes |
mesenchyme |
T1111 |
2197-2199 |
TO |
denotes |
to |
T1112 |
2200-2207 |
VB |
denotes |
specify |
T1113 |
2208-2211 |
DT |
denotes |
the |
T1114 |
2212-2220 |
NN |
denotes |
identity |
T1115 |
2221-2223 |
IN |
denotes |
of |
T1116 |
2224-2227 |
DT |
denotes |
the |
T1117 |
2228-2233 |
NN |
denotes |
organ |
T1118 |
2234-2238 |
WDT |
denotes |
that |
T1119 |
2244-2248 |
VB |
denotes |
form |
T1120 |
2239-2243 |
MD |
denotes |
will |
T1121 |
2249-2252 |
CC |
denotes |
and |
T1122 |
2253-2255 |
TO |
denotes |
to |
T1123 |
2256-2262 |
VB |
denotes |
govern |
T1124 |
2263-2266 |
PRP$ |
denotes |
its |
T1125 |
2267-2273 |
NN |
denotes |
growth |
T1126 |
2273-2274 |
. |
denotes |
. |
T1127 |
2274-2450 |
sentence |
denotes |
At the helm of these molecular communication pathways are Wnts, bone morphogenic proteins (BMPs), transforming growth factor βs (TGF-βs), and fibroblast growth factors (FGFs). |
T1128 |
2275-2277 |
IN |
denotes |
At |
T1129 |
2329-2332 |
VBP |
denotes |
are |
T1130 |
2278-2281 |
DT |
denotes |
the |
T1131 |
2282-2286 |
NN |
denotes |
helm |
T1132 |
2287-2289 |
IN |
denotes |
of |
T1133 |
2290-2295 |
DT |
denotes |
these |
T1134 |
2320-2328 |
NNS |
denotes |
pathways |
T1135 |
2296-2305 |
JJ |
denotes |
molecular |
T1136 |
2306-2319 |
NN |
denotes |
communication |
T1137 |
2333-2337 |
NNS |
denotes |
Wnts |
T1138 |
2337-2339 |
, |
denotes |
, |
T1139 |
2339-2343 |
NN |
denotes |
bone |
T1140 |
2356-2364 |
NN |
denotes |
proteins |
T1141 |
2344-2355 |
JJ |
denotes |
morphogenic |
T1142 |
2365-2366 |
-LRB- |
denotes |
( |
T1143 |
2366-2370 |
NNS |
denotes |
BMPs |
T1144 |
2370-2371 |
-RRB- |
denotes |
) |
T1145 |
2371-2373 |
, |
denotes |
, |
T1146 |
2373-2385 |
VBG |
denotes |
transforming |
T1147 |
2400-2402 |
NNS |
denotes |
βs |
T1148 |
2386-2392 |
NN |
denotes |
growth |
T1149 |
2393-2399 |
NN |
denotes |
factor |
T1150 |
2403-2404 |
-LRB- |
denotes |
( |
T1151 |
2404-2407 |
NN |
denotes |
TGF |
T1152 |
2408-2410 |
NNS |
denotes |
βs |
T1153 |
2407-2408 |
HYPH |
denotes |
- |
T1154 |
2410-2411 |
-RRB- |
denotes |
) |
T1155 |
2411-2413 |
, |
denotes |
, |
T1156 |
2413-2416 |
CC |
denotes |
and |
T1157 |
2417-2427 |
NN |
denotes |
fibroblast |
T1158 |
2435-2442 |
NNS |
denotes |
factors |
T1159 |
2428-2434 |
NN |
denotes |
growth |
T1160 |
2443-2444 |
-LRB- |
denotes |
( |
T1161 |
2444-2448 |
NNS |
denotes |
FGFs |
T1162 |
2448-2449 |
-RRB- |
denotes |
) |
T1163 |
2449-2450 |
. |
denotes |
. |
T1164 |
2450-2674 |
sentence |
denotes |
Through activation of cell surface transmembrane receptors, these external signaling molecules trigger distinct cascades of intracellular events that culminate in changes in gene expression, growth, and differentiation [2]. |
T1165 |
2451-2458 |
IN |
denotes |
Through |
T1166 |
2546-2553 |
VBP |
denotes |
trigger |
T1167 |
2459-2469 |
NN |
denotes |
activation |
T1168 |
2470-2472 |
IN |
denotes |
of |
T1169 |
2473-2477 |
NN |
denotes |
cell |
T1170 |
2478-2485 |
NN |
denotes |
surface |
T1171 |
2500-2509 |
NNS |
denotes |
receptors |
T1172 |
2486-2499 |
NN |
denotes |
transmembrane |
T1173 |
2509-2511 |
, |
denotes |
, |
T1174 |
2511-2516 |
DT |
denotes |
these |
T1175 |
2536-2545 |
NNS |
denotes |
molecules |
T1176 |
2517-2525 |
JJ |
denotes |
external |
T1177 |
2526-2535 |
NN |
denotes |
signaling |
T1178 |
2554-2562 |
JJ |
denotes |
distinct |
T1179 |
2563-2571 |
NNS |
denotes |
cascades |
T1180 |
2572-2574 |
IN |
denotes |
of |
T1181 |
2575-2588 |
JJ |
denotes |
intracellular |
T1182 |
2589-2595 |
NNS |
denotes |
events |
T1183 |
2596-2600 |
WDT |
denotes |
that |
T1184 |
2601-2610 |
VBP |
denotes |
culminate |
T1185 |
2611-2613 |
IN |
denotes |
in |
T1186 |
2614-2621 |
NNS |
denotes |
changes |
T1187 |
2622-2624 |
IN |
denotes |
in |
T1188 |
2625-2629 |
NN |
denotes |
gene |
T1189 |
2630-2640 |
NN |
denotes |
expression |
T1190 |
2640-2642 |
, |
denotes |
, |
T1191 |
2642-2648 |
NN |
denotes |
growth |
T1192 |
2648-2650 |
, |
denotes |
, |
T1193 |
2650-2653 |
CC |
denotes |
and |
T1194 |
2654-2669 |
NN |
denotes |
differentiation |
T1195 |
2670-2671 |
-LRB- |
denotes |
[ |
T1196 |
2671-2672 |
CD |
denotes |
2 |
T1197 |
2672-2673 |
-RRB- |
denotes |
] |
T1198 |
2673-2674 |
. |
denotes |
. |
T1199 |
2674-2847 |
sentence |
denotes |
How this constellation of signals collaborates in tailoring each budding process so that it executes a distinct morphogenetic program has yet to be comprehensively defined. |
T1200 |
2675-2678 |
WRB |
denotes |
How |
T1201 |
2709-2721 |
VBZ |
denotes |
collaborates |
T1202 |
2679-2683 |
DT |
denotes |
this |
T1203 |
2684-2697 |
NN |
denotes |
constellation |
T1204 |
2698-2700 |
IN |
denotes |
of |
T1205 |
2701-2708 |
NNS |
denotes |
signals |
T1206 |
2809-2812 |
VBZ |
denotes |
has |
T1207 |
2722-2724 |
IN |
denotes |
in |
T1208 |
2725-2734 |
VBG |
denotes |
tailoring |
T1209 |
2735-2739 |
DT |
denotes |
each |
T1210 |
2748-2755 |
NN |
denotes |
process |
T1211 |
2740-2747 |
NN |
denotes |
budding |
T1212 |
2756-2758 |
IN |
denotes |
so |
T1213 |
2767-2775 |
VBZ |
denotes |
executes |
T1214 |
2759-2763 |
IN |
denotes |
that |
T1215 |
2764-2766 |
PRP |
denotes |
it |
T1216 |
2776-2777 |
DT |
denotes |
a |
T1217 |
2801-2808 |
NN |
denotes |
program |
T1218 |
2778-2786 |
JJ |
denotes |
distinct |
T1219 |
2787-2800 |
JJ |
denotes |
morphogenetic |
T1220 |
2813-2816 |
RB |
denotes |
yet |
T1221 |
2839-2846 |
VBN |
denotes |
defined |
T1222 |
2817-2819 |
TO |
denotes |
to |
T1223 |
2820-2822 |
VB |
denotes |
be |
T1224 |
2823-2838 |
RB |
denotes |
comprehensively |
T1225 |
2846-2847 |
. |
denotes |
. |
T1226 |
2847-3073 |
sentence |
denotes |
However, the process appears to be patterned at the initial stages of bud formation, since the relative importance of these pathways and their downstream effectors differ as buds begin to develop and cell fates are specified. |
T1227 |
2848-2855 |
RB |
denotes |
However |
T1228 |
2869-2876 |
VBZ |
denotes |
appears |
T1229 |
2855-2857 |
, |
denotes |
, |
T1230 |
2857-2860 |
DT |
denotes |
the |
T1231 |
2861-2868 |
NN |
denotes |
process |
T1232 |
2877-2879 |
TO |
denotes |
to |
T1233 |
2883-2892 |
VBN |
denotes |
patterned |
T1234 |
2880-2882 |
VB |
denotes |
be |
T1235 |
2893-2895 |
IN |
denotes |
at |
T1236 |
2896-2899 |
DT |
denotes |
the |
T1237 |
2908-2914 |
NNS |
denotes |
stages |
T1238 |
2900-2907 |
JJ |
denotes |
initial |
T1239 |
2915-2917 |
IN |
denotes |
of |
T1240 |
2918-2921 |
NN |
denotes |
bud |
T1241 |
2922-2931 |
NN |
denotes |
formation |
T1242 |
2931-2933 |
, |
denotes |
, |
T1243 |
2933-2938 |
IN |
denotes |
since |
T1244 |
3012-3018 |
VBP |
denotes |
differ |
T1245 |
2939-2942 |
DT |
denotes |
the |
T1246 |
2952-2962 |
NN |
denotes |
importance |
T1247 |
2943-2951 |
JJ |
denotes |
relative |
T1248 |
2963-2965 |
IN |
denotes |
of |
T1249 |
2966-2971 |
DT |
denotes |
these |
T1250 |
2972-2980 |
NNS |
denotes |
pathways |
T1251 |
2981-2984 |
CC |
denotes |
and |
T1252 |
2985-2990 |
PRP$ |
denotes |
their |
T1253 |
3002-3011 |
NNS |
denotes |
effectors |
T1254 |
2991-3001 |
JJ |
denotes |
downstream |
T1255 |
3019-3021 |
IN |
denotes |
as |
T1256 |
3027-3032 |
VBP |
denotes |
begin |
T1257 |
3022-3026 |
NNS |
denotes |
buds |
T1258 |
3033-3035 |
TO |
denotes |
to |
T1259 |
3036-3043 |
VB |
denotes |
develop |
T1260 |
3044-3047 |
CC |
denotes |
and |
T1261 |
3048-3052 |
NN |
denotes |
cell |
T1262 |
3053-3058 |
NNS |
denotes |
fates |
T1263 |
3063-3072 |
VBN |
denotes |
specified |
T1264 |
3059-3062 |
VBP |
denotes |
are |
T1265 |
3072-3073 |
. |
denotes |
. |
T1266 |
3073-3205 |
sentence |
denotes |
The development of a bud requires a number of coordinated changes in the behavior of the targeted cells within an epithelial sheet. |
T1267 |
3074-3077 |
DT |
denotes |
The |
T1268 |
3078-3089 |
NN |
denotes |
development |
T1269 |
3099-3107 |
VBZ |
denotes |
requires |
T1270 |
3090-3092 |
IN |
denotes |
of |
T1271 |
3093-3094 |
DT |
denotes |
a |
T1272 |
3095-3098 |
NN |
denotes |
bud |
T1273 |
3108-3109 |
DT |
denotes |
a |
T1274 |
3110-3116 |
NN |
denotes |
number |
T1275 |
3117-3119 |
IN |
denotes |
of |
T1276 |
3120-3131 |
VBN |
denotes |
coordinated |
T1277 |
3132-3139 |
NNS |
denotes |
changes |
T1278 |
3140-3142 |
IN |
denotes |
in |
T1279 |
3143-3146 |
DT |
denotes |
the |
T1280 |
3147-3155 |
NN |
denotes |
behavior |
T1281 |
3156-3158 |
IN |
denotes |
of |
T1282 |
3159-3162 |
DT |
denotes |
the |
T1283 |
3172-3177 |
NNS |
denotes |
cells |
T1284 |
3163-3171 |
VBN |
denotes |
targeted |
T1285 |
3178-3184 |
IN |
denotes |
within |
T1286 |
3185-3187 |
DT |
denotes |
an |
T1287 |
3199-3204 |
NN |
denotes |
sheet |
T1288 |
3188-3198 |
JJ |
denotes |
epithelial |
T1289 |
3204-3205 |
. |
denotes |
. |
T1290 |
3205-3389 |
sentence |
denotes |
The process must be accompanied by alterations in the proliferation, polarity, shape, and adhesiveness of selected cells, as well as by modifications in their underlying basal lamina. |
T1291 |
3206-3209 |
DT |
denotes |
The |
T1292 |
3210-3217 |
NN |
denotes |
process |
T1293 |
3226-3237 |
VBN |
denotes |
accompanied |
T1294 |
3218-3222 |
MD |
denotes |
must |
T1295 |
3223-3225 |
VB |
denotes |
be |
T1296 |
3238-3240 |
IN |
denotes |
by |
T1297 |
3241-3252 |
NNS |
denotes |
alterations |
T1298 |
3253-3255 |
IN |
denotes |
in |
T1299 |
3256-3259 |
DT |
denotes |
the |
T1300 |
3260-3273 |
NN |
denotes |
proliferation |
T1301 |
3273-3275 |
, |
denotes |
, |
T1302 |
3275-3283 |
NN |
denotes |
polarity |
T1303 |
3283-3285 |
, |
denotes |
, |
T1304 |
3285-3290 |
NN |
denotes |
shape |
T1305 |
3290-3292 |
, |
denotes |
, |
T1306 |
3292-3295 |
CC |
denotes |
and |
T1307 |
3296-3308 |
NN |
denotes |
adhesiveness |
T1308 |
3309-3311 |
IN |
denotes |
of |
T1309 |
3312-3320 |
VBN |
denotes |
selected |
T1310 |
3321-3326 |
NNS |
denotes |
cells |
T1311 |
3326-3328 |
, |
denotes |
, |
T1312 |
3328-3330 |
RB |
denotes |
as |
T1313 |
3336-3338 |
IN |
denotes |
as |
T1314 |
3331-3335 |
RB |
denotes |
well |
T1315 |
3339-3341 |
IN |
denotes |
by |
T1316 |
3342-3355 |
NNS |
denotes |
modifications |
T1317 |
3356-3358 |
IN |
denotes |
in |
T1318 |
3359-3364 |
PRP$ |
denotes |
their |
T1319 |
3382-3388 |
NN |
denotes |
lamina |
T1320 |
3365-3375 |
VBG |
denotes |
underlying |
T1321 |
3376-3381 |
JJ |
denotes |
basal |
T1322 |
3388-3389 |
. |
denotes |
. |
T1323 |
3389-3617 |
sentence |
denotes |
Thus, extracellular epithelial-mesenchymal crosstalk must be intricately orchestrated to couple the determination of distinct cell fates with the contemporaneous remodeling of the physical and structural properties of the cell. |
T1324 |
3390-3394 |
RB |
denotes |
Thus |
T1325 |
3463-3475 |
VBN |
denotes |
orchestrated |
T1326 |
3394-3396 |
, |
denotes |
, |
T1327 |
3396-3409 |
JJ |
denotes |
extracellular |
T1328 |
3433-3442 |
NN |
denotes |
crosstalk |
T1329 |
3410-3420 |
JJ |
denotes |
epithelial |
T1330 |
3421-3432 |
JJ |
denotes |
mesenchymal |
T1331 |
3420-3421 |
HYPH |
denotes |
- |
T1332 |
3443-3447 |
MD |
denotes |
must |
T1333 |
3448-3450 |
VB |
denotes |
be |
T1334 |
3451-3462 |
RB |
denotes |
intricately |
T1335 |
3476-3478 |
TO |
denotes |
to |
T1336 |
3479-3485 |
VB |
denotes |
couple |
T1337 |
3486-3489 |
DT |
denotes |
the |
T1338 |
3490-3503 |
NN |
denotes |
determination |
T1339 |
3504-3506 |
IN |
denotes |
of |
T1340 |
3507-3515 |
JJ |
denotes |
distinct |
T1341 |
3521-3526 |
NNS |
denotes |
fates |
T1342 |
3516-3520 |
NN |
denotes |
cell |
T1343 |
3527-3531 |
IN |
denotes |
with |
T1344 |
3532-3535 |
DT |
denotes |
the |
T1345 |
3552-3562 |
NN |
denotes |
remodeling |
T1346 |
3536-3551 |
JJ |
denotes |
contemporaneous |
T1347 |
3563-3565 |
IN |
denotes |
of |
T1348 |
3566-3569 |
DT |
denotes |
the |
T1349 |
3594-3604 |
NNS |
denotes |
properties |
T1350 |
3570-3578 |
JJ |
denotes |
physical |
T1351 |
3579-3582 |
CC |
denotes |
and |
T1352 |
3583-3593 |
JJ |
denotes |
structural |
T1353 |
3605-3607 |
IN |
denotes |
of |
T1354 |
3608-3611 |
DT |
denotes |
the |
T1355 |
3612-3616 |
NN |
denotes |
cell |
T1356 |
3616-3617 |
. |
denotes |
. |
T1357 |
3617-3733 |
sentence |
denotes |
Among the few dispensable organs, hair follicles offer an excellent model system to study epithelial bud formation. |
T1358 |
3618-3623 |
IN |
denotes |
Among |
T1359 |
3667-3672 |
VBP |
denotes |
offer |
T1360 |
3624-3627 |
DT |
denotes |
the |
T1361 |
3644-3650 |
NNS |
denotes |
organs |
T1362 |
3628-3631 |
JJ |
denotes |
few |
T1363 |
3632-3643 |
JJ |
denotes |
dispensable |
T1364 |
3650-3652 |
, |
denotes |
, |
T1365 |
3652-3656 |
NN |
denotes |
hair |
T1366 |
3657-3666 |
NNS |
denotes |
follicles |
T1367 |
3673-3675 |
DT |
denotes |
an |
T1368 |
3692-3698 |
NN |
denotes |
system |
T1369 |
3676-3685 |
JJ |
denotes |
excellent |
T1370 |
3686-3691 |
NN |
denotes |
model |
T1371 |
3699-3701 |
TO |
denotes |
to |
T1372 |
3702-3707 |
VB |
denotes |
study |
T1373 |
3708-3718 |
JJ |
denotes |
epithelial |
T1374 |
3719-3722 |
NN |
denotes |
bud |
T1375 |
3723-3732 |
NN |
denotes |
formation |
T1376 |
3732-3733 |
. |
denotes |
. |
T1377 |
3733-3817 |
sentence |
denotes |
Mammalian skin epithelium begins as a single sheet of multipotent ectodermal cells. |
T1378 |
3734-3743 |
JJ |
denotes |
Mammalian |
T1379 |
3749-3759 |
NN |
denotes |
epithelium |
T1380 |
3744-3748 |
NN |
denotes |
skin |
T1381 |
3760-3766 |
VBZ |
denotes |
begins |
T1382 |
3767-3769 |
IN |
denotes |
as |
T1383 |
3770-3771 |
DT |
denotes |
a |
T1384 |
3779-3784 |
NN |
denotes |
sheet |
T1385 |
3772-3778 |
JJ |
denotes |
single |
T1386 |
3785-3787 |
IN |
denotes |
of |
T1387 |
3788-3799 |
JJ |
denotes |
multipotent |
T1388 |
3811-3816 |
NNS |
denotes |
cells |
T1389 |
3800-3810 |
JJ |
denotes |
ectodermal |
T1390 |
3816-3817 |
. |
denotes |
. |
T1391 |
3817-4004 |
sentence |
denotes |
During development, specialized mesenchymal cells populate the skin in a spatially defined pattern to initiate the complex epithelial-mesenchymal crosstalk that will specify the bud [3]. |
T1392 |
3818-3824 |
IN |
denotes |
During |
T1393 |
3868-3876 |
VBP |
denotes |
populate |
T1394 |
3825-3836 |
NN |
denotes |
development |
T1395 |
3836-3838 |
, |
denotes |
, |
T1396 |
3838-3849 |
JJ |
denotes |
specialized |
T1397 |
3862-3867 |
NNS |
denotes |
cells |
T1398 |
3850-3861 |
JJ |
denotes |
mesenchymal |
T1399 |
3877-3880 |
DT |
denotes |
the |
T1400 |
3881-3885 |
NN |
denotes |
skin |
T1401 |
3886-3888 |
IN |
denotes |
in |
T1402 |
3889-3890 |
DT |
denotes |
a |
T1403 |
3909-3916 |
NN |
denotes |
pattern |
T1404 |
3891-3900 |
RB |
denotes |
spatially |
T1405 |
3901-3908 |
VBN |
denotes |
defined |
T1406 |
3917-3919 |
TO |
denotes |
to |
T1407 |
3920-3928 |
VB |
denotes |
initiate |
T1408 |
3929-3932 |
DT |
denotes |
the |
T1409 |
3964-3973 |
NN |
denotes |
crosstalk |
T1410 |
3933-3940 |
JJ |
denotes |
complex |
T1411 |
3941-3951 |
JJ |
denotes |
epithelial |
T1412 |
3952-3963 |
JJ |
denotes |
mesenchymal |
T1413 |
3951-3952 |
HYPH |
denotes |
- |
T1414 |
3974-3978 |
WDT |
denotes |
that |
T1415 |
3984-3991 |
VB |
denotes |
specify |
T1416 |
3979-3983 |
MD |
denotes |
will |
T1417 |
3992-3995 |
DT |
denotes |
the |
T1418 |
3996-3999 |
NN |
denotes |
bud |
T1419 |
4000-4001 |
-LRB- |
denotes |
[ |
T1420 |
4001-4002 |
CD |
denotes |
3 |
T1421 |
4002-4003 |
-RRB- |
denotes |
] |
T1422 |
4003-4004 |
. |
denotes |
. |
T1423 |
4004-4225 |
sentence |
denotes |
Once committed, a small cluster of epithelial cells, the placode, instructs a group of underlying mesenchymal cells to condense and form the nascent dermal papilla, which will be a permanent fixture of the hair follicle. |
T1424 |
4005-4009 |
IN |
denotes |
Once |
T1425 |
4010-4019 |
VBN |
denotes |
committed |
T1426 |
4071-4080 |
VBZ |
denotes |
instructs |
T1427 |
4019-4021 |
, |
denotes |
, |
T1428 |
4021-4022 |
DT |
denotes |
a |
T1429 |
4029-4036 |
NN |
denotes |
cluster |
T1430 |
4023-4028 |
JJ |
denotes |
small |
T1431 |
4037-4039 |
IN |
denotes |
of |
T1432 |
4040-4050 |
JJ |
denotes |
epithelial |
T1433 |
4051-4056 |
NNS |
denotes |
cells |
T1434 |
4056-4058 |
, |
denotes |
, |
T1435 |
4058-4061 |
DT |
denotes |
the |
T1436 |
4062-4069 |
NN |
denotes |
placode |
T1437 |
4069-4071 |
, |
denotes |
, |
T1438 |
4081-4082 |
DT |
denotes |
a |
T1439 |
4083-4088 |
NN |
denotes |
group |
T1440 |
4124-4132 |
VB |
denotes |
condense |
T1441 |
4089-4091 |
IN |
denotes |
of |
T1442 |
4092-4102 |
VBG |
denotes |
underlying |
T1443 |
4115-4120 |
NNS |
denotes |
cells |
T1444 |
4103-4114 |
JJ |
denotes |
mesenchymal |
T1445 |
4121-4123 |
TO |
denotes |
to |
T1446 |
4133-4136 |
CC |
denotes |
and |
T1447 |
4137-4141 |
VB |
denotes |
form |
T1448 |
4142-4145 |
DT |
denotes |
the |
T1449 |
4161-4168 |
NN |
denotes |
papilla |
T1450 |
4146-4153 |
JJ |
denotes |
nascent |
T1451 |
4154-4160 |
JJ |
denotes |
dermal |
T1452 |
4168-4170 |
, |
denotes |
, |
T1453 |
4170-4175 |
WDT |
denotes |
which |
T1454 |
4181-4183 |
VB |
denotes |
be |
T1455 |
4176-4180 |
MD |
denotes |
will |
T1456 |
4184-4185 |
DT |
denotes |
a |
T1457 |
4196-4203 |
NN |
denotes |
fixture |
T1458 |
4186-4195 |
JJ |
denotes |
permanent |
T1459 |
4204-4206 |
IN |
denotes |
of |
T1460 |
4207-4210 |
DT |
denotes |
the |
T1461 |
4216-4224 |
NN |
denotes |
follicle |
T1462 |
4211-4215 |
NN |
denotes |
hair |
T1463 |
4224-4225 |
. |
denotes |
. |
T1464 |
4225-4462 |
sentence |
denotes |
Subsequent exchanges between the placode and nascent dermal papilla result in further growth of the follicle into the underlying dermis, or down-growth, and eventual differentiation into the six concentric layers of the mature follicle. |
T1465 |
4226-4236 |
JJ |
denotes |
Subsequent |
T1466 |
4237-4246 |
NNS |
denotes |
exchanges |
T1467 |
4294-4300 |
VBP |
denotes |
result |
T1468 |
4247-4254 |
IN |
denotes |
between |
T1469 |
4255-4258 |
DT |
denotes |
the |
T1470 |
4259-4266 |
NN |
denotes |
placode |
T1471 |
4267-4270 |
CC |
denotes |
and |
T1472 |
4271-4278 |
JJ |
denotes |
nascent |
T1473 |
4286-4293 |
NN |
denotes |
papilla |
T1474 |
4279-4285 |
JJ |
denotes |
dermal |
T1475 |
4301-4303 |
IN |
denotes |
in |
T1476 |
4304-4311 |
JJ |
denotes |
further |
T1477 |
4312-4318 |
NN |
denotes |
growth |
T1478 |
4319-4321 |
IN |
denotes |
of |
T1479 |
4322-4325 |
DT |
denotes |
the |
T1480 |
4326-4334 |
NN |
denotes |
follicle |
T1481 |
4335-4339 |
IN |
denotes |
into |
T1482 |
4340-4343 |
DT |
denotes |
the |
T1483 |
4355-4361 |
NN |
denotes |
dermis |
T1484 |
4344-4354 |
JJ |
denotes |
underlying |
T1485 |
4361-4363 |
, |
denotes |
, |
T1486 |
4363-4365 |
CC |
denotes |
or |
T1487 |
4366-4370 |
JJ |
denotes |
down |
T1488 |
4371-4377 |
NN |
denotes |
growth |
T1489 |
4370-4371 |
HYPH |
denotes |
- |
T1490 |
4377-4379 |
, |
denotes |
, |
T1491 |
4379-4382 |
CC |
denotes |
and |
T1492 |
4383-4391 |
JJ |
denotes |
eventual |
T1493 |
4392-4407 |
NN |
denotes |
differentiation |
T1494 |
4408-4412 |
IN |
denotes |
into |
T1495 |
4413-4416 |
DT |
denotes |
the |
T1496 |
4432-4438 |
NNS |
denotes |
layers |
T1497 |
4417-4420 |
CD |
denotes |
six |
T1498 |
4421-4431 |
JJ |
denotes |
concentric |
T1499 |
4439-4441 |
IN |
denotes |
of |
T1500 |
4442-4445 |
DT |
denotes |
the |
T1501 |
4453-4461 |
NN |
denotes |
follicle |
T1502 |
4446-4452 |
JJ |
denotes |
mature |
T1503 |
4461-4462 |
. |
denotes |
. |
T1504 |
4462-4732 |
sentence |
denotes |
Previously, we delineated how two respective epithelial and mesenchymal signals, Wnts and the BMP-inhibitory factor noggin, function in concert to induce lymphoid enhancer factor-1/β-catenin (LEF-1/β-catenin)-mediated gene transcription within the follicle placode [4]. |
T1505 |
4463-4473 |
RB |
denotes |
Previously |
T1506 |
4478-4488 |
VBD |
denotes |
delineated |
T1507 |
4473-4475 |
, |
denotes |
, |
T1508 |
4475-4477 |
PRP |
denotes |
we |
T1509 |
4489-4492 |
WRB |
denotes |
how |
T1510 |
4587-4595 |
VBP |
denotes |
function |
T1511 |
4493-4496 |
CD |
denotes |
two |
T1512 |
4535-4542 |
NNS |
denotes |
signals |
T1513 |
4497-4507 |
JJ |
denotes |
respective |
T1514 |
4508-4518 |
JJ |
denotes |
epithelial |
T1515 |
4519-4522 |
CC |
denotes |
and |
T1516 |
4523-4534 |
JJ |
denotes |
mesenchymal |
T1517 |
4542-4544 |
, |
denotes |
, |
T1518 |
4544-4548 |
NNS |
denotes |
Wnts |
T1519 |
4549-4552 |
CC |
denotes |
and |
T1520 |
4553-4556 |
DT |
denotes |
the |
T1521 |
4572-4578 |
NN |
denotes |
factor |
T1522 |
4557-4560 |
NN |
denotes |
BMP |
T1523 |
4561-4571 |
JJ |
denotes |
inhibitory |
T1524 |
4560-4561 |
HYPH |
denotes |
- |
T1525 |
4579-4585 |
NN |
denotes |
noggin |
T1526 |
4585-4587 |
, |
denotes |
, |
T1527 |
4596-4598 |
IN |
denotes |
in |
T1528 |
4599-4606 |
NN |
denotes |
concert |
T1529 |
4607-4609 |
TO |
denotes |
to |
T1530 |
4610-4616 |
VB |
denotes |
induce |
T1531 |
4617-4625 |
JJ |
denotes |
lymphoid |
T1532 |
4635-4641 |
NN |
denotes |
factor |
T1533 |
4626-4634 |
NN |
denotes |
enhancer |
T1534 |
4672-4680 |
VBN |
denotes |
mediated |
T1535 |
4641-4642 |
HYPH |
denotes |
- |
T1536 |
4642-4643 |
CD |
denotes |
1 |
T1537 |
4643-4644 |
HYPH |
denotes |
/ |
T1538 |
4644-4645 |
NN |
denotes |
β |
T1539 |
4646-4653 |
NN |
denotes |
catenin |
T1540 |
4645-4646 |
HYPH |
denotes |
- |
T1541 |
4654-4655 |
-LRB- |
denotes |
( |
T1542 |
4655-4658 |
NN |
denotes |
LEF |
T1543 |
4658-4659 |
HYPH |
denotes |
- |
T1544 |
4659-4660 |
CD |
denotes |
1 |
T1545 |
4660-4661 |
HYPH |
denotes |
/ |
T1546 |
4661-4662 |
NN |
denotes |
β |
T1547 |
4663-4670 |
NN |
denotes |
catenin |
T1548 |
4662-4663 |
HYPH |
denotes |
- |
T1549 |
4670-4671 |
-RRB- |
denotes |
) |
T1550 |
4671-4672 |
HYPH |
denotes |
- |
T1551 |
4686-4699 |
NN |
denotes |
transcription |
T1552 |
4681-4685 |
NN |
denotes |
gene |
T1553 |
4700-4706 |
IN |
denotes |
within |
T1554 |
4707-4710 |
DT |
denotes |
the |
T1555 |
4720-4727 |
NN |
denotes |
placode |
T1556 |
4711-4719 |
NN |
denotes |
follicle |
T1557 |
4728-4729 |
-LRB- |
denotes |
[ |
T1558 |
4729-4730 |
CD |
denotes |
4 |
T1559 |
4730-4731 |
-RRB- |
denotes |
] |
T1560 |
4731-4732 |
. |
denotes |
. |
T1561 |
4732-4997 |
sentence |
denotes |
The downstream changes elicited through convergence of these two early signaling pathways include down-regulation of the gene encoding E-cadherin, the prototypical epithelial cadherin that forms the transmembrane core of intercellular adherens junctions (AJs) [5]. |
T1562 |
4733-4736 |
DT |
denotes |
The |
T1563 |
4748-4755 |
NNS |
denotes |
changes |
T1564 |
4737-4747 |
JJ |
denotes |
downstream |
T1565 |
4823-4830 |
VBP |
denotes |
include |
T1566 |
4756-4764 |
VBN |
denotes |
elicited |
T1567 |
4765-4772 |
IN |
denotes |
through |
T1568 |
4773-4784 |
NN |
denotes |
convergence |
T1569 |
4785-4787 |
IN |
denotes |
of |
T1570 |
4788-4793 |
DT |
denotes |
these |
T1571 |
4814-4822 |
NNS |
denotes |
pathways |
T1572 |
4794-4797 |
CD |
denotes |
two |
T1573 |
4798-4803 |
JJ |
denotes |
early |
T1574 |
4804-4813 |
NN |
denotes |
signaling |
T1575 |
4831-4835 |
JJ |
denotes |
down |
T1576 |
4836-4846 |
NN |
denotes |
regulation |
T1577 |
4835-4836 |
HYPH |
denotes |
- |
T1578 |
4847-4849 |
IN |
denotes |
of |
T1579 |
4850-4853 |
DT |
denotes |
the |
T1580 |
4854-4858 |
NN |
denotes |
gene |
T1581 |
4859-4867 |
VBG |
denotes |
encoding |
T1582 |
4868-4869 |
NN |
denotes |
E |
T1583 |
4870-4878 |
NN |
denotes |
cadherin |
T1584 |
4869-4870 |
HYPH |
denotes |
- |
T1585 |
4878-4880 |
, |
denotes |
, |
T1586 |
4880-4883 |
DT |
denotes |
the |
T1587 |
4908-4916 |
NN |
denotes |
cadherin |
T1588 |
4884-4896 |
JJ |
denotes |
prototypical |
T1589 |
4897-4907 |
JJ |
denotes |
epithelial |
T1590 |
4917-4921 |
WDT |
denotes |
that |
T1591 |
4922-4927 |
VBZ |
denotes |
forms |
T1592 |
4928-4931 |
DT |
denotes |
the |
T1593 |
4946-4950 |
NN |
denotes |
core |
T1594 |
4932-4945 |
JJ |
denotes |
transmembrane |
T1595 |
4951-4953 |
IN |
denotes |
of |
T1596 |
4954-4967 |
JJ |
denotes |
intercellular |
T1597 |
4977-4986 |
NNS |
denotes |
junctions |
T1598 |
4968-4976 |
NN |
denotes |
adherens |
T1599 |
4987-4988 |
-LRB- |
denotes |
( |
T1600 |
4988-4991 |
NNS |
denotes |
AJs |
T1601 |
4991-4992 |
-RRB- |
denotes |
) |
T1602 |
4993-4994 |
-LRB- |
denotes |
[ |
T1603 |
4994-4995 |
CD |
denotes |
5 |
T1604 |
4995-4996 |
-RRB- |
denotes |
] |
T1605 |
4996-4997 |
. |
denotes |
. |
T1606 |
4997-5262 |
sentence |
denotes |
We subsequently showed that when E-cadherin is transgenically elevated in mouse skin, hair follicle morphogenesis is blocked, suggesting that E-cadherin down-regulation is a critical event in governing the adhesion dynamics necessary for budding morphogenesis [4]. |
T1607 |
4998-5000 |
PRP |
denotes |
We |
T1608 |
5014-5020 |
VBD |
denotes |
showed |
T1609 |
5001-5013 |
RB |
denotes |
subsequently |
T1610 |
5021-5025 |
IN |
denotes |
that |
T1611 |
5115-5122 |
VBN |
denotes |
blocked |
T1612 |
5026-5030 |
WRB |
denotes |
when |
T1613 |
5060-5068 |
VBN |
denotes |
elevated |
T1614 |
5031-5032 |
NN |
denotes |
E |
T1615 |
5033-5041 |
NN |
denotes |
cadherin |
T1616 |
5032-5033 |
HYPH |
denotes |
- |
T1617 |
5042-5044 |
VBZ |
denotes |
is |
T1618 |
5045-5059 |
RB |
denotes |
transgenically |
T1619 |
5069-5071 |
IN |
denotes |
in |
T1620 |
5072-5077 |
NN |
denotes |
mouse |
T1621 |
5078-5082 |
NN |
denotes |
skin |
T1622 |
5082-5084 |
, |
denotes |
, |
T1623 |
5084-5088 |
NN |
denotes |
hair |
T1624 |
5089-5097 |
NN |
denotes |
follicle |
T1625 |
5098-5111 |
NN |
denotes |
morphogenesis |
T1626 |
5112-5114 |
VBZ |
denotes |
is |
T1627 |
5122-5124 |
, |
denotes |
, |
T1628 |
5124-5134 |
VBG |
denotes |
suggesting |
T1629 |
5135-5139 |
IN |
denotes |
that |
T1630 |
5167-5169 |
VBZ |
denotes |
is |
T1631 |
5140-5141 |
NN |
denotes |
E |
T1632 |
5142-5150 |
NN |
denotes |
cadherin |
T1633 |
5141-5142 |
HYPH |
denotes |
- |
T1634 |
5156-5166 |
NN |
denotes |
regulation |
T1635 |
5151-5155 |
JJ |
denotes |
down |
T1636 |
5155-5156 |
HYPH |
denotes |
- |
T1637 |
5170-5171 |
DT |
denotes |
a |
T1638 |
5181-5186 |
NN |
denotes |
event |
T1639 |
5172-5180 |
JJ |
denotes |
critical |
T1640 |
5187-5189 |
IN |
denotes |
in |
T1641 |
5190-5199 |
VBG |
denotes |
governing |
T1642 |
5200-5203 |
DT |
denotes |
the |
T1643 |
5213-5221 |
NNS |
denotes |
dynamics |
T1644 |
5204-5212 |
NN |
denotes |
adhesion |
T1645 |
5222-5231 |
JJ |
denotes |
necessary |
T1646 |
5232-5235 |
IN |
denotes |
for |
T1647 |
5236-5243 |
NN |
denotes |
budding |
T1648 |
5244-5257 |
NN |
denotes |
morphogenesis |
T1649 |
5258-5259 |
-LRB- |
denotes |
[ |
T1650 |
5259-5260 |
CD |
denotes |
4 |
T1651 |
5260-5261 |
-RRB- |
denotes |
] |
T1652 |
5261-5262 |
. |
denotes |
. |
T1653 |
5262-5310 |
sentence |
denotes |
Like LEF-1, E-cadherin also binds to β-catenin. |
T1654 |
5263-5267 |
IN |
denotes |
Like |
T1655 |
5291-5296 |
VBZ |
denotes |
binds |
T1656 |
5268-5271 |
NN |
denotes |
LEF |
T1657 |
5271-5272 |
HYPH |
denotes |
- |
T1658 |
5272-5273 |
CD |
denotes |
1 |
T1659 |
5273-5275 |
, |
denotes |
, |
T1660 |
5275-5276 |
NN |
denotes |
E |
T1661 |
5277-5285 |
NN |
denotes |
cadherin |
T1662 |
5276-5277 |
HYPH |
denotes |
- |
T1663 |
5286-5290 |
RB |
denotes |
also |
T1664 |
5297-5299 |
IN |
denotes |
to |
T1665 |
5300-5301 |
NN |
denotes |
β |
T1666 |
5302-5309 |
NN |
denotes |
catenin |
T1667 |
5301-5302 |
HYPH |
denotes |
- |
T1668 |
5309-5310 |
. |
denotes |
. |
T1669 |
5310-5573 |
sentence |
denotes |
At sites of cell-cell contact, however, E-cadherin-β-catenin complexes recruit α-catenin, which in turn coordinates the associated actin polymerization dynamics necessary to stabilize nascent AJs and integrate the cytoskeleton across an epithelial sheet [6,7,8]. |
T1670 |
5311-5313 |
IN |
denotes |
At |
T1671 |
5382-5389 |
VBP |
denotes |
recruit |
T1672 |
5314-5319 |
NNS |
denotes |
sites |
T1673 |
5320-5322 |
IN |
denotes |
of |
T1674 |
5323-5327 |
NN |
denotes |
cell |
T1675 |
5328-5332 |
NN |
denotes |
cell |
T1676 |
5327-5328 |
HYPH |
denotes |
- |
T1677 |
5333-5340 |
NN |
denotes |
contact |
T1678 |
5340-5342 |
, |
denotes |
, |
T1679 |
5342-5349 |
RB |
denotes |
however |
T1680 |
5349-5351 |
, |
denotes |
, |
T1681 |
5351-5352 |
NN |
denotes |
E |
T1682 |
5353-5361 |
NN |
denotes |
cadherin |
T1683 |
5352-5353 |
HYPH |
denotes |
- |
T1684 |
5372-5381 |
NNS |
denotes |
complexes |
T1685 |
5361-5362 |
HYPH |
denotes |
- |
T1686 |
5362-5363 |
NN |
denotes |
β |
T1687 |
5364-5371 |
NN |
denotes |
catenin |
T1688 |
5363-5364 |
HYPH |
denotes |
- |
T1689 |
5390-5391 |
NN |
denotes |
α |
T1690 |
5392-5399 |
NN |
denotes |
catenin |
T1691 |
5391-5392 |
HYPH |
denotes |
- |
T1692 |
5399-5401 |
, |
denotes |
, |
T1693 |
5401-5406 |
WDT |
denotes |
which |
T1694 |
5415-5426 |
VBZ |
denotes |
coordinates |
T1695 |
5407-5409 |
IN |
denotes |
in |
T1696 |
5410-5414 |
NN |
denotes |
turn |
T1697 |
5427-5430 |
DT |
denotes |
the |
T1698 |
5463-5471 |
NNS |
denotes |
dynamics |
T1699 |
5431-5441 |
VBN |
denotes |
associated |
T1700 |
5442-5447 |
NN |
denotes |
actin |
T1701 |
5448-5462 |
NN |
denotes |
polymerization |
T1702 |
5472-5481 |
JJ |
denotes |
necessary |
T1703 |
5482-5484 |
TO |
denotes |
to |
T1704 |
5485-5494 |
VB |
denotes |
stabilize |
T1705 |
5495-5502 |
JJ |
denotes |
nascent |
T1706 |
5503-5506 |
NNS |
denotes |
AJs |
T1707 |
5507-5510 |
CC |
denotes |
and |
T1708 |
5511-5520 |
VB |
denotes |
integrate |
T1709 |
5521-5524 |
DT |
denotes |
the |
T1710 |
5525-5537 |
NN |
denotes |
cytoskeleton |
T1711 |
5538-5544 |
IN |
denotes |
across |
T1712 |
5545-5547 |
DT |
denotes |
an |
T1713 |
5559-5564 |
NN |
denotes |
sheet |
T1714 |
5548-5558 |
JJ |
denotes |
epithelial |
T1715 |
5565-5566 |
-LRB- |
denotes |
[ |
T1716 |
5570-5571 |
CD |
denotes |
8 |
T1717 |
5566-5567 |
CD |
denotes |
6 |
T1718 |
5567-5568 |
, |
denotes |
, |
T1719 |
5568-5569 |
CD |
denotes |
7 |
T1720 |
5569-5570 |
, |
denotes |
, |
T1721 |
5571-5572 |
-RRB- |
denotes |
] |
T1722 |
5572-5573 |
. |
denotes |
. |
T1723 |
5573-5830 |
sentence |
denotes |
α-Catenin also binds to the class III Lin-1, Isl-1, Mec-3 (LIM) protein Ajuba (a member of the zyxin family of proteins), which appears to function dually in both adhesion and in activation of the Ras-mitogen-activated protein kinase (MAPK) pathway [9,10]. |
T1724 |
5574-5575 |
NN |
denotes |
α |
T1725 |
5576-5583 |
NN |
denotes |
Catenin |
T1726 |
5575-5576 |
HYPH |
denotes |
- |
T1727 |
5589-5594 |
VBZ |
denotes |
binds |
T1728 |
5584-5588 |
RB |
denotes |
also |
T1729 |
5595-5597 |
IN |
denotes |
to |
T1730 |
5598-5601 |
DT |
denotes |
the |
T1731 |
5638-5645 |
NN |
denotes |
protein |
T1732 |
5602-5607 |
NN |
denotes |
class |
T1733 |
5608-5611 |
CD |
denotes |
III |
T1734 |
5612-5615 |
NN |
denotes |
Lin |
T1735 |
5615-5616 |
HYPH |
denotes |
- |
T1736 |
5616-5617 |
CD |
denotes |
1 |
T1737 |
5617-5619 |
, |
denotes |
, |
T1738 |
5619-5622 |
NN |
denotes |
Isl |
T1739 |
5622-5623 |
HYPH |
denotes |
- |
T1740 |
5623-5624 |
CD |
denotes |
1 |
T1741 |
5624-5626 |
, |
denotes |
, |
T1742 |
5626-5629 |
NN |
denotes |
Mec |
T1743 |
5629-5630 |
HYPH |
denotes |
- |
T1744 |
5630-5631 |
CD |
denotes |
3 |
T1745 |
5632-5633 |
-LRB- |
denotes |
( |
T1746 |
5633-5636 |
NN |
denotes |
LIM |
T1747 |
5636-5637 |
-RRB- |
denotes |
) |
T1748 |
5646-5651 |
NN |
denotes |
Ajuba |
T1749 |
5652-5653 |
-LRB- |
denotes |
( |
T1750 |
5653-5654 |
DT |
denotes |
a |
T1751 |
5655-5661 |
NN |
denotes |
member |
T1752 |
5662-5664 |
IN |
denotes |
of |
T1753 |
5665-5668 |
DT |
denotes |
the |
T1754 |
5675-5681 |
NN |
denotes |
family |
T1755 |
5669-5674 |
NN |
denotes |
zyxin |
T1756 |
5682-5684 |
IN |
denotes |
of |
T1757 |
5685-5693 |
NN |
denotes |
proteins |
T1758 |
5693-5694 |
-RRB- |
denotes |
) |
T1759 |
5694-5696 |
, |
denotes |
, |
T1760 |
5696-5701 |
WDT |
denotes |
which |
T1761 |
5702-5709 |
VBZ |
denotes |
appears |
T1762 |
5710-5712 |
TO |
denotes |
to |
T1763 |
5713-5721 |
VB |
denotes |
function |
T1764 |
5722-5728 |
RB |
denotes |
dually |
T1765 |
5729-5731 |
IN |
denotes |
in |
T1766 |
5732-5736 |
CC |
denotes |
both |
T1767 |
5737-5745 |
NN |
denotes |
adhesion |
T1768 |
5746-5749 |
CC |
denotes |
and |
T1769 |
5750-5752 |
IN |
denotes |
in |
T1770 |
5753-5763 |
NN |
denotes |
activation |
T1771 |
5764-5766 |
IN |
denotes |
of |
T1772 |
5767-5770 |
DT |
denotes |
the |
T1773 |
5815-5822 |
NN |
denotes |
pathway |
T1774 |
5771-5774 |
NN |
denotes |
Ras |
T1775 |
5774-5775 |
HYPH |
denotes |
- |
T1776 |
5775-5782 |
NN |
denotes |
mitogen |
T1777 |
5783-5792 |
VBN |
denotes |
activated |
T1778 |
5782-5783 |
HYPH |
denotes |
- |
T1779 |
5801-5807 |
NN |
denotes |
kinase |
T1780 |
5793-5800 |
NN |
denotes |
protein |
T1781 |
5808-5809 |
-LRB- |
denotes |
( |
T1782 |
5809-5813 |
NN |
denotes |
MAPK |
T1783 |
5813-5814 |
-RRB- |
denotes |
) |
T1784 |
5823-5824 |
-LRB- |
denotes |
[ |
T1785 |
5826-5828 |
CD |
denotes |
10 |
T1786 |
5824-5825 |
CD |
denotes |
9 |
T1787 |
5825-5826 |
, |
denotes |
, |
T1788 |
5828-5829 |
-RRB- |
denotes |
] |
T1789 |
5829-5830 |
. |
denotes |
. |
T1790 |
5830-5964 |
sentence |
denotes |
Through these links, AJs appear able to couple adhesion with cytoskeletal dynamics as well as with nuclear and cytoplasmic signaling. |
T1791 |
5831-5838 |
IN |
denotes |
Through |
T1792 |
5856-5862 |
VBP |
denotes |
appear |
T1793 |
5839-5844 |
DT |
denotes |
these |
T1794 |
5845-5850 |
NNS |
denotes |
links |
T1795 |
5850-5852 |
, |
denotes |
, |
T1796 |
5852-5855 |
NNS |
denotes |
AJs |
T1797 |
5863-5867 |
JJ |
denotes |
able |
T1798 |
5868-5870 |
TO |
denotes |
to |
T1799 |
5871-5877 |
VB |
denotes |
couple |
T1800 |
5878-5886 |
NN |
denotes |
adhesion |
T1801 |
5887-5891 |
IN |
denotes |
with |
T1802 |
5892-5904 |
JJ |
denotes |
cytoskeletal |
T1803 |
5905-5913 |
NNS |
denotes |
dynamics |
T1804 |
5914-5916 |
RB |
denotes |
as |
T1805 |
5922-5924 |
IN |
denotes |
as |
T1806 |
5917-5921 |
RB |
denotes |
well |
T1807 |
5925-5929 |
IN |
denotes |
with |
T1808 |
5930-5937 |
JJ |
denotes |
nuclear |
T1809 |
5954-5963 |
NN |
denotes |
signaling |
T1810 |
5938-5941 |
CC |
denotes |
and |
T1811 |
5942-5953 |
JJ |
denotes |
cytoplasmic |
T1812 |
5963-5964 |
. |
denotes |
. |
T1813 |
5964-6112 |
sentence |
denotes |
This provides a framework for conceptualizing why E-cadherin levels appear to impact upon a plethora of developmental processes (reviewed in [11]). |
T1814 |
5965-5969 |
DT |
denotes |
This |
T1815 |
5970-5978 |
VBZ |
denotes |
provides |
T1816 |
5979-5980 |
DT |
denotes |
a |
T1817 |
5981-5990 |
NN |
denotes |
framework |
T1818 |
5991-5994 |
IN |
denotes |
for |
T1819 |
5995-6010 |
VBG |
denotes |
conceptualizing |
T1820 |
6011-6014 |
WRB |
denotes |
why |
T1821 |
6033-6039 |
VBP |
denotes |
appear |
T1822 |
6015-6016 |
NN |
denotes |
E |
T1823 |
6017-6025 |
NN |
denotes |
cadherin |
T1824 |
6016-6017 |
HYPH |
denotes |
- |
T1825 |
6026-6032 |
NNS |
denotes |
levels |
T1826 |
6040-6042 |
TO |
denotes |
to |
T1827 |
6043-6049 |
VB |
denotes |
impact |
T1828 |
6050-6054 |
IN |
denotes |
upon |
T1829 |
6055-6056 |
DT |
denotes |
a |
T1830 |
6057-6065 |
NN |
denotes |
plethora |
T1831 |
6066-6068 |
IN |
denotes |
of |
T1832 |
6069-6082 |
JJ |
denotes |
developmental |
T1833 |
6083-6092 |
NNS |
denotes |
processes |
T1834 |
6093-6094 |
-LRB- |
denotes |
( |
T1835 |
6094-6102 |
VBN |
denotes |
reviewed |
T1836 |
6103-6105 |
IN |
denotes |
in |
T1837 |
6106-6107 |
-LRB- |
denotes |
[ |
T1838 |
6107-6109 |
CD |
denotes |
11 |
T1839 |
6109-6110 |
-RRB- |
denotes |
] |
T1840 |
6110-6111 |
-RRB- |
denotes |
) |
T1841 |
6111-6112 |
. |
denotes |
. |
T1842 |
6112-6396 |
sentence |
denotes |
As we probed more deeply into the underlying mechanisms governing E-cadherin promoter activity, we were intrigued by the close proximity of the LEF-1/β-catenin binding site to a site known to bind the Snail/Slug family of zinc finger transcriptional repressor proteins [12,13,14,15]. |
T1843 |
6113-6115 |
IN |
denotes |
As |
T1844 |
6119-6125 |
VBD |
denotes |
probed |
T1845 |
6116-6118 |
PRP |
denotes |
we |
T1846 |
6217-6226 |
VBN |
denotes |
intrigued |
T1847 |
6126-6130 |
RBR |
denotes |
more |
T1848 |
6131-6137 |
RB |
denotes |
deeply |
T1849 |
6138-6142 |
IN |
denotes |
into |
T1850 |
6143-6146 |
DT |
denotes |
the |
T1851 |
6158-6168 |
NNS |
denotes |
mechanisms |
T1852 |
6147-6157 |
JJ |
denotes |
underlying |
T1853 |
6169-6178 |
VBG |
denotes |
governing |
T1854 |
6179-6180 |
NN |
denotes |
E |
T1855 |
6181-6189 |
NN |
denotes |
cadherin |
T1856 |
6180-6181 |
HYPH |
denotes |
- |
T1857 |
6190-6198 |
NN |
denotes |
promoter |
T1858 |
6199-6207 |
NN |
denotes |
activity |
T1859 |
6207-6209 |
, |
denotes |
, |
T1860 |
6209-6211 |
PRP |
denotes |
we |
T1861 |
6212-6216 |
VBD |
denotes |
were |
T1862 |
6227-6229 |
IN |
denotes |
by |
T1863 |
6230-6233 |
DT |
denotes |
the |
T1864 |
6240-6249 |
NN |
denotes |
proximity |
T1865 |
6234-6239 |
JJ |
denotes |
close |
T1866 |
6250-6252 |
IN |
denotes |
of |
T1867 |
6253-6256 |
DT |
denotes |
the |
T1868 |
6281-6285 |
NN |
denotes |
site |
T1869 |
6257-6260 |
NN |
denotes |
LEF |
T1870 |
6260-6261 |
HYPH |
denotes |
- |
T1871 |
6261-6262 |
CD |
denotes |
1 |
T1872 |
6262-6263 |
HYPH |
denotes |
/ |
T1873 |
6263-6264 |
NN |
denotes |
β |
T1874 |
6265-6272 |
NN |
denotes |
catenin |
T1875 |
6264-6265 |
HYPH |
denotes |
- |
T1876 |
6273-6280 |
NN |
denotes |
binding |
T1877 |
6286-6288 |
IN |
denotes |
to |
T1878 |
6289-6290 |
DT |
denotes |
a |
T1879 |
6291-6295 |
NN |
denotes |
site |
T1880 |
6296-6301 |
VBN |
denotes |
known |
T1881 |
6302-6304 |
TO |
denotes |
to |
T1882 |
6305-6309 |
VB |
denotes |
bind |
T1883 |
6310-6313 |
DT |
denotes |
the |
T1884 |
6325-6331 |
NN |
denotes |
family |
T1885 |
6314-6319 |
NN |
denotes |
Snail |
T1886 |
6320-6324 |
NN |
denotes |
Slug |
T1887 |
6319-6320 |
HYPH |
denotes |
/ |
T1888 |
6332-6334 |
IN |
denotes |
of |
T1889 |
6335-6339 |
NN |
denotes |
zinc |
T1890 |
6340-6346 |
NN |
denotes |
finger |
T1891 |
6373-6381 |
NN |
denotes |
proteins |
T1892 |
6347-6362 |
JJ |
denotes |
transcriptional |
T1893 |
6363-6372 |
NN |
denotes |
repressor |
T1894 |
6382-6383 |
-LRB- |
denotes |
[ |
T1895 |
6392-6394 |
CD |
denotes |
15 |
T1896 |
6383-6385 |
CD |
denotes |
12 |
T1897 |
6385-6386 |
, |
denotes |
, |
T1898 |
6386-6388 |
CD |
denotes |
13 |
T1899 |
6388-6389 |
, |
denotes |
, |
T1900 |
6389-6391 |
CD |
denotes |
14 |
T1901 |
6391-6392 |
, |
denotes |
, |
T1902 |
6394-6395 |
-RRB- |
denotes |
] |
T1903 |
6395-6396 |
. |
denotes |
. |
T1904 |
6396-6631 |
sentence |
denotes |
Both activity of Snail and down-regulation of E-cadherin play pivotal roles in epithelial to mesenchymal transitions (EMTs), typified by the transformation of polarized, adhering epithelial cells into motile mesenchymal cells [16,17]. |
T1905 |
6397-6401 |
CC |
denotes |
Both |
T1906 |
6402-6410 |
NN |
denotes |
activity |
T1907 |
6454-6458 |
VBP |
denotes |
play |
T1908 |
6411-6413 |
IN |
denotes |
of |
T1909 |
6414-6419 |
NN |
denotes |
Snail |
T1910 |
6420-6423 |
CC |
denotes |
and |
T1911 |
6424-6428 |
NN |
denotes |
down |
T1912 |
6429-6439 |
NN |
denotes |
regulation |
T1913 |
6428-6429 |
HYPH |
denotes |
- |
T1914 |
6440-6442 |
IN |
denotes |
of |
T1915 |
6443-6444 |
NN |
denotes |
E |
T1916 |
6445-6453 |
NN |
denotes |
cadherin |
T1917 |
6444-6445 |
HYPH |
denotes |
- |
T1918 |
6459-6466 |
JJ |
denotes |
pivotal |
T1919 |
6467-6472 |
NNS |
denotes |
roles |
T1920 |
6473-6475 |
IN |
denotes |
in |
T1921 |
6476-6486 |
JJ |
denotes |
epithelial |
T1922 |
6502-6513 |
NNS |
denotes |
transitions |
T1923 |
6487-6489 |
IN |
denotes |
to |
T1924 |
6490-6501 |
JJ |
denotes |
mesenchymal |
T1925 |
6514-6515 |
-LRB- |
denotes |
( |
T1926 |
6515-6519 |
NNS |
denotes |
EMTs |
T1927 |
6519-6520 |
-RRB- |
denotes |
) |
T1928 |
6520-6522 |
, |
denotes |
, |
T1929 |
6522-6530 |
VBN |
denotes |
typified |
T1930 |
6531-6533 |
IN |
denotes |
by |
T1931 |
6534-6537 |
DT |
denotes |
the |
T1932 |
6538-6552 |
NN |
denotes |
transformation |
T1933 |
6553-6555 |
IN |
denotes |
of |
T1934 |
6556-6565 |
VBN |
denotes |
polarized |
T1935 |
6587-6592 |
NNS |
denotes |
cells |
T1936 |
6565-6567 |
, |
denotes |
, |
T1937 |
6567-6575 |
VBG |
denotes |
adhering |
T1938 |
6576-6586 |
JJ |
denotes |
epithelial |
T1939 |
6593-6597 |
IN |
denotes |
into |
T1940 |
6598-6604 |
JJ |
denotes |
motile |
T1941 |
6617-6622 |
NNS |
denotes |
cells |
T1942 |
6605-6616 |
JJ |
denotes |
mesenchymal |
T1943 |
6623-6624 |
-LRB- |
denotes |
[ |
T1944 |
6627-6629 |
CD |
denotes |
17 |
T1945 |
6624-6626 |
CD |
denotes |
16 |
T1946 |
6626-6627 |
, |
denotes |
, |
T1947 |
6629-6630 |
-RRB- |
denotes |
] |
T1948 |
6630-6631 |
. |
denotes |
. |
T1949 |
6631-6817 |
sentence |
denotes |
Bud formation differs from an EMT in that E-cadherin activity needs to be down-regulated but not prevented, so that adhesive junctions are remodeled rather than quantitatively impaired. |
T1950 |
6632-6635 |
NN |
denotes |
Bud |
T1951 |
6636-6645 |
NN |
denotes |
formation |
T1952 |
6646-6653 |
VBZ |
denotes |
differs |
T1953 |
6654-6658 |
IN |
denotes |
from |
T1954 |
6659-6661 |
DT |
denotes |
an |
T1955 |
6662-6665 |
NN |
denotes |
EMT |
T1956 |
6666-6668 |
IN |
denotes |
in |
T1957 |
6694-6699 |
VBZ |
denotes |
needs |
T1958 |
6669-6673 |
DT |
denotes |
that |
T1959 |
6674-6675 |
NN |
denotes |
E |
T1960 |
6676-6684 |
NN |
denotes |
cadherin |
T1961 |
6675-6676 |
HYPH |
denotes |
- |
T1962 |
6685-6693 |
NN |
denotes |
activity |
T1963 |
6700-6702 |
TO |
denotes |
to |
T1964 |
6711-6720 |
VBN |
denotes |
regulated |
T1965 |
6703-6705 |
VB |
denotes |
be |
T1966 |
6706-6710 |
RB |
denotes |
down |
T1967 |
6710-6711 |
HYPH |
denotes |
- |
T1968 |
6721-6724 |
CC |
denotes |
but |
T1969 |
6725-6728 |
RB |
denotes |
not |
T1970 |
6729-6738 |
VBN |
denotes |
prevented |
T1971 |
6738-6740 |
, |
denotes |
, |
T1972 |
6740-6742 |
IN |
denotes |
so |
T1973 |
6771-6780 |
VBN |
denotes |
remodeled |
T1974 |
6743-6747 |
IN |
denotes |
that |
T1975 |
6748-6756 |
JJ |
denotes |
adhesive |
T1976 |
6757-6766 |
NNS |
denotes |
junctions |
T1977 |
6767-6770 |
VBP |
denotes |
are |
T1978 |
6781-6787 |
RB |
denotes |
rather |
T1979 |
6788-6792 |
IN |
denotes |
than |
T1980 |
6793-6807 |
RB |
denotes |
quantitatively |
T1981 |
6808-6816 |
VBN |
denotes |
impaired |
T1982 |
6816-6817 |
. |
denotes |
. |
T1983 |
6817-7035 |
sentence |
denotes |
Supportive of an underlying ability to fine-tune cadherin expression at the transcriptional level, Snail seems to have an additive effect with LEF-1/β-catenin in negatively modulating E-cadherin promoter activity [4]. |
T1984 |
6818-6828 |
JJ |
denotes |
Supportive |
T1985 |
6923-6928 |
VBZ |
denotes |
seems |
T1986 |
6829-6831 |
IN |
denotes |
of |
T1987 |
6832-6834 |
DT |
denotes |
an |
T1988 |
6846-6853 |
NN |
denotes |
ability |
T1989 |
6835-6845 |
JJ |
denotes |
underlying |
T1990 |
6854-6856 |
TO |
denotes |
to |
T1991 |
6862-6866 |
VB |
denotes |
tune |
T1992 |
6857-6861 |
RB |
denotes |
fine |
T1993 |
6861-6862 |
HYPH |
denotes |
- |
T1994 |
6867-6875 |
NN |
denotes |
cadherin |
T1995 |
6876-6886 |
NN |
denotes |
expression |
T1996 |
6887-6889 |
IN |
denotes |
at |
T1997 |
6890-6893 |
DT |
denotes |
the |
T1998 |
6910-6915 |
NN |
denotes |
level |
T1999 |
6894-6909 |
JJ |
denotes |
transcriptional |
T2000 |
6915-6917 |
, |
denotes |
, |
T2001 |
6917-6922 |
NN |
denotes |
Snail |
T2002 |
6929-6931 |
TO |
denotes |
to |
T2003 |
6932-6936 |
VB |
denotes |
have |
T2004 |
6937-6939 |
DT |
denotes |
an |
T2005 |
6949-6955 |
NN |
denotes |
effect |
T2006 |
6940-6948 |
JJ |
denotes |
additive |
T2007 |
6956-6960 |
IN |
denotes |
with |
T2008 |
6961-6964 |
NN |
denotes |
LEF |
T2009 |
6964-6965 |
HYPH |
denotes |
- |
T2010 |
6965-6966 |
CD |
denotes |
1 |
T2011 |
6966-6967 |
HYPH |
denotes |
/ |
T2012 |
6967-6968 |
NN |
denotes |
β |
T2013 |
6969-6976 |
NN |
denotes |
catenin |
T2014 |
6968-6969 |
HYPH |
denotes |
- |
T2015 |
6977-6979 |
IN |
denotes |
in |
T2016 |
6980-6990 |
RB |
denotes |
negatively |
T2017 |
6991-7001 |
VBG |
denotes |
modulating |
T2018 |
7002-7003 |
NN |
denotes |
E |
T2019 |
7004-7012 |
NN |
denotes |
cadherin |
T2020 |
7003-7004 |
HYPH |
denotes |
- |
T2021 |
7013-7021 |
NN |
denotes |
promoter |
T2022 |
7022-7030 |
NN |
denotes |
activity |
T2023 |
7031-7032 |
-LRB- |
denotes |
[ |
T2024 |
7032-7033 |
CD |
denotes |
4 |
T2025 |
7033-7034 |
-RRB- |
denotes |
] |
T2026 |
7034-7035 |
. |
denotes |
. |
T2027 |
7035-7220 |
sentence |
denotes |
In the present study, we discovered that Snail is expressed briefly at an early stage of hair bud formation, when E-cadherin down-regulation and activation of proliferation take place. |
T2028 |
7036-7038 |
IN |
denotes |
In |
T2029 |
7061-7071 |
VBD |
denotes |
discovered |
T2030 |
7039-7042 |
DT |
denotes |
the |
T2031 |
7051-7056 |
NN |
denotes |
study |
T2032 |
7043-7050 |
JJ |
denotes |
present |
T2033 |
7056-7058 |
, |
denotes |
, |
T2034 |
7058-7060 |
PRP |
denotes |
we |
T2035 |
7072-7076 |
IN |
denotes |
that |
T2036 |
7086-7095 |
VBN |
denotes |
expressed |
T2037 |
7077-7082 |
NN |
denotes |
Snail |
T2038 |
7083-7085 |
VBZ |
denotes |
is |
T2039 |
7096-7103 |
RB |
denotes |
briefly |
T2040 |
7104-7106 |
IN |
denotes |
at |
T2041 |
7107-7109 |
DT |
denotes |
an |
T2042 |
7116-7121 |
NN |
denotes |
stage |
T2043 |
7110-7115 |
JJ |
denotes |
early |
T2044 |
7122-7124 |
IN |
denotes |
of |
T2045 |
7125-7129 |
NN |
denotes |
hair |
T2046 |
7130-7133 |
NN |
denotes |
bud |
T2047 |
7134-7143 |
NN |
denotes |
formation |
T2048 |
7143-7145 |
, |
denotes |
, |
T2049 |
7145-7149 |
WRB |
denotes |
when |
T2050 |
7209-7213 |
VBP |
denotes |
take |
T2051 |
7150-7151 |
NN |
denotes |
E |
T2052 |
7152-7160 |
NN |
denotes |
cadherin |
T2053 |
7151-7152 |
HYPH |
denotes |
- |
T2054 |
7161-7165 |
JJ |
denotes |
down |
T2055 |
7166-7176 |
NN |
denotes |
regulation |
T2056 |
7165-7166 |
HYPH |
denotes |
- |
T2057 |
7177-7180 |
CC |
denotes |
and |
T2058 |
7181-7191 |
NN |
denotes |
activation |
T2059 |
7192-7194 |
IN |
denotes |
of |
T2060 |
7195-7208 |
NN |
denotes |
proliferation |
T2061 |
7214-7219 |
NN |
denotes |
place |
T2062 |
7219-7220 |
. |
denotes |
. |
T2063 |
7220-7323 |
sentence |
denotes |
Thereafter, Snail disappears and remains absent during subsequent follicle down-growth and maturation. |
T2064 |
7221-7231 |
RB |
denotes |
Thereafter |
T2065 |
7239-7249 |
VBZ |
denotes |
disappears |
T2066 |
7231-7233 |
, |
denotes |
, |
T2067 |
7233-7238 |
NN |
denotes |
Snail |
T2068 |
7250-7253 |
CC |
denotes |
and |
T2069 |
7254-7261 |
VBZ |
denotes |
remains |
T2070 |
7262-7268 |
JJ |
denotes |
absent |
T2071 |
7269-7275 |
IN |
denotes |
during |
T2072 |
7276-7286 |
JJ |
denotes |
subsequent |
T2073 |
7301-7307 |
NN |
denotes |
growth |
T2074 |
7287-7295 |
NN |
denotes |
follicle |
T2075 |
7296-7300 |
JJ |
denotes |
down |
T2076 |
7300-7301 |
HYPH |
denotes |
- |
T2077 |
7308-7311 |
CC |
denotes |
and |
T2078 |
7312-7322 |
NN |
denotes |
maturation |
T2079 |
7322-7323 |
. |
denotes |
. |
T2080 |
7323-7583 |
sentence |
denotes |
This exquisite pattern appears to be functionally relevant since altering it in vivo correspondingly affects features associated with hair bud formation, including down-regulation of E-cadherin, increased proliferation, and repressed terminal differentiation. |
T2081 |
7324-7328 |
DT |
denotes |
This |
T2082 |
7339-7346 |
NN |
denotes |
pattern |
T2083 |
7329-7338 |
JJ |
denotes |
exquisite |
T2084 |
7347-7354 |
VBZ |
denotes |
appears |
T2085 |
7355-7357 |
TO |
denotes |
to |
T2086 |
7358-7360 |
VB |
denotes |
be |
T2087 |
7361-7373 |
RB |
denotes |
functionally |
T2088 |
7374-7382 |
JJ |
denotes |
relevant |
T2089 |
7383-7388 |
IN |
denotes |
since |
T2090 |
7425-7432 |
VBZ |
denotes |
affects |
T2091 |
7389-7397 |
VBG |
denotes |
altering |
T2092 |
7398-7400 |
PRP |
denotes |
it |
T2093 |
7401-7403 |
FW |
denotes |
in |
T2094 |
7404-7408 |
FW |
denotes |
vivo |
T2095 |
7409-7424 |
RB |
denotes |
correspondingly |
T2096 |
7433-7441 |
NNS |
denotes |
features |
T2097 |
7442-7452 |
VBN |
denotes |
associated |
T2098 |
7453-7457 |
IN |
denotes |
with |
T2099 |
7458-7462 |
NN |
denotes |
hair |
T2100 |
7463-7466 |
NN |
denotes |
bud |
T2101 |
7467-7476 |
NN |
denotes |
formation |
T2102 |
7476-7478 |
, |
denotes |
, |
T2103 |
7478-7487 |
VBG |
denotes |
including |
T2104 |
7488-7492 |
NN |
denotes |
down |
T2105 |
7493-7503 |
NN |
denotes |
regulation |
T2106 |
7492-7493 |
HYPH |
denotes |
- |
T2107 |
7504-7506 |
IN |
denotes |
of |
T2108 |
7507-7508 |
NN |
denotes |
E |
T2109 |
7509-7517 |
NN |
denotes |
cadherin |
T2110 |
7508-7509 |
HYPH |
denotes |
- |
T2111 |
7517-7519 |
, |
denotes |
, |
T2112 |
7519-7528 |
VBN |
denotes |
increased |
T2113 |
7529-7542 |
NN |
denotes |
proliferation |
T2114 |
7542-7544 |
, |
denotes |
, |
T2115 |
7544-7547 |
CC |
denotes |
and |
T2116 |
7548-7557 |
VBN |
denotes |
repressed |
T2117 |
7567-7582 |
NN |
denotes |
differentiation |
T2118 |
7558-7566 |
JJ |
denotes |
terminal |
T2119 |
7582-7583 |
. |
denotes |
. |
T2120 |
7583-7829 |
sentence |
denotes |
Although the temporal spike of Snail in the hair bud is reflected at the mRNA level and seems to follow Wnt signaling and BMP inhibition, LEF-1/β-catenin activation does not appear to induce Snail gene expression in embryonic skin keratinocytes. |
T2121 |
7584-7592 |
IN |
denotes |
Although |
T2122 |
7640-7649 |
VBN |
denotes |
reflected |
T2123 |
7593-7596 |
DT |
denotes |
the |
T2124 |
7606-7611 |
NN |
denotes |
spike |
T2125 |
7597-7605 |
JJ |
denotes |
temporal |
T2126 |
7612-7614 |
IN |
denotes |
of |
T2127 |
7615-7620 |
NN |
denotes |
Snail |
T2128 |
7621-7623 |
IN |
denotes |
in |
T2129 |
7624-7627 |
DT |
denotes |
the |
T2130 |
7633-7636 |
NN |
denotes |
bud |
T2131 |
7628-7632 |
NN |
denotes |
hair |
T2132 |
7637-7639 |
VBZ |
denotes |
is |
T2133 |
7758-7764 |
VB |
denotes |
appear |
T2134 |
7650-7652 |
IN |
denotes |
at |
T2135 |
7653-7656 |
DT |
denotes |
the |
T2136 |
7662-7667 |
NN |
denotes |
level |
T2137 |
7657-7661 |
NN |
denotes |
mRNA |
T2138 |
7668-7671 |
CC |
denotes |
and |
T2139 |
7672-7677 |
VBZ |
denotes |
seems |
T2140 |
7678-7680 |
TO |
denotes |
to |
T2141 |
7681-7687 |
VB |
denotes |
follow |
T2142 |
7688-7691 |
NN |
denotes |
Wnt |
T2143 |
7692-7701 |
NN |
denotes |
signaling |
T2144 |
7702-7705 |
CC |
denotes |
and |
T2145 |
7706-7709 |
NN |
denotes |
BMP |
T2146 |
7710-7720 |
NN |
denotes |
inhibition |
T2147 |
7720-7722 |
, |
denotes |
, |
T2148 |
7722-7725 |
NN |
denotes |
LEF |
T2149 |
7738-7748 |
NN |
denotes |
activation |
T2150 |
7725-7726 |
HYPH |
denotes |
- |
T2151 |
7726-7727 |
CD |
denotes |
1 |
T2152 |
7727-7728 |
HYPH |
denotes |
/ |
T2153 |
7728-7729 |
NN |
denotes |
β |
T2154 |
7730-7737 |
NN |
denotes |
catenin |
T2155 |
7729-7730 |
HYPH |
denotes |
- |
T2156 |
7749-7753 |
VBZ |
denotes |
does |
T2157 |
7754-7757 |
RB |
denotes |
not |
T2158 |
7765-7767 |
TO |
denotes |
to |
T2159 |
7768-7774 |
VB |
denotes |
induce |
T2160 |
7775-7780 |
NN |
denotes |
Snail |
T2161 |
7786-7796 |
NN |
denotes |
expression |
T2162 |
7781-7785 |
NN |
denotes |
gene |
T2163 |
7797-7799 |
IN |
denotes |
in |
T2164 |
7800-7809 |
JJ |
denotes |
embryonic |
T2165 |
7815-7828 |
NNS |
denotes |
keratinocytes |
T2166 |
7810-7814 |
NN |
denotes |
skin |
T2167 |
7828-7829 |
. |
denotes |
. |
T2168 |
7829-8088 |
sentence |
denotes |
In contrast, we provide in vitro, transgenic (Tg), and gene targeting evidence to show that TGF-β2 and small phenotype– and mothers against decapentaplegic–related protein 2 (SMAD2) signaling are upstream inducers of Snail gene expression in skin epithelium. |
T2169 |
7830-7832 |
IN |
denotes |
In |
T2170 |
7846-7853 |
VBP |
denotes |
provide |
T2171 |
7833-7841 |
NN |
denotes |
contrast |
T2172 |
7841-7843 |
, |
denotes |
, |
T2173 |
7843-7845 |
PRP |
denotes |
we |
T2174 |
7854-7856 |
FW |
denotes |
in |
T2175 |
7857-7862 |
FW |
denotes |
vitro |
T2176 |
7900-7908 |
NN |
denotes |
evidence |
T2177 |
7862-7864 |
, |
denotes |
, |
T2178 |
7864-7874 |
JJ |
denotes |
transgenic |
T2179 |
7875-7876 |
-LRB- |
denotes |
( |
T2180 |
7876-7878 |
JJ |
denotes |
Tg |
T2181 |
7878-7879 |
-RRB- |
denotes |
) |
T2182 |
7879-7881 |
, |
denotes |
, |
T2183 |
7881-7884 |
CC |
denotes |
and |
T2184 |
7885-7889 |
NN |
denotes |
gene |
T2185 |
7890-7899 |
VBG |
denotes |
targeting |
T2186 |
7909-7911 |
TO |
denotes |
to |
T2187 |
7912-7916 |
VB |
denotes |
show |
T2188 |
7917-7921 |
IN |
denotes |
that |
T2189 |
8022-8025 |
VBP |
denotes |
are |
T2190 |
7922-7925 |
NN |
denotes |
TGF |
T2191 |
7926-7928 |
NN |
denotes |
β2 |
T2192 |
7925-7926 |
HYPH |
denotes |
- |
T2193 |
8012-8021 |
NN |
denotes |
signaling |
T2194 |
7929-7932 |
CC |
denotes |
and |
T2195 |
7933-7938 |
JJ |
denotes |
small |
T2196 |
7939-7948 |
NN |
denotes |
phenotype |
T2197 |
7986-7993 |
VBN |
denotes |
related |
T2198 |
7948-7949 |
-LRB- |
denotes |
– |
T2199 |
7950-7953 |
CC |
denotes |
and |
T2200 |
7954-7961 |
NNS |
denotes |
mothers |
T2201 |
7962-7969 |
IN |
denotes |
against |
T2202 |
7970-7985 |
NN |
denotes |
decapentaplegic |
T2203 |
7985-7986 |
-RRB- |
denotes |
– |
T2204 |
7994-8001 |
NN |
denotes |
protein |
T2205 |
8002-8003 |
CD |
denotes |
2 |
T2206 |
8004-8005 |
-LRB- |
denotes |
( |
T2207 |
8005-8010 |
NN |
denotes |
SMAD2 |
T2208 |
8010-8011 |
-RRB- |
denotes |
) |
T2209 |
8026-8034 |
JJ |
denotes |
upstream |
T2210 |
8035-8043 |
NNS |
denotes |
inducers |
T2211 |
8044-8046 |
IN |
denotes |
of |
T2212 |
8047-8052 |
NN |
denotes |
Snail |
T2213 |
8058-8068 |
NN |
denotes |
expression |
T2214 |
8053-8057 |
NN |
denotes |
gene |
T2215 |
8069-8071 |
IN |
denotes |
in |
T2216 |
8072-8076 |
NN |
denotes |
skin |
T2217 |
8077-8087 |
NN |
denotes |
epithelium |
T2218 |
8087-8088 |
. |
denotes |
. |
T2219 |
8088-8219 |
sentence |
denotes |
In the absence of TGF-β2 signaling and Snail gene expression, hair placodes can form, but further follicle down-growth is blocked. |
T2220 |
8089-8091 |
IN |
denotes |
In |
T2221 |
8169-8173 |
VB |
denotes |
form |
T2222 |
8092-8095 |
DT |
denotes |
the |
T2223 |
8096-8103 |
NN |
denotes |
absence |
T2224 |
8104-8106 |
IN |
denotes |
of |
T2225 |
8107-8110 |
NN |
denotes |
TGF |
T2226 |
8111-8113 |
NN |
denotes |
β2 |
T2227 |
8110-8111 |
HYPH |
denotes |
- |
T2228 |
8114-8123 |
NN |
denotes |
signaling |
T2229 |
8124-8127 |
CC |
denotes |
and |
T2230 |
8128-8133 |
NN |
denotes |
Snail |
T2231 |
8139-8149 |
NN |
denotes |
expression |
T2232 |
8134-8138 |
NN |
denotes |
gene |
T2233 |
8149-8151 |
, |
denotes |
, |
T2234 |
8151-8155 |
NN |
denotes |
hair |
T2235 |
8156-8164 |
NNS |
denotes |
placodes |
T2236 |
8165-8168 |
MD |
denotes |
can |
T2237 |
8173-8175 |
, |
denotes |
, |
T2238 |
8175-8178 |
CC |
denotes |
but |
T2239 |
8179-8186 |
JJ |
denotes |
further |
T2240 |
8201-8207 |
NN |
denotes |
growth |
T2241 |
8187-8195 |
NN |
denotes |
follicle |
T2242 |
8196-8200 |
JJ |
denotes |
down |
T2243 |
8200-8201 |
HYPH |
denotes |
- |
T2244 |
8211-8218 |
VBN |
denotes |
blocked |
T2245 |
8208-8210 |
VBZ |
denotes |
is |
T2246 |
8218-8219 |
. |
denotes |
. |
T2247 |
8219-8397 |
sentence |
denotes |
Our studies point to the view that Snail likely functions downstream of cell fate specification, at a stage where the bud begins to exhibit enhanced proliferation and migration. |
T2248 |
8220-8223 |
PRP$ |
denotes |
Our |
T2249 |
8224-8231 |
NNS |
denotes |
studies |
T2250 |
8232-8237 |
VBP |
denotes |
point |
T2251 |
8238-8240 |
IN |
denotes |
to |
T2252 |
8241-8244 |
DT |
denotes |
the |
T2253 |
8245-8249 |
NN |
denotes |
view |
T2254 |
8250-8254 |
IN |
denotes |
that |
T2255 |
8268-8277 |
VBZ |
denotes |
functions |
T2256 |
8255-8260 |
NN |
denotes |
Snail |
T2257 |
8261-8267 |
RB |
denotes |
likely |
T2258 |
8278-8288 |
RB |
denotes |
downstream |
T2259 |
8289-8291 |
IN |
denotes |
of |
T2260 |
8292-8296 |
NN |
denotes |
cell |
T2261 |
8297-8301 |
NN |
denotes |
fate |
T2262 |
8302-8315 |
NN |
denotes |
specification |
T2263 |
8315-8317 |
, |
denotes |
, |
T2264 |
8317-8319 |
IN |
denotes |
at |
T2265 |
8320-8321 |
DT |
denotes |
a |
T2266 |
8322-8327 |
NN |
denotes |
stage |
T2267 |
8328-8333 |
WRB |
denotes |
where |
T2268 |
8342-8348 |
VBZ |
denotes |
begins |
T2269 |
8334-8337 |
DT |
denotes |
the |
T2270 |
8338-8341 |
NN |
denotes |
bud |
T2271 |
8349-8351 |
TO |
denotes |
to |
T2272 |
8352-8359 |
VB |
denotes |
exhibit |
T2273 |
8360-8368 |
VBN |
denotes |
enhanced |
T2274 |
8369-8382 |
NN |
denotes |
proliferation |
T2275 |
8383-8386 |
CC |
denotes |
and |
T2276 |
8387-8396 |
NN |
denotes |
migration |
T2277 |
8396-8397 |
. |
denotes |
. |
T2702 |
8408-8413 |
NN |
denotes |
Snail |
T2703 |
8414-8418 |
NN |
denotes |
mRNA |
T2704 |
8435-8444 |
VBN |
denotes |
Expressed |
T2705 |
8419-8422 |
CC |
denotes |
and |
T2706 |
8423-8430 |
NN |
denotes |
Protein |
T2707 |
8431-8434 |
VBP |
denotes |
Are |
T2708 |
8445-8456 |
RB |
denotes |
Transiently |
T2709 |
8457-8459 |
IN |
denotes |
at |
T2710 |
8460-8463 |
DT |
denotes |
the |
T2711 |
8473-8478 |
NN |
denotes |
Stage |
T2712 |
8464-8468 |
NN |
denotes |
Hair |
T2713 |
8469-8472 |
NN |
denotes |
Bud |
T2714 |
8479-8481 |
IN |
denotes |
of |
T2715 |
8482-8490 |
NN |
denotes |
Follicle |
T2716 |
8491-8504 |
NN |
denotes |
Morphogenesis |
T2717 |
8504-8721 |
sentence |
denotes |
Although Snail family members are most frequently associated with EMTs, they also participate in many malignant processes involving a down-regulation but not a quantitative abrogation of intercellular junctions [18]. |
T2718 |
8505-8513 |
IN |
denotes |
Although |
T2719 |
8555-8565 |
VBN |
denotes |
associated |
T2720 |
8514-8519 |
NN |
denotes |
Snail |
T2721 |
8527-8534 |
NNS |
denotes |
members |
T2722 |
8520-8526 |
NN |
denotes |
family |
T2723 |
8535-8538 |
VBP |
denotes |
are |
T2724 |
8539-8543 |
RBS |
denotes |
most |
T2725 |
8544-8554 |
RB |
denotes |
frequently |
T2726 |
8587-8598 |
VBP |
denotes |
participate |
T2727 |
8566-8570 |
IN |
denotes |
with |
T2728 |
8571-8575 |
NNS |
denotes |
EMTs |
T2729 |
8575-8577 |
, |
denotes |
, |
T2730 |
8577-8581 |
PRP |
denotes |
they |
T2731 |
8582-8586 |
RB |
denotes |
also |
T2732 |
8599-8601 |
IN |
denotes |
in |
T2733 |
8602-8606 |
JJ |
denotes |
many |
T2734 |
8617-8626 |
NNS |
denotes |
processes |
T2735 |
8607-8616 |
JJ |
denotes |
malignant |
T2736 |
8627-8636 |
VBG |
denotes |
involving |
T2737 |
8637-8638 |
DT |
denotes |
a |
T2738 |
8644-8654 |
NN |
denotes |
regulation |
T2739 |
8639-8643 |
JJ |
denotes |
down |
T2740 |
8643-8644 |
HYPH |
denotes |
- |
T2741 |
8655-8658 |
CC |
denotes |
but |
T2742 |
8659-8662 |
RB |
denotes |
not |
T2743 |
8663-8664 |
DT |
denotes |
a |
T2744 |
8678-8688 |
NN |
denotes |
abrogation |
T2745 |
8665-8677 |
JJ |
denotes |
quantitative |
T2746 |
8689-8691 |
IN |
denotes |
of |
T2747 |
8692-8705 |
JJ |
denotes |
intercellular |
T2748 |
8706-8715 |
NNS |
denotes |
junctions |
T2749 |
8716-8717 |
-LRB- |
denotes |
[ |
T2750 |
8717-8719 |
CD |
denotes |
18 |
T2751 |
8719-8720 |
-RRB- |
denotes |
] |
T2752 |
8720-8721 |
. |
denotes |
. |
T2753 |
8721-8906 |
sentence |
denotes |
The range of developmental processes in which Snail family members have been implicated thus includes the type of epithelial remodeling that is observed in hair follicle bud formation. |
T2754 |
8722-8725 |
DT |
denotes |
The |
T2755 |
8726-8731 |
NN |
denotes |
range |
T2756 |
8815-8823 |
VBZ |
denotes |
includes |
T2757 |
8732-8734 |
IN |
denotes |
of |
T2758 |
8735-8748 |
JJ |
denotes |
developmental |
T2759 |
8749-8758 |
NNS |
denotes |
processes |
T2760 |
8759-8761 |
IN |
denotes |
in |
T2761 |
8799-8809 |
VBN |
denotes |
implicated |
T2762 |
8762-8767 |
WDT |
denotes |
which |
T2763 |
8768-8773 |
NN |
denotes |
Snail |
T2764 |
8781-8788 |
NNS |
denotes |
members |
T2765 |
8774-8780 |
NN |
denotes |
family |
T2766 |
8789-8793 |
VBP |
denotes |
have |
T2767 |
8794-8798 |
VBN |
denotes |
been |
T2768 |
8810-8814 |
RB |
denotes |
thus |
T2769 |
8824-8827 |
DT |
denotes |
the |
T2770 |
8828-8832 |
NN |
denotes |
type |
T2771 |
8833-8835 |
IN |
denotes |
of |
T2772 |
8836-8846 |
JJ |
denotes |
epithelial |
T2773 |
8847-8857 |
NN |
denotes |
remodeling |
T2774 |
8858-8862 |
WDT |
denotes |
that |
T2775 |
8866-8874 |
VBN |
denotes |
observed |
T2776 |
8863-8865 |
VBZ |
denotes |
is |
T2777 |
8875-8877 |
IN |
denotes |
in |
T2778 |
8878-8882 |
NN |
denotes |
hair |
T2779 |
8883-8891 |
NN |
denotes |
follicle |
T2780 |
8892-8895 |
NN |
denotes |
bud |
T2781 |
8896-8905 |
NN |
denotes |
formation |
T2782 |
8905-8906 |
. |
denotes |
. |
T2783 |
8906-9260 |
sentence |
denotes |
Given our prior observation that exogenously added Snail can participate with LEF-1/β-catenin in down-regulating E-cadherin expression in keratinocytes [4], coupled with the established requirement for LEF-1/β-catenin in hair follicle morphogenesis [4,19], we turned to addressing whether Snail/Slug family members might also participate in the process. |
T2784 |
8907-8912 |
VBN |
denotes |
Given |
T2785 |
9167-9173 |
VBD |
denotes |
turned |
T2786 |
8913-8916 |
PRP$ |
denotes |
our |
T2787 |
8923-8934 |
NN |
denotes |
observation |
T2788 |
8917-8922 |
JJ |
denotes |
prior |
T2789 |
8935-8939 |
IN |
denotes |
that |
T2790 |
8968-8979 |
VB |
denotes |
participate |
T2791 |
8940-8951 |
RB |
denotes |
exogenously |
T2792 |
8952-8957 |
VBN |
denotes |
added |
T2793 |
8958-8963 |
NN |
denotes |
Snail |
T2794 |
8964-8967 |
MD |
denotes |
can |
T2795 |
8980-8984 |
IN |
denotes |
with |
T2796 |
8985-8988 |
NN |
denotes |
LEF |
T2797 |
8988-8989 |
HYPH |
denotes |
- |
T2798 |
8989-8990 |
CD |
denotes |
1 |
T2799 |
8990-8991 |
HYPH |
denotes |
/ |
T2800 |
8991-8992 |
NN |
denotes |
β |
T2801 |
8993-9000 |
NN |
denotes |
catenin |
T2802 |
8992-8993 |
HYPH |
denotes |
- |
T2803 |
9001-9003 |
IN |
denotes |
in |
T2804 |
9004-9008 |
RB |
denotes |
down |
T2805 |
9009-9019 |
VBG |
denotes |
regulating |
T2806 |
9008-9009 |
HYPH |
denotes |
- |
T2807 |
9020-9021 |
NN |
denotes |
E |
T2808 |
9022-9030 |
NN |
denotes |
cadherin |
T2809 |
9021-9022 |
HYPH |
denotes |
- |
T2810 |
9031-9041 |
NN |
denotes |
expression |
T2811 |
9042-9044 |
IN |
denotes |
in |
T2812 |
9045-9058 |
NNS |
denotes |
keratinocytes |
T2813 |
9059-9060 |
-LRB- |
denotes |
[ |
T2814 |
9060-9061 |
CD |
denotes |
4 |
T2815 |
9061-9062 |
-RRB- |
denotes |
] |
T2816 |
9062-9064 |
, |
denotes |
, |
T2817 |
9064-9071 |
VBN |
denotes |
coupled |
T2818 |
9072-9076 |
IN |
denotes |
with |
T2819 |
9077-9080 |
DT |
denotes |
the |
T2820 |
9093-9104 |
NN |
denotes |
requirement |
T2821 |
9081-9092 |
JJ |
denotes |
established |
T2822 |
9105-9108 |
IN |
denotes |
for |
T2823 |
9109-9112 |
NN |
denotes |
LEF |
T2824 |
9112-9113 |
HYPH |
denotes |
- |
T2825 |
9113-9114 |
CD |
denotes |
1 |
T2826 |
9114-9115 |
HYPH |
denotes |
/ |
T2827 |
9115-9116 |
NN |
denotes |
β |
T2828 |
9117-9124 |
NN |
denotes |
catenin |
T2829 |
9116-9117 |
HYPH |
denotes |
- |
T2830 |
9125-9127 |
IN |
denotes |
in |
T2831 |
9128-9132 |
NN |
denotes |
hair |
T2832 |
9133-9141 |
NN |
denotes |
follicle |
T2833 |
9142-9155 |
NN |
denotes |
morphogenesis |
T2834 |
9156-9157 |
-LRB- |
denotes |
[ |
T2835 |
9159-9161 |
CD |
denotes |
19 |
T2836 |
9157-9158 |
CD |
denotes |
4 |
T2837 |
9158-9159 |
, |
denotes |
, |
T2838 |
9161-9162 |
-RRB- |
denotes |
] |
T2839 |
9162-9164 |
, |
denotes |
, |
T2840 |
9164-9166 |
PRP |
denotes |
we |
T2841 |
9174-9176 |
IN |
denotes |
to |
T2842 |
9177-9187 |
VBG |
denotes |
addressing |
T2843 |
9188-9195 |
IN |
denotes |
whether |
T2844 |
9233-9244 |
VB |
denotes |
participate |
T2845 |
9196-9201 |
NN |
denotes |
Snail |
T2846 |
9202-9206 |
NN |
denotes |
Slug |
T2847 |
9201-9202 |
HYPH |
denotes |
/ |
T2848 |
9214-9221 |
NNS |
denotes |
members |
T2849 |
9207-9213 |
NN |
denotes |
family |
T2850 |
9222-9227 |
MD |
denotes |
might |
T2851 |
9228-9232 |
RB |
denotes |
also |
T2852 |
9245-9247 |
IN |
denotes |
in |
T2853 |
9248-9251 |
DT |
denotes |
the |
T2854 |
9252-9259 |
NN |
denotes |
process |
T2855 |
9259-9260 |
. |
denotes |
. |
T2856 |
9260-9415 |
sentence |
denotes |
PCR analyses identified transient Snail mRNA expression during a period of skin embryogenesis when waves of hair follicles are forming (unpublished data). |
T2857 |
9261-9264 |
NN |
denotes |
PCR |
T2858 |
9265-9273 |
NNS |
denotes |
analyses |
T2859 |
9274-9284 |
VBD |
denotes |
identified |
T2860 |
9285-9294 |
JJ |
denotes |
transient |
T2861 |
9306-9316 |
NN |
denotes |
expression |
T2862 |
9295-9300 |
NN |
denotes |
Snail |
T2863 |
9301-9305 |
NN |
denotes |
mRNA |
T2864 |
9317-9323 |
IN |
denotes |
during |
T2865 |
9324-9325 |
DT |
denotes |
a |
T2866 |
9326-9332 |
NN |
denotes |
period |
T2867 |
9333-9335 |
IN |
denotes |
of |
T2868 |
9336-9340 |
NN |
denotes |
skin |
T2869 |
9341-9354 |
NN |
denotes |
embryogenesis |
T2870 |
9355-9359 |
WRB |
denotes |
when |
T2871 |
9388-9395 |
VBG |
denotes |
forming |
T2872 |
9360-9365 |
NNS |
denotes |
waves |
T2873 |
9366-9368 |
IN |
denotes |
of |
T2874 |
9369-9373 |
NN |
denotes |
hair |
T2875 |
9374-9383 |
NNS |
denotes |
follicles |
T2876 |
9384-9387 |
VBP |
denotes |
are |
T2877 |
9396-9397 |
-LRB- |
denotes |
( |
T2878 |
9409-9413 |
NNS |
denotes |
data |
T2879 |
9397-9408 |
JJ |
denotes |
unpublished |
T2880 |
9413-9414 |
-RRB- |
denotes |
) |
T2881 |
9414-9415 |
. |
denotes |
. |
T2882 |
9415-9417 |
TO |
denotes |
To |
T2883 |
9418-9426 |
VB |
denotes |
pinpoint |
T2884 |
9415-9597 |
sentence |
denotes |
To pinpoint specifically where Snail mRNA is expressed in the developing skin, we conducted in situ hybridization using a cRNA probe unique to the Snail 3′ untranslated region (UTR). |
T2885 |
9497-9506 |
VBD |
denotes |
conducted |
T2886 |
9427-9439 |
RB |
denotes |
specifically |
T2887 |
9440-9445 |
WRB |
denotes |
where |
T2888 |
9460-9469 |
VBN |
denotes |
expressed |
T2889 |
9446-9451 |
NN |
denotes |
Snail |
T2890 |
9452-9456 |
NN |
denotes |
mRNA |
T2891 |
9457-9459 |
VBZ |
denotes |
is |
T2892 |
9470-9472 |
IN |
denotes |
in |
T2893 |
9473-9476 |
DT |
denotes |
the |
T2894 |
9488-9492 |
NN |
denotes |
skin |
T2895 |
9477-9487 |
VBG |
denotes |
developing |
T2896 |
9492-9494 |
, |
denotes |
, |
T2897 |
9494-9496 |
PRP |
denotes |
we |
T2898 |
9507-9509 |
FW |
denotes |
in |
T2899 |
9510-9514 |
FW |
denotes |
situ |
T2900 |
9515-9528 |
NN |
denotes |
hybridization |
T2901 |
9529-9534 |
VBG |
denotes |
using |
T2902 |
9535-9536 |
DT |
denotes |
a |
T2903 |
9542-9547 |
NN |
denotes |
probe |
T2904 |
9537-9541 |
NN |
denotes |
cRNA |
T2905 |
9548-9554 |
JJ |
denotes |
unique |
T2906 |
9555-9557 |
IN |
denotes |
to |
T2907 |
9558-9561 |
DT |
denotes |
the |
T2908 |
9584-9590 |
NN |
denotes |
region |
T2909 |
9562-9567 |
NNP |
denotes |
Snail |
T2910 |
9568-9569 |
CD |
denotes |
3 |
T2911 |
9569-9570 |
SYM |
denotes |
′ |
T2912 |
9571-9583 |
JJ |
denotes |
untranslated |
T2913 |
9591-9592 |
-LRB- |
denotes |
( |
T2914 |
9592-9595 |
NN |
denotes |
UTR |
T2915 |
9595-9596 |
-RRB- |
denotes |
) |
T2916 |
9596-9597 |
. |
denotes |
. |
T2917 |
9597-9786 |
sentence |
denotes |
Embryonic day 17.5 (E17.5) was chosen, since the multiple waves of follicle morphogenesis occurring at this time enabled us to evaluate Snail expression at different stages of the process. |
T2918 |
9598-9607 |
JJ |
denotes |
Embryonic |
T2919 |
9608-9611 |
NN |
denotes |
day |
T2920 |
9629-9635 |
VBN |
denotes |
chosen |
T2921 |
9612-9616 |
CD |
denotes |
17.5 |
T2922 |
9617-9618 |
-LRB- |
denotes |
( |
T2923 |
9618-9623 |
NN |
denotes |
E17.5 |
T2924 |
9623-9624 |
-RRB- |
denotes |
) |
T2925 |
9625-9628 |
VBD |
denotes |
was |
T2926 |
9635-9637 |
, |
denotes |
, |
T2927 |
9637-9642 |
IN |
denotes |
since |
T2928 |
9711-9718 |
VBD |
denotes |
enabled |
T2929 |
9643-9646 |
DT |
denotes |
the |
T2930 |
9656-9661 |
NNS |
denotes |
waves |
T2931 |
9647-9655 |
JJ |
denotes |
multiple |
T2932 |
9662-9664 |
IN |
denotes |
of |
T2933 |
9665-9673 |
NN |
denotes |
follicle |
T2934 |
9674-9687 |
NN |
denotes |
morphogenesis |
T2935 |
9688-9697 |
VBG |
denotes |
occurring |
T2936 |
9698-9700 |
IN |
denotes |
at |
T2937 |
9701-9705 |
DT |
denotes |
this |
T2938 |
9706-9710 |
NN |
denotes |
time |
T2939 |
9719-9721 |
PRP |
denotes |
us |
T2940 |
9722-9724 |
TO |
denotes |
to |
T2941 |
9725-9733 |
VB |
denotes |
evaluate |
T2942 |
9734-9739 |
NN |
denotes |
Snail |
T2943 |
9740-9750 |
NN |
denotes |
expression |
T2944 |
9751-9753 |
IN |
denotes |
at |
T2945 |
9754-9763 |
JJ |
denotes |
different |
T2946 |
9764-9770 |
NNS |
denotes |
stages |
T2947 |
9771-9773 |
IN |
denotes |
of |
T2948 |
9774-9777 |
DT |
denotes |
the |
T2949 |
9778-9785 |
NN |
denotes |
process |
T2950 |
9785-9786 |
. |
denotes |
. |
T2951 |
9786-9889 |
sentence |
denotes |
As shown in Figure 1A, specific hybridization was detected within the epithelium of nascent hair buds. |
T2952 |
9787-9789 |
IN |
denotes |
As |
T2953 |
9790-9795 |
VBN |
denotes |
shown |
T2954 |
9837-9845 |
VBN |
denotes |
detected |
T2955 |
9796-9798 |
IN |
denotes |
in |
T2956 |
9799-9805 |
NN |
denotes |
Figure |
T2957 |
9806-9808 |
NN |
denotes |
1A |
T2958 |
9808-9810 |
, |
denotes |
, |
T2959 |
9810-9818 |
JJ |
denotes |
specific |
T2960 |
9819-9832 |
NN |
denotes |
hybridization |
T2961 |
9833-9836 |
VBD |
denotes |
was |
T2962 |
9846-9852 |
IN |
denotes |
within |
T2963 |
9853-9856 |
DT |
denotes |
the |
T2964 |
9857-9867 |
NN |
denotes |
epithelium |
T2965 |
9868-9870 |
IN |
denotes |
of |
T2966 |
9871-9878 |
JJ |
denotes |
nascent |
T2967 |
9884-9888 |
NNS |
denotes |
buds |
T2968 |
9879-9883 |
NN |
denotes |
hair |
T2969 |
9888-9889 |
. |
denotes |
. |
T2970 |
9889-10043 |
sentence |
denotes |
By contrast, as follicles progressed further through their development (e.g., germ and peg stages), they exhibited no signs of hybridization (Figure 1A). |
T2971 |
9890-9892 |
IN |
denotes |
By |
T2972 |
9995-10004 |
VBD |
denotes |
exhibited |
T2973 |
9893-9901 |
NN |
denotes |
contrast |
T2974 |
9901-9903 |
, |
denotes |
, |
T2975 |
9903-9905 |
IN |
denotes |
as |
T2976 |
9916-9926 |
VBD |
denotes |
progressed |
T2977 |
9906-9915 |
NNS |
denotes |
follicles |
T2978 |
9927-9934 |
RBR |
denotes |
further |
T2979 |
9935-9942 |
IN |
denotes |
through |
T2980 |
9943-9948 |
PRP$ |
denotes |
their |
T2981 |
9949-9960 |
NN |
denotes |
development |
T2982 |
9961-9962 |
-LRB- |
denotes |
( |
T2983 |
9981-9987 |
NNS |
denotes |
stages |
T2984 |
9962-9966 |
FW |
denotes |
e.g. |
T2985 |
9966-9968 |
, |
denotes |
, |
T2986 |
9968-9972 |
NN |
denotes |
germ |
T2987 |
9973-9976 |
CC |
denotes |
and |
T2988 |
9977-9980 |
NN |
denotes |
peg |
T2989 |
9987-9988 |
-RRB- |
denotes |
) |
T2990 |
9988-9990 |
, |
denotes |
, |
T2991 |
9990-9994 |
PRP |
denotes |
they |
T2992 |
10005-10007 |
DT |
denotes |
no |
T2993 |
10008-10013 |
NNS |
denotes |
signs |
T2994 |
10014-10016 |
IN |
denotes |
of |
T2995 |
10017-10030 |
NN |
denotes |
hybridization |
T2996 |
10031-10032 |
-LRB- |
denotes |
( |
T2997 |
10039-10041 |
NN |
denotes |
1A |
T2998 |
10032-10038 |
NN |
denotes |
Figure |
T2999 |
10041-10042 |
-RRB- |
denotes |
) |
T3000 |
10042-10043 |
. |
denotes |
. |
T3001 |
10043-10250 |
sentence |
denotes |
The transient nature of Snail mRNA expression during follicle development was most apparent in hybridized skin sections containing follicles from two different waves of morphogenesis (as shown in Figure 1). |
T3002 |
10044-10047 |
DT |
denotes |
The |
T3003 |
10058-10064 |
NN |
denotes |
nature |
T3004 |
10048-10057 |
JJ |
denotes |
transient |
T3005 |
10118-10121 |
VBD |
denotes |
was |
T3006 |
10065-10067 |
IN |
denotes |
of |
T3007 |
10068-10073 |
NN |
denotes |
Snail |
T3008 |
10079-10089 |
NN |
denotes |
expression |
T3009 |
10074-10078 |
NN |
denotes |
mRNA |
T3010 |
10090-10096 |
IN |
denotes |
during |
T3011 |
10097-10105 |
NN |
denotes |
follicle |
T3012 |
10106-10117 |
NN |
denotes |
development |
T3013 |
10122-10126 |
RBS |
denotes |
most |
T3014 |
10127-10135 |
JJ |
denotes |
apparent |
T3015 |
10136-10138 |
IN |
denotes |
in |
T3016 |
10139-10149 |
VBN |
denotes |
hybridized |
T3017 |
10155-10163 |
NNS |
denotes |
sections |
T3018 |
10150-10154 |
NN |
denotes |
skin |
T3019 |
10164-10174 |
VBG |
denotes |
containing |
T3020 |
10175-10184 |
NNS |
denotes |
follicles |
T3021 |
10185-10189 |
IN |
denotes |
from |
T3022 |
10190-10193 |
CD |
denotes |
two |
T3023 |
10204-10209 |
NNS |
denotes |
waves |
T3024 |
10194-10203 |
JJ |
denotes |
different |
T3025 |
10210-10212 |
IN |
denotes |
of |
T3026 |
10213-10226 |
NN |
denotes |
morphogenesis |
T3027 |
10227-10228 |
-LRB- |
denotes |
( |
T3028 |
10231-10236 |
VBN |
denotes |
shown |
T3029 |
10228-10230 |
IN |
denotes |
as |
T3030 |
10237-10239 |
IN |
denotes |
in |
T3031 |
10240-10246 |
NN |
denotes |
Figure |
T3032 |
10247-10248 |
CD |
denotes |
1 |
T3033 |
10248-10249 |
-RRB- |
denotes |
) |
T3034 |
10249-10250 |
. |
denotes |
. |
T3035 |
10250-10362 |
sentence |
denotes |
Hybridizing hair buds from a later wave appeared juxtaposed with nonhybridizing follicles from an earlier wave. |
T3036 |
10251-10262 |
VBG |
denotes |
Hybridizing |
T3037 |
10268-10272 |
NNS |
denotes |
buds |
T3038 |
10263-10267 |
NN |
denotes |
hair |
T3039 |
10291-10299 |
VBD |
denotes |
appeared |
T3040 |
10273-10277 |
IN |
denotes |
from |
T3041 |
10278-10279 |
DT |
denotes |
a |
T3042 |
10286-10290 |
NN |
denotes |
wave |
T3043 |
10280-10285 |
JJ |
denotes |
later |
T3044 |
10300-10310 |
JJ |
denotes |
juxtaposed |
T3045 |
10311-10315 |
IN |
denotes |
with |
T3046 |
10316-10330 |
JJ |
denotes |
nonhybridizing |
T3047 |
10331-10340 |
NNS |
denotes |
follicles |
T3048 |
10341-10345 |
IN |
denotes |
from |
T3049 |
10346-10348 |
DT |
denotes |
an |
T3050 |
10357-10361 |
NN |
denotes |
wave |
T3051 |
10349-10356 |
JJR |
denotes |
earlier |
T3052 |
10361-10362 |
. |
denotes |
. |
T3053 |
10362-12983 |
sentence |
denotes |
Figure 1 Snail Is Expressed Exclusively in the Hair Bud during Morphogenesis
Embryos were either frozen in OCT embedding compound (A, F, and H) or embedded in paraffin (C, D, E, and G), and then sectioned (8 μm).
(A) In situ hybridizations with Snail sense or antisense cRNA probes. Black dotted lines demarcate the basement membrane that separates the epidermis (epi) from dermis (der). Arrows point to Snail RNA expression, restricted to the hair bud stage of follicle morphogenesis. It was not seen in later hair germ or peg stages.
(B) Expression of Snail protein coincides with hair development. Protein extracts were prepared from keratinocytes transfected with empty expression vector (K14), containing the K14 promoter or with the vector driving HA-tagged Snail (K14-Snail); or from whole skin from E13.5 to P5 animals, including newborn (nb). Equal amounts of proteins were then resolved by SDS-PAGE through 12% gels and subjected to Western blotting using either an affinity-purified Snail polyclonal antiserum, which we generated, or anti-tubulin (loading control).
(C–E) Immunohistochemistry shows expression of Snail protein in the nuclei of cells within the hair and skin. (C) E13.5 skin with a single layered epidermis (epi) shows no Snail expression. (D) The first morphological sign that cells have adopted a hair follicle fate is a cluster of cells called a placode in E16.5 skin. Snail is not expressed at this stage of development. (E) Snail is expressed in the hair bud of E17.5 skin but not in later stages of development such as the germ or peg.
(F) Immunofluorescence with anti-Ki67 (green) identifies the proliferating cells of the skin, restricted to the basal layer of the epidermis and developing hair follicles. Anti-β4 int labeling reveals the presence of the hemidesmosomal integrin β4, restricted to the base of cells adhering to the underlying basement membrane. The white dotted line marks the outermost surface of the skin.
(G) Immunohistochemistry with pMAPK marks a subset of proliferating cells within the epidermis and hair bud. Anti-pMAPK labeling was consistently robust within the hair bud.
(H) Immunofluorescence with anti-laminin 5 (lam5), which demarcates the basement membrane, and anti-E-cadherin (E-cad), a component of AJs. At the leading edge of the growing bud, cell-cell borders show markedly diminished anti-E-cadherin labeling (arrowheads). To determine whether this transient nature of Snail mRNA expression is reflected at the protein level, we generated an antibody against the N-terminal sequence that resides upstream of the more conserved zinc finger domains. |
T3054 |
12759-12761 |
TO |
denotes |
To |
T3055 |
12762-12771 |
VB |
denotes |
determine |
T3056 |
12865-12874 |
VBD |
denotes |
generated |
T3057 |
12772-12779 |
IN |
denotes |
whether |
T3058 |
12830-12839 |
VBN |
denotes |
reflected |
T3059 |
12780-12784 |
DT |
denotes |
this |
T3060 |
12795-12801 |
NN |
denotes |
nature |
T3061 |
12785-12794 |
JJ |
denotes |
transient |
T3062 |
12802-12804 |
IN |
denotes |
of |
T3063 |
12805-12810 |
NN |
denotes |
Snail |
T3064 |
12816-12826 |
NN |
denotes |
expression |
T3065 |
12811-12815 |
NN |
denotes |
mRNA |
T3066 |
12827-12829 |
VBZ |
denotes |
is |
T3067 |
12840-12842 |
IN |
denotes |
at |
T3068 |
12843-12846 |
DT |
denotes |
the |
T3069 |
12855-12860 |
NN |
denotes |
level |
T3070 |
12847-12854 |
NN |
denotes |
protein |
T3071 |
12860-12862 |
, |
denotes |
, |
T3072 |
12862-12864 |
PRP |
denotes |
we |
T3073 |
12875-12877 |
DT |
denotes |
an |
T3074 |
12878-12886 |
NN |
denotes |
antibody |
T3075 |
12887-12894 |
IN |
denotes |
against |
T3076 |
12895-12898 |
DT |
denotes |
the |
T3077 |
12910-12918 |
NN |
denotes |
sequence |
T3078 |
12899-12900 |
NN |
denotes |
N |
T3079 |
12901-12909 |
JJ |
denotes |
terminal |
T3080 |
12900-12901 |
HYPH |
denotes |
- |
T3081 |
12919-12923 |
WDT |
denotes |
that |
T3082 |
12924-12931 |
VBZ |
denotes |
resides |
T3083 |
12932-12940 |
RB |
denotes |
upstream |
T3084 |
12941-12943 |
IN |
denotes |
of |
T3085 |
12944-12947 |
DT |
denotes |
the |
T3086 |
12975-12982 |
NNS |
denotes |
domains |
T3087 |
12948-12952 |
RBR |
denotes |
more |
T3088 |
12953-12962 |
VBN |
denotes |
conserved |
T3089 |
12963-12967 |
NN |
denotes |
zinc |
T3090 |
12968-12974 |
NN |
denotes |
finger |
T3091 |
12982-12983 |
. |
denotes |
. |
T3092 |
12983-13238 |
sentence |
denotes |
As judged by Western blot analysis, the antibody did not detect endogenous proteins from cultured keratinocytes, but it did yield a band of the expected size from keratinocytes transiently expressing a hemagglutinin (HA)-tagged Snail protein (Figure 1B). |
T3093 |
12984-12986 |
IN |
denotes |
As |
T3094 |
12987-12993 |
VBN |
denotes |
judged |
T3095 |
13041-13047 |
VB |
denotes |
detect |
T3096 |
12994-12996 |
IN |
denotes |
by |
T3097 |
12997-13004 |
NNP |
denotes |
Western |
T3098 |
13005-13009 |
NN |
denotes |
blot |
T3099 |
13010-13018 |
NN |
denotes |
analysis |
T3100 |
13018-13020 |
, |
denotes |
, |
T3101 |
13020-13023 |
DT |
denotes |
the |
T3102 |
13024-13032 |
NN |
denotes |
antibody |
T3103 |
13033-13036 |
VBD |
denotes |
did |
T3104 |
13037-13040 |
RB |
denotes |
not |
T3105 |
13048-13058 |
JJ |
denotes |
endogenous |
T3106 |
13059-13067 |
NN |
denotes |
proteins |
T3107 |
13068-13072 |
IN |
denotes |
from |
T3108 |
13073-13081 |
VBN |
denotes |
cultured |
T3109 |
13082-13095 |
NNS |
denotes |
keratinocytes |
T3110 |
13095-13097 |
, |
denotes |
, |
T3111 |
13097-13100 |
CC |
denotes |
but |
T3112 |
13101-13103 |
PRP |
denotes |
it |
T3113 |
13108-13113 |
VB |
denotes |
yield |
T3114 |
13104-13107 |
VBD |
denotes |
did |
T3115 |
13114-13115 |
DT |
denotes |
a |
T3116 |
13116-13120 |
NN |
denotes |
band |
T3117 |
13121-13123 |
IN |
denotes |
of |
T3118 |
13124-13127 |
DT |
denotes |
the |
T3119 |
13137-13141 |
NN |
denotes |
size |
T3120 |
13128-13136 |
VBN |
denotes |
expected |
T3121 |
13142-13146 |
IN |
denotes |
from |
T3122 |
13147-13160 |
NNS |
denotes |
keratinocytes |
T3123 |
13161-13172 |
RB |
denotes |
transiently |
T3124 |
13173-13183 |
VBG |
denotes |
expressing |
T3125 |
13184-13185 |
DT |
denotes |
a |
T3126 |
13218-13225 |
NN |
denotes |
protein |
T3127 |
13186-13199 |
NN |
denotes |
hemagglutinin |
T3128 |
13205-13211 |
VBN |
denotes |
tagged |
T3129 |
13200-13201 |
-LRB- |
denotes |
( |
T3130 |
13201-13203 |
NN |
denotes |
HA |
T3131 |
13203-13204 |
-RRB- |
denotes |
) |
T3132 |
13204-13205 |
HYPH |
denotes |
- |
T3133 |
13212-13217 |
NN |
denotes |
Snail |
T3134 |
13226-13227 |
-LRB- |
denotes |
( |
T3135 |
13234-13236 |
NN |
denotes |
1B |
T3136 |
13227-13233 |
NN |
denotes |
Figure |
T3137 |
13236-13237 |
-RRB- |
denotes |
) |
T3138 |
13237-13238 |
. |
denotes |
. |
T3139 |
13238-13555 |
sentence |
denotes |
The antibody also recognized a band corresponding to the size of endogenous Snail (approximately 28 kDa) in lysates from embryonic mouse skin, the temporal appearance of which corresponded to the waves of hair follicle morphogenesis from E15.5 to newborn when over 90% of the hair on the mouse is formed (Figure 1B). |
T3140 |
13239-13242 |
DT |
denotes |
The |
T3141 |
13243-13251 |
NN |
denotes |
antibody |
T3142 |
13257-13267 |
VBD |
denotes |
recognized |
T3143 |
13252-13256 |
RB |
denotes |
also |
T3144 |
13268-13269 |
DT |
denotes |
a |
T3145 |
13270-13274 |
NN |
denotes |
band |
T3146 |
13275-13288 |
VBG |
denotes |
corresponding |
T3147 |
13289-13291 |
IN |
denotes |
to |
T3148 |
13292-13295 |
DT |
denotes |
the |
T3149 |
13296-13300 |
NN |
denotes |
size |
T3150 |
13301-13303 |
IN |
denotes |
of |
T3151 |
13304-13314 |
JJ |
denotes |
endogenous |
T3152 |
13315-13320 |
NN |
denotes |
Snail |
T3153 |
13321-13322 |
-LRB- |
denotes |
( |
T3154 |
13322-13335 |
RB |
denotes |
approximately |
T3155 |
13336-13338 |
CD |
denotes |
28 |
T3156 |
13339-13342 |
NN |
denotes |
kDa |
T3157 |
13342-13343 |
-RRB- |
denotes |
) |
T3158 |
13344-13346 |
IN |
denotes |
in |
T3159 |
13347-13354 |
NNS |
denotes |
lysates |
T3160 |
13355-13359 |
IN |
denotes |
from |
T3161 |
13360-13369 |
JJ |
denotes |
embryonic |
T3162 |
13376-13380 |
NN |
denotes |
skin |
T3163 |
13370-13375 |
NN |
denotes |
mouse |
T3164 |
13380-13382 |
, |
denotes |
, |
T3165 |
13382-13385 |
DT |
denotes |
the |
T3166 |
13395-13405 |
NN |
denotes |
appearance |
T3167 |
13386-13394 |
JJ |
denotes |
temporal |
T3168 |
13415-13427 |
VBD |
denotes |
corresponded |
T3169 |
13406-13408 |
IN |
denotes |
of |
T3170 |
13409-13414 |
WDT |
denotes |
which |
T3171 |
13428-13430 |
IN |
denotes |
to |
T3172 |
13431-13434 |
DT |
denotes |
the |
T3173 |
13435-13440 |
NNS |
denotes |
waves |
T3174 |
13441-13443 |
IN |
denotes |
of |
T3175 |
13444-13448 |
NN |
denotes |
hair |
T3176 |
13449-13457 |
NN |
denotes |
follicle |
T3177 |
13458-13471 |
NN |
denotes |
morphogenesis |
T3178 |
13472-13476 |
IN |
denotes |
from |
T3179 |
13477-13482 |
NN |
denotes |
E15.5 |
T3180 |
13483-13485 |
IN |
denotes |
to |
T3181 |
13486-13493 |
JJ |
denotes |
newborn |
T3182 |
13494-13498 |
WRB |
denotes |
when |
T3183 |
13536-13542 |
VBN |
denotes |
formed |
T3184 |
13499-13503 |
IN |
denotes |
over |
T3185 |
13504-13506 |
CD |
denotes |
90 |
T3186 |
13506-13507 |
NN |
denotes |
% |
T3187 |
13508-13510 |
IN |
denotes |
of |
T3188 |
13511-13514 |
DT |
denotes |
the |
T3189 |
13515-13519 |
NN |
denotes |
hair |
T3190 |
13520-13522 |
IN |
denotes |
on |
T3191 |
13523-13526 |
DT |
denotes |
the |
T3192 |
13527-13532 |
NN |
denotes |
mouse |
T3193 |
13533-13535 |
VBZ |
denotes |
is |
T3194 |
13543-13544 |
-LRB- |
denotes |
( |
T3195 |
13551-13553 |
NN |
denotes |
1B |
T3196 |
13544-13550 |
NN |
denotes |
Figure |
T3197 |
13553-13554 |
-RRB- |
denotes |
) |
T3198 |
13554-13555 |
. |
denotes |
. |
T3199 |
13555-13849 |
sentence |
denotes |
Consistent with the Western blot data, immunohistochemical analysis did not detect Snail in single-layered E13.5 epidermis (Figure 1C) nor in the placode, which is the earliest morphological sign of the commitment of multipotent cells of the embryonic ectoderm to a hair cell fate (Figure 1D). |
T3200 |
13556-13566 |
JJ |
denotes |
Consistent |
T3201 |
13632-13638 |
VB |
denotes |
detect |
T3202 |
13567-13571 |
IN |
denotes |
with |
T3203 |
13572-13575 |
DT |
denotes |
the |
T3204 |
13589-13593 |
NNS |
denotes |
data |
T3205 |
13576-13583 |
NNP |
denotes |
Western |
T3206 |
13584-13588 |
NN |
denotes |
blot |
T3207 |
13593-13595 |
, |
denotes |
, |
T3208 |
13595-13614 |
JJ |
denotes |
immunohistochemical |
T3209 |
13615-13623 |
NN |
denotes |
analysis |
T3210 |
13624-13627 |
VBD |
denotes |
did |
T3211 |
13628-13631 |
RB |
denotes |
not |
T3212 |
13639-13644 |
NN |
denotes |
Snail |
T3213 |
13645-13647 |
IN |
denotes |
in |
T3214 |
13648-13654 |
JJ |
denotes |
single |
T3215 |
13655-13662 |
JJ |
denotes |
layered |
T3216 |
13654-13655 |
HYPH |
denotes |
- |
T3217 |
13669-13678 |
NN |
denotes |
epidermis |
T3218 |
13663-13668 |
NN |
denotes |
E13.5 |
T3219 |
13679-13680 |
-LRB- |
denotes |
( |
T3220 |
13687-13689 |
NN |
denotes |
1C |
T3221 |
13680-13686 |
NN |
denotes |
Figure |
T3222 |
13689-13690 |
-RRB- |
denotes |
) |
T3223 |
13691-13694 |
CC |
denotes |
nor |
T3224 |
13695-13697 |
IN |
denotes |
in |
T3225 |
13698-13701 |
DT |
denotes |
the |
T3226 |
13702-13709 |
NN |
denotes |
placode |
T3227 |
13709-13711 |
, |
denotes |
, |
T3228 |
13711-13716 |
WDT |
denotes |
which |
T3229 |
13717-13719 |
VBZ |
denotes |
is |
T3230 |
13720-13723 |
DT |
denotes |
the |
T3231 |
13747-13751 |
NN |
denotes |
sign |
T3232 |
13724-13732 |
JJS |
denotes |
earliest |
T3233 |
13733-13746 |
JJ |
denotes |
morphological |
T3234 |
13752-13754 |
IN |
denotes |
of |
T3235 |
13755-13758 |
DT |
denotes |
the |
T3236 |
13759-13769 |
NN |
denotes |
commitment |
T3237 |
13770-13772 |
IN |
denotes |
of |
T3238 |
13773-13784 |
JJ |
denotes |
multipotent |
T3239 |
13785-13790 |
NNS |
denotes |
cells |
T3240 |
13791-13793 |
IN |
denotes |
of |
T3241 |
13794-13797 |
DT |
denotes |
the |
T3242 |
13808-13816 |
NN |
denotes |
ectoderm |
T3243 |
13798-13807 |
JJ |
denotes |
embryonic |
T3244 |
13817-13819 |
IN |
denotes |
to |
T3245 |
13820-13821 |
DT |
denotes |
a |
T3246 |
13832-13836 |
NN |
denotes |
fate |
T3247 |
13822-13826 |
NN |
denotes |
hair |
T3248 |
13827-13831 |
NN |
denotes |
cell |
T3249 |
13837-13838 |
-LRB- |
denotes |
( |
T3250 |
13845-13847 |
NN |
denotes |
1D |
T3251 |
13838-13844 |
NN |
denotes |
Figure |
T3252 |
13847-13848 |
-RRB- |
denotes |
) |
T3253 |
13848-13849 |
. |
denotes |
. |
T3254 |
13849-14011 |
sentence |
denotes |
Consistent with the in situ hybridization results, anti-Snail antibody labeled only hair buds and not follicles at more mature stages of development (Figure 1E). |
T3255 |
13850-13860 |
JJ |
denotes |
Consistent |
T3256 |
13921-13928 |
VBD |
denotes |
labeled |
T3257 |
13861-13865 |
IN |
denotes |
with |
T3258 |
13866-13869 |
DT |
denotes |
the |
T3259 |
13892-13899 |
NNS |
denotes |
results |
T3260 |
13870-13872 |
FW |
denotes |
in |
T3261 |
13873-13877 |
FW |
denotes |
situ |
T3262 |
13878-13891 |
NN |
denotes |
hybridization |
T3263 |
13899-13901 |
, |
denotes |
, |
T3264 |
13901-13911 |
JJ |
denotes |
anti-Snail |
T3265 |
13912-13920 |
NN |
denotes |
antibody |
T3266 |
13929-13933 |
RB |
denotes |
only |
T3267 |
13939-13943 |
NNS |
denotes |
buds |
T3268 |
13934-13938 |
NN |
denotes |
hair |
T3269 |
13944-13947 |
CC |
denotes |
and |
T3270 |
13948-13951 |
RB |
denotes |
not |
T3271 |
13952-13961 |
NNS |
denotes |
follicles |
T3272 |
13962-13964 |
IN |
denotes |
at |
T3273 |
13965-13969 |
RBR |
denotes |
more |
T3274 |
13977-13983 |
NNS |
denotes |
stages |
T3275 |
13970-13976 |
JJ |
denotes |
mature |
T3276 |
13984-13986 |
IN |
denotes |
of |
T3277 |
13987-13998 |
NN |
denotes |
development |
T3278 |
13999-14000 |
-LRB- |
denotes |
( |
T3279 |
14007-14009 |
NN |
denotes |
1E |
T3280 |
14000-14006 |
NN |
denotes |
Figure |
T3281 |
14009-14010 |
-RRB- |
denotes |
) |
T3282 |
14010-14011 |
. |
denotes |
. |
T3283 |
14011-14099 |
sentence |
denotes |
Taken together, the anti-Snail antibody appeared to be specific for its target protein. |
T3284 |
14012-14017 |
VBN |
denotes |
Taken |
T3285 |
14052-14060 |
VBD |
denotes |
appeared |
T3286 |
14018-14026 |
RB |
denotes |
together |
T3287 |
14026-14028 |
, |
denotes |
, |
T3288 |
14028-14031 |
DT |
denotes |
the |
T3289 |
14043-14051 |
NN |
denotes |
antibody |
T3290 |
14032-14042 |
JJ |
denotes |
anti-Snail |
T3291 |
14061-14063 |
TO |
denotes |
to |
T3292 |
14064-14066 |
VB |
denotes |
be |
T3293 |
14067-14075 |
JJ |
denotes |
specific |
T3294 |
14076-14079 |
IN |
denotes |
for |
T3295 |
14080-14083 |
PRP$ |
denotes |
its |
T3296 |
14091-14098 |
NN |
denotes |
protein |
T3297 |
14084-14090 |
NN |
denotes |
target |
T3298 |
14098-14099 |
. |
denotes |
. |
T3299 |
14099-14215 |
sentence |
denotes |
It did not detect other Snail family members known to be expressed in keratinocytes and/or skin (unpublished data). |
T3300 |
14100-14102 |
PRP |
denotes |
It |
T3301 |
14111-14117 |
VB |
denotes |
detect |
T3302 |
14103-14106 |
VBD |
denotes |
did |
T3303 |
14107-14110 |
RB |
denotes |
not |
T3304 |
14118-14123 |
JJ |
denotes |
other |
T3305 |
14137-14144 |
NNS |
denotes |
members |
T3306 |
14124-14129 |
NN |
denotes |
Snail |
T3307 |
14130-14136 |
NN |
denotes |
family |
T3308 |
14145-14150 |
VBN |
denotes |
known |
T3309 |
14151-14153 |
TO |
denotes |
to |
T3310 |
14157-14166 |
VBN |
denotes |
expressed |
T3311 |
14154-14156 |
VB |
denotes |
be |
T3312 |
14167-14169 |
IN |
denotes |
in |
T3313 |
14170-14183 |
NNS |
denotes |
keratinocytes |
T3314 |
14184-14187 |
CC |
denotes |
and |
T3315 |
14187-14188 |
HYPH |
denotes |
/ |
T3316 |
14188-14190 |
CC |
denotes |
or |
T3317 |
14191-14195 |
NN |
denotes |
skin |
T3318 |
14196-14197 |
-LRB- |
denotes |
( |
T3319 |
14209-14213 |
NNS |
denotes |
data |
T3320 |
14197-14208 |
JJ |
denotes |
unpublished |
T3321 |
14213-14214 |
-RRB- |
denotes |
) |
T3322 |
14214-14215 |
. |
denotes |
. |
T3323 |
14215-14377 |
sentence |
denotes |
Furthermore, the immunohistochemical data paralleled our Snail in situ hybridization data revealing transient Snail expression at the hair bud stage (Figure 1A). |
T3324 |
14216-14227 |
RB |
denotes |
Furthermore |
T3325 |
14258-14268 |
VBD |
denotes |
paralleled |
T3326 |
14227-14229 |
, |
denotes |
, |
T3327 |
14229-14232 |
DT |
denotes |
the |
T3328 |
14253-14257 |
NNS |
denotes |
data |
T3329 |
14233-14252 |
JJ |
denotes |
immunohistochemical |
T3330 |
14269-14272 |
PRP$ |
denotes |
our |
T3331 |
14301-14305 |
NNS |
denotes |
data |
T3332 |
14273-14278 |
NN |
denotes |
Snail |
T3333 |
14287-14300 |
NN |
denotes |
hybridization |
T3334 |
14279-14281 |
FW |
denotes |
in |
T3335 |
14282-14286 |
FW |
denotes |
situ |
T3336 |
14306-14315 |
VBG |
denotes |
revealing |
T3337 |
14316-14325 |
JJ |
denotes |
transient |
T3338 |
14332-14342 |
NN |
denotes |
expression |
T3339 |
14326-14331 |
NN |
denotes |
Snail |
T3340 |
14343-14345 |
IN |
denotes |
at |
T3341 |
14346-14349 |
DT |
denotes |
the |
T3342 |
14359-14364 |
NN |
denotes |
stage |
T3343 |
14350-14354 |
NN |
denotes |
hair |
T3344 |
14355-14358 |
NN |
denotes |
bud |
T3345 |
14365-14366 |
-LRB- |
denotes |
( |
T3346 |
14373-14375 |
NN |
denotes |
1A |
T3347 |
14366-14372 |
NN |
denotes |
Figure |
T3348 |
14375-14376 |
-RRB- |
denotes |
) |
T3349 |
14376-14377 |
. |
denotes |
. |
T3350 |
14377-14489 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was localized to the nuclei of the hair bud cells (Figure 1E). |
T3351 |
14378-14380 |
IN |
denotes |
As |
T3352 |
14381-14387 |
VBN |
denotes |
judged |
T3353 |
14431-14440 |
VBN |
denotes |
localized |
T3354 |
14388-14390 |
IN |
denotes |
by |
T3355 |
14391-14411 |
NN |
denotes |
immunohistochemistry |
T3356 |
14411-14413 |
, |
denotes |
, |
T3357 |
14413-14418 |
NN |
denotes |
Snail |
T3358 |
14419-14426 |
NN |
denotes |
protein |
T3359 |
14427-14430 |
VBD |
denotes |
was |
T3360 |
14441-14443 |
IN |
denotes |
to |
T3361 |
14444-14447 |
DT |
denotes |
the |
T3362 |
14448-14454 |
NNS |
denotes |
nuclei |
T3363 |
14455-14457 |
IN |
denotes |
of |
T3364 |
14458-14461 |
DT |
denotes |
the |
T3365 |
14471-14476 |
NNS |
denotes |
cells |
T3366 |
14462-14466 |
NN |
denotes |
hair |
T3367 |
14467-14470 |
NN |
denotes |
bud |
T3368 |
14477-14478 |
-LRB- |
denotes |
( |
T3369 |
14485-14487 |
NN |
denotes |
1E |
T3370 |
14478-14484 |
NN |
denotes |
Figure |
T3371 |
14487-14488 |
-RRB- |
denotes |
) |
T3372 |
14488-14489 |
. |
denotes |
. |
T3373 |
14489-14585 |
sentence |
denotes |
This feature was consistent with Snail's known function as a transcriptional repressor [12,13]. |
T3374 |
14490-14494 |
DT |
denotes |
This |
T3375 |
14495-14502 |
NN |
denotes |
feature |
T3376 |
14503-14506 |
VBD |
denotes |
was |
T3377 |
14507-14517 |
JJ |
denotes |
consistent |
T3378 |
14518-14522 |
IN |
denotes |
with |
T3379 |
14523-14528 |
NN |
denotes |
Snail |
T3380 |
14537-14545 |
NN |
denotes |
function |
T3381 |
14528-14530 |
POS |
denotes |
's |
T3382 |
14531-14536 |
VBN |
denotes |
known |
T3383 |
14546-14548 |
IN |
denotes |
as |
T3384 |
14549-14550 |
DT |
denotes |
a |
T3385 |
14567-14576 |
NN |
denotes |
repressor |
T3386 |
14551-14566 |
JJ |
denotes |
transcriptional |
T3387 |
14577-14578 |
-LRB- |
denotes |
[ |
T3388 |
14581-14583 |
CD |
denotes |
13 |
T3389 |
14578-14580 |
CD |
denotes |
12 |
T3390 |
14580-14581 |
, |
denotes |
, |
T3391 |
14583-14584 |
-RRB- |
denotes |
] |
T3392 |
14584-14585 |
. |
denotes |
. |
T3393 |
14585-14697 |
sentence |
denotes |
Additionally, anti-Snail labeling was detected in only three of the four major waves of follicle morphogenesis. |
T3394 |
14586-14598 |
RB |
denotes |
Additionally |
T3395 |
14624-14632 |
VBN |
denotes |
detected |
T3396 |
14598-14600 |
, |
denotes |
, |
T3397 |
14600-14610 |
JJ |
denotes |
anti-Snail |
T3398 |
14611-14619 |
NN |
denotes |
labeling |
T3399 |
14620-14623 |
VBD |
denotes |
was |
T3400 |
14633-14635 |
IN |
denotes |
in |
T3401 |
14636-14640 |
RB |
denotes |
only |
T3402 |
14654-14658 |
CD |
denotes |
four |
T3403 |
14641-14646 |
CD |
denotes |
three |
T3404 |
14647-14649 |
IN |
denotes |
of |
T3405 |
14650-14653 |
DT |
denotes |
the |
T3406 |
14665-14670 |
NNS |
denotes |
waves |
T3407 |
14659-14664 |
JJ |
denotes |
major |
T3408 |
14671-14673 |
IN |
denotes |
of |
T3409 |
14674-14682 |
NN |
denotes |
follicle |
T3410 |
14683-14696 |
NN |
denotes |
morphogenesis |
T3411 |
14696-14697 |
. |
denotes |
. |
T3412 |
14697-14871 |
sentence |
denotes |
Snail was not found in the buds of guard hairs that are the earliest of all hairs to form (at E13.5), and which constitute less than 5% of the mouse coat (unpublished data). |
T3413 |
14698-14703 |
NN |
denotes |
Snail |
T3414 |
14712-14717 |
VBN |
denotes |
found |
T3415 |
14704-14707 |
VBD |
denotes |
was |
T3416 |
14708-14711 |
RB |
denotes |
not |
T3417 |
14718-14720 |
IN |
denotes |
in |
T3418 |
14721-14724 |
DT |
denotes |
the |
T3419 |
14725-14729 |
NNS |
denotes |
buds |
T3420 |
14730-14732 |
IN |
denotes |
of |
T3421 |
14733-14738 |
NN |
denotes |
guard |
T3422 |
14739-14744 |
NNS |
denotes |
hairs |
T3423 |
14745-14749 |
WDT |
denotes |
that |
T3424 |
14750-14753 |
VBP |
denotes |
are |
T3425 |
14754-14757 |
DT |
denotes |
the |
T3426 |
14758-14766 |
JJS |
denotes |
earliest |
T3427 |
14767-14769 |
IN |
denotes |
of |
T3428 |
14770-14773 |
DT |
denotes |
all |
T3429 |
14774-14779 |
NNS |
denotes |
hairs |
T3430 |
14780-14782 |
TO |
denotes |
to |
T3431 |
14783-14787 |
VB |
denotes |
form |
T3432 |
14788-14789 |
-LRB- |
denotes |
( |
T3433 |
14789-14791 |
IN |
denotes |
at |
T3434 |
14792-14797 |
NN |
denotes |
E13.5 |
T3435 |
14797-14798 |
-RRB- |
denotes |
) |
T3436 |
14798-14800 |
, |
denotes |
, |
T3437 |
14800-14803 |
CC |
denotes |
and |
T3438 |
14804-14809 |
WDT |
denotes |
which |
T3439 |
14810-14820 |
VBP |
denotes |
constitute |
T3440 |
14821-14825 |
JJR |
denotes |
less |
T3441 |
14831-14832 |
CD |
denotes |
5 |
T3442 |
14826-14830 |
IN |
denotes |
than |
T3443 |
14832-14833 |
NN |
denotes |
% |
T3444 |
14834-14836 |
IN |
denotes |
of |
T3445 |
14837-14840 |
DT |
denotes |
the |
T3446 |
14847-14851 |
NN |
denotes |
coat |
T3447 |
14841-14846 |
NN |
denotes |
mouse |
T3448 |
14852-14853 |
-LRB- |
denotes |
( |
T3449 |
14865-14869 |
NNS |
denotes |
data |
T3450 |
14853-14864 |
JJ |
denotes |
unpublished |
T3451 |
14869-14870 |
-RRB- |
denotes |
) |
T3452 |
14870-14871 |
. |
denotes |
. |
T3453 |
14871-15112 |
sentence |
denotes |
As judged by immunofluorescence with antibodies against the proliferating nuclear antigen Ki67, the timing of Snail expression coincided with the stage at which the developing follicle enhanced its proliferation and down-growth (Figure 1F). |
T3454 |
14872-14874 |
IN |
denotes |
As |
T3455 |
14875-14881 |
VBN |
denotes |
judged |
T3456 |
14999-15008 |
VBD |
denotes |
coincided |
T3457 |
14882-14884 |
IN |
denotes |
by |
T3458 |
14885-14903 |
NN |
denotes |
immunofluorescence |
T3459 |
14904-14908 |
IN |
denotes |
with |
T3460 |
14909-14919 |
NNS |
denotes |
antibodies |
T3461 |
14920-14927 |
IN |
denotes |
against |
T3462 |
14928-14931 |
DT |
denotes |
the |
T3463 |
14954-14961 |
NN |
denotes |
antigen |
T3464 |
14932-14945 |
VBG |
denotes |
proliferating |
T3465 |
14946-14953 |
JJ |
denotes |
nuclear |
T3466 |
14962-14966 |
NN |
denotes |
Ki67 |
T3467 |
14966-14968 |
, |
denotes |
, |
T3468 |
14968-14971 |
DT |
denotes |
the |
T3469 |
14972-14978 |
NN |
denotes |
timing |
T3470 |
14979-14981 |
IN |
denotes |
of |
T3471 |
14982-14987 |
NN |
denotes |
Snail |
T3472 |
14988-14998 |
NN |
denotes |
expression |
T3473 |
15009-15013 |
IN |
denotes |
with |
T3474 |
15014-15017 |
DT |
denotes |
the |
T3475 |
15018-15023 |
NN |
denotes |
stage |
T3476 |
15024-15026 |
IN |
denotes |
at |
T3477 |
15057-15065 |
VBD |
denotes |
enhanced |
T3478 |
15027-15032 |
WDT |
denotes |
which |
T3479 |
15033-15036 |
DT |
denotes |
the |
T3480 |
15048-15056 |
NN |
denotes |
follicle |
T3481 |
15037-15047 |
VBG |
denotes |
developing |
T3482 |
15066-15069 |
PRP$ |
denotes |
its |
T3483 |
15070-15083 |
NN |
denotes |
proliferation |
T3484 |
15084-15087 |
CC |
denotes |
and |
T3485 |
15088-15092 |
JJ |
denotes |
down |
T3486 |
15093-15099 |
NN |
denotes |
growth |
T3487 |
15092-15093 |
HYPH |
denotes |
- |
T3488 |
15100-15101 |
-LRB- |
denotes |
( |
T3489 |
15108-15110 |
NN |
denotes |
1F |
T3490 |
15101-15107 |
NN |
denotes |
Figure |
T3491 |
15110-15111 |
-RRB- |
denotes |
) |
T3492 |
15111-15112 |
. |
denotes |
. |
T3493 |
15112-15334 |
sentence |
denotes |
Immunohistochemistry with antibodies against the active (phosphorylated) form of MAPK (pMAPK) marked a subset of the proliferating (Ki67-positive) cells, and pMAPK-positive cells were enriched in the hair bud (Figure 1G). |
T3494 |
15113-15133 |
NN |
denotes |
Immunohistochemistry |
T3495 |
15207-15213 |
VBD |
denotes |
marked |
T3496 |
15134-15138 |
IN |
denotes |
with |
T3497 |
15139-15149 |
NNS |
denotes |
antibodies |
T3498 |
15150-15157 |
IN |
denotes |
against |
T3499 |
15158-15161 |
DT |
denotes |
the |
T3500 |
15186-15190 |
NN |
denotes |
form |
T3501 |
15162-15168 |
JJ |
denotes |
active |
T3502 |
15169-15170 |
-LRB- |
denotes |
( |
T3503 |
15170-15184 |
VBN |
denotes |
phosphorylated |
T3504 |
15184-15185 |
-RRB- |
denotes |
) |
T3505 |
15191-15193 |
IN |
denotes |
of |
T3506 |
15194-15198 |
NN |
denotes |
MAPK |
T3507 |
15199-15200 |
-LRB- |
denotes |
( |
T3508 |
15200-15205 |
NN |
denotes |
pMAPK |
T3509 |
15205-15206 |
-RRB- |
denotes |
) |
T3510 |
15214-15215 |
DT |
denotes |
a |
T3511 |
15216-15222 |
NN |
denotes |
subset |
T3512 |
15223-15225 |
IN |
denotes |
of |
T3513 |
15226-15229 |
DT |
denotes |
the |
T3514 |
15260-15265 |
NNS |
denotes |
cells |
T3515 |
15230-15243 |
VBG |
denotes |
proliferating |
T3516 |
15244-15245 |
-LRB- |
denotes |
( |
T3517 |
15245-15249 |
NN |
denotes |
Ki67 |
T3518 |
15250-15258 |
JJ |
denotes |
positive |
T3519 |
15249-15250 |
HYPH |
denotes |
- |
T3520 |
15258-15259 |
-RRB- |
denotes |
) |
T3521 |
15265-15267 |
, |
denotes |
, |
T3522 |
15267-15270 |
CC |
denotes |
and |
T3523 |
15271-15276 |
NN |
denotes |
pMAPK |
T3524 |
15277-15285 |
JJ |
denotes |
positive |
T3525 |
15276-15277 |
HYPH |
denotes |
- |
T3526 |
15286-15291 |
NNS |
denotes |
cells |
T3527 |
15297-15305 |
VBN |
denotes |
enriched |
T3528 |
15292-15296 |
VBD |
denotes |
were |
T3529 |
15306-15308 |
IN |
denotes |
in |
T3530 |
15309-15312 |
DT |
denotes |
the |
T3531 |
15318-15321 |
NN |
denotes |
bud |
T3532 |
15313-15317 |
NN |
denotes |
hair |
T3533 |
15322-15323 |
-LRB- |
denotes |
( |
T3534 |
15330-15332 |
NN |
denotes |
1G |
T3535 |
15323-15329 |
NN |
denotes |
Figure |
T3536 |
15332-15333 |
-RRB- |
denotes |
) |
T3537 |
15333-15334 |
. |
denotes |
. |
T3538 |
15334-15530 |
sentence |
denotes |
The timing of Snail induction and Ki67 and pMAPK enrichment in the hair bud appeared to follow closely the induction of LEF-1/β-catenin activity, known to initiate in the hair placode stage [20]. |
T3539 |
15335-15338 |
DT |
denotes |
The |
T3540 |
15339-15345 |
NN |
denotes |
timing |
T3541 |
15411-15419 |
VBD |
denotes |
appeared |
T3542 |
15346-15348 |
IN |
denotes |
of |
T3543 |
15349-15354 |
NN |
denotes |
Snail |
T3544 |
15355-15364 |
NN |
denotes |
induction |
T3545 |
15365-15368 |
CC |
denotes |
and |
T3546 |
15369-15373 |
NN |
denotes |
Ki67 |
T3547 |
15384-15394 |
NN |
denotes |
enrichment |
T3548 |
15374-15377 |
CC |
denotes |
and |
T3549 |
15378-15383 |
NN |
denotes |
pMAPK |
T3550 |
15395-15397 |
IN |
denotes |
in |
T3551 |
15398-15401 |
DT |
denotes |
the |
T3552 |
15407-15410 |
NN |
denotes |
bud |
T3553 |
15402-15406 |
NN |
denotes |
hair |
T3554 |
15420-15422 |
TO |
denotes |
to |
T3555 |
15423-15429 |
VB |
denotes |
follow |
T3556 |
15430-15437 |
RB |
denotes |
closely |
T3557 |
15438-15441 |
DT |
denotes |
the |
T3558 |
15442-15451 |
NN |
denotes |
induction |
T3559 |
15452-15454 |
IN |
denotes |
of |
T3560 |
15455-15458 |
NN |
denotes |
LEF |
T3561 |
15471-15479 |
NN |
denotes |
activity |
T3562 |
15458-15459 |
HYPH |
denotes |
- |
T3563 |
15459-15460 |
CD |
denotes |
1 |
T3564 |
15460-15461 |
HYPH |
denotes |
/ |
T3565 |
15461-15462 |
NN |
denotes |
β |
T3566 |
15463-15470 |
NN |
denotes |
catenin |
T3567 |
15462-15463 |
HYPH |
denotes |
- |
T3568 |
15479-15481 |
, |
denotes |
, |
T3569 |
15481-15486 |
VBN |
denotes |
known |
T3570 |
15487-15489 |
TO |
denotes |
to |
T3571 |
15490-15498 |
VB |
denotes |
initiate |
T3572 |
15499-15501 |
IN |
denotes |
in |
T3573 |
15502-15505 |
DT |
denotes |
the |
T3574 |
15519-15524 |
NN |
denotes |
stage |
T3575 |
15506-15510 |
NN |
denotes |
hair |
T3576 |
15511-15518 |
NN |
denotes |
placode |
T3577 |
15525-15526 |
-LRB- |
denotes |
[ |
T3578 |
15526-15528 |
CD |
denotes |
20 |
T3579 |
15528-15529 |
-RRB- |
denotes |
] |
T3580 |
15529-15530 |
. |
denotes |
. |
T3581 |
15530-15642 |
sentence |
denotes |
However, like placodes, hair buds exhibited down-regulation in E-cadherin expression (Figure 1H; see also [4]). |
T3582 |
15531-15538 |
RB |
denotes |
However |
T3583 |
15565-15574 |
VBD |
denotes |
exhibited |
T3584 |
15538-15540 |
, |
denotes |
, |
T3585 |
15540-15544 |
IN |
denotes |
like |
T3586 |
15545-15553 |
NNS |
denotes |
placodes |
T3587 |
15553-15555 |
, |
denotes |
, |
T3588 |
15555-15559 |
NN |
denotes |
hair |
T3589 |
15560-15564 |
NNS |
denotes |
buds |
T3590 |
15575-15579 |
JJ |
denotes |
down |
T3591 |
15580-15590 |
NN |
denotes |
regulation |
T3592 |
15579-15580 |
HYPH |
denotes |
- |
T3593 |
15591-15593 |
IN |
denotes |
in |
T3594 |
15594-15595 |
NN |
denotes |
E |
T3595 |
15596-15604 |
NN |
denotes |
cadherin |
T3596 |
15595-15596 |
HYPH |
denotes |
- |
T3597 |
15605-15615 |
NN |
denotes |
expression |
T3598 |
15616-15617 |
-LRB- |
denotes |
( |
T3599 |
15624-15626 |
NN |
denotes |
1H |
T3600 |
15617-15623 |
NN |
denotes |
Figure |
T3601 |
15626-15627 |
: |
denotes |
; |
T3602 |
15628-15631 |
VB |
denotes |
see |
T3603 |
15632-15636 |
RB |
denotes |
also |
T3604 |
15637-15638 |
-LRB- |
denotes |
[ |
T3605 |
15638-15639 |
CD |
denotes |
4 |
T3606 |
15639-15640 |
-RRB- |
denotes |
] |
T3607 |
15640-15641 |
-RRB- |
denotes |
) |
T3608 |
15641-15642 |
. |
denotes |
. |
T3910 |
15644-15653 |
JJ |
denotes |
Sustained |
T3911 |
15654-15664 |
NN |
denotes |
Expression |
T3912 |
15674-15681 |
VBZ |
denotes |
Results |
T3913 |
15665-15667 |
IN |
denotes |
of |
T3914 |
15668-15673 |
NN |
denotes |
Snail |
T3915 |
15682-15684 |
IN |
denotes |
in |
T3916 |
15685-15694 |
JJ |
denotes |
Epidermal |
T3917 |
15695-15713 |
NN |
denotes |
Hyperproliferation |
T3918 |
15714-15717 |
CC |
denotes |
and |
T3919 |
15718-15733 |
NN |
denotes |
Differentiation |
T3920 |
15734-15741 |
NNS |
denotes |
Defects |
T3921 |
15742-15744 |
IN |
denotes |
in |
T3922 |
15745-15747 |
NN |
denotes |
Tg |
T3923 |
15754-15758 |
NN |
denotes |
Skin |
T3924 |
15748-15753 |
NN |
denotes |
Mouse |
T3925 |
15758-15966 |
sentence |
denotes |
The striking spike of Snail expression coincident with hair bud formation and enhanced proliferation prompted us to examine the consequences of ectopically expressing Snail elsewhere in mouse skin epidermis. |
T3926 |
15759-15762 |
DT |
denotes |
The |
T3927 |
15772-15777 |
NN |
denotes |
spike |
T3928 |
15763-15771 |
JJ |
denotes |
striking |
T3929 |
15860-15868 |
VBD |
denotes |
prompted |
T3930 |
15778-15780 |
IN |
denotes |
of |
T3931 |
15781-15786 |
NN |
denotes |
Snail |
T3932 |
15787-15797 |
NN |
denotes |
expression |
T3933 |
15798-15808 |
JJ |
denotes |
coincident |
T3934 |
15809-15813 |
IN |
denotes |
with |
T3935 |
15814-15818 |
NN |
denotes |
hair |
T3936 |
15819-15822 |
NN |
denotes |
bud |
T3937 |
15823-15832 |
NN |
denotes |
formation |
T3938 |
15833-15836 |
CC |
denotes |
and |
T3939 |
15837-15845 |
VBN |
denotes |
enhanced |
T3940 |
15846-15859 |
NN |
denotes |
proliferation |
T3941 |
15869-15871 |
PRP |
denotes |
us |
T3942 |
15872-15874 |
TO |
denotes |
to |
T3943 |
15875-15882 |
VB |
denotes |
examine |
T3944 |
15883-15886 |
DT |
denotes |
the |
T3945 |
15887-15899 |
NNS |
denotes |
consequences |
T3946 |
15900-15902 |
IN |
denotes |
of |
T3947 |
15903-15914 |
RB |
denotes |
ectopically |
T3948 |
15915-15925 |
VBG |
denotes |
expressing |
T3949 |
15926-15931 |
NN |
denotes |
Snail |
T3950 |
15932-15941 |
RB |
denotes |
elsewhere |
T3951 |
15942-15944 |
IN |
denotes |
in |
T3952 |
15945-15950 |
NN |
denotes |
mouse |
T3953 |
15956-15965 |
NN |
denotes |
epidermis |
T3954 |
15951-15955 |
NN |
denotes |
skin |
T3955 |
15965-15966 |
. |
denotes |
. |
T3956 |
15966-16100 |
sentence |
denotes |
To distinguish Tg from endogenous Snail, we used the HA-epitope, shown previously not to alter Snail's transcriptional activity [12]. |
T3957 |
15967-15969 |
TO |
denotes |
To |
T3958 |
15970-15981 |
VB |
denotes |
distinguish |
T3959 |
16011-16015 |
VBD |
denotes |
used |
T3960 |
15982-15984 |
NN |
denotes |
Tg |
T3961 |
15985-15989 |
IN |
denotes |
from |
T3962 |
15990-16000 |
JJ |
denotes |
endogenous |
T3963 |
16001-16006 |
NN |
denotes |
Snail |
T3964 |
16006-16008 |
, |
denotes |
, |
T3965 |
16008-16010 |
PRP |
denotes |
we |
T3966 |
16016-16019 |
DT |
denotes |
the |
T3967 |
16023-16030 |
NN |
denotes |
epitope |
T3968 |
16020-16022 |
NN |
denotes |
HA |
T3969 |
16022-16023 |
HYPH |
denotes |
- |
T3970 |
16030-16032 |
, |
denotes |
, |
T3971 |
16032-16037 |
VBN |
denotes |
shown |
T3972 |
16038-16048 |
RB |
denotes |
previously |
T3973 |
16049-16052 |
RB |
denotes |
not |
T3974 |
16056-16061 |
VB |
denotes |
alter |
T3975 |
16053-16055 |
TO |
denotes |
to |
T3976 |
16062-16067 |
NNP |
denotes |
Snail |
T3977 |
16086-16094 |
NN |
denotes |
activity |
T3978 |
16067-16069 |
POS |
denotes |
's |
T3979 |
16070-16085 |
JJ |
denotes |
transcriptional |
T3980 |
16095-16096 |
-LRB- |
denotes |
[ |
T3981 |
16096-16098 |
CD |
denotes |
12 |
T3982 |
16098-16099 |
-RRB- |
denotes |
] |
T3983 |
16099-16100 |
. |
denotes |
. |
T3984 |
16100-16212 |
sentence |
denotes |
Of 20 K14-Snail[HA] Tg animals generated, three expressed the transgene and all exhibited analogous phenotypes. |
T3985 |
16101-16103 |
IN |
denotes |
Of |
T3986 |
16149-16158 |
VBD |
denotes |
expressed |
T3987 |
16104-16106 |
CD |
denotes |
20 |
T3988 |
16124-16131 |
NNS |
denotes |
animals |
T3989 |
16107-16110 |
NN |
denotes |
K14 |
T3990 |
16111-16116 |
NN |
denotes |
Snail |
T3991 |
16110-16111 |
HYPH |
denotes |
- |
T3992 |
16116-16117 |
-LRB- |
denotes |
[ |
T3993 |
16117-16119 |
NN |
denotes |
HA |
T3994 |
16119-16120 |
-RRB- |
denotes |
] |
T3995 |
16121-16123 |
NN |
denotes |
Tg |
T3996 |
16132-16141 |
VBN |
denotes |
generated |
T3997 |
16141-16143 |
, |
denotes |
, |
T3998 |
16143-16148 |
CD |
denotes |
three |
T3999 |
16159-16162 |
DT |
denotes |
the |
T4000 |
16163-16172 |
NN |
denotes |
transgene |
T4001 |
16173-16176 |
CC |
denotes |
and |
T4002 |
16177-16180 |
DT |
denotes |
all |
T4003 |
16181-16190 |
VBD |
denotes |
exhibited |
T4004 |
16191-16200 |
JJ |
denotes |
analogous |
T4005 |
16201-16211 |
NNS |
denotes |
phenotypes |
T4006 |
16211-16212 |
. |
denotes |
. |
T4007 |
16212-16304 |
sentence |
denotes |
Mice that integrated the transgene at the single-cell stage died at or shortly after birth. |
T4008 |
16213-16217 |
NNS |
denotes |
Mice |
T4009 |
16273-16277 |
VBD |
denotes |
died |
T4010 |
16218-16222 |
WDT |
denotes |
that |
T4011 |
16223-16233 |
VBD |
denotes |
integrated |
T4012 |
16234-16237 |
DT |
denotes |
the |
T4013 |
16238-16247 |
NN |
denotes |
transgene |
T4014 |
16248-16250 |
IN |
denotes |
at |
T4015 |
16251-16254 |
DT |
denotes |
the |
T4016 |
16267-16272 |
NN |
denotes |
stage |
T4017 |
16255-16261 |
JJ |
denotes |
single |
T4018 |
16262-16266 |
NN |
denotes |
cell |
T4019 |
16261-16262 |
HYPH |
denotes |
- |
T4020 |
16278-16280 |
IN |
denotes |
at |
T4021 |
16281-16283 |
CC |
denotes |
or |
T4022 |
16284-16291 |
RB |
denotes |
shortly |
T4023 |
16292-16297 |
IN |
denotes |
after |
T4024 |
16298-16303 |
NN |
denotes |
birth |
T4025 |
16303-16304 |
. |
denotes |
. |
T4026 |
16304-16461 |
sentence |
denotes |
The three surviving full-Tg founder mice harbored transgene integrations that gave stable transmission of mosaic Snail gene expression through the germline. |
T4027 |
16305-16308 |
DT |
denotes |
The |
T4028 |
16341-16345 |
NNS |
denotes |
mice |
T4029 |
16309-16314 |
CD |
denotes |
three |
T4030 |
16315-16324 |
VBG |
denotes |
surviving |
T4031 |
16325-16329 |
JJ |
denotes |
full |
T4032 |
16330-16332 |
NN |
denotes |
Tg |
T4033 |
16329-16330 |
HYPH |
denotes |
- |
T4034 |
16333-16340 |
NN |
denotes |
founder |
T4035 |
16346-16354 |
VBD |
denotes |
harbored |
T4036 |
16355-16364 |
NN |
denotes |
transgene |
T4037 |
16365-16377 |
NNS |
denotes |
integrations |
T4038 |
16378-16382 |
WDT |
denotes |
that |
T4039 |
16383-16387 |
VBD |
denotes |
gave |
T4040 |
16388-16394 |
JJ |
denotes |
stable |
T4041 |
16395-16407 |
NN |
denotes |
transmission |
T4042 |
16408-16410 |
IN |
denotes |
of |
T4043 |
16411-16417 |
JJ |
denotes |
mosaic |
T4044 |
16424-16428 |
NN |
denotes |
gene |
T4045 |
16418-16423 |
NN |
denotes |
Snail |
T4046 |
16429-16439 |
NN |
denotes |
expression |
T4047 |
16440-16447 |
IN |
denotes |
through |
T4048 |
16448-16451 |
DT |
denotes |
the |
T4049 |
16452-16460 |
NN |
denotes |
germline |
T4050 |
16460-16461 |
. |
denotes |
. |
T4051 |
16461-16572 |
sentence |
denotes |
Progressively poor health necessitated our sacrificing most offspring from these lines within a year of birth. |
T4052 |
16462-16475 |
RB |
denotes |
Progressively |
T4053 |
16476-16480 |
JJ |
denotes |
poor |
T4054 |
16481-16487 |
NN |
denotes |
health |
T4055 |
16488-16500 |
VBD |
denotes |
necessitated |
T4056 |
16501-16504 |
PRP$ |
denotes |
our |
T4057 |
16505-16516 |
VBG |
denotes |
sacrificing |
T4058 |
16517-16521 |
JJS |
denotes |
most |
T4059 |
16522-16531 |
NN |
denotes |
offspring |
T4060 |
16532-16536 |
IN |
denotes |
from |
T4061 |
16537-16542 |
DT |
denotes |
these |
T4062 |
16543-16548 |
NNS |
denotes |
lines |
T4063 |
16549-16555 |
IN |
denotes |
within |
T4064 |
16556-16557 |
DT |
denotes |
a |
T4065 |
16558-16562 |
NN |
denotes |
year |
T4066 |
16563-16565 |
IN |
denotes |
of |
T4067 |
16566-16571 |
NN |
denotes |
birth |
T4068 |
16571-16572 |
. |
denotes |
. |
T4069 |
16572-16686 |
sentence |
denotes |
As Snail Tg animals grew, they became distinguished by their small size, short tails, and flaky skin (Figure 2A). |
T4070 |
16573-16575 |
IN |
denotes |
As |
T4071 |
16593-16597 |
VBD |
denotes |
grew |
T4072 |
16576-16581 |
NN |
denotes |
Snail |
T4073 |
16585-16592 |
NNS |
denotes |
animals |
T4074 |
16582-16584 |
NN |
denotes |
Tg |
T4075 |
16604-16610 |
VBD |
denotes |
became |
T4076 |
16597-16599 |
, |
denotes |
, |
T4077 |
16599-16603 |
PRP |
denotes |
they |
T4078 |
16611-16624 |
JJ |
denotes |
distinguished |
T4079 |
16625-16627 |
IN |
denotes |
by |
T4080 |
16628-16633 |
PRP$ |
denotes |
their |
T4081 |
16640-16644 |
NN |
denotes |
size |
T4082 |
16634-16639 |
JJ |
denotes |
small |
T4083 |
16644-16646 |
, |
denotes |
, |
T4084 |
16646-16651 |
JJ |
denotes |
short |
T4085 |
16652-16657 |
NNS |
denotes |
tails |
T4086 |
16657-16659 |
, |
denotes |
, |
T4087 |
16659-16662 |
CC |
denotes |
and |
T4088 |
16663-16668 |
JJ |
denotes |
flaky |
T4089 |
16669-16673 |
NN |
denotes |
skin |
T4090 |
16674-16675 |
-LRB- |
denotes |
( |
T4091 |
16682-16684 |
NN |
denotes |
2A |
T4092 |
16675-16681 |
NN |
denotes |
Figure |
T4093 |
16684-16685 |
-RRB- |
denotes |
) |
T4094 |
16685-16686 |
. |
denotes |
. |
T4095 |
16686-16797 |
sentence |
denotes |
Histological analyses of 3-d old (P3) mice revealed mosaic patches marked by epidermal thickening (Figure 2B). |
T4096 |
16687-16699 |
JJ |
denotes |
Histological |
T4097 |
16700-16708 |
NNS |
denotes |
analyses |
T4098 |
16730-16738 |
VBD |
denotes |
revealed |
T4099 |
16709-16711 |
IN |
denotes |
of |
T4100 |
16712-16713 |
CD |
denotes |
3 |
T4101 |
16714-16715 |
NN |
denotes |
d |
T4102 |
16713-16714 |
HYPH |
denotes |
- |
T4103 |
16716-16719 |
JJ |
denotes |
old |
T4104 |
16725-16729 |
NNS |
denotes |
mice |
T4105 |
16720-16721 |
-LRB- |
denotes |
( |
T4106 |
16721-16723 |
JJ |
denotes |
P3 |
T4107 |
16723-16724 |
-RRB- |
denotes |
) |
T4108 |
16739-16745 |
NN |
denotes |
mosaic |
T4109 |
16746-16753 |
NNS |
denotes |
patches |
T4110 |
16754-16760 |
VBN |
denotes |
marked |
T4111 |
16761-16763 |
IN |
denotes |
by |
T4112 |
16764-16773 |
JJ |
denotes |
epidermal |
T4113 |
16774-16784 |
NN |
denotes |
thickening |
T4114 |
16785-16786 |
-LRB- |
denotes |
( |
T4115 |
16793-16795 |
NN |
denotes |
2B |
T4116 |
16786-16792 |
NN |
denotes |
Figure |
T4117 |
16795-16796 |
-RRB- |
denotes |
) |
T4118 |
16796-16797 |
. |
denotes |
. |
T4119 |
16797-16952 |
sentence |
denotes |
The mosaic morphology was reflected at the level of Tg Snail protein, with only the hyperthickened regions expressing nuclear HA-tagged Snail (Figure 2C). |
T4120 |
16798-16801 |
DT |
denotes |
The |
T4121 |
16809-16819 |
NN |
denotes |
morphology |
T4122 |
16802-16808 |
NN |
denotes |
mosaic |
T4123 |
16824-16833 |
VBN |
denotes |
reflected |
T4124 |
16820-16823 |
VBD |
denotes |
was |
T4125 |
16834-16836 |
IN |
denotes |
at |
T4126 |
16837-16840 |
DT |
denotes |
the |
T4127 |
16841-16846 |
NN |
denotes |
level |
T4128 |
16847-16849 |
IN |
denotes |
of |
T4129 |
16850-16852 |
NN |
denotes |
Tg |
T4130 |
16859-16866 |
NN |
denotes |
protein |
T4131 |
16853-16858 |
NN |
denotes |
Snail |
T4132 |
16866-16868 |
, |
denotes |
, |
T4133 |
16868-16872 |
IN |
denotes |
with |
T4134 |
16905-16915 |
VBG |
denotes |
expressing |
T4135 |
16873-16877 |
RB |
denotes |
only |
T4136 |
16897-16904 |
NNS |
denotes |
regions |
T4137 |
16878-16881 |
DT |
denotes |
the |
T4138 |
16882-16896 |
VBN |
denotes |
hyperthickened |
T4139 |
16916-16923 |
JJ |
denotes |
nuclear |
T4140 |
16934-16939 |
NN |
denotes |
Snail |
T4141 |
16924-16926 |
NN |
denotes |
HA |
T4142 |
16927-16933 |
VBN |
denotes |
tagged |
T4143 |
16926-16927 |
HYPH |
denotes |
- |
T4144 |
16940-16941 |
-LRB- |
denotes |
( |
T4145 |
16948-16950 |
NN |
denotes |
2C |
T4146 |
16941-16947 |
NN |
denotes |
Figure |
T4147 |
16950-16951 |
-RRB- |
denotes |
) |
T4148 |
16951-16952 |
. |
denotes |
. |
T4149 |
16952-17112 |
sentence |
denotes |
These hyperthickened areas were marked by excessive proliferation, as revealed by antibodies against the proliferating nuclear antigen Ki67 (Figure 2D and 2E). |
T4150 |
16953-16958 |
DT |
denotes |
These |
T4151 |
16974-16979 |
NNS |
denotes |
areas |
T4152 |
16959-16973 |
VBN |
denotes |
hyperthickened |
T4153 |
16985-16991 |
VBN |
denotes |
marked |
T4154 |
16980-16984 |
VBD |
denotes |
were |
T4155 |
16992-16994 |
IN |
denotes |
by |
T4156 |
16995-17004 |
JJ |
denotes |
excessive |
T4157 |
17005-17018 |
NN |
denotes |
proliferation |
T4158 |
17018-17020 |
, |
denotes |
, |
T4159 |
17020-17022 |
IN |
denotes |
as |
T4160 |
17023-17031 |
VBN |
denotes |
revealed |
T4161 |
17032-17034 |
IN |
denotes |
by |
T4162 |
17035-17045 |
NNS |
denotes |
antibodies |
T4163 |
17046-17053 |
IN |
denotes |
against |
T4164 |
17054-17057 |
DT |
denotes |
the |
T4165 |
17080-17087 |
NN |
denotes |
antigen |
T4166 |
17058-17071 |
VBG |
denotes |
proliferating |
T4167 |
17072-17079 |
JJ |
denotes |
nuclear |
T4168 |
17088-17092 |
NN |
denotes |
Ki67 |
T4169 |
17093-17094 |
-LRB- |
denotes |
( |
T4170 |
17101-17103 |
NN |
denotes |
2D |
T4171 |
17094-17100 |
NN |
denotes |
Figure |
T4172 |
17104-17107 |
CC |
denotes |
and |
T4173 |
17108-17110 |
NN |
denotes |
2E |
T4174 |
17110-17111 |
-RRB- |
denotes |
) |
T4175 |
17111-17112 |
. |
denotes |
. |
T4176 |
17112-17325 |
sentence |
denotes |
Activated, pMAPK-positive cells were also prevalent in these areas (Figure 2F and 2G), as were cells expressing keratin 6, a keratin induced in the suprabasal layers of hyperproliferative skin (Figure 2H and 2I). |
T4177 |
17113-17122 |
VBN |
denotes |
Activated |
T4178 |
17139-17144 |
NNS |
denotes |
cells |
T4179 |
17122-17124 |
, |
denotes |
, |
T4180 |
17124-17129 |
NN |
denotes |
pMAPK |
T4181 |
17130-17138 |
JJ |
denotes |
positive |
T4182 |
17129-17130 |
HYPH |
denotes |
- |
T4183 |
17145-17149 |
VBD |
denotes |
were |
T4184 |
17150-17154 |
RB |
denotes |
also |
T4185 |
17155-17164 |
JJ |
denotes |
prevalent |
T4186 |
17165-17167 |
IN |
denotes |
in |
T4187 |
17168-17173 |
DT |
denotes |
these |
T4188 |
17174-17179 |
NNS |
denotes |
areas |
T4189 |
17180-17181 |
-LRB- |
denotes |
( |
T4190 |
17188-17190 |
NN |
denotes |
2F |
T4191 |
17181-17187 |
NN |
denotes |
Figure |
T4192 |
17191-17194 |
CC |
denotes |
and |
T4193 |
17195-17197 |
NN |
denotes |
2G |
T4194 |
17197-17198 |
-RRB- |
denotes |
) |
T4195 |
17198-17200 |
, |
denotes |
, |
T4196 |
17200-17202 |
IN |
denotes |
as |
T4197 |
17203-17207 |
VBD |
denotes |
were |
T4198 |
17208-17213 |
NNS |
denotes |
cells |
T4199 |
17214-17224 |
VBG |
denotes |
expressing |
T4200 |
17225-17232 |
NN |
denotes |
keratin |
T4201 |
17233-17234 |
CD |
denotes |
6 |
T4202 |
17234-17236 |
, |
denotes |
, |
T4203 |
17236-17237 |
DT |
denotes |
a |
T4204 |
17238-17245 |
NN |
denotes |
keratin |
T4205 |
17246-17253 |
VBN |
denotes |
induced |
T4206 |
17254-17256 |
IN |
denotes |
in |
T4207 |
17257-17260 |
DT |
denotes |
the |
T4208 |
17272-17278 |
NNS |
denotes |
layers |
T4209 |
17261-17271 |
JJ |
denotes |
suprabasal |
T4210 |
17279-17281 |
IN |
denotes |
of |
T4211 |
17282-17300 |
JJ |
denotes |
hyperproliferative |
T4212 |
17301-17305 |
NN |
denotes |
skin |
T4213 |
17306-17307 |
-LRB- |
denotes |
( |
T4214 |
17314-17316 |
NN |
denotes |
2H |
T4215 |
17307-17313 |
NN |
denotes |
Figure |
T4216 |
17317-17320 |
CC |
denotes |
and |
T4217 |
17321-17323 |
NN |
denotes |
2I |
T4218 |
17323-17324 |
-RRB- |
denotes |
) |
T4219 |
17324-17325 |
. |
denotes |
. |
T4220 |
17325-19464 |
sentence |
denotes |
Figure 2 Misexpression of Snail in Mouse Skin Epidermis Results in Hyperproliferation
Three different surviving Tg founder mice harbored a K14-Snail transgene that was integrated into a locus that resulted in inheritable, mosaic expression of the transgene in skin epidermis. All displayed similar abnormalities, as did their offspring.
(A) P16 WT and K14-Snail Tg mice. Insets denote magnified tail segments, which displayed a mosaic, flaky appearance in Tg mice. Size differences appeared with age, and are likely due to K14-promoter activity in the tongue and oral epithelium, resulting in progressive defects and reduced food intake. Hence, skin sections from young (P3) mice were analyzed (B–I).
(B) Hematoxylin- and eosin-stained Tg skin section. Double arrows demarcate the border of mosaic histology, with seemingly normal epidermis (epi) and a mature hair follicle (hf) at left and hyperthickened epidermis at right.
(C) Immunofluorescence of Tg skin section labeled with antibodies as color-coded on frame. Double arrows demarcate the border of mosaic anti-Snail (green), revealing Snail expression coincident with regions of hyperthickened epidermis (at left) and absent in regions of normal epidermis (at right).
(D–I) Sections of P3 WT or Tg skin (affected region) subjected to either immunofluorescence (D, E, H, and I) or immunohistochemistry (F and G) with antibodies as indicated on the panel. Anti-keratin 5 indicates K5, normally restricted to the basal layer of the epidermis; anti-keratin 6 detects keratin 6, expressed in postnatal epidermis under conditions such as wounding, in which hyperproliferation occurs. All other antibodies are as in the legend to Figure 2. Comparison of D and E provide representative examples that illustrate that pMAPK is found in only a subset of all proliferating (Ki67-positive) cells. Note also the presence of Ki67- (E) and pMAPK-positive (G) cells in some suprabasal areas; Ki67-positive cells colabeled with anti-Snail (E). Expression of the Snail transgene did not block terminal differentiation in the hyperproliferative epidermis, but it distorted it markedly (Figure 3A–3H). |
T4221 |
19310-19320 |
NN |
denotes |
Expression |
T4222 |
19352-19357 |
VB |
denotes |
block |
T4223 |
19321-19323 |
IN |
denotes |
of |
T4224 |
19324-19327 |
DT |
denotes |
the |
T4225 |
19334-19343 |
NN |
denotes |
transgene |
T4226 |
19328-19333 |
NN |
denotes |
Snail |
T4227 |
19344-19347 |
VBD |
denotes |
did |
T4228 |
19348-19351 |
RB |
denotes |
not |
T4229 |
19358-19366 |
JJ |
denotes |
terminal |
T4230 |
19367-19382 |
NN |
denotes |
differentiation |
T4231 |
19383-19385 |
IN |
denotes |
in |
T4232 |
19386-19389 |
DT |
denotes |
the |
T4233 |
19409-19418 |
NN |
denotes |
epidermis |
T4234 |
19390-19408 |
JJ |
denotes |
hyperproliferative |
T4235 |
19418-19420 |
, |
denotes |
, |
T4236 |
19420-19423 |
CC |
denotes |
but |
T4237 |
19424-19426 |
PRP |
denotes |
it |
T4238 |
19427-19436 |
VBD |
denotes |
distorted |
T4239 |
19437-19439 |
PRP |
denotes |
it |
T4240 |
19440-19448 |
RB |
denotes |
markedly |
T4241 |
19449-19450 |
-LRB- |
denotes |
( |
T4242 |
19457-19459 |
NN |
denotes |
3A |
T4243 |
19450-19456 |
NN |
denotes |
Figure |
T4244 |
19459-19460 |
SYM |
denotes |
– |
T4245 |
19460-19462 |
NN |
denotes |
3H |
T4246 |
19462-19463 |
-RRB- |
denotes |
) |
T4247 |
19463-19464 |
. |
denotes |
. |
T4248 |
19464-19601 |
sentence |
denotes |
Typical of most hyperproliferating conditions, Snail expression led to a large expansion in layers with spinous and granular morphology. |
T4249 |
19465-19472 |
JJ |
denotes |
Typical |
T4250 |
19529-19532 |
VBD |
denotes |
led |
T4251 |
19473-19475 |
IN |
denotes |
of |
T4252 |
19476-19480 |
JJS |
denotes |
most |
T4253 |
19500-19510 |
NNS |
denotes |
conditions |
T4254 |
19481-19499 |
NN |
denotes |
hyperproliferating |
T4255 |
19510-19512 |
, |
denotes |
, |
T4256 |
19512-19517 |
NN |
denotes |
Snail |
T4257 |
19518-19528 |
NN |
denotes |
expression |
T4258 |
19533-19535 |
IN |
denotes |
to |
T4259 |
19536-19537 |
DT |
denotes |
a |
T4260 |
19544-19553 |
NN |
denotes |
expansion |
T4261 |
19538-19543 |
JJ |
denotes |
large |
T4262 |
19554-19556 |
IN |
denotes |
in |
T4263 |
19557-19563 |
NNS |
denotes |
layers |
T4264 |
19564-19568 |
IN |
denotes |
with |
T4265 |
19569-19576 |
JJ |
denotes |
spinous |
T4266 |
19590-19600 |
NN |
denotes |
morphology |
T4267 |
19577-19580 |
CC |
denotes |
and |
T4268 |
19581-19589 |
JJ |
denotes |
granular |
T4269 |
19600-19601 |
. |
denotes |
. |
T4270 |
19601-19744 |
sentence |
denotes |
Additionally, however, was a marked and variable expansion of keratin 5 (K5), normally restricted to the innermost basal layer (see Figure 3). |
T4271 |
19602-19614 |
RB |
denotes |
Additionally |
T4272 |
19625-19628 |
VBD |
denotes |
was |
T4273 |
19614-19616 |
, |
denotes |
, |
T4274 |
19616-19623 |
RB |
denotes |
however |
T4275 |
19623-19625 |
, |
denotes |
, |
T4276 |
19629-19630 |
DT |
denotes |
a |
T4277 |
19651-19660 |
NN |
denotes |
expansion |
T4278 |
19631-19637 |
JJ |
denotes |
marked |
T4279 |
19638-19641 |
CC |
denotes |
and |
T4280 |
19642-19650 |
JJ |
denotes |
variable |
T4281 |
19661-19663 |
IN |
denotes |
of |
T4282 |
19664-19671 |
NN |
denotes |
keratin |
T4283 |
19672-19673 |
CD |
denotes |
5 |
T4284 |
19674-19675 |
-LRB- |
denotes |
( |
T4285 |
19675-19677 |
NN |
denotes |
K5 |
T4286 |
19677-19678 |
-RRB- |
denotes |
) |
T4287 |
19678-19680 |
, |
denotes |
, |
T4288 |
19680-19688 |
RB |
denotes |
normally |
T4289 |
19689-19699 |
VBN |
denotes |
restricted |
T4290 |
19700-19702 |
IN |
denotes |
to |
T4291 |
19703-19706 |
DT |
denotes |
the |
T4292 |
19723-19728 |
NN |
denotes |
layer |
T4293 |
19707-19716 |
JJS |
denotes |
innermost |
T4294 |
19717-19722 |
JJ |
denotes |
basal |
T4295 |
19729-19730 |
-LRB- |
denotes |
( |
T4296 |
19730-19733 |
VB |
denotes |
see |
T4297 |
19734-19740 |
NN |
denotes |
Figure |
T4298 |
19741-19742 |
CD |
denotes |
3 |
T4299 |
19742-19743 |
-RRB- |
denotes |
) |
T4300 |
19743-19744 |
. |
denotes |
. |
T4301 |
19744-20053 |
sentence |
denotes |
Although the failure of Snail-null mice to develop past gastrulation [21] precluded our ability to study the loss of Snail function in skin development, a good correlation emerged between the expression of Snail protein and the extension of K5, Ki67, and pMAPK suprabasally (compare data in Figures 2 and 3). |
T4302 |
19745-19753 |
IN |
denotes |
Although |
T4303 |
19819-19828 |
VBD |
denotes |
precluded |
T4304 |
19754-19757 |
DT |
denotes |
the |
T4305 |
19758-19765 |
NN |
denotes |
failure |
T4306 |
19766-19768 |
IN |
denotes |
of |
T4307 |
19769-19774 |
NN |
denotes |
Snail |
T4308 |
19780-19784 |
NNS |
denotes |
mice |
T4309 |
19774-19775 |
HYPH |
denotes |
- |
T4310 |
19775-19779 |
JJ |
denotes |
null |
T4311 |
19785-19787 |
TO |
denotes |
to |
T4312 |
19788-19795 |
VB |
denotes |
develop |
T4313 |
19796-19800 |
JJ |
denotes |
past |
T4314 |
19801-19813 |
NN |
denotes |
gastrulation |
T4315 |
19814-19815 |
-LRB- |
denotes |
[ |
T4316 |
19815-19817 |
CD |
denotes |
21 |
T4317 |
19817-19818 |
-RRB- |
denotes |
] |
T4318 |
19917-19924 |
VBD |
denotes |
emerged |
T4319 |
19829-19832 |
PRP$ |
denotes |
our |
T4320 |
19833-19840 |
NN |
denotes |
ability |
T4321 |
19841-19843 |
TO |
denotes |
to |
T4322 |
19844-19849 |
VB |
denotes |
study |
T4323 |
19850-19853 |
DT |
denotes |
the |
T4324 |
19854-19858 |
NN |
denotes |
loss |
T4325 |
19859-19861 |
IN |
denotes |
of |
T4326 |
19862-19867 |
NN |
denotes |
Snail |
T4327 |
19868-19876 |
NN |
denotes |
function |
T4328 |
19877-19879 |
IN |
denotes |
in |
T4329 |
19880-19884 |
NN |
denotes |
skin |
T4330 |
19885-19896 |
NN |
denotes |
development |
T4331 |
19896-19898 |
, |
denotes |
, |
T4332 |
19898-19899 |
DT |
denotes |
a |
T4333 |
19905-19916 |
NN |
denotes |
correlation |
T4334 |
19900-19904 |
JJ |
denotes |
good |
T4335 |
19925-19932 |
IN |
denotes |
between |
T4336 |
19933-19936 |
DT |
denotes |
the |
T4337 |
19937-19947 |
NN |
denotes |
expression |
T4338 |
19948-19950 |
IN |
denotes |
of |
T4339 |
19951-19956 |
NN |
denotes |
Snail |
T4340 |
19957-19964 |
NN |
denotes |
protein |
T4341 |
19965-19968 |
CC |
denotes |
and |
T4342 |
19969-19972 |
DT |
denotes |
the |
T4343 |
19973-19982 |
NN |
denotes |
extension |
T4344 |
19983-19985 |
IN |
denotes |
of |
T4345 |
19986-19988 |
NN |
denotes |
K5 |
T4346 |
19988-19990 |
, |
denotes |
, |
T4347 |
19990-19994 |
NN |
denotes |
Ki67 |
T4348 |
19994-19996 |
, |
denotes |
, |
T4349 |
19996-19999 |
CC |
denotes |
and |
T4350 |
20000-20005 |
NN |
denotes |
pMAPK |
T4351 |
20006-20018 |
RB |
denotes |
suprabasally |
T4352 |
20019-20020 |
-LRB- |
denotes |
( |
T4353 |
20020-20027 |
VB |
denotes |
compare |
T4354 |
20028-20032 |
NNS |
denotes |
data |
T4355 |
20033-20035 |
IN |
denotes |
in |
T4356 |
20036-20043 |
NNS |
denotes |
Figures |
T4357 |
20044-20045 |
CD |
denotes |
2 |
T4358 |
20046-20049 |
CC |
denotes |
and |
T4359 |
20050-20051 |
CD |
denotes |
3 |
T4360 |
20051-20052 |
-RRB- |
denotes |
) |
T4361 |
20052-20053 |
. |
denotes |
. |
T4362 |
20053-22035 |
sentence |
denotes |
Figure 3 Alterations in the Differentiation Program and Basement Membrane Organization in Snail-Expressing Tg Epidermis
(A–H) Immunofluorescence of skin sections from P3 WT and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Sections were labeled with antibodies as indicated and color-coded on each frame. Antibodies are against markers of normal epidermal differentiation, and include K5 (a basally expressed keratin), K1 (a suprabasal keratin, expressed in spinous layer cells), involucrin (Inv; a suprabasally expressed cornified envelope protein found in upper spinous and granular layer cells), loricrin (Lor; a cornified envelope protein expressed in the granular layer), and filaggrin (Fil; a protein that bundles keratin filaments in the granular layer and stratum corneum). Note abnormal extension of anti-K5 suprabasally, often present in anti-K1 positive suprabasal Tg cells.
(I–N) Immunohistochemistry (I and J) or immunofluorescence (K–N) of sections of P30 Wt (I, K, and M) and Tg (J, L, and N) (affected areas) skins using the antibodies indicated. Note that with age, affected areas of the Tg epidermis became increasingly undulating, often exhibiting papilloma-like invaginations (J). Insets in I and J are magnified views of the boxed areas, illustrating the absence (Wt) or presence (Tg) of nuclear anti-cyclin D staining. With age, affected areas of the Tg epidermis also displayed perturbations within the basement membrane, as judged by antibody labeling against either basement membrane (K and L) or hemidesmosomal (M and N) components. Double arrows in L demarcate mosaic zones, revealing that perturbations were restricted to hyperthickened, i.e., Snail-positive zones (to left of double arrows). Other abbreviations are as noted in the legend to Figure 2. The changes in hyperproliferation and differentiation were not initially accompanied by gross signs of epithelial invaginations. |
T4363 |
21907-21910 |
DT |
denotes |
The |
T4364 |
21911-21918 |
NNS |
denotes |
changes |
T4365 |
21980-21991 |
VBN |
denotes |
accompanied |
T4366 |
21919-21921 |
IN |
denotes |
in |
T4367 |
21922-21940 |
NN |
denotes |
hyperproliferation |
T4368 |
21941-21944 |
CC |
denotes |
and |
T4369 |
21945-21960 |
NN |
denotes |
differentiation |
T4370 |
21961-21965 |
VBD |
denotes |
were |
T4371 |
21966-21969 |
RB |
denotes |
not |
T4372 |
21970-21979 |
RB |
denotes |
initially |
T4373 |
21992-21994 |
IN |
denotes |
by |
T4374 |
21995-22000 |
JJ |
denotes |
gross |
T4375 |
22001-22006 |
NNS |
denotes |
signs |
T4376 |
22007-22009 |
IN |
denotes |
of |
T4377 |
22010-22020 |
JJ |
denotes |
epithelial |
T4378 |
22021-22034 |
NNS |
denotes |
invaginations |
T4379 |
22034-22035 |
. |
denotes |
. |
T4380 |
22035-22229 |
sentence |
denotes |
With age, however, epidermal folds and undulations developed in areas where Snail was expressed, and proliferative markers persisted in these regions (Figure 3I and 3J; anti-cyclin D staining). |
T4381 |
22036-22040 |
IN |
denotes |
With |
T4382 |
22087-22096 |
VBN |
denotes |
developed |
T4383 |
22041-22044 |
NN |
denotes |
age |
T4384 |
22044-22046 |
, |
denotes |
, |
T4385 |
22046-22053 |
RB |
denotes |
however |
T4386 |
22053-22055 |
, |
denotes |
, |
T4387 |
22055-22064 |
JJ |
denotes |
epidermal |
T4388 |
22065-22070 |
NNS |
denotes |
folds |
T4389 |
22071-22074 |
CC |
denotes |
and |
T4390 |
22075-22086 |
NNS |
denotes |
undulations |
T4391 |
22097-22099 |
IN |
denotes |
in |
T4392 |
22100-22105 |
NNS |
denotes |
areas |
T4393 |
22106-22111 |
WRB |
denotes |
where |
T4394 |
22122-22131 |
VBN |
denotes |
expressed |
T4395 |
22112-22117 |
NN |
denotes |
Snail |
T4396 |
22118-22121 |
VBD |
denotes |
was |
T4397 |
22131-22133 |
, |
denotes |
, |
T4398 |
22133-22136 |
CC |
denotes |
and |
T4399 |
22137-22150 |
JJ |
denotes |
proliferative |
T4400 |
22151-22158 |
NNS |
denotes |
markers |
T4401 |
22159-22168 |
VBD |
denotes |
persisted |
T4402 |
22169-22171 |
IN |
denotes |
in |
T4403 |
22172-22177 |
DT |
denotes |
these |
T4404 |
22178-22185 |
NNS |
denotes |
regions |
T4405 |
22186-22187 |
-LRB- |
denotes |
( |
T4406 |
22219-22227 |
NN |
denotes |
staining |
T4407 |
22187-22193 |
NN |
denotes |
Figure |
T4408 |
22194-22196 |
NN |
denotes |
3I |
T4409 |
22197-22200 |
CC |
denotes |
and |
T4410 |
22201-22203 |
NN |
denotes |
3J |
T4411 |
22203-22204 |
: |
denotes |
; |
T4412 |
22205-22216 |
JJ |
denotes |
anti-cyclin |
T4413 |
22217-22218 |
NN |
denotes |
D |
T4414 |
22227-22228 |
-RRB- |
denotes |
) |
T4415 |
22228-22229 |
. |
denotes |
. |
T4416 |
22229-22341 |
sentence |
denotes |
The undulations were accompanied by partial dissolution of the underlying basement membrane (Figure 3K and 3L). |
T4417 |
22230-22233 |
DT |
denotes |
The |
T4418 |
22234-22245 |
NNS |
denotes |
undulations |
T4419 |
22251-22262 |
VBN |
denotes |
accompanied |
T4420 |
22246-22250 |
VBD |
denotes |
were |
T4421 |
22263-22265 |
IN |
denotes |
by |
T4422 |
22266-22273 |
JJ |
denotes |
partial |
T4423 |
22274-22285 |
NN |
denotes |
dissolution |
T4424 |
22286-22288 |
IN |
denotes |
of |
T4425 |
22289-22292 |
DT |
denotes |
the |
T4426 |
22313-22321 |
NN |
denotes |
membrane |
T4427 |
22293-22303 |
JJ |
denotes |
underlying |
T4428 |
22304-22312 |
NN |
denotes |
basement |
T4429 |
22322-22323 |
-LRB- |
denotes |
( |
T4430 |
22330-22332 |
NN |
denotes |
3K |
T4431 |
22323-22329 |
NN |
denotes |
Figure |
T4432 |
22333-22336 |
CC |
denotes |
and |
T4433 |
22337-22339 |
NN |
denotes |
3L |
T4434 |
22339-22340 |
-RRB- |
denotes |
) |
T4435 |
22340-22341 |
. |
denotes |
. |
T4436 |
22341-22541 |
sentence |
denotes |
Aberrant staining was also observed with antibodies against components of the hemidesmosomes, which provide strong adhesion of basal epidermal cells to the underlying basal lamina (Figure 3M and 3N). |
T4437 |
22342-22350 |
JJ |
denotes |
Aberrant |
T4438 |
22351-22359 |
NN |
denotes |
staining |
T4439 |
22369-22377 |
VBN |
denotes |
observed |
T4440 |
22360-22363 |
VBD |
denotes |
was |
T4441 |
22364-22368 |
RB |
denotes |
also |
T4442 |
22378-22382 |
IN |
denotes |
with |
T4443 |
22383-22393 |
NNS |
denotes |
antibodies |
T4444 |
22394-22401 |
IN |
denotes |
against |
T4445 |
22402-22412 |
NNS |
denotes |
components |
T4446 |
22413-22415 |
IN |
denotes |
of |
T4447 |
22416-22419 |
DT |
denotes |
the |
T4448 |
22420-22434 |
NNS |
denotes |
hemidesmosomes |
T4449 |
22434-22436 |
, |
denotes |
, |
T4450 |
22436-22441 |
WDT |
denotes |
which |
T4451 |
22442-22449 |
VBP |
denotes |
provide |
T4452 |
22450-22456 |
JJ |
denotes |
strong |
T4453 |
22457-22465 |
NN |
denotes |
adhesion |
T4454 |
22466-22468 |
IN |
denotes |
of |
T4455 |
22469-22474 |
JJ |
denotes |
basal |
T4456 |
22485-22490 |
NNS |
denotes |
cells |
T4457 |
22475-22484 |
JJ |
denotes |
epidermal |
T4458 |
22491-22493 |
IN |
denotes |
to |
T4459 |
22494-22497 |
DT |
denotes |
the |
T4460 |
22515-22521 |
NN |
denotes |
lamina |
T4461 |
22498-22508 |
JJ |
denotes |
underlying |
T4462 |
22509-22514 |
JJ |
denotes |
basal |
T4463 |
22522-22523 |
-LRB- |
denotes |
( |
T4464 |
22530-22532 |
NN |
denotes |
3M |
T4465 |
22523-22529 |
NN |
denotes |
Figure |
T4466 |
22533-22536 |
CC |
denotes |
and |
T4467 |
22537-22539 |
NN |
denotes |
3N |
T4468 |
22539-22540 |
-RRB- |
denotes |
) |
T4469 |
22540-22541 |
. |
denotes |
. |
T4470 |
22541-22696 |
sentence |
denotes |
Interestingly, similar types of alterations occur in the basement membrane in the hair bud of embryonic and newborn mice when Snail is normally expressed. |
T4471 |
22542-22555 |
RB |
denotes |
Interestingly |
T4472 |
22586-22591 |
VBP |
denotes |
occur |
T4473 |
22555-22557 |
, |
denotes |
, |
T4474 |
22557-22564 |
JJ |
denotes |
similar |
T4475 |
22565-22570 |
NNS |
denotes |
types |
T4476 |
22571-22573 |
IN |
denotes |
of |
T4477 |
22574-22585 |
NNS |
denotes |
alterations |
T4478 |
22592-22594 |
IN |
denotes |
in |
T4479 |
22595-22598 |
DT |
denotes |
the |
T4480 |
22608-22616 |
NN |
denotes |
membrane |
T4481 |
22599-22607 |
NN |
denotes |
basement |
T4482 |
22617-22619 |
IN |
denotes |
in |
T4483 |
22620-22623 |
DT |
denotes |
the |
T4484 |
22629-22632 |
NN |
denotes |
bud |
T4485 |
22624-22628 |
NN |
denotes |
hair |
T4486 |
22633-22635 |
IN |
denotes |
of |
T4487 |
22636-22645 |
JJ |
denotes |
embryonic |
T4488 |
22658-22662 |
NNS |
denotes |
mice |
T4489 |
22646-22649 |
CC |
denotes |
and |
T4490 |
22650-22657 |
JJ |
denotes |
newborn |
T4491 |
22663-22667 |
WRB |
denotes |
when |
T4492 |
22686-22695 |
VBN |
denotes |
expressed |
T4493 |
22668-22673 |
NN |
denotes |
Snail |
T4494 |
22674-22676 |
VBZ |
denotes |
is |
T4495 |
22677-22685 |
RB |
denotes |
normally |
T4496 |
22695-22696 |
. |
denotes |
. |
T4497 |
22696-22933 |
sentence |
denotes |
The fact that the basement membrane separating the epidermis from the dermis is altered only in the adult Tg animals suggests the involvement of intermediary factors not as readily available in the epidermis as they are in the follicle. |
T4498 |
22697-22700 |
DT |
denotes |
The |
T4499 |
22701-22705 |
NN |
denotes |
fact |
T4500 |
22814-22822 |
VBZ |
denotes |
suggests |
T4501 |
22706-22710 |
IN |
denotes |
that |
T4502 |
22777-22784 |
VBN |
denotes |
altered |
T4503 |
22711-22714 |
DT |
denotes |
the |
T4504 |
22724-22732 |
NN |
denotes |
membrane |
T4505 |
22715-22723 |
NN |
denotes |
basement |
T4506 |
22733-22743 |
VBG |
denotes |
separating |
T4507 |
22744-22747 |
DT |
denotes |
the |
T4508 |
22748-22757 |
NN |
denotes |
epidermis |
T4509 |
22758-22762 |
IN |
denotes |
from |
T4510 |
22763-22766 |
DT |
denotes |
the |
T4511 |
22767-22773 |
NN |
denotes |
dermis |
T4512 |
22774-22776 |
VBZ |
denotes |
is |
T4513 |
22785-22789 |
RB |
denotes |
only |
T4514 |
22790-22792 |
IN |
denotes |
in |
T4515 |
22793-22796 |
DT |
denotes |
the |
T4516 |
22806-22813 |
NNS |
denotes |
animals |
T4517 |
22797-22802 |
JJ |
denotes |
adult |
T4518 |
22803-22805 |
NN |
denotes |
Tg |
T4519 |
22823-22826 |
DT |
denotes |
the |
T4520 |
22827-22838 |
NN |
denotes |
involvement |
T4521 |
22839-22841 |
IN |
denotes |
of |
T4522 |
22842-22854 |
JJ |
denotes |
intermediary |
T4523 |
22855-22862 |
NNS |
denotes |
factors |
T4524 |
22863-22866 |
RB |
denotes |
not |
T4525 |
22878-22887 |
JJ |
denotes |
available |
T4526 |
22867-22869 |
RB |
denotes |
as |
T4527 |
22870-22877 |
RB |
denotes |
readily |
T4528 |
22888-22890 |
IN |
denotes |
in |
T4529 |
22891-22894 |
DT |
denotes |
the |
T4530 |
22895-22904 |
NN |
denotes |
epidermis |
T4531 |
22905-22907 |
IN |
denotes |
as |
T4532 |
22913-22916 |
VBP |
denotes |
are |
T4533 |
22908-22912 |
PRP |
denotes |
they |
T4534 |
22917-22919 |
IN |
denotes |
in |
T4535 |
22920-22923 |
DT |
denotes |
the |
T4536 |
22924-22932 |
NN |
denotes |
follicle |
T4537 |
22932-22933 |
. |
denotes |
. |
T5218 |
22935-22943 |
JJ |
denotes |
Possible |
T5219 |
22944-22949 |
NNS |
denotes |
Links |
T5220 |
22950-22957 |
IN |
denotes |
between |
T5221 |
22958-22967 |
JJ |
denotes |
Epidermal |
T5222 |
22968-22986 |
NN |
denotes |
Hyperproliferation |
T5223 |
22987-22990 |
CC |
denotes |
and |
T5224 |
22991-22995 |
JJ |
denotes |
Down |
T5225 |
22996-23006 |
NN |
denotes |
regulation |
T5226 |
22995-22996 |
HYPH |
denotes |
- |
T5227 |
23007-23009 |
IN |
denotes |
of |
T5228 |
23010-23012 |
NN |
denotes |
AJ |
T5229 |
23013-23021 |
NNS |
denotes |
Proteins |
T5230 |
23022-23024 |
IN |
denotes |
in |
T5231 |
23025-23030 |
NN |
denotes |
Snail |
T5232 |
23034-23038 |
NNS |
denotes |
Mice |
T5233 |
23031-23033 |
NN |
denotes |
Tg |
T5234 |
23038-23358 |
sentence |
denotes |
Given that the E-cadherin promoter is a direct target for Snail-mediated repression in vitro [4,12,13], and that E-cadherin was down-regulated in Snail-expressing hair buds, we examined the status of E-cadherin and other AJ proteins within regions of hyperproliferative epidermis where Tg Snail was present (Figure 4A). |
T5235 |
23039-23044 |
VBN |
denotes |
Given |
T5236 |
23216-23224 |
VBD |
denotes |
examined |
T5237 |
23045-23049 |
IN |
denotes |
that |
T5238 |
23074-23076 |
VBZ |
denotes |
is |
T5239 |
23050-23053 |
DT |
denotes |
the |
T5240 |
23065-23073 |
NN |
denotes |
promoter |
T5241 |
23054-23055 |
NN |
denotes |
E |
T5242 |
23056-23064 |
NN |
denotes |
cadherin |
T5243 |
23055-23056 |
HYPH |
denotes |
- |
T5244 |
23077-23078 |
DT |
denotes |
a |
T5245 |
23086-23092 |
NN |
denotes |
target |
T5246 |
23079-23085 |
JJ |
denotes |
direct |
T5247 |
23093-23096 |
IN |
denotes |
for |
T5248 |
23097-23102 |
NN |
denotes |
Snail |
T5249 |
23103-23111 |
VBN |
denotes |
mediated |
T5250 |
23102-23103 |
HYPH |
denotes |
- |
T5251 |
23112-23122 |
NN |
denotes |
repression |
T5252 |
23123-23125 |
FW |
denotes |
in |
T5253 |
23126-23131 |
FW |
denotes |
vitro |
T5254 |
23132-23133 |
-LRB- |
denotes |
[ |
T5255 |
23138-23140 |
CD |
denotes |
13 |
T5256 |
23133-23134 |
CD |
denotes |
4 |
T5257 |
23134-23135 |
, |
denotes |
, |
T5258 |
23135-23137 |
CD |
denotes |
12 |
T5259 |
23137-23138 |
, |
denotes |
, |
T5260 |
23140-23141 |
-RRB- |
denotes |
] |
T5261 |
23141-23143 |
, |
denotes |
, |
T5262 |
23143-23146 |
CC |
denotes |
and |
T5263 |
23147-23151 |
IN |
denotes |
that |
T5264 |
23172-23181 |
VBN |
denotes |
regulated |
T5265 |
23152-23153 |
NN |
denotes |
E |
T5266 |
23154-23162 |
NN |
denotes |
cadherin |
T5267 |
23153-23154 |
HYPH |
denotes |
- |
T5268 |
23163-23166 |
VBD |
denotes |
was |
T5269 |
23167-23171 |
RB |
denotes |
down |
T5270 |
23171-23172 |
HYPH |
denotes |
- |
T5271 |
23182-23184 |
IN |
denotes |
in |
T5272 |
23185-23190 |
NN |
denotes |
Snail |
T5273 |
23191-23201 |
VBG |
denotes |
expressing |
T5274 |
23190-23191 |
HYPH |
denotes |
- |
T5275 |
23207-23211 |
NNS |
denotes |
buds |
T5276 |
23202-23206 |
NN |
denotes |
hair |
T5277 |
23211-23213 |
, |
denotes |
, |
T5278 |
23213-23215 |
PRP |
denotes |
we |
T5279 |
23225-23228 |
DT |
denotes |
the |
T5280 |
23229-23235 |
NN |
denotes |
status |
T5281 |
23236-23238 |
IN |
denotes |
of |
T5282 |
23239-23240 |
NN |
denotes |
E |
T5283 |
23241-23249 |
NN |
denotes |
cadherin |
T5284 |
23240-23241 |
HYPH |
denotes |
- |
T5285 |
23250-23253 |
CC |
denotes |
and |
T5286 |
23254-23259 |
JJ |
denotes |
other |
T5287 |
23263-23271 |
NN |
denotes |
proteins |
T5288 |
23260-23262 |
NN |
denotes |
AJ |
T5289 |
23272-23278 |
IN |
denotes |
within |
T5290 |
23279-23286 |
NNS |
denotes |
regions |
T5291 |
23287-23289 |
IN |
denotes |
of |
T5292 |
23290-23308 |
JJ |
denotes |
hyperproliferative |
T5293 |
23309-23318 |
NN |
denotes |
epidermis |
T5294 |
23319-23324 |
WRB |
denotes |
where |
T5295 |
23334-23337 |
VBD |
denotes |
was |
T5296 |
23325-23327 |
NN |
denotes |
Tg |
T5297 |
23328-23333 |
NN |
denotes |
Snail |
T5298 |
23338-23345 |
JJ |
denotes |
present |
T5299 |
23346-23347 |
-LRB- |
denotes |
( |
T5300 |
23354-23356 |
NN |
denotes |
4A |
T5301 |
23347-23353 |
NN |
denotes |
Figure |
T5302 |
23356-23357 |
-RRB- |
denotes |
) |
T5303 |
23357-23358 |
. |
denotes |
. |
T5304 |
23358-23458 |
sentence |
denotes |
In these regions, immunofluorescence staining of E-cadherin and α-catenin were markedly diminished. |
T5305 |
23359-23361 |
IN |
denotes |
In |
T5306 |
23447-23457 |
VBN |
denotes |
diminished |
T5307 |
23362-23367 |
DT |
denotes |
these |
T5308 |
23368-23375 |
NNS |
denotes |
regions |
T5309 |
23375-23377 |
, |
denotes |
, |
T5310 |
23377-23395 |
NN |
denotes |
immunofluorescence |
T5311 |
23396-23404 |
NN |
denotes |
staining |
T5312 |
23405-23407 |
IN |
denotes |
of |
T5313 |
23408-23409 |
NN |
denotes |
E |
T5314 |
23410-23418 |
NN |
denotes |
cadherin |
T5315 |
23409-23410 |
HYPH |
denotes |
- |
T5316 |
23419-23422 |
CC |
denotes |
and |
T5317 |
23423-23424 |
NN |
denotes |
α |
T5318 |
23425-23432 |
NN |
denotes |
catenin |
T5319 |
23424-23425 |
HYPH |
denotes |
- |
T5320 |
23433-23437 |
VBD |
denotes |
were |
T5321 |
23438-23446 |
RB |
denotes |
markedly |
T5322 |
23457-23458 |
. |
denotes |
. |
T5323 |
23458-23572 |
sentence |
denotes |
In contrast, the intensity of antibody staining for two other AJ proteins, β-catenin and Ajuba, was still strong. |
T5324 |
23459-23461 |
IN |
denotes |
In |
T5325 |
23555-23558 |
VBD |
denotes |
was |
T5326 |
23462-23470 |
NN |
denotes |
contrast |
T5327 |
23470-23472 |
, |
denotes |
, |
T5328 |
23472-23475 |
DT |
denotes |
the |
T5329 |
23476-23485 |
NN |
denotes |
intensity |
T5330 |
23486-23488 |
IN |
denotes |
of |
T5331 |
23489-23497 |
NN |
denotes |
antibody |
T5332 |
23498-23506 |
NN |
denotes |
staining |
T5333 |
23507-23510 |
IN |
denotes |
for |
T5334 |
23511-23514 |
CD |
denotes |
two |
T5335 |
23524-23532 |
NN |
denotes |
proteins |
T5336 |
23515-23520 |
JJ |
denotes |
other |
T5337 |
23521-23523 |
NN |
denotes |
AJ |
T5338 |
23532-23534 |
, |
denotes |
, |
T5339 |
23534-23535 |
NN |
denotes |
β |
T5340 |
23536-23543 |
NN |
denotes |
catenin |
T5341 |
23535-23536 |
HYPH |
denotes |
- |
T5342 |
23544-23547 |
CC |
denotes |
and |
T5343 |
23548-23553 |
NN |
denotes |
Ajuba |
T5344 |
23553-23555 |
, |
denotes |
, |
T5345 |
23559-23564 |
RB |
denotes |
still |
T5346 |
23565-23571 |
JJ |
denotes |
strong |
T5347 |
23571-23572 |
. |
denotes |
. |
T5348 |
23572-23760 |
sentence |
denotes |
Interestingly, however, despite appreciable immunofluorescence, localization of β-catenin and Ajuba appeared to be largely cytoplasmic rather than at cell-cell borders (Figure 4A insets). |
T5349 |
23573-23586 |
RB |
denotes |
Interestingly |
T5350 |
23673-23681 |
VBD |
denotes |
appeared |
T5351 |
23586-23588 |
, |
denotes |
, |
T5352 |
23588-23595 |
RB |
denotes |
however |
T5353 |
23595-23597 |
, |
denotes |
, |
T5354 |
23597-23604 |
IN |
denotes |
despite |
T5355 |
23605-23616 |
JJ |
denotes |
appreciable |
T5356 |
23617-23635 |
NN |
denotes |
immunofluorescence |
T5357 |
23635-23637 |
, |
denotes |
, |
T5358 |
23637-23649 |
NN |
denotes |
localization |
T5359 |
23650-23652 |
IN |
denotes |
of |
T5360 |
23653-23654 |
NN |
denotes |
β |
T5361 |
23655-23662 |
NN |
denotes |
catenin |
T5362 |
23654-23655 |
HYPH |
denotes |
- |
T5363 |
23663-23666 |
CC |
denotes |
and |
T5364 |
23667-23672 |
NN |
denotes |
Ajuba |
T5365 |
23682-23684 |
TO |
denotes |
to |
T5366 |
23685-23687 |
VB |
denotes |
be |
T5367 |
23688-23695 |
RB |
denotes |
largely |
T5368 |
23696-23707 |
JJ |
denotes |
cytoplasmic |
T5369 |
23708-23714 |
RB |
denotes |
rather |
T5370 |
23715-23719 |
IN |
denotes |
than |
T5371 |
23720-23722 |
IN |
denotes |
at |
T5372 |
23723-23727 |
NN |
denotes |
cell |
T5373 |
23728-23732 |
NN |
denotes |
cell |
T5374 |
23727-23728 |
HYPH |
denotes |
- |
T5375 |
23733-23740 |
NNS |
denotes |
borders |
T5376 |
23741-23742 |
-LRB- |
denotes |
( |
T5377 |
23752-23758 |
NNS |
denotes |
insets |
T5378 |
23742-23748 |
NN |
denotes |
Figure |
T5379 |
23749-23751 |
NN |
denotes |
4A |
T5380 |
23758-23759 |
-RRB- |
denotes |
) |
T5381 |
23759-23760 |
. |
denotes |
. |
T5382 |
23760-27837 |
sentence |
denotes |
Figure 4 Snail-Mediated Remodeling of AJs Contributes to Hyperproliferation
(A) Immunofluorescence of skin sections from P30 Wt and Tg mice. Shown are affected areas of Tg skin; in areas where Snail protein was not expressed, stainings were normal. Antibodies used are against AJ proteins and include E-cadherin (E-cad), the transmembrane core protein; β-catenin (β-cat), which binds E-cadherin at AJs and which can also participate as a transcription cofactor when associated with LEF-1/TCF proteins in the nucleus; α-catenin (α-cat) which binds to both β-catenin and Ajuba, a close relative of zyxin; and Ajuba, which can associate with proteins that bind to the actin cytoskeleton, as well as with Grb-2, a mediator of the GTP nucleotide-exchange protein Sos, involved in activation of the Ras-MAPK signaling cascade. In Snail-expressing Tg regions, there was a reduced staining with anti-E-cad and anti-α-cat and a more diffuse staining with anti-Ajuba. Insets in the panels for β-catenin and Ajuba staining are magnified views of the boxed areas. Arrows mark membrane localization of the protein and asterisks mark cells with elevated levels of cytoplasmic β-catenin or Ajuba.
(B) Western blot analyses of protein extracts from P30 Wt and Tg back and ear skins. Antibodies are as in (A) except anti-P-cad, which detects P-cadherin, whose expression in the hair follicle was not affected, and anti-tubulin, which detects tubulin, a control for equal protein loadings. Note that the reductions seen in E-cadherin and α-catenin are likely to be underestimates of the actual differences in affected regions, since the Tg skin expressed Snail mosaically.
(C) In the presence of elevated Snail, α-catenin levels can be restored by overexpression of E-cadherin. Keratinocytes were transfected with either HA-tagged Snail (Snail[HA]; images on the left) or Snail(HA) and Ecad(HA) (images on the right). 2 d after transfection, cells were switched from low-calcium growth medium to high-calcium medium for 6 h to induce AJ formation. Cells were stained with antibodies as indicated on the panels. Arrowheads point to sites of intercellular contact between a Snail-transfected keratinocyte and its neighboring untransfected cell.
(D) Reintroduction of E-cadherin in keratinocytes expressing Snail returns pMAPK to basal levels. Keratinocytes were transfected with control vector (K14), or Snail(HA), or Snail(HA) + E-cad(HA). After 2 d, cells were serum starved for 4 h and whole cell lysates were made and Western blotted with antibodies to pMAPK, HA to recognize the HA-tagged Snail and E-cadherin protein, 20or tubulin as a loading control.
(E) Ajuba interacts with Grb-2 under conditions where α-catenin levels are reduced. Protein extracts were made from skins of P30 Wt and K14-Snail Tg P30 mice (blots on the left) and of newborn Wt and K14-Cre/α-catenin (fl/fl) conditionally null animals (blots on the right) [7]. Equal amounts of protein extracts were treated with anti-Grb-2 antibody (+) or control isotype antibody (–), and following centrifugation, immunoprecipitates were subjected to SDS-PAGE and Western blot analysis with anti-Ajuba and anti-Grb-2 antibodies. Note the presence of Ajuba only under conditions where levels of α-catenin and other AJ proteins were aberrantly low or absent.
(F) Transgene expression of excess Ajuba or the Grb-2-interacting domain (pre-LIM) of Ajuba in keratinocytes results in the activation of the Ras-MAPK pathway. Primary newborn mouse keratinocytes were transfected with either the empty K14 expression vector (K14), or the expression vector driving Snail, full length Ajuba, or the pre-LIM domain of Ajuba in the absence or presence of a peptide inhibitor (inh) that disrupts the interaction between Grb-2 and Sos. 48 h posttransfection, protein extracts were prepared and subjected to SDS-PAGE and Western blot analyses with antibodies against pMAPK, total MAPK, Ajuba (also recognizing the smaller, pre-LIM domain), and Snail. Architectural differences in the epidermis made Western blot analyses somewhat difficult to gauge. |
T5383 |
27739-27752 |
JJ |
denotes |
Architectural |
T5384 |
27753-27764 |
NNS |
denotes |
differences |
T5385 |
27782-27786 |
VBD |
denotes |
made |
T5386 |
27765-27767 |
IN |
denotes |
in |
T5387 |
27768-27771 |
DT |
denotes |
the |
T5388 |
27772-27781 |
NN |
denotes |
epidermis |
T5389 |
27787-27794 |
NNP |
denotes |
Western |
T5390 |
27795-27799 |
NN |
denotes |
blot |
T5391 |
27800-27808 |
NNS |
denotes |
analyses |
T5392 |
27818-27827 |
JJ |
denotes |
difficult |
T5393 |
27809-27817 |
RB |
denotes |
somewhat |
T5394 |
27828-27830 |
TO |
denotes |
to |
T5395 |
27831-27836 |
VB |
denotes |
gauge |
T5396 |
27836-27837 |
. |
denotes |
. |
T5397 |
27837-27963 |
sentence |
denotes |
However, in regions such as ear skin, where the highest levels of Snail protein were expressed, the effects were accentuated. |
T5398 |
27838-27845 |
RB |
denotes |
However |
T5399 |
27951-27962 |
VBN |
denotes |
accentuated |
T5400 |
27845-27847 |
, |
denotes |
, |
T5401 |
27847-27849 |
IN |
denotes |
in |
T5402 |
27850-27857 |
NNS |
denotes |
regions |
T5403 |
27858-27862 |
JJ |
denotes |
such |
T5404 |
27863-27865 |
IN |
denotes |
as |
T5405 |
27866-27869 |
NN |
denotes |
ear |
T5406 |
27870-27874 |
NN |
denotes |
skin |
T5407 |
27874-27876 |
, |
denotes |
, |
T5408 |
27876-27881 |
WRB |
denotes |
where |
T5409 |
27923-27932 |
VBN |
denotes |
expressed |
T5410 |
27882-27885 |
DT |
denotes |
the |
T5411 |
27894-27900 |
NNS |
denotes |
levels |
T5412 |
27886-27893 |
JJS |
denotes |
highest |
T5413 |
27901-27903 |
IN |
denotes |
of |
T5414 |
27904-27909 |
NN |
denotes |
Snail |
T5415 |
27910-27917 |
NN |
denotes |
protein |
T5416 |
27918-27922 |
VBD |
denotes |
were |
T5417 |
27932-27934 |
, |
denotes |
, |
T5418 |
27934-27937 |
DT |
denotes |
the |
T5419 |
27938-27945 |
NNS |
denotes |
effects |
T5420 |
27946-27950 |
VBD |
denotes |
were |
T5421 |
27962-27963 |
. |
denotes |
. |
T5422 |
27963-28155 |
sentence |
denotes |
In both back skin and ear skin, overall levels of E-cadherin and α-catenin were reduced, under conditions where β-catenin and Ajuba levels remained unchanged relative to controls (Figure 4B). |
T5423 |
27964-27966 |
IN |
denotes |
In |
T5424 |
28044-28051 |
VBN |
denotes |
reduced |
T5425 |
27967-27971 |
CC |
denotes |
both |
T5426 |
27977-27981 |
NN |
denotes |
skin |
T5427 |
27972-27976 |
NN |
denotes |
back |
T5428 |
27982-27985 |
CC |
denotes |
and |
T5429 |
27986-27989 |
NN |
denotes |
ear |
T5430 |
27990-27994 |
NN |
denotes |
skin |
T5431 |
27994-27996 |
, |
denotes |
, |
T5432 |
27996-28003 |
JJ |
denotes |
overall |
T5433 |
28004-28010 |
NNS |
denotes |
levels |
T5434 |
28011-28013 |
IN |
denotes |
of |
T5435 |
28014-28015 |
NN |
denotes |
E |
T5436 |
28016-28024 |
NN |
denotes |
cadherin |
T5437 |
28015-28016 |
HYPH |
denotes |
- |
T5438 |
28025-28028 |
CC |
denotes |
and |
T5439 |
28029-28030 |
NN |
denotes |
α |
T5440 |
28031-28038 |
NN |
denotes |
catenin |
T5441 |
28030-28031 |
HYPH |
denotes |
- |
T5442 |
28039-28043 |
VBD |
denotes |
were |
T5443 |
28051-28053 |
, |
denotes |
, |
T5444 |
28053-28058 |
IN |
denotes |
under |
T5445 |
28059-28069 |
NNS |
denotes |
conditions |
T5446 |
28070-28075 |
WRB |
denotes |
where |
T5447 |
28103-28111 |
VBD |
denotes |
remained |
T5448 |
28076-28077 |
NN |
denotes |
β |
T5449 |
28078-28085 |
NN |
denotes |
catenin |
T5450 |
28077-28078 |
HYPH |
denotes |
- |
T5451 |
28096-28102 |
NNS |
denotes |
levels |
T5452 |
28086-28089 |
CC |
denotes |
and |
T5453 |
28090-28095 |
NN |
denotes |
Ajuba |
T5454 |
28112-28121 |
JJ |
denotes |
unchanged |
T5455 |
28122-28130 |
JJ |
denotes |
relative |
T5456 |
28131-28133 |
IN |
denotes |
to |
T5457 |
28134-28142 |
NNS |
denotes |
controls |
T5458 |
28143-28144 |
-LRB- |
denotes |
( |
T5459 |
28151-28153 |
NN |
denotes |
4B |
T5460 |
28144-28150 |
NN |
denotes |
Figure |
T5461 |
28153-28154 |
-RRB- |
denotes |
) |
T5462 |
28154-28155 |
. |
denotes |
. |
T5463 |
28155-28260 |
sentence |
denotes |
Taken together, these data were consistent with our results obtained from immunofluorescence microscopy. |
T5464 |
28156-28161 |
VBN |
denotes |
Taken |
T5465 |
28183-28187 |
VBD |
denotes |
were |
T5466 |
28162-28170 |
RB |
denotes |
together |
T5467 |
28170-28172 |
, |
denotes |
, |
T5468 |
28172-28177 |
DT |
denotes |
these |
T5469 |
28178-28182 |
NNS |
denotes |
data |
T5470 |
28188-28198 |
JJ |
denotes |
consistent |
T5471 |
28199-28203 |
IN |
denotes |
with |
T5472 |
28204-28207 |
PRP$ |
denotes |
our |
T5473 |
28208-28215 |
NNS |
denotes |
results |
T5474 |
28216-28224 |
VBN |
denotes |
obtained |
T5475 |
28225-28229 |
IN |
denotes |
from |
T5476 |
28230-28248 |
NN |
denotes |
immunofluorescence |
T5477 |
28249-28259 |
NN |
denotes |
microscopy |
T5478 |
28259-28260 |
. |
denotes |
. |
T5479 |
28260-28456 |
sentence |
denotes |
A priori, the decrease in α-catenin levels could be due to either direct transcriptional repression by Snail or perturbations in AJ formation caused by the decrease in E-cadherin gene expression. |
T5480 |
28261-28262 |
FW |
denotes |
A |
T5481 |
28263-28269 |
FW |
denotes |
priori |
T5482 |
28310-28312 |
VB |
denotes |
be |
T5483 |
28269-28271 |
, |
denotes |
, |
T5484 |
28271-28274 |
DT |
denotes |
the |
T5485 |
28275-28283 |
NN |
denotes |
decrease |
T5486 |
28284-28286 |
IN |
denotes |
in |
T5487 |
28287-28288 |
NN |
denotes |
α |
T5488 |
28289-28296 |
NN |
denotes |
catenin |
T5489 |
28288-28289 |
HYPH |
denotes |
- |
T5490 |
28297-28303 |
NNS |
denotes |
levels |
T5491 |
28304-28309 |
MD |
denotes |
could |
T5492 |
28313-28316 |
IN |
denotes |
due |
T5493 |
28317-28319 |
IN |
denotes |
to |
T5494 |
28320-28326 |
CC |
denotes |
either |
T5495 |
28350-28360 |
NN |
denotes |
repression |
T5496 |
28327-28333 |
JJ |
denotes |
direct |
T5497 |
28334-28349 |
JJ |
denotes |
transcriptional |
T5498 |
28361-28363 |
IN |
denotes |
by |
T5499 |
28364-28369 |
NN |
denotes |
Snail |
T5500 |
28370-28372 |
CC |
denotes |
or |
T5501 |
28373-28386 |
NNS |
denotes |
perturbations |
T5502 |
28387-28389 |
IN |
denotes |
in |
T5503 |
28390-28392 |
NN |
denotes |
AJ |
T5504 |
28393-28402 |
NN |
denotes |
formation |
T5505 |
28403-28409 |
VBN |
denotes |
caused |
T5506 |
28410-28412 |
IN |
denotes |
by |
T5507 |
28413-28416 |
DT |
denotes |
the |
T5508 |
28417-28425 |
NN |
denotes |
decrease |
T5509 |
28426-28428 |
IN |
denotes |
in |
T5510 |
28429-28430 |
NN |
denotes |
E |
T5511 |
28431-28439 |
NN |
denotes |
cadherin |
T5512 |
28430-28431 |
HYPH |
denotes |
- |
T5513 |
28445-28455 |
NN |
denotes |
expression |
T5514 |
28440-28444 |
NN |
denotes |
gene |
T5515 |
28455-28456 |
. |
denotes |
. |
T5516 |
28456-28626 |
sentence |
denotes |
To distinguish between these possibilities, we tested whether α-catenin levels could be restored by exogenous expression of E-cadherin in Snail-expressing keratinocytes. |
T5517 |
28457-28459 |
TO |
denotes |
To |
T5518 |
28460-28471 |
VB |
denotes |
distinguish |
T5519 |
28504-28510 |
VBD |
denotes |
tested |
T5520 |
28472-28479 |
IN |
denotes |
between |
T5521 |
28480-28485 |
DT |
denotes |
these |
T5522 |
28486-28499 |
NNS |
denotes |
possibilities |
T5523 |
28499-28501 |
, |
denotes |
, |
T5524 |
28501-28503 |
PRP |
denotes |
we |
T5525 |
28511-28518 |
IN |
denotes |
whether |
T5526 |
28545-28553 |
VBN |
denotes |
restored |
T5527 |
28519-28520 |
NN |
denotes |
α |
T5528 |
28521-28528 |
NN |
denotes |
catenin |
T5529 |
28520-28521 |
HYPH |
denotes |
- |
T5530 |
28529-28535 |
NNS |
denotes |
levels |
T5531 |
28536-28541 |
MD |
denotes |
could |
T5532 |
28542-28544 |
VB |
denotes |
be |
T5533 |
28554-28556 |
IN |
denotes |
by |
T5534 |
28557-28566 |
JJ |
denotes |
exogenous |
T5535 |
28567-28577 |
NN |
denotes |
expression |
T5536 |
28578-28580 |
IN |
denotes |
of |
T5537 |
28581-28582 |
NN |
denotes |
E |
T5538 |
28583-28591 |
NN |
denotes |
cadherin |
T5539 |
28582-28583 |
HYPH |
denotes |
- |
T5540 |
28592-28594 |
IN |
denotes |
in |
T5541 |
28595-28600 |
NN |
denotes |
Snail |
T5542 |
28601-28611 |
VBG |
denotes |
expressing |
T5543 |
28600-28601 |
HYPH |
denotes |
- |
T5544 |
28612-28625 |
NNS |
denotes |
keratinocytes |
T5545 |
28625-28626 |
. |
denotes |
. |
T5546 |
28626-28781 |
sentence |
denotes |
As shown in Figure 4C, transiently transfected keratinocytes expressing HA-tagged Snail displayed a loss of E-cadherin and α-catenin at cell-cell borders. |
T5547 |
28627-28629 |
IN |
denotes |
As |
T5548 |
28630-28635 |
VBN |
denotes |
shown |
T5549 |
28715-28724 |
VBD |
denotes |
displayed |
T5550 |
28636-28638 |
IN |
denotes |
in |
T5551 |
28639-28645 |
NN |
denotes |
Figure |
T5552 |
28646-28648 |
NN |
denotes |
4C |
T5553 |
28648-28650 |
, |
denotes |
, |
T5554 |
28650-28661 |
RB |
denotes |
transiently |
T5555 |
28662-28673 |
VBN |
denotes |
transfected |
T5556 |
28674-28687 |
NNS |
denotes |
keratinocytes |
T5557 |
28688-28698 |
VBG |
denotes |
expressing |
T5558 |
28699-28701 |
NN |
denotes |
HA |
T5559 |
28702-28708 |
VBN |
denotes |
tagged |
T5560 |
28701-28702 |
HYPH |
denotes |
- |
T5561 |
28709-28714 |
NN |
denotes |
Snail |
T5562 |
28725-28726 |
DT |
denotes |
a |
T5563 |
28727-28731 |
NN |
denotes |
loss |
T5564 |
28732-28734 |
IN |
denotes |
of |
T5565 |
28735-28736 |
NN |
denotes |
E |
T5566 |
28737-28745 |
NN |
denotes |
cadherin |
T5567 |
28736-28737 |
HYPH |
denotes |
- |
T5568 |
28746-28749 |
CC |
denotes |
and |
T5569 |
28750-28751 |
NN |
denotes |
α |
T5570 |
28752-28759 |
NN |
denotes |
catenin |
T5571 |
28751-28752 |
HYPH |
denotes |
- |
T5572 |
28760-28762 |
IN |
denotes |
at |
T5573 |
28763-28767 |
NN |
denotes |
cell |
T5574 |
28768-28772 |
NN |
denotes |
cell |
T5575 |
28767-28768 |
HYPH |
denotes |
- |
T5576 |
28773-28780 |
NNS |
denotes |
borders |
T5577 |
28780-28781 |
. |
denotes |
. |
T5578 |
28781-28971 |
sentence |
denotes |
Coexpression of exogenous HA-tagged E-cadherin not only enabled cell-cell border localization of E-cadherin protein, but also rescued the cell-cell border staining of α-catenin (Figure 4C). |
T5579 |
28782-28794 |
NN |
denotes |
Coexpression |
T5580 |
28838-28845 |
VBD |
denotes |
enabled |
T5581 |
28795-28797 |
IN |
denotes |
of |
T5582 |
28798-28807 |
JJ |
denotes |
exogenous |
T5583 |
28820-28828 |
NN |
denotes |
cadherin |
T5584 |
28808-28810 |
NN |
denotes |
HA |
T5585 |
28811-28817 |
VBN |
denotes |
tagged |
T5586 |
28810-28811 |
HYPH |
denotes |
- |
T5587 |
28818-28819 |
NN |
denotes |
E |
T5588 |
28819-28820 |
HYPH |
denotes |
- |
T5589 |
28829-28832 |
RB |
denotes |
not |
T5590 |
28833-28837 |
RB |
denotes |
only |
T5591 |
28846-28850 |
NN |
denotes |
cell |
T5592 |
28851-28855 |
NN |
denotes |
cell |
T5593 |
28850-28851 |
HYPH |
denotes |
- |
T5594 |
28863-28875 |
NN |
denotes |
localization |
T5595 |
28856-28862 |
NN |
denotes |
border |
T5596 |
28876-28878 |
IN |
denotes |
of |
T5597 |
28879-28880 |
NN |
denotes |
E |
T5598 |
28881-28889 |
NN |
denotes |
cadherin |
T5599 |
28880-28881 |
HYPH |
denotes |
- |
T5600 |
28890-28897 |
NN |
denotes |
protein |
T5601 |
28897-28899 |
, |
denotes |
, |
T5602 |
28899-28902 |
CC |
denotes |
but |
T5603 |
28903-28907 |
RB |
denotes |
also |
T5604 |
28908-28915 |
VBD |
denotes |
rescued |
T5605 |
28916-28919 |
DT |
denotes |
the |
T5606 |
28937-28945 |
NN |
denotes |
staining |
T5607 |
28920-28924 |
NN |
denotes |
cell |
T5608 |
28925-28929 |
NN |
denotes |
cell |
T5609 |
28924-28925 |
HYPH |
denotes |
- |
T5610 |
28930-28936 |
NN |
denotes |
border |
T5611 |
28946-28948 |
IN |
denotes |
of |
T5612 |
28949-28950 |
NN |
denotes |
α |
T5613 |
28951-28958 |
NN |
denotes |
catenin |
T5614 |
28950-28951 |
HYPH |
denotes |
- |
T5615 |
28959-28960 |
-LRB- |
denotes |
( |
T5616 |
28967-28969 |
NN |
denotes |
4C |
T5617 |
28960-28966 |
NN |
denotes |
Figure |
T5618 |
28969-28970 |
-RRB- |
denotes |
) |
T5619 |
28970-28971 |
. |
denotes |
. |
T5620 |
28971-29131 |
sentence |
denotes |
The ability to restore α-catenin expression and localization under these conditions argues against the notion that Snail transcriptionally represses α-catenin. |
T5621 |
28972-28975 |
DT |
denotes |
The |
T5622 |
28976-28983 |
NN |
denotes |
ability |
T5623 |
29056-29062 |
VBZ |
denotes |
argues |
T5624 |
28984-28986 |
TO |
denotes |
to |
T5625 |
28987-28994 |
VB |
denotes |
restore |
T5626 |
28995-28996 |
NN |
denotes |
α |
T5627 |
28997-29004 |
NN |
denotes |
catenin |
T5628 |
28996-28997 |
HYPH |
denotes |
- |
T5629 |
29005-29015 |
NN |
denotes |
expression |
T5630 |
29016-29019 |
CC |
denotes |
and |
T5631 |
29020-29032 |
NN |
denotes |
localization |
T5632 |
29033-29038 |
IN |
denotes |
under |
T5633 |
29039-29044 |
DT |
denotes |
these |
T5634 |
29045-29055 |
NNS |
denotes |
conditions |
T5635 |
29063-29070 |
IN |
denotes |
against |
T5636 |
29071-29074 |
DT |
denotes |
the |
T5637 |
29075-29081 |
NN |
denotes |
notion |
T5638 |
29082-29086 |
IN |
denotes |
that |
T5639 |
29111-29120 |
VBZ |
denotes |
represses |
T5640 |
29087-29092 |
NN |
denotes |
Snail |
T5641 |
29093-29110 |
RB |
denotes |
transcriptionally |
T5642 |
29121-29122 |
NN |
denotes |
α |
T5643 |
29123-29130 |
NN |
denotes |
catenin |
T5644 |
29122-29123 |
HYPH |
denotes |
- |
T5645 |
29130-29131 |
. |
denotes |
. |
T5646 |
29131-29262 |
sentence |
denotes |
Rather, the findings are consistent with a previous report that E-cadherin is required for the translation of α-catenin mRNA [22]. |
T5647 |
29132-29138 |
RB |
denotes |
Rather |
T5648 |
29153-29156 |
VBP |
denotes |
are |
T5649 |
29138-29140 |
, |
denotes |
, |
T5650 |
29140-29143 |
DT |
denotes |
the |
T5651 |
29144-29152 |
NNS |
denotes |
findings |
T5652 |
29157-29167 |
JJ |
denotes |
consistent |
T5653 |
29168-29172 |
IN |
denotes |
with |
T5654 |
29173-29174 |
DT |
denotes |
a |
T5655 |
29184-29190 |
NN |
denotes |
report |
T5656 |
29175-29183 |
JJ |
denotes |
previous |
T5657 |
29191-29195 |
IN |
denotes |
that |
T5658 |
29210-29218 |
VBN |
denotes |
required |
T5659 |
29196-29197 |
NN |
denotes |
E |
T5660 |
29198-29206 |
NN |
denotes |
cadherin |
T5661 |
29197-29198 |
HYPH |
denotes |
- |
T5662 |
29207-29209 |
VBZ |
denotes |
is |
T5663 |
29219-29222 |
IN |
denotes |
for |
T5664 |
29223-29226 |
DT |
denotes |
the |
T5665 |
29227-29238 |
NN |
denotes |
translation |
T5666 |
29239-29241 |
IN |
denotes |
of |
T5667 |
29242-29243 |
NN |
denotes |
α |
T5668 |
29244-29251 |
NN |
denotes |
catenin |
T5669 |
29243-29244 |
HYPH |
denotes |
- |
T5670 |
29252-29256 |
NN |
denotes |
mRNA |
T5671 |
29257-29258 |
-LRB- |
denotes |
[ |
T5672 |
29258-29260 |
CD |
denotes |
22 |
T5673 |
29260-29261 |
-RRB- |
denotes |
] |
T5674 |
29261-29262 |
. |
denotes |
. |
T5675 |
29262-29453 |
sentence |
denotes |
Despite the reductions in AJ markers, Tg skin still displayed sealed membranes and intercellular junctions that were largely intact, as judged by ultrastructural analyses (unpublished data). |
T5676 |
29263-29270 |
IN |
denotes |
Despite |
T5677 |
29315-29324 |
VBD |
denotes |
displayed |
T5678 |
29271-29274 |
DT |
denotes |
the |
T5679 |
29275-29285 |
NNS |
denotes |
reductions |
T5680 |
29286-29288 |
IN |
denotes |
in |
T5681 |
29289-29291 |
NN |
denotes |
AJ |
T5682 |
29292-29299 |
NNS |
denotes |
markers |
T5683 |
29299-29301 |
, |
denotes |
, |
T5684 |
29301-29303 |
NN |
denotes |
Tg |
T5685 |
29304-29308 |
NN |
denotes |
skin |
T5686 |
29309-29314 |
RB |
denotes |
still |
T5687 |
29325-29331 |
JJ |
denotes |
sealed |
T5688 |
29332-29341 |
NNS |
denotes |
membranes |
T5689 |
29342-29345 |
CC |
denotes |
and |
T5690 |
29346-29359 |
JJ |
denotes |
intercellular |
T5691 |
29360-29369 |
NNS |
denotes |
junctions |
T5692 |
29370-29374 |
WDT |
denotes |
that |
T5693 |
29375-29379 |
VBD |
denotes |
were |
T5694 |
29380-29387 |
RB |
denotes |
largely |
T5695 |
29388-29394 |
JJ |
denotes |
intact |
T5696 |
29394-29396 |
, |
denotes |
, |
T5697 |
29396-29398 |
IN |
denotes |
as |
T5698 |
29399-29405 |
VBN |
denotes |
judged |
T5699 |
29406-29408 |
IN |
denotes |
by |
T5700 |
29409-29424 |
JJ |
denotes |
ultrastructural |
T5701 |
29425-29433 |
NNS |
denotes |
analyses |
T5702 |
29434-29435 |
-LRB- |
denotes |
( |
T5703 |
29447-29451 |
NNS |
denotes |
data |
T5704 |
29435-29446 |
JJ |
denotes |
unpublished |
T5705 |
29451-29452 |
-RRB- |
denotes |
) |
T5706 |
29452-29453 |
. |
denotes |
. |
T5707 |
29453-29651 |
sentence |
denotes |
In this respect, the skin epithelium resembled that of the hair bud, where the down-regulation in junction proteins is permissive for cell-cell remodeling without abrogating intercellular adhesion. |
T5708 |
29454-29456 |
IN |
denotes |
In |
T5709 |
29491-29500 |
VBD |
denotes |
resembled |
T5710 |
29457-29461 |
DT |
denotes |
this |
T5711 |
29462-29469 |
NN |
denotes |
respect |
T5712 |
29469-29471 |
, |
denotes |
, |
T5713 |
29471-29474 |
DT |
denotes |
the |
T5714 |
29480-29490 |
NN |
denotes |
epithelium |
T5715 |
29475-29479 |
NN |
denotes |
skin |
T5716 |
29501-29505 |
DT |
denotes |
that |
T5717 |
29506-29508 |
IN |
denotes |
of |
T5718 |
29509-29512 |
DT |
denotes |
the |
T5719 |
29518-29521 |
NN |
denotes |
bud |
T5720 |
29513-29517 |
NN |
denotes |
hair |
T5721 |
29521-29523 |
, |
denotes |
, |
T5722 |
29523-29528 |
WRB |
denotes |
where |
T5723 |
29570-29572 |
VBZ |
denotes |
is |
T5724 |
29529-29532 |
DT |
denotes |
the |
T5725 |
29538-29548 |
NN |
denotes |
regulation |
T5726 |
29533-29537 |
JJ |
denotes |
down |
T5727 |
29537-29538 |
HYPH |
denotes |
- |
T5728 |
29549-29551 |
IN |
denotes |
in |
T5729 |
29552-29560 |
NN |
denotes |
junction |
T5730 |
29561-29569 |
NN |
denotes |
proteins |
T5731 |
29573-29583 |
JJ |
denotes |
permissive |
T5732 |
29584-29587 |
IN |
denotes |
for |
T5733 |
29588-29592 |
NN |
denotes |
cell |
T5734 |
29593-29597 |
NN |
denotes |
cell |
T5735 |
29592-29593 |
HYPH |
denotes |
- |
T5736 |
29598-29608 |
NN |
denotes |
remodeling |
T5737 |
29609-29616 |
IN |
denotes |
without |
T5738 |
29617-29627 |
VBG |
denotes |
abrogating |
T5739 |
29628-29641 |
JJ |
denotes |
intercellular |
T5740 |
29642-29650 |
NN |
denotes |
adhesion |
T5741 |
29650-29651 |
. |
denotes |
. |
T5742 |
29651-29851 |
sentence |
denotes |
The similarities between Snail Tg epidermis and hair buds extended to the hyperproliferative state, leading us to wonder whether the down-regulation of AJ proteins might contribute to this condition. |
T5743 |
29652-29655 |
DT |
denotes |
The |
T5744 |
29656-29668 |
NNS |
denotes |
similarities |
T5745 |
29710-29718 |
VBD |
denotes |
extended |
T5746 |
29669-29676 |
IN |
denotes |
between |
T5747 |
29677-29682 |
NN |
denotes |
Snail |
T5748 |
29686-29695 |
NN |
denotes |
epidermis |
T5749 |
29683-29685 |
NN |
denotes |
Tg |
T5750 |
29696-29699 |
CC |
denotes |
and |
T5751 |
29700-29704 |
NN |
denotes |
hair |
T5752 |
29705-29709 |
NNS |
denotes |
buds |
T5753 |
29719-29721 |
IN |
denotes |
to |
T5754 |
29722-29725 |
DT |
denotes |
the |
T5755 |
29745-29750 |
NN |
denotes |
state |
T5756 |
29726-29744 |
JJ |
denotes |
hyperproliferative |
T5757 |
29750-29752 |
, |
denotes |
, |
T5758 |
29752-29759 |
VBG |
denotes |
leading |
T5759 |
29760-29762 |
PRP |
denotes |
us |
T5760 |
29763-29765 |
TO |
denotes |
to |
T5761 |
29766-29772 |
VB |
denotes |
wonder |
T5762 |
29773-29780 |
IN |
denotes |
whether |
T5763 |
29822-29832 |
VB |
denotes |
contribute |
T5764 |
29781-29784 |
DT |
denotes |
the |
T5765 |
29790-29800 |
NN |
denotes |
regulation |
T5766 |
29785-29789 |
JJ |
denotes |
down |
T5767 |
29789-29790 |
HYPH |
denotes |
- |
T5768 |
29801-29803 |
IN |
denotes |
of |
T5769 |
29804-29806 |
NN |
denotes |
AJ |
T5770 |
29807-29815 |
NN |
denotes |
proteins |
T5771 |
29816-29821 |
MD |
denotes |
might |
T5772 |
29833-29835 |
IN |
denotes |
to |
T5773 |
29836-29840 |
DT |
denotes |
this |
T5774 |
29841-29850 |
NN |
denotes |
condition |
T5775 |
29850-29851 |
. |
denotes |
. |
T5776 |
29851-30061 |
sentence |
denotes |
Given the increase in pMAPK staining in Snail Tg epidermis (see Figure 2G), we used pMAPK levels as our assay to test whether the loss of E-cadherin contributed to the Snail-mediated increase in proliferation. |
T5777 |
29852-29857 |
VBN |
denotes |
Given |
T5778 |
29931-29935 |
VBD |
denotes |
used |
T5779 |
29858-29861 |
DT |
denotes |
the |
T5780 |
29862-29870 |
NN |
denotes |
increase |
T5781 |
29871-29873 |
IN |
denotes |
in |
T5782 |
29874-29879 |
NN |
denotes |
pMAPK |
T5783 |
29880-29888 |
NN |
denotes |
staining |
T5784 |
29889-29891 |
IN |
denotes |
in |
T5785 |
29892-29897 |
NN |
denotes |
Snail |
T5786 |
29901-29910 |
NN |
denotes |
epidermis |
T5787 |
29898-29900 |
NN |
denotes |
Tg |
T5788 |
29911-29912 |
-LRB- |
denotes |
( |
T5789 |
29912-29915 |
VB |
denotes |
see |
T5790 |
29916-29922 |
NN |
denotes |
Figure |
T5791 |
29923-29925 |
NN |
denotes |
2G |
T5792 |
29925-29926 |
-RRB- |
denotes |
) |
T5793 |
29926-29928 |
, |
denotes |
, |
T5794 |
29928-29930 |
PRP |
denotes |
we |
T5795 |
29936-29941 |
NN |
denotes |
pMAPK |
T5796 |
29942-29948 |
NNS |
denotes |
levels |
T5797 |
29949-29951 |
IN |
denotes |
as |
T5798 |
29952-29955 |
PRP$ |
denotes |
our |
T5799 |
29956-29961 |
NN |
denotes |
assay |
T5800 |
29962-29964 |
TO |
denotes |
to |
T5801 |
29965-29969 |
VB |
denotes |
test |
T5802 |
29970-29977 |
IN |
denotes |
whether |
T5803 |
30001-30012 |
VBD |
denotes |
contributed |
T5804 |
29978-29981 |
DT |
denotes |
the |
T5805 |
29982-29986 |
NN |
denotes |
loss |
T5806 |
29987-29989 |
IN |
denotes |
of |
T5807 |
29990-29991 |
NN |
denotes |
E |
T5808 |
29992-30000 |
NN |
denotes |
cadherin |
T5809 |
29991-29992 |
HYPH |
denotes |
- |
T5810 |
30013-30015 |
IN |
denotes |
to |
T5811 |
30016-30019 |
DT |
denotes |
the |
T5812 |
30035-30043 |
NN |
denotes |
increase |
T5813 |
30020-30025 |
NN |
denotes |
Snail |
T5814 |
30026-30034 |
VBN |
denotes |
mediated |
T5815 |
30025-30026 |
HYPH |
denotes |
- |
T5816 |
30044-30046 |
IN |
denotes |
in |
T5817 |
30047-30060 |
NN |
denotes |
proliferation |
T5818 |
30060-30061 |
. |
denotes |
. |
T5819 |
30061-30234 |
sentence |
denotes |
Consistent with our in vivo observations, transfected keratinocytes expressing Snail exhibited a substantial increase in pMAPK levels relative to control cells (Figure 4D). |
T5820 |
30062-30072 |
JJ |
denotes |
Consistent |
T5821 |
30147-30156 |
VBD |
denotes |
exhibited |
T5822 |
30073-30077 |
IN |
denotes |
with |
T5823 |
30078-30081 |
PRP$ |
denotes |
our |
T5824 |
30090-30102 |
NNS |
denotes |
observations |
T5825 |
30082-30084 |
FW |
denotes |
in |
T5826 |
30085-30089 |
FW |
denotes |
vivo |
T5827 |
30102-30104 |
, |
denotes |
, |
T5828 |
30104-30115 |
VBN |
denotes |
transfected |
T5829 |
30116-30129 |
NNS |
denotes |
keratinocytes |
T5830 |
30130-30140 |
VBG |
denotes |
expressing |
T5831 |
30141-30146 |
NN |
denotes |
Snail |
T5832 |
30157-30158 |
DT |
denotes |
a |
T5833 |
30171-30179 |
NN |
denotes |
increase |
T5834 |
30159-30170 |
JJ |
denotes |
substantial |
T5835 |
30180-30182 |
IN |
denotes |
in |
T5836 |
30183-30188 |
NN |
denotes |
pMAPK |
T5837 |
30189-30195 |
NNS |
denotes |
levels |
T5838 |
30196-30204 |
JJ |
denotes |
relative |
T5839 |
30205-30207 |
IN |
denotes |
to |
T5840 |
30208-30215 |
NN |
denotes |
control |
T5841 |
30216-30221 |
NNS |
denotes |
cells |
T5842 |
30222-30223 |
-LRB- |
denotes |
( |
T5843 |
30230-30232 |
NN |
denotes |
4D |
T5844 |
30223-30229 |
NN |
denotes |
Figure |
T5845 |
30232-30233 |
-RRB- |
denotes |
) |
T5846 |
30233-30234 |
. |
denotes |
. |
T5847 |
30234-30306 |
sentence |
denotes |
Coexpression of E-cadherin with Snail appeared to abrogate this effect. |
T5848 |
30235-30247 |
NN |
denotes |
Coexpression |
T5849 |
30273-30281 |
VBD |
denotes |
appeared |
T5850 |
30248-30250 |
IN |
denotes |
of |
T5851 |
30251-30252 |
NN |
denotes |
E |
T5852 |
30253-30261 |
NN |
denotes |
cadherin |
T5853 |
30252-30253 |
HYPH |
denotes |
- |
T5854 |
30262-30266 |
IN |
denotes |
with |
T5855 |
30267-30272 |
NN |
denotes |
Snail |
T5856 |
30282-30284 |
TO |
denotes |
to |
T5857 |
30285-30293 |
VB |
denotes |
abrogate |
T5858 |
30294-30298 |
DT |
denotes |
this |
T5859 |
30299-30305 |
NN |
denotes |
effect |
T5860 |
30305-30306 |
. |
denotes |
. |
T5861 |
30306-30517 |
sentence |
denotes |
Together, these findings raised the possibility that an AJ-associated protein that is normally sequestered at the plasma membrane may participate in a proliferation signaling pathway when AJs are deconstructed. |
T5862 |
30307-30315 |
RB |
denotes |
Together |
T5863 |
30332-30338 |
VBD |
denotes |
raised |
T5864 |
30315-30317 |
, |
denotes |
, |
T5865 |
30317-30322 |
DT |
denotes |
these |
T5866 |
30323-30331 |
NNS |
denotes |
findings |
T5867 |
30339-30342 |
DT |
denotes |
the |
T5868 |
30343-30354 |
NN |
denotes |
possibility |
T5869 |
30355-30359 |
IN |
denotes |
that |
T5870 |
30441-30452 |
VB |
denotes |
participate |
T5871 |
30360-30362 |
DT |
denotes |
an |
T5872 |
30377-30384 |
NN |
denotes |
protein |
T5873 |
30363-30365 |
NN |
denotes |
AJ |
T5874 |
30366-30376 |
VBN |
denotes |
associated |
T5875 |
30365-30366 |
HYPH |
denotes |
- |
T5876 |
30385-30389 |
WDT |
denotes |
that |
T5877 |
30402-30413 |
VBN |
denotes |
sequestered |
T5878 |
30390-30392 |
VBZ |
denotes |
is |
T5879 |
30393-30401 |
RB |
denotes |
normally |
T5880 |
30414-30416 |
IN |
denotes |
at |
T5881 |
30417-30420 |
DT |
denotes |
the |
T5882 |
30428-30436 |
NN |
denotes |
membrane |
T5883 |
30421-30427 |
NN |
denotes |
plasma |
T5884 |
30437-30440 |
MD |
denotes |
may |
T5885 |
30453-30455 |
IN |
denotes |
in |
T5886 |
30456-30457 |
DT |
denotes |
a |
T5887 |
30482-30489 |
NN |
denotes |
pathway |
T5888 |
30458-30471 |
NN |
denotes |
proliferation |
T5889 |
30472-30481 |
NN |
denotes |
signaling |
T5890 |
30490-30494 |
WRB |
denotes |
when |
T5891 |
30503-30516 |
VBN |
denotes |
deconstructed |
T5892 |
30495-30498 |
NNS |
denotes |
AJs |
T5893 |
30499-30502 |
VBP |
denotes |
are |
T5894 |
30516-30517 |
. |
denotes |
. |
T5895 |
30517-30757 |
sentence |
denotes |
Numerous studies have correlated a down-regulation of E-cadherin with a translocation of β-catenin to the nucleus and a transactivation of genes that are regulated by the LEF-1/T cell factor (TCF) family of DNA binding proteins [23,24,25]. |
T5896 |
30518-30526 |
JJ |
denotes |
Numerous |
T5897 |
30527-30534 |
NNS |
denotes |
studies |
T5898 |
30540-30550 |
VBN |
denotes |
correlated |
T5899 |
30535-30539 |
VBP |
denotes |
have |
T5900 |
30551-30552 |
DT |
denotes |
a |
T5901 |
30558-30568 |
NN |
denotes |
regulation |
T5902 |
30553-30557 |
JJ |
denotes |
down |
T5903 |
30557-30558 |
HYPH |
denotes |
- |
T5904 |
30569-30571 |
IN |
denotes |
of |
T5905 |
30572-30573 |
NN |
denotes |
E |
T5906 |
30574-30582 |
NN |
denotes |
cadherin |
T5907 |
30573-30574 |
HYPH |
denotes |
- |
T5908 |
30583-30587 |
IN |
denotes |
with |
T5909 |
30588-30589 |
DT |
denotes |
a |
T5910 |
30590-30603 |
NN |
denotes |
translocation |
T5911 |
30604-30606 |
IN |
denotes |
of |
T5912 |
30607-30608 |
NN |
denotes |
β |
T5913 |
30609-30616 |
NN |
denotes |
catenin |
T5914 |
30608-30609 |
HYPH |
denotes |
- |
T5915 |
30617-30619 |
IN |
denotes |
to |
T5916 |
30620-30623 |
DT |
denotes |
the |
T5917 |
30624-30631 |
NN |
denotes |
nucleus |
T5918 |
30632-30635 |
CC |
denotes |
and |
T5919 |
30636-30637 |
DT |
denotes |
a |
T5920 |
30638-30653 |
NN |
denotes |
transactivation |
T5921 |
30654-30656 |
IN |
denotes |
of |
T5922 |
30657-30662 |
NNS |
denotes |
genes |
T5923 |
30663-30667 |
WDT |
denotes |
that |
T5924 |
30672-30681 |
VBN |
denotes |
regulated |
T5925 |
30668-30671 |
VBP |
denotes |
are |
T5926 |
30682-30684 |
IN |
denotes |
by |
T5927 |
30685-30688 |
DT |
denotes |
the |
T5928 |
30715-30721 |
NN |
denotes |
family |
T5929 |
30689-30692 |
NN |
denotes |
LEF |
T5930 |
30692-30693 |
HYPH |
denotes |
- |
T5931 |
30693-30694 |
CD |
denotes |
1 |
T5932 |
30694-30695 |
HYPH |
denotes |
/ |
T5933 |
30695-30696 |
NN |
denotes |
T |
T5934 |
30697-30701 |
NN |
denotes |
cell |
T5935 |
30702-30708 |
NN |
denotes |
factor |
T5936 |
30709-30710 |
-LRB- |
denotes |
( |
T5937 |
30710-30713 |
NN |
denotes |
TCF |
T5938 |
30713-30714 |
-RRB- |
denotes |
) |
T5939 |
30722-30724 |
IN |
denotes |
of |
T5940 |
30725-30728 |
NN |
denotes |
DNA |
T5941 |
30729-30736 |
VBG |
denotes |
binding |
T5942 |
30737-30745 |
NN |
denotes |
proteins |
T5943 |
30746-30747 |
-LRB- |
denotes |
[ |
T5944 |
30753-30755 |
CD |
denotes |
25 |
T5945 |
30747-30749 |
CD |
denotes |
23 |
T5946 |
30749-30750 |
, |
denotes |
, |
T5947 |
30750-30752 |
CD |
denotes |
24 |
T5948 |
30752-30753 |
, |
denotes |
, |
T5949 |
30755-30756 |
-RRB- |
denotes |
] |
T5950 |
30756-30757 |
. |
denotes |
. |
T5951 |
30757-30963 |
sentence |
denotes |
The presence of nuclear cyclin D in hyperproliferative Snail Tg epidermis was particularly intriguing since prior studies have reported cyclin D gene as a direct target of TCF/β-catenin transcription [26]. |
T5952 |
30758-30761 |
DT |
denotes |
The |
T5953 |
30762-30770 |
NN |
denotes |
presence |
T5954 |
30832-30835 |
VBD |
denotes |
was |
T5955 |
30771-30773 |
IN |
denotes |
of |
T5956 |
30774-30781 |
JJ |
denotes |
nuclear |
T5957 |
30789-30790 |
NN |
denotes |
D |
T5958 |
30782-30788 |
NN |
denotes |
cyclin |
T5959 |
30791-30793 |
IN |
denotes |
in |
T5960 |
30794-30812 |
JJ |
denotes |
hyperproliferative |
T5961 |
30822-30831 |
NN |
denotes |
epidermis |
T5962 |
30813-30818 |
NN |
denotes |
Snail |
T5963 |
30819-30821 |
NN |
denotes |
Tg |
T5964 |
30836-30848 |
RB |
denotes |
particularly |
T5965 |
30849-30859 |
JJ |
denotes |
intriguing |
T5966 |
30860-30865 |
IN |
denotes |
since |
T5967 |
30885-30893 |
VBN |
denotes |
reported |
T5968 |
30866-30871 |
JJ |
denotes |
prior |
T5969 |
30872-30879 |
NNS |
denotes |
studies |
T5970 |
30880-30884 |
VBP |
denotes |
have |
T5971 |
30894-30900 |
NN |
denotes |
cyclin |
T5972 |
30901-30902 |
NN |
denotes |
D |
T5973 |
30903-30907 |
NN |
denotes |
gene |
T5974 |
30908-30910 |
IN |
denotes |
as |
T5975 |
30911-30912 |
DT |
denotes |
a |
T5976 |
30920-30926 |
NN |
denotes |
target |
T5977 |
30913-30919 |
JJ |
denotes |
direct |
T5978 |
30927-30929 |
IN |
denotes |
of |
T5979 |
30930-30933 |
NN |
denotes |
TCF |
T5980 |
30934-30935 |
NN |
denotes |
β |
T5981 |
30933-30934 |
HYPH |
denotes |
/ |
T5982 |
30944-30957 |
NN |
denotes |
transcription |
T5983 |
30935-30936 |
HYPH |
denotes |
- |
T5984 |
30936-30943 |
NN |
denotes |
catenin |
T5985 |
30958-30959 |
-LRB- |
denotes |
[ |
T5986 |
30959-30961 |
CD |
denotes |
26 |
T5987 |
30961-30962 |
-RRB- |
denotes |
] |
T5988 |
30962-30963 |
. |
denotes |
. |
T5989 |
30963-31173 |
sentence |
denotes |
This said, we did not detect nuclear β-catenin in our Tg epidermis, and mating the Snail Tg mice against the TOPGal reporter mouse [20] gave no signs of ectopic LEF-1/Tcf/β-catenin activity (unpublished data). |
T5990 |
30964-30968 |
DT |
denotes |
This |
T5991 |
30969-30973 |
VBN |
denotes |
said |
T5992 |
30986-30992 |
VB |
denotes |
detect |
T5993 |
30973-30975 |
, |
denotes |
, |
T5994 |
30975-30977 |
PRP |
denotes |
we |
T5995 |
30978-30981 |
VBD |
denotes |
did |
T5996 |
30982-30985 |
RB |
denotes |
not |
T5997 |
30993-31000 |
JJ |
denotes |
nuclear |
T5998 |
31003-31010 |
NN |
denotes |
catenin |
T5999 |
31001-31002 |
NN |
denotes |
β |
T6000 |
31002-31003 |
HYPH |
denotes |
- |
T6001 |
31011-31013 |
IN |
denotes |
in |
T6002 |
31014-31017 |
PRP$ |
denotes |
our |
T6003 |
31021-31030 |
NN |
denotes |
epidermis |
T6004 |
31018-31020 |
NN |
denotes |
Tg |
T6005 |
31030-31032 |
, |
denotes |
, |
T6006 |
31032-31035 |
CC |
denotes |
and |
T6007 |
31036-31042 |
VBG |
denotes |
mating |
T6008 |
31100-31104 |
VBD |
denotes |
gave |
T6009 |
31043-31046 |
DT |
denotes |
the |
T6010 |
31056-31060 |
NNS |
denotes |
mice |
T6011 |
31047-31052 |
NN |
denotes |
Snail |
T6012 |
31053-31055 |
NN |
denotes |
Tg |
T6013 |
31061-31068 |
IN |
denotes |
against |
T6014 |
31069-31072 |
DT |
denotes |
the |
T6015 |
31089-31094 |
NN |
denotes |
mouse |
T6016 |
31073-31079 |
NN |
denotes |
TOPGal |
T6017 |
31080-31088 |
NN |
denotes |
reporter |
T6018 |
31095-31096 |
-LRB- |
denotes |
[ |
T6019 |
31096-31098 |
CD |
denotes |
20 |
T6020 |
31098-31099 |
-RRB- |
denotes |
] |
T6021 |
31105-31107 |
DT |
denotes |
no |
T6022 |
31108-31113 |
NNS |
denotes |
signs |
T6023 |
31114-31116 |
IN |
denotes |
of |
T6024 |
31117-31124 |
JJ |
denotes |
ectopic |
T6025 |
31145-31153 |
NN |
denotes |
activity |
T6026 |
31125-31128 |
NN |
denotes |
LEF |
T6027 |
31128-31129 |
HYPH |
denotes |
- |
T6028 |
31129-31130 |
CD |
denotes |
1 |
T6029 |
31130-31131 |
HYPH |
denotes |
/ |
T6030 |
31131-31134 |
NN |
denotes |
Tcf |
T6031 |
31134-31135 |
HYPH |
denotes |
/ |
T6032 |
31135-31136 |
NN |
denotes |
β |
T6033 |
31137-31144 |
NN |
denotes |
catenin |
T6034 |
31136-31137 |
HYPH |
denotes |
- |
T6035 |
31154-31155 |
-LRB- |
denotes |
( |
T6036 |
31167-31171 |
NNS |
denotes |
data |
T6037 |
31155-31166 |
JJ |
denotes |
unpublished |
T6038 |
31171-31172 |
-RRB- |
denotes |
) |
T6039 |
31172-31173 |
. |
denotes |
. |
T6040 |
31173-31314 |
sentence |
denotes |
We next turned to the presence of cytoplasmic Ajuba for a possible mechanistic link to the proliferative increase in our Snail Tg epidermis. |
T6041 |
31174-31176 |
PRP |
denotes |
We |
T6042 |
31182-31188 |
VBD |
denotes |
turned |
T6043 |
31177-31181 |
RB |
denotes |
next |
T6044 |
31189-31191 |
IN |
denotes |
to |
T6045 |
31192-31195 |
DT |
denotes |
the |
T6046 |
31196-31204 |
NN |
denotes |
presence |
T6047 |
31205-31207 |
IN |
denotes |
of |
T6048 |
31208-31219 |
JJ |
denotes |
cytoplasmic |
T6049 |
31220-31225 |
NN |
denotes |
Ajuba |
T6050 |
31226-31229 |
IN |
denotes |
for |
T6051 |
31230-31231 |
DT |
denotes |
a |
T6052 |
31253-31257 |
NN |
denotes |
link |
T6053 |
31232-31240 |
JJ |
denotes |
possible |
T6054 |
31241-31252 |
JJ |
denotes |
mechanistic |
T6055 |
31258-31260 |
IN |
denotes |
to |
T6056 |
31261-31264 |
DT |
denotes |
the |
T6057 |
31279-31287 |
NN |
denotes |
increase |
T6058 |
31265-31278 |
JJ |
denotes |
proliferative |
T6059 |
31288-31290 |
IN |
denotes |
in |
T6060 |
31291-31294 |
PRP$ |
denotes |
our |
T6061 |
31304-31313 |
NN |
denotes |
epidermis |
T6062 |
31295-31300 |
NN |
denotes |
Snail |
T6063 |
31301-31303 |
NN |
denotes |
Tg |
T6064 |
31313-31314 |
. |
denotes |
. |
T6065 |
31314-31564 |
sentence |
denotes |
In addition to its documented ability to bind α-catenin [10], Ajuba can also associate with growth factor receptor-bound protein-2 (Grb-2)/son of sevenless (Sos), the nucleotide exchange factor for Ras, which is upstream from activation of MAPK [9]. |
T6066 |
31315-31317 |
IN |
denotes |
In |
T6067 |
31392-31401 |
VB |
denotes |
associate |
T6068 |
31318-31326 |
NN |
denotes |
addition |
T6069 |
31327-31329 |
IN |
denotes |
to |
T6070 |
31330-31333 |
PRP$ |
denotes |
its |
T6071 |
31345-31352 |
NN |
denotes |
ability |
T6072 |
31334-31344 |
VBN |
denotes |
documented |
T6073 |
31353-31355 |
TO |
denotes |
to |
T6074 |
31356-31360 |
VB |
denotes |
bind |
T6075 |
31361-31362 |
NN |
denotes |
α |
T6076 |
31363-31370 |
NN |
denotes |
catenin |
T6077 |
31362-31363 |
HYPH |
denotes |
- |
T6078 |
31371-31372 |
-LRB- |
denotes |
[ |
T6079 |
31372-31374 |
CD |
denotes |
10 |
T6080 |
31374-31375 |
-RRB- |
denotes |
] |
T6081 |
31375-31377 |
, |
denotes |
, |
T6082 |
31377-31382 |
NN |
denotes |
Ajuba |
T6083 |
31383-31386 |
MD |
denotes |
can |
T6084 |
31387-31391 |
RB |
denotes |
also |
T6085 |
31402-31406 |
IN |
denotes |
with |
T6086 |
31407-31413 |
NN |
denotes |
growth |
T6087 |
31414-31420 |
NN |
denotes |
factor |
T6088 |
31421-31429 |
NN |
denotes |
receptor |
T6089 |
31430-31435 |
JJ |
denotes |
bound |
T6090 |
31429-31430 |
HYPH |
denotes |
- |
T6091 |
31436-31443 |
NN |
denotes |
protein |
T6092 |
31443-31444 |
HYPH |
denotes |
- |
T6093 |
31444-31445 |
CD |
denotes |
2 |
T6094 |
31446-31447 |
-LRB- |
denotes |
( |
T6095 |
31447-31450 |
NN |
denotes |
Grb |
T6096 |
31450-31451 |
HYPH |
denotes |
- |
T6097 |
31451-31452 |
CD |
denotes |
2 |
T6098 |
31452-31453 |
-RRB- |
denotes |
) |
T6099 |
31453-31454 |
HYPH |
denotes |
/ |
T6100 |
31454-31457 |
NN |
denotes |
son |
T6101 |
31458-31460 |
IN |
denotes |
of |
T6102 |
31461-31470 |
NN |
denotes |
sevenless |
T6103 |
31471-31472 |
-LRB- |
denotes |
( |
T6104 |
31472-31475 |
NN |
denotes |
Sos |
T6105 |
31475-31476 |
-RRB- |
denotes |
) |
T6106 |
31476-31478 |
, |
denotes |
, |
T6107 |
31478-31481 |
DT |
denotes |
the |
T6108 |
31502-31508 |
NN |
denotes |
factor |
T6109 |
31482-31492 |
NN |
denotes |
nucleotide |
T6110 |
31493-31501 |
NN |
denotes |
exchange |
T6111 |
31509-31512 |
IN |
denotes |
for |
T6112 |
31513-31516 |
NN |
denotes |
Ras |
T6113 |
31516-31518 |
, |
denotes |
, |
T6114 |
31518-31523 |
WDT |
denotes |
which |
T6115 |
31524-31526 |
VBZ |
denotes |
is |
T6116 |
31527-31535 |
RB |
denotes |
upstream |
T6117 |
31536-31540 |
IN |
denotes |
from |
T6118 |
31541-31551 |
NN |
denotes |
activation |
T6119 |
31552-31554 |
IN |
denotes |
of |
T6120 |
31555-31559 |
NN |
denotes |
MAPK |
T6121 |
31560-31561 |
-LRB- |
denotes |
[ |
T6122 |
31561-31562 |
CD |
denotes |
9 |
T6123 |
31562-31563 |
-RRB- |
denotes |
] |
T6124 |
31563-31564 |
. |
denotes |
. |
T6125 |
31564-31722 |
sentence |
denotes |
Given the increase in pMAPK staining in Tg skin, we examined the possibility that Ajuba might have changed its binding partner in Snail-expressing epidermis. |
T6126 |
31565-31570 |
VBN |
denotes |
Given |
T6127 |
31617-31625 |
VBD |
denotes |
examined |
T6128 |
31571-31574 |
DT |
denotes |
the |
T6129 |
31575-31583 |
NN |
denotes |
increase |
T6130 |
31584-31586 |
IN |
denotes |
in |
T6131 |
31587-31592 |
NN |
denotes |
pMAPK |
T6132 |
31593-31601 |
NN |
denotes |
staining |
T6133 |
31602-31604 |
IN |
denotes |
in |
T6134 |
31605-31607 |
NN |
denotes |
Tg |
T6135 |
31608-31612 |
NN |
denotes |
skin |
T6136 |
31612-31614 |
, |
denotes |
, |
T6137 |
31614-31616 |
PRP |
denotes |
we |
T6138 |
31626-31629 |
DT |
denotes |
the |
T6139 |
31630-31641 |
NN |
denotes |
possibility |
T6140 |
31642-31646 |
IN |
denotes |
that |
T6141 |
31664-31671 |
VBN |
denotes |
changed |
T6142 |
31647-31652 |
NN |
denotes |
Ajuba |
T6143 |
31653-31658 |
MD |
denotes |
might |
T6144 |
31659-31663 |
VB |
denotes |
have |
T6145 |
31672-31675 |
PRP$ |
denotes |
its |
T6146 |
31684-31691 |
NN |
denotes |
partner |
T6147 |
31676-31683 |
NN |
denotes |
binding |
T6148 |
31692-31694 |
IN |
denotes |
in |
T6149 |
31695-31700 |
NN |
denotes |
Snail |
T6150 |
31701-31711 |
VBG |
denotes |
expressing |
T6151 |
31700-31701 |
HYPH |
denotes |
- |
T6152 |
31712-31721 |
NN |
denotes |
epidermis |
T6153 |
31721-31722 |
. |
denotes |
. |
T6154 |
31722-31911 |
sentence |
denotes |
Interestingly, Ajuba was readily detected in anti-Grb-2 immunoprecipitates of protein lysates from skins of Snail Tg mice but not from the corresponding wild-type (WT) animals (Figure 4E). |
T6155 |
31723-31736 |
RB |
denotes |
Interestingly |
T6156 |
31756-31764 |
VBN |
denotes |
detected |
T6157 |
31736-31738 |
, |
denotes |
, |
T6158 |
31738-31743 |
NN |
denotes |
Ajuba |
T6159 |
31744-31747 |
VBD |
denotes |
was |
T6160 |
31748-31755 |
RB |
denotes |
readily |
T6161 |
31765-31767 |
IN |
denotes |
in |
T6162 |
31768-31776 |
JJ |
denotes |
anti-Grb |
T6163 |
31779-31797 |
NNS |
denotes |
immunoprecipitates |
T6164 |
31776-31777 |
HYPH |
denotes |
- |
T6165 |
31777-31778 |
CD |
denotes |
2 |
T6166 |
31798-31800 |
IN |
denotes |
of |
T6167 |
31801-31808 |
NN |
denotes |
protein |
T6168 |
31809-31816 |
NNS |
denotes |
lysates |
T6169 |
31817-31821 |
IN |
denotes |
from |
T6170 |
31822-31827 |
NNS |
denotes |
skins |
T6171 |
31828-31830 |
IN |
denotes |
of |
T6172 |
31831-31836 |
NN |
denotes |
Snail |
T6173 |
31840-31844 |
NNS |
denotes |
mice |
T6174 |
31837-31839 |
NN |
denotes |
Tg |
T6175 |
31845-31848 |
CC |
denotes |
but |
T6176 |
31849-31852 |
RB |
denotes |
not |
T6177 |
31853-31857 |
IN |
denotes |
from |
T6178 |
31858-31861 |
DT |
denotes |
the |
T6179 |
31891-31898 |
NNS |
denotes |
animals |
T6180 |
31862-31875 |
JJ |
denotes |
corresponding |
T6181 |
31876-31880 |
JJ |
denotes |
wild |
T6182 |
31881-31885 |
NN |
denotes |
type |
T6183 |
31880-31881 |
HYPH |
denotes |
- |
T6184 |
31886-31887 |
-LRB- |
denotes |
( |
T6185 |
31887-31889 |
NN |
denotes |
WT |
T6186 |
31889-31890 |
-RRB- |
denotes |
) |
T6187 |
31899-31900 |
-LRB- |
denotes |
( |
T6188 |
31907-31909 |
NN |
denotes |
4E |
T6189 |
31900-31906 |
NN |
denotes |
Figure |
T6190 |
31909-31910 |
-RRB- |
denotes |
) |
T6191 |
31910-31911 |
. |
denotes |
. |
T6192 |
31911-32138 |
sentence |
denotes |
When these experiments were repeated with α-catenin-null epidermis, a similar Grb-2-Ajuba association was detected, and again, this interaction was not detected in the protein extracts from control littermate skin (Figure 4E). |
T6193 |
31912-31916 |
WRB |
denotes |
When |
T6194 |
31940-31948 |
VBN |
denotes |
repeated |
T6195 |
31917-31922 |
DT |
denotes |
these |
T6196 |
31923-31934 |
NNS |
denotes |
experiments |
T6197 |
31935-31939 |
VBD |
denotes |
were |
T6198 |
32018-32026 |
VBN |
denotes |
detected |
T6199 |
31949-31953 |
IN |
denotes |
with |
T6200 |
31954-31955 |
NN |
denotes |
α |
T6201 |
31956-31963 |
NN |
denotes |
catenin |
T6202 |
31955-31956 |
HYPH |
denotes |
- |
T6203 |
31964-31968 |
JJ |
denotes |
null |
T6204 |
31963-31964 |
HYPH |
denotes |
- |
T6205 |
31969-31978 |
NN |
denotes |
epidermis |
T6206 |
31978-31980 |
, |
denotes |
, |
T6207 |
31980-31981 |
DT |
denotes |
a |
T6208 |
32002-32013 |
NN |
denotes |
association |
T6209 |
31982-31989 |
JJ |
denotes |
similar |
T6210 |
31990-31993 |
NN |
denotes |
Grb |
T6211 |
31996-32001 |
NN |
denotes |
Ajuba |
T6212 |
31993-31994 |
HYPH |
denotes |
- |
T6213 |
31994-31995 |
CD |
denotes |
2 |
T6214 |
31995-31996 |
HYPH |
denotes |
- |
T6215 |
32014-32017 |
VBD |
denotes |
was |
T6216 |
32026-32028 |
, |
denotes |
, |
T6217 |
32028-32031 |
CC |
denotes |
and |
T6218 |
32032-32037 |
RB |
denotes |
again |
T6219 |
32064-32072 |
VBN |
denotes |
detected |
T6220 |
32037-32039 |
, |
denotes |
, |
T6221 |
32039-32043 |
DT |
denotes |
this |
T6222 |
32044-32055 |
NN |
denotes |
interaction |
T6223 |
32056-32059 |
VBD |
denotes |
was |
T6224 |
32060-32063 |
RB |
denotes |
not |
T6225 |
32073-32075 |
IN |
denotes |
in |
T6226 |
32076-32079 |
DT |
denotes |
the |
T6227 |
32088-32096 |
NNS |
denotes |
extracts |
T6228 |
32080-32087 |
NN |
denotes |
protein |
T6229 |
32097-32101 |
IN |
denotes |
from |
T6230 |
32102-32109 |
NN |
denotes |
control |
T6231 |
32121-32125 |
NN |
denotes |
skin |
T6232 |
32110-32120 |
NN |
denotes |
littermate |
T6233 |
32126-32127 |
-LRB- |
denotes |
( |
T6234 |
32134-32136 |
NN |
denotes |
4E |
T6235 |
32127-32133 |
NN |
denotes |
Figure |
T6236 |
32136-32137 |
-RRB- |
denotes |
) |
T6237 |
32137-32138 |
. |
denotes |
. |
T6238 |
32138-32346 |
sentence |
denotes |
Together, these data demonstrate that the reduction in α-catenin levels, either by Snail-mediated down-regulation of E-cadherin or by α-catenin conditional targeting, allows Ajuba to interact with Grb-2/Sos. |
T6239 |
32139-32147 |
RB |
denotes |
Together |
T6240 |
32160-32171 |
VBP |
denotes |
demonstrate |
T6241 |
32147-32149 |
, |
denotes |
, |
T6242 |
32149-32154 |
DT |
denotes |
these |
T6243 |
32155-32159 |
NNS |
denotes |
data |
T6244 |
32172-32176 |
IN |
denotes |
that |
T6245 |
32306-32312 |
VBZ |
denotes |
allows |
T6246 |
32177-32180 |
DT |
denotes |
the |
T6247 |
32181-32190 |
NN |
denotes |
reduction |
T6248 |
32191-32193 |
IN |
denotes |
in |
T6249 |
32194-32195 |
NN |
denotes |
α |
T6250 |
32196-32203 |
NN |
denotes |
catenin |
T6251 |
32195-32196 |
HYPH |
denotes |
- |
T6252 |
32204-32210 |
NNS |
denotes |
levels |
T6253 |
32210-32212 |
, |
denotes |
, |
T6254 |
32212-32218 |
CC |
denotes |
either |
T6255 |
32219-32221 |
IN |
denotes |
by |
T6256 |
32222-32227 |
NN |
denotes |
Snail |
T6257 |
32228-32236 |
VBN |
denotes |
mediated |
T6258 |
32227-32228 |
HYPH |
denotes |
- |
T6259 |
32242-32252 |
NN |
denotes |
regulation |
T6260 |
32237-32241 |
JJ |
denotes |
down |
T6261 |
32241-32242 |
HYPH |
denotes |
- |
T6262 |
32253-32255 |
IN |
denotes |
of |
T6263 |
32256-32257 |
NN |
denotes |
E |
T6264 |
32258-32266 |
NN |
denotes |
cadherin |
T6265 |
32257-32258 |
HYPH |
denotes |
- |
T6266 |
32267-32269 |
CC |
denotes |
or |
T6267 |
32270-32272 |
IN |
denotes |
by |
T6268 |
32273-32274 |
NN |
denotes |
α |
T6269 |
32275-32282 |
NN |
denotes |
catenin |
T6270 |
32274-32275 |
HYPH |
denotes |
- |
T6271 |
32283-32294 |
JJ |
denotes |
conditional |
T6272 |
32295-32304 |
NN |
denotes |
targeting |
T6273 |
32304-32306 |
, |
denotes |
, |
T6274 |
32313-32318 |
NN |
denotes |
Ajuba |
T6275 |
32322-32330 |
VB |
denotes |
interact |
T6276 |
32319-32321 |
TO |
denotes |
to |
T6277 |
32331-32335 |
IN |
denotes |
with |
T6278 |
32336-32339 |
NN |
denotes |
Grb |
T6279 |
32339-32340 |
HYPH |
denotes |
- |
T6280 |
32340-32341 |
CD |
denotes |
2 |
T6281 |
32341-32342 |
HYPH |
denotes |
/ |
T6282 |
32342-32345 |
NN |
denotes |
Sos |
T6283 |
32345-32346 |
. |
denotes |
. |
T6284 |
32346-32624 |
sentence |
denotes |
If the competition between Grb-2/Sos and α-catenin for Ajuba is functionally relevant to the hyperproliferative state of a keratinocyte, then overexpression of Ajuba would be expected to bypass the competition and promote activation of the Ras-MAPK pathway in WT keratinocytes. |
T6285 |
32347-32349 |
IN |
denotes |
If |
T6286 |
32408-32410 |
VBZ |
denotes |
is |
T6287 |
32350-32353 |
DT |
denotes |
the |
T6288 |
32354-32365 |
NN |
denotes |
competition |
T6289 |
32366-32373 |
IN |
denotes |
between |
T6290 |
32374-32377 |
NN |
denotes |
Grb |
T6291 |
32377-32378 |
HYPH |
denotes |
- |
T6292 |
32378-32379 |
CD |
denotes |
2 |
T6293 |
32379-32380 |
HYPH |
denotes |
/ |
T6294 |
32380-32383 |
NN |
denotes |
Sos |
T6295 |
32384-32387 |
CC |
denotes |
and |
T6296 |
32388-32389 |
NN |
denotes |
α |
T6297 |
32390-32397 |
NN |
denotes |
catenin |
T6298 |
32389-32390 |
HYPH |
denotes |
- |
T6299 |
32398-32401 |
IN |
denotes |
for |
T6300 |
32402-32407 |
NN |
denotes |
Ajuba |
T6301 |
32522-32530 |
VBN |
denotes |
expected |
T6302 |
32411-32423 |
RB |
denotes |
functionally |
T6303 |
32424-32432 |
JJ |
denotes |
relevant |
T6304 |
32433-32435 |
IN |
denotes |
to |
T6305 |
32436-32439 |
DT |
denotes |
the |
T6306 |
32459-32464 |
NN |
denotes |
state |
T6307 |
32440-32458 |
JJ |
denotes |
hyperproliferative |
T6308 |
32465-32467 |
IN |
denotes |
of |
T6309 |
32468-32469 |
DT |
denotes |
a |
T6310 |
32470-32482 |
NN |
denotes |
keratinocyte |
T6311 |
32482-32484 |
, |
denotes |
, |
T6312 |
32484-32488 |
RB |
denotes |
then |
T6313 |
32489-32503 |
NN |
denotes |
overexpression |
T6314 |
32504-32506 |
IN |
denotes |
of |
T6315 |
32507-32512 |
NN |
denotes |
Ajuba |
T6316 |
32513-32518 |
MD |
denotes |
would |
T6317 |
32519-32521 |
VB |
denotes |
be |
T6318 |
32531-32533 |
TO |
denotes |
to |
T6319 |
32534-32540 |
VB |
denotes |
bypass |
T6320 |
32541-32544 |
DT |
denotes |
the |
T6321 |
32545-32556 |
NN |
denotes |
competition |
T6322 |
32557-32560 |
CC |
denotes |
and |
T6323 |
32561-32568 |
VB |
denotes |
promote |
T6324 |
32569-32579 |
NN |
denotes |
activation |
T6325 |
32580-32582 |
IN |
denotes |
of |
T6326 |
32583-32586 |
DT |
denotes |
the |
T6327 |
32596-32603 |
NN |
denotes |
pathway |
T6328 |
32587-32590 |
NN |
denotes |
Ras |
T6329 |
32591-32595 |
NN |
denotes |
MAPK |
T6330 |
32590-32591 |
HYPH |
denotes |
- |
T6331 |
32604-32606 |
IN |
denotes |
in |
T6332 |
32607-32609 |
NN |
denotes |
WT |
T6333 |
32610-32623 |
NNS |
denotes |
keratinocytes |
T6334 |
32623-32624 |
. |
denotes |
. |
T6335 |
32624-32855 |
sentence |
denotes |
Indeed, when serum-starved keratinocytes were transiently transfected with an Ajuba expression vector, the levels of pMAPK were not only elevated but also comparable to those transfected with the K14-HASnail transgene (Figure 4F). |
T6336 |
32625-32631 |
RB |
denotes |
Indeed |
T6337 |
32748-32752 |
VBD |
denotes |
were |
T6338 |
32631-32633 |
, |
denotes |
, |
T6339 |
32633-32637 |
WRB |
denotes |
when |
T6340 |
32683-32694 |
VBN |
denotes |
transfected |
T6341 |
32638-32643 |
NN |
denotes |
serum |
T6342 |
32644-32651 |
VBN |
denotes |
starved |
T6343 |
32643-32644 |
HYPH |
denotes |
- |
T6344 |
32652-32665 |
NNS |
denotes |
keratinocytes |
T6345 |
32666-32670 |
VBD |
denotes |
were |
T6346 |
32671-32682 |
RB |
denotes |
transiently |
T6347 |
32695-32699 |
IN |
denotes |
with |
T6348 |
32700-32702 |
DT |
denotes |
an |
T6349 |
32720-32726 |
NN |
denotes |
vector |
T6350 |
32703-32708 |
NN |
denotes |
Ajuba |
T6351 |
32709-32719 |
NN |
denotes |
expression |
T6352 |
32726-32728 |
, |
denotes |
, |
T6353 |
32728-32731 |
DT |
denotes |
the |
T6354 |
32732-32738 |
NNS |
denotes |
levels |
T6355 |
32739-32741 |
IN |
denotes |
of |
T6356 |
32742-32747 |
NN |
denotes |
pMAPK |
T6357 |
32753-32756 |
RB |
denotes |
not |
T6358 |
32762-32770 |
JJ |
denotes |
elevated |
T6359 |
32757-32761 |
RB |
denotes |
only |
T6360 |
32771-32774 |
CC |
denotes |
but |
T6361 |
32775-32779 |
RB |
denotes |
also |
T6362 |
32780-32790 |
JJ |
denotes |
comparable |
T6363 |
32791-32793 |
IN |
denotes |
to |
T6364 |
32794-32799 |
DT |
denotes |
those |
T6365 |
32800-32811 |
VBN |
denotes |
transfected |
T6366 |
32812-32816 |
IN |
denotes |
with |
T6367 |
32817-32820 |
DT |
denotes |
the |
T6368 |
32833-32842 |
NN |
denotes |
transgene |
T6369 |
32821-32824 |
NN |
denotes |
K14 |
T6370 |
32825-32832 |
NN |
denotes |
HASnail |
T6371 |
32824-32825 |
HYPH |
denotes |
- |
T6372 |
32843-32844 |
-LRB- |
denotes |
( |
T6373 |
32851-32853 |
NN |
denotes |
4F |
T6374 |
32844-32850 |
NN |
denotes |
Figure |
T6375 |
32853-32854 |
-RRB- |
denotes |
) |
T6376 |
32854-32855 |
. |
denotes |
. |
T6377 |
32855-33037 |
sentence |
denotes |
This activation was abolished when cells were treated with a small peptide inhibitor that specifically interrupts the Grb-2/Sos interaction (Figure 4F; see lanes marked “inh”) [27]. |
T6378 |
32856-32860 |
DT |
denotes |
This |
T6379 |
32861-32871 |
NN |
denotes |
activation |
T6380 |
32876-32885 |
VBN |
denotes |
abolished |
T6381 |
32872-32875 |
VBD |
denotes |
was |
T6382 |
32886-32890 |
WRB |
denotes |
when |
T6383 |
32902-32909 |
VBN |
denotes |
treated |
T6384 |
32891-32896 |
NNS |
denotes |
cells |
T6385 |
32897-32901 |
VBD |
denotes |
were |
T6386 |
32910-32914 |
IN |
denotes |
with |
T6387 |
32915-32916 |
DT |
denotes |
a |
T6388 |
32931-32940 |
NN |
denotes |
inhibitor |
T6389 |
32917-32922 |
JJ |
denotes |
small |
T6390 |
32923-32930 |
NN |
denotes |
peptide |
T6391 |
32941-32945 |
WDT |
denotes |
that |
T6392 |
32959-32969 |
VBZ |
denotes |
interrupts |
T6393 |
32946-32958 |
RB |
denotes |
specifically |
T6394 |
32970-32973 |
DT |
denotes |
the |
T6395 |
32984-32995 |
NN |
denotes |
interaction |
T6396 |
32974-32977 |
NN |
denotes |
Grb |
T6397 |
32977-32978 |
HYPH |
denotes |
- |
T6398 |
32978-32979 |
CD |
denotes |
2 |
T6399 |
32979-32980 |
HYPH |
denotes |
/ |
T6400 |
32980-32983 |
NN |
denotes |
Sos |
T6401 |
32996-32997 |
-LRB- |
denotes |
( |
T6402 |
33004-33006 |
NN |
denotes |
4F |
T6403 |
32997-33003 |
NN |
denotes |
Figure |
T6404 |
33006-33007 |
: |
denotes |
; |
T6405 |
33008-33011 |
VB |
denotes |
see |
T6406 |
33012-33017 |
NNS |
denotes |
lanes |
T6407 |
33018-33024 |
VBN |
denotes |
marked |
T6408 |
33025-33026 |
`` |
denotes |
“ |
T6409 |
33026-33029 |
NN |
denotes |
inh |
T6410 |
33029-33030 |
'' |
denotes |
” |
T6411 |
33030-33031 |
-RRB- |
denotes |
) |
T6412 |
33032-33033 |
-LRB- |
denotes |
[ |
T6413 |
33033-33035 |
CD |
denotes |
27 |
T6414 |
33035-33036 |
-RRB- |
denotes |
] |
T6415 |
33036-33037 |
. |
denotes |
. |
T6416 |
33037-33131 |
sentence |
denotes |
Ajuba's pre-LIM domain is the segment that associates with Grb-2's Src-homology 3 domain [9]. |
T6417 |
33038-33043 |
NN |
denotes |
Ajuba |
T6418 |
33054-33060 |
NN |
denotes |
domain |
T6419 |
33043-33045 |
POS |
denotes |
's |
T6420 |
33046-33053 |
JJ |
denotes |
pre-LIM |
T6421 |
33061-33063 |
VBZ |
denotes |
is |
T6422 |
33064-33067 |
DT |
denotes |
the |
T6423 |
33068-33075 |
NN |
denotes |
segment |
T6424 |
33076-33080 |
WDT |
denotes |
that |
T6425 |
33081-33091 |
VBZ |
denotes |
associates |
T6426 |
33092-33096 |
IN |
denotes |
with |
T6427 |
33097-33100 |
NN |
denotes |
Grb |
T6428 |
33120-33126 |
NN |
denotes |
domain |
T6429 |
33100-33101 |
HYPH |
denotes |
- |
T6430 |
33101-33102 |
CD |
denotes |
2 |
T6431 |
33102-33104 |
POS |
denotes |
's |
T6432 |
33105-33108 |
NN |
denotes |
Src |
T6433 |
33109-33117 |
NN |
denotes |
homology |
T6434 |
33108-33109 |
HYPH |
denotes |
- |
T6435 |
33118-33119 |
CD |
denotes |
3 |
T6436 |
33127-33128 |
-LRB- |
denotes |
[ |
T6437 |
33128-33129 |
CD |
denotes |
9 |
T6438 |
33129-33130 |
-RRB- |
denotes |
] |
T6439 |
33130-33131 |
. |
denotes |
. |
T6440 |
33131-33256 |
sentence |
denotes |
When this domain was overexpressed in serum-starved keratinocytes, a comparable elevation in pMAPK was observed (Figure 4F). |
T6441 |
33132-33136 |
WRB |
denotes |
When |
T6442 |
33153-33166 |
VBN |
denotes |
overexpressed |
T6443 |
33137-33141 |
DT |
denotes |
this |
T6444 |
33142-33148 |
NN |
denotes |
domain |
T6445 |
33149-33152 |
VBD |
denotes |
was |
T6446 |
33235-33243 |
VBN |
denotes |
observed |
T6447 |
33167-33169 |
IN |
denotes |
in |
T6448 |
33170-33175 |
NN |
denotes |
serum |
T6449 |
33176-33183 |
VBN |
denotes |
starved |
T6450 |
33175-33176 |
HYPH |
denotes |
- |
T6451 |
33184-33197 |
NNS |
denotes |
keratinocytes |
T6452 |
33197-33199 |
, |
denotes |
, |
T6453 |
33199-33200 |
DT |
denotes |
a |
T6454 |
33212-33221 |
NN |
denotes |
elevation |
T6455 |
33201-33211 |
JJ |
denotes |
comparable |
T6456 |
33222-33224 |
IN |
denotes |
in |
T6457 |
33225-33230 |
NN |
denotes |
pMAPK |
T6458 |
33231-33234 |
VBD |
denotes |
was |
T6459 |
33244-33245 |
-LRB- |
denotes |
( |
T6460 |
33252-33254 |
NN |
denotes |
4F |
T6461 |
33245-33251 |
NN |
denotes |
Figure |
T6462 |
33254-33255 |
-RRB- |
denotes |
) |
T6463 |
33255-33256 |
. |
denotes |
. |
T6464 |
33256-33360 |
sentence |
denotes |
As expected, the small peptide inhibitor that interrupts the Grb-2/Sos association blocked the effects. |
T6465 |
33257-33259 |
IN |
denotes |
As |
T6466 |
33260-33268 |
VBN |
denotes |
expected |
T6467 |
33340-33347 |
VBD |
denotes |
blocked |
T6468 |
33268-33270 |
, |
denotes |
, |
T6469 |
33270-33273 |
DT |
denotes |
the |
T6470 |
33288-33297 |
NN |
denotes |
inhibitor |
T6471 |
33274-33279 |
JJ |
denotes |
small |
T6472 |
33280-33287 |
NN |
denotes |
peptide |
T6473 |
33298-33302 |
WDT |
denotes |
that |
T6474 |
33303-33313 |
VBZ |
denotes |
interrupts |
T6475 |
33314-33317 |
DT |
denotes |
the |
T6476 |
33328-33339 |
NN |
denotes |
association |
T6477 |
33318-33321 |
NN |
denotes |
Grb |
T6478 |
33321-33322 |
HYPH |
denotes |
- |
T6479 |
33322-33323 |
CD |
denotes |
2 |
T6480 |
33323-33324 |
HYPH |
denotes |
/ |
T6481 |
33324-33327 |
NN |
denotes |
Sos |
T6482 |
33348-33351 |
DT |
denotes |
the |
T6483 |
33352-33359 |
NNS |
denotes |
effects |
T6484 |
33359-33360 |
. |
denotes |
. |
T6485 |
33360-33585 |
sentence |
denotes |
These data suggested that by elevating cytosolic Ajuba levels, Ajuba's pre-LIM domain may associate with Grb-2/Sos in a manner that stimulates its nucleotide exchange activity and leads to activation of the Ras-MAPK pathway. |
T6486 |
33361-33366 |
DT |
denotes |
These |
T6487 |
33367-33371 |
NNS |
denotes |
data |
T6488 |
33372-33381 |
VBD |
denotes |
suggested |
T6489 |
33382-33386 |
IN |
denotes |
that |
T6490 |
33451-33460 |
VB |
denotes |
associate |
T6491 |
33387-33389 |
IN |
denotes |
by |
T6492 |
33390-33399 |
VBG |
denotes |
elevating |
T6493 |
33400-33409 |
JJ |
denotes |
cytosolic |
T6494 |
33416-33422 |
NNS |
denotes |
levels |
T6495 |
33410-33415 |
NN |
denotes |
Ajuba |
T6496 |
33422-33424 |
, |
denotes |
, |
T6497 |
33424-33429 |
NN |
denotes |
Ajuba |
T6498 |
33440-33446 |
NN |
denotes |
domain |
T6499 |
33429-33431 |
POS |
denotes |
's |
T6500 |
33432-33439 |
JJ |
denotes |
pre-LIM |
T6501 |
33447-33450 |
MD |
denotes |
may |
T6502 |
33461-33465 |
IN |
denotes |
with |
T6503 |
33466-33469 |
NN |
denotes |
Grb |
T6504 |
33469-33470 |
HYPH |
denotes |
- |
T6505 |
33470-33471 |
CD |
denotes |
2 |
T6506 |
33471-33472 |
HYPH |
denotes |
/ |
T6507 |
33472-33475 |
NN |
denotes |
Sos |
T6508 |
33476-33478 |
IN |
denotes |
in |
T6509 |
33479-33480 |
DT |
denotes |
a |
T6510 |
33481-33487 |
NN |
denotes |
manner |
T6511 |
33488-33492 |
WDT |
denotes |
that |
T6512 |
33493-33503 |
VBZ |
denotes |
stimulates |
T6513 |
33504-33507 |
PRP$ |
denotes |
its |
T6514 |
33528-33536 |
NN |
denotes |
activity |
T6515 |
33508-33518 |
NN |
denotes |
nucleotide |
T6516 |
33519-33527 |
NN |
denotes |
exchange |
T6517 |
33537-33540 |
CC |
denotes |
and |
T6518 |
33541-33546 |
VBZ |
denotes |
leads |
T6519 |
33547-33549 |
IN |
denotes |
to |
T6520 |
33550-33560 |
NN |
denotes |
activation |
T6521 |
33561-33563 |
IN |
denotes |
of |
T6522 |
33564-33567 |
DT |
denotes |
the |
T6523 |
33577-33584 |
NN |
denotes |
pathway |
T6524 |
33568-33571 |
NN |
denotes |
Ras |
T6525 |
33572-33576 |
NN |
denotes |
MAPK |
T6526 |
33571-33572 |
HYPH |
denotes |
- |
T6527 |
33584-33585 |
. |
denotes |
. |
T6528 |
33585-33795 |
sentence |
denotes |
Although this pathway provides one mechanism by which Snail expression and proliferation may be coupled in skin epithelium, proliferative circuitries involving AJs are known to be complex and often interwoven. |
T6529 |
33586-33594 |
IN |
denotes |
Although |
T6530 |
33608-33616 |
VBZ |
denotes |
provides |
T6531 |
33595-33599 |
DT |
denotes |
this |
T6532 |
33600-33607 |
NN |
denotes |
pathway |
T6533 |
33754-33759 |
VBN |
denotes |
known |
T6534 |
33617-33620 |
CD |
denotes |
one |
T6535 |
33621-33630 |
NN |
denotes |
mechanism |
T6536 |
33631-33633 |
IN |
denotes |
by |
T6537 |
33682-33689 |
VBN |
denotes |
coupled |
T6538 |
33634-33639 |
WDT |
denotes |
which |
T6539 |
33640-33645 |
NN |
denotes |
Snail |
T6540 |
33646-33656 |
NN |
denotes |
expression |
T6541 |
33657-33660 |
CC |
denotes |
and |
T6542 |
33661-33674 |
NN |
denotes |
proliferation |
T6543 |
33675-33678 |
MD |
denotes |
may |
T6544 |
33679-33681 |
VB |
denotes |
be |
T6545 |
33690-33692 |
IN |
denotes |
in |
T6546 |
33693-33697 |
NN |
denotes |
skin |
T6547 |
33698-33708 |
NN |
denotes |
epithelium |
T6548 |
33708-33710 |
, |
denotes |
, |
T6549 |
33710-33723 |
JJ |
denotes |
proliferative |
T6550 |
33724-33735 |
NNS |
denotes |
circuitries |
T6551 |
33736-33745 |
VBG |
denotes |
involving |
T6552 |
33746-33749 |
NNS |
denotes |
AJs |
T6553 |
33750-33753 |
VBP |
denotes |
are |
T6554 |
33760-33762 |
TO |
denotes |
to |
T6555 |
33763-33765 |
VB |
denotes |
be |
T6556 |
33766-33773 |
JJ |
denotes |
complex |
T6557 |
33774-33777 |
CC |
denotes |
and |
T6558 |
33778-33783 |
RB |
denotes |
often |
T6559 |
33784-33794 |
VBN |
denotes |
interwoven |
T6560 |
33794-33795 |
. |
denotes |
. |
T6561 |
33795-33900 |
sentence |
denotes |
Future studies will be needed to systematically dissect these putative intricacies at a molecular level. |
T6562 |
33796-33802 |
JJ |
denotes |
Future |
T6563 |
33803-33810 |
NNS |
denotes |
studies |
T6564 |
33819-33825 |
VBN |
denotes |
needed |
T6565 |
33811-33815 |
MD |
denotes |
will |
T6566 |
33816-33818 |
VB |
denotes |
be |
T6567 |
33826-33828 |
TO |
denotes |
to |
T6568 |
33844-33851 |
VB |
denotes |
dissect |
T6569 |
33829-33843 |
RB |
denotes |
systematically |
T6570 |
33852-33857 |
DT |
denotes |
these |
T6571 |
33867-33878 |
NNS |
denotes |
intricacies |
T6572 |
33858-33866 |
JJ |
denotes |
putative |
T6573 |
33879-33881 |
IN |
denotes |
at |
T6574 |
33882-33883 |
DT |
denotes |
a |
T6575 |
33894-33899 |
NN |
denotes |
level |
T6576 |
33884-33893 |
JJ |
denotes |
molecular |
T6577 |
33899-33900 |
. |
denotes |
. |
T7354 |
33902-33909 |
VBG |
denotes |
Probing |
T7355 |
33950-33957 |
VBZ |
denotes |
Reveals |
T7356 |
33910-33913 |
DT |
denotes |
the |
T7357 |
33914-33924 |
NN |
denotes |
Regulation |
T7358 |
33925-33927 |
IN |
denotes |
of |
T7359 |
33928-33933 |
NN |
denotes |
Snail |
T7360 |
33934-33938 |
NN |
denotes |
Gene |
T7361 |
33939-33949 |
NN |
denotes |
Expression |
T7362 |
33958-33960 |
DT |
denotes |
an |
T7363 |
33971-33975 |
NN |
denotes |
Link |
T7364 |
33961-33970 |
JJ |
denotes |
Essential |
T7365 |
33976-33978 |
IN |
denotes |
to |
T7366 |
33979-33982 |
NN |
denotes |
TGF |
T7367 |
33983-33985 |
NN |
denotes |
β2 |
T7368 |
33982-33983 |
HYPH |
denotes |
- |
T7369 |
33986-33995 |
NN |
denotes |
Signaling |
T7370 |
33996-33998 |
IN |
denotes |
in |
T7371 |
33999-34002 |
DT |
denotes |
the |
T7372 |
34019-34022 |
NN |
denotes |
Bud |
T7373 |
34003-34013 |
VBG |
denotes |
Developing |
T7374 |
34014-34018 |
NN |
denotes |
Hair |
T7375 |
34022-34155 |
sentence |
denotes |
The temporal spike of Snail mRNA expression in the hair bud prompted us to consider what factor(s) may be regulating the Snail gene. |
T7376 |
34023-34026 |
DT |
denotes |
The |
T7377 |
34036-34041 |
NN |
denotes |
spike |
T7378 |
34027-34035 |
JJ |
denotes |
temporal |
T7379 |
34083-34091 |
VBD |
denotes |
prompted |
T7380 |
34042-34044 |
IN |
denotes |
of |
T7381 |
34045-34050 |
NN |
denotes |
Snail |
T7382 |
34056-34066 |
NN |
denotes |
expression |
T7383 |
34051-34055 |
NN |
denotes |
mRNA |
T7384 |
34067-34069 |
IN |
denotes |
in |
T7385 |
34070-34073 |
DT |
denotes |
the |
T7386 |
34079-34082 |
NN |
denotes |
bud |
T7387 |
34074-34078 |
NN |
denotes |
hair |
T7388 |
34092-34094 |
PRP |
denotes |
us |
T7389 |
34095-34097 |
TO |
denotes |
to |
T7390 |
34098-34106 |
VB |
denotes |
consider |
T7391 |
34107-34111 |
WDT |
denotes |
what |
T7392 |
34112-34118 |
NN |
denotes |
factor |
T7393 |
34129-34139 |
VBG |
denotes |
regulating |
T7394 |
34118-34119 |
-LRB- |
denotes |
( |
T7395 |
34119-34120 |
AFX |
denotes |
s |
T7396 |
34120-34121 |
-RRB- |
denotes |
) |
T7397 |
34122-34125 |
MD |
denotes |
may |
T7398 |
34126-34128 |
VB |
denotes |
be |
T7399 |
34140-34143 |
DT |
denotes |
the |
T7400 |
34150-34154 |
NN |
denotes |
gene |
T7401 |
34144-34149 |
NN |
denotes |
Snail |
T7402 |
34154-34155 |
. |
denotes |
. |
T7403 |
34155-34379 |
sentence |
denotes |
A variety of extracellular signals have an impact on the cell type-specific expression of different Snail family members, and many of them, including Wnts, BMPs, FGFs, and TGF-βs, also affect hair bud development [2,16,28]. |
T7404 |
34156-34157 |
DT |
denotes |
A |
T7405 |
34158-34165 |
NN |
denotes |
variety |
T7406 |
34191-34195 |
VBP |
denotes |
have |
T7407 |
34166-34168 |
IN |
denotes |
of |
T7408 |
34169-34182 |
JJ |
denotes |
extracellular |
T7409 |
34183-34190 |
NNS |
denotes |
signals |
T7410 |
34196-34198 |
DT |
denotes |
an |
T7411 |
34199-34205 |
NN |
denotes |
impact |
T7412 |
34206-34208 |
IN |
denotes |
on |
T7413 |
34209-34212 |
DT |
denotes |
the |
T7414 |
34232-34242 |
NN |
denotes |
expression |
T7415 |
34213-34217 |
NN |
denotes |
cell |
T7416 |
34218-34222 |
NN |
denotes |
type |
T7417 |
34223-34231 |
JJ |
denotes |
specific |
T7418 |
34222-34223 |
HYPH |
denotes |
- |
T7419 |
34243-34245 |
IN |
denotes |
of |
T7420 |
34246-34255 |
JJ |
denotes |
different |
T7421 |
34269-34276 |
NNS |
denotes |
members |
T7422 |
34256-34261 |
NN |
denotes |
Snail |
T7423 |
34262-34268 |
NN |
denotes |
family |
T7424 |
34276-34278 |
, |
denotes |
, |
T7425 |
34278-34281 |
CC |
denotes |
and |
T7426 |
34282-34286 |
JJ |
denotes |
many |
T7427 |
34341-34347 |
VBP |
denotes |
affect |
T7428 |
34287-34289 |
IN |
denotes |
of |
T7429 |
34290-34294 |
PRP |
denotes |
them |
T7430 |
34294-34296 |
, |
denotes |
, |
T7431 |
34296-34305 |
VBG |
denotes |
including |
T7432 |
34306-34310 |
NNS |
denotes |
Wnts |
T7433 |
34310-34312 |
, |
denotes |
, |
T7434 |
34312-34316 |
NNS |
denotes |
BMPs |
T7435 |
34316-34318 |
, |
denotes |
, |
T7436 |
34318-34322 |
NNS |
denotes |
FGFs |
T7437 |
34322-34324 |
, |
denotes |
, |
T7438 |
34324-34327 |
CC |
denotes |
and |
T7439 |
34328-34331 |
NN |
denotes |
TGF |
T7440 |
34332-34334 |
NNS |
denotes |
βs |
T7441 |
34331-34332 |
HYPH |
denotes |
- |
T7442 |
34334-34336 |
, |
denotes |
, |
T7443 |
34336-34340 |
RB |
denotes |
also |
T7444 |
34348-34352 |
NN |
denotes |
hair |
T7445 |
34353-34356 |
NN |
denotes |
bud |
T7446 |
34357-34368 |
NN |
denotes |
development |
T7447 |
34369-34370 |
-LRB- |
denotes |
[ |
T7448 |
34375-34377 |
CD |
denotes |
28 |
T7449 |
34370-34371 |
CD |
denotes |
2 |
T7450 |
34371-34372 |
, |
denotes |
, |
T7451 |
34372-34374 |
CD |
denotes |
16 |
T7452 |
34374-34375 |
, |
denotes |
, |
T7453 |
34377-34378 |
-RRB- |
denotes |
] |
T7454 |
34378-34379 |
. |
denotes |
. |
T7455 |
34379-34607 |
sentence |
denotes |
Since Snail is not expressed in cultured skin keratinocytes that secrete active BMPs and FGFs (see Figure 1B), we focused our attention on Wnt and TGF-β signaling as more likely candidates for Snail induction in this cell type. |
T7456 |
34380-34385 |
IN |
denotes |
Since |
T7457 |
34399-34408 |
VBN |
denotes |
expressed |
T7458 |
34386-34391 |
NN |
denotes |
Snail |
T7459 |
34392-34394 |
VBZ |
denotes |
is |
T7460 |
34395-34398 |
RB |
denotes |
not |
T7461 |
34494-34501 |
VBD |
denotes |
focused |
T7462 |
34409-34411 |
IN |
denotes |
in |
T7463 |
34412-34420 |
VBN |
denotes |
cultured |
T7464 |
34426-34439 |
NNS |
denotes |
keratinocytes |
T7465 |
34421-34425 |
NN |
denotes |
skin |
T7466 |
34440-34444 |
WDT |
denotes |
that |
T7467 |
34445-34452 |
VBP |
denotes |
secrete |
T7468 |
34453-34459 |
JJ |
denotes |
active |
T7469 |
34460-34464 |
NNS |
denotes |
BMPs |
T7470 |
34465-34468 |
CC |
denotes |
and |
T7471 |
34469-34473 |
NNS |
denotes |
FGFs |
T7472 |
34474-34475 |
-LRB- |
denotes |
( |
T7473 |
34475-34478 |
VB |
denotes |
see |
T7474 |
34479-34485 |
NN |
denotes |
Figure |
T7475 |
34486-34488 |
NN |
denotes |
1B |
T7476 |
34488-34489 |
-RRB- |
denotes |
) |
T7477 |
34489-34491 |
, |
denotes |
, |
T7478 |
34491-34493 |
PRP |
denotes |
we |
T7479 |
34502-34505 |
PRP$ |
denotes |
our |
T7480 |
34506-34515 |
NN |
denotes |
attention |
T7481 |
34516-34518 |
IN |
denotes |
on |
T7482 |
34519-34522 |
NN |
denotes |
Wnt |
T7483 |
34533-34542 |
NN |
denotes |
signaling |
T7484 |
34523-34526 |
CC |
denotes |
and |
T7485 |
34527-34530 |
NN |
denotes |
TGF |
T7486 |
34531-34532 |
NN |
denotes |
β |
T7487 |
34530-34531 |
HYPH |
denotes |
- |
T7488 |
34543-34545 |
IN |
denotes |
as |
T7489 |
34546-34550 |
RBR |
denotes |
more |
T7490 |
34551-34557 |
JJ |
denotes |
likely |
T7491 |
34558-34568 |
NNS |
denotes |
candidates |
T7492 |
34569-34572 |
IN |
denotes |
for |
T7493 |
34573-34578 |
NN |
denotes |
Snail |
T7494 |
34579-34588 |
NN |
denotes |
induction |
T7495 |
34589-34591 |
IN |
denotes |
in |
T7496 |
34592-34596 |
DT |
denotes |
this |
T7497 |
34602-34606 |
NN |
denotes |
type |
T7498 |
34597-34601 |
NN |
denotes |
cell |
T7499 |
34606-34607 |
. |
denotes |
. |
T7500 |
34607-34806 |
sentence |
denotes |
Previously, we showed that effective transmission of a Wnt-3a signal in cultured keratinocytes can be achieved through their exposure to the BMP inhibitor noggin, which induces LEF-1 expression [4]. |
T7501 |
34608-34618 |
RB |
denotes |
Previously |
T7502 |
34623-34629 |
VBD |
denotes |
showed |
T7503 |
34618-34620 |
, |
denotes |
, |
T7504 |
34620-34622 |
PRP |
denotes |
we |
T7505 |
34630-34634 |
IN |
denotes |
that |
T7506 |
34710-34718 |
VBN |
denotes |
achieved |
T7507 |
34635-34644 |
JJ |
denotes |
effective |
T7508 |
34645-34657 |
NN |
denotes |
transmission |
T7509 |
34658-34660 |
IN |
denotes |
of |
T7510 |
34661-34662 |
DT |
denotes |
a |
T7511 |
34670-34676 |
NN |
denotes |
signal |
T7512 |
34663-34666 |
NN |
denotes |
Wnt |
T7513 |
34666-34667 |
HYPH |
denotes |
- |
T7514 |
34667-34669 |
CD |
denotes |
3a |
T7515 |
34677-34679 |
IN |
denotes |
in |
T7516 |
34680-34688 |
VBN |
denotes |
cultured |
T7517 |
34689-34702 |
NNS |
denotes |
keratinocytes |
T7518 |
34703-34706 |
MD |
denotes |
can |
T7519 |
34707-34709 |
VB |
denotes |
be |
T7520 |
34719-34726 |
IN |
denotes |
through |
T7521 |
34727-34732 |
PRP$ |
denotes |
their |
T7522 |
34733-34741 |
NN |
denotes |
exposure |
T7523 |
34742-34744 |
IN |
denotes |
to |
T7524 |
34745-34748 |
DT |
denotes |
the |
T7525 |
34753-34762 |
NN |
denotes |
inhibitor |
T7526 |
34749-34752 |
NN |
denotes |
BMP |
T7527 |
34763-34769 |
NN |
denotes |
noggin |
T7528 |
34769-34771 |
, |
denotes |
, |
T7529 |
34771-34776 |
WDT |
denotes |
which |
T7530 |
34777-34784 |
VBZ |
denotes |
induces |
T7531 |
34785-34788 |
NN |
denotes |
LEF |
T7532 |
34791-34801 |
NN |
denotes |
expression |
T7533 |
34788-34789 |
HYPH |
denotes |
- |
T7534 |
34789-34790 |
CD |
denotes |
1 |
T7535 |
34802-34803 |
-LRB- |
denotes |
[ |
T7536 |
34803-34804 |
CD |
denotes |
4 |
T7537 |
34804-34805 |
-RRB- |
denotes |
] |
T7538 |
34805-34806 |
. |
denotes |
. |
T7539 |
34806-34941 |
sentence |
denotes |
In vitro, these conditions down-regulated the E-cadherin promoter and induced a LEF-1/β-catenin-sensitive reporter gene, TOPFLASH [4]. |
T7540 |
34807-34809 |
FW |
denotes |
In |
T7541 |
34810-34815 |
FW |
denotes |
vitro |
T7542 |
34839-34848 |
VBD |
denotes |
regulated |
T7543 |
34815-34817 |
, |
denotes |
, |
T7544 |
34817-34822 |
DT |
denotes |
these |
T7545 |
34823-34833 |
NNS |
denotes |
conditions |
T7546 |
34834-34838 |
RB |
denotes |
down |
T7547 |
34838-34839 |
HYPH |
denotes |
- |
T7548 |
34849-34852 |
DT |
denotes |
the |
T7549 |
34864-34872 |
NN |
denotes |
promoter |
T7550 |
34853-34854 |
NN |
denotes |
E |
T7551 |
34855-34863 |
NN |
denotes |
cadherin |
T7552 |
34854-34855 |
HYPH |
denotes |
- |
T7553 |
34873-34876 |
CC |
denotes |
and |
T7554 |
34877-34884 |
VBD |
denotes |
induced |
T7555 |
34885-34886 |
DT |
denotes |
a |
T7556 |
34922-34926 |
NN |
denotes |
gene |
T7557 |
34887-34890 |
NN |
denotes |
LEF |
T7558 |
34903-34912 |
JJ |
denotes |
sensitive |
T7559 |
34890-34891 |
HYPH |
denotes |
- |
T7560 |
34891-34892 |
CD |
denotes |
1 |
T7561 |
34892-34893 |
HYPH |
denotes |
/ |
T7562 |
34893-34894 |
NN |
denotes |
β |
T7563 |
34895-34902 |
NN |
denotes |
catenin |
T7564 |
34894-34895 |
HYPH |
denotes |
- |
T7565 |
34902-34903 |
HYPH |
denotes |
- |
T7566 |
34913-34921 |
NN |
denotes |
reporter |
T7567 |
34926-34928 |
, |
denotes |
, |
T7568 |
34928-34936 |
NN |
denotes |
TOPFLASH |
T7569 |
34937-34938 |
-LRB- |
denotes |
[ |
T7570 |
34938-34939 |
CD |
denotes |
4 |
T7571 |
34939-34940 |
-RRB- |
denotes |
] |
T7572 |
34940-34941 |
. |
denotes |
. |
T7573 |
34941-35020 |
sentence |
denotes |
In contrast, Snail expression was not induced by these conditions (Figure 5A). |
T7574 |
34942-34944 |
IN |
denotes |
In |
T7575 |
34980-34987 |
VBN |
denotes |
induced |
T7576 |
34945-34953 |
NN |
denotes |
contrast |
T7577 |
34953-34955 |
, |
denotes |
, |
T7578 |
34955-34960 |
NN |
denotes |
Snail |
T7579 |
34961-34971 |
NN |
denotes |
expression |
T7580 |
34972-34975 |
VBD |
denotes |
was |
T7581 |
34976-34979 |
RB |
denotes |
not |
T7582 |
34988-34990 |
IN |
denotes |
by |
T7583 |
34991-34996 |
DT |
denotes |
these |
T7584 |
34997-35007 |
NNS |
denotes |
conditions |
T7585 |
35008-35009 |
-LRB- |
denotes |
( |
T7586 |
35016-35018 |
NN |
denotes |
5A |
T7587 |
35009-35015 |
NN |
denotes |
Figure |
T7588 |
35018-35019 |
-RRB- |
denotes |
) |
T7589 |
35019-35020 |
. |
denotes |
. |
T7590 |
35020-35224 |
sentence |
denotes |
Thus, despite essential roles for Wnts and noggin in hair follicle specification [4,29,30], our studies did not support an essential role for these signals in governing Snail expression in keratinocytes. |
T7591 |
35021-35025 |
RB |
denotes |
Thus |
T7592 |
35133-35140 |
VB |
denotes |
support |
T7593 |
35025-35027 |
, |
denotes |
, |
T7594 |
35027-35034 |
IN |
denotes |
despite |
T7595 |
35035-35044 |
JJ |
denotes |
essential |
T7596 |
35045-35050 |
NNS |
denotes |
roles |
T7597 |
35051-35054 |
IN |
denotes |
for |
T7598 |
35055-35059 |
NNS |
denotes |
Wnts |
T7599 |
35060-35063 |
CC |
denotes |
and |
T7600 |
35064-35070 |
NN |
denotes |
noggin |
T7601 |
35071-35073 |
IN |
denotes |
in |
T7602 |
35074-35078 |
NN |
denotes |
hair |
T7603 |
35079-35087 |
NN |
denotes |
follicle |
T7604 |
35088-35101 |
NN |
denotes |
specification |
T7605 |
35102-35103 |
-LRB- |
denotes |
[ |
T7606 |
35108-35110 |
CD |
denotes |
30 |
T7607 |
35103-35104 |
CD |
denotes |
4 |
T7608 |
35104-35105 |
, |
denotes |
, |
T7609 |
35105-35107 |
CD |
denotes |
29 |
T7610 |
35107-35108 |
, |
denotes |
, |
T7611 |
35110-35111 |
-RRB- |
denotes |
] |
T7612 |
35111-35113 |
, |
denotes |
, |
T7613 |
35113-35116 |
PRP$ |
denotes |
our |
T7614 |
35117-35124 |
NNS |
denotes |
studies |
T7615 |
35125-35128 |
VBD |
denotes |
did |
T7616 |
35129-35132 |
RB |
denotes |
not |
T7617 |
35141-35143 |
DT |
denotes |
an |
T7618 |
35154-35158 |
NN |
denotes |
role |
T7619 |
35144-35153 |
JJ |
denotes |
essential |
T7620 |
35159-35162 |
IN |
denotes |
for |
T7621 |
35163-35168 |
DT |
denotes |
these |
T7622 |
35169-35176 |
NNS |
denotes |
signals |
T7623 |
35177-35179 |
IN |
denotes |
in |
T7624 |
35180-35189 |
VBG |
denotes |
governing |
T7625 |
35190-35195 |
NN |
denotes |
Snail |
T7626 |
35196-35206 |
NN |
denotes |
expression |
T7627 |
35207-35209 |
IN |
denotes |
in |
T7628 |
35210-35223 |
NNS |
denotes |
keratinocytes |
T7629 |
35223-35224 |
. |
denotes |
. |
T7630 |
35224-37423 |
sentence |
denotes |
Figure 5 TGF-β2, but Not Wnt/noggin, Transiently Induces Snail Expression In Vitro
(A) Failure of Wnt and noggin signaling to induce Snail in cultured keratinocytes. Primary mouse keratinocytes were treated with Wnt- and/or noggin-conditioned medium (+) or the corresponding control medium (–). These conditions are known to activate the LEF-1/β-catenin reporter TOPGal and down-regulate the E-cadherin promoter (see [4] for details). Using Western blot analyses, cellular proteins were then analyzed for Snail, LEF-1, β-catenin, and tubulin. Proteins from keratinocytes transfected with K14-Snail were used as a positive control for Snail expression.
(B) TGF-β2 can induce Snail protein. Primary keratinocytes were treated for the indicated times with recombinant TGF-β2 (+) or heat inactivated TGF-β2 (–).Total cellular proteins were then isolated and analyzed by Western blot for Snail, pSMAD2 (reflective of activated TGF- signaling), and tubulin. Note the activation of Snail expression, peaking at 2 h post-TGF-β2 treatment and then disappearing thereafter.
(C) Snail mRNA expression is transiently induced by TGF-β2. The experiment in (B) was repeated, and this time, total RNAs were isolated from keratinocytes treated with TGF-β2 for the indicated times. RT-PCR was then used with (+) or without (–) reverse transcriptase (RT) and with primer sets specific for Snail and GAPDH mRNAs. Note that Snail mRNA expression also peaked at 2 h, paralleling Snail protein.
(D) TGF-β2 treatment results in enhanced activity of a Snail promoter-β-galactosidase reporter. Keratinocytes were transfected with a β-galactosidase reporter driven by a Snail promoter that is either WT (wt prom) or harbors a mutation in a putative pSMAD2/pSMAD4 binding site (mt prom). At 2 d posttransfection, cells were treated with either TGF-β or heat-inactivated TGF-β2 (inact) for the times indicated. β-galactosidase assays were then conducted, and results are reported as fold increase over a basal level of activity of 1. The experiment was repeated three times in triplicate, and error bars reflect variations in the results. TGF-β1 has been shown to induce Snail family members in hepatocytes and heart [15, 31]. |
T7631 |
37336-37339 |
NN |
denotes |
TGF |
T7632 |
37340-37342 |
NN |
denotes |
β1 |
T7633 |
37339-37340 |
HYPH |
denotes |
- |
T7634 |
37352-37357 |
VBN |
denotes |
shown |
T7635 |
37343-37346 |
VBZ |
denotes |
has |
T7636 |
37347-37351 |
VBN |
denotes |
been |
T7637 |
37358-37360 |
TO |
denotes |
to |
T7638 |
37361-37367 |
VB |
denotes |
induce |
T7639 |
37368-37373 |
NN |
denotes |
Snail |
T7640 |
37381-37388 |
NNS |
denotes |
members |
T7641 |
37374-37380 |
NN |
denotes |
family |
T7642 |
37389-37391 |
IN |
denotes |
in |
T7643 |
37392-37403 |
NNS |
denotes |
hepatocytes |
T7644 |
37404-37407 |
CC |
denotes |
and |
T7645 |
37408-37413 |
NN |
denotes |
heart |
T7646 |
37414-37415 |
-LRB- |
denotes |
[ |
T7647 |
37419-37421 |
CD |
denotes |
31 |
T7648 |
37415-37417 |
CD |
denotes |
15 |
T7649 |
37417-37419 |
, |
denotes |
, |
T7650 |
37421-37422 |
-RRB- |
denotes |
] |
T7651 |
37422-37423 |
. |
denotes |
. |
T7652 |
37423-37582 |
sentence |
denotes |
In keratinocytes, however, TGF-β1 inhibits keratinocyte growth and seems to be involved in triggering the destructive phase of the cycling hair follicle [32]. |
T7653 |
37424-37426 |
IN |
denotes |
In |
T7654 |
37458-37466 |
VBZ |
denotes |
inhibits |
T7655 |
37427-37440 |
NNS |
denotes |
keratinocytes |
T7656 |
37440-37442 |
, |
denotes |
, |
T7657 |
37442-37449 |
RB |
denotes |
however |
T7658 |
37449-37451 |
, |
denotes |
, |
T7659 |
37451-37454 |
NN |
denotes |
TGF |
T7660 |
37455-37457 |
NN |
denotes |
β1 |
T7661 |
37454-37455 |
HYPH |
denotes |
- |
T7662 |
37467-37479 |
NN |
denotes |
keratinocyte |
T7663 |
37480-37486 |
NN |
denotes |
growth |
T7664 |
37487-37490 |
CC |
denotes |
and |
T7665 |
37491-37496 |
VBZ |
denotes |
seems |
T7666 |
37497-37499 |
TO |
denotes |
to |
T7667 |
37503-37511 |
VBN |
denotes |
involved |
T7668 |
37500-37502 |
VB |
denotes |
be |
T7669 |
37512-37514 |
IN |
denotes |
in |
T7670 |
37515-37525 |
VBG |
denotes |
triggering |
T7671 |
37526-37529 |
DT |
denotes |
the |
T7672 |
37542-37547 |
NN |
denotes |
phase |
T7673 |
37530-37541 |
JJ |
denotes |
destructive |
T7674 |
37548-37550 |
IN |
denotes |
of |
T7675 |
37551-37554 |
DT |
denotes |
the |
T7676 |
37568-37576 |
NN |
denotes |
follicle |
T7677 |
37555-37562 |
VBG |
denotes |
cycling |
T7678 |
37563-37567 |
NN |
denotes |
hair |
T7679 |
37577-37578 |
-LRB- |
denotes |
[ |
T7680 |
37578-37580 |
CD |
denotes |
32 |
T7681 |
37580-37581 |
-RRB- |
denotes |
] |
T7682 |
37581-37582 |
. |
denotes |
. |
T7683 |
37582-37738 |
sentence |
denotes |
Of the loss-of-function mutations generated in each of the TGF-β genes, only the TGF-β2 null state blocked follicle development at the hair bud stage [32]. |
T7684 |
37583-37585 |
IN |
denotes |
Of |
T7685 |
37682-37689 |
VBD |
denotes |
blocked |
T7686 |
37586-37589 |
DT |
denotes |
the |
T7687 |
37607-37616 |
NNS |
denotes |
mutations |
T7688 |
37590-37594 |
NN |
denotes |
loss |
T7689 |
37594-37595 |
HYPH |
denotes |
- |
T7690 |
37595-37597 |
IN |
denotes |
of |
T7691 |
37597-37598 |
HYPH |
denotes |
- |
T7692 |
37598-37606 |
NN |
denotes |
function |
T7693 |
37617-37626 |
VBN |
denotes |
generated |
T7694 |
37627-37629 |
IN |
denotes |
in |
T7695 |
37630-37634 |
DT |
denotes |
each |
T7696 |
37635-37637 |
IN |
denotes |
of |
T7697 |
37638-37641 |
DT |
denotes |
the |
T7698 |
37648-37653 |
NNS |
denotes |
genes |
T7699 |
37642-37645 |
NN |
denotes |
TGF |
T7700 |
37646-37647 |
NN |
denotes |
β |
T7701 |
37645-37646 |
HYPH |
denotes |
- |
T7702 |
37653-37655 |
, |
denotes |
, |
T7703 |
37655-37659 |
RB |
denotes |
only |
T7704 |
37676-37681 |
NN |
denotes |
state |
T7705 |
37660-37663 |
DT |
denotes |
the |
T7706 |
37664-37667 |
NN |
denotes |
TGF |
T7707 |
37668-37670 |
NN |
denotes |
β2 |
T7708 |
37667-37668 |
HYPH |
denotes |
- |
T7709 |
37671-37675 |
JJ |
denotes |
null |
T7710 |
37690-37698 |
NN |
denotes |
follicle |
T7711 |
37699-37710 |
NN |
denotes |
development |
T7712 |
37711-37713 |
IN |
denotes |
at |
T7713 |
37714-37717 |
DT |
denotes |
the |
T7714 |
37727-37732 |
NN |
denotes |
stage |
T7715 |
37718-37722 |
NN |
denotes |
hair |
T7716 |
37723-37726 |
NN |
denotes |
bud |
T7717 |
37733-37734 |
-LRB- |
denotes |
[ |
T7718 |
37734-37736 |
CD |
denotes |
32 |
T7719 |
37736-37737 |
-RRB- |
denotes |
] |
T7720 |
37737-37738 |
. |
denotes |
. |
T7721 |
37738-37902 |
sentence |
denotes |
Thus, we turned towards addressing whether TGF-β2 might be involved in regulating Snail expression in keratinocytes isolated from the basal layer of the epidermis. |
T7722 |
37739-37743 |
RB |
denotes |
Thus |
T7723 |
37748-37754 |
VBD |
denotes |
turned |
T7724 |
37743-37745 |
, |
denotes |
, |
T7725 |
37745-37747 |
PRP |
denotes |
we |
T7726 |
37755-37762 |
IN |
denotes |
towards |
T7727 |
37763-37773 |
VBG |
denotes |
addressing |
T7728 |
37774-37781 |
IN |
denotes |
whether |
T7729 |
37798-37806 |
VBN |
denotes |
involved |
T7730 |
37782-37785 |
NN |
denotes |
TGF |
T7731 |
37786-37788 |
NN |
denotes |
β2 |
T7732 |
37785-37786 |
HYPH |
denotes |
- |
T7733 |
37789-37794 |
MD |
denotes |
might |
T7734 |
37795-37797 |
VB |
denotes |
be |
T7735 |
37807-37809 |
IN |
denotes |
in |
T7736 |
37810-37820 |
VBG |
denotes |
regulating |
T7737 |
37821-37826 |
NN |
denotes |
Snail |
T7738 |
37827-37837 |
NN |
denotes |
expression |
T7739 |
37838-37840 |
IN |
denotes |
in |
T7740 |
37841-37854 |
NNS |
denotes |
keratinocytes |
T7741 |
37855-37863 |
VBN |
denotes |
isolated |
T7742 |
37864-37868 |
IN |
denotes |
from |
T7743 |
37869-37872 |
DT |
denotes |
the |
T7744 |
37879-37884 |
NN |
denotes |
layer |
T7745 |
37873-37878 |
JJ |
denotes |
basal |
T7746 |
37885-37887 |
IN |
denotes |
of |
T7747 |
37888-37891 |
DT |
denotes |
the |
T7748 |
37892-37901 |
NN |
denotes |
epidermis |
T7749 |
37901-37902 |
. |
denotes |
. |
T7750 |
37902-38133 |
sentence |
denotes |
Though there is no cell culture system available to specifically study placodal cells, these keratinocytes are their progenitors and are the closest approximation available to study the behavior of epithelial cells of the placode. |
T7751 |
37903-37909 |
IN |
denotes |
Though |
T7752 |
37916-37918 |
VBZ |
denotes |
is |
T7753 |
37910-37915 |
EX |
denotes |
there |
T7754 |
38010-38013 |
VBP |
denotes |
are |
T7755 |
37919-37921 |
DT |
denotes |
no |
T7756 |
37935-37941 |
NN |
denotes |
system |
T7757 |
37922-37926 |
NN |
denotes |
cell |
T7758 |
37927-37934 |
NN |
denotes |
culture |
T7759 |
37942-37951 |
JJ |
denotes |
available |
T7760 |
37952-37954 |
TO |
denotes |
to |
T7761 |
37968-37973 |
VB |
denotes |
study |
T7762 |
37955-37967 |
RB |
denotes |
specifically |
T7763 |
37974-37982 |
JJ |
denotes |
placodal |
T7764 |
37983-37988 |
NNS |
denotes |
cells |
T7765 |
37988-37990 |
, |
denotes |
, |
T7766 |
37990-37995 |
DT |
denotes |
these |
T7767 |
37996-38009 |
NNS |
denotes |
keratinocytes |
T7768 |
38014-38019 |
PRP$ |
denotes |
their |
T7769 |
38020-38031 |
NNS |
denotes |
progenitors |
T7770 |
38032-38035 |
CC |
denotes |
and |
T7771 |
38036-38039 |
VBP |
denotes |
are |
T7772 |
38040-38043 |
DT |
denotes |
the |
T7773 |
38052-38065 |
NN |
denotes |
approximation |
T7774 |
38044-38051 |
JJS |
denotes |
closest |
T7775 |
38066-38075 |
JJ |
denotes |
available |
T7776 |
38076-38078 |
TO |
denotes |
to |
T7777 |
38079-38084 |
VB |
denotes |
study |
T7778 |
38085-38088 |
DT |
denotes |
the |
T7779 |
38089-38097 |
NN |
denotes |
behavior |
T7780 |
38098-38100 |
IN |
denotes |
of |
T7781 |
38101-38111 |
JJ |
denotes |
epithelial |
T7782 |
38112-38117 |
NNS |
denotes |
cells |
T7783 |
38118-38120 |
IN |
denotes |
of |
T7784 |
38121-38124 |
DT |
denotes |
the |
T7785 |
38125-38132 |
NN |
denotes |
placode |
T7786 |
38132-38133 |
. |
denotes |
. |
T7787 |
38133-38281 |
sentence |
denotes |
Interestingly, treatment of cultured keratinocytes with as little as 5 ng/ml of TGF-β2 caused a rapid and transient induction of Snail (Figure 5B). |
T7788 |
38134-38147 |
RB |
denotes |
Interestingly |
T7789 |
38221-38227 |
VBD |
denotes |
caused |
T7790 |
38147-38149 |
, |
denotes |
, |
T7791 |
38149-38158 |
NN |
denotes |
treatment |
T7792 |
38159-38161 |
IN |
denotes |
of |
T7793 |
38162-38170 |
VBN |
denotes |
cultured |
T7794 |
38171-38184 |
NNS |
denotes |
keratinocytes |
T7795 |
38185-38189 |
IN |
denotes |
with |
T7796 |
38190-38192 |
RB |
denotes |
as |
T7797 |
38203-38204 |
CD |
denotes |
5 |
T7798 |
38193-38199 |
JJ |
denotes |
little |
T7799 |
38200-38202 |
IN |
denotes |
as |
T7800 |
38205-38207 |
NN |
denotes |
ng |
T7801 |
38207-38208 |
SYM |
denotes |
/ |
T7802 |
38208-38210 |
NN |
denotes |
ml |
T7803 |
38211-38213 |
IN |
denotes |
of |
T7804 |
38214-38217 |
NN |
denotes |
TGF |
T7805 |
38218-38220 |
NN |
denotes |
β2 |
T7806 |
38217-38218 |
HYPH |
denotes |
- |
T7807 |
38228-38229 |
DT |
denotes |
a |
T7808 |
38250-38259 |
NN |
denotes |
induction |
T7809 |
38230-38235 |
JJ |
denotes |
rapid |
T7810 |
38236-38239 |
CC |
denotes |
and |
T7811 |
38240-38249 |
JJ |
denotes |
transient |
T7812 |
38260-38262 |
IN |
denotes |
of |
T7813 |
38263-38268 |
NN |
denotes |
Snail |
T7814 |
38269-38270 |
-LRB- |
denotes |
( |
T7815 |
38277-38279 |
NN |
denotes |
5B |
T7816 |
38270-38276 |
NN |
denotes |
Figure |
T7817 |
38279-38280 |
-RRB- |
denotes |
) |
T7818 |
38280-38281 |
. |
denotes |
. |
T7819 |
38281-38394 |
sentence |
denotes |
Following this treatment, Snail protein was detected within 30 min, peaked at 2 h, and then declined thereafter. |
T7820 |
38282-38291 |
VBG |
denotes |
Following |
T7821 |
38326-38334 |
VBN |
denotes |
detected |
T7822 |
38292-38296 |
DT |
denotes |
this |
T7823 |
38297-38306 |
NN |
denotes |
treatment |
T7824 |
38306-38308 |
, |
denotes |
, |
T7825 |
38308-38313 |
NN |
denotes |
Snail |
T7826 |
38314-38321 |
NN |
denotes |
protein |
T7827 |
38322-38325 |
VBD |
denotes |
was |
T7828 |
38335-38341 |
IN |
denotes |
within |
T7829 |
38342-38344 |
CD |
denotes |
30 |
T7830 |
38345-38348 |
NN |
denotes |
min |
T7831 |
38348-38350 |
, |
denotes |
, |
T7832 |
38350-38356 |
VBD |
denotes |
peaked |
T7833 |
38357-38359 |
IN |
denotes |
at |
T7834 |
38360-38361 |
CD |
denotes |
2 |
T7835 |
38362-38363 |
NN |
denotes |
h |
T7836 |
38363-38365 |
, |
denotes |
, |
T7837 |
38365-38368 |
CC |
denotes |
and |
T7838 |
38369-38373 |
RB |
denotes |
then |
T7839 |
38374-38382 |
VBD |
denotes |
declined |
T7840 |
38383-38393 |
RB |
denotes |
thereafter |
T7841 |
38393-38394 |
. |
denotes |
. |
T7842 |
38394-38586 |
sentence |
denotes |
The induction of Snail appeared to be specific for the active form of the growth factor, as pretreatment of TGF-β2 for 10 min at 100 °C obliterated the response [Figure 5B, lanes marked (–)]. |
T7843 |
38395-38398 |
DT |
denotes |
The |
T7844 |
38399-38408 |
NN |
denotes |
induction |
T7845 |
38418-38426 |
VBD |
denotes |
appeared |
T7846 |
38409-38411 |
IN |
denotes |
of |
T7847 |
38412-38417 |
NN |
denotes |
Snail |
T7848 |
38427-38429 |
TO |
denotes |
to |
T7849 |
38430-38432 |
VB |
denotes |
be |
T7850 |
38433-38441 |
JJ |
denotes |
specific |
T7851 |
38442-38445 |
IN |
denotes |
for |
T7852 |
38446-38449 |
DT |
denotes |
the |
T7853 |
38457-38461 |
NN |
denotes |
form |
T7854 |
38450-38456 |
JJ |
denotes |
active |
T7855 |
38462-38464 |
IN |
denotes |
of |
T7856 |
38465-38468 |
DT |
denotes |
the |
T7857 |
38476-38482 |
NN |
denotes |
factor |
T7858 |
38469-38475 |
NN |
denotes |
growth |
T7859 |
38482-38484 |
, |
denotes |
, |
T7860 |
38484-38486 |
IN |
denotes |
as |
T7861 |
38531-38542 |
VBD |
denotes |
obliterated |
T7862 |
38487-38499 |
NN |
denotes |
pretreatment |
T7863 |
38500-38502 |
IN |
denotes |
of |
T7864 |
38503-38506 |
NN |
denotes |
TGF |
T7865 |
38507-38509 |
NN |
denotes |
β2 |
T7866 |
38506-38507 |
HYPH |
denotes |
- |
T7867 |
38510-38513 |
IN |
denotes |
for |
T7868 |
38514-38516 |
CD |
denotes |
10 |
T7869 |
38517-38520 |
NN |
denotes |
min |
T7870 |
38521-38523 |
IN |
denotes |
at |
T7871 |
38524-38527 |
CD |
denotes |
100 |
T7872 |
38528-38530 |
NN |
denotes |
°C |
T7873 |
38543-38546 |
DT |
denotes |
the |
T7874 |
38547-38555 |
NN |
denotes |
response |
T7875 |
38556-38557 |
-LRB- |
denotes |
[ |
T7876 |
38568-38573 |
NNS |
denotes |
lanes |
T7877 |
38557-38563 |
NN |
denotes |
Figure |
T7878 |
38564-38566 |
NN |
denotes |
5B |
T7879 |
38566-38568 |
, |
denotes |
, |
T7880 |
38574-38580 |
VBN |
denotes |
marked |
T7881 |
38581-38582 |
-LRB- |
denotes |
( |
T7882 |
38582-38583 |
SYM |
denotes |
– |
T7883 |
38583-38584 |
-RRB- |
denotes |
) |
T7884 |
38584-38585 |
-RRB- |
denotes |
] |
T7885 |
38585-38586 |
. |
denotes |
. |
T7886 |
38586-38824 |
sentence |
denotes |
By contrast, although TGF-β receptor activation remained elevated during the duration of the experiment (as measured by the sustained phosphorylation of the downstream effector SMAD2) Snail expression could not be maintained (Figure 5B). |
T7887 |
38587-38589 |
IN |
denotes |
By |
T7888 |
38801-38811 |
VBN |
denotes |
maintained |
T7889 |
38590-38598 |
NN |
denotes |
contrast |
T7890 |
38598-38600 |
, |
denotes |
, |
T7891 |
38600-38608 |
IN |
denotes |
although |
T7892 |
38635-38643 |
VBD |
denotes |
remained |
T7893 |
38609-38612 |
NN |
denotes |
TGF |
T7894 |
38613-38614 |
NN |
denotes |
β |
T7895 |
38612-38613 |
HYPH |
denotes |
- |
T7896 |
38615-38623 |
NN |
denotes |
receptor |
T7897 |
38624-38634 |
NN |
denotes |
activation |
T7898 |
38644-38652 |
JJ |
denotes |
elevated |
T7899 |
38653-38659 |
IN |
denotes |
during |
T7900 |
38660-38663 |
DT |
denotes |
the |
T7901 |
38664-38672 |
NN |
denotes |
duration |
T7902 |
38673-38675 |
IN |
denotes |
of |
T7903 |
38676-38679 |
DT |
denotes |
the |
T7904 |
38680-38690 |
NN |
denotes |
experiment |
T7905 |
38691-38692 |
-LRB- |
denotes |
( |
T7906 |
38692-38694 |
IN |
denotes |
as |
T7907 |
38695-38703 |
VBN |
denotes |
measured |
T7908 |
38704-38706 |
IN |
denotes |
by |
T7909 |
38707-38710 |
DT |
denotes |
the |
T7910 |
38721-38736 |
NN |
denotes |
phosphorylation |
T7911 |
38711-38720 |
JJ |
denotes |
sustained |
T7912 |
38737-38739 |
IN |
denotes |
of |
T7913 |
38740-38743 |
DT |
denotes |
the |
T7914 |
38755-38763 |
NN |
denotes |
effector |
T7915 |
38744-38754 |
JJ |
denotes |
downstream |
T7916 |
38764-38769 |
NN |
denotes |
SMAD2 |
T7917 |
38769-38770 |
-RRB- |
denotes |
) |
T7918 |
38771-38776 |
NN |
denotes |
Snail |
T7919 |
38777-38787 |
NN |
denotes |
expression |
T7920 |
38788-38793 |
MD |
denotes |
could |
T7921 |
38794-38797 |
RB |
denotes |
not |
T7922 |
38798-38800 |
VB |
denotes |
be |
T7923 |
38812-38813 |
-LRB- |
denotes |
( |
T7924 |
38820-38822 |
NN |
denotes |
5B |
T7925 |
38813-38819 |
NN |
denotes |
Figure |
T7926 |
38822-38823 |
-RRB- |
denotes |
) |
T7927 |
38823-38824 |
. |
denotes |
. |
T7928 |
38824-38972 |
sentence |
denotes |
Thus, although Snail expression correlated with phosphorylated SMAD2 (pSMAD2) induction, its decline seemed to rely on secondary downstream events. |
T7929 |
38825-38829 |
RB |
denotes |
Thus |
T7930 |
38926-38932 |
VBD |
denotes |
seemed |
T7931 |
38829-38831 |
, |
denotes |
, |
T7932 |
38831-38839 |
IN |
denotes |
although |
T7933 |
38857-38867 |
VBD |
denotes |
correlated |
T7934 |
38840-38845 |
NN |
denotes |
Snail |
T7935 |
38846-38856 |
NN |
denotes |
expression |
T7936 |
38868-38872 |
IN |
denotes |
with |
T7937 |
38873-38887 |
VBN |
denotes |
phosphorylated |
T7938 |
38888-38893 |
NN |
denotes |
SMAD2 |
T7939 |
38903-38912 |
NN |
denotes |
induction |
T7940 |
38894-38895 |
-LRB- |
denotes |
( |
T7941 |
38895-38901 |
NN |
denotes |
pSMAD2 |
T7942 |
38901-38902 |
-RRB- |
denotes |
) |
T7943 |
38912-38914 |
, |
denotes |
, |
T7944 |
38914-38917 |
PRP$ |
denotes |
its |
T7945 |
38918-38925 |
NN |
denotes |
decline |
T7946 |
38933-38935 |
TO |
denotes |
to |
T7947 |
38936-38940 |
VB |
denotes |
rely |
T7948 |
38941-38943 |
IN |
denotes |
on |
T7949 |
38944-38953 |
JJ |
denotes |
secondary |
T7950 |
38965-38971 |
NNS |
denotes |
events |
T7951 |
38954-38964 |
JJ |
denotes |
downstream |
T7952 |
38971-38972 |
. |
denotes |
. |
T7953 |
38972-39154 |
sentence |
denotes |
The rapid kinetics of Snail expression were reflected at the mRNA level, suggesting that Snail promoter activity in keratinocytes might be sensitive to TGF-β2 signaling (Figure 5C). |
T7954 |
38973-38976 |
DT |
denotes |
The |
T7955 |
38983-38991 |
NNS |
denotes |
kinetics |
T7956 |
38977-38982 |
JJ |
denotes |
rapid |
T7957 |
39017-39026 |
VBN |
denotes |
reflected |
T7958 |
38992-38994 |
IN |
denotes |
of |
T7959 |
38995-39000 |
NN |
denotes |
Snail |
T7960 |
39001-39011 |
NN |
denotes |
expression |
T7961 |
39012-39016 |
VBD |
denotes |
were |
T7962 |
39027-39029 |
IN |
denotes |
at |
T7963 |
39030-39033 |
DT |
denotes |
the |
T7964 |
39039-39044 |
NN |
denotes |
level |
T7965 |
39034-39038 |
NN |
denotes |
mRNA |
T7966 |
39044-39046 |
, |
denotes |
, |
T7967 |
39046-39056 |
VBG |
denotes |
suggesting |
T7968 |
39057-39061 |
IN |
denotes |
that |
T7969 |
39109-39111 |
VB |
denotes |
be |
T7970 |
39062-39067 |
NN |
denotes |
Snail |
T7971 |
39068-39076 |
NN |
denotes |
promoter |
T7972 |
39077-39085 |
NN |
denotes |
activity |
T7973 |
39086-39088 |
IN |
denotes |
in |
T7974 |
39089-39102 |
NNS |
denotes |
keratinocytes |
T7975 |
39103-39108 |
MD |
denotes |
might |
T7976 |
39112-39121 |
JJ |
denotes |
sensitive |
T7977 |
39122-39124 |
IN |
denotes |
to |
T7978 |
39125-39128 |
NN |
denotes |
TGF |
T7979 |
39129-39131 |
NN |
denotes |
β2 |
T7980 |
39128-39129 |
HYPH |
denotes |
- |
T7981 |
39132-39141 |
NN |
denotes |
signaling |
T7982 |
39142-39143 |
-LRB- |
denotes |
( |
T7983 |
39150-39152 |
NN |
denotes |
5C |
T7984 |
39143-39149 |
NN |
denotes |
Figure |
T7985 |
39152-39153 |
-RRB- |
denotes |
) |
T7986 |
39153-39154 |
. |
denotes |
. |
T7987 |
39154-39381 |
sentence |
denotes |
To test this possibility, we engineered a transgene driving the β-galactosidase reporter under the control of approximately 2.2 kb of promoter sequence located 5′ from the transcription initiation site of the mouse Snail gene. |
T7988 |
39155-39157 |
TO |
denotes |
To |
T7989 |
39158-39162 |
VB |
denotes |
test |
T7990 |
39184-39194 |
VBD |
denotes |
engineered |
T7991 |
39163-39167 |
DT |
denotes |
this |
T7992 |
39168-39179 |
NN |
denotes |
possibility |
T7993 |
39179-39181 |
, |
denotes |
, |
T7994 |
39181-39183 |
PRP |
denotes |
we |
T7995 |
39195-39196 |
DT |
denotes |
a |
T7996 |
39197-39206 |
NN |
denotes |
transgene |
T7997 |
39207-39214 |
VBG |
denotes |
driving |
T7998 |
39215-39218 |
DT |
denotes |
the |
T7999 |
39235-39243 |
NN |
denotes |
reporter |
T8000 |
39219-39220 |
NN |
denotes |
β |
T8001 |
39221-39234 |
NN |
denotes |
galactosidase |
T8002 |
39220-39221 |
HYPH |
denotes |
- |
T8003 |
39244-39249 |
IN |
denotes |
under |
T8004 |
39250-39253 |
DT |
denotes |
the |
T8005 |
39254-39261 |
NN |
denotes |
control |
T8006 |
39262-39264 |
IN |
denotes |
of |
T8007 |
39265-39278 |
RB |
denotes |
approximately |
T8008 |
39279-39282 |
CD |
denotes |
2.2 |
T8009 |
39283-39285 |
NN |
denotes |
kb |
T8010 |
39286-39288 |
IN |
denotes |
of |
T8011 |
39289-39297 |
NN |
denotes |
promoter |
T8012 |
39298-39306 |
NN |
denotes |
sequence |
T8013 |
39307-39314 |
VBN |
denotes |
located |
T8014 |
39315-39316 |
CD |
denotes |
5 |
T8015 |
39316-39317 |
SYM |
denotes |
′ |
T8016 |
39318-39322 |
IN |
denotes |
from |
T8017 |
39323-39326 |
DT |
denotes |
the |
T8018 |
39352-39356 |
NN |
denotes |
site |
T8019 |
39327-39340 |
NN |
denotes |
transcription |
T8020 |
39341-39351 |
NN |
denotes |
initiation |
T8021 |
39357-39359 |
IN |
denotes |
of |
T8022 |
39360-39363 |
DT |
denotes |
the |
T8023 |
39376-39380 |
NN |
denotes |
gene |
T8024 |
39364-39369 |
NN |
denotes |
mouse |
T8025 |
39370-39375 |
NN |
denotes |
Snail |
T8026 |
39380-39381 |
. |
denotes |
. |
T8027 |
39381-39581 |
sentence |
denotes |
At 2 d after transient transfection, keratinocytes were treated with TGF-β2 (t = 0) and then assayed for transgene activity over the same time course in which we had observed Snail protein induction. |
T8028 |
39382-39384 |
IN |
denotes |
At |
T8029 |
39438-39445 |
VBN |
denotes |
treated |
T8030 |
39385-39386 |
CD |
denotes |
2 |
T8031 |
39387-39388 |
NN |
denotes |
d |
T8032 |
39389-39394 |
IN |
denotes |
after |
T8033 |
39395-39404 |
JJ |
denotes |
transient |
T8034 |
39405-39417 |
NN |
denotes |
transfection |
T8035 |
39417-39419 |
, |
denotes |
, |
T8036 |
39419-39432 |
NNS |
denotes |
keratinocytes |
T8037 |
39433-39437 |
VBD |
denotes |
were |
T8038 |
39446-39450 |
IN |
denotes |
with |
T8039 |
39451-39454 |
NN |
denotes |
TGF |
T8040 |
39455-39457 |
NN |
denotes |
β2 |
T8041 |
39454-39455 |
HYPH |
denotes |
- |
T8042 |
39458-39459 |
-LRB- |
denotes |
( |
T8043 |
39463-39464 |
CD |
denotes |
0 |
T8044 |
39459-39460 |
NN |
denotes |
t |
T8045 |
39461-39462 |
SYM |
denotes |
= |
T8046 |
39464-39465 |
-RRB- |
denotes |
) |
T8047 |
39466-39469 |
CC |
denotes |
and |
T8048 |
39470-39474 |
RB |
denotes |
then |
T8049 |
39475-39482 |
VBN |
denotes |
assayed |
T8050 |
39483-39486 |
IN |
denotes |
for |
T8051 |
39487-39496 |
NN |
denotes |
transgene |
T8052 |
39497-39505 |
NN |
denotes |
activity |
T8053 |
39506-39510 |
IN |
denotes |
over |
T8054 |
39511-39514 |
DT |
denotes |
the |
T8055 |
39525-39531 |
NN |
denotes |
course |
T8056 |
39515-39519 |
JJ |
denotes |
same |
T8057 |
39520-39524 |
NN |
denotes |
time |
T8058 |
39532-39534 |
IN |
denotes |
in |
T8059 |
39548-39556 |
VBN |
denotes |
observed |
T8060 |
39535-39540 |
WDT |
denotes |
which |
T8061 |
39541-39543 |
PRP |
denotes |
we |
T8062 |
39544-39547 |
VBD |
denotes |
had |
T8063 |
39557-39562 |
NN |
denotes |
Snail |
T8064 |
39563-39570 |
NN |
denotes |
protein |
T8065 |
39571-39580 |
NN |
denotes |
induction |
T8066 |
39580-39581 |
. |
denotes |
. |
T8067 |
39581-39640 |
sentence |
denotes |
The results of this experiment are presented in Figure 5D. |
T8068 |
39582-39585 |
DT |
denotes |
The |
T8069 |
39586-39593 |
NNS |
denotes |
results |
T8070 |
39617-39626 |
VBN |
denotes |
presented |
T8071 |
39594-39596 |
IN |
denotes |
of |
T8072 |
39597-39601 |
DT |
denotes |
this |
T8073 |
39602-39612 |
NN |
denotes |
experiment |
T8074 |
39613-39616 |
VBP |
denotes |
are |
T8075 |
39627-39629 |
IN |
denotes |
in |
T8076 |
39630-39636 |
NN |
denotes |
Figure |
T8077 |
39637-39639 |
NN |
denotes |
5D |
T8078 |
39639-39640 |
. |
denotes |
. |
T8079 |
39640-39800 |
sentence |
denotes |
Within 0.5 h of TGF-β2 treatment, Snail promoter activity had increased 3-fold, and by 2 h, it peaked to approximately 10-fold over control levels (Figure 5D). |
T8080 |
39641-39647 |
IN |
denotes |
Within |
T8081 |
39703-39712 |
VBN |
denotes |
increased |
T8082 |
39648-39651 |
CD |
denotes |
0.5 |
T8083 |
39652-39653 |
NN |
denotes |
h |
T8084 |
39654-39656 |
IN |
denotes |
of |
T8085 |
39657-39660 |
NN |
denotes |
TGF |
T8086 |
39661-39663 |
NN |
denotes |
β2 |
T8087 |
39660-39661 |
HYPH |
denotes |
- |
T8088 |
39664-39673 |
NN |
denotes |
treatment |
T8089 |
39673-39675 |
, |
denotes |
, |
T8090 |
39675-39680 |
NN |
denotes |
Snail |
T8091 |
39681-39689 |
NN |
denotes |
promoter |
T8092 |
39690-39698 |
NN |
denotes |
activity |
T8093 |
39699-39702 |
VBD |
denotes |
had |
T8094 |
39713-39719 |
RB |
denotes |
3-fold |
T8095 |
39719-39721 |
, |
denotes |
, |
T8096 |
39721-39724 |
CC |
denotes |
and |
T8097 |
39725-39727 |
IN |
denotes |
by |
T8098 |
39736-39742 |
VBD |
denotes |
peaked |
T8099 |
39728-39729 |
CD |
denotes |
2 |
T8100 |
39730-39731 |
NN |
denotes |
h |
T8101 |
39731-39733 |
, |
denotes |
, |
T8102 |
39733-39735 |
PRP |
denotes |
it |
T8103 |
39743-39745 |
IN |
denotes |
to |
T8104 |
39746-39759 |
RB |
denotes |
approximately |
T8105 |
39760-39767 |
RB |
denotes |
10-fold |
T8106 |
39768-39772 |
IN |
denotes |
over |
T8107 |
39773-39780 |
NN |
denotes |
control |
T8108 |
39781-39787 |
NNS |
denotes |
levels |
T8109 |
39788-39789 |
-LRB- |
denotes |
( |
T8110 |
39796-39798 |
NN |
denotes |
5D |
T8111 |
39789-39795 |
NN |
denotes |
Figure |
T8112 |
39798-39799 |
-RRB- |
denotes |
) |
T8113 |
39799-39800 |
. |
denotes |
. |
T8114 |
39800-39909 |
sentence |
denotes |
Thereafter, Snail promoter activity rapidly returned to the basal levels seen in unstimulated keratinocytes. |
T8115 |
39801-39811 |
RB |
denotes |
Thereafter |
T8116 |
39845-39853 |
VBD |
denotes |
returned |
T8117 |
39811-39813 |
, |
denotes |
, |
T8118 |
39813-39818 |
NN |
denotes |
Snail |
T8119 |
39819-39827 |
NN |
denotes |
promoter |
T8120 |
39828-39836 |
NN |
denotes |
activity |
T8121 |
39837-39844 |
RB |
denotes |
rapidly |
T8122 |
39854-39856 |
IN |
denotes |
to |
T8123 |
39857-39860 |
DT |
denotes |
the |
T8124 |
39867-39873 |
NNS |
denotes |
levels |
T8125 |
39861-39866 |
JJ |
denotes |
basal |
T8126 |
39874-39878 |
VBN |
denotes |
seen |
T8127 |
39879-39881 |
IN |
denotes |
in |
T8128 |
39882-39894 |
JJ |
denotes |
unstimulated |
T8129 |
39895-39908 |
NNS |
denotes |
keratinocytes |
T8130 |
39908-39909 |
. |
denotes |
. |
T8131 |
39909-40012 |
sentence |
denotes |
The kinetics of Snail promoter activity closely paralleled those observed for Snail protein induction. |
T8132 |
39910-39913 |
DT |
denotes |
The |
T8133 |
39914-39922 |
NNS |
denotes |
kinetics |
T8134 |
39958-39968 |
VBD |
denotes |
paralleled |
T8135 |
39923-39925 |
IN |
denotes |
of |
T8136 |
39926-39931 |
NN |
denotes |
Snail |
T8137 |
39932-39940 |
NN |
denotes |
promoter |
T8138 |
39941-39949 |
NN |
denotes |
activity |
T8139 |
39950-39957 |
RB |
denotes |
closely |
T8140 |
39969-39974 |
DT |
denotes |
those |
T8141 |
39975-39983 |
VBN |
denotes |
observed |
T8142 |
39984-39987 |
IN |
denotes |
for |
T8143 |
39988-39993 |
NN |
denotes |
Snail |
T8144 |
39994-40001 |
NN |
denotes |
protein |
T8145 |
40002-40011 |
NN |
denotes |
induction |
T8146 |
40011-40012 |
. |
denotes |
. |
T8147 |
40012-40284 |
sentence |
denotes |
Moreover, the stimulatory effects appeared to be specific to TGF-β2, since they were abrogated either by heat inactivation of the TGF-β2 protein or by mutation of a putative SMAD binding element located about 1.8 kb 5′ from the Snail transcription start site (Figure 5D). |
T8148 |
40013-40021 |
RB |
denotes |
Moreover |
T8149 |
40047-40055 |
VBD |
denotes |
appeared |
T8150 |
40021-40023 |
, |
denotes |
, |
T8151 |
40023-40026 |
DT |
denotes |
the |
T8152 |
40039-40046 |
NNS |
denotes |
effects |
T8153 |
40027-40038 |
JJ |
denotes |
stimulatory |
T8154 |
40056-40058 |
TO |
denotes |
to |
T8155 |
40059-40061 |
VB |
denotes |
be |
T8156 |
40062-40070 |
JJ |
denotes |
specific |
T8157 |
40071-40073 |
IN |
denotes |
to |
T8158 |
40074-40077 |
NN |
denotes |
TGF |
T8159 |
40078-40080 |
NN |
denotes |
β2 |
T8160 |
40077-40078 |
HYPH |
denotes |
- |
T8161 |
40080-40082 |
, |
denotes |
, |
T8162 |
40082-40087 |
IN |
denotes |
since |
T8163 |
40098-40107 |
VBN |
denotes |
abrogated |
T8164 |
40088-40092 |
PRP |
denotes |
they |
T8165 |
40093-40097 |
VBD |
denotes |
were |
T8166 |
40108-40114 |
CC |
denotes |
either |
T8167 |
40115-40117 |
IN |
denotes |
by |
T8168 |
40118-40122 |
NN |
denotes |
heat |
T8169 |
40123-40135 |
NN |
denotes |
inactivation |
T8170 |
40136-40138 |
IN |
denotes |
of |
T8171 |
40139-40142 |
DT |
denotes |
the |
T8172 |
40150-40157 |
NN |
denotes |
protein |
T8173 |
40143-40146 |
NN |
denotes |
TGF |
T8174 |
40147-40149 |
NN |
denotes |
β2 |
T8175 |
40146-40147 |
HYPH |
denotes |
- |
T8176 |
40158-40160 |
CC |
denotes |
or |
T8177 |
40161-40163 |
IN |
denotes |
by |
T8178 |
40164-40172 |
NN |
denotes |
mutation |
T8179 |
40173-40175 |
IN |
denotes |
of |
T8180 |
40176-40177 |
DT |
denotes |
a |
T8181 |
40200-40207 |
NN |
denotes |
element |
T8182 |
40178-40186 |
JJ |
denotes |
putative |
T8183 |
40187-40191 |
NN |
denotes |
SMAD |
T8184 |
40192-40199 |
NN |
denotes |
binding |
T8185 |
40208-40215 |
VBN |
denotes |
located |
T8186 |
40216-40221 |
IN |
denotes |
about |
T8187 |
40222-40225 |
CD |
denotes |
1.8 |
T8188 |
40226-40228 |
NN |
denotes |
kb |
T8189 |
40229-40230 |
CD |
denotes |
5 |
T8190 |
40230-40231 |
SYM |
denotes |
′ |
T8191 |
40232-40236 |
IN |
denotes |
from |
T8192 |
40237-40240 |
DT |
denotes |
the |
T8193 |
40267-40271 |
NN |
denotes |
site |
T8194 |
40241-40246 |
NN |
denotes |
Snail |
T8195 |
40247-40260 |
NN |
denotes |
transcription |
T8196 |
40261-40266 |
NN |
denotes |
start |
T8197 |
40272-40273 |
-LRB- |
denotes |
( |
T8198 |
40280-40282 |
NN |
denotes |
5D |
T8199 |
40273-40279 |
NN |
denotes |
Figure |
T8200 |
40282-40283 |
-RRB- |
denotes |
) |
T8201 |
40283-40284 |
. |
denotes |
. |
T8202 |
40284-40523 |
sentence |
denotes |
Taken together, these results suggested that in keratinocytes, TGF-β2 signaling results in a pSMAD2-dependent transient activation of the Snail gene, and that maintenance of Snail protein relies, in part, upon sustained promoter activity. |
T8203 |
40285-40290 |
VBN |
denotes |
Taken |
T8204 |
40315-40324 |
VBD |
denotes |
suggested |
T8205 |
40291-40299 |
RB |
denotes |
together |
T8206 |
40299-40301 |
, |
denotes |
, |
T8207 |
40301-40306 |
DT |
denotes |
these |
T8208 |
40307-40314 |
NNS |
denotes |
results |
T8209 |
40325-40329 |
IN |
denotes |
that |
T8210 |
40365-40372 |
VBZ |
denotes |
results |
T8211 |
40330-40332 |
IN |
denotes |
in |
T8212 |
40333-40346 |
NNS |
denotes |
keratinocytes |
T8213 |
40346-40348 |
, |
denotes |
, |
T8214 |
40348-40351 |
NN |
denotes |
TGF |
T8215 |
40352-40354 |
NN |
denotes |
β2 |
T8216 |
40351-40352 |
HYPH |
denotes |
- |
T8217 |
40355-40364 |
NN |
denotes |
signaling |
T8218 |
40373-40375 |
IN |
denotes |
in |
T8219 |
40376-40377 |
DT |
denotes |
a |
T8220 |
40405-40415 |
NN |
denotes |
activation |
T8221 |
40378-40384 |
NN |
denotes |
pSMAD2 |
T8222 |
40385-40394 |
JJ |
denotes |
dependent |
T8223 |
40384-40385 |
HYPH |
denotes |
- |
T8224 |
40395-40404 |
JJ |
denotes |
transient |
T8225 |
40416-40418 |
IN |
denotes |
of |
T8226 |
40419-40422 |
DT |
denotes |
the |
T8227 |
40429-40433 |
NN |
denotes |
gene |
T8228 |
40423-40428 |
NN |
denotes |
Snail |
T8229 |
40433-40435 |
, |
denotes |
, |
T8230 |
40435-40438 |
CC |
denotes |
and |
T8231 |
40439-40443 |
IN |
denotes |
that |
T8232 |
40473-40479 |
VBZ |
denotes |
relies |
T8233 |
40444-40455 |
NN |
denotes |
maintenance |
T8234 |
40456-40458 |
IN |
denotes |
of |
T8235 |
40459-40464 |
NN |
denotes |
Snail |
T8236 |
40465-40472 |
NN |
denotes |
protein |
T8237 |
40479-40481 |
, |
denotes |
, |
T8238 |
40481-40483 |
IN |
denotes |
in |
T8239 |
40484-40488 |
NN |
denotes |
part |
T8240 |
40488-40490 |
, |
denotes |
, |
T8241 |
40490-40494 |
IN |
denotes |
upon |
T8242 |
40495-40504 |
JJ |
denotes |
sustained |
T8243 |
40514-40522 |
NN |
denotes |
activity |
T8244 |
40505-40513 |
NN |
denotes |
promoter |
T8245 |
40522-40523 |
. |
denotes |
. |
T8246 |
40523-40746 |
sentence |
denotes |
The brevity of Snail gene and protein induction in TGF-β2 treated cultured keratinocytes resembled the temporal appearance of Snail mRNA and protein at the initiation of hair follicle morphogenesis in embryonic mouse skin. |
T8247 |
40524-40527 |
DT |
denotes |
The |
T8248 |
40528-40535 |
NN |
denotes |
brevity |
T8249 |
40613-40622 |
VBD |
denotes |
resembled |
T8250 |
40536-40538 |
IN |
denotes |
of |
T8251 |
40539-40544 |
NN |
denotes |
Snail |
T8252 |
40545-40549 |
NN |
denotes |
gene |
T8253 |
40562-40571 |
NN |
denotes |
induction |
T8254 |
40550-40553 |
CC |
denotes |
and |
T8255 |
40554-40561 |
NN |
denotes |
protein |
T8256 |
40572-40574 |
IN |
denotes |
in |
T8257 |
40575-40578 |
NN |
denotes |
TGF |
T8258 |
40579-40581 |
NN |
denotes |
β2 |
T8259 |
40578-40579 |
HYPH |
denotes |
- |
T8260 |
40582-40589 |
VBN |
denotes |
treated |
T8261 |
40599-40612 |
NNS |
denotes |
keratinocytes |
T8262 |
40590-40598 |
VBN |
denotes |
cultured |
T8263 |
40623-40626 |
DT |
denotes |
the |
T8264 |
40636-40646 |
NN |
denotes |
appearance |
T8265 |
40627-40635 |
JJ |
denotes |
temporal |
T8266 |
40647-40649 |
IN |
denotes |
of |
T8267 |
40650-40655 |
NN |
denotes |
Snail |
T8268 |
40656-40660 |
NN |
denotes |
mRNA |
T8269 |
40661-40664 |
CC |
denotes |
and |
T8270 |
40665-40672 |
NN |
denotes |
protein |
T8271 |
40673-40675 |
IN |
denotes |
at |
T8272 |
40676-40679 |
DT |
denotes |
the |
T8273 |
40680-40690 |
NN |
denotes |
initiation |
T8274 |
40691-40693 |
IN |
denotes |
of |
T8275 |
40694-40698 |
NN |
denotes |
hair |
T8276 |
40699-40707 |
NN |
denotes |
follicle |
T8277 |
40708-40721 |
NN |
denotes |
morphogenesis |
T8278 |
40722-40724 |
IN |
denotes |
in |
T8279 |
40725-40734 |
JJ |
denotes |
embryonic |
T8280 |
40741-40745 |
NN |
denotes |
skin |
T8281 |
40735-40740 |
NN |
denotes |
mouse |
T8282 |
40745-40746 |
. |
denotes |
. |
T8283 |
40746-40912 |
sentence |
denotes |
To test whether TGF-β2 might be required for Snail induction in hair bud formation in vivo, we first analyzed whether TGF-β2 was expressed in or around the hair bud. |
T8284 |
40747-40749 |
TO |
denotes |
To |
T8285 |
40750-40754 |
VB |
denotes |
test |
T8286 |
40848-40856 |
VBD |
denotes |
analyzed |
T8287 |
40755-40762 |
IN |
denotes |
whether |
T8288 |
40779-40787 |
VBN |
denotes |
required |
T8289 |
40763-40766 |
NN |
denotes |
TGF |
T8290 |
40767-40769 |
NN |
denotes |
β2 |
T8291 |
40766-40767 |
HYPH |
denotes |
- |
T8292 |
40770-40775 |
MD |
denotes |
might |
T8293 |
40776-40778 |
VB |
denotes |
be |
T8294 |
40788-40791 |
IN |
denotes |
for |
T8295 |
40792-40797 |
NN |
denotes |
Snail |
T8296 |
40798-40807 |
NN |
denotes |
induction |
T8297 |
40808-40810 |
IN |
denotes |
in |
T8298 |
40811-40815 |
NN |
denotes |
hair |
T8299 |
40816-40819 |
NN |
denotes |
bud |
T8300 |
40820-40829 |
NN |
denotes |
formation |
T8301 |
40830-40832 |
FW |
denotes |
in |
T8302 |
40833-40837 |
FW |
denotes |
vivo |
T8303 |
40837-40839 |
, |
denotes |
, |
T8304 |
40839-40841 |
PRP |
denotes |
we |
T8305 |
40842-40847 |
RB |
denotes |
first |
T8306 |
40857-40864 |
IN |
denotes |
whether |
T8307 |
40876-40885 |
VBN |
denotes |
expressed |
T8308 |
40865-40868 |
NN |
denotes |
TGF |
T8309 |
40869-40871 |
NN |
denotes |
β2 |
T8310 |
40868-40869 |
HYPH |
denotes |
- |
T8311 |
40872-40875 |
VBD |
denotes |
was |
T8312 |
40886-40888 |
IN |
denotes |
in |
T8313 |
40889-40891 |
CC |
denotes |
or |
T8314 |
40892-40898 |
IN |
denotes |
around |
T8315 |
40899-40902 |
DT |
denotes |
the |
T8316 |
40908-40911 |
NN |
denotes |
bud |
T8317 |
40903-40907 |
NN |
denotes |
hair |
T8318 |
40911-40912 |
. |
denotes |
. |
T8319 |
40912-41022 |
sentence |
denotes |
Consistent with previous observations [33], an anti-TGF-β2 antibody labeled developing hair buds (Figure 6A). |
T8320 |
40913-40923 |
JJ |
denotes |
Consistent |
T8321 |
40981-40988 |
VBD |
denotes |
labeled |
T8322 |
40924-40928 |
IN |
denotes |
with |
T8323 |
40929-40937 |
JJ |
denotes |
previous |
T8324 |
40938-40950 |
NNS |
denotes |
observations |
T8325 |
40951-40952 |
-LRB- |
denotes |
[ |
T8326 |
40952-40954 |
CD |
denotes |
33 |
T8327 |
40954-40955 |
-RRB- |
denotes |
] |
T8328 |
40955-40957 |
, |
denotes |
, |
T8329 |
40957-40959 |
DT |
denotes |
an |
T8330 |
40972-40980 |
NN |
denotes |
antibody |
T8331 |
40960-40968 |
JJ |
denotes |
anti-TGF |
T8332 |
40969-40971 |
NN |
denotes |
β2 |
T8333 |
40968-40969 |
HYPH |
denotes |
- |
T8334 |
40989-40999 |
VBG |
denotes |
developing |
T8335 |
41005-41009 |
NNS |
denotes |
buds |
T8336 |
41000-41004 |
NN |
denotes |
hair |
T8337 |
41010-41011 |
-LRB- |
denotes |
( |
T8338 |
41018-41020 |
NN |
denotes |
6A |
T8339 |
41011-41017 |
NN |
denotes |
Figure |
T8340 |
41020-41021 |
-RRB- |
denotes |
) |
T8341 |
41021-41022 |
. |
denotes |
. |
T8342 |
41022-41178 |
sentence |
denotes |
This labeling appeared to be specific as judged by the lack of staining in follicle buds from mice homozygous for a TGF-β2 null mutation (Figure 6A; [34]). |
T8343 |
41023-41027 |
DT |
denotes |
This |
T8344 |
41028-41036 |
NN |
denotes |
labeling |
T8345 |
41037-41045 |
VBD |
denotes |
appeared |
T8346 |
41046-41048 |
TO |
denotes |
to |
T8347 |
41049-41051 |
VB |
denotes |
be |
T8348 |
41052-41060 |
JJ |
denotes |
specific |
T8349 |
41061-41063 |
IN |
denotes |
as |
T8350 |
41064-41070 |
VBN |
denotes |
judged |
T8351 |
41071-41073 |
IN |
denotes |
by |
T8352 |
41074-41077 |
DT |
denotes |
the |
T8353 |
41078-41082 |
NN |
denotes |
lack |
T8354 |
41083-41085 |
IN |
denotes |
of |
T8355 |
41086-41094 |
NN |
denotes |
staining |
T8356 |
41095-41097 |
IN |
denotes |
in |
T8357 |
41098-41106 |
NN |
denotes |
follicle |
T8358 |
41107-41111 |
NNS |
denotes |
buds |
T8359 |
41112-41116 |
IN |
denotes |
from |
T8360 |
41117-41121 |
NNS |
denotes |
mice |
T8361 |
41122-41132 |
JJ |
denotes |
homozygous |
T8362 |
41133-41136 |
IN |
denotes |
for |
T8363 |
41137-41138 |
DT |
denotes |
a |
T8364 |
41151-41159 |
NN |
denotes |
mutation |
T8365 |
41139-41142 |
NN |
denotes |
TGF |
T8366 |
41143-41145 |
NN |
denotes |
β2 |
T8367 |
41142-41143 |
HYPH |
denotes |
- |
T8368 |
41146-41150 |
JJ |
denotes |
null |
T8369 |
41160-41161 |
-LRB- |
denotes |
( |
T8370 |
41173-41175 |
CD |
denotes |
34 |
T8371 |
41161-41167 |
NN |
denotes |
Figure |
T8372 |
41168-41170 |
NN |
denotes |
6A |
T8373 |
41170-41171 |
: |
denotes |
; |
T8374 |
41172-41173 |
-LRB- |
denotes |
[ |
T8375 |
41175-41176 |
-RRB- |
denotes |
] |
T8376 |
41176-41177 |
-RRB- |
denotes |
) |
T8377 |
41177-41178 |
. |
denotes |
. |
T8378 |
41178-41311 |
sentence |
denotes |
Moreover, the downstream effector of TGF-β2 signaling, pSMAD2, was also expressed in WT, but not TGF-β2-null, hair buds (Figure 6B). |
T8379 |
41179-41187 |
RB |
denotes |
Moreover |
T8380 |
41251-41260 |
VBN |
denotes |
expressed |
T8381 |
41187-41189 |
, |
denotes |
, |
T8382 |
41189-41192 |
DT |
denotes |
the |
T8383 |
41204-41212 |
NN |
denotes |
effector |
T8384 |
41193-41203 |
JJ |
denotes |
downstream |
T8385 |
41213-41215 |
IN |
denotes |
of |
T8386 |
41216-41219 |
NN |
denotes |
TGF |
T8387 |
41220-41222 |
NN |
denotes |
β2 |
T8388 |
41219-41220 |
HYPH |
denotes |
- |
T8389 |
41223-41232 |
NN |
denotes |
signaling |
T8390 |
41232-41234 |
, |
denotes |
, |
T8391 |
41234-41240 |
NN |
denotes |
pSMAD2 |
T8392 |
41240-41242 |
, |
denotes |
, |
T8393 |
41242-41245 |
VBD |
denotes |
was |
T8394 |
41246-41250 |
RB |
denotes |
also |
T8395 |
41261-41263 |
IN |
denotes |
in |
T8396 |
41264-41266 |
NN |
denotes |
WT |
T8397 |
41294-41298 |
NNS |
denotes |
buds |
T8398 |
41266-41268 |
, |
denotes |
, |
T8399 |
41268-41271 |
CC |
denotes |
but |
T8400 |
41272-41275 |
RB |
denotes |
not |
T8401 |
41276-41279 |
NN |
denotes |
TGF |
T8402 |
41280-41282 |
NN |
denotes |
β2 |
T8403 |
41279-41280 |
HYPH |
denotes |
- |
T8404 |
41283-41287 |
JJ |
denotes |
null |
T8405 |
41282-41283 |
HYPH |
denotes |
- |
T8406 |
41287-41289 |
, |
denotes |
, |
T8407 |
41289-41293 |
NN |
denotes |
hair |
T8408 |
41299-41300 |
-LRB- |
denotes |
( |
T8409 |
41307-41309 |
NN |
denotes |
6B |
T8410 |
41300-41306 |
NN |
denotes |
Figure |
T8411 |
41309-41310 |
-RRB- |
denotes |
) |
T8412 |
41310-41311 |
. |
denotes |
. |
T8413 |
41311-41464 |
sentence |
denotes |
Together, these data underscore the importance of the TGF-β2 isoform despite expression of both TGF-β1 and TGF-β2 in developing hair buds at this stage. |
T8414 |
41312-41320 |
RB |
denotes |
Together |
T8415 |
41333-41343 |
VBP |
denotes |
underscore |
T8416 |
41320-41322 |
, |
denotes |
, |
T8417 |
41322-41327 |
DT |
denotes |
these |
T8418 |
41328-41332 |
NNS |
denotes |
data |
T8419 |
41344-41347 |
DT |
denotes |
the |
T8420 |
41348-41358 |
NN |
denotes |
importance |
T8421 |
41359-41361 |
IN |
denotes |
of |
T8422 |
41362-41365 |
DT |
denotes |
the |
T8423 |
41373-41380 |
NN |
denotes |
isoform |
T8424 |
41366-41369 |
NN |
denotes |
TGF |
T8425 |
41370-41372 |
NN |
denotes |
β2 |
T8426 |
41369-41370 |
HYPH |
denotes |
- |
T8427 |
41381-41388 |
IN |
denotes |
despite |
T8428 |
41389-41399 |
NN |
denotes |
expression |
T8429 |
41400-41402 |
IN |
denotes |
of |
T8430 |
41403-41407 |
CC |
denotes |
both |
T8431 |
41412-41414 |
NN |
denotes |
β1 |
T8432 |
41408-41411 |
NN |
denotes |
TGF |
T8433 |
41411-41412 |
HYPH |
denotes |
- |
T8434 |
41415-41418 |
CC |
denotes |
and |
T8435 |
41419-41422 |
NN |
denotes |
TGF |
T8436 |
41423-41425 |
NN |
denotes |
β2 |
T8437 |
41422-41423 |
HYPH |
denotes |
- |
T8438 |
41426-41428 |
IN |
denotes |
in |
T8439 |
41429-41439 |
VBG |
denotes |
developing |
T8440 |
41445-41449 |
NNS |
denotes |
buds |
T8441 |
41440-41444 |
NN |
denotes |
hair |
T8442 |
41450-41452 |
IN |
denotes |
at |
T8443 |
41453-41457 |
DT |
denotes |
this |
T8444 |
41458-41463 |
NN |
denotes |
stage |
T8445 |
41463-41464 |
. |
denotes |
. |
T8446 |
41464-42595 |
sentence |
denotes |
Figure 6 TGF-β2 Is Necessary to Induce Snail Expression and Regulate Proliferation and E-Cadherin in the Hair Bud
(A–D) Skins from TGF-β2 WT or KO E17.5 embryos were analyzed for expression of TGF-β2 protein (A), which is present in the epidermis and dermis as previously described [33] and in the hair bud, pSMAD2 (B), Snail (C), and Snail mRNA (D). Arrows point to the hair buds.
(E) Western blot analyses of Snail expression in the skins of 2-wk-old K14-Smad2 transgenic (SMAD2 TG) and WT littermate (WT) mice. Antibody to tubulin was used as a control for equal protein loadings. The K14-Smad2 Tg mouse was previously shown to possess activated TGF-β signaling [35].
(F–G) Proliferation markers Ki67 (F) and pMAPK (G) are diminished in TGF-β2-null hair relative to its WT counterpart.
(H–J) TGF-β2-null hair fails to down-regulate E-cadherin (H). Wnt and noggin signaling pathways are still intact in the TGF-β2 null hair as nuclear LEF-1 (I) and nuclear β-catenin (J) are still expressed. To further explore the possible relation between Snail and TGF-β2, we examined the status of Snail expression in TGF-β2-null hair buds. |
T8447 |
42460-42462 |
TO |
denotes |
To |
T8448 |
42471-42478 |
VB |
denotes |
explore |
T8449 |
42463-42470 |
RB |
denotes |
further |
T8450 |
42530-42538 |
VBD |
denotes |
examined |
T8451 |
42479-42482 |
DT |
denotes |
the |
T8452 |
42492-42500 |
NN |
denotes |
relation |
T8453 |
42483-42491 |
JJ |
denotes |
possible |
T8454 |
42501-42508 |
IN |
denotes |
between |
T8455 |
42509-42514 |
NN |
denotes |
Snail |
T8456 |
42515-42518 |
CC |
denotes |
and |
T8457 |
42519-42522 |
NN |
denotes |
TGF |
T8458 |
42523-42525 |
NN |
denotes |
β2 |
T8459 |
42522-42523 |
HYPH |
denotes |
- |
T8460 |
42525-42527 |
, |
denotes |
, |
T8461 |
42527-42529 |
PRP |
denotes |
we |
T8462 |
42539-42542 |
DT |
denotes |
the |
T8463 |
42543-42549 |
NN |
denotes |
status |
T8464 |
42550-42552 |
IN |
denotes |
of |
T8465 |
42553-42558 |
NN |
denotes |
Snail |
T8466 |
42559-42569 |
NN |
denotes |
expression |
T8467 |
42570-42572 |
IN |
denotes |
in |
T8468 |
42573-42576 |
NN |
denotes |
TGF |
T8469 |
42577-42579 |
NN |
denotes |
β2 |
T8470 |
42576-42577 |
HYPH |
denotes |
- |
T8471 |
42580-42584 |
JJ |
denotes |
null |
T8472 |
42579-42580 |
HYPH |
denotes |
- |
T8473 |
42590-42594 |
NNS |
denotes |
buds |
T8474 |
42585-42589 |
NN |
denotes |
hair |
T8475 |
42594-42595 |
. |
denotes |
. |
T8476 |
42595-42748 |
sentence |
denotes |
As judged by immunohistochemistry, Snail protein was absent from E17.5 skin of TGF-β2-null embryos but not from that of control littermates (Figure 6C). |
T8477 |
42596-42598 |
IN |
denotes |
As |
T8478 |
42599-42605 |
VBN |
denotes |
judged |
T8479 |
42645-42648 |
VBD |
denotes |
was |
T8480 |
42606-42608 |
IN |
denotes |
by |
T8481 |
42609-42629 |
NN |
denotes |
immunohistochemistry |
T8482 |
42629-42631 |
, |
denotes |
, |
T8483 |
42631-42636 |
NN |
denotes |
Snail |
T8484 |
42637-42644 |
NN |
denotes |
protein |
T8485 |
42649-42655 |
JJ |
denotes |
absent |
T8486 |
42656-42660 |
IN |
denotes |
from |
T8487 |
42661-42666 |
NN |
denotes |
E17.5 |
T8488 |
42667-42671 |
NN |
denotes |
skin |
T8489 |
42672-42674 |
IN |
denotes |
of |
T8490 |
42675-42678 |
NN |
denotes |
TGF |
T8491 |
42679-42681 |
NN |
denotes |
β2 |
T8492 |
42678-42679 |
HYPH |
denotes |
- |
T8493 |
42682-42686 |
JJ |
denotes |
null |
T8494 |
42681-42682 |
HYPH |
denotes |
- |
T8495 |
42687-42694 |
NNS |
denotes |
embryos |
T8496 |
42695-42698 |
CC |
denotes |
but |
T8497 |
42699-42702 |
RB |
denotes |
not |
T8498 |
42703-42707 |
IN |
denotes |
from |
T8499 |
42708-42712 |
DT |
denotes |
that |
T8500 |
42713-42715 |
IN |
denotes |
of |
T8501 |
42716-42723 |
NN |
denotes |
control |
T8502 |
42724-42735 |
NNS |
denotes |
littermates |
T8503 |
42736-42737 |
-LRB- |
denotes |
( |
T8504 |
42744-42746 |
NN |
denotes |
6C |
T8505 |
42737-42743 |
NN |
denotes |
Figure |
T8506 |
42746-42747 |
-RRB- |
denotes |
) |
T8507 |
42747-42748 |
. |
denotes |
. |
T8508 |
42748-42983 |
sentence |
denotes |
This effect appeared to be exerted at the transcriptional level, since Snail mRNAs were also not found in TGF-β2 null hair buds under conditions in which the signal was readily detected in the hair buds of littermate skin (Figure 6D). |
T8509 |
42749-42753 |
DT |
denotes |
This |
T8510 |
42754-42760 |
NN |
denotes |
effect |
T8511 |
42761-42769 |
VBD |
denotes |
appeared |
T8512 |
42770-42772 |
TO |
denotes |
to |
T8513 |
42776-42783 |
VBN |
denotes |
exerted |
T8514 |
42773-42775 |
VB |
denotes |
be |
T8515 |
42784-42786 |
IN |
denotes |
at |
T8516 |
42787-42790 |
DT |
denotes |
the |
T8517 |
42807-42812 |
NN |
denotes |
level |
T8518 |
42791-42806 |
JJ |
denotes |
transcriptional |
T8519 |
42812-42814 |
, |
denotes |
, |
T8520 |
42814-42819 |
IN |
denotes |
since |
T8521 |
42846-42851 |
VBN |
denotes |
found |
T8522 |
42820-42825 |
NN |
denotes |
Snail |
T8523 |
42826-42831 |
NNS |
denotes |
mRNAs |
T8524 |
42832-42836 |
VBD |
denotes |
were |
T8525 |
42837-42841 |
RB |
denotes |
also |
T8526 |
42842-42845 |
RB |
denotes |
not |
T8527 |
42852-42854 |
IN |
denotes |
in |
T8528 |
42855-42858 |
NN |
denotes |
TGF |
T8529 |
42859-42861 |
NN |
denotes |
β2 |
T8530 |
42858-42859 |
HYPH |
denotes |
- |
T8531 |
42862-42866 |
JJ |
denotes |
null |
T8532 |
42872-42876 |
NNS |
denotes |
buds |
T8533 |
42867-42871 |
NN |
denotes |
hair |
T8534 |
42877-42882 |
IN |
denotes |
under |
T8535 |
42883-42893 |
NNS |
denotes |
conditions |
T8536 |
42894-42896 |
IN |
denotes |
in |
T8537 |
42926-42934 |
VBN |
denotes |
detected |
T8538 |
42897-42902 |
WDT |
denotes |
which |
T8539 |
42903-42906 |
DT |
denotes |
the |
T8540 |
42907-42913 |
NN |
denotes |
signal |
T8541 |
42914-42917 |
VBD |
denotes |
was |
T8542 |
42918-42925 |
RB |
denotes |
readily |
T8543 |
42935-42937 |
IN |
denotes |
in |
T8544 |
42938-42941 |
DT |
denotes |
the |
T8545 |
42947-42951 |
NNS |
denotes |
buds |
T8546 |
42942-42946 |
NN |
denotes |
hair |
T8547 |
42952-42954 |
IN |
denotes |
of |
T8548 |
42955-42965 |
NN |
denotes |
littermate |
T8549 |
42966-42970 |
NN |
denotes |
skin |
T8550 |
42971-42972 |
-LRB- |
denotes |
( |
T8551 |
42979-42981 |
NN |
denotes |
6D |
T8552 |
42972-42978 |
NN |
denotes |
Figure |
T8553 |
42981-42982 |
-RRB- |
denotes |
) |
T8554 |
42982-42983 |
. |
denotes |
. |
T8555 |
42983-43194 |
sentence |
denotes |
Conversely, in 2-wk-old K14-Smad2 Tg mice, which display elevated TGF-β signaling in skin [35], Snail protein was readily detected by Western blot analyses, where it was not found in postnatal skin (Figure 6E). |
T8556 |
42984-42994 |
RB |
denotes |
Conversely |
T8557 |
43106-43114 |
VBN |
denotes |
detected |
T8558 |
42994-42996 |
, |
denotes |
, |
T8559 |
42996-42998 |
IN |
denotes |
in |
T8560 |
42999-43000 |
CD |
denotes |
2 |
T8561 |
43001-43003 |
NN |
denotes |
wk |
T8562 |
43000-43001 |
HYPH |
denotes |
- |
T8563 |
43004-43007 |
JJ |
denotes |
old |
T8564 |
43003-43004 |
HYPH |
denotes |
- |
T8565 |
43021-43025 |
NNS |
denotes |
mice |
T8566 |
43008-43011 |
NN |
denotes |
K14 |
T8567 |
43012-43017 |
NN |
denotes |
Smad2 |
T8568 |
43011-43012 |
HYPH |
denotes |
- |
T8569 |
43018-43020 |
NN |
denotes |
Tg |
T8570 |
43025-43027 |
, |
denotes |
, |
T8571 |
43027-43032 |
WDT |
denotes |
which |
T8572 |
43033-43040 |
VBP |
denotes |
display |
T8573 |
43041-43049 |
VBN |
denotes |
elevated |
T8574 |
43056-43065 |
NN |
denotes |
signaling |
T8575 |
43050-43053 |
NN |
denotes |
TGF |
T8576 |
43054-43055 |
NN |
denotes |
β |
T8577 |
43053-43054 |
HYPH |
denotes |
- |
T8578 |
43066-43068 |
IN |
denotes |
in |
T8579 |
43069-43073 |
NN |
denotes |
skin |
T8580 |
43074-43075 |
-LRB- |
denotes |
[ |
T8581 |
43075-43077 |
CD |
denotes |
35 |
T8582 |
43077-43078 |
-RRB- |
denotes |
] |
T8583 |
43078-43080 |
, |
denotes |
, |
T8584 |
43080-43085 |
NN |
denotes |
Snail |
T8585 |
43086-43093 |
NN |
denotes |
protein |
T8586 |
43094-43097 |
VBD |
denotes |
was |
T8587 |
43098-43105 |
RB |
denotes |
readily |
T8588 |
43115-43117 |
IN |
denotes |
by |
T8589 |
43118-43125 |
NNP |
denotes |
Western |
T8590 |
43126-43130 |
NN |
denotes |
blot |
T8591 |
43131-43139 |
NNS |
denotes |
analyses |
T8592 |
43139-43141 |
, |
denotes |
, |
T8593 |
43141-43146 |
WRB |
denotes |
where |
T8594 |
43158-43163 |
VBN |
denotes |
found |
T8595 |
43147-43149 |
PRP |
denotes |
it |
T8596 |
43150-43153 |
VBD |
denotes |
was |
T8597 |
43154-43157 |
RB |
denotes |
not |
T8598 |
43164-43166 |
IN |
denotes |
in |
T8599 |
43167-43176 |
JJ |
denotes |
postnatal |
T8600 |
43177-43181 |
NN |
denotes |
skin |
T8601 |
43182-43183 |
-LRB- |
denotes |
( |
T8602 |
43190-43192 |
NN |
denotes |
6E |
T8603 |
43183-43189 |
NN |
denotes |
Figure |
T8604 |
43192-43193 |
-RRB- |
denotes |
) |
T8605 |
43193-43194 |
. |
denotes |
. |
T8606 |
43194-43378 |
sentence |
denotes |
Taken together, these results provide compelling evidence that TGF-β2 is functionally important for inducing Snail gene expression in a pSMAD-dependent manner in developing hair buds. |
T8607 |
43195-43200 |
VBN |
denotes |
Taken |
T8608 |
43225-43232 |
VBP |
denotes |
provide |
T8609 |
43201-43209 |
RB |
denotes |
together |
T8610 |
43209-43211 |
, |
denotes |
, |
T8611 |
43211-43216 |
DT |
denotes |
these |
T8612 |
43217-43224 |
NNS |
denotes |
results |
T8613 |
43233-43243 |
JJ |
denotes |
compelling |
T8614 |
43244-43252 |
NN |
denotes |
evidence |
T8615 |
43253-43257 |
IN |
denotes |
that |
T8616 |
43265-43267 |
VBZ |
denotes |
is |
T8617 |
43258-43261 |
NN |
denotes |
TGF |
T8618 |
43262-43264 |
NN |
denotes |
β2 |
T8619 |
43261-43262 |
HYPH |
denotes |
- |
T8620 |
43268-43280 |
RB |
denotes |
functionally |
T8621 |
43281-43290 |
JJ |
denotes |
important |
T8622 |
43291-43294 |
IN |
denotes |
for |
T8623 |
43295-43303 |
VBG |
denotes |
inducing |
T8624 |
43304-43309 |
NN |
denotes |
Snail |
T8625 |
43315-43325 |
NN |
denotes |
expression |
T8626 |
43310-43314 |
NN |
denotes |
gene |
T8627 |
43326-43328 |
IN |
denotes |
in |
T8628 |
43329-43330 |
DT |
denotes |
a |
T8629 |
43347-43353 |
NN |
denotes |
manner |
T8630 |
43331-43336 |
NN |
denotes |
pSMAD |
T8631 |
43337-43346 |
JJ |
denotes |
dependent |
T8632 |
43336-43337 |
HYPH |
denotes |
- |
T8633 |
43354-43356 |
IN |
denotes |
in |
T8634 |
43357-43367 |
VBG |
denotes |
developing |
T8635 |
43373-43377 |
NNS |
denotes |
buds |
T8636 |
43368-43372 |
NN |
denotes |
hair |
T8637 |
43377-43378 |
. |
denotes |
. |
T8638 |
43378-43482 |
sentence |
denotes |
Whether pMARK activity also contributes to Snail induction was not addressed in the present study [15]. |
T8639 |
43379-43386 |
IN |
denotes |
Whether |
T8640 |
43407-43418 |
VBZ |
denotes |
contributes |
T8641 |
43387-43392 |
NN |
denotes |
pMARK |
T8642 |
43393-43401 |
NN |
denotes |
activity |
T8643 |
43402-43406 |
RB |
denotes |
also |
T8644 |
43446-43455 |
VBN |
denotes |
addressed |
T8645 |
43419-43421 |
IN |
denotes |
to |
T8646 |
43422-43427 |
NN |
denotes |
Snail |
T8647 |
43428-43437 |
NN |
denotes |
induction |
T8648 |
43438-43441 |
VBD |
denotes |
was |
T8649 |
43442-43445 |
RB |
denotes |
not |
T8650 |
43456-43458 |
IN |
denotes |
in |
T8651 |
43459-43462 |
DT |
denotes |
the |
T8652 |
43471-43476 |
NN |
denotes |
study |
T8653 |
43463-43470 |
JJ |
denotes |
present |
T8654 |
43477-43478 |
-LRB- |
denotes |
[ |
T8655 |
43478-43480 |
CD |
denotes |
15 |
T8656 |
43480-43481 |
-RRB- |
denotes |
] |
T8657 |
43481-43482 |
. |
denotes |
. |
T8658 |
43482-43592 |
sentence |
denotes |
Although some hair buds still formed in TGF-β2 null skin, their number was reduced by approximately 50% [32]. |
T8659 |
43483-43491 |
IN |
denotes |
Although |
T8660 |
43513-43519 |
VBD |
denotes |
formed |
T8661 |
43492-43496 |
DT |
denotes |
some |
T8662 |
43502-43506 |
NNS |
denotes |
buds |
T8663 |
43497-43501 |
NN |
denotes |
hair |
T8664 |
43507-43512 |
RB |
denotes |
still |
T8665 |
43558-43565 |
VBN |
denotes |
reduced |
T8666 |
43520-43522 |
IN |
denotes |
in |
T8667 |
43523-43526 |
NN |
denotes |
TGF |
T8668 |
43527-43529 |
NN |
denotes |
β2 |
T8669 |
43526-43527 |
HYPH |
denotes |
- |
T8670 |
43530-43534 |
JJ |
denotes |
null |
T8671 |
43535-43539 |
NN |
denotes |
skin |
T8672 |
43539-43541 |
, |
denotes |
, |
T8673 |
43541-43546 |
PRP$ |
denotes |
their |
T8674 |
43547-43553 |
NN |
denotes |
number |
T8675 |
43554-43557 |
VBD |
denotes |
was |
T8676 |
43566-43568 |
IN |
denotes |
by |
T8677 |
43569-43582 |
RB |
denotes |
approximately |
T8678 |
43583-43585 |
CD |
denotes |
50 |
T8679 |
43585-43586 |
NN |
denotes |
% |
T8680 |
43587-43588 |
-LRB- |
denotes |
[ |
T8681 |
43588-43590 |
CD |
denotes |
32 |
T8682 |
43590-43591 |
-RRB- |
denotes |
] |
T8683 |
43591-43592 |
. |
denotes |
. |
T8684 |
43592-43760 |
sentence |
denotes |
Thus, although the pathway mediated by TGF-β2 signaling impacts the earliest step of epithelial invagination, it does not appear to be essential for bud morphogenesis. |
T8685 |
43593-43597 |
RB |
denotes |
Thus |
T8686 |
43715-43721 |
VB |
denotes |
appear |
T8687 |
43597-43599 |
, |
denotes |
, |
T8688 |
43599-43607 |
IN |
denotes |
although |
T8689 |
43649-43656 |
VBZ |
denotes |
impacts |
T8690 |
43608-43611 |
DT |
denotes |
the |
T8691 |
43612-43619 |
NN |
denotes |
pathway |
T8692 |
43620-43628 |
VBN |
denotes |
mediated |
T8693 |
43629-43631 |
IN |
denotes |
by |
T8694 |
43632-43635 |
NN |
denotes |
TGF |
T8695 |
43636-43638 |
NN |
denotes |
β2 |
T8696 |
43635-43636 |
HYPH |
denotes |
- |
T8697 |
43639-43648 |
NN |
denotes |
signaling |
T8698 |
43657-43660 |
DT |
denotes |
the |
T8699 |
43670-43674 |
NN |
denotes |
step |
T8700 |
43661-43669 |
JJS |
denotes |
earliest |
T8701 |
43675-43677 |
IN |
denotes |
of |
T8702 |
43678-43688 |
JJ |
denotes |
epithelial |
T8703 |
43689-43701 |
NN |
denotes |
invagination |
T8704 |
43701-43703 |
, |
denotes |
, |
T8705 |
43703-43705 |
PRP |
denotes |
it |
T8706 |
43706-43710 |
VBZ |
denotes |
does |
T8707 |
43711-43714 |
RB |
denotes |
not |
T8708 |
43722-43724 |
TO |
denotes |
to |
T8709 |
43725-43727 |
VB |
denotes |
be |
T8710 |
43728-43737 |
JJ |
denotes |
essential |
T8711 |
43738-43741 |
IN |
denotes |
for |
T8712 |
43742-43745 |
NN |
denotes |
bud |
T8713 |
43746-43759 |
NN |
denotes |
morphogenesis |
T8714 |
43759-43760 |
. |
denotes |
. |
T8715 |
43760-44034 |
sentence |
denotes |
Consistent with this notion, basement membrane remodeling still took place in the TGF-β2-null buds, as judged by immunofluorescence with antibodies against β4 integrin, an integral component of keratinocyte-mediated adhesion to its underlying basement membrane (Figure 6F). |
T8716 |
43761-43771 |
JJ |
denotes |
Consistent |
T8717 |
43825-43829 |
VBD |
denotes |
took |
T8718 |
43772-43776 |
IN |
denotes |
with |
T8719 |
43777-43781 |
DT |
denotes |
this |
T8720 |
43782-43788 |
NN |
denotes |
notion |
T8721 |
43788-43790 |
, |
denotes |
, |
T8722 |
43790-43798 |
NN |
denotes |
basement |
T8723 |
43799-43807 |
NN |
denotes |
membrane |
T8724 |
43808-43818 |
NN |
denotes |
remodeling |
T8725 |
43819-43824 |
RB |
denotes |
still |
T8726 |
43830-43835 |
RP |
denotes |
place |
T8727 |
43836-43838 |
IN |
denotes |
in |
T8728 |
43839-43842 |
DT |
denotes |
the |
T8729 |
43855-43859 |
NNS |
denotes |
buds |
T8730 |
43843-43846 |
NN |
denotes |
TGF |
T8731 |
43847-43849 |
NN |
denotes |
β2 |
T8732 |
43846-43847 |
HYPH |
denotes |
- |
T8733 |
43850-43854 |
JJ |
denotes |
null |
T8734 |
43849-43850 |
HYPH |
denotes |
- |
T8735 |
43859-43861 |
, |
denotes |
, |
T8736 |
43861-43863 |
IN |
denotes |
as |
T8737 |
43864-43870 |
VBN |
denotes |
judged |
T8738 |
43871-43873 |
IN |
denotes |
by |
T8739 |
43874-43892 |
NN |
denotes |
immunofluorescence |
T8740 |
43893-43897 |
IN |
denotes |
with |
T8741 |
43898-43908 |
NNS |
denotes |
antibodies |
T8742 |
43909-43916 |
IN |
denotes |
against |
T8743 |
43917-43919 |
NN |
denotes |
β4 |
T8744 |
43920-43928 |
NN |
denotes |
integrin |
T8745 |
43928-43930 |
, |
denotes |
, |
T8746 |
43930-43932 |
DT |
denotes |
an |
T8747 |
43942-43951 |
NN |
denotes |
component |
T8748 |
43933-43941 |
JJ |
denotes |
integral |
T8749 |
43952-43954 |
IN |
denotes |
of |
T8750 |
43955-43967 |
NN |
denotes |
keratinocyte |
T8751 |
43968-43976 |
VBN |
denotes |
mediated |
T8752 |
43967-43968 |
HYPH |
denotes |
- |
T8753 |
43977-43985 |
NN |
denotes |
adhesion |
T8754 |
43986-43988 |
IN |
denotes |
to |
T8755 |
43989-43992 |
PRP$ |
denotes |
its |
T8756 |
44013-44021 |
NN |
denotes |
membrane |
T8757 |
43993-44003 |
JJ |
denotes |
underlying |
T8758 |
44004-44012 |
NN |
denotes |
basement |
T8759 |
44022-44023 |
-LRB- |
denotes |
( |
T8760 |
44030-44032 |
NN |
denotes |
6F |
T8761 |
44023-44029 |
NN |
denotes |
Figure |
T8762 |
44032-44033 |
-RRB- |
denotes |
) |
T8763 |
44033-44034 |
. |
denotes |
. |
T8764 |
44034-44245 |
sentence |
denotes |
In contrast, TGF-β2 signaling appeared to be an important factor for the early proliferation that occurs in the developing hair buds, as judged by anti-Ki67 and anti-pMAPK immunofluorescence (Figure 6F and 6G). |
T8765 |
44035-44037 |
IN |
denotes |
In |
T8766 |
44065-44073 |
VBD |
denotes |
appeared |
T8767 |
44038-44046 |
NN |
denotes |
contrast |
T8768 |
44046-44048 |
, |
denotes |
, |
T8769 |
44048-44051 |
NN |
denotes |
TGF |
T8770 |
44052-44054 |
NN |
denotes |
β2 |
T8771 |
44051-44052 |
HYPH |
denotes |
- |
T8772 |
44055-44064 |
NN |
denotes |
signaling |
T8773 |
44074-44076 |
TO |
denotes |
to |
T8774 |
44077-44079 |
VB |
denotes |
be |
T8775 |
44080-44082 |
DT |
denotes |
an |
T8776 |
44093-44099 |
NN |
denotes |
factor |
T8777 |
44083-44092 |
JJ |
denotes |
important |
T8778 |
44100-44103 |
IN |
denotes |
for |
T8779 |
44104-44107 |
DT |
denotes |
the |
T8780 |
44114-44127 |
NN |
denotes |
proliferation |
T8781 |
44108-44113 |
JJ |
denotes |
early |
T8782 |
44128-44132 |
WDT |
denotes |
that |
T8783 |
44133-44139 |
VBZ |
denotes |
occurs |
T8784 |
44140-44142 |
IN |
denotes |
in |
T8785 |
44143-44146 |
DT |
denotes |
the |
T8786 |
44163-44167 |
NNS |
denotes |
buds |
T8787 |
44147-44157 |
VBG |
denotes |
developing |
T8788 |
44158-44162 |
NN |
denotes |
hair |
T8789 |
44167-44169 |
, |
denotes |
, |
T8790 |
44169-44171 |
IN |
denotes |
as |
T8791 |
44172-44178 |
VBN |
denotes |
judged |
T8792 |
44179-44181 |
IN |
denotes |
by |
T8793 |
44182-44191 |
JJ |
denotes |
anti-Ki67 |
T8794 |
44207-44225 |
NN |
denotes |
immunofluorescence |
T8795 |
44192-44195 |
CC |
denotes |
and |
T8796 |
44196-44206 |
JJ |
denotes |
anti-pMAPK |
T8797 |
44226-44227 |
-LRB- |
denotes |
( |
T8798 |
44234-44236 |
NN |
denotes |
6F |
T8799 |
44227-44233 |
NN |
denotes |
Figure |
T8800 |
44237-44240 |
CC |
denotes |
and |
T8801 |
44241-44243 |
NN |
denotes |
6G |
T8802 |
44243-44244 |
-RRB- |
denotes |
) |
T8803 |
44244-44245 |
. |
denotes |
. |
T8804 |
44245-44417 |
sentence |
denotes |
If TGF-β2 stimulates Snail expression in developing buds, loss of this morphogen would be expected to affect the expression of genes that are typically repressed by Snail. |
T8805 |
44246-44248 |
IN |
denotes |
If |
T8806 |
44256-44266 |
VBZ |
denotes |
stimulates |
T8807 |
44249-44252 |
NN |
denotes |
TGF |
T8808 |
44253-44255 |
NN |
denotes |
β2 |
T8809 |
44252-44253 |
HYPH |
denotes |
- |
T8810 |
44336-44344 |
VBN |
denotes |
expected |
T8811 |
44267-44272 |
NN |
denotes |
Snail |
T8812 |
44273-44283 |
NN |
denotes |
expression |
T8813 |
44284-44286 |
IN |
denotes |
in |
T8814 |
44287-44297 |
VBG |
denotes |
developing |
T8815 |
44298-44302 |
NNS |
denotes |
buds |
T8816 |
44302-44304 |
, |
denotes |
, |
T8817 |
44304-44308 |
NN |
denotes |
loss |
T8818 |
44309-44311 |
IN |
denotes |
of |
T8819 |
44312-44316 |
DT |
denotes |
this |
T8820 |
44317-44326 |
NN |
denotes |
morphogen |
T8821 |
44327-44332 |
MD |
denotes |
would |
T8822 |
44333-44335 |
VB |
denotes |
be |
T8823 |
44345-44347 |
TO |
denotes |
to |
T8824 |
44348-44354 |
VB |
denotes |
affect |
T8825 |
44355-44358 |
DT |
denotes |
the |
T8826 |
44359-44369 |
NN |
denotes |
expression |
T8827 |
44370-44372 |
IN |
denotes |
of |
T8828 |
44373-44378 |
NNS |
denotes |
genes |
T8829 |
44379-44383 |
WDT |
denotes |
that |
T8830 |
44398-44407 |
VBN |
denotes |
repressed |
T8831 |
44384-44387 |
VBP |
denotes |
are |
T8832 |
44388-44397 |
RB |
denotes |
typically |
T8833 |
44408-44410 |
IN |
denotes |
by |
T8834 |
44411-44416 |
NN |
denotes |
Snail |
T8835 |
44416-44417 |
. |
denotes |
. |
T8836 |
44417-44562 |
sentence |
denotes |
Since a major target for Snail-mediated repression is the E-cadherin gene [12,13], we investigated the status of E-cadherin in TGF-β2-null buds. |
T8837 |
44418-44423 |
IN |
denotes |
Since |
T8838 |
44469-44471 |
VBZ |
denotes |
is |
T8839 |
44424-44425 |
DT |
denotes |
a |
T8840 |
44432-44438 |
NN |
denotes |
target |
T8841 |
44426-44431 |
JJ |
denotes |
major |
T8842 |
44439-44442 |
IN |
denotes |
for |
T8843 |
44443-44448 |
NN |
denotes |
Snail |
T8844 |
44449-44457 |
VBN |
denotes |
mediated |
T8845 |
44448-44449 |
HYPH |
denotes |
- |
T8846 |
44458-44468 |
NN |
denotes |
repression |
T8847 |
44504-44516 |
VBD |
denotes |
investigated |
T8848 |
44472-44475 |
DT |
denotes |
the |
T8849 |
44487-44491 |
NN |
denotes |
gene |
T8850 |
44476-44477 |
NN |
denotes |
E |
T8851 |
44478-44486 |
NN |
denotes |
cadherin |
T8852 |
44477-44478 |
HYPH |
denotes |
- |
T8853 |
44492-44493 |
-LRB- |
denotes |
[ |
T8854 |
44496-44498 |
CD |
denotes |
13 |
T8855 |
44493-44495 |
CD |
denotes |
12 |
T8856 |
44495-44496 |
, |
denotes |
, |
T8857 |
44498-44499 |
-RRB- |
denotes |
] |
T8858 |
44499-44501 |
, |
denotes |
, |
T8859 |
44501-44503 |
PRP |
denotes |
we |
T8860 |
44517-44520 |
DT |
denotes |
the |
T8861 |
44521-44527 |
NN |
denotes |
status |
T8862 |
44528-44530 |
IN |
denotes |
of |
T8863 |
44531-44532 |
NN |
denotes |
E |
T8864 |
44533-44541 |
NN |
denotes |
cadherin |
T8865 |
44532-44533 |
HYPH |
denotes |
- |
T8866 |
44542-44544 |
IN |
denotes |
in |
T8867 |
44545-44548 |
NN |
denotes |
TGF |
T8868 |
44549-44551 |
NN |
denotes |
β2 |
T8869 |
44548-44549 |
HYPH |
denotes |
- |
T8870 |
44552-44556 |
JJ |
denotes |
null |
T8871 |
44551-44552 |
HYPH |
denotes |
- |
T8872 |
44557-44561 |
NNS |
denotes |
buds |
T8873 |
44561-44562 |
. |
denotes |
. |
T8874 |
44562-44697 |
sentence |
denotes |
As shown in Figure 6H, hair buds in TGF-β2 null skin displayed elevated immunofluorescence staining relative to their WT counterparts. |
T8875 |
44563-44565 |
IN |
denotes |
As |
T8876 |
44566-44571 |
VBN |
denotes |
shown |
T8877 |
44616-44625 |
VBD |
denotes |
displayed |
T8878 |
44572-44574 |
IN |
denotes |
in |
T8879 |
44575-44581 |
NN |
denotes |
Figure |
T8880 |
44582-44584 |
NN |
denotes |
6H |
T8881 |
44584-44586 |
, |
denotes |
, |
T8882 |
44586-44590 |
NN |
denotes |
hair |
T8883 |
44591-44595 |
NNS |
denotes |
buds |
T8884 |
44596-44598 |
IN |
denotes |
in |
T8885 |
44599-44602 |
NN |
denotes |
TGF |
T8886 |
44603-44605 |
NN |
denotes |
β2 |
T8887 |
44602-44603 |
HYPH |
denotes |
- |
T8888 |
44606-44610 |
JJ |
denotes |
null |
T8889 |
44611-44615 |
NN |
denotes |
skin |
T8890 |
44626-44634 |
JJ |
denotes |
elevated |
T8891 |
44654-44662 |
NN |
denotes |
staining |
T8892 |
44635-44653 |
NN |
denotes |
immunofluorescence |
T8893 |
44663-44671 |
JJ |
denotes |
relative |
T8894 |
44672-44674 |
IN |
denotes |
to |
T8895 |
44675-44680 |
PRP$ |
denotes |
their |
T8896 |
44684-44696 |
NNS |
denotes |
counterparts |
T8897 |
44681-44683 |
NN |
denotes |
WT |
T8898 |
44696-44697 |
. |
denotes |
. |
T8899 |
44697-44946 |
sentence |
denotes |
Previously we demonstrated that the concerted action of the extracellular signals Wnt and noggin are required for the generation of a LEF-1/β-catenin transcription complex to repress E-cadherin transcription at the onset of hair fate specification. |
T8900 |
44698-44708 |
RB |
denotes |
Previously |
T8901 |
44712-44724 |
VBD |
denotes |
demonstrated |
T8902 |
44709-44711 |
PRP |
denotes |
we |
T8903 |
44725-44729 |
IN |
denotes |
that |
T8904 |
44799-44807 |
VBN |
denotes |
required |
T8905 |
44730-44733 |
DT |
denotes |
the |
T8906 |
44744-44750 |
NN |
denotes |
action |
T8907 |
44734-44743 |
JJ |
denotes |
concerted |
T8908 |
44751-44753 |
IN |
denotes |
of |
T8909 |
44754-44757 |
DT |
denotes |
the |
T8910 |
44772-44779 |
NNS |
denotes |
signals |
T8911 |
44758-44771 |
JJ |
denotes |
extracellular |
T8912 |
44780-44783 |
NN |
denotes |
Wnt |
T8913 |
44784-44787 |
CC |
denotes |
and |
T8914 |
44788-44794 |
NN |
denotes |
noggin |
T8915 |
44795-44798 |
VBP |
denotes |
are |
T8916 |
44808-44811 |
IN |
denotes |
for |
T8917 |
44873-44880 |
VB |
denotes |
repress |
T8918 |
44812-44815 |
DT |
denotes |
the |
T8919 |
44816-44826 |
NN |
denotes |
generation |
T8920 |
44827-44829 |
IN |
denotes |
of |
T8921 |
44830-44831 |
DT |
denotes |
a |
T8922 |
44862-44869 |
NN |
denotes |
complex |
T8923 |
44832-44835 |
NN |
denotes |
LEF |
T8924 |
44835-44836 |
HYPH |
denotes |
- |
T8925 |
44836-44837 |
CD |
denotes |
1 |
T8926 |
44837-44838 |
HYPH |
denotes |
/ |
T8927 |
44838-44839 |
NN |
denotes |
β |
T8928 |
44840-44847 |
NN |
denotes |
catenin |
T8929 |
44839-44840 |
HYPH |
denotes |
- |
T8930 |
44848-44861 |
NN |
denotes |
transcription |
T8931 |
44870-44872 |
TO |
denotes |
to |
T8932 |
44881-44882 |
NN |
denotes |
E |
T8933 |
44883-44891 |
NN |
denotes |
cadherin |
T8934 |
44882-44883 |
HYPH |
denotes |
- |
T8935 |
44892-44905 |
NN |
denotes |
transcription |
T8936 |
44906-44908 |
IN |
denotes |
at |
T8937 |
44909-44912 |
DT |
denotes |
the |
T8938 |
44913-44918 |
NN |
denotes |
onset |
T8939 |
44919-44921 |
IN |
denotes |
of |
T8940 |
44922-44926 |
NN |
denotes |
hair |
T8941 |
44927-44931 |
NN |
denotes |
fate |
T8942 |
44932-44945 |
NN |
denotes |
specification |
T8943 |
44945-44946 |
. |
denotes |
. |
T8944 |
44946-45113 |
sentence |
denotes |
As shown in Figure 6I and 6J, both WT and TGF-β2 null buds exhibited nuclear LEF-1 and β-catenin localization, signs that the Wnt-noggin signaling pathway was intact. |
T8945 |
44947-44949 |
IN |
denotes |
As |
T8946 |
44950-44955 |
VBN |
denotes |
shown |
T8947 |
45006-45015 |
VBD |
denotes |
exhibited |
T8948 |
44956-44958 |
IN |
denotes |
in |
T8949 |
44959-44965 |
NN |
denotes |
Figure |
T8950 |
44966-44968 |
NN |
denotes |
6I |
T8951 |
44969-44972 |
CC |
denotes |
and |
T8952 |
44973-44975 |
NN |
denotes |
6J |
T8953 |
44975-44977 |
, |
denotes |
, |
T8954 |
44977-44981 |
CC |
denotes |
both |
T8955 |
44982-44984 |
NN |
denotes |
WT |
T8956 |
44996-45000 |
JJ |
denotes |
null |
T8957 |
44985-44988 |
CC |
denotes |
and |
T8958 |
44989-44992 |
NN |
denotes |
TGF |
T8959 |
44993-44995 |
NN |
denotes |
β2 |
T8960 |
44992-44993 |
HYPH |
denotes |
- |
T8961 |
45001-45005 |
NNS |
denotes |
buds |
T8962 |
45016-45023 |
JJ |
denotes |
nuclear |
T8963 |
45044-45056 |
NN |
denotes |
localization |
T8964 |
45024-45027 |
NN |
denotes |
LEF |
T8965 |
45027-45028 |
HYPH |
denotes |
- |
T8966 |
45028-45029 |
CD |
denotes |
1 |
T8967 |
45030-45033 |
CC |
denotes |
and |
T8968 |
45034-45035 |
NN |
denotes |
β |
T8969 |
45036-45043 |
NN |
denotes |
catenin |
T8970 |
45035-45036 |
HYPH |
denotes |
- |
T8971 |
45056-45058 |
, |
denotes |
, |
T8972 |
45058-45063 |
NNS |
denotes |
signs |
T8973 |
45064-45068 |
IN |
denotes |
that |
T8974 |
45102-45105 |
VBD |
denotes |
was |
T8975 |
45069-45072 |
DT |
denotes |
the |
T8976 |
45094-45101 |
NN |
denotes |
pathway |
T8977 |
45073-45076 |
NN |
denotes |
Wnt |
T8978 |
45077-45083 |
NN |
denotes |
noggin |
T8979 |
45076-45077 |
HYPH |
denotes |
- |
T8980 |
45084-45093 |
NN |
denotes |
signaling |
T8981 |
45106-45112 |
JJ |
denotes |
intact |
T9019 |
45308-45310 |
, |
denotes |
, |
T9020 |
45310-45313 |
NN |
denotes |
TGF |
T9021 |
45314-45316 |
NN |
denotes |
β2 |
T9022 |
45313-45314 |
HYPH |
denotes |
- |
T9023 |
45325-45327 |
TO |
denotes |
to |
T9024 |
45328-45332 |
VB |
denotes |
work |
T9025 |
45333-45335 |
IN |
denotes |
in |
T9026 |
45336-45342 |
NN |
denotes |
tandem |
T9027 |
45343-45347 |
IN |
denotes |
with |
T9028 |
45348-45353 |
DT |
denotes |
these |
T9029 |
45360-45370 |
NNS |
denotes |
morphogens |
T9030 |
45354-45359 |
JJ |
denotes |
other |
T9031 |
45371-45373 |
TO |
denotes |
to |
T9032 |
45379-45387 |
VB |
denotes |
regulate |
T9033 |
45374-45378 |
RB |
denotes |
down |
T9034 |
45378-45379 |
HYPH |
denotes |
- |
T9035 |
45388-45389 |
NN |
denotes |
E |
T9036 |
45390-45398 |
NN |
denotes |
cadherin |
T9037 |
45389-45390 |
HYPH |
denotes |
- |
T9038 |
45399-45405 |
NNS |
denotes |
levels |
T9039 |
45405-45407 |
, |
denotes |
, |
T9040 |
45407-45412 |
WDT |
denotes |
which |
T9041 |
45413-45424 |
VBZ |
denotes |
contributes |
T9042 |
45425-45427 |
IN |
denotes |
to |
T9043 |
45428-45431 |
DT |
denotes |
the |
T9044 |
45432-45442 |
NN |
denotes |
activation |
T9045 |
45443-45445 |
IN |
denotes |
of |
T9046 |
45446-45459 |
JJ |
denotes |
proliferative |
T9047 |
45460-45471 |
NNS |
denotes |
circuitries |
T9048 |
45471-45472 |
. |
denotes |
. |
T9197 |
46100-46102 |
, |
denotes |
, |
T9102 |
45485-45491 |
IN |
denotes |
During |
T9103 |
45582-45588 |
VBP |
denotes |
govern |
T9104 |
45492-45499 |
NN |
denotes |
budding |
T9105 |
45500-45513 |
NN |
denotes |
morphogenesis |
T9106 |
45513-45515 |
, |
denotes |
, |
T9107 |
45515-45527 |
VBG |
denotes |
intersecting |
T9108 |
45538-45546 |
NNS |
denotes |
networks |
T9109 |
45528-45537 |
NN |
denotes |
signaling |
T9110 |
45547-45551 |
IN |
denotes |
from |
T9111 |
45552-45555 |
DT |
denotes |
the |
T9112 |
45556-45566 |
NN |
denotes |
epithelium |
T9113 |
45567-45570 |
CC |
denotes |
and |
T9114 |
45571-45581 |
NN |
denotes |
mesenchyme |
T9115 |
45589-45604 |
JJ |
denotes |
transcriptional |
T9116 |
45639-45647 |
NNS |
denotes |
programs |
T9117 |
45604-45606 |
, |
denotes |
, |
T9118 |
45606-45614 |
JJ |
denotes |
adhesive |
T9119 |
45614-45616 |
, |
denotes |
, |
T9120 |
45616-45624 |
NN |
denotes |
polarity |
T9121 |
45624-45626 |
, |
denotes |
, |
T9122 |
45626-45629 |
CC |
denotes |
and |
T9123 |
45630-45638 |
NN |
denotes |
motility |
T9124 |
45648-45650 |
IN |
denotes |
in |
T9125 |
45651-45656 |
DT |
denotes |
these |
T9126 |
45664-45670 |
NNS |
denotes |
groups |
T9127 |
45657-45663 |
JJ |
denotes |
select |
T9128 |
45671-45673 |
IN |
denotes |
of |
T9129 |
45674-45679 |
NNS |
denotes |
cells |
T9130 |
45679-45680 |
. |
denotes |
. |
T9131 |
45680-45801 |
sentence |
denotes |
The dynamic nuclear and cytosolic changes that take place during this time form the cornerstone for organ morphogenesis. |
T9132 |
45681-45684 |
DT |
denotes |
The |
T9133 |
45715-45722 |
NNS |
denotes |
changes |
T9134 |
45685-45692 |
JJ |
denotes |
dynamic |
T9135 |
45693-45700 |
JJ |
denotes |
nuclear |
T9136 |
45701-45704 |
CC |
denotes |
and |
T9137 |
45705-45714 |
JJ |
denotes |
cytosolic |
T9138 |
45756-45760 |
VBP |
denotes |
form |
T9139 |
45723-45727 |
WDT |
denotes |
that |
T9140 |
45728-45732 |
VBP |
denotes |
take |
T9141 |
45733-45738 |
NN |
denotes |
place |
T9142 |
45739-45745 |
IN |
denotes |
during |
T9143 |
45746-45750 |
DT |
denotes |
this |
T9144 |
45751-45755 |
NN |
denotes |
time |
T9145 |
45761-45764 |
DT |
denotes |
the |
T9146 |
45765-45776 |
NN |
denotes |
cornerstone |
T9147 |
45777-45780 |
IN |
denotes |
for |
T9148 |
45781-45786 |
NN |
denotes |
organ |
T9149 |
45787-45800 |
NN |
denotes |
morphogenesis |
T9150 |
45800-45801 |
. |
denotes |
. |
T9151 |
45801-46122 |
sentence |
denotes |
Two major challenges in understanding the mechanisms underlying a particular budding process are to order the temporal sequence of external cues involved and then to dissect how the cells of the developing bud translate these signals into the downstream events of cellular remodeling, proliferation, and differentiation. |
T9152 |
45802-45805 |
CD |
denotes |
Two |
T9153 |
45812-45822 |
NNS |
denotes |
challenges |
T9154 |
45806-45811 |
JJ |
denotes |
major |
T9155 |
45895-45898 |
VBP |
denotes |
are |
T9156 |
45823-45825 |
IN |
denotes |
in |
T9157 |
45826-45839 |
VBG |
denotes |
understanding |
T9158 |
45840-45843 |
DT |
denotes |
the |
T9159 |
45844-45854 |
NNS |
denotes |
mechanisms |
T9160 |
45855-45865 |
VBG |
denotes |
underlying |
T9161 |
45866-45867 |
DT |
denotes |
a |
T9162 |
45887-45894 |
NN |
denotes |
process |
T9163 |
45868-45878 |
JJ |
denotes |
particular |
T9164 |
45879-45886 |
NN |
denotes |
budding |
T9165 |
45899-45901 |
TO |
denotes |
to |
T9166 |
45902-45907 |
VB |
denotes |
order |
T9167 |
45908-45911 |
DT |
denotes |
the |
T9168 |
45921-45929 |
NN |
denotes |
sequence |
T9169 |
45912-45920 |
JJ |
denotes |
temporal |
T9170 |
45930-45932 |
IN |
denotes |
of |
T9171 |
45933-45941 |
JJ |
denotes |
external |
T9172 |
45942-45946 |
NNS |
denotes |
cues |
T9173 |
45947-45955 |
VBN |
denotes |
involved |
T9174 |
45956-45959 |
CC |
denotes |
and |
T9175 |
45960-45964 |
RB |
denotes |
then |
T9176 |
45968-45975 |
VB |
denotes |
dissect |
T9177 |
45965-45967 |
TO |
denotes |
to |
T9178 |
45976-45979 |
WRB |
denotes |
how |
T9179 |
46012-46021 |
VB |
denotes |
translate |
T9180 |
45980-45983 |
DT |
denotes |
the |
T9181 |
45984-45989 |
NNS |
denotes |
cells |
T9182 |
45990-45992 |
IN |
denotes |
of |
T9183 |
45993-45996 |
DT |
denotes |
the |
T9184 |
46008-46011 |
NN |
denotes |
bud |
T9185 |
45997-46007 |
VBG |
denotes |
developing |
T9186 |
46022-46027 |
DT |
denotes |
these |
T9187 |
46028-46035 |
NNS |
denotes |
signals |
T9188 |
46036-46040 |
IN |
denotes |
into |
T9189 |
46041-46044 |
DT |
denotes |
the |
T9190 |
46056-46062 |
NNS |
denotes |
events |
T9191 |
46045-46055 |
JJ |
denotes |
downstream |
T9192 |
46063-46065 |
IN |
denotes |
of |
T9193 |
46066-46074 |
JJ |
denotes |
cellular |
T9194 |
46075-46085 |
NN |
denotes |
remodeling |
T9195 |
46085-46087 |
, |
denotes |
, |
T9196 |
46087-46100 |
NN |
denotes |
proliferation |
T9198 |
46102-46105 |
CC |
denotes |
and |
T9199 |
46106-46121 |
NN |
denotes |
differentiation |
T9200 |
46121-46122 |
. |
denotes |
. |
T9201 |
46122-46246 |
sentence |
denotes |
Our studies here provide some insights into how these events are orchestrated during hair bud formation in developing skin. |
T9202 |
46123-46126 |
PRP$ |
denotes |
Our |
T9203 |
46127-46134 |
NNS |
denotes |
studies |
T9204 |
46140-46147 |
VBP |
denotes |
provide |
T9205 |
46135-46139 |
RB |
denotes |
here |
T9206 |
46148-46152 |
DT |
denotes |
some |
T9207 |
46153-46161 |
NNS |
denotes |
insights |
T9208 |
46162-46166 |
IN |
denotes |
into |
T9209 |
46167-46170 |
WRB |
denotes |
how |
T9210 |
46188-46200 |
VBN |
denotes |
orchestrated |
T9211 |
46171-46176 |
DT |
denotes |
these |
T9212 |
46177-46183 |
NNS |
denotes |
events |
T9213 |
46184-46187 |
VBP |
denotes |
are |
T9214 |
46201-46207 |
IN |
denotes |
during |
T9215 |
46208-46212 |
NN |
denotes |
hair |
T9216 |
46213-46216 |
NN |
denotes |
bud |
T9217 |
46217-46226 |
NN |
denotes |
formation |
T9218 |
46227-46229 |
IN |
denotes |
in |
T9219 |
46230-46240 |
VBG |
denotes |
developing |
T9220 |
46241-46245 |
NN |
denotes |
skin |
T9221 |
46245-46246 |
. |
denotes |
. |
T9653 |
46248-46257 |
NN |
denotes |
Signaling |
T9654 |
46258-46264 |
IN |
denotes |
during |
T9655 |
46265-46270 |
JJ |
denotes |
Early |
T9656 |
46285-46298 |
NN |
denotes |
Morphogenesis |
T9657 |
46271-46275 |
NN |
denotes |
Hair |
T9658 |
46276-46284 |
NN |
denotes |
Follicle |
T9659 |
46298-46624 |
sentence |
denotes |
Recent studies on hair bud morphogenesis suggest that Wnt signals likely from the epithelium and BMP inhibitory signals from the underlying mesenchyme converge to produce an active transcription factor complex involving β-catenin and LEF-1, which in turn plays a key role in specifying the hair follicle fate [4,29,30,36,37]. |
T9660 |
46299-46305 |
JJ |
denotes |
Recent |
T9661 |
46306-46313 |
NNS |
denotes |
studies |
T9662 |
46340-46347 |
VBP |
denotes |
suggest |
T9663 |
46314-46316 |
IN |
denotes |
on |
T9664 |
46317-46321 |
NN |
denotes |
hair |
T9665 |
46322-46325 |
NN |
denotes |
bud |
T9666 |
46326-46339 |
NN |
denotes |
morphogenesis |
T9667 |
46348-46352 |
IN |
denotes |
that |
T9668 |
46450-46458 |
VBP |
denotes |
converge |
T9669 |
46353-46356 |
NN |
denotes |
Wnt |
T9670 |
46357-46364 |
NNS |
denotes |
signals |
T9671 |
46365-46371 |
RB |
denotes |
likely |
T9672 |
46372-46376 |
IN |
denotes |
from |
T9673 |
46377-46380 |
DT |
denotes |
the |
T9674 |
46381-46391 |
NN |
denotes |
epithelium |
T9675 |
46392-46395 |
CC |
denotes |
and |
T9676 |
46396-46399 |
NN |
denotes |
BMP |
T9677 |
46411-46418 |
NNS |
denotes |
signals |
T9678 |
46400-46410 |
JJ |
denotes |
inhibitory |
T9679 |
46419-46423 |
IN |
denotes |
from |
T9680 |
46424-46427 |
DT |
denotes |
the |
T9681 |
46439-46449 |
NN |
denotes |
mesenchyme |
T9682 |
46428-46438 |
VBG |
denotes |
underlying |
T9683 |
46459-46461 |
TO |
denotes |
to |
T9684 |
46462-46469 |
VB |
denotes |
produce |
T9685 |
46470-46472 |
DT |
denotes |
an |
T9686 |
46501-46508 |
NN |
denotes |
complex |
T9687 |
46473-46479 |
JJ |
denotes |
active |
T9688 |
46480-46493 |
NN |
denotes |
transcription |
T9689 |
46494-46500 |
NN |
denotes |
factor |
T9690 |
46509-46518 |
VBG |
denotes |
involving |
T9691 |
46519-46520 |
NN |
denotes |
β |
T9692 |
46521-46528 |
NN |
denotes |
catenin |
T9693 |
46520-46521 |
HYPH |
denotes |
- |
T9694 |
46529-46532 |
CC |
denotes |
and |
T9695 |
46533-46536 |
NN |
denotes |
LEF |
T9696 |
46536-46537 |
HYPH |
denotes |
- |
T9697 |
46537-46538 |
CD |
denotes |
1 |
T9698 |
46538-46540 |
, |
denotes |
, |
T9699 |
46540-46545 |
WDT |
denotes |
which |
T9700 |
46554-46559 |
VBZ |
denotes |
plays |
T9701 |
46546-46548 |
IN |
denotes |
in |
T9702 |
46549-46553 |
NN |
denotes |
turn |
T9703 |
46560-46561 |
DT |
denotes |
a |
T9704 |
46566-46570 |
NN |
denotes |
role |
T9705 |
46562-46565 |
JJ |
denotes |
key |
T9706 |
46571-46573 |
IN |
denotes |
in |
T9707 |
46574-46584 |
VBG |
denotes |
specifying |
T9708 |
46585-46588 |
DT |
denotes |
the |
T9709 |
46603-46607 |
NN |
denotes |
fate |
T9710 |
46589-46593 |
NN |
denotes |
hair |
T9711 |
46594-46602 |
NN |
denotes |
follicle |
T9712 |
46608-46609 |
-LRB- |
denotes |
[ |
T9713 |
46620-46622 |
CD |
denotes |
37 |
T9714 |
46609-46610 |
CD |
denotes |
4 |
T9715 |
46610-46611 |
, |
denotes |
, |
T9716 |
46611-46613 |
CD |
denotes |
29 |
T9717 |
46613-46614 |
, |
denotes |
, |
T9718 |
46614-46616 |
CD |
denotes |
30 |
T9719 |
46616-46617 |
, |
denotes |
, |
T9720 |
46617-46619 |
CD |
denotes |
36 |
T9721 |
46619-46620 |
, |
denotes |
, |
T9722 |
46622-46623 |
-RRB- |
denotes |
] |
T9723 |
46623-46624 |
. |
denotes |
. |
T9724 |
46624-46883 |
sentence |
denotes |
Sonic hedgehog (Shh) and TGF-β2 signaling also play essential roles in follicle morphogenesis, but in contrast to β-catenin null skin, in which follicle invaginations are absent [30], some hair buds still form in the absence of LEF-1, Shh, or TGF-β2 [32,38]. |
T9725 |
46625-46630 |
JJ |
denotes |
Sonic |
T9726 |
46631-46639 |
NN |
denotes |
hedgehog |
T9727 |
46672-46676 |
VBP |
denotes |
play |
T9728 |
46640-46641 |
-LRB- |
denotes |
( |
T9729 |
46641-46644 |
NN |
denotes |
Shh |
T9730 |
46644-46645 |
-RRB- |
denotes |
) |
T9731 |
46646-46649 |
CC |
denotes |
and |
T9732 |
46650-46653 |
NN |
denotes |
TGF |
T9733 |
46654-46656 |
NN |
denotes |
β2 |
T9734 |
46653-46654 |
HYPH |
denotes |
- |
T9735 |
46657-46666 |
NN |
denotes |
signaling |
T9736 |
46667-46671 |
RB |
denotes |
also |
T9737 |
46677-46686 |
JJ |
denotes |
essential |
T9738 |
46687-46692 |
NNS |
denotes |
roles |
T9739 |
46693-46695 |
IN |
denotes |
in |
T9740 |
46696-46704 |
NN |
denotes |
follicle |
T9741 |
46705-46718 |
NN |
denotes |
morphogenesis |
T9742 |
46718-46720 |
, |
denotes |
, |
T9743 |
46720-46723 |
CC |
denotes |
but |
T9744 |
46724-46726 |
IN |
denotes |
in |
T9745 |
46830-46834 |
VBP |
denotes |
form |
T9746 |
46727-46735 |
NN |
denotes |
contrast |
T9747 |
46736-46738 |
IN |
denotes |
to |
T9748 |
46739-46740 |
NN |
denotes |
β |
T9749 |
46741-46748 |
NN |
denotes |
catenin |
T9750 |
46740-46741 |
HYPH |
denotes |
- |
T9751 |
46749-46753 |
JJ |
denotes |
null |
T9752 |
46754-46758 |
NN |
denotes |
skin |
T9753 |
46758-46760 |
, |
denotes |
, |
T9754 |
46760-46762 |
IN |
denotes |
in |
T9755 |
46792-46795 |
VBP |
denotes |
are |
T9756 |
46763-46768 |
WDT |
denotes |
which |
T9757 |
46769-46777 |
NN |
denotes |
follicle |
T9758 |
46778-46791 |
NNS |
denotes |
invaginations |
T9759 |
46796-46802 |
JJ |
denotes |
absent |
T9760 |
46803-46804 |
-LRB- |
denotes |
[ |
T9761 |
46804-46806 |
CD |
denotes |
30 |
T9762 |
46806-46807 |
-RRB- |
denotes |
] |
T9763 |
46807-46809 |
, |
denotes |
, |
T9764 |
46809-46813 |
DT |
denotes |
some |
T9765 |
46819-46823 |
NNS |
denotes |
buds |
T9766 |
46814-46818 |
NN |
denotes |
hair |
T9767 |
46824-46829 |
RB |
denotes |
still |
T9768 |
46835-46837 |
IN |
denotes |
in |
T9769 |
46838-46841 |
DT |
denotes |
the |
T9770 |
46842-46849 |
NN |
denotes |
absence |
T9771 |
46850-46852 |
IN |
denotes |
of |
T9772 |
46853-46856 |
NN |
denotes |
LEF |
T9773 |
46856-46857 |
HYPH |
denotes |
- |
T9774 |
46857-46858 |
CD |
denotes |
1 |
T9775 |
46858-46860 |
, |
denotes |
, |
T9776 |
46860-46863 |
NN |
denotes |
Shh |
T9777 |
46863-46865 |
, |
denotes |
, |
T9778 |
46865-46867 |
CC |
denotes |
or |
T9779 |
46868-46871 |
NN |
denotes |
TGF |
T9780 |
46872-46874 |
NN |
denotes |
β2 |
T9781 |
46871-46872 |
HYPH |
denotes |
- |
T9782 |
46875-46876 |
-LRB- |
denotes |
[ |
T9783 |
46879-46881 |
CD |
denotes |
38 |
T9784 |
46876-46878 |
CD |
denotes |
32 |
T9785 |
46878-46879 |
, |
denotes |
, |
T9786 |
46881-46882 |
-RRB- |
denotes |
] |
T9787 |
46882-46883 |
. |
denotes |
. |
T9788 |
46883-47066 |
sentence |
denotes |
These likely reflect the first wave of follicle (i.e., guard hair) morphogenesis, which accounts for a small number (fewer than 5%) of hairs and is under distinct regulatory control. |
T9789 |
46884-46889 |
DT |
denotes |
These |
T9790 |
46897-46904 |
VBP |
denotes |
reflect |
T9791 |
46890-46896 |
RB |
denotes |
likely |
T9792 |
46905-46908 |
DT |
denotes |
the |
T9793 |
46915-46919 |
NN |
denotes |
wave |
T9794 |
46909-46914 |
JJ |
denotes |
first |
T9795 |
46920-46922 |
IN |
denotes |
of |
T9796 |
46923-46931 |
NN |
denotes |
follicle |
T9797 |
46951-46964 |
NN |
denotes |
morphogenesis |
T9798 |
46932-46933 |
-LRB- |
denotes |
( |
T9799 |
46945-46949 |
NN |
denotes |
hair |
T9800 |
46933-46937 |
FW |
denotes |
i.e. |
T9801 |
46937-46939 |
, |
denotes |
, |
T9802 |
46939-46944 |
NN |
denotes |
guard |
T9803 |
46949-46950 |
-RRB- |
denotes |
) |
T9804 |
46964-46966 |
, |
denotes |
, |
T9805 |
46966-46971 |
WDT |
denotes |
which |
T9806 |
46972-46980 |
VBZ |
denotes |
accounts |
T9807 |
46981-46984 |
IN |
denotes |
for |
T9808 |
46985-46986 |
DT |
denotes |
a |
T9809 |
46993-46999 |
NN |
denotes |
number |
T9810 |
46987-46992 |
JJ |
denotes |
small |
T9811 |
47000-47001 |
-LRB- |
denotes |
( |
T9812 |
47001-47006 |
JJR |
denotes |
fewer |
T9813 |
47012-47013 |
CD |
denotes |
5 |
T9814 |
47007-47011 |
IN |
denotes |
than |
T9815 |
47013-47014 |
NN |
denotes |
% |
T9816 |
47014-47015 |
-RRB- |
denotes |
) |
T9817 |
47016-47018 |
IN |
denotes |
of |
T9818 |
47019-47024 |
NNS |
denotes |
hairs |
T9819 |
47025-47028 |
CC |
denotes |
and |
T9820 |
47029-47031 |
VBZ |
denotes |
is |
T9821 |
47032-47037 |
IN |
denotes |
under |
T9822 |
47038-47046 |
JJ |
denotes |
distinct |
T9823 |
47058-47065 |
NN |
denotes |
control |
T9824 |
47047-47057 |
JJ |
denotes |
regulatory |
T9825 |
47065-47066 |
. |
denotes |
. |
T9826 |
47066-47230 |
sentence |
denotes |
Guard hairs form in the absence of LEF-1 and TGF-β2, and we have found that they also fail to express Snail at the budding stage of development (unpublished data). |
T9827 |
47067-47072 |
NN |
denotes |
Guard |
T9828 |
47073-47078 |
NNS |
denotes |
hairs |
T9829 |
47079-47083 |
VBP |
denotes |
form |
T9830 |
47084-47086 |
IN |
denotes |
in |
T9831 |
47087-47090 |
DT |
denotes |
the |
T9832 |
47091-47098 |
NN |
denotes |
absence |
T9833 |
47099-47101 |
IN |
denotes |
of |
T9834 |
47102-47105 |
NN |
denotes |
LEF |
T9835 |
47105-47106 |
HYPH |
denotes |
- |
T9836 |
47106-47107 |
CD |
denotes |
1 |
T9837 |
47108-47111 |
CC |
denotes |
and |
T9838 |
47112-47115 |
NN |
denotes |
TGF |
T9839 |
47116-47118 |
NN |
denotes |
β2 |
T9840 |
47115-47116 |
HYPH |
denotes |
- |
T9841 |
47118-47120 |
, |
denotes |
, |
T9842 |
47120-47123 |
CC |
denotes |
and |
T9843 |
47124-47126 |
PRP |
denotes |
we |
T9844 |
47132-47137 |
VBN |
denotes |
found |
T9845 |
47127-47131 |
VBP |
denotes |
have |
T9846 |
47138-47142 |
IN |
denotes |
that |
T9847 |
47153-47157 |
VBP |
denotes |
fail |
T9848 |
47143-47147 |
PRP |
denotes |
they |
T9849 |
47148-47152 |
RB |
denotes |
also |
T9850 |
47158-47160 |
TO |
denotes |
to |
T9851 |
47161-47168 |
VB |
denotes |
express |
T9852 |
47169-47174 |
NN |
denotes |
Snail |
T9853 |
47175-47177 |
IN |
denotes |
at |
T9854 |
47178-47181 |
DT |
denotes |
the |
T9855 |
47190-47195 |
NN |
denotes |
stage |
T9856 |
47182-47189 |
NN |
denotes |
budding |
T9857 |
47196-47198 |
IN |
denotes |
of |
T9858 |
47199-47210 |
NN |
denotes |
development |
T9859 |
47211-47212 |
-LRB- |
denotes |
( |
T9860 |
47224-47228 |
NNS |
denotes |
data |
T9861 |
47212-47223 |
JJ |
denotes |
unpublished |
T9862 |
47228-47229 |
-RRB- |
denotes |
) |
T9863 |
47229-47230 |
. |
denotes |
. |
T9864 |
47230-47299 |
sentence |
denotes |
How E-cadherin is regulated in guard hairs remains to be determined. |
T9865 |
47231-47234 |
WRB |
denotes |
How |
T9866 |
47249-47258 |
VBN |
denotes |
regulated |
T9867 |
47235-47236 |
NN |
denotes |
E |
T9868 |
47237-47245 |
NN |
denotes |
cadherin |
T9869 |
47236-47237 |
HYPH |
denotes |
- |
T9870 |
47246-47248 |
VBZ |
denotes |
is |
T9871 |
47274-47281 |
VBZ |
denotes |
remains |
T9872 |
47259-47261 |
IN |
denotes |
in |
T9873 |
47262-47267 |
NN |
denotes |
guard |
T9874 |
47268-47273 |
NNS |
denotes |
hairs |
T9875 |
47282-47284 |
TO |
denotes |
to |
T9876 |
47288-47298 |
VBN |
denotes |
determined |
T9877 |
47285-47287 |
VB |
denotes |
be |
T9878 |
47298-47299 |
. |
denotes |
. |
T9879 |
47299-47533 |
sentence |
denotes |
Several candidates include other Snail family members such as Slug or twist, or alternatively, transcription factors involving β-catenin and a different member of the LEF-1/TCF/Sry-type HMG box (commonly known as SOX) family [39,40]. |
T9880 |
47300-47307 |
JJ |
denotes |
Several |
T9881 |
47308-47318 |
NNS |
denotes |
candidates |
T9882 |
47319-47326 |
VBP |
denotes |
include |
T9883 |
47327-47332 |
JJ |
denotes |
other |
T9884 |
47346-47353 |
NNS |
denotes |
members |
T9885 |
47333-47338 |
NN |
denotes |
Snail |
T9886 |
47339-47345 |
NN |
denotes |
family |
T9887 |
47354-47358 |
JJ |
denotes |
such |
T9888 |
47359-47361 |
IN |
denotes |
as |
T9889 |
47362-47366 |
NN |
denotes |
Slug |
T9890 |
47367-47369 |
CC |
denotes |
or |
T9891 |
47370-47375 |
NN |
denotes |
twist |
T9892 |
47375-47377 |
, |
denotes |
, |
T9893 |
47377-47379 |
CC |
denotes |
or |
T9894 |
47380-47393 |
RB |
denotes |
alternatively |
T9895 |
47409-47416 |
NNS |
denotes |
factors |
T9896 |
47393-47395 |
, |
denotes |
, |
T9897 |
47395-47408 |
NN |
denotes |
transcription |
T9898 |
47417-47426 |
VBG |
denotes |
involving |
T9899 |
47427-47428 |
NN |
denotes |
β |
T9900 |
47429-47436 |
NN |
denotes |
catenin |
T9901 |
47428-47429 |
HYPH |
denotes |
- |
T9902 |
47437-47440 |
CC |
denotes |
and |
T9903 |
47441-47442 |
DT |
denotes |
a |
T9904 |
47453-47459 |
NN |
denotes |
member |
T9905 |
47443-47452 |
JJ |
denotes |
different |
T9906 |
47460-47462 |
IN |
denotes |
of |
T9907 |
47463-47466 |
DT |
denotes |
the |
T9908 |
47518-47524 |
NN |
denotes |
family |
T9909 |
47467-47470 |
NN |
denotes |
LEF |
T9910 |
47490-47493 |
NN |
denotes |
box |
T9911 |
47470-47471 |
HYPH |
denotes |
- |
T9912 |
47471-47472 |
CD |
denotes |
1 |
T9913 |
47472-47473 |
HYPH |
denotes |
/ |
T9914 |
47473-47476 |
NN |
denotes |
TCF |
T9915 |
47476-47477 |
HYPH |
denotes |
/ |
T9916 |
47477-47480 |
NN |
denotes |
Sry |
T9917 |
47481-47485 |
NN |
denotes |
type |
T9918 |
47480-47481 |
HYPH |
denotes |
- |
T9919 |
47486-47489 |
NN |
denotes |
HMG |
T9920 |
47494-47495 |
-LRB- |
denotes |
( |
T9921 |
47504-47509 |
VBN |
denotes |
known |
T9922 |
47495-47503 |
RB |
denotes |
commonly |
T9923 |
47510-47512 |
IN |
denotes |
as |
T9924 |
47513-47516 |
NN |
denotes |
SOX |
T9925 |
47516-47517 |
-RRB- |
denotes |
) |
T9926 |
47525-47526 |
-LRB- |
denotes |
[ |
T9927 |
47529-47531 |
CD |
denotes |
40 |
T9928 |
47526-47528 |
CD |
denotes |
39 |
T9929 |
47528-47529 |
, |
denotes |
, |
T9930 |
47531-47532 |
-RRB- |
denotes |
] |
T9931 |
47532-47533 |
. |
denotes |
. |
T9932 |
47533-47676 |
sentence |
denotes |
Further investigation will be required to determine whether the signaling pathway we have elucidated here is a theme with multiple variations. |
T9933 |
47534-47541 |
JJ |
denotes |
Further |
T9934 |
47542-47555 |
NN |
denotes |
investigation |
T9935 |
47564-47572 |
VBN |
denotes |
required |
T9936 |
47556-47560 |
MD |
denotes |
will |
T9937 |
47561-47563 |
VB |
denotes |
be |
T9938 |
47573-47575 |
TO |
denotes |
to |
T9939 |
47576-47585 |
VB |
denotes |
determine |
T9940 |
47586-47593 |
IN |
denotes |
whether |
T9941 |
47640-47642 |
VBZ |
denotes |
is |
T9942 |
47594-47597 |
DT |
denotes |
the |
T9943 |
47608-47615 |
NN |
denotes |
pathway |
T9944 |
47598-47607 |
NN |
denotes |
signaling |
T9945 |
47616-47618 |
PRP |
denotes |
we |
T9946 |
47624-47634 |
VBN |
denotes |
elucidated |
T9947 |
47619-47623 |
VBP |
denotes |
have |
T9948 |
47635-47639 |
RB |
denotes |
here |
T9949 |
47643-47644 |
DT |
denotes |
a |
T9950 |
47645-47650 |
NN |
denotes |
theme |
T9951 |
47651-47655 |
IN |
denotes |
with |
T9952 |
47656-47664 |
JJ |
denotes |
multiple |
T9953 |
47665-47675 |
NNS |
denotes |
variations |
T9954 |
47675-47676 |
. |
denotes |
. |
T9955 |
47676-47758 |
sentence |
denotes |
TGF-βs are known to promote withdrawal of keratinocytes from the cell cycle [41]. |
T9956 |
47677-47680 |
NN |
denotes |
TGF |
T9957 |
47681-47683 |
NNS |
denotes |
βs |
T9958 |
47680-47681 |
HYPH |
denotes |
- |
T9959 |
47688-47693 |
VBN |
denotes |
known |
T9960 |
47684-47687 |
VBP |
denotes |
are |
T9961 |
47694-47696 |
TO |
denotes |
to |
T9963 |
47705-47715 |
NN |
denotes |
withdrawal |
T9964 |
47716-47718 |
IN |
denotes |
of |
T9965 |
47719-47732 |
NNS |
denotes |
keratinocytes |
T9966 |
47733-47737 |
IN |
denotes |
from |
T9967 |
47738-47741 |
DT |
denotes |
the |
T9968 |
47747-47752 |
NN |
denotes |
cycle |
T9969 |
47742-47746 |
NN |
denotes |
cell |
T9970 |
47753-47754 |
-LRB- |
denotes |
[ |
T9971 |
47754-47756 |
CD |
denotes |
41 |
T9972 |
47756-47757 |
-RRB- |
denotes |
] |
T9973 |
47757-47758 |
. |
denotes |
. |
T9974 |
47758-48040 |
sentence |
denotes |
Hence, when TGF-β2 protein was detected at the transition between the growing and destructive phases of the adult hair cycle, research initially and naturally focused on a role for this family member in cessation of growth and/or triggering apoptosis ([42] and references therein). |
T9975 |
47759-47764 |
RB |
denotes |
Hence |
T9976 |
47918-47925 |
VBD |
denotes |
focused |
T9977 |
47764-47766 |
, |
denotes |
, |
T9978 |
47766-47770 |
WRB |
denotes |
when |
T9979 |
47790-47798 |
VBN |
denotes |
detected |
T9980 |
47771-47774 |
NN |
denotes |
TGF |
T9981 |
47775-47777 |
NN |
denotes |
β2 |
T9982 |
47774-47775 |
HYPH |
denotes |
- |
T9983 |
47778-47785 |
NN |
denotes |
protein |
T9984 |
47786-47789 |
VBD |
denotes |
was |
T9985 |
47799-47801 |
IN |
denotes |
at |
T9986 |
47802-47805 |
DT |
denotes |
the |
T9987 |
47806-47816 |
NN |
denotes |
transition |
T9988 |
47817-47824 |
IN |
denotes |
between |
T9989 |
47825-47828 |
DT |
denotes |
the |
T9990 |
47853-47859 |
NNS |
denotes |
phases |
T9991 |
47829-47836 |
NN |
denotes |
growing |
T9992 |
47841-47852 |
JJ |
denotes |
destructive |
T9993 |
47837-47840 |
CC |
denotes |
and |
T9994 |
47860-47862 |
IN |
denotes |
of |
T9995 |
47863-47866 |
DT |
denotes |
the |
T9996 |
47878-47883 |
NN |
denotes |
cycle |
T9997 |
47867-47872 |
JJ |
denotes |
adult |
T9998 |
47873-47877 |
NN |
denotes |
hair |
T9999 |
47883-47885 |
, |
denotes |
, |
T10000 |
47885-47893 |
NN |
denotes |
research |
T10001 |
47894-47903 |
RB |
denotes |
initially |
T10002 |
47904-47907 |
CC |
denotes |
and |
T10003 |
47908-47917 |
RB |
denotes |
naturally |
T10004 |
47926-47928 |
IN |
denotes |
on |
T10005 |
47929-47930 |
DT |
denotes |
a |
T10006 |
47931-47935 |
NN |
denotes |
role |
T10007 |
47936-47939 |
IN |
denotes |
for |
T10008 |
47940-47944 |
DT |
denotes |
this |
T10009 |
47952-47958 |
NN |
denotes |
member |
T10010 |
47945-47951 |
NN |
denotes |
family |
T10011 |
47959-47961 |
IN |
denotes |
in |
T10012 |
47962-47971 |
NN |
denotes |
cessation |
T10013 |
47972-47974 |
IN |
denotes |
of |
T10014 |
47975-47981 |
NN |
denotes |
growth |
T10015 |
47982-47985 |
CC |
denotes |
and |
T10016 |
47985-47986 |
HYPH |
denotes |
/ |
T10017 |
47986-47988 |
CC |
denotes |
or |
T10018 |
47989-47999 |
VBG |
denotes |
triggering |
T10019 |
48000-48009 |
NN |
denotes |
apoptosis |
T10020 |
48010-48011 |
-LRB- |
denotes |
( |
T10021 |
48012-48014 |
CD |
denotes |
42 |
T10022 |
48011-48012 |
-LRB- |
denotes |
[ |
T10023 |
48014-48015 |
-RRB- |
denotes |
] |
T10024 |
48016-48019 |
CC |
denotes |
and |
T10025 |
48020-48030 |
NNS |
denotes |
references |
T10026 |
48031-48038 |
RB |
denotes |
therein |
T10027 |
48038-48039 |
-RRB- |
denotes |
) |
T10028 |
48039-48040 |
. |
denotes |
. |
T10029 |
48040-48231 |
sentence |
denotes |
However, in contrast to TGF-β1-null skin, which exhibits an extended growing phase of postnatal hair follicles, TGF-β2-null skin displays an embryonic block in follicle bud progression [32]. |
T10030 |
48041-48048 |
RB |
denotes |
However |
T10031 |
48170-48178 |
VBZ |
denotes |
displays |
T10032 |
48048-48050 |
, |
denotes |
, |
T10033 |
48050-48052 |
IN |
denotes |
in |
T10034 |
48053-48061 |
NN |
denotes |
contrast |
T10035 |
48062-48064 |
IN |
denotes |
to |
T10036 |
48065-48068 |
NN |
denotes |
TGF |
T10037 |
48069-48071 |
NN |
denotes |
β1 |
T10038 |
48068-48069 |
HYPH |
denotes |
- |
T10039 |
48072-48076 |
JJ |
denotes |
null |
T10040 |
48071-48072 |
HYPH |
denotes |
- |
T10041 |
48077-48081 |
NN |
denotes |
skin |
T10042 |
48081-48083 |
, |
denotes |
, |
T10043 |
48083-48088 |
WDT |
denotes |
which |
T10044 |
48089-48097 |
VBZ |
denotes |
exhibits |
T10045 |
48098-48100 |
DT |
denotes |
an |
T10046 |
48118-48123 |
NN |
denotes |
phase |
T10047 |
48101-48109 |
JJ |
denotes |
extended |
T10048 |
48110-48117 |
NN |
denotes |
growing |
T10049 |
48124-48126 |
IN |
denotes |
of |
T10050 |
48127-48136 |
JJ |
denotes |
postnatal |
T10051 |
48142-48151 |
NNS |
denotes |
follicles |
T10052 |
48137-48141 |
NN |
denotes |
hair |
T10053 |
48151-48153 |
, |
denotes |
, |
T10054 |
48153-48156 |
NN |
denotes |
TGF |
T10055 |
48157-48159 |
NN |
denotes |
β2 |
T10056 |
48156-48157 |
HYPH |
denotes |
- |
T10057 |
48160-48164 |
JJ |
denotes |
null |
T10058 |
48159-48160 |
HYPH |
denotes |
- |
T10059 |
48165-48169 |
NN |
denotes |
skin |
T10060 |
48179-48181 |
DT |
denotes |
an |
T10061 |
48192-48197 |
NN |
denotes |
block |
T10062 |
48182-48191 |
JJ |
denotes |
embryonic |
T10063 |
48198-48200 |
IN |
denotes |
in |
T10064 |
48201-48209 |
NN |
denotes |
follicle |
T10065 |
48210-48213 |
NN |
denotes |
bud |
T10066 |
48214-48225 |
NN |
denotes |
progression |
T10067 |
48226-48227 |
-LRB- |
denotes |
[ |
T10068 |
48227-48229 |
CD |
denotes |
32 |
T10069 |
48229-48230 |
-RRB- |
denotes |
] |
T10070 |
48230-48231 |
. |
denotes |
. |
T10071 |
48231-48502 |
sentence |
denotes |
Although this phenotype is consistent with TGF-β2's embryonic expression patterns [33], about 50% of TGF-β2 null buds appear unable to progress to the down-growth phase, a feature that cannot be explained readily on the basis of previously established effects of TGF-βs. |
T10072 |
48232-48240 |
IN |
denotes |
Although |
T10073 |
48256-48258 |
VBZ |
denotes |
is |
T10074 |
48241-48245 |
DT |
denotes |
this |
T10075 |
48246-48255 |
NN |
denotes |
phenotype |
T10076 |
48350-48356 |
VBP |
denotes |
appear |
T10077 |
48259-48269 |
JJ |
denotes |
consistent |
T10078 |
48270-48274 |
IN |
denotes |
with |
T10079 |
48275-48278 |
NN |
denotes |
TGF |
T10080 |
48279-48281 |
NN |
denotes |
β2 |
T10081 |
48278-48279 |
HYPH |
denotes |
- |
T10082 |
48305-48313 |
NNS |
denotes |
patterns |
T10083 |
48281-48283 |
POS |
denotes |
's |
T10084 |
48284-48293 |
JJ |
denotes |
embryonic |
T10085 |
48294-48304 |
NN |
denotes |
expression |
T10086 |
48314-48315 |
-LRB- |
denotes |
[ |
T10087 |
48315-48317 |
CD |
denotes |
33 |
T10088 |
48317-48318 |
-RRB- |
denotes |
] |
T10089 |
48318-48320 |
, |
denotes |
, |
T10090 |
48320-48325 |
IN |
denotes |
about |
T10091 |
48326-48328 |
CD |
denotes |
50 |
T10092 |
48328-48329 |
NN |
denotes |
% |
T10093 |
48330-48332 |
IN |
denotes |
of |
T10094 |
48333-48336 |
NN |
denotes |
TGF |
T10095 |
48337-48339 |
NN |
denotes |
β2 |
T10096 |
48336-48337 |
HYPH |
denotes |
- |
T10097 |
48340-48344 |
JJ |
denotes |
null |
T10098 |
48345-48349 |
NNS |
denotes |
buds |
T10099 |
48357-48363 |
JJ |
denotes |
unable |
T10100 |
48364-48366 |
TO |
denotes |
to |
T10101 |
48367-48375 |
VB |
denotes |
progress |
T10102 |
48376-48378 |
IN |
denotes |
to |
T10103 |
48379-48382 |
DT |
denotes |
the |
T10104 |
48395-48400 |
NN |
denotes |
phase |
T10105 |
48383-48387 |
JJ |
denotes |
down |
T10106 |
48388-48394 |
NN |
denotes |
growth |
T10107 |
48387-48388 |
HYPH |
denotes |
- |
T10108 |
48400-48402 |
, |
denotes |
, |
T10109 |
48402-48403 |
DT |
denotes |
a |
T10110 |
48404-48411 |
NN |
denotes |
feature |
T10111 |
48412-48416 |
WDT |
denotes |
that |
T10112 |
48427-48436 |
VBN |
denotes |
explained |
T10113 |
48417-48420 |
MD |
denotes |
can |
T10114 |
48420-48423 |
RB |
denotes |
not |
T10115 |
48424-48426 |
VB |
denotes |
be |
T10116 |
48437-48444 |
RB |
denotes |
readily |
T10117 |
48445-48447 |
IN |
denotes |
on |
T10118 |
48448-48451 |
DT |
denotes |
the |
T10119 |
48452-48457 |
NN |
denotes |
basis |
T10120 |
48458-48460 |
IN |
denotes |
of |
T10121 |
48461-48471 |
RB |
denotes |
previously |
T10122 |
48472-48483 |
VBN |
denotes |
established |
T10123 |
48484-48491 |
NNS |
denotes |
effects |
T10124 |
48492-48494 |
IN |
denotes |
of |
T10125 |
48495-48498 |
NN |
denotes |
TGF |
T10126 |
48499-48501 |
NNS |
denotes |
βs |
T10127 |
48498-48499 |
HYPH |
denotes |
- |
T10128 |
48501-48502 |
. |
denotes |
. |
T10129 |
48502-48777 |
sentence |
denotes |
Our finding that TGF-β2 is upstream from Ki67 expression and MAPK activation lends further support to the notion that hair follicle keratinocytes at this early stage of development react to TGF-β2 signaling in a fashion opposite to that typically expected for TGF-β factors. |
T10130 |
48503-48506 |
PRP$ |
denotes |
Our |
T10131 |
48507-48514 |
NN |
denotes |
finding |
T10132 |
48580-48585 |
VBZ |
denotes |
lends |
T10133 |
48515-48519 |
IN |
denotes |
that |
T10134 |
48527-48529 |
VBZ |
denotes |
is |
T10135 |
48520-48523 |
NN |
denotes |
TGF |
T10136 |
48524-48526 |
NN |
denotes |
β2 |
T10137 |
48523-48524 |
HYPH |
denotes |
- |
T10138 |
48530-48538 |
RB |
denotes |
upstream |
T10139 |
48539-48543 |
IN |
denotes |
from |
T10140 |
48544-48548 |
NN |
denotes |
Ki67 |
T10141 |
48549-48559 |
NN |
denotes |
expression |
T10142 |
48560-48563 |
CC |
denotes |
and |
T10143 |
48564-48568 |
NN |
denotes |
MAPK |
T10144 |
48569-48579 |
NN |
denotes |
activation |
T10145 |
48586-48593 |
JJ |
denotes |
further |
T10146 |
48594-48601 |
NN |
denotes |
support |
T10147 |
48602-48604 |
IN |
denotes |
to |
T10148 |
48605-48608 |
DT |
denotes |
the |
T10149 |
48609-48615 |
NN |
denotes |
notion |
T10150 |
48616-48620 |
IN |
denotes |
that |
T10151 |
48684-48689 |
VBP |
denotes |
react |
T10152 |
48621-48625 |
NN |
denotes |
hair |
T10153 |
48626-48634 |
NN |
denotes |
follicle |
T10154 |
48635-48648 |
NNS |
denotes |
keratinocytes |
T10155 |
48649-48651 |
IN |
denotes |
at |
T10156 |
48652-48656 |
DT |
denotes |
this |
T10157 |
48663-48668 |
NN |
denotes |
stage |
T10158 |
48657-48662 |
JJ |
denotes |
early |
T10159 |
48669-48671 |
IN |
denotes |
of |
T10160 |
48672-48683 |
NN |
denotes |
development |
T10161 |
48690-48692 |
IN |
denotes |
to |
T10162 |
48693-48696 |
NN |
denotes |
TGF |
T10163 |
48697-48699 |
NN |
denotes |
β2 |
T10164 |
48696-48697 |
HYPH |
denotes |
- |
T10165 |
48700-48709 |
NN |
denotes |
signaling |
T10166 |
48710-48712 |
IN |
denotes |
in |
T10167 |
48713-48714 |
DT |
denotes |
a |
T10168 |
48715-48722 |
NN |
denotes |
fashion |
T10169 |
48723-48731 |
JJ |
denotes |
opposite |
T10170 |
48732-48734 |
IN |
denotes |
to |
T10171 |
48735-48739 |
DT |
denotes |
that |
T10172 |
48740-48749 |
RB |
denotes |
typically |
T10173 |
48750-48758 |
VBN |
denotes |
expected |
T10174 |
48759-48762 |
IN |
denotes |
for |
T10175 |
48763-48766 |
NN |
denotes |
TGF |
T10176 |
48767-48768 |
NN |
denotes |
β |
T10177 |
48766-48767 |
HYPH |
denotes |
- |
T10178 |
48769-48776 |
NNS |
denotes |
factors |
T10179 |
48776-48777 |
. |
denotes |
. |
T10180 |
48777-48895 |
sentence |
denotes |
This said, based upon pSMAD2 immunohistochemistry, the immediate steps of downstream signaling appeared to be intact. |
T10181 |
48778-48782 |
DT |
denotes |
This |
T10182 |
48783-48787 |
VBN |
denotes |
said |
T10183 |
48873-48881 |
VBD |
denotes |
appeared |
T10184 |
48787-48789 |
, |
denotes |
, |
T10185 |
48789-48794 |
VBN |
denotes |
based |
T10186 |
48795-48799 |
IN |
denotes |
upon |
T10187 |
48800-48806 |
NN |
denotes |
pSMAD2 |
T10188 |
48807-48827 |
NN |
denotes |
immunohistochemistry |
T10189 |
48827-48829 |
, |
denotes |
, |
T10190 |
48829-48832 |
DT |
denotes |
the |
T10191 |
48843-48848 |
NNS |
denotes |
steps |
T10192 |
48833-48842 |
JJ |
denotes |
immediate |
T10193 |
48849-48851 |
IN |
denotes |
of |
T10194 |
48852-48862 |
JJ |
denotes |
downstream |
T10195 |
48863-48872 |
NN |
denotes |
signaling |
T10196 |
48882-48884 |
TO |
denotes |
to |
T10197 |
48885-48887 |
VB |
denotes |
be |
T10198 |
48888-48894 |
JJ |
denotes |
intact |
T10199 |
48894-48895 |
. |
denotes |
. |
T10200 |
48895-49031 |
sentence |
denotes |
Thus, we surmise that the proliferative outcome is likely to be rooted in differences in the repertoire of activated SMAD target genes. |
T10201 |
48896-48900 |
RB |
denotes |
Thus |
T10202 |
48905-48912 |
VBP |
denotes |
surmise |
T10203 |
48900-48902 |
, |
denotes |
, |
T10204 |
48902-48904 |
PRP |
denotes |
we |
T10205 |
48913-48917 |
IN |
denotes |
that |
T10206 |
48944-48946 |
VBZ |
denotes |
is |
T10207 |
48918-48921 |
DT |
denotes |
the |
T10208 |
48936-48943 |
NN |
denotes |
outcome |
T10209 |
48922-48935 |
JJ |
denotes |
proliferative |
T10210 |
48947-48953 |
JJ |
denotes |
likely |
T10211 |
48954-48956 |
TO |
denotes |
to |
T10212 |
48960-48966 |
VBN |
denotes |
rooted |
T10213 |
48957-48959 |
VB |
denotes |
be |
T10214 |
48967-48969 |
IN |
denotes |
in |
T10215 |
48970-48981 |
NNS |
denotes |
differences |
T10216 |
48982-48984 |
IN |
denotes |
in |
T10217 |
48985-48988 |
DT |
denotes |
the |
T10218 |
48989-48999 |
NN |
denotes |
repertoire |
T10219 |
49000-49002 |
IN |
denotes |
of |
T10220 |
49003-49012 |
VBN |
denotes |
activated |
T10221 |
49025-49030 |
NNS |
denotes |
genes |
T10222 |
49013-49017 |
NN |
denotes |
SMAD |
T10223 |
49018-49024 |
NN |
denotes |
target |
T10224 |
49030-49031 |
. |
denotes |
. |
T10225 |
49031-49296 |
sentence |
denotes |
In this regard, the positive effects of TGF-β2 on proliferation within the hair bud may be more analogous to what has been seen in progression of squamous cell carcinoma to metastatic carcinoma [43] rather than that typically observed for keratinocytes [44,45,46]. |
T10226 |
49032-49034 |
IN |
denotes |
In |
T10227 |
49120-49122 |
VB |
denotes |
be |
T10228 |
49035-49039 |
DT |
denotes |
this |
T10229 |
49040-49046 |
NN |
denotes |
regard |
T10230 |
49046-49048 |
, |
denotes |
, |
T10231 |
49048-49051 |
DT |
denotes |
the |
T10232 |
49061-49068 |
NNS |
denotes |
effects |
T10233 |
49052-49060 |
JJ |
denotes |
positive |
T10234 |
49069-49071 |
IN |
denotes |
of |
T10235 |
49072-49075 |
NN |
denotes |
TGF |
T10236 |
49076-49078 |
NN |
denotes |
β2 |
T10237 |
49075-49076 |
HYPH |
denotes |
- |
T10238 |
49079-49081 |
IN |
denotes |
on |
T10239 |
49082-49095 |
NN |
denotes |
proliferation |
T10240 |
49096-49102 |
IN |
denotes |
within |
T10241 |
49103-49106 |
DT |
denotes |
the |
T10242 |
49112-49115 |
NN |
denotes |
bud |
T10243 |
49107-49111 |
NN |
denotes |
hair |
T10244 |
49116-49119 |
MD |
denotes |
may |
T10245 |
49123-49127 |
RBR |
denotes |
more |
T10246 |
49128-49137 |
JJ |
denotes |
analogous |
T10247 |
49138-49140 |
IN |
denotes |
to |
T10248 |
49141-49145 |
WP |
denotes |
what |
T10249 |
49155-49159 |
VBN |
denotes |
seen |
T10250 |
49146-49149 |
VBZ |
denotes |
has |
T10251 |
49150-49154 |
VBN |
denotes |
been |
T10252 |
49160-49162 |
IN |
denotes |
in |
T10253 |
49163-49174 |
NN |
denotes |
progression |
T10254 |
49175-49177 |
IN |
denotes |
of |
T10255 |
49178-49186 |
JJ |
denotes |
squamous |
T10256 |
49187-49191 |
NN |
denotes |
cell |
T10257 |
49192-49201 |
NN |
denotes |
carcinoma |
T10258 |
49202-49204 |
IN |
denotes |
to |
T10259 |
49205-49215 |
JJ |
denotes |
metastatic |
T10260 |
49216-49225 |
NN |
denotes |
carcinoma |
T10261 |
49226-49227 |
-LRB- |
denotes |
[ |
T10262 |
49227-49229 |
CD |
denotes |
43 |
T10263 |
49229-49230 |
-RRB- |
denotes |
] |
T10264 |
49231-49237 |
RB |
denotes |
rather |
T10265 |
49238-49242 |
IN |
denotes |
than |
T10266 |
49243-49247 |
DT |
denotes |
that |
T10267 |
49248-49257 |
RB |
denotes |
typically |
T10268 |
49258-49266 |
VBN |
denotes |
observed |
T10269 |
49267-49270 |
IN |
denotes |
for |
T10270 |
49271-49284 |
NNS |
denotes |
keratinocytes |
T10271 |
49285-49286 |
-LRB- |
denotes |
[ |
T10272 |
49292-49294 |
CD |
denotes |
46 |
T10273 |
49286-49288 |
CD |
denotes |
44 |
T10274 |
49288-49289 |
, |
denotes |
, |
T10275 |
49289-49291 |
CD |
denotes |
45 |
T10276 |
49291-49292 |
, |
denotes |
, |
T10277 |
49294-49295 |
-RRB- |
denotes |
] |
T10278 |
49295-49296 |
. |
denotes |
. |
T10279 |
49296-49490 |
sentence |
denotes |
The prior identification of the Snail gene as a potential target of TGF-β signaling [15] was intriguing, given the temporal wave of Snail gene expression that occurs in the developing hair bud. |
T10280 |
49297-49300 |
DT |
denotes |
The |
T10281 |
49307-49321 |
NN |
denotes |
identification |
T10282 |
49301-49306 |
JJ |
denotes |
prior |
T10283 |
49386-49389 |
VBD |
denotes |
was |
T10284 |
49322-49324 |
IN |
denotes |
of |
T10285 |
49325-49328 |
DT |
denotes |
the |
T10286 |
49335-49339 |
NN |
denotes |
gene |
T10287 |
49329-49334 |
NN |
denotes |
Snail |
T10288 |
49340-49342 |
IN |
denotes |
as |
T10289 |
49343-49344 |
DT |
denotes |
a |
T10290 |
49355-49361 |
NN |
denotes |
target |
T10291 |
49345-49354 |
JJ |
denotes |
potential |
T10292 |
49362-49364 |
IN |
denotes |
of |
T10293 |
49365-49368 |
NN |
denotes |
TGF |
T10294 |
49369-49370 |
NN |
denotes |
β |
T10295 |
49368-49369 |
HYPH |
denotes |
- |
T10296 |
49371-49380 |
NN |
denotes |
signaling |
T10297 |
49381-49382 |
-LRB- |
denotes |
[ |
T10298 |
49382-49384 |
CD |
denotes |
15 |
T10299 |
49384-49385 |
-RRB- |
denotes |
] |
T10300 |
49390-49400 |
JJ |
denotes |
intriguing |
T10301 |
49400-49402 |
, |
denotes |
, |
T10302 |
49402-49407 |
VBN |
denotes |
given |
T10303 |
49408-49411 |
DT |
denotes |
the |
T10304 |
49421-49425 |
NN |
denotes |
wave |
T10305 |
49412-49420 |
JJ |
denotes |
temporal |
T10306 |
49426-49428 |
IN |
denotes |
of |
T10307 |
49429-49434 |
NN |
denotes |
Snail |
T10308 |
49440-49450 |
NN |
denotes |
expression |
T10309 |
49435-49439 |
NN |
denotes |
gene |
T10310 |
49451-49455 |
WDT |
denotes |
that |
T10311 |
49456-49462 |
VBZ |
denotes |
occurs |
T10312 |
49463-49465 |
IN |
denotes |
in |
T10313 |
49466-49469 |
DT |
denotes |
the |
T10314 |
49486-49489 |
NN |
denotes |
bud |
T10315 |
49470-49480 |
VBG |
denotes |
developing |
T10316 |
49481-49485 |
NN |
denotes |
hair |
T10317 |
49489-49490 |
. |
denotes |
. |
T10318 |
49490-49661 |
sentence |
denotes |
The additional correlation between epithelial hyperproliferation and Snail transgene expression further fostered our interest in a possible link between TGF-β2 and Snail. |
T10319 |
49491-49494 |
DT |
denotes |
The |
T10320 |
49506-49517 |
NN |
denotes |
correlation |
T10321 |
49495-49505 |
JJ |
denotes |
additional |
T10322 |
49595-49603 |
VBD |
denotes |
fostered |
T10323 |
49518-49525 |
IN |
denotes |
between |
T10324 |
49526-49536 |
JJ |
denotes |
epithelial |
T10325 |
49537-49555 |
NN |
denotes |
hyperproliferation |
T10326 |
49556-49559 |
CC |
denotes |
and |
T10327 |
49560-49565 |
NN |
denotes |
Snail |
T10328 |
49576-49586 |
NN |
denotes |
expression |
T10329 |
49566-49575 |
NN |
denotes |
transgene |
T10330 |
49587-49594 |
RB |
denotes |
further |
T10331 |
49604-49607 |
PRP$ |
denotes |
our |
T10332 |
49608-49616 |
NN |
denotes |
interest |
T10333 |
49617-49619 |
IN |
denotes |
in |
T10334 |
49620-49621 |
DT |
denotes |
a |
T10335 |
49631-49635 |
NN |
denotes |
link |
T10336 |
49622-49630 |
JJ |
denotes |
possible |
T10337 |
49636-49643 |
IN |
denotes |
between |
T10338 |
49644-49647 |
NN |
denotes |
TGF |
T10339 |
49648-49650 |
NN |
denotes |
β2 |
T10340 |
49647-49648 |
HYPH |
denotes |
- |
T10341 |
49651-49654 |
CC |
denotes |
and |
T10342 |
49655-49660 |
NN |
denotes |
Snail |
T10343 |
49660-49661 |
. |
denotes |
. |
T10344 |
49661-49839 |
sentence |
denotes |
Our functional studies demonstrate that without TGF-β2, Snail expression is abolished in the mutant hair buds, and conversely, in K14-Smad2 skin, Snail is ectopically activated. |
T10345 |
49662-49665 |
PRP$ |
denotes |
Our |
T10346 |
49677-49684 |
NNS |
denotes |
studies |
T10347 |
49666-49676 |
JJ |
denotes |
functional |
T10348 |
49685-49696 |
VBP |
denotes |
demonstrate |
T10349 |
49697-49701 |
IN |
denotes |
that |
T10350 |
49738-49747 |
VBN |
denotes |
abolished |
T10351 |
49702-49709 |
IN |
denotes |
without |
T10352 |
49710-49713 |
NN |
denotes |
TGF |
T10353 |
49714-49716 |
NN |
denotes |
β2 |
T10354 |
49713-49714 |
HYPH |
denotes |
- |
T10355 |
49716-49718 |
, |
denotes |
, |
T10356 |
49718-49723 |
NN |
denotes |
Snail |
T10357 |
49724-49734 |
NN |
denotes |
expression |
T10358 |
49735-49737 |
VBZ |
denotes |
is |
T10359 |
49748-49750 |
IN |
denotes |
in |
T10360 |
49751-49754 |
DT |
denotes |
the |
T10361 |
49767-49771 |
NNS |
denotes |
buds |
T10362 |
49755-49761 |
NN |
denotes |
mutant |
T10363 |
49762-49766 |
NN |
denotes |
hair |
T10364 |
49771-49773 |
, |
denotes |
, |
T10365 |
49773-49776 |
CC |
denotes |
and |
T10366 |
49777-49787 |
RB |
denotes |
conversely |
T10367 |
49829-49838 |
VBN |
denotes |
activated |
T10368 |
49787-49789 |
, |
denotes |
, |
T10369 |
49789-49791 |
IN |
denotes |
in |
T10370 |
49792-49795 |
NN |
denotes |
K14 |
T10371 |
49796-49801 |
NN |
denotes |
Smad2 |
T10372 |
49795-49796 |
HYPH |
denotes |
- |
T10373 |
49802-49806 |
NN |
denotes |
skin |
T10374 |
49806-49808 |
, |
denotes |
, |
T10375 |
49808-49813 |
NN |
denotes |
Snail |
T10376 |
49814-49816 |
VBZ |
denotes |
is |
T10377 |
49817-49828 |
RB |
denotes |
ectopically |
T10378 |
49838-49839 |
. |
denotes |
. |
T10379 |
49839-50070 |
sentence |
denotes |
Moreover, our in vitro studies indicate that even sustained TGF-β2 exposure may cause only a transient induction of Snail, offering a possible explanation as to why Snail is so briefly expressed during hair follicle morphogenesis. |
T10380 |
49840-49848 |
RB |
denotes |
Moreover |
T10381 |
49871-49879 |
VBP |
denotes |
indicate |
T10382 |
49848-49850 |
, |
denotes |
, |
T10383 |
49850-49853 |
PRP$ |
denotes |
our |
T10384 |
49863-49870 |
NNS |
denotes |
studies |
T10385 |
49854-49856 |
FW |
denotes |
in |
T10386 |
49857-49862 |
FW |
denotes |
vitro |
T10387 |
49880-49884 |
IN |
denotes |
that |
T10388 |
49920-49925 |
VB |
denotes |
cause |
T10389 |
49885-49889 |
RB |
denotes |
even |
T10390 |
49907-49915 |
NN |
denotes |
exposure |
T10391 |
49890-49899 |
JJ |
denotes |
sustained |
T10392 |
49900-49903 |
NN |
denotes |
TGF |
T10393 |
49904-49906 |
NN |
denotes |
β2 |
T10394 |
49903-49904 |
HYPH |
denotes |
- |
T10395 |
49916-49919 |
MD |
denotes |
may |
T10396 |
49926-49930 |
RB |
denotes |
only |
T10397 |
49943-49952 |
NN |
denotes |
induction |
T10398 |
49931-49932 |
DT |
denotes |
a |
T10399 |
49933-49942 |
JJ |
denotes |
transient |
T10400 |
49953-49955 |
IN |
denotes |
of |
T10401 |
49956-49961 |
NN |
denotes |
Snail |
T10402 |
49961-49963 |
, |
denotes |
, |
T10403 |
49963-49971 |
VBG |
denotes |
offering |
T10404 |
49972-49973 |
DT |
denotes |
a |
T10405 |
49983-49994 |
NN |
denotes |
explanation |
T10406 |
49974-49982 |
JJ |
denotes |
possible |
T10407 |
49995-49997 |
IN |
denotes |
as |
T10408 |
49998-50000 |
IN |
denotes |
to |
T10409 |
50001-50004 |
WRB |
denotes |
why |
T10410 |
50025-50034 |
VBN |
denotes |
expressed |
T10411 |
50005-50010 |
NN |
denotes |
Snail |
T10412 |
50011-50013 |
VBZ |
denotes |
is |
T10413 |
50014-50016 |
RB |
denotes |
so |
T10414 |
50017-50024 |
RB |
denotes |
briefly |
T10415 |
50035-50041 |
IN |
denotes |
during |
T10416 |
50042-50046 |
NN |
denotes |
hair |
T10417 |
50047-50055 |
NN |
denotes |
follicle |
T10418 |
50056-50069 |
NN |
denotes |
morphogenesis |
T10419 |
50069-50070 |
. |
denotes |
. |
T10420 |
50070-50387 |
sentence |
denotes |
An additional point worth mentioning is that prolonged expression of Tg Snail in postnatal skin resulted in morphological and biochemical signs of epithelial to mesenchymal transitions (unpublished data), underscoring why transient Snail expression may be so important during normal hair follicle morphogenesis [18]. |
T10421 |
50071-50073 |
DT |
denotes |
An |
T10422 |
50085-50090 |
NN |
denotes |
point |
T10423 |
50074-50084 |
JJ |
denotes |
additional |
T10424 |
50108-50110 |
VBZ |
denotes |
is |
T10425 |
50091-50096 |
JJ |
denotes |
worth |
T10426 |
50097-50107 |
VBG |
denotes |
mentioning |
T10427 |
50111-50115 |
IN |
denotes |
that |
T10428 |
50167-50175 |
VBD |
denotes |
resulted |
T10429 |
50116-50125 |
VBN |
denotes |
prolonged |
T10430 |
50126-50136 |
NN |
denotes |
expression |
T10431 |
50137-50139 |
IN |
denotes |
of |
T10432 |
50140-50142 |
NN |
denotes |
Tg |
T10433 |
50143-50148 |
NN |
denotes |
Snail |
T10434 |
50149-50151 |
IN |
denotes |
in |
T10435 |
50152-50161 |
JJ |
denotes |
postnatal |
T10436 |
50162-50166 |
NN |
denotes |
skin |
T10437 |
50176-50178 |
IN |
denotes |
in |
T10438 |
50179-50192 |
JJ |
denotes |
morphological |
T10439 |
50209-50214 |
NNS |
denotes |
signs |
T10440 |
50193-50196 |
CC |
denotes |
and |
T10441 |
50197-50208 |
JJ |
denotes |
biochemical |
T10442 |
50215-50217 |
IN |
denotes |
of |
T10443 |
50218-50228 |
JJ |
denotes |
epithelial |
T10444 |
50244-50255 |
NNS |
denotes |
transitions |
T10445 |
50229-50231 |
IN |
denotes |
to |
T10446 |
50232-50243 |
JJ |
denotes |
mesenchymal |
T10447 |
50256-50257 |
-LRB- |
denotes |
( |
T10448 |
50269-50273 |
NNS |
denotes |
data |
T10449 |
50257-50268 |
JJ |
denotes |
unpublished |
T10450 |
50273-50274 |
-RRB- |
denotes |
) |
T10451 |
50274-50276 |
, |
denotes |
, |
T10452 |
50276-50288 |
VBG |
denotes |
underscoring |
T10453 |
50289-50292 |
WRB |
denotes |
why |
T10454 |
50324-50326 |
VB |
denotes |
be |
T10455 |
50293-50302 |
JJ |
denotes |
transient |
T10456 |
50309-50319 |
NN |
denotes |
expression |
T10457 |
50303-50308 |
NN |
denotes |
Snail |
T10458 |
50320-50323 |
MD |
denotes |
may |
T10459 |
50327-50329 |
RB |
denotes |
so |
T10460 |
50330-50339 |
JJ |
denotes |
important |
T10461 |
50340-50346 |
IN |
denotes |
during |
T10462 |
50347-50353 |
JJ |
denotes |
normal |
T10463 |
50368-50381 |
NN |
denotes |
morphogenesis |
T10464 |
50354-50358 |
NN |
denotes |
hair |
T10465 |
50359-50367 |
NN |
denotes |
follicle |
T10466 |
50382-50383 |
-LRB- |
denotes |
[ |
T10467 |
50383-50385 |
CD |
denotes |
18 |
T10468 |
50385-50386 |
-RRB- |
denotes |
] |
T10469 |
50386-50387 |
. |
denotes |
. |
T10470 |
50387-50520 |
sentence |
denotes |
At first glance, the sparsity in hair coat of K14-Snail Tg mice seemed indicative of a defect in follicle formation (see Figure 2A). |
T10471 |
50388-50390 |
IN |
denotes |
At |
T10472 |
50452-50458 |
VBD |
denotes |
seemed |
T10473 |
50391-50396 |
JJ |
denotes |
first |
T10474 |
50397-50403 |
NN |
denotes |
glance |
T10475 |
50403-50405 |
, |
denotes |
, |
T10476 |
50405-50408 |
DT |
denotes |
the |
T10477 |
50409-50417 |
NN |
denotes |
sparsity |
T10478 |
50418-50420 |
IN |
denotes |
in |
T10479 |
50421-50425 |
NN |
denotes |
hair |
T10480 |
50426-50430 |
NN |
denotes |
coat |
T10481 |
50431-50433 |
IN |
denotes |
of |
T10482 |
50434-50437 |
NN |
denotes |
K14 |
T10483 |
50438-50443 |
NN |
denotes |
Snail |
T10484 |
50437-50438 |
HYPH |
denotes |
- |
T10485 |
50447-50451 |
NNS |
denotes |
mice |
T10486 |
50444-50446 |
NN |
denotes |
Tg |
T10487 |
50459-50469 |
JJ |
denotes |
indicative |
T10488 |
50470-50472 |
IN |
denotes |
of |
T10489 |
50473-50474 |
DT |
denotes |
a |
T10490 |
50475-50481 |
NN |
denotes |
defect |
T10491 |
50482-50484 |
IN |
denotes |
in |
T10492 |
50485-50493 |
NN |
denotes |
follicle |
T10493 |
50494-50503 |
NN |
denotes |
formation |
T10494 |
50504-50505 |
-LRB- |
denotes |
( |
T10495 |
50505-50508 |
VB |
denotes |
see |
T10496 |
50509-50515 |
NN |
denotes |
Figure |
T10497 |
50516-50518 |
NN |
denotes |
2A |
T10498 |
50518-50519 |
-RRB- |
denotes |
) |
T10499 |
50519-50520 |
. |
denotes |
. |
T10500 |
50520-50620 |
sentence |
denotes |
Closer inspection, however, revealed that not all hairs penetrated the hyperthickened Tg epidermis. |
T10501 |
50521-50527 |
JJR |
denotes |
Closer |
T10502 |
50528-50538 |
NN |
denotes |
inspection |
T10503 |
50549-50557 |
VBD |
denotes |
revealed |
T10504 |
50538-50540 |
, |
denotes |
, |
T10505 |
50540-50547 |
RB |
denotes |
however |
T10506 |
50547-50549 |
, |
denotes |
, |
T10507 |
50558-50562 |
IN |
denotes |
that |
T10508 |
50577-50587 |
VBD |
denotes |
penetrated |
T10509 |
50563-50566 |
RB |
denotes |
not |
T10510 |
50571-50576 |
NNS |
denotes |
hairs |
T10511 |
50567-50570 |
DT |
denotes |
all |
T10512 |
50588-50591 |
DT |
denotes |
the |
T10513 |
50610-50619 |
NN |
denotes |
epidermis |
T10514 |
50592-50606 |
VBN |
denotes |
hyperthickened |
T10515 |
50607-50609 |
NN |
denotes |
Tg |
T10516 |
50619-50620 |
. |
denotes |
. |
T10517 |
50620-50711 |
sentence |
denotes |
Several factors may contribute to the seemingly normal follicle development in these mice. |
T10518 |
50621-50628 |
JJ |
denotes |
Several |
T10519 |
50629-50636 |
NNS |
denotes |
factors |
T10520 |
50641-50651 |
VB |
denotes |
contribute |
T10521 |
50637-50640 |
MD |
denotes |
may |
T10522 |
50652-50654 |
IN |
denotes |
to |
T10523 |
50655-50658 |
DT |
denotes |
the |
T10524 |
50685-50696 |
NN |
denotes |
development |
T10525 |
50659-50668 |
RB |
denotes |
seemingly |
T10526 |
50669-50675 |
JJ |
denotes |
normal |
T10527 |
50676-50684 |
NN |
denotes |
follicle |
T10528 |
50697-50699 |
IN |
denotes |
in |
T10529 |
50700-50705 |
DT |
denotes |
these |
T10530 |
50706-50710 |
NNS |
denotes |
mice |
T10531 |
50710-50711 |
. |
denotes |
. |
T10532 |
50711-50975 |
sentence |
denotes |
One obvious factor is the K14 promoter, which is elevated in the basal layer of the epidermis and the outer root sheath (ORS) of the hair follicle, but is markedly down-regulated in developing embryonic hair buds as well as in the postnatal hair progenitor cells. |
T10533 |
50712-50715 |
CD |
denotes |
One |
T10534 |
50724-50730 |
NN |
denotes |
factor |
T10535 |
50716-50723 |
JJ |
denotes |
obvious |
T10536 |
50731-50733 |
VBZ |
denotes |
is |
T10537 |
50734-50737 |
DT |
denotes |
the |
T10538 |
50742-50750 |
NN |
denotes |
promoter |
T10539 |
50738-50741 |
NN |
denotes |
K14 |
T10540 |
50750-50752 |
, |
denotes |
, |
T10541 |
50752-50757 |
WDT |
denotes |
which |
T10542 |
50758-50760 |
VBZ |
denotes |
is |
T10543 |
50761-50769 |
JJ |
denotes |
elevated |
T10544 |
50770-50772 |
IN |
denotes |
in |
T10545 |
50773-50776 |
DT |
denotes |
the |
T10546 |
50783-50788 |
NN |
denotes |
layer |
T10547 |
50777-50782 |
JJ |
denotes |
basal |
T10548 |
50789-50791 |
IN |
denotes |
of |
T10549 |
50792-50795 |
DT |
denotes |
the |
T10550 |
50796-50805 |
NN |
denotes |
epidermis |
T10551 |
50806-50809 |
CC |
denotes |
and |
T10552 |
50810-50813 |
DT |
denotes |
the |
T10553 |
50825-50831 |
NN |
denotes |
sheath |
T10554 |
50814-50819 |
JJ |
denotes |
outer |
T10555 |
50820-50824 |
NN |
denotes |
root |
T10556 |
50832-50833 |
-LRB- |
denotes |
( |
T10557 |
50833-50836 |
NN |
denotes |
ORS |
T10558 |
50836-50837 |
-RRB- |
denotes |
) |
T10559 |
50838-50840 |
IN |
denotes |
of |
T10560 |
50841-50844 |
DT |
denotes |
the |
T10561 |
50850-50858 |
NN |
denotes |
follicle |
T10562 |
50845-50849 |
NN |
denotes |
hair |
T10563 |
50858-50860 |
, |
denotes |
, |
T10564 |
50860-50863 |
CC |
denotes |
but |
T10565 |
50864-50866 |
VBZ |
denotes |
is |
T10566 |
50881-50890 |
VBN |
denotes |
regulated |
T10567 |
50867-50875 |
RB |
denotes |
markedly |
T10568 |
50876-50880 |
RB |
denotes |
down |
T10569 |
50880-50881 |
HYPH |
denotes |
- |
T10570 |
50891-50893 |
IN |
denotes |
in |
T10571 |
50894-50904 |
JJ |
denotes |
developing |
T10572 |
50920-50924 |
NNS |
denotes |
buds |
T10573 |
50905-50914 |
JJ |
denotes |
embryonic |
T10574 |
50915-50919 |
NN |
denotes |
hair |
T10575 |
50925-50927 |
RB |
denotes |
as |
T10576 |
50933-50935 |
IN |
denotes |
as |
T10577 |
50928-50932 |
RB |
denotes |
well |
T10578 |
50936-50938 |
IN |
denotes |
in |
T10579 |
50939-50942 |
DT |
denotes |
the |
T10580 |
50969-50974 |
NNS |
denotes |
cells |
T10581 |
50943-50952 |
JJ |
denotes |
postnatal |
T10582 |
50953-50957 |
NN |
denotes |
hair |
T10583 |
50958-50968 |
NN |
denotes |
progenitor |
T10584 |
50974-50975 |
. |
denotes |
. |
T10585 |
50975-51135 |
sentence |
denotes |
The K14 promoter is also less active in the ORS than epidermis and hence this might also account for the lack of apparent response of the ORS to ectopic Snail. |
T10586 |
50976-50979 |
DT |
denotes |
The |
T10587 |
50984-50992 |
NN |
denotes |
promoter |
T10588 |
50980-50983 |
NN |
denotes |
K14 |
T10589 |
50993-50995 |
VBZ |
denotes |
is |
T10590 |
50996-51000 |
RB |
denotes |
also |
T10591 |
51001-51005 |
RBR |
denotes |
less |
T10592 |
51006-51012 |
JJ |
denotes |
active |
T10593 |
51013-51015 |
IN |
denotes |
in |
T10594 |
51016-51019 |
DT |
denotes |
the |
T10595 |
51020-51023 |
NN |
denotes |
ORS |
T10596 |
51024-51028 |
IN |
denotes |
than |
T10597 |
51029-51038 |
NN |
denotes |
epidermis |
T10598 |
51039-51042 |
CC |
denotes |
and |
T10599 |
51043-51048 |
RB |
denotes |
hence |
T10600 |
51065-51072 |
VB |
denotes |
account |
T10601 |
51049-51053 |
DT |
denotes |
this |
T10602 |
51054-51059 |
MD |
denotes |
might |
T10603 |
51060-51064 |
RB |
denotes |
also |
T10604 |
51073-51076 |
IN |
denotes |
for |
T10605 |
51077-51080 |
DT |
denotes |
the |
T10606 |
51081-51085 |
NN |
denotes |
lack |
T10607 |
51086-51088 |
IN |
denotes |
of |
T10608 |
51089-51097 |
JJ |
denotes |
apparent |
T10609 |
51098-51106 |
NN |
denotes |
response |
T10610 |
51107-51109 |
IN |
denotes |
of |
T10611 |
51110-51113 |
DT |
denotes |
the |
T10612 |
51114-51117 |
NN |
denotes |
ORS |
T10613 |
51118-51120 |
IN |
denotes |
to |
T10614 |
51121-51128 |
JJ |
denotes |
ectopic |
T10615 |
51129-51134 |
NN |
denotes |
Snail |
T10616 |
51134-51135 |
. |
denotes |
. |
T10617 |
51135-51386 |
sentence |
denotes |
Additional contributing factors could be the multiplicity of Snail family members and their differential expression, the saturation, and/or diversity of regulatory mechanisms that govern AJ formation, migration, and proliferation in the follicle ORS. |
T10618 |
51136-51146 |
JJ |
denotes |
Additional |
T10619 |
51160-51167 |
NNS |
denotes |
factors |
T10620 |
51147-51159 |
VBG |
denotes |
contributing |
T10621 |
51174-51176 |
VB |
denotes |
be |
T10622 |
51168-51173 |
MD |
denotes |
could |
T10623 |
51177-51180 |
DT |
denotes |
the |
T10624 |
51181-51193 |
NN |
denotes |
multiplicity |
T10625 |
51194-51196 |
IN |
denotes |
of |
T10626 |
51197-51202 |
NN |
denotes |
Snail |
T10627 |
51210-51217 |
NNS |
denotes |
members |
T10628 |
51203-51209 |
NN |
denotes |
family |
T10629 |
51218-51221 |
CC |
denotes |
and |
T10630 |
51222-51227 |
PRP$ |
denotes |
their |
T10631 |
51241-51251 |
NN |
denotes |
expression |
T10632 |
51228-51240 |
JJ |
denotes |
differential |
T10633 |
51251-51253 |
, |
denotes |
, |
T10634 |
51253-51256 |
DT |
denotes |
the |
T10635 |
51257-51267 |
NN |
denotes |
saturation |
T10636 |
51267-51269 |
, |
denotes |
, |
T10637 |
51269-51272 |
CC |
denotes |
and |
T10638 |
51272-51273 |
HYPH |
denotes |
/ |
T10639 |
51273-51275 |
CC |
denotes |
or |
T10640 |
51276-51285 |
NN |
denotes |
diversity |
T10641 |
51286-51288 |
IN |
denotes |
of |
T10642 |
51289-51299 |
JJ |
denotes |
regulatory |
T10643 |
51300-51310 |
NNS |
denotes |
mechanisms |
T10644 |
51311-51315 |
WDT |
denotes |
that |
T10645 |
51316-51322 |
VBP |
denotes |
govern |
T10646 |
51323-51325 |
NN |
denotes |
AJ |
T10647 |
51326-51335 |
NN |
denotes |
formation |
T10648 |
51335-51337 |
, |
denotes |
, |
T10649 |
51337-51346 |
NN |
denotes |
migration |
T10650 |
51346-51348 |
, |
denotes |
, |
T10651 |
51348-51351 |
CC |
denotes |
and |
T10652 |
51352-51365 |
NN |
denotes |
proliferation |
T10653 |
51366-51368 |
IN |
denotes |
in |
T10654 |
51369-51372 |
DT |
denotes |
the |
T10655 |
51382-51385 |
NN |
denotes |
ORS |
T10656 |
51373-51381 |
NN |
denotes |
follicle |
T10657 |
51385-51386 |
. |
denotes |
. |
T10658 |
51386-51521 |
sentence |
denotes |
Distinguishing between these possibilities must await the generation of mice harboring skin-specific loss-of-function Snail mutations. |
T10659 |
51387-51401 |
VBG |
denotes |
Distinguishing |
T10660 |
51435-51440 |
VB |
denotes |
await |
T10661 |
51402-51409 |
IN |
denotes |
between |
T10662 |
51410-51415 |
DT |
denotes |
these |
T10663 |
51416-51429 |
NNS |
denotes |
possibilities |
T10664 |
51430-51434 |
MD |
denotes |
must |
T10665 |
51441-51444 |
DT |
denotes |
the |
T10666 |
51445-51455 |
NN |
denotes |
generation |
T10667 |
51456-51458 |
IN |
denotes |
of |
T10668 |
51459-51463 |
NNS |
denotes |
mice |
T10669 |
51464-51473 |
VBG |
denotes |
harboring |
T10670 |
51474-51478 |
NN |
denotes |
skin |
T10671 |
51479-51487 |
JJ |
denotes |
specific |
T10672 |
51478-51479 |
HYPH |
denotes |
- |
T10673 |
51511-51520 |
NNS |
denotes |
mutations |
T10674 |
51488-51492 |
NN |
denotes |
loss |
T10675 |
51492-51493 |
HYPH |
denotes |
- |
T10676 |
51493-51495 |
IN |
denotes |
of |
T10677 |
51495-51496 |
HYPH |
denotes |
- |
T10678 |
51496-51504 |
NN |
denotes |
function |
T10679 |
51505-51510 |
NN |
denotes |
Snail |
T10680 |
51520-51521 |
. |
denotes |
. |
T11057 |
51523-51528 |
NNS |
denotes |
Links |
T11058 |
51529-51536 |
IN |
denotes |
between |
T11059 |
51537-51546 |
NN |
denotes |
Signaling |
T11060 |
51546-51548 |
, |
denotes |
, |
T11061 |
51548-51563 |
JJ |
denotes |
Transcriptional |
T11062 |
51564-51572 |
NNS |
denotes |
Cascades |
T11063 |
51572-51574 |
, |
denotes |
, |
T11064 |
51574-51584 |
JJ |
denotes |
Epithelial |
T11065 |
51585-51595 |
NN |
denotes |
Remodeling |
T11066 |
51595-51597 |
, |
denotes |
, |
T11067 |
51597-51600 |
CC |
denotes |
and |
T11068 |
51601-51614 |
NN |
denotes |
Proliferation |
T11069 |
51615-51617 |
IN |
denotes |
in |
T11070 |
51618-51621 |
DT |
denotes |
the |
T11071 |
51627-51630 |
NN |
denotes |
Bud |
T11072 |
51622-51626 |
NN |
denotes |
Hair |
T11073 |
51630-51827 |
sentence |
denotes |
Previously, we discovered that early during hair follicle morphogenesis, E-cadherin gene expression is down-regulated concomitantly with the invagination of developing bud cells into the skin [4]. |
T11074 |
51631-51641 |
RB |
denotes |
Previously |
T11075 |
51646-51656 |
VBD |
denotes |
discovered |
T11076 |
51641-51643 |
, |
denotes |
, |
T11077 |
51643-51645 |
PRP |
denotes |
we |
T11078 |
51657-51661 |
IN |
denotes |
that |
T11079 |
51739-51748 |
VBN |
denotes |
regulated |
T11080 |
51662-51667 |
RB |
denotes |
early |
T11081 |
51668-51674 |
IN |
denotes |
during |
T11082 |
51675-51679 |
NN |
denotes |
hair |
T11083 |
51680-51688 |
NN |
denotes |
follicle |
T11084 |
51689-51702 |
NN |
denotes |
morphogenesis |
T11085 |
51702-51704 |
, |
denotes |
, |
T11086 |
51704-51705 |
NN |
denotes |
E |
T11087 |
51706-51714 |
NN |
denotes |
cadherin |
T11088 |
51705-51706 |
HYPH |
denotes |
- |
T11089 |
51720-51730 |
NN |
denotes |
expression |
T11090 |
51715-51719 |
NN |
denotes |
gene |
T11091 |
51731-51733 |
VBZ |
denotes |
is |
T11092 |
51734-51738 |
RB |
denotes |
down |
T11093 |
51738-51739 |
HYPH |
denotes |
- |
T11094 |
51749-51762 |
RB |
denotes |
concomitantly |
T11095 |
51763-51767 |
IN |
denotes |
with |
T11096 |
51768-51771 |
DT |
denotes |
the |
T11097 |
51772-51784 |
NN |
denotes |
invagination |
T11098 |
51785-51787 |
IN |
denotes |
of |
T11099 |
51788-51798 |
JJ |
denotes |
developing |
T11100 |
51803-51808 |
NNS |
denotes |
cells |
T11101 |
51799-51802 |
NN |
denotes |
bud |
T11102 |
51809-51813 |
IN |
denotes |
into |
T11103 |
51814-51817 |
DT |
denotes |
the |
T11104 |
51818-51822 |
NN |
denotes |
skin |
T11105 |
51823-51824 |
-LRB- |
denotes |
[ |
T11106 |
51824-51825 |
CD |
denotes |
4 |
T11107 |
51825-51826 |
-RRB- |
denotes |
] |
T11108 |
51826-51827 |
. |
denotes |
. |
T11109 |
51827-52046 |
sentence |
denotes |
Because the timing of this event correlated with the activation of a LEF-1/β-catenin transcription factor complex [20], we were intrigued by the presence of a putative LEF-1/TCF binding site in the E-cadherin promoter. |
T11110 |
51828-51835 |
IN |
denotes |
Because |
T11111 |
51861-51871 |
VBD |
denotes |
correlated |
T11112 |
51836-51839 |
DT |
denotes |
the |
T11113 |
51840-51846 |
NN |
denotes |
timing |
T11114 |
51847-51849 |
IN |
denotes |
of |
T11115 |
51850-51854 |
DT |
denotes |
this |
T11116 |
51855-51860 |
NN |
denotes |
event |
T11117 |
51956-51965 |
VBN |
denotes |
intrigued |
T11118 |
51872-51876 |
IN |
denotes |
with |
T11119 |
51877-51880 |
DT |
denotes |
the |
T11120 |
51881-51891 |
NN |
denotes |
activation |
T11121 |
51892-51894 |
IN |
denotes |
of |
T11122 |
51895-51896 |
DT |
denotes |
a |
T11123 |
51934-51941 |
NN |
denotes |
complex |
T11124 |
51897-51900 |
NN |
denotes |
LEF |
T11125 |
51927-51933 |
NN |
denotes |
factor |
T11126 |
51900-51901 |
HYPH |
denotes |
- |
T11127 |
51901-51902 |
CD |
denotes |
1 |
T11128 |
51902-51903 |
HYPH |
denotes |
/ |
T11129 |
51903-51904 |
NN |
denotes |
β |
T11130 |
51905-51912 |
NN |
denotes |
catenin |
T11131 |
51904-51905 |
HYPH |
denotes |
- |
T11132 |
51913-51926 |
NN |
denotes |
transcription |
T11133 |
51942-51943 |
-LRB- |
denotes |
[ |
T11134 |
51943-51945 |
CD |
denotes |
20 |
T11135 |
51945-51946 |
-RRB- |
denotes |
] |
T11136 |
51946-51948 |
, |
denotes |
, |
T11137 |
51948-51950 |
PRP |
denotes |
we |
T11138 |
51951-51955 |
VBD |
denotes |
were |
T11139 |
51966-51968 |
IN |
denotes |
by |
T11140 |
51969-51972 |
DT |
denotes |
the |
T11141 |
51973-51981 |
NN |
denotes |
presence |
T11142 |
51982-51984 |
IN |
denotes |
of |
T11143 |
51985-51986 |
DT |
denotes |
a |
T11144 |
52014-52018 |
NN |
denotes |
site |
T11145 |
51987-51995 |
JJ |
denotes |
putative |
T11146 |
51996-51999 |
NN |
denotes |
LEF |
T11147 |
51999-52000 |
HYPH |
denotes |
- |
T11148 |
52000-52001 |
CD |
denotes |
1 |
T11149 |
52001-52002 |
HYPH |
denotes |
/ |
T11150 |
52002-52005 |
NN |
denotes |
TCF |
T11151 |
52006-52013 |
NN |
denotes |
binding |
T11152 |
52019-52021 |
IN |
denotes |
in |
T11153 |
52022-52025 |
DT |
denotes |
the |
T11154 |
52037-52045 |
NN |
denotes |
promoter |
T11155 |
52026-52027 |
NN |
denotes |
E |
T11156 |
52028-52036 |
NN |
denotes |
cadherin |
T11157 |
52027-52028 |
HYPH |
denotes |
- |
T11158 |
52045-52046 |
. |
denotes |
. |
T11159 |
52046-52223 |
sentence |
denotes |
This prompted an investigation that subsequently led to our discovery that LEF-1/β-catenin can contribute to repression of E-cadherin gene expression in skin keratinocytes [4]. |
T11160 |
52047-52051 |
DT |
denotes |
This |
T11161 |
52052-52060 |
VBD |
denotes |
prompted |
T11162 |
52061-52063 |
DT |
denotes |
an |
T11163 |
52064-52077 |
NN |
denotes |
investigation |
T11164 |
52078-52082 |
WDT |
denotes |
that |
T11165 |
52096-52099 |
VBD |
denotes |
led |
T11166 |
52083-52095 |
RB |
denotes |
subsequently |
T11167 |
52100-52102 |
IN |
denotes |
to |
T11168 |
52103-52106 |
PRP$ |
denotes |
our |
T11169 |
52107-52116 |
NN |
denotes |
discovery |
T11170 |
52117-52121 |
IN |
denotes |
that |
T11171 |
52142-52152 |
VB |
denotes |
contribute |
T11172 |
52122-52125 |
NN |
denotes |
LEF |
T11173 |
52125-52126 |
HYPH |
denotes |
- |
T11174 |
52126-52127 |
CD |
denotes |
1 |
T11175 |
52127-52128 |
HYPH |
denotes |
/ |
T11176 |
52128-52129 |
NN |
denotes |
β |
T11177 |
52130-52137 |
NN |
denotes |
catenin |
T11178 |
52129-52130 |
HYPH |
denotes |
- |
T11179 |
52138-52141 |
MD |
denotes |
can |
T11180 |
52153-52155 |
IN |
denotes |
to |
T11181 |
52156-52166 |
NN |
denotes |
repression |
T11182 |
52167-52169 |
IN |
denotes |
of |
T11183 |
52170-52171 |
NN |
denotes |
E |
T11184 |
52172-52180 |
NN |
denotes |
cadherin |
T11185 |
52171-52172 |
HYPH |
denotes |
- |
T11186 |
52186-52196 |
NN |
denotes |
expression |
T11187 |
52181-52185 |
NN |
denotes |
gene |
T11188 |
52197-52199 |
IN |
denotes |
in |
T11189 |
52200-52204 |
NN |
denotes |
skin |
T11190 |
52205-52218 |
NNS |
denotes |
keratinocytes |
T11191 |
52219-52220 |
-LRB- |
denotes |
[ |
T11192 |
52220-52221 |
CD |
denotes |
4 |
T11193 |
52221-52222 |
-RRB- |
denotes |
] |
T11194 |
52222-52223 |
. |
denotes |
. |
T11195 |
52223-52475 |
sentence |
denotes |
In the course of these studies, we also noted that Snail can also contribute to this process in keratinocytes in vitro, and our present studies revealed that Snail is expressed at the right place and time to be physiologically relevant in the process. |
T11196 |
52224-52226 |
IN |
denotes |
In |
T11197 |
52264-52269 |
VBD |
denotes |
noted |
T11198 |
52227-52230 |
DT |
denotes |
the |
T11199 |
52231-52237 |
NN |
denotes |
course |
T11200 |
52238-52240 |
IN |
denotes |
of |
T11201 |
52241-52246 |
DT |
denotes |
these |
T11202 |
52247-52254 |
NNS |
denotes |
studies |
T11203 |
52254-52256 |
, |
denotes |
, |
T11204 |
52256-52258 |
PRP |
denotes |
we |
T11205 |
52259-52263 |
RB |
denotes |
also |
T11206 |
52270-52274 |
IN |
denotes |
that |
T11207 |
52290-52300 |
VB |
denotes |
contribute |
T11208 |
52275-52280 |
NN |
denotes |
Snail |
T11209 |
52281-52284 |
MD |
denotes |
can |
T11210 |
52285-52289 |
RB |
denotes |
also |
T11211 |
52301-52303 |
IN |
denotes |
to |
T11212 |
52304-52308 |
DT |
denotes |
this |
T11213 |
52309-52316 |
NN |
denotes |
process |
T11214 |
52317-52319 |
IN |
denotes |
in |
T11215 |
52320-52333 |
NNS |
denotes |
keratinocytes |
T11216 |
52334-52336 |
FW |
denotes |
in |
T11217 |
52337-52342 |
FW |
denotes |
vitro |
T11218 |
52342-52344 |
, |
denotes |
, |
T11219 |
52344-52347 |
CC |
denotes |
and |
T11220 |
52348-52351 |
PRP$ |
denotes |
our |
T11221 |
52360-52367 |
NNS |
denotes |
studies |
T11222 |
52352-52359 |
JJ |
denotes |
present |
T11223 |
52368-52376 |
VBD |
denotes |
revealed |
T11224 |
52377-52381 |
IN |
denotes |
that |
T11225 |
52391-52400 |
VBN |
denotes |
expressed |
T11226 |
52382-52387 |
NN |
denotes |
Snail |
T11227 |
52388-52390 |
VBZ |
denotes |
is |
T11228 |
52401-52403 |
IN |
denotes |
at |
T11229 |
52404-52407 |
DT |
denotes |
the |
T11230 |
52414-52419 |
NN |
denotes |
place |
T11231 |
52408-52413 |
JJ |
denotes |
right |
T11232 |
52420-52423 |
CC |
denotes |
and |
T11233 |
52424-52428 |
NN |
denotes |
time |
T11234 |
52429-52431 |
TO |
denotes |
to |
T11235 |
52432-52434 |
VB |
denotes |
be |
T11236 |
52435-52450 |
RB |
denotes |
physiologically |
T11237 |
52451-52459 |
JJ |
denotes |
relevant |
T11238 |
52460-52462 |
IN |
denotes |
in |
T11239 |
52463-52466 |
DT |
denotes |
the |
T11240 |
52467-52474 |
NN |
denotes |
process |
T11241 |
52474-52475 |
. |
denotes |
. |
T11242 |
52475-52627 |
sentence |
denotes |
In noggin-null embryonic skin, LEF-1 expression and subsequent activation of the LEF-1/β-catenin reporter gene is abrogated in the developing placodes. |
T11243 |
52476-52478 |
IN |
denotes |
In |
T11244 |
52590-52599 |
VBN |
denotes |
abrogated |
T11245 |
52479-52485 |
NN |
denotes |
noggin |
T11246 |
52486-52490 |
JJ |
denotes |
null |
T11247 |
52485-52486 |
HYPH |
denotes |
- |
T11248 |
52501-52505 |
NN |
denotes |
skin |
T11249 |
52491-52500 |
JJ |
denotes |
embryonic |
T11250 |
52505-52507 |
, |
denotes |
, |
T11251 |
52507-52510 |
NN |
denotes |
LEF |
T11252 |
52513-52523 |
NN |
denotes |
expression |
T11253 |
52510-52511 |
HYPH |
denotes |
- |
T11254 |
52511-52512 |
CD |
denotes |
1 |
T11255 |
52524-52527 |
CC |
denotes |
and |
T11256 |
52528-52538 |
JJ |
denotes |
subsequent |
T11257 |
52539-52549 |
NN |
denotes |
activation |
T11258 |
52550-52552 |
IN |
denotes |
of |
T11259 |
52553-52556 |
DT |
denotes |
the |
T11260 |
52582-52586 |
NN |
denotes |
gene |
T11261 |
52557-52560 |
NN |
denotes |
LEF |
T11262 |
52560-52561 |
HYPH |
denotes |
- |
T11263 |
52561-52562 |
CD |
denotes |
1 |
T11264 |
52562-52563 |
HYPH |
denotes |
/ |
T11265 |
52563-52564 |
NN |
denotes |
β |
T11266 |
52565-52572 |
NN |
denotes |
catenin |
T11267 |
52564-52565 |
HYPH |
denotes |
- |
T11268 |
52573-52581 |
NN |
denotes |
reporter |
T11269 |
52587-52589 |
VBZ |
denotes |
is |
T11270 |
52600-52602 |
IN |
denotes |
in |
T11271 |
52603-52606 |
DT |
denotes |
the |
T11272 |
52618-52626 |
NNS |
denotes |
placodes |
T11273 |
52607-52617 |
VBG |
denotes |
developing |
T11274 |
52626-52627 |
. |
denotes |
. |
T11275 |
52627-52790 |
sentence |
denotes |
The corresponding failure of E-cadherin down-regulation underscores the importance of Wnt/noggin signaling in regulating this event in follicle morphogenesis [4]. |
T11276 |
52628-52631 |
DT |
denotes |
The |
T11277 |
52646-52653 |
NN |
denotes |
failure |
T11278 |
52632-52645 |
VBG |
denotes |
corresponding |
T11279 |
52684-52695 |
VBZ |
denotes |
underscores |
T11280 |
52654-52656 |
IN |
denotes |
of |
T11281 |
52657-52658 |
NN |
denotes |
E |
T11282 |
52659-52667 |
NN |
denotes |
cadherin |
T11283 |
52658-52659 |
HYPH |
denotes |
- |
T11284 |
52673-52683 |
NN |
denotes |
regulation |
T11285 |
52668-52672 |
JJ |
denotes |
down |
T11286 |
52672-52673 |
HYPH |
denotes |
- |
T11287 |
52696-52699 |
DT |
denotes |
the |
T11288 |
52700-52710 |
NN |
denotes |
importance |
T11289 |
52711-52713 |
IN |
denotes |
of |
T11290 |
52714-52717 |
NN |
denotes |
Wnt |
T11291 |
52718-52724 |
NN |
denotes |
noggin |
T11292 |
52717-52718 |
HYPH |
denotes |
/ |
T11293 |
52725-52734 |
NN |
denotes |
signaling |
T11294 |
52735-52737 |
IN |
denotes |
in |
T11295 |
52738-52748 |
VBG |
denotes |
regulating |
T11296 |
52749-52753 |
DT |
denotes |
this |
T11297 |
52754-52759 |
NN |
denotes |
event |
T11298 |
52760-52762 |
IN |
denotes |
in |
T11299 |
52763-52771 |
NN |
denotes |
follicle |
T11300 |
52772-52785 |
NN |
denotes |
morphogenesis |
T11301 |
52786-52787 |
-LRB- |
denotes |
[ |
T11302 |
52787-52788 |
CD |
denotes |
4 |
T11303 |
52788-52789 |
-RRB- |
denotes |
] |
T11304 |
52789-52790 |
. |
denotes |
. |
T11305 |
52790-52993 |
sentence |
denotes |
Conditional gene targeting studies will be necessary to establish whether Snail family members also contribute to the down-regulation in E-cadherin gene expression that occurs during follicle formation. |
T11306 |
52791-52802 |
JJ |
denotes |
Conditional |
T11307 |
52818-52825 |
NNS |
denotes |
studies |
T11308 |
52803-52807 |
NN |
denotes |
gene |
T11309 |
52808-52817 |
NN |
denotes |
targeting |
T11310 |
52831-52833 |
VB |
denotes |
be |
T11311 |
52826-52830 |
MD |
denotes |
will |
T11312 |
52834-52843 |
JJ |
denotes |
necessary |
T11313 |
52844-52846 |
TO |
denotes |
to |
T11314 |
52847-52856 |
VB |
denotes |
establish |
T11315 |
52857-52864 |
IN |
denotes |
whether |
T11316 |
52891-52901 |
VBP |
denotes |
contribute |
T11317 |
52865-52870 |
NN |
denotes |
Snail |
T11318 |
52878-52885 |
NNS |
denotes |
members |
T11319 |
52871-52877 |
NN |
denotes |
family |
T11320 |
52886-52890 |
RB |
denotes |
also |
T11321 |
52902-52904 |
IN |
denotes |
to |
T11322 |
52905-52908 |
DT |
denotes |
the |
T11323 |
52914-52924 |
NN |
denotes |
regulation |
T11324 |
52909-52913 |
JJ |
denotes |
down |
T11325 |
52913-52914 |
HYPH |
denotes |
- |
T11326 |
52925-52927 |
IN |
denotes |
in |
T11327 |
52928-52929 |
NN |
denotes |
E |
T11328 |
52930-52938 |
NN |
denotes |
cadherin |
T11329 |
52929-52930 |
HYPH |
denotes |
- |
T11330 |
52944-52954 |
NN |
denotes |
expression |
T11331 |
52939-52943 |
NN |
denotes |
gene |
T11332 |
52955-52959 |
WDT |
denotes |
that |
T11333 |
52960-52966 |
VBZ |
denotes |
occurs |
T11334 |
52967-52973 |
IN |
denotes |
during |
T11335 |
52974-52982 |
NN |
denotes |
follicle |
T11336 |
52983-52992 |
NN |
denotes |
formation |
T11337 |
52992-52993 |
. |
denotes |
. |
T11338 |
52993-53162 |
sentence |
denotes |
However, it is intriguing that K14-Snail Tg epidermis displayed a marked down-regulation in E-cadherin expression, thereby demonstrating its potential to do so in skin. |
T11339 |
52994-53001 |
RB |
denotes |
However |
T11340 |
53006-53008 |
VBZ |
denotes |
is |
T11341 |
53001-53003 |
, |
denotes |
, |
T11342 |
53003-53005 |
PRP |
denotes |
it |
T11343 |
53009-53019 |
VBG |
denotes |
intriguing |
T11344 |
53020-53024 |
IN |
denotes |
that |
T11345 |
53048-53057 |
VBD |
denotes |
displayed |
T11346 |
53025-53028 |
NN |
denotes |
K14 |
T11347 |
53029-53034 |
NN |
denotes |
Snail |
T11348 |
53028-53029 |
HYPH |
denotes |
- |
T11349 |
53038-53047 |
NN |
denotes |
epidermis |
T11350 |
53035-53037 |
NN |
denotes |
Tg |
T11351 |
53058-53059 |
DT |
denotes |
a |
T11352 |
53072-53082 |
NN |
denotes |
regulation |
T11353 |
53060-53066 |
JJ |
denotes |
marked |
T11354 |
53067-53071 |
JJ |
denotes |
down |
T11355 |
53071-53072 |
HYPH |
denotes |
- |
T11356 |
53083-53085 |
IN |
denotes |
in |
T11357 |
53086-53087 |
NN |
denotes |
E |
T11358 |
53088-53096 |
NN |
denotes |
cadherin |
T11359 |
53087-53088 |
HYPH |
denotes |
- |
T11360 |
53097-53107 |
NN |
denotes |
expression |
T11361 |
53107-53109 |
, |
denotes |
, |
T11362 |
53109-53116 |
RB |
denotes |
thereby |
T11363 |
53117-53130 |
VBG |
denotes |
demonstrating |
T11364 |
53131-53134 |
PRP$ |
denotes |
its |
T11365 |
53135-53144 |
NN |
denotes |
potential |
T11366 |
53145-53147 |
TO |
denotes |
to |
T11367 |
53148-53150 |
VB |
denotes |
do |
T11368 |
53151-53153 |
RB |
denotes |
so |
T11369 |
53154-53156 |
IN |
denotes |
in |
T11370 |
53157-53161 |
NN |
denotes |
skin |
T11371 |
53161-53162 |
. |
denotes |
. |
T11372 |
53162-53315 |
sentence |
denotes |
Our prior findings showed that by elevating E-cadherin levels or by conditionally ablating α-catenin, hair follicle morphogenesis can be impaired [4,7]. |
T11373 |
53163-53166 |
PRP$ |
denotes |
Our |
T11374 |
53173-53181 |
NNS |
denotes |
findings |
T11375 |
53167-53172 |
JJ |
denotes |
prior |
T11376 |
53182-53188 |
VBD |
denotes |
showed |
T11377 |
53189-53193 |
IN |
denotes |
that |
T11378 |
53300-53308 |
VBN |
denotes |
impaired |
T11379 |
53194-53196 |
IN |
denotes |
by |
T11380 |
53197-53206 |
VBG |
denotes |
elevating |
T11381 |
53207-53208 |
NN |
denotes |
E |
T11382 |
53209-53217 |
NN |
denotes |
cadherin |
T11383 |
53208-53209 |
HYPH |
denotes |
- |
T11384 |
53218-53224 |
NNS |
denotes |
levels |
T11385 |
53225-53227 |
CC |
denotes |
or |
T11386 |
53228-53230 |
IN |
denotes |
by |
T11387 |
53231-53244 |
RB |
denotes |
conditionally |
T11388 |
53245-53253 |
VBG |
denotes |
ablating |
T11389 |
53254-53255 |
NN |
denotes |
α |
T11390 |
53256-53263 |
NN |
denotes |
catenin |
T11391 |
53255-53256 |
HYPH |
denotes |
- |
T11392 |
53263-53265 |
, |
denotes |
, |
T11393 |
53265-53269 |
NN |
denotes |
hair |
T11394 |
53270-53278 |
NN |
denotes |
follicle |
T11395 |
53279-53292 |
NN |
denotes |
morphogenesis |
T11396 |
53293-53296 |
MD |
denotes |
can |
T11397 |
53297-53299 |
VB |
denotes |
be |
T11398 |
53309-53310 |
-LRB- |
denotes |
[ |
T11399 |
53312-53313 |
CD |
denotes |
7 |
T11400 |
53310-53311 |
CD |
denotes |
4 |
T11401 |
53311-53312 |
, |
denotes |
, |
T11402 |
53313-53314 |
-RRB- |
denotes |
] |
T11403 |
53314-53315 |
. |
denotes |
. |
T11404 |
53315-53645 |
sentence |
denotes |
The marked epidermal hyperproliferation seen in the K14-Snail Tg skin, coupled with the converse suppression of proliferation and Snail in TGF-β2-null hair buds led us to wonder whether the down-regulation of E-cadherin during follicle morphogenesis might have a direct impact on elevating the proliferative state of these cells. |
T11405 |
53316-53319 |
DT |
denotes |
The |
T11406 |
53337-53355 |
NN |
denotes |
hyperproliferation |
T11407 |
53320-53326 |
JJ |
denotes |
marked |
T11408 |
53327-53336 |
JJ |
denotes |
epidermal |
T11409 |
53477-53480 |
VBD |
denotes |
led |
T11410 |
53356-53360 |
VBN |
denotes |
seen |
T11411 |
53361-53363 |
IN |
denotes |
in |
T11412 |
53364-53367 |
DT |
denotes |
the |
T11413 |
53381-53385 |
NN |
denotes |
skin |
T11414 |
53368-53371 |
NN |
denotes |
K14 |
T11415 |
53372-53377 |
NN |
denotes |
Snail |
T11416 |
53371-53372 |
HYPH |
denotes |
- |
T11417 |
53378-53380 |
NN |
denotes |
Tg |
T11418 |
53385-53387 |
, |
denotes |
, |
T11419 |
53387-53394 |
VBN |
denotes |
coupled |
T11420 |
53395-53399 |
IN |
denotes |
with |
T11421 |
53400-53403 |
DT |
denotes |
the |
T11422 |
53413-53424 |
NN |
denotes |
suppression |
T11423 |
53404-53412 |
JJ |
denotes |
converse |
T11424 |
53425-53427 |
IN |
denotes |
of |
T11425 |
53428-53441 |
NN |
denotes |
proliferation |
T11426 |
53442-53445 |
CC |
denotes |
and |
T11427 |
53446-53451 |
NN |
denotes |
Snail |
T11428 |
53452-53454 |
IN |
denotes |
in |
T11429 |
53455-53458 |
NN |
denotes |
TGF |
T11430 |
53459-53461 |
NN |
denotes |
β2 |
T11431 |
53458-53459 |
HYPH |
denotes |
- |
T11432 |
53462-53466 |
JJ |
denotes |
null |
T11433 |
53461-53462 |
HYPH |
denotes |
- |
T11434 |
53472-53476 |
NNS |
denotes |
buds |
T11435 |
53467-53471 |
NN |
denotes |
hair |
T11436 |
53481-53483 |
PRP |
denotes |
us |
T11437 |
53484-53486 |
TO |
denotes |
to |
T11438 |
53487-53493 |
VB |
denotes |
wonder |
T11439 |
53494-53501 |
IN |
denotes |
whether |
T11440 |
53572-53576 |
VB |
denotes |
have |
T11441 |
53502-53505 |
DT |
denotes |
the |
T11442 |
53511-53521 |
NN |
denotes |
regulation |
T11443 |
53506-53510 |
JJ |
denotes |
down |
T11444 |
53510-53511 |
HYPH |
denotes |
- |
T11445 |
53522-53524 |
IN |
denotes |
of |
T11446 |
53525-53526 |
NN |
denotes |
E |
T11447 |
53527-53535 |
NN |
denotes |
cadherin |
T11448 |
53526-53527 |
HYPH |
denotes |
- |
T11449 |
53536-53542 |
IN |
denotes |
during |
T11450 |
53543-53551 |
NN |
denotes |
follicle |
T11451 |
53552-53565 |
NN |
denotes |
morphogenesis |
T11452 |
53566-53571 |
MD |
denotes |
might |
T11453 |
53577-53578 |
DT |
denotes |
a |
T11454 |
53586-53592 |
NN |
denotes |
impact |
T11455 |
53579-53585 |
JJ |
denotes |
direct |
T11456 |
53593-53595 |
IN |
denotes |
on |
T11457 |
53596-53605 |
VBG |
denotes |
elevating |
T11458 |
53606-53609 |
DT |
denotes |
the |
T11459 |
53624-53629 |
NN |
denotes |
state |
T11460 |
53610-53623 |
JJ |
denotes |
proliferative |
T11461 |
53630-53632 |
IN |
denotes |
of |
T11462 |
53633-53638 |
DT |
denotes |
these |
T11463 |
53639-53644 |
NNS |
denotes |
cells |
T11464 |
53644-53645 |
. |
denotes |
. |
T11465 |
53645-53827 |
sentence |
denotes |
Our Tg studies suggested that, at least in part through its regulation of E-cadherin, Snail is able to influence the subcellular localization of a variety of AJ-associated proteins. |
T11466 |
53646-53649 |
PRP$ |
denotes |
Our |
T11467 |
53653-53660 |
NNS |
denotes |
studies |
T11468 |
53650-53652 |
NN |
denotes |
Tg |
T11469 |
53661-53670 |
VBD |
denotes |
suggested |
T11470 |
53671-53675 |
IN |
denotes |
that |
T11471 |
53738-53740 |
VBZ |
denotes |
is |
T11472 |
53675-53677 |
, |
denotes |
, |
T11473 |
53677-53679 |
RB |
denotes |
at |
T11474 |
53680-53685 |
RBS |
denotes |
least |
T11475 |
53686-53688 |
IN |
denotes |
in |
T11476 |
53694-53701 |
IN |
denotes |
through |
T11477 |
53689-53693 |
NN |
denotes |
part |
T11478 |
53702-53705 |
PRP$ |
denotes |
its |
T11479 |
53706-53716 |
NN |
denotes |
regulation |
T11480 |
53717-53719 |
IN |
denotes |
of |
T11481 |
53720-53721 |
NN |
denotes |
E |
T11482 |
53722-53730 |
NN |
denotes |
cadherin |
T11483 |
53721-53722 |
HYPH |
denotes |
- |
T11484 |
53730-53732 |
, |
denotes |
, |
T11485 |
53732-53737 |
NN |
denotes |
Snail |
T11486 |
53741-53745 |
JJ |
denotes |
able |
T11487 |
53746-53748 |
TO |
denotes |
to |
T11488 |
53749-53758 |
VB |
denotes |
influence |
T11489 |
53759-53762 |
DT |
denotes |
the |
T11490 |
53775-53787 |
NN |
denotes |
localization |
T11491 |
53763-53774 |
JJ |
denotes |
subcellular |
T11492 |
53788-53790 |
IN |
denotes |
of |
T11493 |
53791-53792 |
DT |
denotes |
a |
T11494 |
53793-53800 |
NN |
denotes |
variety |
T11495 |
53801-53803 |
IN |
denotes |
of |
T11496 |
53804-53806 |
NN |
denotes |
AJ |
T11497 |
53807-53817 |
VBN |
denotes |
associated |
T11498 |
53806-53807 |
HYPH |
denotes |
- |
T11499 |
53818-53826 |
NN |
denotes |
proteins |
T11500 |
53826-53827 |
. |
denotes |
. |
T11501 |
53827-53957 |
sentence |
denotes |
One of these appears to be Ajuba, which was previously shown to have the dual capacity to bind Grb-2 as well as α-catenin [9,10]. |
T11502 |
53828-53831 |
CD |
denotes |
One |
T11503 |
53841-53848 |
VBZ |
denotes |
appears |
T11504 |
53832-53834 |
IN |
denotes |
of |
T11505 |
53835-53840 |
DT |
denotes |
these |
T11506 |
53849-53851 |
TO |
denotes |
to |
T11507 |
53852-53854 |
VB |
denotes |
be |
T11508 |
53855-53860 |
NN |
denotes |
Ajuba |
T11509 |
53860-53862 |
, |
denotes |
, |
T11510 |
53862-53867 |
WDT |
denotes |
which |
T11511 |
53883-53888 |
VBN |
denotes |
shown |
T11512 |
53868-53871 |
VBD |
denotes |
was |
T11513 |
53872-53882 |
RB |
denotes |
previously |
T11514 |
53889-53891 |
TO |
denotes |
to |
T11515 |
53892-53896 |
VB |
denotes |
have |
T11516 |
53897-53900 |
DT |
denotes |
the |
T11517 |
53906-53914 |
NN |
denotes |
capacity |
T11518 |
53901-53905 |
JJ |
denotes |
dual |
T11519 |
53915-53917 |
TO |
denotes |
to |
T11520 |
53918-53922 |
VB |
denotes |
bind |
T11521 |
53923-53926 |
NN |
denotes |
Grb |
T11522 |
53926-53927 |
HYPH |
denotes |
- |
T11523 |
53927-53928 |
CD |
denotes |
2 |
T11524 |
53929-53931 |
RB |
denotes |
as |
T11525 |
53937-53939 |
IN |
denotes |
as |
T11526 |
53932-53936 |
RB |
denotes |
well |
T11527 |
53940-53941 |
NN |
denotes |
α |
T11528 |
53942-53949 |
NN |
denotes |
catenin |
T11529 |
53941-53942 |
HYPH |
denotes |
- |
T11530 |
53950-53951 |
-LRB- |
denotes |
[ |
T11531 |
53953-53955 |
CD |
denotes |
10 |
T11532 |
53951-53952 |
CD |
denotes |
9 |
T11533 |
53952-53953 |
, |
denotes |
, |
T11534 |
53955-53956 |
-RRB- |
denotes |
] |
T11535 |
53956-53957 |
. |
denotes |
. |
T11536 |
53957-54185 |
sentence |
denotes |
Our studies revealed that in skin keratinocytes that either harbor a conditional null mutation in α-catenin or that overexpress Snail, Ajuba develops an interaction with Grb-2 that is otherwise not observed in WT keratinocytes. |
T11537 |
53958-53961 |
PRP$ |
denotes |
Our |
T11538 |
53962-53969 |
NNS |
denotes |
studies |
T11539 |
53970-53978 |
VBD |
denotes |
revealed |
T11540 |
53979-53983 |
IN |
denotes |
that |
T11541 |
54099-54107 |
VBZ |
denotes |
develops |
T11542 |
53984-53986 |
IN |
denotes |
in |
T11543 |
53987-53991 |
NN |
denotes |
skin |
T11544 |
53992-54005 |
NNS |
denotes |
keratinocytes |
T11545 |
54006-54010 |
WDT |
denotes |
that |
T11546 |
54018-54024 |
VBP |
denotes |
harbor |
T11547 |
54011-54017 |
CC |
denotes |
either |
T11548 |
54025-54026 |
DT |
denotes |
a |
T11549 |
54044-54052 |
NN |
denotes |
mutation |
T11550 |
54027-54038 |
JJ |
denotes |
conditional |
T11551 |
54039-54043 |
JJ |
denotes |
null |
T11552 |
54053-54055 |
IN |
denotes |
in |
T11553 |
54056-54057 |
NN |
denotes |
α |
T11554 |
54058-54065 |
NN |
denotes |
catenin |
T11555 |
54057-54058 |
HYPH |
denotes |
- |
T11556 |
54066-54068 |
CC |
denotes |
or |
T11557 |
54069-54073 |
WDT |
denotes |
that |
T11558 |
54074-54085 |
VBP |
denotes |
overexpress |
T11559 |
54086-54091 |
NN |
denotes |
Snail |
T11560 |
54091-54093 |
, |
denotes |
, |
T11561 |
54093-54098 |
NN |
denotes |
Ajuba |
T11562 |
54108-54110 |
DT |
denotes |
an |
T11563 |
54111-54122 |
NN |
denotes |
interaction |
T11564 |
54123-54127 |
IN |
denotes |
with |
T11565 |
54128-54131 |
NN |
denotes |
Grb |
T11566 |
54131-54132 |
HYPH |
denotes |
- |
T11567 |
54132-54133 |
CD |
denotes |
2 |
T11568 |
54134-54138 |
WDT |
denotes |
that |
T11569 |
54156-54164 |
VBN |
denotes |
observed |
T11570 |
54139-54141 |
VBZ |
denotes |
is |
T11571 |
54142-54151 |
RB |
denotes |
otherwise |
T11572 |
54152-54155 |
RB |
denotes |
not |
T11573 |
54165-54167 |
IN |
denotes |
in |
T11574 |
54168-54170 |
NN |
denotes |
WT |
T11575 |
54171-54184 |
NNS |
denotes |
keratinocytes |
T11576 |
54184-54185 |
. |
denotes |
. |
T11577 |
54185-54489 |
sentence |
denotes |
The corresponding abilities of either Snail-transfected or Ajuba-transfected keratinocytes to exhibit elevated activation of the Ras-MAPK pathway suggest that the Grb-2 association of Ajuba under conditions of reduced levels of AJ proteins may be directly relevant to the parallel in hyperproliferation. |
T11578 |
54186-54189 |
DT |
denotes |
The |
T11579 |
54204-54213 |
NNS |
denotes |
abilities |
T11580 |
54190-54203 |
VBG |
denotes |
corresponding |
T11581 |
54332-54339 |
VBP |
denotes |
suggest |
T11582 |
54214-54216 |
IN |
denotes |
of |
T11583 |
54217-54223 |
CC |
denotes |
either |
T11584 |
54263-54276 |
NNS |
denotes |
keratinocytes |
T11585 |
54224-54229 |
NN |
denotes |
Snail |
T11586 |
54230-54241 |
VBN |
denotes |
transfected |
T11587 |
54229-54230 |
HYPH |
denotes |
- |
T11588 |
54242-54244 |
CC |
denotes |
or |
T11589 |
54245-54250 |
NN |
denotes |
Ajuba |
T11590 |
54251-54262 |
VBN |
denotes |
transfected |
T11591 |
54250-54251 |
HYPH |
denotes |
- |
T11592 |
54277-54279 |
TO |
denotes |
to |
T11593 |
54280-54287 |
VB |
denotes |
exhibit |
T11594 |
54288-54296 |
JJ |
denotes |
elevated |
T11595 |
54297-54307 |
NN |
denotes |
activation |
T11596 |
54308-54310 |
IN |
denotes |
of |
T11597 |
54311-54314 |
DT |
denotes |
the |
T11598 |
54324-54331 |
NN |
denotes |
pathway |
T11599 |
54315-54318 |
NN |
denotes |
Ras |
T11600 |
54319-54323 |
NN |
denotes |
MAPK |
T11601 |
54318-54319 |
HYPH |
denotes |
- |
T11602 |
54340-54344 |
IN |
denotes |
that |
T11603 |
54430-54432 |
VB |
denotes |
be |
T11604 |
54345-54348 |
DT |
denotes |
the |
T11605 |
54355-54366 |
NN |
denotes |
association |
T11606 |
54349-54352 |
NN |
denotes |
Grb |
T11607 |
54352-54353 |
HYPH |
denotes |
- |
T11608 |
54353-54354 |
CD |
denotes |
2 |
T11609 |
54367-54369 |
IN |
denotes |
of |
T11610 |
54370-54375 |
NN |
denotes |
Ajuba |
T11611 |
54376-54381 |
IN |
denotes |
under |
T11612 |
54382-54392 |
NNS |
denotes |
conditions |
T11613 |
54393-54395 |
IN |
denotes |
of |
T11614 |
54396-54403 |
JJ |
denotes |
reduced |
T11615 |
54404-54410 |
NNS |
denotes |
levels |
T11616 |
54411-54413 |
IN |
denotes |
of |
T11617 |
54414-54416 |
NN |
denotes |
AJ |
T11618 |
54417-54425 |
NN |
denotes |
proteins |
T11619 |
54426-54429 |
MD |
denotes |
may |
T11620 |
54433-54441 |
RB |
denotes |
directly |
T11621 |
54442-54450 |
JJ |
denotes |
relevant |
T11622 |
54451-54453 |
IN |
denotes |
to |
T11623 |
54454-54457 |
DT |
denotes |
the |
T11624 |
54458-54466 |
NN |
denotes |
parallel |
T11625 |
54467-54469 |
IN |
denotes |
in |
T11626 |
54470-54488 |
NN |
denotes |
hyperproliferation |
T11627 |
54488-54489 |
. |
denotes |
. |
T11628 |
54489-54676 |
sentence |
denotes |
In stable epithelial (i.e., Madin-Darby canine kidney, or MDCK) cell lines, Snail has been shown to block cell cycle progression and promote motility and shape changes for invasion [47]. |
T11629 |
54490-54492 |
IN |
denotes |
In |
T11630 |
54581-54586 |
VBN |
denotes |
shown |
T11631 |
54493-54499 |
JJ |
denotes |
stable |
T11632 |
54559-54564 |
NNS |
denotes |
lines |
T11633 |
54500-54510 |
JJ |
denotes |
epithelial |
T11634 |
54511-54512 |
-LRB- |
denotes |
( |
T11635 |
54537-54543 |
NN |
denotes |
kidney |
T11636 |
54512-54516 |
FW |
denotes |
i.e. |
T11637 |
54516-54518 |
, |
denotes |
, |
T11638 |
54518-54523 |
NNP |
denotes |
Madin |
T11639 |
54524-54529 |
NNP |
denotes |
Darby |
T11640 |
54523-54524 |
HYPH |
denotes |
- |
T11641 |
54530-54536 |
JJ |
denotes |
canine |
T11642 |
54543-54545 |
, |
denotes |
, |
T11643 |
54545-54547 |
CC |
denotes |
or |
T11644 |
54548-54552 |
NN |
denotes |
MDCK |
T11645 |
54552-54553 |
-RRB- |
denotes |
) |
T11646 |
54554-54558 |
NN |
denotes |
cell |
T11647 |
54564-54566 |
, |
denotes |
, |
T11648 |
54566-54571 |
NN |
denotes |
Snail |
T11649 |
54572-54575 |
VBZ |
denotes |
has |
T11650 |
54576-54580 |
VBN |
denotes |
been |
T11651 |
54587-54589 |
TO |
denotes |
to |
T11652 |
54590-54595 |
VB |
denotes |
block |
T11653 |
54596-54600 |
NN |
denotes |
cell |
T11654 |
54601-54606 |
NN |
denotes |
cycle |
T11655 |
54607-54618 |
NN |
denotes |
progression |
T11656 |
54619-54622 |
CC |
denotes |
and |
T11657 |
54623-54630 |
VB |
denotes |
promote |
T11658 |
54631-54639 |
NN |
denotes |
motility |
T11659 |
54650-54657 |
NNS |
denotes |
changes |
T11660 |
54640-54643 |
CC |
denotes |
and |
T11661 |
54644-54649 |
NN |
denotes |
shape |
T11662 |
54658-54661 |
IN |
denotes |
for |
T11663 |
54662-54670 |
NN |
denotes |
invasion |
T11664 |
54671-54672 |
-LRB- |
denotes |
[ |
T11665 |
54672-54674 |
CD |
denotes |
47 |
T11666 |
54674-54675 |
-RRB- |
denotes |
] |
T11667 |
54675-54676 |
. |
denotes |
. |
T11668 |
54676-54846 |
sentence |
denotes |
While our in vivo studies are consistent with a role for Snail in motility and epithelial remodeling, they differ with respect to Snail's apparent proliferative effects. |
T11669 |
54677-54682 |
IN |
denotes |
While |
T11670 |
54703-54706 |
VBP |
denotes |
are |
T11671 |
54683-54686 |
PRP$ |
denotes |
our |
T11672 |
54695-54702 |
NNS |
denotes |
studies |
T11673 |
54687-54689 |
FW |
denotes |
in |
T11674 |
54690-54694 |
FW |
denotes |
vivo |
T11675 |
54784-54790 |
VBP |
denotes |
differ |
T11676 |
54707-54717 |
JJ |
denotes |
consistent |
T11677 |
54718-54722 |
IN |
denotes |
with |
T11678 |
54723-54724 |
DT |
denotes |
a |
T11679 |
54725-54729 |
NN |
denotes |
role |
T11680 |
54730-54733 |
IN |
denotes |
for |
T11681 |
54734-54739 |
NN |
denotes |
Snail |
T11682 |
54740-54742 |
IN |
denotes |
in |
T11683 |
54743-54751 |
NN |
denotes |
motility |
T11684 |
54767-54777 |
NN |
denotes |
remodeling |
T11685 |
54752-54755 |
CC |
denotes |
and |
T11686 |
54756-54766 |
JJ |
denotes |
epithelial |
T11687 |
54777-54779 |
, |
denotes |
, |
T11688 |
54779-54783 |
PRP |
denotes |
they |
T11689 |
54791-54795 |
IN |
denotes |
with |
T11690 |
54796-54803 |
NN |
denotes |
respect |
T11691 |
54804-54806 |
IN |
denotes |
to |
T11692 |
54807-54812 |
NN |
denotes |
Snail |
T11693 |
54838-54845 |
NNS |
denotes |
effects |
T11694 |
54812-54814 |
POS |
denotes |
's |
T11695 |
54815-54823 |
JJ |
denotes |
apparent |
T11696 |
54824-54837 |
JJ |
denotes |
proliferative |
T11697 |
54845-54846 |
. |
denotes |
. |
T11698 |
54846-54956 |
sentence |
denotes |
A priori, this could be simply due to variations in the response of different cell types to Snail expression. |
T11699 |
54847-54848 |
FW |
denotes |
A |
T11700 |
54849-54855 |
FW |
denotes |
priori |
T11701 |
54868-54870 |
VB |
denotes |
be |
T11702 |
54855-54857 |
, |
denotes |
, |
T11703 |
54857-54861 |
DT |
denotes |
this |
T11704 |
54862-54867 |
MD |
denotes |
could |
T11705 |
54871-54877 |
RB |
denotes |
simply |
T11706 |
54878-54881 |
IN |
denotes |
due |
T11707 |
54882-54884 |
IN |
denotes |
to |
T11708 |
54885-54895 |
NNS |
denotes |
variations |
T11709 |
54896-54898 |
IN |
denotes |
in |
T11710 |
54899-54902 |
DT |
denotes |
the |
T11711 |
54903-54911 |
NN |
denotes |
response |
T11712 |
54912-54914 |
IN |
denotes |
of |
T11713 |
54915-54924 |
JJ |
denotes |
different |
T11714 |
54930-54935 |
NNS |
denotes |
types |
T11715 |
54925-54929 |
NN |
denotes |
cell |
T11716 |
54936-54938 |
IN |
denotes |
to |
T11717 |
54939-54944 |
NN |
denotes |
Snail |
T11718 |
54945-54955 |
NN |
denotes |
expression |
T11719 |
54955-54956 |
. |
denotes |
. |
T11720 |
54956-55115 |
sentence |
denotes |
Alternatively, these differences may be relevant to the benefit of using mouse models to reveal functions not always recapitulated in stable cell line models. |
T11721 |
54957-54970 |
RB |
denotes |
Alternatively |
T11722 |
54994-54996 |
VB |
denotes |
be |
T11723 |
54970-54972 |
, |
denotes |
, |
T11724 |
54972-54977 |
DT |
denotes |
these |
T11725 |
54978-54989 |
NNS |
denotes |
differences |
T11726 |
54990-54993 |
MD |
denotes |
may |
T11727 |
54997-55005 |
JJ |
denotes |
relevant |
T11728 |
55006-55008 |
IN |
denotes |
to |
T11729 |
55009-55012 |
DT |
denotes |
the |
T11730 |
55013-55020 |
NN |
denotes |
benefit |
T11731 |
55021-55023 |
IN |
denotes |
of |
T11732 |
55024-55029 |
VBG |
denotes |
using |
T11733 |
55030-55035 |
NN |
denotes |
mouse |
T11734 |
55036-55042 |
NNS |
denotes |
models |
T11735 |
55043-55045 |
TO |
denotes |
to |
T11736 |
55046-55052 |
VB |
denotes |
reveal |
T11737 |
55053-55062 |
NNS |
denotes |
functions |
T11738 |
55063-55066 |
RB |
denotes |
not |
T11739 |
55074-55087 |
VBN |
denotes |
recapitulated |
T11740 |
55067-55073 |
RB |
denotes |
always |
T11741 |
55088-55090 |
IN |
denotes |
in |
T11742 |
55091-55097 |
JJ |
denotes |
stable |
T11743 |
55108-55114 |
NNS |
denotes |
models |
T11744 |
55098-55102 |
NN |
denotes |
cell |
T11745 |
55103-55107 |
NN |
denotes |
line |
T11746 |
55114-55115 |
. |
denotes |
. |
T11747 |
55115-55198 |
sentence |
denotes |
Future studies should highlight the underlying reasons for these opposing results. |
T11748 |
55116-55122 |
JJ |
denotes |
Future |
T11749 |
55123-55130 |
NNS |
denotes |
studies |
T11750 |
55138-55147 |
VB |
denotes |
highlight |
T11751 |
55131-55137 |
MD |
denotes |
should |
T11752 |
55148-55151 |
DT |
denotes |
the |
T11753 |
55163-55170 |
NNS |
denotes |
reasons |
T11754 |
55152-55162 |
JJ |
denotes |
underlying |
T11755 |
55171-55174 |
IN |
denotes |
for |
T11756 |
55175-55180 |
DT |
denotes |
these |
T11757 |
55190-55197 |
NNS |
denotes |
results |
T11758 |
55181-55189 |
VBG |
denotes |
opposing |
T11759 |
55197-55198 |
. |
denotes |
. |
T11760 |
55198-55383 |
sentence |
denotes |
Irrespective of these differences, our in vivo studies do not stand alone, as there are many situations in which a down-regulation in AJ proteins correlate with enhanced proliferation. |
T11761 |
55199-55211 |
JJ |
denotes |
Irrespective |
T11762 |
55261-55266 |
VB |
denotes |
stand |
T11763 |
55212-55214 |
IN |
denotes |
of |
T11764 |
55215-55220 |
DT |
denotes |
these |
T11765 |
55221-55232 |
NNS |
denotes |
differences |
T11766 |
55232-55234 |
, |
denotes |
, |
T11767 |
55234-55237 |
PRP$ |
denotes |
our |
T11768 |
55246-55253 |
NNS |
denotes |
studies |
T11769 |
55238-55240 |
FW |
denotes |
in |
T11770 |
55241-55245 |
FW |
denotes |
vivo |
T11771 |
55254-55256 |
VBP |
denotes |
do |
T11772 |
55257-55260 |
RB |
denotes |
not |
T11773 |
55267-55272 |
RB |
denotes |
alone |
T11774 |
55272-55274 |
, |
denotes |
, |
T11775 |
55274-55276 |
IN |
denotes |
as |
T11776 |
55283-55286 |
VBP |
denotes |
are |
T11777 |
55277-55282 |
EX |
denotes |
there |
T11778 |
55287-55291 |
JJ |
denotes |
many |
T11779 |
55292-55302 |
NNS |
denotes |
situations |
T11780 |
55303-55305 |
IN |
denotes |
in |
T11781 |
55345-55354 |
VBP |
denotes |
correlate |
T11782 |
55306-55311 |
WDT |
denotes |
which |
T11783 |
55312-55313 |
DT |
denotes |
a |
T11784 |
55319-55329 |
NN |
denotes |
regulation |
T11785 |
55314-55318 |
JJ |
denotes |
down |
T11786 |
55318-55319 |
HYPH |
denotes |
- |
T11787 |
55330-55332 |
IN |
denotes |
in |
T11788 |
55333-55335 |
NN |
denotes |
AJ |
T11789 |
55336-55344 |
NN |
denotes |
proteins |
T11790 |
55355-55359 |
IN |
denotes |
with |
T11791 |
55360-55368 |
VBN |
denotes |
enhanced |
T11792 |
55369-55382 |
NN |
denotes |
proliferation |
T11793 |
55382-55383 |
. |
denotes |
. |
T11794 |
55383-55533 |
sentence |
denotes |
In fact, a myriad of diverse mechanisms have been implicated in activating epithelial proliferation upon down-regulation of AJ proteins [7,23,24,48]. |
T11795 |
55384-55386 |
IN |
denotes |
In |
T11796 |
55434-55444 |
VBN |
denotes |
implicated |
T11797 |
55387-55391 |
NN |
denotes |
fact |
T11798 |
55391-55393 |
, |
denotes |
, |
T11799 |
55393-55394 |
DT |
denotes |
a |
T11800 |
55395-55401 |
NN |
denotes |
myriad |
T11801 |
55402-55404 |
IN |
denotes |
of |
T11802 |
55405-55412 |
JJ |
denotes |
diverse |
T11803 |
55413-55423 |
NNS |
denotes |
mechanisms |
T11804 |
55424-55428 |
VBP |
denotes |
have |
T11805 |
55429-55433 |
VBN |
denotes |
been |
T11806 |
55445-55447 |
IN |
denotes |
in |
T11807 |
55448-55458 |
VBG |
denotes |
activating |
T11808 |
55459-55469 |
JJ |
denotes |
epithelial |
T11809 |
55470-55483 |
NN |
denotes |
proliferation |
T11810 |
55484-55488 |
IN |
denotes |
upon |
T11811 |
55489-55493 |
JJ |
denotes |
down |
T11812 |
55494-55504 |
NN |
denotes |
regulation |
T11813 |
55493-55494 |
HYPH |
denotes |
- |
T11814 |
55505-55507 |
IN |
denotes |
of |
T11815 |
55508-55510 |
NN |
denotes |
AJ |
T11816 |
55511-55519 |
NN |
denotes |
proteins |
T11817 |
55520-55521 |
-LRB- |
denotes |
[ |
T11818 |
55529-55531 |
CD |
denotes |
48 |
T11819 |
55521-55522 |
CD |
denotes |
7 |
T11820 |
55522-55523 |
, |
denotes |
, |
T11821 |
55523-55525 |
CD |
denotes |
23 |
T11822 |
55525-55526 |
, |
denotes |
, |
T11823 |
55526-55528 |
CD |
denotes |
24 |
T11824 |
55528-55529 |
, |
denotes |
, |
T11825 |
55531-55532 |
-RRB- |
denotes |
] |
T11826 |
55532-55533 |
. |
denotes |
. |
T11827 |
55533-55628 |
sentence |
denotes |
Sifting through these converging pathways is likely to be a difficult and painstaking process. |
T11828 |
55534-55541 |
VBG |
denotes |
Sifting |
T11829 |
55576-55578 |
VBZ |
denotes |
is |
T11830 |
55542-55549 |
IN |
denotes |
through |
T11831 |
55550-55555 |
DT |
denotes |
these |
T11832 |
55567-55575 |
NNS |
denotes |
pathways |
T11833 |
55556-55566 |
VBG |
denotes |
converging |
T11834 |
55579-55585 |
JJ |
denotes |
likely |
T11835 |
55586-55588 |
TO |
denotes |
to |
T11836 |
55589-55591 |
VB |
denotes |
be |
T11837 |
55592-55593 |
DT |
denotes |
a |
T11838 |
55620-55627 |
NN |
denotes |
process |
T11839 |
55594-55603 |
JJ |
denotes |
difficult |
T11840 |
55604-55607 |
CC |
denotes |
and |
T11841 |
55608-55619 |
JJ |
denotes |
painstaking |
T11842 |
55627-55628 |
. |
denotes |
. |
T11843 |
55628-55913 |
sentence |
denotes |
This said, by identifying the status of different players involved in specific cell types and at specific stages in development, our mechanistic understanding of how intercellular remodeling is linked to proliferation in epithelial morphogenesis should begin to surface in the future. |
T11844 |
55629-55633 |
DT |
denotes |
This |
T11845 |
55634-55638 |
VBD |
denotes |
said |
T11846 |
55882-55887 |
VB |
denotes |
begin |
T11847 |
55638-55640 |
, |
denotes |
, |
T11848 |
55640-55642 |
IN |
denotes |
by |
T11849 |
55643-55654 |
VBG |
denotes |
identifying |
T11850 |
55655-55658 |
DT |
denotes |
the |
T11851 |
55659-55665 |
NN |
denotes |
status |
T11852 |
55666-55668 |
IN |
denotes |
of |
T11853 |
55669-55678 |
JJ |
denotes |
different |
T11854 |
55679-55686 |
NNS |
denotes |
players |
T11855 |
55687-55695 |
VBN |
denotes |
involved |
T11856 |
55696-55698 |
IN |
denotes |
in |
T11857 |
55699-55707 |
JJ |
denotes |
specific |
T11858 |
55713-55718 |
NNS |
denotes |
types |
T11859 |
55708-55712 |
NN |
denotes |
cell |
T11860 |
55719-55722 |
CC |
denotes |
and |
T11861 |
55723-55725 |
IN |
denotes |
at |
T11862 |
55726-55734 |
JJ |
denotes |
specific |
T11863 |
55735-55741 |
NNS |
denotes |
stages |
T11864 |
55742-55744 |
IN |
denotes |
in |
T11865 |
55745-55756 |
NN |
denotes |
development |
T11866 |
55756-55758 |
, |
denotes |
, |
T11867 |
55758-55761 |
PRP$ |
denotes |
our |
T11868 |
55774-55787 |
NN |
denotes |
understanding |
T11869 |
55762-55773 |
JJ |
denotes |
mechanistic |
T11870 |
55788-55790 |
IN |
denotes |
of |
T11871 |
55791-55794 |
WRB |
denotes |
how |
T11872 |
55823-55829 |
VBN |
denotes |
linked |
T11873 |
55795-55808 |
JJ |
denotes |
intercellular |
T11874 |
55809-55819 |
NN |
denotes |
remodeling |
T11875 |
55820-55822 |
VBZ |
denotes |
is |
T11876 |
55830-55832 |
IN |
denotes |
to |
T11877 |
55833-55846 |
NN |
denotes |
proliferation |
T11878 |
55847-55849 |
IN |
denotes |
in |
T11879 |
55850-55860 |
JJ |
denotes |
epithelial |
T11880 |
55861-55874 |
NN |
denotes |
morphogenesis |
T11881 |
55875-55881 |
MD |
denotes |
should |
T11882 |
55888-55890 |
TO |
denotes |
to |
T11883 |
55891-55898 |
VB |
denotes |
surface |
T11884 |
55899-55901 |
IN |
denotes |
in |
T11885 |
55902-55905 |
DT |
denotes |
the |
T11886 |
55906-55912 |
NN |
denotes |
future |
T11887 |
55912-55913 |
. |
denotes |
. |
T11888 |
55913-56079 |
sentence |
denotes |
Elucidating the molecular mechanisms through which these networks converge is also a prerequisite for understanding how these processes go awry during tumorigenesis. |
T11889 |
55914-55925 |
VBG |
denotes |
Elucidating |
T11890 |
55989-55991 |
VBZ |
denotes |
is |
T11891 |
55926-55929 |
DT |
denotes |
the |
T11892 |
55940-55950 |
NNS |
denotes |
mechanisms |
T11893 |
55930-55939 |
JJ |
denotes |
molecular |
T11894 |
55951-55958 |
IN |
denotes |
through |
T11895 |
55980-55988 |
VBP |
denotes |
converge |
T11896 |
55959-55964 |
WDT |
denotes |
which |
T11897 |
55965-55970 |
DT |
denotes |
these |
T11898 |
55971-55979 |
NNS |
denotes |
networks |
T11899 |
55992-55996 |
RB |
denotes |
also |
T11900 |
55997-55998 |
DT |
denotes |
a |
T11901 |
55999-56011 |
NN |
denotes |
prerequisite |
T11902 |
56012-56015 |
IN |
denotes |
for |
T11903 |
56016-56029 |
VBG |
denotes |
understanding |
T11904 |
56030-56033 |
WRB |
denotes |
how |
T11905 |
56050-56052 |
VBP |
denotes |
go |
T11906 |
56034-56039 |
DT |
denotes |
these |
T11907 |
56040-56049 |
NNS |
denotes |
processes |
T11908 |
56053-56057 |
RB |
denotes |
awry |
T11909 |
56058-56064 |
IN |
denotes |
during |
T11910 |
56065-56078 |
NN |
denotes |
tumorigenesis |
T11911 |
56078-56079 |
. |
denotes |
. |
T12021 |
56104-56112 |
NNS |
denotes |
Reagents |
T12022 |
56112-57203 |
sentence |
denotes |
Primary antibodies used were against: E-cadherin (M. Takeichi, Kyoto University, Japan); α-catenin, β-catenin, pMAPK, tubulin (Sigma, St. Louis, Missouri, United States), Ajuba (G. Longmore, Washington University, St. Louis, Missouri, United States); β4 integrin/CD104 (BD Pharmingen, San Diego, California, United States), laminin 5 (R. Burgeson, Harvard University, Cambridge, Massachusetts, United States), K5, K1, loricrin (Fuchs Lab), involucrin, fillagrin (Covance, Berkeley, California, United States), MAPK, pSMAD2 (Cell Signaling, Beverly, Massachusetts, United States); Grb-2 (Santa Cruz Biotech, Santa Cruz, California, United States); P-cadherin (Zymed Laboratories, South San Francisco, California, United States); HA (Roche Biochemicals), vimentin (Chemicon, Temecula, California, United States), Ki67 (Novo Castra, Newcastle Upon Tyne, United Kingdom), keratin 6 (P. Coulombe, John Hopkins University, Baltimore, Maryland, United States), cyclin D (Oncogene, San Diego, California, United States), and TGF-β2 (L. Gold, New York University, New York, New York, United States). |
T12023 |
56113-56120 |
JJ |
denotes |
Primary |
T12024 |
56121-56131 |
NNS |
denotes |
antibodies |
T12025 |
56137-56141 |
VBD |
denotes |
were |
T12026 |
56132-56136 |
VBN |
denotes |
used |
T12027 |
56142-56149 |
IN |
denotes |
against |
T12028 |
56149-56151 |
: |
denotes |
: |
T12029 |
56151-56152 |
NN |
denotes |
E |
T12030 |
56153-56161 |
NN |
denotes |
cadherin |
T12031 |
56152-56153 |
HYPH |
denotes |
- |
T12032 |
56162-56163 |
-LRB- |
denotes |
( |
T12033 |
56166-56174 |
NNP |
denotes |
Takeichi |
T12034 |
56163-56165 |
NNP |
denotes |
M. |
T12035 |
56174-56176 |
, |
denotes |
, |
T12036 |
56176-56181 |
NNP |
denotes |
Kyoto |
T12037 |
56182-56192 |
NNP |
denotes |
University |
T12038 |
56192-56194 |
, |
denotes |
, |
T12039 |
56194-56199 |
NNP |
denotes |
Japan |
T12040 |
56199-56200 |
-RRB- |
denotes |
) |
T12041 |
56200-56201 |
: |
denotes |
; |
T12042 |
56202-56203 |
NN |
denotes |
α |
T12043 |
56204-56211 |
NN |
denotes |
catenin |
T12044 |
56203-56204 |
HYPH |
denotes |
- |
T12045 |
56211-56213 |
, |
denotes |
, |
T12046 |
56213-56214 |
NN |
denotes |
β |
T12047 |
56215-56222 |
NN |
denotes |
catenin |
T12048 |
56214-56215 |
HYPH |
denotes |
- |
T12049 |
56222-56224 |
, |
denotes |
, |
T12050 |
56224-56229 |
NN |
denotes |
pMAPK |
T12051 |
56229-56231 |
, |
denotes |
, |
T12052 |
56231-56238 |
NN |
denotes |
tubulin |
T12053 |
56239-56240 |
-LRB- |
denotes |
( |
T12054 |
56240-56245 |
NNP |
denotes |
Sigma |
T12055 |
56245-56247 |
, |
denotes |
, |
T12056 |
56247-56250 |
NNP |
denotes |
St. |
T12057 |
56251-56256 |
NNP |
denotes |
Louis |
T12058 |
56256-56258 |
, |
denotes |
, |
T12059 |
56258-56266 |
NNP |
denotes |
Missouri |
T12060 |
56266-56268 |
, |
denotes |
, |
T12061 |
56268-56274 |
NNP |
denotes |
United |
T12062 |
56275-56281 |
NNP |
denotes |
States |
T12063 |
56281-56282 |
-RRB- |
denotes |
) |
T12064 |
56282-56284 |
, |
denotes |
, |
T12065 |
56284-56289 |
NN |
denotes |
Ajuba |
T12066 |
56290-56291 |
-LRB- |
denotes |
( |
T12067 |
56294-56302 |
NNP |
denotes |
Longmore |
T12068 |
56291-56293 |
NNP |
denotes |
G. |
T12069 |
56302-56304 |
, |
denotes |
, |
T12070 |
56304-56314 |
NNP |
denotes |
Washington |
T12071 |
56315-56325 |
NNP |
denotes |
University |
T12072 |
56325-56327 |
, |
denotes |
, |
T12073 |
56327-56330 |
NNP |
denotes |
St. |
T12074 |
56331-56336 |
NNP |
denotes |
Louis |
T12075 |
56336-56338 |
, |
denotes |
, |
T12076 |
56338-56346 |
NNP |
denotes |
Missouri |
T12077 |
56346-56348 |
, |
denotes |
, |
T12078 |
56348-56354 |
NNP |
denotes |
United |
T12079 |
56355-56361 |
NNP |
denotes |
States |
T12080 |
56361-56362 |
-RRB- |
denotes |
) |
T12081 |
56362-56363 |
: |
denotes |
; |
T12082 |
56364-56366 |
NN |
denotes |
β4 |
T12083 |
56367-56375 |
NN |
denotes |
integrin |
T12084 |
56375-56376 |
HYPH |
denotes |
/ |
T12085 |
56376-56381 |
NN |
denotes |
CD104 |
T12086 |
56382-56383 |
-LRB- |
denotes |
( |
T12087 |
56386-56396 |
NNP |
denotes |
Pharmingen |
T12088 |
56383-56385 |
NNP |
denotes |
BD |
T12089 |
56396-56398 |
, |
denotes |
, |
T12090 |
56398-56401 |
NNP |
denotes |
San |
T12091 |
56402-56407 |
NNP |
denotes |
Diego |
T12092 |
56407-56409 |
, |
denotes |
, |
T12093 |
56409-56419 |
NNP |
denotes |
California |
T12094 |
56419-56421 |
, |
denotes |
, |
T12095 |
56421-56427 |
NNP |
denotes |
United |
T12096 |
56428-56434 |
NNP |
denotes |
States |
T12097 |
56434-56435 |
-RRB- |
denotes |
) |
T12098 |
56435-56437 |
, |
denotes |
, |
T12099 |
56437-56444 |
NN |
denotes |
laminin |
T12100 |
56445-56446 |
CD |
denotes |
5 |
T12101 |
56447-56448 |
-LRB- |
denotes |
( |
T12102 |
56451-56459 |
NNP |
denotes |
Burgeson |
T12103 |
56448-56450 |
NNP |
denotes |
R. |
T12104 |
56459-56461 |
, |
denotes |
, |
T12105 |
56461-56468 |
NNP |
denotes |
Harvard |
T12106 |
56469-56479 |
NNP |
denotes |
University |
T12107 |
56479-56481 |
, |
denotes |
, |
T12108 |
56481-56490 |
NNP |
denotes |
Cambridge |
T12109 |
56490-56492 |
, |
denotes |
, |
T12110 |
56492-56505 |
NNP |
denotes |
Massachusetts |
T12111 |
56505-56507 |
, |
denotes |
, |
T12112 |
56507-56513 |
NNP |
denotes |
United |
T12113 |
56514-56520 |
NNP |
denotes |
States |
T12114 |
56520-56521 |
-RRB- |
denotes |
) |
T12115 |
56521-56523 |
, |
denotes |
, |
T12116 |
56523-56525 |
NN |
denotes |
K5 |
T12117 |
56525-56527 |
, |
denotes |
, |
T12118 |
56527-56529 |
NN |
denotes |
K1 |
T12119 |
56529-56531 |
, |
denotes |
, |
T12120 |
56531-56539 |
NN |
denotes |
loricrin |
T12121 |
56540-56541 |
-LRB- |
denotes |
( |
T12122 |
56547-56550 |
NNP |
denotes |
Lab |
T12123 |
56541-56546 |
NNP |
denotes |
Fuchs |
T12124 |
56550-56551 |
-RRB- |
denotes |
) |
T12125 |
56551-56553 |
, |
denotes |
, |
T12126 |
56553-56563 |
NN |
denotes |
involucrin |
T12127 |
56563-56565 |
, |
denotes |
, |
T12128 |
56565-56574 |
NN |
denotes |
fillagrin |
T12129 |
56575-56576 |
-LRB- |
denotes |
( |
T12130 |
56576-56583 |
NNP |
denotes |
Covance |
T12131 |
56583-56585 |
, |
denotes |
, |
T12132 |
56585-56593 |
NNP |
denotes |
Berkeley |
T12133 |
56593-56595 |
, |
denotes |
, |
T12134 |
56595-56605 |
NNP |
denotes |
California |
T12135 |
56605-56607 |
, |
denotes |
, |
T12136 |
56607-56613 |
NNP |
denotes |
United |
T12137 |
56614-56620 |
NNP |
denotes |
States |
T12138 |
56620-56621 |
-RRB- |
denotes |
) |
T12139 |
56621-56623 |
, |
denotes |
, |
T12140 |
56623-56627 |
NN |
denotes |
MAPK |
T12141 |
56627-56629 |
, |
denotes |
, |
T12142 |
56629-56635 |
NN |
denotes |
pSMAD2 |
T12143 |
56636-56637 |
-LRB- |
denotes |
( |
T12144 |
56642-56651 |
NNP |
denotes |
Signaling |
T12145 |
56637-56641 |
NNP |
denotes |
Cell |
T12146 |
56651-56653 |
, |
denotes |
, |
T12147 |
56653-56660 |
NNP |
denotes |
Beverly |
T12148 |
56660-56662 |
, |
denotes |
, |
T12149 |
56662-56675 |
NNP |
denotes |
Massachusetts |
T12150 |
56675-56677 |
, |
denotes |
, |
T12151 |
56677-56683 |
NNP |
denotes |
United |
T12152 |
56684-56690 |
NNP |
denotes |
States |
T12153 |
56690-56691 |
-RRB- |
denotes |
) |
T12154 |
56691-56692 |
: |
denotes |
; |
T12155 |
56693-56696 |
NN |
denotes |
Grb |
T12156 |
56696-56697 |
HYPH |
denotes |
- |
T12157 |
56697-56698 |
CD |
denotes |
2 |
T12158 |
56699-56700 |
-LRB- |
denotes |
( |
T12159 |
56711-56718 |
NNP |
denotes |
Biotech |
T12160 |
56700-56705 |
NNP |
denotes |
Santa |
T12161 |
56706-56710 |
NNP |
denotes |
Cruz |
T12162 |
56718-56720 |
, |
denotes |
, |
T12163 |
56720-56725 |
NNP |
denotes |
Santa |
T12164 |
56726-56730 |
NNP |
denotes |
Cruz |
T12165 |
56730-56732 |
, |
denotes |
, |
T12166 |
56732-56742 |
NNP |
denotes |
California |
T12167 |
56742-56744 |
, |
denotes |
, |
T12168 |
56744-56750 |
NNP |
denotes |
United |
T12169 |
56751-56757 |
NNP |
denotes |
States |
T12170 |
56757-56758 |
-RRB- |
denotes |
) |
T12171 |
56758-56759 |
: |
denotes |
; |
T12172 |
56760-56761 |
NN |
denotes |
P |
T12173 |
56762-56770 |
NN |
denotes |
cadherin |
T12174 |
56761-56762 |
HYPH |
denotes |
- |
T12175 |
56771-56772 |
-LRB- |
denotes |
( |
T12176 |
56778-56790 |
NNP |
denotes |
Laboratories |
T12177 |
56772-56777 |
NNP |
denotes |
Zymed |
T12178 |
56790-56792 |
, |
denotes |
, |
T12179 |
56792-56797 |
JJ |
denotes |
South |
T12180 |
56802-56811 |
NNP |
denotes |
Francisco |
T12181 |
56798-56801 |
NNP |
denotes |
San |
T12182 |
56811-56813 |
, |
denotes |
, |
T12183 |
56813-56823 |
NNP |
denotes |
California |
T12184 |
56823-56825 |
, |
denotes |
, |
T12185 |
56825-56831 |
NNP |
denotes |
United |
T12186 |
56832-56838 |
NNP |
denotes |
States |
T12187 |
56838-56839 |
-RRB- |
denotes |
) |
T12188 |
56839-56840 |
: |
denotes |
; |
T12189 |
56841-56843 |
NN |
denotes |
HA |
T12190 |
56844-56845 |
-LRB- |
denotes |
( |
T12191 |
56851-56863 |
NNP |
denotes |
Biochemicals |
T12192 |
56845-56850 |
NNP |
denotes |
Roche |
T12193 |
56863-56864 |
-RRB- |
denotes |
) |
T12194 |
56864-56866 |
, |
denotes |
, |
T12195 |
56866-56874 |
NN |
denotes |
vimentin |
T12196 |
56875-56876 |
-LRB- |
denotes |
( |
T12197 |
56876-56884 |
NNP |
denotes |
Chemicon |
T12198 |
56884-56886 |
, |
denotes |
, |
T12199 |
56886-56894 |
NNP |
denotes |
Temecula |
T12200 |
56894-56896 |
, |
denotes |
, |
T12201 |
56896-56906 |
NNP |
denotes |
California |
T12202 |
56906-56908 |
, |
denotes |
, |
T12203 |
56908-56914 |
NNP |
denotes |
United |
T12204 |
56915-56921 |
NNP |
denotes |
States |
T12205 |
56921-56922 |
-RRB- |
denotes |
) |
T12206 |
56922-56924 |
, |
denotes |
, |
T12207 |
56924-56928 |
NN |
denotes |
Ki67 |
T12208 |
56929-56930 |
-LRB- |
denotes |
( |
T12209 |
56935-56941 |
NNP |
denotes |
Castra |
T12210 |
56930-56934 |
NNP |
denotes |
Novo |
T12211 |
56941-56943 |
, |
denotes |
, |
T12212 |
56943-56952 |
NNP |
denotes |
Newcastle |
T12213 |
56953-56957 |
IN |
denotes |
Upon |
T12214 |
56958-56962 |
NNP |
denotes |
Tyne |
T12215 |
56962-56964 |
, |
denotes |
, |
T12216 |
56964-56970 |
NNP |
denotes |
United |
T12217 |
56971-56978 |
NNP |
denotes |
Kingdom |
T12218 |
56978-56979 |
-RRB- |
denotes |
) |
T12219 |
56979-56981 |
, |
denotes |
, |
T12220 |
56981-56988 |
NN |
denotes |
keratin |
T12221 |
56989-56990 |
CD |
denotes |
6 |
T12222 |
56991-56992 |
-LRB- |
denotes |
( |
T12223 |
56995-57003 |
NNP |
denotes |
Coulombe |
T12224 |
56992-56994 |
NNP |
denotes |
P. |
T12225 |
57003-57005 |
, |
denotes |
, |
T12226 |
57005-57009 |
NNP |
denotes |
John |
T12227 |
57010-57017 |
NNP |
denotes |
Hopkins |
T12228 |
57018-57028 |
NNP |
denotes |
University |
T12229 |
57028-57030 |
, |
denotes |
, |
T12230 |
57030-57039 |
NNP |
denotes |
Baltimore |
T12231 |
57039-57041 |
, |
denotes |
, |
T12232 |
57041-57049 |
NNP |
denotes |
Maryland |
T12233 |
57049-57051 |
, |
denotes |
, |
T12234 |
57051-57057 |
NNP |
denotes |
United |
T12235 |
57058-57064 |
NNP |
denotes |
States |
T12236 |
57064-57065 |
-RRB- |
denotes |
) |
T12237 |
57065-57067 |
, |
denotes |
, |
T12238 |
57067-57073 |
NN |
denotes |
cyclin |
T12239 |
57074-57075 |
NN |
denotes |
D |
T12240 |
57076-57077 |
-LRB- |
denotes |
( |
T12241 |
57077-57085 |
NNP |
denotes |
Oncogene |
T12242 |
57085-57087 |
, |
denotes |
, |
T12243 |
57087-57090 |
NNP |
denotes |
San |
T12244 |
57091-57096 |
NNP |
denotes |
Diego |
T12245 |
57096-57098 |
, |
denotes |
, |
T12246 |
57098-57108 |
NNP |
denotes |
California |
T12247 |
57108-57110 |
, |
denotes |
, |
T12248 |
57110-57116 |
NNP |
denotes |
United |
T12249 |
57117-57123 |
NNP |
denotes |
States |
T12250 |
57123-57124 |
-RRB- |
denotes |
) |
T12251 |
57124-57126 |
, |
denotes |
, |
T12252 |
57126-57129 |
CC |
denotes |
and |
T12253 |
57130-57133 |
NN |
denotes |
TGF |
T12254 |
57134-57136 |
NN |
denotes |
β2 |
T12255 |
57133-57134 |
HYPH |
denotes |
- |
T12256 |
57137-57138 |
-LRB- |
denotes |
( |
T12257 |
57141-57145 |
NNP |
denotes |
Gold |
T12258 |
57138-57140 |
NNP |
denotes |
L. |
T12259 |
57145-57147 |
, |
denotes |
, |
T12260 |
57147-57150 |
NNP |
denotes |
New |
T12261 |
57151-57155 |
NNP |
denotes |
York |
T12262 |
57156-57166 |
NNP |
denotes |
University |
T12263 |
57166-57168 |
, |
denotes |
, |
T12264 |
57168-57171 |
NNP |
denotes |
New |
T12265 |
57172-57176 |
NNP |
denotes |
York |
T12266 |
57176-57178 |
, |
denotes |
, |
T12267 |
57178-57181 |
NNP |
denotes |
New |
T12268 |
57182-57186 |
NNP |
denotes |
York |
T12269 |
57186-57188 |
, |
denotes |
, |
T12270 |
57188-57194 |
NNP |
denotes |
United |
T12271 |
57195-57201 |
NNP |
denotes |
States |
T12272 |
57201-57202 |
-RRB- |
denotes |
) |
T12273 |
57202-57203 |
. |
denotes |
. |
T12274 |
57203-57337 |
sentence |
denotes |
FITC-, Texas Red-, or HRP-conjugated secondary antibodies were from Jackson ImmunoResearch (West Grove, Pennsylvania, United States). |
T12275 |
57204-57208 |
NN |
denotes |
FITC |
T12276 |
57230-57240 |
VBN |
denotes |
conjugated |
T12277 |
57208-57209 |
HYPH |
denotes |
- |
T12278 |
57209-57211 |
, |
denotes |
, |
T12279 |
57211-57216 |
NNP |
denotes |
Texas |
T12280 |
57217-57220 |
NNP |
denotes |
Red |
T12281 |
57220-57221 |
HYPH |
denotes |
- |
T12282 |
57221-57223 |
, |
denotes |
, |
T12283 |
57223-57225 |
CC |
denotes |
or |
T12284 |
57226-57229 |
NN |
denotes |
HRP |
T12285 |
57229-57230 |
HYPH |
denotes |
- |
T12286 |
57251-57261 |
NNS |
denotes |
antibodies |
T12287 |
57241-57250 |
JJ |
denotes |
secondary |
T12288 |
57262-57266 |
VBD |
denotes |
were |
T12289 |
57267-57271 |
IN |
denotes |
from |
T12290 |
57272-57279 |
NNP |
denotes |
Jackson |
T12291 |
57280-57294 |
NNP |
denotes |
ImmunoResearch |
T12292 |
57295-57296 |
-LRB- |
denotes |
( |
T12293 |
57301-57306 |
NNP |
denotes |
Grove |
T12294 |
57296-57300 |
NNP |
denotes |
West |
T12295 |
57306-57308 |
, |
denotes |
, |
T12296 |
57308-57320 |
NNP |
denotes |
Pennsylvania |
T12297 |
57320-57322 |
, |
denotes |
, |
T12298 |
57322-57328 |
NNP |
denotes |
United |
T12299 |
57329-57335 |
NNP |
denotes |
States |
T12300 |
57335-57336 |
-RRB- |
denotes |
) |
T12301 |
57336-57337 |
. |
denotes |
. |
T12302 |
57337-57434 |
sentence |
denotes |
Biotinylated secondary antibodies were from Vector Labs (Burlingame, California, United States). |
T12303 |
57338-57350 |
VBN |
denotes |
Biotinylated |
T12304 |
57361-57371 |
NNS |
denotes |
antibodies |
T12305 |
57351-57360 |
JJ |
denotes |
secondary |
T12306 |
57372-57376 |
VBD |
denotes |
were |
T12307 |
57377-57381 |
IN |
denotes |
from |
T12308 |
57382-57388 |
NNP |
denotes |
Vector |
T12309 |
57389-57393 |
NNP |
denotes |
Labs |
T12310 |
57394-57395 |
-LRB- |
denotes |
( |
T12311 |
57395-57405 |
NNP |
denotes |
Burlingame |
T12312 |
57405-57407 |
, |
denotes |
, |
T12313 |
57407-57417 |
NNP |
denotes |
California |
T12314 |
57417-57419 |
, |
denotes |
, |
T12315 |
57419-57425 |
NNP |
denotes |
United |
T12316 |
57426-57432 |
NNP |
denotes |
States |
T12317 |
57432-57433 |
-RRB- |
denotes |
) |
T12318 |
57433-57434 |
. |
denotes |
. |
T12319 |
57434-57497 |
sentence |
denotes |
Dilutions were according to the manufacturer's recommendation. |
T12320 |
57435-57444 |
NNS |
denotes |
Dilutions |
T12321 |
57445-57449 |
VBD |
denotes |
were |
T12322 |
57450-57459 |
VBG |
denotes |
according |
T12323 |
57460-57462 |
IN |
denotes |
to |
T12324 |
57463-57466 |
DT |
denotes |
the |
T12325 |
57467-57479 |
NN |
denotes |
manufacturer |
T12326 |
57482-57496 |
NN |
denotes |
recommendation |
T12327 |
57479-57481 |
POS |
denotes |
's |
T12328 |
57496-57497 |
. |
denotes |
. |
T12329 |
57497-57672 |
sentence |
denotes |
The Snail antibody was generated in Guinea pigs by inoculating them with the N-terminal sequence of murine Snail fused to GST (Covance, Princeton, New Jersey, United States). |
T12330 |
57498-57501 |
DT |
denotes |
The |
T12331 |
57508-57516 |
NN |
denotes |
antibody |
T12332 |
57502-57507 |
NN |
denotes |
Snail |
T12333 |
57521-57530 |
VBN |
denotes |
generated |
T12334 |
57517-57520 |
VBD |
denotes |
was |
T12335 |
57531-57533 |
IN |
denotes |
in |
T12336 |
57534-57540 |
NN |
denotes |
Guinea |
T12337 |
57541-57545 |
NNS |
denotes |
pigs |
T12338 |
57546-57548 |
IN |
denotes |
by |
T12339 |
57549-57560 |
VBG |
denotes |
inoculating |
T12340 |
57561-57565 |
PRP |
denotes |
them |
T12341 |
57566-57570 |
IN |
denotes |
with |
T12342 |
57571-57574 |
DT |
denotes |
the |
T12343 |
57586-57594 |
NN |
denotes |
sequence |
T12344 |
57575-57576 |
NN |
denotes |
N |
T12345 |
57577-57585 |
JJ |
denotes |
terminal |
T12346 |
57576-57577 |
HYPH |
denotes |
- |
T12347 |
57595-57597 |
IN |
denotes |
of |
T12348 |
57598-57604 |
JJ |
denotes |
murine |
T12349 |
57605-57610 |
NN |
denotes |
Snail |
T12350 |
57611-57616 |
VBN |
denotes |
fused |
T12351 |
57617-57619 |
IN |
denotes |
to |
T12352 |
57620-57623 |
NN |
denotes |
GST |
T12353 |
57624-57625 |
-LRB- |
denotes |
( |
T12354 |
57625-57632 |
NNP |
denotes |
Covance |
T12355 |
57632-57634 |
, |
denotes |
, |
T12356 |
57634-57643 |
NNP |
denotes |
Princeton |
T12357 |
57643-57645 |
, |
denotes |
, |
T12358 |
57645-57648 |
NNP |
denotes |
New |
T12359 |
57649-57655 |
NNP |
denotes |
Jersey |
T12360 |
57655-57657 |
, |
denotes |
, |
T12361 |
57657-57663 |
NNP |
denotes |
United |
T12362 |
57664-57670 |
NNP |
denotes |
States |
T12363 |
57670-57671 |
-RRB- |
denotes |
) |
T12364 |
57671-57672 |
. |
denotes |
. |
T12365 |
57672-57761 |
sentence |
denotes |
Recombinant human TGF-β2 was purchased from R&D (Minneapolis, Minnesota, United States). |
T12366 |
57673-57684 |
JJ |
denotes |
Recombinant |
T12367 |
57695-57697 |
NN |
denotes |
β2 |
T12368 |
57685-57690 |
JJ |
denotes |
human |
T12369 |
57691-57694 |
NN |
denotes |
TGF |
T12370 |
57694-57695 |
HYPH |
denotes |
- |
T12371 |
57702-57711 |
VBN |
denotes |
purchased |
T12372 |
57698-57701 |
VBD |
denotes |
was |
T12373 |
57712-57716 |
IN |
denotes |
from |
T12374 |
57717-57718 |
NNP |
denotes |
R |
T12375 |
57718-57719 |
CC |
denotes |
& |
T12376 |
57719-57720 |
NNP |
denotes |
D |
T12377 |
57721-57722 |
-LRB- |
denotes |
( |
T12378 |
57722-57733 |
NNP |
denotes |
Minneapolis |
T12379 |
57733-57735 |
, |
denotes |
, |
T12380 |
57735-57744 |
NNP |
denotes |
Minnesota |
T12381 |
57744-57746 |
, |
denotes |
, |
T12382 |
57746-57752 |
NNP |
denotes |
United |
T12383 |
57753-57759 |
NNP |
denotes |
States |
T12384 |
57759-57760 |
-RRB- |
denotes |
) |
T12385 |
57760-57761 |
. |
denotes |
. |
T12386 |
57761-57856 |
sentence |
denotes |
Heat inactivated TGF-β2 was generated by heating the recombinant protein at 100 °C for 10 min. |
T12387 |
57762-57766 |
NN |
denotes |
Heat |
T12388 |
57767-57778 |
VBN |
denotes |
inactivated |
T12389 |
57783-57785 |
NN |
denotes |
β2 |
T12390 |
57779-57782 |
NN |
denotes |
TGF |
T12391 |
57782-57783 |
HYPH |
denotes |
- |
T12392 |
57790-57799 |
VBN |
denotes |
generated |
T12393 |
57786-57789 |
VBD |
denotes |
was |
T12394 |
57800-57802 |
IN |
denotes |
by |
T12395 |
57803-57810 |
VBG |
denotes |
heating |
T12396 |
57811-57814 |
DT |
denotes |
the |
T12397 |
57827-57834 |
NN |
denotes |
protein |
T12398 |
57815-57826 |
JJ |
denotes |
recombinant |
T12399 |
57835-57837 |
IN |
denotes |
at |
T12400 |
57838-57841 |
CD |
denotes |
100 |
T12401 |
57842-57844 |
NN |
denotes |
°C |
T12402 |
57845-57848 |
IN |
denotes |
for |
T12403 |
57849-57851 |
CD |
denotes |
10 |
T12404 |
57852-57855 |
NN |
denotes |
min |
T12405 |
57855-57856 |
. |
denotes |
. |
T14008 |
63750-63752 |
NN |
denotes |
RT |
T9016 |
45287-45292 |
NN |
denotes |
Snail |
T14035 |
63881-63884 |
VBD |
denotes |
was |
T14036 |
63895-63900 |
VBG |
denotes |
using |
T14037 |
63901-63906 |
NN |
denotes |
oligo |
T14038 |
63907-63909 |
NN |
denotes |
dT |
T14039 |
63906-63907 |
HYPH |
denotes |
- |
T14040 |
63910-63917 |
NNS |
denotes |
primers |
T14041 |
63918-63921 |
CC |
denotes |
and |
T14042 |
63922-63925 |
DT |
denotes |
the |
T14043 |
63941-63944 |
NN |
denotes |
kit |
T14044 |
63926-63937 |
NNP |
denotes |
Superscript |
T14045 |
63938-63940 |
CD |
denotes |
II |
T14046 |
63945-63946 |
-LRB- |
denotes |
( |
T14047 |
63946-63956 |
NNP |
denotes |
Invitrogen |
T14048 |
63956-63957 |
-RRB- |
denotes |
) |
T14049 |
63957-63958 |
. |
denotes |
. |
T14050 |
63958-64171 |
sentence |
denotes |
The primers used for PCR were Snail forward: 5′- CAGCTGGCCAGGCTCTCGGT-3′; Snail reverse: 5′- GCGAGGGCCTCCGGAGCA-3′; GAPDH forward 5′- CGTAGACAAAATGGTGAAGGTCGG-3′; and GAPDH reverse: 5′- AAGCAGTTGGTGGTGCAGGATG-3′. |
T14051 |
63959-63962 |
DT |
denotes |
The |
T14052 |
63963-63970 |
NNS |
denotes |
primers |
T14053 |
63984-63988 |
VBD |
denotes |
were |
T14054 |
63971-63975 |
VBN |
denotes |
used |
T14055 |
63976-63979 |
IN |
denotes |
for |
T14056 |
63980-63983 |
NN |
denotes |
PCR |
T14057 |
63989-63994 |
NN |
denotes |
Snail |
T14058 |
63995-64002 |
NN |
denotes |
forward |
T14059 |
64002-64004 |
: |
denotes |
: |
T14060 |
64004-64005 |
CD |
denotes |
5 |
T14061 |
64008-64028 |
NN |
denotes |
CAGCTGGCCAGGCTCTCGGT |
T14062 |
64005-64006 |
SYM |
denotes |
′ |
T14063 |
64006-64007 |
HYPH |
denotes |
- |
T14064 |
64028-64029 |
HYPH |
denotes |
- |
T9017 |
45298-45308 |
NN |
denotes |
expression |
T9018 |
45293-45297 |
NN |
denotes |
gene |
T146 |
0-1 |
DT |
denotes |
A |
T9962 |
47697-47704 |
VB |
denotes |
promote |
T8982 |
45112-45113 |
. |
denotes |
. |
T8983 |
45113-45254 |
sentence |
denotes |
These data suggest that during hair follicle morphogenesis, TGF-β2 functions subsequently to Wnt/noggin-mediated determination of hair fate. |
T8984 |
45114-45119 |
DT |
denotes |
These |
T8985 |
45120-45124 |
NNS |
denotes |
data |
T8986 |
45125-45132 |
VBP |
denotes |
suggest |
T8987 |
45133-45137 |
IN |
denotes |
that |
T8988 |
45181-45190 |
VBZ |
denotes |
functions |
T8989 |
45138-45144 |
IN |
denotes |
during |
T8990 |
45145-45149 |
NN |
denotes |
hair |
T8991 |
45150-45158 |
NN |
denotes |
follicle |
T8992 |
45159-45172 |
NN |
denotes |
morphogenesis |
T8993 |
45172-45174 |
, |
denotes |
, |
T8994 |
45174-45177 |
NN |
denotes |
TGF |
T8995 |
45178-45180 |
NN |
denotes |
β2 |
T8996 |
45177-45178 |
HYPH |
denotes |
- |
T8997 |
45191-45203 |
RB |
denotes |
subsequently |
T8998 |
45204-45206 |
IN |
denotes |
to |
T8999 |
45207-45210 |
NN |
denotes |
Wnt |
T9000 |
45211-45217 |
NN |
denotes |
noggin |
T9001 |
45210-45211 |
HYPH |
denotes |
/ |
T9002 |
45218-45226 |
VBN |
denotes |
mediated |
T9003 |
45217-45218 |
HYPH |
denotes |
- |
T9004 |
45227-45240 |
NN |
denotes |
determination |
T9005 |
45241-45243 |
IN |
denotes |
of |
T9006 |
45244-45248 |
NN |
denotes |
hair |
T9007 |
45249-45253 |
NN |
denotes |
fate |
T9008 |
45253-45254 |
. |
denotes |
. |
T9009 |
45254-45472 |
sentence |
denotes |
Moreover, through activation of Snail gene expression, TGF-β2 appears to work in tandem with these other morphogens to down-regulate E-cadherin levels, which contributes to the activation of proliferative circuitries. |
T9010 |
45255-45263 |
RB |
denotes |
Moreover |
T9011 |
45317-45324 |
VBZ |
denotes |
appears |
T9012 |
45263-45265 |
, |
denotes |
, |
T9013 |
45265-45272 |
IN |
denotes |
through |
T9014 |
45273-45283 |
NN |
denotes |
activation |
T9015 |
45284-45286 |
IN |
denotes |
of |
R5 |
T152 |
T150 |
dobj |
β2,Involving |
R6 |
T153 |
T152 |
punct |
-,β2 |
R15 |
T165 |
T162 |
pobj |
theme,In |
R16 |
T166 |
T165 |
amod |
common,theme |
R24 |
T174 |
T172 |
pobj |
sheet,within |
R25 |
T175 |
T174 |
amod |
multipotent,sheet |
R26 |
T176 |
T174 |
amod |
epithelial,sheet |
R35 |
T185 |
T183 |
pobj |
structure,into |
R36 |
T186 |
T185 |
compound |
bud,structure |
R59 |
T211 |
T209 |
pobj |
cues,of |
R60 |
T212 |
T211 |
amod |
extracellular,cues |
R77 |
T231 |
T229 |
ccomp |
is,found |
R78 |
T232 |
T231 |
csubj |
transforming,is |
R79 |
T233 |
T234 |
compound |
growth,β2 |
R81 |
T235 |
T234 |
compound |
factor,β2 |
R82 |
T236 |
T232 |
dobj |
signaling,transforming |
R85 |
T239 |
T231 |
advcl |
induce,is |
R86 |
T240 |
T239 |
advmod |
transiently,induce |
R88 |
T242 |
T239 |
dobj |
Snail,induce |
R89 |
T243 |
T242 |
compound |
transcription,Snail |
R90 |
T244 |
T242 |
compound |
factor,Snail |
R94 |
T248 |
T246 |
dobj |
pathway,activate |
R95 |
T249 |
T250 |
nmod |
Ras,kinase |
R96 |
T250 |
T248 |
nmod |
kinase,pathway |
R97 |
T251 |
T250 |
punct |
-,kinase |
R98 |
T252 |
T253 |
npadvmod |
mitogen,activated |
R99 |
T253 |
T250 |
amod |
activated,kinase |
R100 |
T254 |
T253 |
punct |
-,activated |
R101 |
T255 |
T250 |
nmod |
protein,kinase |
R102 |
T256 |
T250 |
punct |
(,kinase |
R103 |
T257 |
T250 |
appos |
MAPK,kinase |
R104 |
T258 |
T248 |
punct |
),pathway |
R125 |
T282 |
T290 |
advcl |
regulated,released |
R126 |
T283 |
T284 |
compound |
E,cadherin |
R128 |
T285 |
T284 |
punct |
-,cadherin |
R129 |
T286 |
T282 |
auxpass |
is,regulated |
R130 |
T287 |
T282 |
advmod |
transcriptionally,regulated |
R131 |
T288 |
T282 |
advmod |
down,regulated |
R132 |
T289 |
T282 |
punct |
-,regulated |
R135 |
T293 |
T290 |
nsubjpass |
proteins,released |
R136 |
T294 |
T293 |
compound |
adhesion,proteins |
R145 |
T303 |
T305 |
compound |
cell,contacts |
R146 |
T304 |
T303 |
punct |
-,cell |
R152 |
T310 |
T308 |
relcl |
demonstrate,process |
R153 |
T311 |
T310 |
nsubj |
we,demonstrate |
R157 |
T315 |
T317 |
compound |
MAPK,activation |
R158 |
T316 |
T315 |
punct |
-,MAPK |
R166 |
T326 |
T324 |
pcomp |
stimulated,into |
R167 |
T327 |
T328 |
amod |
multipotent,cells |
R168 |
T328 |
T326 |
nsubjpass |
cells,stimulated |
R169 |
T329 |
T328 |
prep |
within,cells |
R170 |
T330 |
T331 |
det |
a,sheet |
R171 |
T331 |
T329 |
pobj |
sheet,within |
R172 |
T332 |
T326 |
auxpass |
are,stimulated |
R190 |
T351 |
T354 |
nsubj |
pathway,weaves |
R191 |
T352 |
T351 |
amod |
novel,pathway |
R192 |
T353 |
T351 |
compound |
signaling,pathway |
R202 |
T364 |
T361 |
conj |
events,morphogens |
R203 |
T365 |
T364 |
amod |
transcriptional,events |
R211 |
T373 |
T371 |
pobj |
skin,within |
R212 |
T374 |
T373 |
amod |
developing,skin |
R214 |
T146 |
T147 |
det |
A,Pathway |
R227 |
T1019 |
T1020 |
amod |
Mammalian,development |
R228 |
T1020 |
T1021 |
nsubj |
development,involves |
R229 |
T1022 |
T1023 |
det |
the,morphogenesis |
R230 |
T1023 |
T1021 |
dobj |
morphogenesis,involves |
R231 |
T1024 |
T1023 |
prep |
of,morphogenesis |
R232 |
T1025 |
T1026 |
amod |
complex,structures |
R233 |
T1026 |
T1024 |
pobj |
structures,of |
R234 |
T1027 |
T1028 |
advmod |
three,dimensional |
R235 |
T1028 |
T1026 |
amod |
dimensional,structures |
R236 |
T1029 |
T1028 |
punct |
-,dimensional |
R237 |
T1030 |
T1023 |
prep |
from,morphogenesis |
R238 |
T1031 |
T1032 |
advmod |
seemingly,uniform |
R239 |
T1032 |
T1033 |
amod |
uniform,sheets |
R240 |
T1033 |
T1030 |
pobj |
sheets,from |
R241 |
T1034 |
T1033 |
cc |
or,sheets |
R242 |
T1035 |
T1033 |
conj |
masses,sheets |
R243 |
T1036 |
T1033 |
prep |
of,sheets |
R244 |
T1037 |
T1036 |
pobj |
cells,of |
R245 |
T1038 |
T1021 |
punct |
.,involves |
R246 |
T1040 |
T1041 |
det |
A,structure |
R247 |
T1041 |
T1046 |
nsubj |
structure,initiates |
R248 |
T1042 |
T1041 |
amod |
simple,structure |
R249 |
T1043 |
T1044 |
npadvmod |
bud,like |
R250 |
T1044 |
T1041 |
amod |
like,structure |
R251 |
T1045 |
T1044 |
punct |
-,like |
R252 |
T1047 |
T1048 |
det |
the,formation |
R253 |
T1048 |
T1046 |
dobj |
formation,initiates |
R254 |
T1049 |
T1048 |
prep |
of,formation |
R255 |
T1050 |
T1051 |
amod |
many,organs |
R256 |
T1051 |
T1049 |
pobj |
organs,of |
R257 |
T1052 |
T1051 |
punct |
", ",organs |
R258 |
T1053 |
T1051 |
prep |
including,organs |
R259 |
T1054 |
T1053 |
pobj |
lungs,including |
R260 |
T1055 |
T1054 |
punct |
", ",lungs |
R261 |
T1056 |
T1057 |
amod |
spinal,cord |
R262 |
T1057 |
T1054 |
conj |
cord,lungs |
R263 |
T1058 |
T1057 |
punct |
", ",cord |
R264 |
T1059 |
T1060 |
amod |
mammary,glands |
R265 |
T1060 |
T1057 |
conj |
glands,cord |
R266 |
T1061 |
T1060 |
punct |
", ",glands |
R267 |
T1062 |
T1060 |
cc |
and,glands |
R268 |
T1063 |
T1064 |
compound |
hair,follicles |
R269 |
T1064 |
T1060 |
conj |
follicles,glands |
R270 |
T1065 |
T1066 |
punct |
[,1 |
R271 |
T1066 |
T1046 |
parataxis |
1,initiates |
R272 |
T1067 |
T1066 |
punct |
],1 |
R273 |
T1068 |
T1046 |
punct |
.,initiates |
R274 |
T1070 |
T1071 |
det |
The,cells |
R275 |
T1071 |
T1076 |
nsubjpass |
cells,attached |
R276 |
T1072 |
T1071 |
amod |
multipotent,cells |
R277 |
T1073 |
T1071 |
punct |
", ",cells |
R278 |
T1074 |
T1071 |
amod |
adhering,cells |
R279 |
T1075 |
T1071 |
amod |
epithelial,cells |
R280 |
T1077 |
T1076 |
auxpass |
are,attached |
R281 |
T1078 |
T1076 |
advmod |
typically,attached |
R282 |
T1079 |
T1076 |
prep |
to,attached |
R283 |
T1080 |
T1081 |
det |
an,lamina |
R284 |
T1081 |
T1079 |
pobj |
lamina,to |
R285 |
T1082 |
T1081 |
amod |
underlying,lamina |
R286 |
T1083 |
T1081 |
amod |
basal,lamina |
R287 |
T1084 |
T1085 |
dep |
that,polarizes |
R288 |
T1085 |
T1081 |
relcl |
polarizes,lamina |
R289 |
T1086 |
T1087 |
det |
the,sheet |
R290 |
T1087 |
T1085 |
dobj |
sheet,polarizes |
R291 |
T1088 |
T1087 |
amod |
epithelial,sheet |
R292 |
T1089 |
T1085 |
cc |
and,polarizes |
R293 |
T1090 |
T1085 |
conj |
separates,polarizes |
R294 |
T1091 |
T1090 |
dobj |
it,separates |
R295 |
T1092 |
T1090 |
prep |
from,separates |
R296 |
T1093 |
T1094 |
amod |
surrounding,mesenchyme |
R297 |
T1094 |
T1092 |
pobj |
mesenchyme,from |
R298 |
T1095 |
T1076 |
punct |
.,attached |
R299 |
T1097 |
T1098 |
amod |
Budding,morphogenesis |
R300 |
T1098 |
T1099 |
nsubjpass |
morphogenesis,guided |
R301 |
T1100 |
T1099 |
auxpass |
is,guided |
R302 |
T1101 |
T1099 |
agent |
by,guided |
R303 |
T1102 |
T1103 |
det |
a,exchange |
R304 |
T1103 |
T1101 |
pobj |
exchange,by |
R305 |
T1104 |
T1103 |
amod |
reciprocal,exchange |
R306 |
T1105 |
T1103 |
prep |
of,exchange |
R307 |
T1106 |
T1105 |
pobj |
signals,of |
R308 |
T1107 |
T1103 |
prep |
between,exchange |
R309 |
T1108 |
T1107 |
pobj |
epithelium,between |
R310 |
T1109 |
T1108 |
cc |
and,epithelium |
R311 |
T1110 |
T1108 |
conj |
mesenchyme,epithelium |
R312 |
T1111 |
T1112 |
aux |
to,specify |
R313 |
T1112 |
T1103 |
advcl |
specify,exchange |
R314 |
T1113 |
T1114 |
det |
the,identity |
R315 |
T1114 |
T1112 |
dobj |
identity,specify |
R316 |
T1115 |
T1114 |
prep |
of,identity |
R317 |
T1116 |
T1117 |
det |
the,organ |
R318 |
T1117 |
T1115 |
pobj |
organ,of |
R319 |
T1118 |
T1119 |
dep |
that,form |
R320 |
T1119 |
T1117 |
relcl |
form,organ |
R321 |
T1120 |
T1119 |
aux |
will,form |
R322 |
T1121 |
T1112 |
cc |
and,specify |
R323 |
T1122 |
T1123 |
aux |
to,govern |
R324 |
T1123 |
T1112 |
conj |
govern,specify |
R325 |
T1124 |
T1125 |
poss |
its,growth |
R326 |
T1125 |
T1123 |
dobj |
growth,govern |
R327 |
T1126 |
T1099 |
punct |
.,guided |
R328 |
T1128 |
T1129 |
prep |
At,are |
R329 |
T1130 |
T1131 |
det |
the,helm |
R330 |
T1131 |
T1128 |
pobj |
helm,At |
R331 |
T1132 |
T1131 |
prep |
of,helm |
R332 |
T1133 |
T1134 |
det |
these,pathways |
R333 |
T1134 |
T1132 |
pobj |
pathways,of |
R334 |
T1135 |
T1136 |
amod |
molecular,communication |
R335 |
T1136 |
T1134 |
compound |
communication,pathways |
R336 |
T1137 |
T1129 |
nsubj |
Wnts,are |
R337 |
T1138 |
T1137 |
punct |
", ",Wnts |
R338 |
T1139 |
T1140 |
nmod |
bone,proteins |
R339 |
T1140 |
T1137 |
appos |
proteins,Wnts |
R340 |
T1141 |
T1140 |
amod |
morphogenic,proteins |
R341 |
T1142 |
T1140 |
punct |
(,proteins |
R342 |
T1143 |
T1140 |
appos |
BMPs,proteins |
R343 |
T1144 |
T1137 |
punct |
),Wnts |
R344 |
T1145 |
T1137 |
punct |
", ",Wnts |
R345 |
T1146 |
T1147 |
amod |
transforming,βs |
R346 |
T1147 |
T1137 |
appos |
βs,Wnts |
R347 |
T1148 |
T1147 |
compound |
growth,βs |
R348 |
T1149 |
T1147 |
compound |
factor,βs |
R349 |
T1150 |
T1147 |
punct |
(,βs |
R350 |
T1151 |
T1152 |
compound |
TGF,βs |
R351 |
T1152 |
T1147 |
appos |
βs,βs |
R352 |
T1153 |
T1152 |
punct |
-,βs |
R353 |
T1154 |
T1137 |
punct |
),Wnts |
R354 |
T1155 |
T1137 |
punct |
", ",Wnts |
R355 |
T1156 |
T1137 |
cc |
and,Wnts |
R356 |
T1157 |
T1158 |
compound |
fibroblast,factors |
R357 |
T1158 |
T1137 |
conj |
factors,Wnts |
R358 |
T1159 |
T1158 |
compound |
growth,factors |
R359 |
T1160 |
T1158 |
punct |
(,factors |
R360 |
T1161 |
T1158 |
appos |
FGFs,factors |
R361 |
T1162 |
T1129 |
punct |
),are |
R362 |
T1163 |
T1129 |
punct |
.,are |
R363 |
T1165 |
T1166 |
prep |
Through,trigger |
R364 |
T1167 |
T1165 |
pobj |
activation,Through |
R365 |
T1168 |
T1167 |
prep |
of,activation |
R366 |
T1169 |
T1170 |
compound |
cell,surface |
R367 |
T1170 |
T1171 |
compound |
surface,receptors |
R368 |
T1171 |
T1168 |
pobj |
receptors,of |
R369 |
T1172 |
T1171 |
compound |
transmembrane,receptors |
R370 |
T1173 |
T1166 |
punct |
", ",trigger |
R371 |
T1174 |
T1175 |
det |
these,molecules |
R372 |
T1175 |
T1166 |
nsubj |
molecules,trigger |
R373 |
T1176 |
T1175 |
amod |
external,molecules |
R374 |
T1177 |
T1175 |
compound |
signaling,molecules |
R375 |
T1178 |
T1179 |
amod |
distinct,cascades |
R376 |
T1179 |
T1166 |
dobj |
cascades,trigger |
R377 |
T1180 |
T1179 |
prep |
of,cascades |
R378 |
T1181 |
T1182 |
amod |
intracellular,events |
R379 |
T1182 |
T1180 |
pobj |
events,of |
R380 |
T1183 |
T1184 |
dep |
that,culminate |
R381 |
T1184 |
T1179 |
relcl |
culminate,cascades |
R382 |
T1185 |
T1184 |
prep |
in,culminate |
R383 |
T1186 |
T1185 |
pobj |
changes,in |
R384 |
T1187 |
T1186 |
prep |
in,changes |
R385 |
T1188 |
T1189 |
compound |
gene,expression |
R386 |
T1189 |
T1187 |
pobj |
expression,in |
R387 |
T1190 |
T1189 |
punct |
", ",expression |
R388 |
T1191 |
T1189 |
conj |
growth,expression |
R389 |
T1192 |
T1191 |
punct |
", ",growth |
R390 |
T1193 |
T1191 |
cc |
and,growth |
R391 |
T1194 |
T1191 |
conj |
differentiation,growth |
R392 |
T1195 |
T1196 |
punct |
[,2 |
R393 |
T1196 |
T1166 |
parataxis |
2,trigger |
R394 |
T1197 |
T1196 |
punct |
],2 |
R395 |
T1198 |
T1166 |
punct |
.,trigger |
R396 |
T1200 |
T1201 |
advmod |
How,collaborates |
R397 |
T1201 |
T1206 |
csubj |
collaborates,has |
R398 |
T1202 |
T1203 |
det |
this,constellation |
R399 |
T1203 |
T1201 |
nsubj |
constellation,collaborates |
R400 |
T1204 |
T1203 |
prep |
of,constellation |
R401 |
T1205 |
T1204 |
pobj |
signals,of |
R402 |
T1207 |
T1201 |
prep |
in,collaborates |
R403 |
T1208 |
T1207 |
pcomp |
tailoring,in |
R404 |
T1209 |
T1210 |
det |
each,process |
R405 |
T1210 |
T1208 |
dobj |
process,tailoring |
R406 |
T1211 |
T1210 |
compound |
budding,process |
R407 |
T1212 |
T1213 |
mark |
so,executes |
R408 |
T1213 |
T1208 |
advcl |
executes,tailoring |
R409 |
T1214 |
T1213 |
mark |
that,executes |
R410 |
T1215 |
T1213 |
nsubj |
it,executes |
R411 |
T1216 |
T1217 |
det |
a,program |
R412 |
T1217 |
T1213 |
dobj |
program,executes |
R413 |
T1218 |
T1217 |
amod |
distinct,program |
R414 |
T1219 |
T1217 |
amod |
morphogenetic,program |
R415 |
T1220 |
T1221 |
advmod |
yet,defined |
R416 |
T1221 |
T1206 |
xcomp |
defined,has |
R417 |
T1222 |
T1221 |
aux |
to,defined |
R418 |
T1223 |
T1221 |
auxpass |
be,defined |
R419 |
T1224 |
T1221 |
advmod |
comprehensively,defined |
R420 |
T1225 |
T1206 |
punct |
.,has |
R421 |
T1227 |
T1228 |
advmod |
However,appears |
R422 |
T1229 |
T1228 |
punct |
", ",appears |
R423 |
T1230 |
T1231 |
det |
the,process |
R424 |
T1231 |
T1228 |
nsubj |
process,appears |
R425 |
T1232 |
T1233 |
aux |
to,patterned |
R426 |
T1233 |
T1228 |
xcomp |
patterned,appears |
R427 |
T1234 |
T1233 |
auxpass |
be,patterned |
R428 |
T1235 |
T1233 |
prep |
at,patterned |
R429 |
T1236 |
T1237 |
det |
the,stages |
R430 |
T1237 |
T1235 |
pobj |
stages,at |
R431 |
T1238 |
T1237 |
amod |
initial,stages |
R432 |
T1239 |
T1237 |
prep |
of,stages |
R433 |
T1240 |
T1241 |
compound |
bud,formation |
R434 |
T1241 |
T1239 |
pobj |
formation,of |
R435 |
T1242 |
T1228 |
punct |
", ",appears |
R436 |
T1243 |
T1244 |
mark |
since,differ |
R437 |
T1244 |
T1228 |
advcl |
differ,appears |
R438 |
T1245 |
T1246 |
det |
the,importance |
R439 |
T1246 |
T1244 |
nsubj |
importance,differ |
R440 |
T1247 |
T1246 |
amod |
relative,importance |
R441 |
T1248 |
T1246 |
prep |
of,importance |
R442 |
T1249 |
T1250 |
det |
these,pathways |
R443 |
T1250 |
T1248 |
pobj |
pathways,of |
R444 |
T1251 |
T1250 |
cc |
and,pathways |
R445 |
T1252 |
T1253 |
poss |
their,effectors |
R446 |
T1253 |
T1250 |
conj |
effectors,pathways |
R447 |
T1254 |
T1253 |
amod |
downstream,effectors |
R448 |
T1255 |
T1256 |
mark |
as,begin |
R449 |
T1256 |
T1244 |
advcl |
begin,differ |
R450 |
T1257 |
T1256 |
nsubj |
buds,begin |
R451 |
T1258 |
T1259 |
aux |
to,develop |
R452 |
T1259 |
T1256 |
xcomp |
develop,begin |
R453 |
T1260 |
T1256 |
cc |
and,begin |
R454 |
T1261 |
T1262 |
compound |
cell,fates |
R455 |
T1262 |
T1263 |
nsubjpass |
fates,specified |
R456 |
T1263 |
T1256 |
conj |
specified,begin |
R457 |
T1264 |
T1263 |
auxpass |
are,specified |
R458 |
T1265 |
T1228 |
punct |
.,appears |
R459 |
T1267 |
T1268 |
det |
The,development |
R460 |
T1268 |
T1269 |
nsubj |
development,requires |
R461 |
T1270 |
T1268 |
prep |
of,development |
R462 |
T1271 |
T1272 |
det |
a,bud |
R463 |
T1272 |
T1270 |
pobj |
bud,of |
R464 |
T1273 |
T1274 |
det |
a,number |
R465 |
T1274 |
T1269 |
dobj |
number,requires |
R466 |
T1275 |
T1274 |
prep |
of,number |
R467 |
T1276 |
T1277 |
amod |
coordinated,changes |
R468 |
T1277 |
T1275 |
pobj |
changes,of |
R469 |
T1278 |
T1277 |
prep |
in,changes |
R470 |
T1279 |
T1280 |
det |
the,behavior |
R471 |
T1280 |
T1278 |
pobj |
behavior,in |
R472 |
T1281 |
T1280 |
prep |
of,behavior |
R473 |
T1282 |
T1283 |
det |
the,cells |
R474 |
T1283 |
T1281 |
pobj |
cells,of |
R475 |
T1284 |
T1283 |
amod |
targeted,cells |
R476 |
T1285 |
T1280 |
prep |
within,behavior |
R477 |
T1286 |
T1287 |
det |
an,sheet |
R478 |
T1287 |
T1285 |
pobj |
sheet,within |
R479 |
T1288 |
T1287 |
amod |
epithelial,sheet |
R480 |
T1289 |
T1269 |
punct |
.,requires |
R481 |
T1291 |
T1292 |
det |
The,process |
R482 |
T1292 |
T1293 |
nsubjpass |
process,accompanied |
R483 |
T1294 |
T1293 |
aux |
must,accompanied |
R484 |
T1295 |
T1293 |
auxpass |
be,accompanied |
R485 |
T1296 |
T1293 |
prep |
by,accompanied |
R486 |
T1297 |
T1296 |
pobj |
alterations,by |
R487 |
T1298 |
T1297 |
prep |
in,alterations |
R488 |
T1299 |
T1300 |
det |
the,proliferation |
R489 |
T1300 |
T1298 |
pobj |
proliferation,in |
R490 |
T1301 |
T1300 |
punct |
", ",proliferation |
R491 |
T1302 |
T1300 |
conj |
polarity,proliferation |
R492 |
T1303 |
T1302 |
punct |
", ",polarity |
R493 |
T1304 |
T1302 |
conj |
shape,polarity |
R494 |
T1305 |
T1304 |
punct |
", ",shape |
R495 |
T1306 |
T1304 |
cc |
and,shape |
R496 |
T1307 |
T1304 |
conj |
adhesiveness,shape |
R497 |
T1308 |
T1300 |
prep |
of,proliferation |
R498 |
T1309 |
T1310 |
amod |
selected,cells |
R499 |
T1310 |
T1308 |
pobj |
cells,of |
R500 |
T1311 |
T1296 |
punct |
", ",by |
R501 |
T1312 |
T1313 |
advmod |
as,as |
R502 |
T1313 |
T1296 |
cc |
as,by |
R503 |
T1314 |
T1313 |
advmod |
well,as |
R504 |
T1315 |
T1296 |
conj |
by,by |
R505 |
T1316 |
T1315 |
pobj |
modifications,by |
R506 |
T1317 |
T1316 |
prep |
in,modifications |
R507 |
T1318 |
T1319 |
poss |
their,lamina |
R508 |
T1319 |
T1317 |
pobj |
lamina,in |
R509 |
T1320 |
T1319 |
amod |
underlying,lamina |
R510 |
T1321 |
T1319 |
amod |
basal,lamina |
R511 |
T1322 |
T1293 |
punct |
.,accompanied |
R512 |
T1324 |
T1325 |
advmod |
Thus,orchestrated |
R513 |
T1326 |
T1325 |
punct |
", ",orchestrated |
R514 |
T1327 |
T1328 |
amod |
extracellular,crosstalk |
R515 |
T1328 |
T1325 |
nsubjpass |
crosstalk,orchestrated |
R516 |
T1329 |
T1330 |
amod |
epithelial,mesenchymal |
R517 |
T1330 |
T1328 |
amod |
mesenchymal,crosstalk |
R518 |
T1331 |
T1330 |
punct |
-,mesenchymal |
R519 |
T1332 |
T1325 |
aux |
must,orchestrated |
R520 |
T1333 |
T1325 |
auxpass |
be,orchestrated |
R521 |
T1334 |
T1325 |
advmod |
intricately,orchestrated |
R522 |
T1335 |
T1336 |
aux |
to,couple |
R523 |
T1336 |
T1325 |
advcl |
couple,orchestrated |
R524 |
T1337 |
T1338 |
det |
the,determination |
R525 |
T1338 |
T1336 |
dobj |
determination,couple |
R526 |
T1339 |
T1338 |
prep |
of,determination |
R527 |
T1340 |
T1341 |
amod |
distinct,fates |
R528 |
T1341 |
T1339 |
pobj |
fates,of |
R529 |
T1342 |
T1341 |
compound |
cell,fates |
R530 |
T1343 |
T1336 |
prep |
with,couple |
R531 |
T1344 |
T1345 |
det |
the,remodeling |
R532 |
T1345 |
T1343 |
pobj |
remodeling,with |
R533 |
T1346 |
T1345 |
amod |
contemporaneous,remodeling |
R534 |
T1347 |
T1345 |
prep |
of,remodeling |
R535 |
T1348 |
T1349 |
det |
the,properties |
R536 |
T1349 |
T1347 |
pobj |
properties,of |
R537 |
T1350 |
T1349 |
amod |
physical,properties |
R538 |
T1351 |
T1350 |
cc |
and,physical |
R539 |
T1352 |
T1350 |
conj |
structural,physical |
R540 |
T1353 |
T1349 |
prep |
of,properties |
R541 |
T1354 |
T1355 |
det |
the,cell |
R542 |
T1355 |
T1353 |
pobj |
cell,of |
R543 |
T1356 |
T1325 |
punct |
.,orchestrated |
R544 |
T1358 |
T1359 |
prep |
Among,offer |
R545 |
T1360 |
T1361 |
det |
the,organs |
R546 |
T1361 |
T1358 |
pobj |
organs,Among |
R547 |
T1362 |
T1361 |
amod |
few,organs |
R548 |
T1363 |
T1361 |
amod |
dispensable,organs |
R549 |
T1364 |
T1359 |
punct |
", ",offer |
R550 |
T1365 |
T1366 |
compound |
hair,follicles |
R551 |
T1366 |
T1359 |
nsubj |
follicles,offer |
R552 |
T1367 |
T1368 |
det |
an,system |
R553 |
T1368 |
T1359 |
dobj |
system,offer |
R554 |
T1369 |
T1368 |
amod |
excellent,system |
R555 |
T1370 |
T1368 |
compound |
model,system |
R556 |
T1371 |
T1372 |
aux |
to,study |
R557 |
T1372 |
T1368 |
advcl |
study,system |
R558 |
T1373 |
T1374 |
amod |
epithelial,bud |
R559 |
T1374 |
T1375 |
compound |
bud,formation |
R560 |
T1375 |
T1372 |
dobj |
formation,study |
R561 |
T1376 |
T1359 |
punct |
.,offer |
R562 |
T1378 |
T1379 |
amod |
Mammalian,epithelium |
R563 |
T1379 |
T1381 |
nsubj |
epithelium,begins |
R564 |
T1380 |
T1379 |
compound |
skin,epithelium |
R565 |
T1382 |
T1381 |
prep |
as,begins |
R566 |
T1383 |
T1384 |
det |
a,sheet |
R567 |
T1384 |
T1382 |
pobj |
sheet,as |
R568 |
T1385 |
T1384 |
amod |
single,sheet |
R569 |
T1386 |
T1384 |
prep |
of,sheet |
R570 |
T1387 |
T1388 |
amod |
multipotent,cells |
R571 |
T1388 |
T1386 |
pobj |
cells,of |
R572 |
T1389 |
T1388 |
amod |
ectodermal,cells |
R573 |
T1390 |
T1381 |
punct |
.,begins |
R574 |
T1392 |
T1393 |
prep |
During,populate |
R575 |
T1394 |
T1392 |
pobj |
development,During |
R576 |
T1395 |
T1393 |
punct |
", ",populate |
R577 |
T1396 |
T1397 |
amod |
specialized,cells |
R578 |
T1397 |
T1393 |
nsubj |
cells,populate |
R579 |
T1398 |
T1397 |
amod |
mesenchymal,cells |
R580 |
T1399 |
T1400 |
det |
the,skin |
R581 |
T1400 |
T1393 |
dobj |
skin,populate |
R582 |
T1401 |
T1393 |
prep |
in,populate |
R583 |
T1402 |
T1403 |
det |
a,pattern |
R584 |
T1403 |
T1401 |
pobj |
pattern,in |
R585 |
T1404 |
T1405 |
advmod |
spatially,defined |
R586 |
T1405 |
T1403 |
amod |
defined,pattern |
R587 |
T1406 |
T1407 |
aux |
to,initiate |
R588 |
T1407 |
T1393 |
advcl |
initiate,populate |
R589 |
T1408 |
T1409 |
det |
the,crosstalk |
R590 |
T1409 |
T1407 |
dobj |
crosstalk,initiate |
R591 |
T1410 |
T1409 |
amod |
complex,crosstalk |
R592 |
T1411 |
T1412 |
amod |
epithelial,mesenchymal |
R593 |
T1412 |
T1409 |
amod |
mesenchymal,crosstalk |
R594 |
T1413 |
T1412 |
punct |
-,mesenchymal |
R595 |
T1414 |
T1415 |
dep |
that,specify |
R596 |
T1415 |
T1409 |
relcl |
specify,crosstalk |
R597 |
T1416 |
T1415 |
aux |
will,specify |
R598 |
T1417 |
T1418 |
det |
the,bud |
R599 |
T1418 |
T1415 |
dobj |
bud,specify |
R600 |
T1419 |
T1420 |
punct |
[,3 |
R601 |
T1420 |
T1393 |
parataxis |
3,populate |
R602 |
T1421 |
T1420 |
punct |
],3 |
R603 |
T1422 |
T1393 |
punct |
.,populate |
R604 |
T1424 |
T1425 |
mark |
Once,committed |
R605 |
T1425 |
T1426 |
advcl |
committed,instructs |
R606 |
T1427 |
T1426 |
punct |
", ",instructs |
R607 |
T1428 |
T1429 |
det |
a,cluster |
R608 |
T1429 |
T1426 |
nsubj |
cluster,instructs |
R609 |
T1430 |
T1429 |
amod |
small,cluster |
R610 |
T1431 |
T1429 |
prep |
of,cluster |
R611 |
T1432 |
T1433 |
amod |
epithelial,cells |
R612 |
T1433 |
T1431 |
pobj |
cells,of |
R613 |
T1434 |
T1429 |
punct |
", ",cluster |
R614 |
T1435 |
T1436 |
det |
the,placode |
R615 |
T1436 |
T1429 |
appos |
placode,cluster |
R616 |
T1437 |
T1426 |
punct |
", ",instructs |
R617 |
T1438 |
T1439 |
det |
a,group |
R618 |
T1439 |
T1440 |
nsubj |
group,condense |
R619 |
T1440 |
T1426 |
ccomp |
condense,instructs |
R620 |
T1441 |
T1439 |
prep |
of,group |
R621 |
T1442 |
T1443 |
amod |
underlying,cells |
R622 |
T1443 |
T1441 |
pobj |
cells,of |
R623 |
T1444 |
T1443 |
amod |
mesenchymal,cells |
R624 |
T1445 |
T1440 |
aux |
to,condense |
R625 |
T1446 |
T1440 |
cc |
and,condense |
R626 |
T1447 |
T1440 |
conj |
form,condense |
R627 |
T1448 |
T1449 |
det |
the,papilla |
R628 |
T1449 |
T1447 |
dobj |
papilla,form |
R629 |
T1450 |
T1449 |
amod |
nascent,papilla |
R630 |
T1451 |
T1449 |
amod |
dermal,papilla |
R631 |
T1452 |
T1449 |
punct |
", ",papilla |
R632 |
T1453 |
T1454 |
dep |
which,be |
R633 |
T1454 |
T1449 |
relcl |
be,papilla |
R634 |
T1455 |
T1454 |
aux |
will,be |
R635 |
T1456 |
T1457 |
det |
a,fixture |
R636 |
T1457 |
T1454 |
attr |
fixture,be |
R637 |
T1458 |
T1457 |
amod |
permanent,fixture |
R638 |
T1459 |
T1457 |
prep |
of,fixture |
R639 |
T1460 |
T1461 |
det |
the,follicle |
R640 |
T1461 |
T1459 |
pobj |
follicle,of |
R641 |
T1462 |
T1461 |
compound |
hair,follicle |
R642 |
T1463 |
T1426 |
punct |
.,instructs |
R643 |
T1465 |
T1466 |
amod |
Subsequent,exchanges |
R644 |
T1466 |
T1467 |
nsubj |
exchanges,result |
R645 |
T1468 |
T1466 |
prep |
between,exchanges |
R646 |
T1469 |
T1470 |
det |
the,placode |
R647 |
T1470 |
T1468 |
pobj |
placode,between |
R648 |
T1471 |
T1470 |
cc |
and,placode |
R649 |
T1472 |
T1473 |
amod |
nascent,papilla |
R650 |
T1473 |
T1470 |
conj |
papilla,placode |
R651 |
T1474 |
T1473 |
amod |
dermal,papilla |
R652 |
T1475 |
T1467 |
prep |
in,result |
R653 |
T1476 |
T1477 |
amod |
further,growth |
R654 |
T1477 |
T1475 |
pobj |
growth,in |
R655 |
T1478 |
T1477 |
prep |
of,growth |
R656 |
T1479 |
T1480 |
det |
the,follicle |
R657 |
T1480 |
T1478 |
pobj |
follicle,of |
R658 |
T1481 |
T1477 |
prep |
into,growth |
R659 |
T1482 |
T1483 |
det |
the,dermis |
R660 |
T1483 |
T1481 |
pobj |
dermis,into |
R661 |
T1484 |
T1483 |
amod |
underlying,dermis |
R662 |
T1485 |
T1477 |
punct |
", ",growth |
R663 |
T1486 |
T1477 |
cc |
or,growth |
R664 |
T1487 |
T1488 |
amod |
down,growth |
R665 |
T1488 |
T1477 |
conj |
growth,growth |
R666 |
T1489 |
T1488 |
punct |
-,growth |
R667 |
T1490 |
T1488 |
punct |
", ",growth |
R668 |
T1491 |
T1488 |
cc |
and,growth |
R669 |
T1492 |
T1493 |
amod |
eventual,differentiation |
R670 |
T1493 |
T1488 |
conj |
differentiation,growth |
R671 |
T1494 |
T1493 |
prep |
into,differentiation |
R672 |
T1495 |
T1496 |
det |
the,layers |
R673 |
T1496 |
T1494 |
pobj |
layers,into |
R674 |
T1497 |
T1496 |
nummod |
six,layers |
R675 |
T1498 |
T1496 |
amod |
concentric,layers |
R676 |
T1499 |
T1496 |
prep |
of,layers |
R677 |
T1500 |
T1501 |
det |
the,follicle |
R678 |
T1501 |
T1499 |
pobj |
follicle,of |
R679 |
T1502 |
T1501 |
amod |
mature,follicle |
R680 |
T1503 |
T1467 |
punct |
.,result |
R681 |
T1505 |
T1506 |
advmod |
Previously,delineated |
R682 |
T1507 |
T1506 |
punct |
", ",delineated |
R683 |
T1508 |
T1506 |
nsubj |
we,delineated |
R684 |
T1509 |
T1510 |
advmod |
how,function |
R685 |
T1510 |
T1506 |
ccomp |
function,delineated |
R686 |
T1511 |
T1512 |
nummod |
two,signals |
R687 |
T1512 |
T1510 |
nsubj |
signals,function |
R688 |
T1513 |
T1512 |
amod |
respective,signals |
R689 |
T1514 |
T1512 |
amod |
epithelial,signals |
R690 |
T1515 |
T1514 |
cc |
and,epithelial |
R691 |
T1516 |
T1514 |
conj |
mesenchymal,epithelial |
R692 |
T1517 |
T1512 |
punct |
", ",signals |
R693 |
T1518 |
T1512 |
appos |
Wnts,signals |
R694 |
T1519 |
T1518 |
cc |
and,Wnts |
R695 |
T1520 |
T1521 |
det |
the,factor |
R696 |
T1521 |
T1518 |
conj |
factor,Wnts |
R697 |
T1522 |
T1523 |
npadvmod |
BMP,inhibitory |
R698 |
T1523 |
T1521 |
amod |
inhibitory,factor |
R699 |
T1524 |
T1523 |
punct |
-,inhibitory |
R700 |
T1525 |
T1521 |
appos |
noggin,factor |
R701 |
T1526 |
T1510 |
punct |
", ",function |
R702 |
T1527 |
T1510 |
prep |
in,function |
R703 |
T1528 |
T1527 |
pobj |
concert,in |
R704 |
T1529 |
T1530 |
aux |
to,induce |
R705 |
T1530 |
T1510 |
advcl |
induce,function |
R706 |
T1531 |
T1532 |
amod |
lymphoid,factor |
R707 |
T1532 |
T1534 |
npadvmod |
factor,mediated |
R708 |
T1533 |
T1532 |
compound |
enhancer,factor |
R709 |
T1534 |
T1551 |
amod |
mediated,transcription |
R710 |
T1535 |
T1532 |
punct |
-,factor |
R711 |
T1536 |
T1532 |
nummod |
1,factor |
R712 |
T1537 |
T1532 |
punct |
/,factor |
R713 |
T1538 |
T1539 |
compound |
β,catenin |
R714 |
T1539 |
T1532 |
appos |
catenin,factor |
R715 |
T1540 |
T1539 |
punct |
-,catenin |
R716 |
T1541 |
T1532 |
punct |
(,factor |
R717 |
T1542 |
T1532 |
appos |
LEF,factor |
R718 |
T1543 |
T1542 |
punct |
-,LEF |
R719 |
T1544 |
T1542 |
nummod |
1,LEF |
R720 |
T1545 |
T1542 |
punct |
/,LEF |
R721 |
T1546 |
T1547 |
compound |
β,catenin |
R722 |
T1547 |
T1542 |
appos |
catenin,LEF |
R723 |
T1548 |
T1547 |
punct |
-,catenin |
R724 |
T1549 |
T1534 |
punct |
),mediated |
R725 |
T1550 |
T1534 |
punct |
-,mediated |
R726 |
T1551 |
T1530 |
dobj |
transcription,induce |
R727 |
T1552 |
T1551 |
compound |
gene,transcription |
R728 |
T1553 |
T1530 |
prep |
within,induce |
R729 |
T1554 |
T1555 |
det |
the,placode |
R730 |
T1555 |
T1553 |
pobj |
placode,within |
R731 |
T1556 |
T1555 |
compound |
follicle,placode |
R732 |
T1557 |
T1558 |
punct |
[,4 |
R733 |
T1558 |
T1506 |
parataxis |
4,delineated |
R734 |
T1559 |
T1558 |
punct |
],4 |
R735 |
T1560 |
T1506 |
punct |
.,delineated |
R736 |
T1562 |
T1563 |
det |
The,changes |
R737 |
T1563 |
T1565 |
nsubj |
changes,include |
R738 |
T1564 |
T1563 |
amod |
downstream,changes |
R739 |
T1566 |
T1563 |
acl |
elicited,changes |
R740 |
T1567 |
T1566 |
prep |
through,elicited |
R741 |
T1568 |
T1567 |
pobj |
convergence,through |
R742 |
T1569 |
T1568 |
prep |
of,convergence |
R743 |
T1675 |
T1677 |
compound |
cell,contact |
R744 |
T1676 |
T1675 |
punct |
-,cell |
R745 |
T1677 |
T1673 |
pobj |
contact,of |
R746 |
T1678 |
T1671 |
punct |
", ",recruit |
R747 |
T1679 |
T1671 |
advmod |
however,recruit |
R748 |
T1570 |
T1571 |
det |
these,pathways |
R749 |
T1680 |
T1671 |
punct |
", ",recruit |
R750 |
T1571 |
T1569 |
pobj |
pathways,of |
R751 |
T1681 |
T1682 |
nmod |
E,cadherin |
R752 |
T1572 |
T1571 |
nummod |
two,pathways |
R753 |
T1573 |
T1571 |
amod |
early,pathways |
R754 |
T1682 |
T1684 |
nmod |
cadherin,complexes |
R755 |
T1574 |
T1571 |
compound |
signaling,pathways |
R756 |
T1575 |
T1576 |
amod |
down,regulation |
R757 |
T1683 |
T1682 |
punct |
-,cadherin |
R758 |
T1576 |
T1565 |
dobj |
regulation,include |
R759 |
T1577 |
T1576 |
punct |
-,regulation |
R760 |
T1578 |
T1576 |
prep |
of,regulation |
R761 |
T1684 |
T1671 |
nsubj |
complexes,recruit |
R762 |
T1579 |
T1580 |
det |
the,gene |
R763 |
T1580 |
T1578 |
pobj |
gene,of |
R764 |
T1685 |
T1682 |
punct |
-,cadherin |
R765 |
T1581 |
T1580 |
acl |
encoding,gene |
R766 |
T1582 |
T1583 |
compound |
E,cadherin |
R767 |
T1583 |
T1581 |
dobj |
cadherin,encoding |
R768 |
T1686 |
T1687 |
compound |
β,catenin |
R769 |
T1584 |
T1583 |
punct |
-,cadherin |
R770 |
T1585 |
T1583 |
punct |
", ",cadherin |
R771 |
T1586 |
T1587 |
det |
the,cadherin |
R772 |
T1687 |
T1682 |
appos |
catenin,cadherin |
R773 |
T1587 |
T1583 |
appos |
cadherin,cadherin |
R774 |
T1588 |
T1587 |
amod |
prototypical,cadherin |
R775 |
T1688 |
T1687 |
punct |
-,catenin |
R776 |
T1589 |
T1587 |
amod |
epithelial,cadherin |
R777 |
T1590 |
T1591 |
dep |
that,forms |
R778 |
T1591 |
T1587 |
relcl |
forms,cadherin |
R779 |
T1689 |
T1690 |
compound |
α,catenin |
R780 |
T1592 |
T1593 |
det |
the,core |
R781 |
T1593 |
T1591 |
dobj |
core,forms |
R782 |
T1690 |
T1671 |
dobj |
catenin,recruit |
R783 |
T1594 |
T1593 |
amod |
transmembrane,core |
R784 |
T1595 |
T1593 |
prep |
of,core |
R785 |
T1596 |
T1597 |
amod |
intercellular,junctions |
R786 |
T1691 |
T1690 |
punct |
-,catenin |
R787 |
T1597 |
T1595 |
pobj |
junctions,of |
R788 |
T1598 |
T1597 |
compound |
adherens,junctions |
R789 |
T1599 |
T1597 |
punct |
(,junctions |
R790 |
T1692 |
T1690 |
punct |
", ",catenin |
R791 |
T1600 |
T1597 |
appos |
AJs,junctions |
R792 |
T1601 |
T1565 |
punct |
),include |
R793 |
T1602 |
T1603 |
punct |
[,5 |
R794 |
T1603 |
T1565 |
parataxis |
5,include |
R795 |
T1604 |
T1603 |
punct |
],5 |
R796 |
T1693 |
T1694 |
dep |
which,coordinates |
R797 |
T1605 |
T1565 |
punct |
.,include |
R798 |
T1607 |
T1608 |
nsubj |
We,showed |
R799 |
T1694 |
T1690 |
relcl |
coordinates,catenin |
R800 |
T1609 |
T1608 |
advmod |
subsequently,showed |
R801 |
T1695 |
T1694 |
prep |
in,coordinates |
R802 |
T1610 |
T1611 |
mark |
that,blocked |
R803 |
T1696 |
T1695 |
pobj |
turn,in |
R804 |
T1611 |
T1608 |
ccomp |
blocked,showed |
R805 |
T1697 |
T1698 |
det |
the,dynamics |
R806 |
T1612 |
T1613 |
advmod |
when,elevated |
R807 |
T1613 |
T1611 |
advcl |
elevated,blocked |
R808 |
T1698 |
T1694 |
dobj |
dynamics,coordinates |
R809 |
T1614 |
T1615 |
compound |
E,cadherin |
R810 |
T1615 |
T1613 |
nsubjpass |
cadherin,elevated |
R811 |
T1616 |
T1615 |
punct |
-,cadherin |
R812 |
T1699 |
T1698 |
amod |
associated,dynamics |
R813 |
T1617 |
T1613 |
auxpass |
is,elevated |
R814 |
T1618 |
T1613 |
advmod |
transgenically,elevated |
R815 |
T1700 |
T1698 |
compound |
actin,dynamics |
R816 |
T1619 |
T1613 |
prep |
in,elevated |
R817 |
T1620 |
T1621 |
compound |
mouse,skin |
R818 |
T1621 |
T1619 |
pobj |
skin,in |
R819 |
T1701 |
T1698 |
compound |
polymerization,dynamics |
R820 |
T1622 |
T1611 |
punct |
", ",blocked |
R821 |
T1623 |
T1624 |
compound |
hair,follicle |
R822 |
T1624 |
T1625 |
compound |
follicle,morphogenesis |
R823 |
T1702 |
T1698 |
amod |
necessary,dynamics |
R824 |
T1625 |
T1611 |
nsubjpass |
morphogenesis,blocked |
R825 |
T1626 |
T1611 |
auxpass |
is,blocked |
R826 |
T1627 |
T1611 |
punct |
", ",blocked |
R827 |
T1703 |
T1704 |
aux |
to,stabilize |
R828 |
T1628 |
T1611 |
advcl |
suggesting,blocked |
R829 |
T1629 |
T1630 |
mark |
that,is |
R830 |
T1630 |
T1628 |
ccomp |
is,suggesting |
R831 |
T1704 |
T1702 |
xcomp |
stabilize,necessary |
R832 |
T1631 |
T1632 |
nmod |
E,cadherin |
R833 |
T1632 |
T1634 |
nmod |
cadherin,regulation |
R834 |
T1705 |
T1706 |
amod |
nascent,AJs |
R835 |
T1633 |
T1632 |
punct |
-,cadherin |
R836 |
T1634 |
T1630 |
nsubj |
regulation,is |
R837 |
T1635 |
T1634 |
amod |
down,regulation |
R838 |
T1706 |
T1704 |
dobj |
AJs,stabilize |
R839 |
T1636 |
T1634 |
punct |
-,regulation |
R840 |
T1637 |
T1638 |
det |
a,event |
R841 |
T1638 |
T1630 |
attr |
event,is |
R842 |
T1639 |
T1638 |
amod |
critical,event |
R843 |
T1640 |
T1638 |
prep |
in,event |
R844 |
T1707 |
T1704 |
cc |
and,stabilize |
R845 |
T1708 |
T1704 |
conj |
integrate,stabilize |
R846 |
T1641 |
T1640 |
pcomp |
governing,in |
R847 |
T1709 |
T1710 |
det |
the,cytoskeleton |
R848 |
T1642 |
T1643 |
det |
the,dynamics |
R849 |
T1643 |
T1641 |
dobj |
dynamics,governing |
R850 |
T1644 |
T1643 |
compound |
adhesion,dynamics |
R851 |
T1710 |
T1708 |
dobj |
cytoskeleton,integrate |
R852 |
T1645 |
T1643 |
amod |
necessary,dynamics |
R853 |
T1646 |
T1645 |
prep |
for,necessary |
R854 |
T1647 |
T1648 |
compound |
budding,morphogenesis |
R855 |
T1711 |
T1708 |
prep |
across,integrate |
R856 |
T1648 |
T1646 |
pobj |
morphogenesis,for |
R857 |
T1649 |
T1650 |
punct |
[,4 |
R858 |
T1712 |
T1713 |
det |
an,sheet |
R859 |
T1650 |
T1608 |
parataxis |
4,showed |
R860 |
T1651 |
T1650 |
punct |
],4 |
R861 |
T1652 |
T1608 |
punct |
.,showed |
R862 |
T1713 |
T1711 |
pobj |
sheet,across |
R863 |
T1654 |
T1655 |
prep |
Like,binds |
R864 |
T1714 |
T1713 |
amod |
epithelial,sheet |
R865 |
T1656 |
T1654 |
pobj |
LEF,Like |
R866 |
T1657 |
T1656 |
punct |
-,LEF |
R867 |
T1715 |
T1716 |
punct |
[,8 |
R868 |
T1658 |
T1656 |
nummod |
1,LEF |
R869 |
T1659 |
T1655 |
punct |
", ",binds |
R870 |
T1660 |
T1661 |
compound |
E,cadherin |
R871 |
T1661 |
T1655 |
nsubj |
cadherin,binds |
R872 |
T1716 |
T1694 |
parataxis |
8,coordinates |
R873 |
T1662 |
T1661 |
punct |
-,cadherin |
R874 |
T1663 |
T1655 |
advmod |
also,binds |
R875 |
T1717 |
T1716 |
nummod |
6,8 |
R876 |
T1664 |
T1655 |
prep |
to,binds |
R877 |
T1665 |
T1666 |
compound |
β,catenin |
R878 |
T1666 |
T1664 |
pobj |
catenin,to |
R879 |
T1718 |
T1716 |
punct |
",",8 |
R880 |
T1667 |
T1666 |
punct |
-,catenin |
R881 |
T1668 |
T1655 |
punct |
.,binds |
R882 |
T1719 |
T1716 |
nummod |
7,8 |
R883 |
T1670 |
T1671 |
prep |
At,recruit |
R884 |
T1720 |
T1716 |
punct |
",",8 |
R885 |
T1672 |
T1670 |
pobj |
sites,At |
R886 |
T1673 |
T1672 |
prep |
of,sites |
R887 |
T1674 |
T1675 |
compound |
cell,cell |
R888 |
T1721 |
T1716 |
punct |
],8 |
R889 |
T1722 |
T1671 |
punct |
.,recruit |
R890 |
T1724 |
T1725 |
compound |
α,Catenin |
R891 |
T1725 |
T1727 |
nsubj |
Catenin,binds |
R892 |
T1726 |
T1725 |
punct |
-,Catenin |
R893 |
T1780 |
T1779 |
compound |
protein,kinase |
R894 |
T1781 |
T1779 |
punct |
(,kinase |
R895 |
T1782 |
T1779 |
appos |
MAPK,kinase |
R896 |
T1728 |
T1727 |
advmod |
also,binds |
R897 |
T1783 |
T1773 |
punct |
),pathway |
R898 |
T1784 |
T1785 |
punct |
[,10 |
R899 |
T1729 |
T1727 |
prep |
to,binds |
R900 |
T1785 |
T1727 |
parataxis |
10,binds |
R901 |
T1786 |
T1785 |
nummod |
9,10 |
R902 |
T1730 |
T1731 |
det |
the,protein |
R903 |
T1787 |
T1785 |
punct |
",",10 |
R904 |
T1788 |
T1785 |
punct |
],10 |
R905 |
T1731 |
T1729 |
pobj |
protein,to |
R906 |
T1789 |
T1727 |
punct |
.,binds |
R907 |
T1732 |
T1731 |
nmod |
class,protein |
R908 |
T1791 |
T1792 |
prep |
Through,appear |
R909 |
T1793 |
T1794 |
det |
these,links |
R910 |
T1733 |
T1732 |
nummod |
III,class |
R911 |
T1794 |
T1791 |
pobj |
links,Through |
R912 |
T1795 |
T1792 |
punct |
", ",appear |
R913 |
T1734 |
T1731 |
nmod |
Lin,protein |
R914 |
T1796 |
T1792 |
nsubj |
AJs,appear |
R915 |
T1797 |
T1792 |
oprd |
able,appear |
R916 |
T1798 |
T1799 |
aux |
to,couple |
R917 |
T1735 |
T1734 |
punct |
-,Lin |
R918 |
T1799 |
T1797 |
xcomp |
couple,able |
R919 |
T1800 |
T1799 |
dobj |
adhesion,couple |
R920 |
T1736 |
T1734 |
nummod |
1,Lin |
R921 |
T1801 |
T1799 |
prep |
with,couple |
R922 |
T1802 |
T1803 |
amod |
cytoskeletal,dynamics |
R923 |
T1803 |
T1801 |
pobj |
dynamics,with |
R924 |
T1737 |
T1734 |
punct |
", ",Lin |
R925 |
T1804 |
T1805 |
advmod |
as,as |
R926 |
T1805 |
T1801 |
cc |
as,with |
R927 |
T1806 |
T1805 |
advmod |
well,as |
R928 |
T1738 |
T1734 |
appos |
Isl,Lin |
R929 |
T1807 |
T1801 |
conj |
with,with |
R930 |
T1808 |
T1809 |
amod |
nuclear,signaling |
R931 |
T1739 |
T1738 |
punct |
-,Isl |
R932 |
T1809 |
T1807 |
pobj |
signaling,with |
R933 |
T1810 |
T1808 |
cc |
and,nuclear |
R934 |
T1811 |
T1808 |
conj |
cytoplasmic,nuclear |
R935 |
T1740 |
T1738 |
nummod |
1,Isl |
R936 |
T1812 |
T1792 |
punct |
.,appear |
R937 |
T1814 |
T1815 |
nsubj |
This,provides |
R938 |
T1741 |
T1734 |
punct |
", ",Lin |
R939 |
T1816 |
T1817 |
det |
a,framework |
R940 |
T1742 |
T1734 |
appos |
Mec,Lin |
R941 |
T1817 |
T1815 |
dobj |
framework,provides |
R942 |
T1818 |
T1817 |
prep |
for,framework |
R943 |
T1819 |
T1818 |
pcomp |
conceptualizing,for |
R944 |
T1820 |
T1821 |
advmod |
why,appear |
R945 |
T1821 |
T1819 |
ccomp |
appear,conceptualizing |
R946 |
T1822 |
T1823 |
compound |
E,cadherin |
R947 |
T1743 |
T1742 |
punct |
-,Mec |
R948 |
T1823 |
T1825 |
compound |
cadherin,levels |
R949 |
T1824 |
T1823 |
punct |
-,cadherin |
R950 |
T1825 |
T1821 |
nsubj |
levels,appear |
R951 |
T1826 |
T1827 |
aux |
to,impact |
R952 |
T1744 |
T1742 |
nummod |
3,Mec |
R953 |
T1827 |
T1821 |
xcomp |
impact,appear |
R954 |
T1828 |
T1827 |
prep |
upon,impact |
R955 |
T1745 |
T1734 |
punct |
(,Lin |
R956 |
T1829 |
T1830 |
det |
a,plethora |
R957 |
T1830 |
T1828 |
pobj |
plethora,upon |
R958 |
T1831 |
T1830 |
prep |
of,plethora |
R959 |
T1746 |
T1734 |
appos |
LIM,Lin |
R960 |
T1832 |
T1833 |
amod |
developmental,processes |
R961 |
T1833 |
T1831 |
pobj |
processes,of |
R962 |
T1834 |
T1835 |
punct |
(,reviewed |
R963 |
T1747 |
T1731 |
punct |
),protein |
R964 |
T1835 |
T1815 |
parataxis |
reviewed,provides |
R965 |
T1836 |
T1835 |
prep |
in,reviewed |
R966 |
T1837 |
T1836 |
punct |
[,in |
R967 |
T1748 |
T1731 |
appos |
Ajuba,protein |
R968 |
T1838 |
T1836 |
pobj |
11,in |
R969 |
T1839 |
T1835 |
punct |
],reviewed |
R970 |
T1840 |
T1835 |
punct |
),reviewed |
R971 |
T1749 |
T1731 |
punct |
(,protein |
R972 |
T1841 |
T1815 |
punct |
.,provides |
R973 |
T1750 |
T1751 |
det |
a,member |
R974 |
T1843 |
T1844 |
mark |
As,probed |
R975 |
T1844 |
T1846 |
advcl |
probed,intrigued |
R976 |
T1845 |
T1844 |
nsubj |
we,probed |
R977 |
T1751 |
T1731 |
appos |
member,protein |
R978 |
T1847 |
T1848 |
advmod |
more,deeply |
R979 |
T1848 |
T1844 |
advmod |
deeply,probed |
R980 |
T1752 |
T1751 |
prep |
of,member |
R981 |
T1849 |
T1844 |
prep |
into,probed |
R982 |
T1850 |
T1851 |
det |
the,mechanisms |
R983 |
T1851 |
T1849 |
pobj |
mechanisms,into |
R984 |
T1753 |
T1754 |
det |
the,family |
R985 |
T1852 |
T1851 |
amod |
underlying,mechanisms |
R986 |
T1853 |
T1851 |
acl |
governing,mechanisms |
R987 |
T1854 |
T1855 |
compound |
E,cadherin |
R988 |
T1754 |
T1752 |
pobj |
family,of |
R989 |
T1855 |
T1857 |
compound |
cadherin,promoter |
R990 |
T1856 |
T1855 |
punct |
-,cadherin |
R991 |
T1857 |
T1858 |
compound |
promoter,activity |
R992 |
T1755 |
T1754 |
compound |
zyxin,family |
R993 |
T1858 |
T1853 |
dobj |
activity,governing |
R994 |
T1859 |
T1846 |
punct |
", ",intrigued |
R995 |
T1756 |
T1754 |
prep |
of,family |
R996 |
T1860 |
T1846 |
nsubjpass |
we,intrigued |
R997 |
T1861 |
T1846 |
auxpass |
were,intrigued |
R998 |
T1862 |
T1846 |
agent |
by,intrigued |
R999 |
T1863 |
T1864 |
det |
the,proximity |
R1000 |
T1864 |
T1862 |
pobj |
proximity,by |
R1001 |
T1865 |
T1864 |
amod |
close,proximity |
R1002 |
T1757 |
T1756 |
pobj |
proteins,of |
R1003 |
T1866 |
T1864 |
prep |
of,proximity |
R1004 |
T1867 |
T1868 |
det |
the,site |
R1005 |
T1758 |
T1731 |
punct |
),protein |
R1006 |
T1759 |
T1731 |
punct |
", ",protein |
R1007 |
T1868 |
T1866 |
pobj |
site,of |
R1008 |
T1869 |
T1868 |
nmod |
LEF,site |
R1009 |
T1870 |
T1869 |
punct |
-,LEF |
R1010 |
T1760 |
T1761 |
dep |
which,appears |
R1011 |
T1871 |
T1869 |
nummod |
1,LEF |
R1012 |
T1872 |
T1869 |
punct |
/,LEF |
R1013 |
T1761 |
T1731 |
relcl |
appears,protein |
R1014 |
T1873 |
T1874 |
compound |
β,catenin |
R1015 |
T1762 |
T1763 |
aux |
to,function |
R1016 |
T1874 |
T1869 |
appos |
catenin,LEF |
R1017 |
T1875 |
T1874 |
punct |
-,catenin |
R1018 |
T1876 |
T1868 |
compound |
binding,site |
R1019 |
T1763 |
T1761 |
xcomp |
function,appears |
R1020 |
T1877 |
T1864 |
prep |
to,proximity |
R1021 |
T1878 |
T1879 |
det |
a,site |
R1022 |
T1879 |
T1877 |
pobj |
site,to |
R1023 |
T1764 |
T1763 |
advmod |
dually,function |
R1024 |
T1880 |
T1879 |
acl |
known,site |
R1025 |
T1881 |
T1882 |
aux |
to,bind |
R1026 |
T1765 |
T1763 |
prep |
in,function |
R1027 |
T1882 |
T1880 |
xcomp |
bind,known |
R1028 |
T1883 |
T1884 |
det |
the,family |
R1029 |
T1884 |
T1882 |
dobj |
family,bind |
R1030 |
T1766 |
T1765 |
preconj |
both,in |
R1031 |
T1767 |
T1765 |
conj |
adhesion,in |
R1032 |
T1768 |
T1765 |
cc |
and,in |
R1033 |
T1769 |
T1765 |
conj |
in,in |
R1034 |
T1885 |
T1886 |
compound |
Snail,Slug |
R1035 |
T1886 |
T1884 |
compound |
Slug,family |
R1036 |
T1770 |
T1769 |
pobj |
activation,in |
R1037 |
T1887 |
T1886 |
punct |
/,Slug |
R1038 |
T1888 |
T1884 |
prep |
of,family |
R1039 |
T1889 |
T1890 |
nmod |
zinc,finger |
R1040 |
T1771 |
T1770 |
prep |
of,activation |
R1041 |
T1890 |
T1891 |
nmod |
finger,proteins |
R1042 |
T1891 |
T1888 |
pobj |
proteins,of |
R1043 |
T1772 |
T1773 |
det |
the,pathway |
R1044 |
T1892 |
T1893 |
amod |
transcriptional,repressor |
R1045 |
T1893 |
T1891 |
compound |
repressor,proteins |
R1046 |
T1894 |
T1895 |
punct |
[,15 |
R1047 |
T1773 |
T1771 |
pobj |
pathway,of |
R1048 |
T1895 |
T1846 |
parataxis |
15,intrigued |
R1049 |
T1896 |
T1895 |
nummod |
12,15 |
R1050 |
T1897 |
T1895 |
punct |
",",15 |
R1051 |
T1898 |
T1895 |
nummod |
13,15 |
R1052 |
T1899 |
T1895 |
punct |
",",15 |
R1053 |
T1900 |
T1895 |
nummod |
14,15 |
R1054 |
T1774 |
T1773 |
nmod |
Ras,pathway |
R1055 |
T1901 |
T1895 |
punct |
",",15 |
R1056 |
T1902 |
T1895 |
punct |
],15 |
R1057 |
T1903 |
T1846 |
punct |
.,intrigued |
R1058 |
T1775 |
T1774 |
punct |
-,Ras |
R1059 |
T1905 |
T1906 |
preconj |
Both,activity |
R1060 |
T1776 |
T1777 |
npadvmod |
mitogen,activated |
R1061 |
T1906 |
T1907 |
nsubj |
activity,play |
R1062 |
T1908 |
T1906 |
prep |
of,activity |
R1063 |
T1777 |
T1779 |
amod |
activated,kinase |
R1064 |
T1909 |
T1908 |
pobj |
Snail,of |
R1065 |
T1910 |
T1906 |
cc |
and,activity |
R1066 |
T1911 |
T1912 |
compound |
down,regulation |
R1067 |
T1778 |
T1777 |
punct |
-,activated |
R1068 |
T1912 |
T1906 |
conj |
regulation,activity |
R1069 |
T1913 |
T1912 |
punct |
-,regulation |
R1070 |
T1914 |
T1912 |
prep |
of,regulation |
R1071 |
T1779 |
T1774 |
appos |
kinase,Ras |
R1072 |
T1915 |
T1916 |
compound |
E,cadherin |
R1073 |
T1916 |
T1914 |
pobj |
cadherin,of |
R1074 |
T1991 |
T1988 |
acl |
tune,ability |
R1075 |
T1917 |
T1916 |
punct |
-,cadherin |
R1076 |
T1918 |
T1919 |
amod |
pivotal,roles |
R1077 |
T1919 |
T1907 |
dobj |
roles,play |
R1078 |
T1920 |
T1907 |
prep |
in,play |
R1079 |
T1992 |
T1991 |
advmod |
fine,tune |
R1080 |
T1921 |
T1922 |
amod |
epithelial,transitions |
R1081 |
T1922 |
T1920 |
pobj |
transitions,in |
R1082 |
T1923 |
T1921 |
prep |
to,epithelial |
R1083 |
T1993 |
T1991 |
punct |
-,tune |
R1084 |
T1924 |
T1923 |
amod |
mesenchymal,to |
R1085 |
T1925 |
T1922 |
punct |
(,transitions |
R1086 |
T1994 |
T1995 |
compound |
cadherin,expression |
R1087 |
T1926 |
T1922 |
appos |
EMTs,transitions |
R1088 |
T1927 |
T1922 |
punct |
),transitions |
R1089 |
T1928 |
T1922 |
punct |
", ",transitions |
R1090 |
T1995 |
T1991 |
dobj |
expression,tune |
R1091 |
T1929 |
T1922 |
acl |
typified,transitions |
R1092 |
T1930 |
T1929 |
agent |
by,typified |
R1093 |
T1931 |
T1932 |
det |
the,transformation |
R1094 |
T1996 |
T1991 |
prep |
at,tune |
R1095 |
T1932 |
T1930 |
pobj |
transformation,by |
R1096 |
T1933 |
T1932 |
prep |
of,transformation |
R1097 |
T1934 |
T1935 |
amod |
polarized,cells |
R1098 |
T1997 |
T1998 |
det |
the,level |
R1099 |
T1935 |
T1933 |
pobj |
cells,of |
R1100 |
T1936 |
T1935 |
punct |
", ",cells |
R1101 |
T1937 |
T1935 |
amod |
adhering,cells |
R1102 |
T1938 |
T1935 |
amod |
epithelial,cells |
R1103 |
T1939 |
T1932 |
prep |
into,transformation |
R1104 |
T1998 |
T1996 |
pobj |
level,at |
R1105 |
T1940 |
T1941 |
amod |
motile,cells |
R1106 |
T1941 |
T1939 |
pobj |
cells,into |
R1107 |
T1999 |
T1998 |
amod |
transcriptional,level |
R1108 |
T1942 |
T1941 |
amod |
mesenchymal,cells |
R1109 |
T1943 |
T1944 |
punct |
[,17 |
R1110 |
T1944 |
T1907 |
parataxis |
17,play |
R1111 |
T2000 |
T1985 |
punct |
", ",seems |
R1112 |
T1945 |
T1944 |
nummod |
16,17 |
R1113 |
T1946 |
T1944 |
punct |
",",17 |
R1114 |
T1947 |
T1944 |
punct |
],17 |
R1115 |
T2001 |
T1985 |
nsubj |
Snail,seems |
R1116 |
T1948 |
T1907 |
punct |
.,play |
R1117 |
T1950 |
T1951 |
compound |
Bud,formation |
R1118 |
T2002 |
T2003 |
aux |
to,have |
R1119 |
T1951 |
T1952 |
nsubj |
formation,differs |
R1120 |
T2003 |
T1985 |
xcomp |
have,seems |
R1121 |
T1953 |
T1952 |
prep |
from,differs |
R1122 |
T1954 |
T1955 |
det |
an,EMT |
R1123 |
T2004 |
T2005 |
det |
an,effect |
R1124 |
T1955 |
T1953 |
pobj |
EMT,from |
R1125 |
T1956 |
T1957 |
mark |
in,needs |
R1126 |
T2005 |
T2003 |
dobj |
effect,have |
R1127 |
T2006 |
T2005 |
amod |
additive,effect |
R1128 |
T1957 |
T1952 |
advcl |
needs,differs |
R1129 |
T1958 |
T1957 |
mark |
that,needs |
R1130 |
T1959 |
T1960 |
compound |
E,cadherin |
R1131 |
T2007 |
T2003 |
prep |
with,have |
R1132 |
T1960 |
T1962 |
compound |
cadherin,activity |
R1133 |
T1961 |
T1960 |
punct |
-,cadherin |
R1134 |
T1962 |
T1957 |
nsubj |
activity,needs |
R1135 |
T2008 |
T2007 |
pobj |
LEF,with |
R1136 |
T1963 |
T1964 |
aux |
to,regulated |
R1137 |
T1964 |
T1957 |
xcomp |
regulated,needs |
R1138 |
T1965 |
T1964 |
aux |
be,regulated |
R1139 |
T2009 |
T2008 |
punct |
-,LEF |
R1140 |
T1966 |
T1964 |
advmod |
down,regulated |
R1141 |
T1967 |
T1964 |
punct |
-,regulated |
R1142 |
T2010 |
T2008 |
nummod |
1,LEF |
R1143 |
T1968 |
T1964 |
cc |
but,regulated |
R1144 |
T1969 |
T1968 |
neg |
not,but |
R1145 |
T2011 |
T2008 |
punct |
/,LEF |
R1146 |
T1970 |
T1964 |
conj |
prevented,regulated |
R1147 |
T1971 |
T1964 |
punct |
", ",regulated |
R1148 |
T1972 |
T1973 |
mark |
so,remodeled |
R1149 |
T2012 |
T2013 |
compound |
β,catenin |
R1150 |
T1973 |
T1964 |
advcl |
remodeled,regulated |
R1151 |
T1974 |
T1973 |
mark |
that,remodeled |
R1152 |
T2013 |
T2008 |
appos |
catenin,LEF |
R1153 |
T1975 |
T1976 |
amod |
adhesive,junctions |
R1154 |
T1976 |
T1973 |
nsubjpass |
junctions,remodeled |
R1155 |
T1977 |
T1973 |
auxpass |
are,remodeled |
R1156 |
T1978 |
T1979 |
advmod |
rather,than |
R1157 |
T1979 |
T1973 |
cc |
than,remodeled |
R1158 |
T1980 |
T1981 |
advmod |
quantitatively,impaired |
R1159 |
T1981 |
T1973 |
conj |
impaired,remodeled |
R1160 |
T2014 |
T2013 |
punct |
-,catenin |
R1161 |
T1982 |
T1952 |
punct |
.,differs |
R1162 |
T2015 |
T2003 |
prep |
in,have |
R1163 |
T1984 |
T1985 |
advcl |
Supportive,seems |
R1164 |
T1986 |
T1984 |
prep |
of,Supportive |
R1165 |
T2016 |
T2017 |
advmod |
negatively,modulating |
R1166 |
T1987 |
T1988 |
det |
an,ability |
R1167 |
T1988 |
T1986 |
pobj |
ability,of |
R1168 |
T1989 |
T1988 |
amod |
underlying,ability |
R1169 |
T2017 |
T2015 |
pcomp |
modulating,in |
R1170 |
T1990 |
T1991 |
aux |
to,tune |
R1171 |
T2018 |
T2019 |
compound |
E,cadherin |
R1172 |
T2019 |
T2021 |
compound |
cadherin,promoter |
R1173 |
T2020 |
T2019 |
punct |
-,cadherin |
R1174 |
T2021 |
T2022 |
compound |
promoter,activity |
R1175 |
T2022 |
T2017 |
dobj |
activity,modulating |
R1176 |
T2023 |
T2024 |
punct |
[,4 |
R1177 |
T2097 |
T2096 |
acl |
associated,features |
R1178 |
T2098 |
T2097 |
prep |
with,associated |
R1179 |
T2024 |
T1985 |
parataxis |
4,seems |
R1180 |
T2099 |
T2100 |
compound |
hair,bud |
R1181 |
T2100 |
T2101 |
compound |
bud,formation |
R1182 |
T2025 |
T2024 |
punct |
],4 |
R1183 |
T2101 |
T2098 |
pobj |
formation,with |
R1184 |
T2102 |
T2096 |
punct |
", ",features |
R1185 |
T2103 |
T2096 |
prep |
including,features |
R1186 |
T2026 |
T1985 |
punct |
.,seems |
R1187 |
T2104 |
T2105 |
compound |
down,regulation |
R1188 |
T2105 |
T2103 |
pobj |
regulation,including |
R1189 |
T2028 |
T2029 |
prep |
In,discovered |
R1190 |
T2106 |
T2105 |
punct |
-,regulation |
R1191 |
T2107 |
T2105 |
prep |
of,regulation |
R1192 |
T2108 |
T2109 |
compound |
E,cadherin |
R1193 |
T2109 |
T2107 |
pobj |
cadherin,of |
R1194 |
T2030 |
T2031 |
det |
the,study |
R1195 |
T2110 |
T2109 |
punct |
-,cadherin |
R1196 |
T2111 |
T2105 |
punct |
", ",regulation |
R1197 |
T2112 |
T2113 |
amod |
increased,proliferation |
R1198 |
T2113 |
T2105 |
conj |
proliferation,regulation |
R1199 |
T2031 |
T2028 |
pobj |
study,In |
R1200 |
T2114 |
T2113 |
punct |
", ",proliferation |
R1201 |
T2115 |
T2113 |
cc |
and,proliferation |
R1202 |
T2032 |
T2031 |
amod |
present,study |
R1203 |
T2116 |
T2117 |
amod |
repressed,differentiation |
R1204 |
T2117 |
T2113 |
conj |
differentiation,proliferation |
R1205 |
T2118 |
T2117 |
amod |
terminal,differentiation |
R1206 |
T2119 |
T2084 |
punct |
.,appears |
R1207 |
T2033 |
T2029 |
punct |
", ",discovered |
R1208 |
T2121 |
T2122 |
mark |
Although,reflected |
R1209 |
T2034 |
T2029 |
nsubj |
we,discovered |
R1210 |
T2122 |
T2133 |
advcl |
reflected,appear |
R1211 |
T2123 |
T2124 |
det |
the,spike |
R1212 |
T2035 |
T2036 |
mark |
that,expressed |
R1213 |
T2124 |
T2122 |
nsubjpass |
spike,reflected |
R1214 |
T2125 |
T2124 |
amod |
temporal,spike |
R1215 |
T2036 |
T2029 |
ccomp |
expressed,discovered |
R1216 |
T2126 |
T2124 |
prep |
of,spike |
R1217 |
T2127 |
T2126 |
pobj |
Snail,of |
R1218 |
T2037 |
T2036 |
nsubjpass |
Snail,expressed |
R1219 |
T2128 |
T2124 |
prep |
in,spike |
R1220 |
T2129 |
T2130 |
det |
the,bud |
R1221 |
T2130 |
T2128 |
pobj |
bud,in |
R1222 |
T2038 |
T2036 |
auxpass |
is,expressed |
R1223 |
T2131 |
T2130 |
compound |
hair,bud |
R1224 |
T2132 |
T2122 |
auxpass |
is,reflected |
R1225 |
T2039 |
T2036 |
advmod |
briefly,expressed |
R1226 |
T2134 |
T2122 |
prep |
at,reflected |
R1227 |
T2135 |
T2136 |
det |
the,level |
R1228 |
T2136 |
T2134 |
pobj |
level,at |
R1229 |
T2040 |
T2036 |
prep |
at,expressed |
R1230 |
T2137 |
T2136 |
compound |
mRNA,level |
R1231 |
T2138 |
T2122 |
cc |
and,reflected |
R1232 |
T2139 |
T2122 |
conj |
seems,reflected |
R1233 |
T2041 |
T2042 |
det |
an,stage |
R1234 |
T2140 |
T2141 |
aux |
to,follow |
R1235 |
T2141 |
T2139 |
xcomp |
follow,seems |
R1236 |
T2142 |
T2143 |
compound |
Wnt,signaling |
R1237 |
T2042 |
T2040 |
pobj |
stage,at |
R1238 |
T2143 |
T2141 |
dobj |
signaling,follow |
R1239 |
T2144 |
T2143 |
cc |
and,signaling |
R1240 |
T2043 |
T2042 |
amod |
early,stage |
R1241 |
T2145 |
T2146 |
compound |
BMP,inhibition |
R1242 |
T2146 |
T2143 |
conj |
inhibition,signaling |
R1243 |
T2147 |
T2133 |
punct |
", ",appear |
R1244 |
T2044 |
T2042 |
prep |
of,stage |
R1245 |
T2148 |
T2149 |
nmod |
LEF,activation |
R1246 |
T2149 |
T2133 |
nsubj |
activation,appear |
R1247 |
T2045 |
T2046 |
compound |
hair,bud |
R1248 |
T2150 |
T2148 |
punct |
-,LEF |
R1249 |
T2151 |
T2148 |
nummod |
1,LEF |
R1250 |
T2152 |
T2148 |
punct |
/,LEF |
R1251 |
T2046 |
T2047 |
compound |
bud,formation |
R1252 |
T2153 |
T2154 |
compound |
β,catenin |
R1253 |
T2154 |
T2148 |
appos |
catenin,LEF |
R1254 |
T2155 |
T2154 |
punct |
-,catenin |
R1255 |
T2047 |
T2044 |
pobj |
formation,of |
R1256 |
T2156 |
T2133 |
aux |
does,appear |
R1257 |
T2157 |
T2133 |
neg |
not,appear |
R1258 |
T2158 |
T2159 |
aux |
to,induce |
R1259 |
T2159 |
T2133 |
xcomp |
induce,appear |
R1260 |
T2160 |
T2161 |
compound |
Snail,expression |
R1261 |
T2161 |
T2159 |
dobj |
expression,induce |
R1262 |
T2162 |
T2161 |
compound |
gene,expression |
R1263 |
T2048 |
T2042 |
punct |
", ",stage |
R1264 |
T2163 |
T2159 |
prep |
in,induce |
R1265 |
T2164 |
T2165 |
amod |
embryonic,keratinocytes |
R1266 |
T2165 |
T2163 |
pobj |
keratinocytes,in |
R1267 |
T2166 |
T2165 |
compound |
skin,keratinocytes |
R1268 |
T2049 |
T2050 |
advmod |
when,take |
R1269 |
T2167 |
T2133 |
punct |
.,appear |
R1270 |
T2050 |
T2042 |
relcl |
take,stage |
R1271 |
T2169 |
T2170 |
prep |
In,provide |
R1272 |
T2171 |
T2169 |
pobj |
contrast,In |
R1273 |
T2051 |
T2052 |
compound |
E,cadherin |
R1274 |
T2172 |
T2170 |
punct |
", ",provide |
R1275 |
T2173 |
T2170 |
nsubj |
we,provide |
R1276 |
T2174 |
T2175 |
advmod |
in,vitro |
R1277 |
T2052 |
T2050 |
nsubj |
cadherin,take |
R1278 |
T2175 |
T2176 |
amod |
vitro,evidence |
R1279 |
T2176 |
T2170 |
dobj |
evidence,provide |
R1280 |
T2053 |
T2052 |
punct |
-,cadherin |
R1281 |
T2177 |
T2175 |
punct |
", ",vitro |
R1282 |
T2178 |
T2175 |
conj |
transgenic,vitro |
R1283 |
T2179 |
T2180 |
punct |
(,Tg |
R1284 |
T2054 |
T2055 |
amod |
down,regulation |
R1285 |
T2180 |
T2178 |
parataxis |
Tg,transgenic |
R1286 |
T2181 |
T2180 |
punct |
),Tg |
R1287 |
T2182 |
T2178 |
punct |
", ",transgenic |
R1288 |
T2055 |
T2052 |
appos |
regulation,cadherin |
R1289 |
T2183 |
T2178 |
cc |
and,transgenic |
R1290 |
T2184 |
T2185 |
npadvmod |
gene,targeting |
R1291 |
T2056 |
T2055 |
punct |
-,regulation |
R1292 |
T2185 |
T2178 |
conj |
targeting,transgenic |
R1293 |
T2186 |
T2187 |
aux |
to,show |
R1294 |
T2057 |
T2055 |
cc |
and,regulation |
R1295 |
T2187 |
T2170 |
advcl |
show,provide |
R1296 |
T2188 |
T2189 |
mark |
that,are |
R1297 |
T2058 |
T2055 |
conj |
activation,regulation |
R1298 |
T2059 |
T2058 |
prep |
of,activation |
R1299 |
T2189 |
T2187 |
ccomp |
are,show |
R1300 |
T2190 |
T2191 |
nmod |
TGF,β2 |
R1301 |
T2060 |
T2059 |
pobj |
proliferation,of |
R1302 |
T2191 |
T2193 |
nmod |
β2,signaling |
R1303 |
T2192 |
T2191 |
punct |
-,β2 |
R1304 |
T2193 |
T2189 |
nsubj |
signaling,are |
R1305 |
T2061 |
T2050 |
dobj |
place,take |
R1306 |
T2194 |
T2191 |
cc |
and,β2 |
R1307 |
T2195 |
T2196 |
amod |
small,phenotype |
R1308 |
T2196 |
T2197 |
npadvmod |
phenotype,related |
R1309 |
T2197 |
T2204 |
amod |
related,protein |
R1310 |
T2198 |
T2196 |
punct |
–,phenotype |
R1311 |
T2199 |
T2196 |
cc |
and,phenotype |
R1312 |
T2062 |
T2029 |
punct |
.,discovered |
R1313 |
T2200 |
T2196 |
conj |
mothers,phenotype |
R1314 |
T2201 |
T2200 |
prep |
against,mothers |
R1315 |
T2202 |
T2201 |
pobj |
decapentaplegic,against |
R1316 |
T2064 |
T2065 |
advmod |
Thereafter,disappears |
R1317 |
T2066 |
T2065 |
punct |
", ",disappears |
R1318 |
T2203 |
T2197 |
punct |
–,related |
R1319 |
T2204 |
T2191 |
conj |
protein,β2 |
R1320 |
T2067 |
T2065 |
nsubj |
Snail,disappears |
R1321 |
T2205 |
T2204 |
nummod |
2,protein |
R1322 |
T2206 |
T2204 |
punct |
(,protein |
R1323 |
T2207 |
T2204 |
appos |
SMAD2,protein |
R1324 |
T2068 |
T2065 |
cc |
and,disappears |
R1325 |
T2208 |
T2193 |
punct |
),signaling |
R1326 |
T2209 |
T2210 |
amod |
upstream,inducers |
R1327 |
T2069 |
T2065 |
conj |
remains,disappears |
R1328 |
T2210 |
T2189 |
attr |
inducers,are |
R1329 |
T2211 |
T2210 |
prep |
of,inducers |
R1330 |
T2212 |
T2213 |
compound |
Snail,expression |
R1331 |
T2070 |
T2069 |
acomp |
absent,remains |
R1332 |
T2213 |
T2211 |
pobj |
expression,of |
R1333 |
T2214 |
T2213 |
compound |
gene,expression |
R1334 |
T2071 |
T2069 |
prep |
during,remains |
R1335 |
T2215 |
T2189 |
prep |
in,are |
R1336 |
T2216 |
T2217 |
compound |
skin,epithelium |
R1337 |
T2072 |
T2073 |
amod |
subsequent,growth |
R1338 |
T2217 |
T2215 |
pobj |
epithelium,in |
R1339 |
T2218 |
T2170 |
punct |
.,provide |
R1340 |
T2073 |
T2071 |
pobj |
growth,during |
R1341 |
T2220 |
T2221 |
prep |
In,form |
R1342 |
T2074 |
T2073 |
nmod |
follicle,growth |
R1343 |
T2222 |
T2223 |
det |
the,absence |
R1344 |
T2223 |
T2220 |
pobj |
absence,In |
R1345 |
T2075 |
T2073 |
amod |
down,growth |
R1346 |
T2224 |
T2223 |
prep |
of,absence |
R1347 |
T2225 |
T2226 |
compound |
TGF,β2 |
R1348 |
T2226 |
T2228 |
compound |
β2,signaling |
R1349 |
T2076 |
T2073 |
punct |
-,growth |
R1350 |
T2227 |
T2226 |
punct |
-,β2 |
R1351 |
T2077 |
T2073 |
cc |
and,growth |
R1352 |
T2228 |
T2224 |
pobj |
signaling,of |
R1353 |
T2229 |
T2228 |
cc |
and,signaling |
R1354 |
T2230 |
T2231 |
compound |
Snail,expression |
R1355 |
T2078 |
T2073 |
conj |
maturation,growth |
R1356 |
T2231 |
T2228 |
conj |
expression,signaling |
R1357 |
T2232 |
T2231 |
compound |
gene,expression |
R1358 |
T2079 |
T2065 |
punct |
.,disappears |
R1359 |
T2233 |
T2221 |
punct |
", ",form |
R1360 |
T2234 |
T2235 |
compound |
hair,placodes |
R1361 |
T2235 |
T2221 |
nsubj |
placodes,form |
R1362 |
T2236 |
T2221 |
aux |
can,form |
R1363 |
T2237 |
T2221 |
punct |
", ",form |
R1364 |
T2238 |
T2221 |
cc |
but,form |
R1365 |
T2081 |
T2082 |
det |
This,pattern |
R1366 |
T2239 |
T2240 |
amod |
further,growth |
R1367 |
T2240 |
T2244 |
nsubjpass |
growth,blocked |
R1370 |
T2082 |
T2084 |
nsubj |
pattern,appears |
R1371 |
T2243 |
T2240 |
punct |
-,growth |
R1372 |
T2244 |
T2221 |
conj |
blocked,form |
R1373 |
T2245 |
T2244 |
auxpass |
is,blocked |
R1374 |
T2083 |
T2082 |
amod |
exquisite,pattern |
R1375 |
T2246 |
T2221 |
punct |
.,form |
R1376 |
T2085 |
T2086 |
aux |
to,be |
R1377 |
T2248 |
T2249 |
poss |
Our,studies |
R1378 |
T2249 |
T2250 |
nsubj |
studies,point |
R1379 |
T2251 |
T2250 |
prep |
to,point |
R1380 |
T2086 |
T2084 |
xcomp |
be,appears |
R1381 |
T2252 |
T2253 |
det |
the,view |
R1382 |
T2253 |
T2251 |
pobj |
view,to |
R1383 |
T2087 |
T2088 |
advmod |
functionally,relevant |
R1384 |
T2254 |
T2255 |
mark |
that,functions |
R1385 |
T2255 |
T2253 |
acl |
functions,view |
R1386 |
T2256 |
T2255 |
nsubj |
Snail,functions |
R1387 |
T2088 |
T2086 |
acomp |
relevant,be |
R1388 |
T2257 |
T2255 |
advmod |
likely,functions |
R1389 |
T2258 |
T2255 |
advmod |
downstream,functions |
R1390 |
T2259 |
T2258 |
prep |
of,downstream |
R1391 |
T2089 |
T2090 |
mark |
since,affects |
R1392 |
T2260 |
T2261 |
compound |
cell,fate |
R1393 |
T2261 |
T2262 |
compound |
fate,specification |
R1394 |
T2090 |
T2086 |
advcl |
affects,be |
R1395 |
T2262 |
T2259 |
pobj |
specification,of |
R1396 |
T2263 |
T2250 |
punct |
", ",point |
R1397 |
T2264 |
T2250 |
prep |
at,point |
R1398 |
T2091 |
T2090 |
csubj |
altering,affects |
R1399 |
T2265 |
T2266 |
det |
a,stage |
R1400 |
T2266 |
T2264 |
pobj |
stage,at |
R1401 |
T2092 |
T2091 |
dobj |
it,altering |
R1402 |
T2267 |
T2268 |
advmod |
where,begins |
R1403 |
T2268 |
T2266 |
relcl |
begins,stage |
R1404 |
T2093 |
T2094 |
advmod |
in,vivo |
R1405 |
T2269 |
T2270 |
det |
the,bud |
R1406 |
T2270 |
T2268 |
nsubj |
bud,begins |
R1407 |
T2094 |
T2091 |
advmod |
vivo,altering |
R1408 |
T2271 |
T2272 |
aux |
to,exhibit |
R1409 |
T2272 |
T2268 |
xcomp |
exhibit,begins |
R1410 |
T2273 |
T2274 |
amod |
enhanced,proliferation |
R1411 |
T2095 |
T2090 |
advmod |
correspondingly,affects |
R1412 |
T2274 |
T2272 |
dobj |
proliferation,exhibit |
R1413 |
T2275 |
T2274 |
cc |
and,proliferation |
R1414 |
T2276 |
T2274 |
conj |
migration,proliferation |
R1415 |
T2277 |
T2250 |
punct |
.,point |
R1416 |
T2096 |
T2090 |
dobj |
features,affects |
R1433 |
T2702 |
T2703 |
compound |
Snail,mRNA |
R1434 |
T2703 |
T2704 |
nsubjpass |
mRNA,Expressed |
R1435 |
T2705 |
T2703 |
cc |
and,mRNA |
R1436 |
T2706 |
T2703 |
conj |
Protein,mRNA |
R1437 |
T2707 |
T2704 |
auxpass |
Are,Expressed |
R1438 |
T2708 |
T2704 |
advmod |
Transiently,Expressed |
R1439 |
T2709 |
T2704 |
prep |
at,Expressed |
R1440 |
T2710 |
T2711 |
det |
the,Stage |
R1441 |
T2711 |
T2709 |
pobj |
Stage,at |
R1442 |
T2712 |
T2713 |
compound |
Hair,Bud |
R1443 |
T2713 |
T2711 |
compound |
Bud,Stage |
R1444 |
T2714 |
T2711 |
prep |
of,Stage |
R1445 |
T2715 |
T2716 |
compound |
Follicle,Morphogenesis |
R1446 |
T2716 |
T2714 |
pobj |
Morphogenesis,of |
R1447 |
T2718 |
T2719 |
mark |
Although,associated |
R1448 |
T2719 |
T2726 |
advcl |
associated,participate |
R1449 |
T2720 |
T2721 |
compound |
Snail,members |
R1450 |
T2721 |
T2719 |
nsubjpass |
members,associated |
R1451 |
T2722 |
T2721 |
compound |
family,members |
R1452 |
T2723 |
T2719 |
auxpass |
are,associated |
R1453 |
T2724 |
T2725 |
advmod |
most,frequently |
R1454 |
T2725 |
T2719 |
advmod |
frequently,associated |
R1455 |
T2727 |
T2719 |
prep |
with,associated |
R1456 |
T2728 |
T2727 |
pobj |
EMTs,with |
R1457 |
T2729 |
T2726 |
punct |
", ",participate |
R1458 |
T2730 |
T2726 |
nsubj |
they,participate |
R1459 |
T2731 |
T2726 |
advmod |
also,participate |
R1460 |
T2732 |
T2726 |
prep |
in,participate |
R1461 |
T2733 |
T2734 |
amod |
many,processes |
R1462 |
T2734 |
T2732 |
pobj |
processes,in |
R1463 |
T2735 |
T2734 |
amod |
malignant,processes |
R1464 |
T2736 |
T2734 |
acl |
involving,processes |
R1465 |
T2737 |
T2738 |
det |
a,regulation |
R1466 |
T2738 |
T2736 |
dobj |
regulation,involving |
R1467 |
T2739 |
T2738 |
amod |
down,regulation |
R1468 |
T2740 |
T2738 |
punct |
-,regulation |
R1469 |
T2741 |
T2738 |
cc |
but,regulation |
R1470 |
T2742 |
T2741 |
neg |
not,but |
R1471 |
T2743 |
T2744 |
det |
a,abrogation |
R1472 |
T2744 |
T2738 |
conj |
abrogation,regulation |
R1473 |
T2745 |
T2744 |
amod |
quantitative,abrogation |
R1474 |
T2746 |
T2738 |
prep |
of,regulation |
R1475 |
T2747 |
T2748 |
amod |
intercellular,junctions |
R1476 |
T2748 |
T2746 |
pobj |
junctions,of |
R1477 |
T2749 |
T2750 |
punct |
[,18 |
R1478 |
T2750 |
T2726 |
parataxis |
18,participate |
R1479 |
T2751 |
T2750 |
punct |
],18 |
R1480 |
T2752 |
T2726 |
punct |
.,participate |
R1481 |
T2754 |
T2755 |
det |
The,range |
R1482 |
T2755 |
T2756 |
nsubj |
range,includes |
R1483 |
T2757 |
T2755 |
prep |
of,range |
R1484 |
T2758 |
T2759 |
amod |
developmental,processes |
R1485 |
T2759 |
T2757 |
pobj |
processes,of |
R1486 |
T2760 |
T2761 |
prep |
in,implicated |
R1487 |
T2761 |
T2759 |
relcl |
implicated,processes |
R1488 |
T2762 |
T2760 |
pobj |
which,in |
R1489 |
T2763 |
T2764 |
compound |
Snail,members |
R1490 |
T2764 |
T2761 |
nsubjpass |
members,implicated |
R1491 |
T2765 |
T2764 |
compound |
family,members |
R1492 |
T2766 |
T2761 |
aux |
have,implicated |
R1493 |
T2767 |
T2761 |
auxpass |
been,implicated |
R1494 |
T2768 |
T2756 |
advmod |
thus,includes |
R1495 |
T2769 |
T2770 |
det |
the,type |
R1496 |
T2770 |
T2756 |
dobj |
type,includes |
R1497 |
T2771 |
T2770 |
prep |
of,type |
R1498 |
T2772 |
T2773 |
amod |
epithelial,remodeling |
R1499 |
T2773 |
T2771 |
pobj |
remodeling,of |
R1500 |
T2774 |
T2775 |
dep |
that,observed |
R1501 |
T2775 |
T2770 |
relcl |
observed,type |
R1502 |
T2776 |
T2775 |
auxpass |
is,observed |
R1503 |
T2777 |
T2775 |
prep |
in,observed |
R1504 |
T2778 |
T2779 |
compound |
hair,follicle |
R1505 |
T2779 |
T2780 |
compound |
follicle,bud |
R1506 |
T2780 |
T2781 |
compound |
bud,formation |
R1507 |
T2781 |
T2777 |
pobj |
formation,in |
R1508 |
T2782 |
T2756 |
punct |
.,includes |
R1509 |
T2784 |
T2785 |
prep |
Given,turned |
R1510 |
T2786 |
T2787 |
poss |
our,observation |
R1511 |
T2787 |
T2784 |
pobj |
observation,Given |
R1512 |
T2788 |
T2787 |
amod |
prior,observation |
R1513 |
T2789 |
T2790 |
mark |
that,participate |
R1514 |
T2790 |
T2787 |
acl |
participate,observation |
R1515 |
T2791 |
T2792 |
advmod |
exogenously,added |
R1516 |
T2792 |
T2793 |
amod |
added,Snail |
R1517 |
T2793 |
T2790 |
nsubj |
Snail,participate |
R1518 |
T2794 |
T2790 |
aux |
can,participate |
R1519 |
T2795 |
T2790 |
prep |
with,participate |
R1520 |
T2796 |
T2795 |
pobj |
LEF,with |
R1521 |
T2797 |
T2796 |
punct |
-,LEF |
R1522 |
T2798 |
T2796 |
nummod |
1,LEF |
R1523 |
T2799 |
T2796 |
punct |
/,LEF |
R1524 |
T2800 |
T2801 |
compound |
β,catenin |
R1525 |
T2801 |
T2796 |
appos |
catenin,LEF |
R1526 |
T2802 |
T2801 |
punct |
-,catenin |
R1527 |
T2803 |
T2790 |
prep |
in,participate |
R1528 |
T2804 |
T2805 |
advmod |
down,regulating |
R1529 |
T2805 |
T2803 |
pcomp |
regulating,in |
R1530 |
T2806 |
T2805 |
punct |
-,regulating |
R1531 |
T2807 |
T2808 |
compound |
E,cadherin |
R1532 |
T2808 |
T2810 |
compound |
cadherin,expression |
R1533 |
T2809 |
T2808 |
punct |
-,cadherin |
R1534 |
T2810 |
T2805 |
dobj |
expression,regulating |
R1535 |
T2811 |
T2790 |
prep |
in,participate |
R1536 |
T2812 |
T2811 |
pobj |
keratinocytes,in |
R1537 |
T2813 |
T2814 |
punct |
[,4 |
R1538 |
T2814 |
T2790 |
parataxis |
4,participate |
R1539 |
T2815 |
T2814 |
punct |
],4 |
R1540 |
T2816 |
T2787 |
punct |
", ",observation |
R1541 |
T2817 |
T2787 |
acl |
coupled,observation |
R1542 |
T2818 |
T2817 |
prep |
with,coupled |
R1543 |
T2819 |
T2820 |
det |
the,requirement |
R1544 |
T2820 |
T2818 |
pobj |
requirement,with |
R1545 |
T2821 |
T2820 |
amod |
established,requirement |
R1546 |
T2822 |
T2820 |
prep |
for,requirement |
R1547 |
T2823 |
T2822 |
pobj |
LEF,for |
R1548 |
T2824 |
T2823 |
punct |
-,LEF |
R1549 |
T2825 |
T2823 |
nummod |
1,LEF |
R1550 |
T2826 |
T2823 |
punct |
/,LEF |
R1551 |
T2827 |
T2828 |
compound |
β,catenin |
R1552 |
T2828 |
T2823 |
appos |
catenin,LEF |
R1553 |
T2829 |
T2828 |
punct |
-,catenin |
R1554 |
T2830 |
T2820 |
prep |
in,requirement |
R1555 |
T2831 |
T2832 |
compound |
hair,follicle |
R1556 |
T2832 |
T2833 |
compound |
follicle,morphogenesis |
R1557 |
T2833 |
T2830 |
pobj |
morphogenesis,in |
R1558 |
T2834 |
T2835 |
punct |
[,19 |
R1559 |
T2835 |
T2817 |
parataxis |
19,coupled |
R1560 |
T2836 |
T2835 |
nummod |
4,19 |
R1561 |
T2837 |
T2835 |
punct |
",",19 |
R1562 |
T2838 |
T2835 |
punct |
],19 |
R1563 |
T2839 |
T2785 |
punct |
", ",turned |
R1564 |
T2840 |
T2785 |
nsubj |
we,turned |
R1565 |
T2841 |
T2785 |
prep |
to,turned |
R1566 |
T2842 |
T2841 |
pcomp |
addressing,to |
R1567 |
T2843 |
T2844 |
mark |
whether,participate |
R1568 |
T2844 |
T2842 |
ccomp |
participate,addressing |
R1569 |
T2845 |
T2846 |
compound |
Snail,Slug |
R1570 |
T2846 |
T2848 |
compound |
Slug,members |
R1571 |
T2847 |
T2846 |
punct |
/,Slug |
R1572 |
T2848 |
T2844 |
nsubj |
members,participate |
R1573 |
T2849 |
T2848 |
compound |
family,members |
R1574 |
T2850 |
T2844 |
aux |
might,participate |
R1575 |
T2851 |
T2844 |
advmod |
also,participate |
R1576 |
T2852 |
T2844 |
prep |
in,participate |
R1577 |
T2853 |
T2854 |
det |
the,process |
R1578 |
T2854 |
T2852 |
pobj |
process,in |
R1579 |
T2855 |
T2785 |
punct |
.,turned |
R1580 |
T2857 |
T2858 |
compound |
PCR,analyses |
R1581 |
T2858 |
T2859 |
nsubj |
analyses,identified |
R1582 |
T2860 |
T2861 |
amod |
transient,expression |
R1583 |
T2861 |
T2859 |
dobj |
expression,identified |
R1584 |
T2862 |
T2861 |
compound |
Snail,expression |
R1585 |
T2863 |
T2861 |
compound |
mRNA,expression |
R1586 |
T2864 |
T2859 |
prep |
during,identified |
R1587 |
T2865 |
T2866 |
det |
a,period |
R1588 |
T2866 |
T2864 |
pobj |
period,during |
R1589 |
T2867 |
T2866 |
prep |
of,period |
R1590 |
T2868 |
T2869 |
compound |
skin,embryogenesis |
R1591 |
T2869 |
T2867 |
pobj |
embryogenesis,of |
R1592 |
T2870 |
T2871 |
advmod |
when,forming |
R1593 |
T2871 |
T2866 |
advcl |
forming,period |
R1594 |
T2872 |
T2871 |
nsubj |
waves,forming |
R1595 |
T2873 |
T2872 |
prep |
of,waves |
R1596 |
T2874 |
T2875 |
compound |
hair,follicles |
R1597 |
T2875 |
T2873 |
pobj |
follicles,of |
R1598 |
T2876 |
T2871 |
aux |
are,forming |
R1599 |
T2877 |
T2878 |
punct |
(,data |
R1600 |
T2878 |
T2859 |
meta |
data,identified |
R1601 |
T2879 |
T2878 |
amod |
unpublished,data |
R1602 |
T2880 |
T2878 |
punct |
),data |
R1603 |
T2881 |
T2859 |
punct |
.,identified |
R1604 |
T2882 |
T2883 |
aux |
To,pinpoint |
R1605 |
T2883 |
T2885 |
advcl |
pinpoint,conducted |
R1606 |
T2886 |
T2883 |
advmod |
specifically,pinpoint |
R1607 |
T2887 |
T2888 |
advmod |
where,expressed |
R1608 |
T2888 |
T2883 |
advcl |
expressed,pinpoint |
R1609 |
T2889 |
T2890 |
compound |
Snail,mRNA |
R1610 |
T2890 |
T2888 |
nsubjpass |
mRNA,expressed |
R1611 |
T2891 |
T2888 |
auxpass |
is,expressed |
R1612 |
T2892 |
T2888 |
prep |
in,expressed |
R1613 |
T2893 |
T2894 |
det |
the,skin |
R1614 |
T2894 |
T2892 |
pobj |
skin,in |
R1615 |
T2895 |
T2894 |
amod |
developing,skin |
R1616 |
T2896 |
T2885 |
punct |
", ",conducted |
R1617 |
T2897 |
T2885 |
nsubj |
we,conducted |
R1618 |
T2898 |
T2899 |
advmod |
in,situ |
R1619 |
T2899 |
T2900 |
amod |
situ,hybridization |
R1620 |
T2900 |
T2885 |
dobj |
hybridization,conducted |
R1621 |
T2901 |
T2885 |
advcl |
using,conducted |
R1622 |
T2902 |
T2903 |
det |
a,probe |
R1623 |
T2903 |
T2901 |
dobj |
probe,using |
R1624 |
T2904 |
T2903 |
compound |
cRNA,probe |
R1625 |
T2905 |
T2903 |
amod |
unique,probe |
R1626 |
T2906 |
T2905 |
prep |
to,unique |
R1627 |
T2907 |
T2908 |
det |
the,region |
R1628 |
T2908 |
T2906 |
pobj |
region,to |
R1629 |
T2909 |
T2908 |
nmod |
Snail,region |
R1630 |
T2910 |
T2908 |
nummod |
3,region |
R1631 |
T2911 |
T2910 |
punct |
′,3 |
R1632 |
T2912 |
T2908 |
amod |
untranslated,region |
R1633 |
T2913 |
T2908 |
punct |
(,region |
R1634 |
T2914 |
T2908 |
appos |
UTR,region |
R1635 |
T2915 |
T2908 |
punct |
),region |
R1636 |
T2916 |
T2885 |
punct |
.,conducted |
R1637 |
T2918 |
T2919 |
amod |
Embryonic,day |
R1638 |
T2919 |
T2920 |
nsubjpass |
day,chosen |
R1639 |
T2921 |
T2919 |
nummod |
17.5,day |
R1640 |
T2922 |
T2919 |
punct |
(,day |
R1641 |
T2923 |
T2919 |
appos |
E17.5,day |
R1642 |
T2924 |
T2920 |
punct |
),chosen |
R1643 |
T2925 |
T2920 |
auxpass |
was,chosen |
R1644 |
T2926 |
T2920 |
punct |
", ",chosen |
R1645 |
T2927 |
T2928 |
mark |
since,enabled |
R1646 |
T2928 |
T2920 |
advcl |
enabled,chosen |
R1647 |
T2929 |
T2930 |
det |
the,waves |
R1648 |
T2930 |
T2928 |
nsubj |
waves,enabled |
R1649 |
T2931 |
T2930 |
amod |
multiple,waves |
R1650 |
T2932 |
T2930 |
prep |
of,waves |
R1651 |
T2933 |
T2934 |
compound |
follicle,morphogenesis |
R1652 |
T2934 |
T2932 |
pobj |
morphogenesis,of |
R1653 |
T2935 |
T2930 |
acl |
occurring,waves |
R1654 |
T2936 |
T2935 |
prep |
at,occurring |
R1655 |
T2937 |
T2938 |
det |
this,time |
R1656 |
T2938 |
T2936 |
pobj |
time,at |
R1657 |
T2939 |
T2928 |
dobj |
us,enabled |
R1658 |
T2940 |
T2941 |
aux |
to,evaluate |
R1659 |
T2941 |
T2928 |
xcomp |
evaluate,enabled |
R1660 |
T2942 |
T2943 |
compound |
Snail,expression |
R1661 |
T2943 |
T2941 |
dobj |
expression,evaluate |
R1662 |
T2944 |
T2941 |
prep |
at,evaluate |
R1663 |
T2945 |
T2946 |
amod |
different,stages |
R1664 |
T2946 |
T2944 |
pobj |
stages,at |
R1665 |
T2947 |
T2946 |
prep |
of,stages |
R1666 |
T2948 |
T2949 |
det |
the,process |
R1667 |
T2949 |
T2947 |
pobj |
process,of |
R1668 |
T2950 |
T2920 |
punct |
.,chosen |
R1669 |
T2952 |
T2953 |
mark |
As,shown |
R1670 |
T2953 |
T2954 |
advcl |
shown,detected |
R1671 |
T2955 |
T2953 |
prep |
in,shown |
R1672 |
T2956 |
T2957 |
compound |
Figure,1A |
R1673 |
T2957 |
T2955 |
pobj |
1A,in |
R1674 |
T2958 |
T2954 |
punct |
", ",detected |
R1675 |
T2959 |
T2960 |
amod |
specific,hybridization |
R1676 |
T2960 |
T2954 |
nsubjpass |
hybridization,detected |
R1677 |
T2961 |
T2954 |
auxpass |
was,detected |
R1678 |
T2962 |
T2954 |
prep |
within,detected |
R1679 |
T2963 |
T2964 |
det |
the,epithelium |
R1680 |
T2964 |
T2962 |
pobj |
epithelium,within |
R1681 |
T2965 |
T2964 |
prep |
of,epithelium |
R1682 |
T2966 |
T2967 |
amod |
nascent,buds |
R1683 |
T2967 |
T2965 |
pobj |
buds,of |
R1684 |
T2968 |
T2967 |
compound |
hair,buds |
R1685 |
T2969 |
T2954 |
punct |
.,detected |
R1686 |
T2971 |
T2972 |
prep |
By,exhibited |
R1687 |
T2973 |
T2971 |
pobj |
contrast,By |
R1688 |
T2974 |
T2972 |
punct |
", ",exhibited |
R1689 |
T2975 |
T2976 |
mark |
as,progressed |
R1690 |
T2976 |
T2972 |
advcl |
progressed,exhibited |
R1691 |
T2977 |
T2976 |
nsubj |
follicles,progressed |
R1692 |
T2978 |
T2976 |
advmod |
further,progressed |
R1693 |
T2979 |
T2976 |
prep |
through,progressed |
R1694 |
T2980 |
T2981 |
poss |
their,development |
R1695 |
T2981 |
T2979 |
pobj |
development,through |
R1696 |
T2982 |
T2983 |
punct |
(,stages |
R1697 |
T2983 |
T2976 |
parataxis |
stages,progressed |
R1698 |
T2984 |
T2983 |
advmod |
e.g.,stages |
R1699 |
T2985 |
T2983 |
punct |
", ",stages |
R1700 |
T2986 |
T2983 |
nmod |
germ,stages |
R1701 |
T2987 |
T2986 |
cc |
and,germ |
R1702 |
T2988 |
T2986 |
conj |
peg,germ |
R1703 |
T2989 |
T2983 |
punct |
),stages |
R1704 |
T2990 |
T2972 |
punct |
", ",exhibited |
R1705 |
T2991 |
T2972 |
nsubj |
they,exhibited |
R1706 |
T2992 |
T2993 |
det |
no,signs |
R1707 |
T2993 |
T2972 |
dobj |
signs,exhibited |
R1708 |
T2994 |
T2993 |
prep |
of,signs |
R1709 |
T2995 |
T2994 |
pobj |
hybridization,of |
R1710 |
T2996 |
T2997 |
punct |
(,1A |
R1711 |
T2997 |
T2972 |
parataxis |
1A,exhibited |
R1712 |
T2998 |
T2997 |
compound |
Figure,1A |
R1713 |
T2999 |
T2997 |
punct |
),1A |
R1714 |
T3000 |
T2972 |
punct |
.,exhibited |
R1715 |
T3002 |
T3003 |
det |
The,nature |
R1716 |
T3003 |
T3005 |
nsubj |
nature,was |
R1717 |
T3004 |
T3003 |
amod |
transient,nature |
R1718 |
T3006 |
T3003 |
prep |
of,nature |
R1719 |
T3007 |
T3008 |
compound |
Snail,expression |
R1720 |
T3008 |
T3006 |
pobj |
expression,of |
R1721 |
T3009 |
T3008 |
compound |
mRNA,expression |
R1722 |
T3010 |
T3008 |
prep |
during,expression |
R1723 |
T3011 |
T3012 |
compound |
follicle,development |
R1724 |
T3012 |
T3010 |
pobj |
development,during |
R1725 |
T3013 |
T3014 |
advmod |
most,apparent |
R1726 |
T3014 |
T3005 |
acomp |
apparent,was |
R1727 |
T3015 |
T3005 |
prep |
in,was |
R1728 |
T3016 |
T3017 |
amod |
hybridized,sections |
R1729 |
T3017 |
T3015 |
pobj |
sections,in |
R1730 |
T3018 |
T3017 |
compound |
skin,sections |
R1731 |
T3019 |
T3017 |
acl |
containing,sections |
R1732 |
T3020 |
T3019 |
dobj |
follicles,containing |
R1733 |
T3021 |
T3020 |
prep |
from,follicles |
R1734 |
T3022 |
T3023 |
nummod |
two,waves |
R1735 |
T3023 |
T3021 |
pobj |
waves,from |
R1736 |
T3024 |
T3023 |
amod |
different,waves |
R1737 |
T3025 |
T3023 |
prep |
of,waves |
R1738 |
T3026 |
T3025 |
pobj |
morphogenesis,of |
R1739 |
T3027 |
T3028 |
punct |
(,shown |
R1740 |
T3028 |
T3005 |
parataxis |
shown,was |
R1741 |
T3029 |
T3028 |
mark |
as,shown |
R1742 |
T3030 |
T3028 |
prep |
in,shown |
R1743 |
T3031 |
T3030 |
pobj |
Figure,in |
R1744 |
T3032 |
T3031 |
nummod |
1,Figure |
R1745 |
T3033 |
T3028 |
punct |
),shown |
R1746 |
T3034 |
T3005 |
punct |
.,was |
R1747 |
T3036 |
T3037 |
amod |
Hybridizing,buds |
R1748 |
T3037 |
T3039 |
nsubj |
buds,appeared |
R1749 |
T3038 |
T3037 |
compound |
hair,buds |
R1750 |
T3040 |
T3037 |
prep |
from,buds |
R1751 |
T3041 |
T3042 |
det |
a,wave |
R1752 |
T3042 |
T3040 |
pobj |
wave,from |
R1753 |
T3043 |
T3042 |
amod |
later,wave |
R1754 |
T3044 |
T3039 |
oprd |
juxtaposed,appeared |
R1755 |
T3045 |
T3044 |
prep |
with,juxtaposed |
R1756 |
T3046 |
T3047 |
amod |
nonhybridizing,follicles |
R1757 |
T3047 |
T3045 |
pobj |
follicles,with |
R1758 |
T3048 |
T3047 |
prep |
from,follicles |
R1759 |
T3049 |
T3050 |
det |
an,wave |
R1760 |
T3050 |
T3048 |
pobj |
wave,from |
R1761 |
T3051 |
T3050 |
amod |
earlier,wave |
R1762 |
T3052 |
T3039 |
punct |
.,appeared |
R1763 |
T3054 |
T3055 |
aux |
To,determine |
R1764 |
T3055 |
T3056 |
advcl |
determine,generated |
R1765 |
T3057 |
T3058 |
mark |
whether,reflected |
R1766 |
T3058 |
T3055 |
ccomp |
reflected,determine |
R1767 |
T3059 |
T3060 |
det |
this,nature |
R1768 |
T3060 |
T3058 |
nsubjpass |
nature,reflected |
R1769 |
T3061 |
T3060 |
amod |
transient,nature |
R1770 |
T3062 |
T3060 |
prep |
of,nature |
R1771 |
T3063 |
T3064 |
compound |
Snail,expression |
R1772 |
T3064 |
T3062 |
pobj |
expression,of |
R1773 |
T3065 |
T3064 |
compound |
mRNA,expression |
R1774 |
T3066 |
T3058 |
auxpass |
is,reflected |
R1775 |
T3067 |
T3058 |
prep |
at,reflected |
R1776 |
T3068 |
T3069 |
det |
the,level |
R1777 |
T3069 |
T3067 |
pobj |
level,at |
R1778 |
T3070 |
T3069 |
compound |
protein,level |
R1779 |
T3071 |
T3056 |
punct |
", ",generated |
R1780 |
T3072 |
T3056 |
nsubj |
we,generated |
R1781 |
T3073 |
T3074 |
det |
an,antibody |
R1782 |
T3074 |
T3056 |
dobj |
antibody,generated |
R1783 |
T3075 |
T3074 |
prep |
against,antibody |
R1784 |
T3076 |
T3077 |
det |
the,sequence |
R1785 |
T3077 |
T3075 |
pobj |
sequence,against |
R1786 |
T3078 |
T3079 |
npadvmod |
N,terminal |
R1787 |
T3079 |
T3077 |
amod |
terminal,sequence |
R1788 |
T3080 |
T3079 |
punct |
-,terminal |
R1789 |
T3081 |
T3082 |
dep |
that,resides |
R1790 |
T3082 |
T3077 |
relcl |
resides,sequence |
R1791 |
T3083 |
T3082 |
advmod |
upstream,resides |
R1792 |
T3084 |
T3083 |
prep |
of,upstream |
R1793 |
T3085 |
T3086 |
det |
the,domains |
R1794 |
T3086 |
T3084 |
pobj |
domains,of |
R1795 |
T3087 |
T3088 |
advmod |
more,conserved |
R1796 |
T3088 |
T3086 |
amod |
conserved,domains |
R1797 |
T3089 |
T3090 |
compound |
zinc,finger |
R1798 |
T3090 |
T3086 |
compound |
finger,domains |
R1799 |
T3091 |
T3056 |
punct |
.,generated |
R1800 |
T3093 |
T3094 |
mark |
As,judged |
R1801 |
T3094 |
T3095 |
advcl |
judged,detect |
R1802 |
T3096 |
T3094 |
prep |
by,judged |
R1803 |
T3097 |
T3098 |
compound |
Western,blot |
R1804 |
T3098 |
T3099 |
compound |
blot,analysis |
R1805 |
T3099 |
T3096 |
pobj |
analysis,by |
R1806 |
T3100 |
T3095 |
punct |
", ",detect |
R1807 |
T3101 |
T3102 |
det |
the,antibody |
R1808 |
T3102 |
T3095 |
nsubj |
antibody,detect |
R1809 |
T3103 |
T3095 |
aux |
did,detect |
R1810 |
T3104 |
T3095 |
neg |
not,detect |
R1811 |
T3105 |
T3106 |
amod |
endogenous,proteins |
R1812 |
T3106 |
T3095 |
dobj |
proteins,detect |
R1813 |
T3107 |
T3106 |
prep |
from,proteins |
R1814 |
T3108 |
T3109 |
amod |
cultured,keratinocytes |
R1815 |
T3109 |
T3107 |
pobj |
keratinocytes,from |
R1816 |
T3110 |
T3095 |
punct |
", ",detect |
R1817 |
T3111 |
T3095 |
cc |
but,detect |
R1818 |
T3112 |
T3113 |
nsubj |
it,yield |
R1819 |
T3113 |
T3095 |
conj |
yield,detect |
R1820 |
T3114 |
T3113 |
aux |
did,yield |
R1821 |
T3115 |
T3116 |
det |
a,band |
R1822 |
T3116 |
T3113 |
dobj |
band,yield |
R1823 |
T3117 |
T3116 |
prep |
of,band |
R1824 |
T3118 |
T3119 |
det |
the,size |
R1825 |
T3119 |
T3117 |
pobj |
size,of |
R1826 |
T3120 |
T3119 |
amod |
expected,size |
R1827 |
T3121 |
T3113 |
prep |
from,yield |
R1828 |
T3122 |
T3121 |
pobj |
keratinocytes,from |
R1829 |
T3123 |
T3124 |
advmod |
transiently,expressing |
R1830 |
T3124 |
T3122 |
acl |
expressing,keratinocytes |
R1831 |
T3125 |
T3126 |
det |
a,protein |
R1832 |
T3126 |
T3124 |
dobj |
protein,expressing |
R1833 |
T3127 |
T3128 |
npadvmod |
hemagglutinin,tagged |
R1834 |
T3128 |
T3126 |
amod |
tagged,protein |
R1835 |
T3129 |
T3127 |
punct |
(,hemagglutinin |
R1836 |
T3130 |
T3127 |
appos |
HA,hemagglutinin |
R1837 |
T3131 |
T3128 |
punct |
),tagged |
R1838 |
T3132 |
T3128 |
punct |
-,tagged |
R1839 |
T3133 |
T3126 |
compound |
Snail,protein |
R1840 |
T3134 |
T3135 |
punct |
(,1B |
R1841 |
T3135 |
T3113 |
parataxis |
1B,yield |
R1842 |
T3136 |
T3135 |
compound |
Figure,1B |
R1843 |
T3137 |
T3135 |
punct |
),1B |
R1844 |
T3138 |
T3095 |
punct |
.,detect |
R1845 |
T3140 |
T3141 |
det |
The,antibody |
R1846 |
T3141 |
T3142 |
nsubj |
antibody,recognized |
R1847 |
T3143 |
T3142 |
advmod |
also,recognized |
R1848 |
T3144 |
T3145 |
det |
a,band |
R1849 |
T3145 |
T3142 |
dobj |
band,recognized |
R1850 |
T3146 |
T3145 |
acl |
corresponding,band |
R1851 |
T3147 |
T3146 |
prep |
to,corresponding |
R1852 |
T3148 |
T3149 |
det |
the,size |
R1853 |
T3149 |
T3147 |
pobj |
size,to |
R1854 |
T3150 |
T3149 |
prep |
of,size |
R1855 |
T3151 |
T3152 |
amod |
endogenous,Snail |
R1856 |
T3152 |
T3150 |
pobj |
Snail,of |
R1857 |
T3153 |
T3149 |
punct |
(,size |
R1858 |
T3154 |
T3155 |
advmod |
approximately,28 |
R1859 |
T3155 |
T3156 |
nummod |
28,kDa |
R1860 |
T3156 |
T3149 |
appos |
kDa,size |
R1861 |
T3157 |
T3149 |
punct |
),size |
R1862 |
T3158 |
T3149 |
prep |
in,size |
R1863 |
T3159 |
T3158 |
pobj |
lysates,in |
R1864 |
T3160 |
T3159 |
prep |
from,lysates |
R1865 |
T3161 |
T3162 |
amod |
embryonic,skin |
R1866 |
T3162 |
T3160 |
pobj |
skin,from |
R1867 |
T3163 |
T3162 |
compound |
mouse,skin |
R1868 |
T3164 |
T3145 |
punct |
", ",band |
R1869 |
T3165 |
T3166 |
det |
the,appearance |
R1870 |
T3166 |
T3168 |
dep |
appearance,corresponded |
R1871 |
T3167 |
T3166 |
amod |
temporal,appearance |
R1872 |
T3168 |
T3145 |
relcl |
corresponded,band |
R1873 |
T3169 |
T3166 |
prep |
of,appearance |
R1874 |
T3170 |
T3169 |
pobj |
which,of |
R1875 |
T3171 |
T3168 |
prep |
to,corresponded |
R1876 |
T3172 |
T3173 |
det |
the,waves |
R1877 |
T3173 |
T3171 |
pobj |
waves,to |
R1878 |
T3174 |
T3173 |
prep |
of,waves |
R1879 |
T3175 |
T3176 |
compound |
hair,follicle |
R1880 |
T3176 |
T3177 |
compound |
follicle,morphogenesis |
R1881 |
T3177 |
T3174 |
pobj |
morphogenesis,of |
R1882 |
T3178 |
T3173 |
prep |
from,waves |
R1883 |
T3179 |
T3178 |
pobj |
E15.5,from |
R1884 |
T3180 |
T3178 |
prep |
to,from |
R1885 |
T3181 |
T3180 |
amod |
newborn,to |
R1886 |
T3182 |
T3183 |
advmod |
when,formed |
R1887 |
T3183 |
T3173 |
relcl |
formed,waves |
R1888 |
T3184 |
T3185 |
quantmod |
over,90 |
R1889 |
T3185 |
T3186 |
nummod |
90,% |
R1890 |
T3186 |
T3183 |
nsubjpass |
%,formed |
R1891 |
T3187 |
T3186 |
prep |
of,% |
R1892 |
T3188 |
T3189 |
det |
the,hair |
R1893 |
T3189 |
T3187 |
pobj |
hair,of |
R1894 |
T3190 |
T3189 |
prep |
on,hair |
R1895 |
T3191 |
T3192 |
det |
the,mouse |
R1896 |
T3192 |
T3190 |
pobj |
mouse,on |
R1897 |
T3193 |
T3183 |
auxpass |
is,formed |
R1898 |
T3194 |
T3195 |
punct |
(,1B |
R1899 |
T3195 |
T3142 |
parataxis |
1B,recognized |
R1900 |
T3196 |
T3195 |
compound |
Figure,1B |
R1901 |
T3197 |
T3195 |
punct |
),1B |
R1902 |
T3198 |
T3142 |
punct |
.,recognized |
R1903 |
T3200 |
T3201 |
advcl |
Consistent,detect |
R1904 |
T3202 |
T3200 |
prep |
with,Consistent |
R1905 |
T3203 |
T3204 |
det |
the,data |
R1906 |
T3204 |
T3202 |
pobj |
data,with |
R1907 |
T3205 |
T3206 |
compound |
Western,blot |
R1908 |
T3206 |
T3204 |
compound |
blot,data |
R1909 |
T3207 |
T3201 |
punct |
", ",detect |
R1910 |
T3208 |
T3209 |
amod |
immunohistochemical,analysis |
R1911 |
T3209 |
T3201 |
nsubj |
analysis,detect |
R1912 |
T3210 |
T3201 |
aux |
did,detect |
R1913 |
T3211 |
T3201 |
neg |
not,detect |
R1914 |
T3212 |
T3201 |
dobj |
Snail,detect |
R1915 |
T3213 |
T3201 |
prep |
in,detect |
R1916 |
T3214 |
T3215 |
amod |
single,layered |
R1917 |
T3215 |
T3217 |
amod |
layered,epidermis |
R1918 |
T3216 |
T3215 |
punct |
-,layered |
R1919 |
T3217 |
T3213 |
pobj |
epidermis,in |
R1920 |
T3218 |
T3217 |
compound |
E13.5,epidermis |
R1921 |
T3219 |
T3220 |
punct |
(,1C |
R1922 |
T3220 |
T3217 |
parataxis |
1C,epidermis |
R1923 |
T3221 |
T3220 |
compound |
Figure,1C |
R1924 |
T3222 |
T3220 |
punct |
),1C |
R1925 |
T3223 |
T3213 |
cc |
nor,in |
R1926 |
T3224 |
T3213 |
conj |
in,in |
R1927 |
T3225 |
T3226 |
det |
the,placode |
R1928 |
T3226 |
T3224 |
pobj |
placode,in |
R1929 |
T3227 |
T3201 |
punct |
", ",detect |
R1930 |
T3228 |
T3229 |
dep |
which,is |
R1931 |
T3229 |
T3201 |
advcl |
is,detect |
R1932 |
T3230 |
T3231 |
det |
the,sign |
R1933 |
T3231 |
T3229 |
attr |
sign,is |
R1934 |
T3232 |
T3231 |
amod |
earliest,sign |
R1935 |
T3233 |
T3231 |
amod |
morphological,sign |
R1936 |
T3234 |
T3231 |
prep |
of,sign |
R1937 |
T3235 |
T3236 |
det |
the,commitment |
R1938 |
T3236 |
T3234 |
pobj |
commitment,of |
R1939 |
T3237 |
T3236 |
prep |
of,commitment |
R1940 |
T3238 |
T3239 |
amod |
multipotent,cells |
R1941 |
T3239 |
T3237 |
pobj |
cells,of |
R1942 |
T3240 |
T3239 |
prep |
of,cells |
R1943 |
T3241 |
T3242 |
det |
the,ectoderm |
R1944 |
T3242 |
T3240 |
pobj |
ectoderm,of |
R1945 |
T3243 |
T3242 |
amod |
embryonic,ectoderm |
R1946 |
T3244 |
T3236 |
prep |
to,commitment |
R1947 |
T3245 |
T3246 |
det |
a,fate |
R1948 |
T3246 |
T3244 |
pobj |
fate,to |
R1949 |
T3247 |
T3248 |
compound |
hair,cell |
R1950 |
T3248 |
T3246 |
compound |
cell,fate |
R1951 |
T3249 |
T3250 |
punct |
(,1D |
R1952 |
T3250 |
T3201 |
parataxis |
1D,detect |
R1953 |
T3251 |
T3250 |
compound |
Figure,1D |
R1954 |
T3252 |
T3250 |
punct |
),1D |
R1955 |
T3253 |
T3201 |
punct |
.,detect |
R1956 |
T3255 |
T3256 |
advcl |
Consistent,labeled |
R1957 |
T3257 |
T3255 |
prep |
with,Consistent |
R1958 |
T3258 |
T3259 |
det |
the,results |
R1959 |
T3259 |
T3257 |
pobj |
results,with |
R1960 |
T3260 |
T3261 |
advmod |
in,situ |
R1961 |
T3261 |
T3259 |
amod |
situ,results |
R1962 |
T3262 |
T3259 |
compound |
hybridization,results |
R1963 |
T3263 |
T3256 |
punct |
", ",labeled |
R1964 |
T3264 |
T3265 |
amod |
anti-Snail,antibody |
R1965 |
T3265 |
T3256 |
nsubj |
antibody,labeled |
R1966 |
T3266 |
T3267 |
advmod |
only,buds |
R1967 |
T3267 |
T3256 |
dobj |
buds,labeled |
R1968 |
T3268 |
T3267 |
compound |
hair,buds |
R1969 |
T3269 |
T3267 |
cc |
and,buds |
R1970 |
T3270 |
T3269 |
neg |
not,and |
R1971 |
T3271 |
T3267 |
conj |
follicles,buds |
R1972 |
T3272 |
T3256 |
prep |
at,labeled |
R1973 |
T3273 |
T3274 |
advmod |
more,stages |
R1974 |
T3274 |
T3272 |
pobj |
stages,at |
R1975 |
T3275 |
T3274 |
amod |
mature,stages |
R1976 |
T3276 |
T3274 |
prep |
of,stages |
R1977 |
T3277 |
T3276 |
pobj |
development,of |
R1978 |
T3278 |
T3279 |
punct |
(,1E |
R1979 |
T3279 |
T3256 |
parataxis |
1E,labeled |
R1980 |
T3280 |
T3279 |
compound |
Figure,1E |
R1981 |
T3281 |
T3279 |
punct |
),1E |
R1982 |
T3282 |
T3256 |
punct |
.,labeled |
R1983 |
T3284 |
T3285 |
advcl |
Taken,appeared |
R1984 |
T3286 |
T3284 |
advmod |
together,Taken |
R1985 |
T3287 |
T3285 |
punct |
", ",appeared |
R1986 |
T3288 |
T3289 |
det |
the,antibody |
R1987 |
T3289 |
T3285 |
nsubj |
antibody,appeared |
R1988 |
T3290 |
T3289 |
amod |
anti-Snail,antibody |
R1989 |
T3291 |
T3292 |
aux |
to,be |
R1990 |
T3292 |
T3285 |
xcomp |
be,appeared |
R1991 |
T3293 |
T3292 |
acomp |
specific,be |
R1992 |
T3294 |
T3293 |
prep |
for,specific |
R1993 |
T3295 |
T3296 |
poss |
its,protein |
R1994 |
T3296 |
T3294 |
pobj |
protein,for |
R1995 |
T3297 |
T3296 |
compound |
target,protein |
R1996 |
T3298 |
T3285 |
punct |
.,appeared |
R1997 |
T3300 |
T3301 |
nsubj |
It,detect |
R1998 |
T3302 |
T3301 |
aux |
did,detect |
R1999 |
T3303 |
T3301 |
neg |
not,detect |
R2000 |
T3304 |
T3305 |
amod |
other,members |
R2001 |
T3305 |
T3301 |
dobj |
members,detect |
R2002 |
T3306 |
T3305 |
compound |
Snail,members |
R2003 |
T3307 |
T3305 |
compound |
family,members |
R2004 |
T3308 |
T3305 |
acl |
known,members |
R2005 |
T3309 |
T3310 |
aux |
to,expressed |
R2006 |
T3310 |
T3308 |
xcomp |
expressed,known |
R2007 |
T3311 |
T3310 |
auxpass |
be,expressed |
R2008 |
T3312 |
T3310 |
prep |
in,expressed |
R2009 |
T3313 |
T3312 |
pobj |
keratinocytes,in |
R2010 |
T3314 |
T3313 |
cc |
and,keratinocytes |
R2011 |
T3315 |
T3314 |
punct |
/,and |
R2012 |
T3316 |
T3314 |
cc |
or,and |
R2013 |
T3317 |
T3313 |
conj |
skin,keratinocytes |
R2014 |
T3318 |
T3319 |
punct |
(,data |
R2015 |
T3319 |
T3308 |
meta |
data,known |
R2016 |
T3320 |
T3319 |
amod |
unpublished,data |
R2017 |
T3321 |
T3319 |
punct |
),data |
R2018 |
T3322 |
T3301 |
punct |
.,detect |
R2019 |
T3324 |
T3325 |
advmod |
Furthermore,paralleled |
R2020 |
T3326 |
T3325 |
punct |
", ",paralleled |
R2021 |
T3327 |
T3328 |
det |
the,data |
R2022 |
T3328 |
T3325 |
nsubj |
data,paralleled |
R2023 |
T3329 |
T3328 |
amod |
immunohistochemical,data |
R2024 |
T3330 |
T3331 |
poss |
our,data |
R2025 |
T3331 |
T3325 |
dobj |
data,paralleled |
R2026 |
T3332 |
T3333 |
nmod |
Snail,hybridization |
R2027 |
T3333 |
T3331 |
compound |
hybridization,data |
R2028 |
T3334 |
T3335 |
advmod |
in,situ |
R2029 |
T3335 |
T3333 |
amod |
situ,hybridization |
R2030 |
T3336 |
T3325 |
advcl |
revealing,paralleled |
R2031 |
T3337 |
T3338 |
amod |
transient,expression |
R2032 |
T3338 |
T3336 |
dobj |
expression,revealing |
R2033 |
T3339 |
T3338 |
compound |
Snail,expression |
R2034 |
T3340 |
T3336 |
prep |
at,revealing |
R2035 |
T3341 |
T3342 |
det |
the,stage |
R2036 |
T3342 |
T3340 |
pobj |
stage,at |
R2037 |
T3343 |
T3344 |
compound |
hair,bud |
R2038 |
T3344 |
T3342 |
compound |
bud,stage |
R2039 |
T3345 |
T3346 |
punct |
(,1A |
R2040 |
T3346 |
T3325 |
parataxis |
1A,paralleled |
R2041 |
T3347 |
T3346 |
compound |
Figure,1A |
R2042 |
T3348 |
T3346 |
punct |
),1A |
R2043 |
T3349 |
T3325 |
punct |
.,paralleled |
R2044 |
T3351 |
T3352 |
mark |
As,judged |
R2045 |
T3352 |
T3353 |
advcl |
judged,localized |
R2046 |
T3354 |
T3352 |
prep |
by,judged |
R2047 |
T3355 |
T3354 |
pobj |
immunohistochemistry,by |
R2048 |
T3356 |
T3353 |
punct |
", ",localized |
R2049 |
T3357 |
T3358 |
compound |
Snail,protein |
R2050 |
T3358 |
T3353 |
nsubjpass |
protein,localized |
R2051 |
T3359 |
T3353 |
auxpass |
was,localized |
R2052 |
T3360 |
T3353 |
prep |
to,localized |
R2053 |
T3361 |
T3362 |
det |
the,nuclei |
R2054 |
T3362 |
T3360 |
pobj |
nuclei,to |
R2055 |
T3363 |
T3362 |
prep |
of,nuclei |
R2056 |
T3364 |
T3365 |
det |
the,cells |
R2057 |
T3365 |
T3363 |
pobj |
cells,of |
R2058 |
T3366 |
T3367 |
compound |
hair,bud |
R2059 |
T3367 |
T3365 |
compound |
bud,cells |
R2060 |
T3368 |
T3369 |
punct |
(,1E |
R2061 |
T3369 |
T3353 |
parataxis |
1E,localized |
R2062 |
T3370 |
T3369 |
compound |
Figure,1E |
R2063 |
T3371 |
T3369 |
punct |
),1E |
R2064 |
T3372 |
T3353 |
punct |
.,localized |
R2065 |
T3374 |
T3375 |
det |
This,feature |
R2066 |
T3375 |
T3376 |
nsubj |
feature,was |
R2067 |
T3377 |
T3376 |
acomp |
consistent,was |
R2068 |
T3378 |
T3377 |
prep |
with,consistent |
R2069 |
T3379 |
T3380 |
poss |
Snail,function |
R2070 |
T3380 |
T3378 |
pobj |
function,with |
R2071 |
T3381 |
T3379 |
case |
's,Snail |
R2072 |
T3382 |
T3380 |
amod |
known,function |
R2073 |
T3383 |
T3380 |
prep |
as,function |
R2074 |
T3384 |
T3385 |
det |
a,repressor |
R2075 |
T3385 |
T3383 |
pobj |
repressor,as |
R2076 |
T3386 |
T3385 |
amod |
transcriptional,repressor |
R2077 |
T3387 |
T3388 |
punct |
[,13 |
R2078 |
T3388 |
T3376 |
parataxis |
13,was |
R2079 |
T3389 |
T3388 |
nummod |
12,13 |
R2080 |
T3390 |
T3388 |
punct |
",",13 |
R2081 |
T3391 |
T3388 |
punct |
],13 |
R2082 |
T3392 |
T3376 |
punct |
.,was |
R2083 |
T3394 |
T3395 |
advmod |
Additionally,detected |
R2084 |
T3396 |
T3395 |
punct |
", ",detected |
R2085 |
T3397 |
T3398 |
amod |
anti-Snail,labeling |
R2086 |
T3398 |
T3395 |
nsubjpass |
labeling,detected |
R2087 |
T3399 |
T3395 |
auxpass |
was,detected |
R2088 |
T3400 |
T3395 |
prep |
in,detected |
R2089 |
T3401 |
T3402 |
advmod |
only,four |
R2090 |
T3402 |
T3406 |
nummod |
four,waves |
R2091 |
T3403 |
T3402 |
quantmod |
three,four |
R2092 |
T3404 |
T3402 |
quantmod |
of,four |
R2093 |
T3405 |
T3402 |
quantmod |
the,four |
R2094 |
T3406 |
T3400 |
pobj |
waves,in |
R2095 |
T3407 |
T3406 |
amod |
major,waves |
R2096 |
T3408 |
T3406 |
prep |
of,waves |
R2097 |
T3409 |
T3410 |
compound |
follicle,morphogenesis |
R2098 |
T3410 |
T3408 |
pobj |
morphogenesis,of |
R2099 |
T3411 |
T3395 |
punct |
.,detected |
R2100 |
T3413 |
T3414 |
nsubjpass |
Snail,found |
R2101 |
T3415 |
T3414 |
auxpass |
was,found |
R2102 |
T3416 |
T3414 |
neg |
not,found |
R2103 |
T3417 |
T3414 |
prep |
in,found |
R2104 |
T3418 |
T3419 |
det |
the,buds |
R2105 |
T3419 |
T3417 |
pobj |
buds,in |
R2106 |
T3420 |
T3419 |
prep |
of,buds |
R2107 |
T3421 |
T3422 |
compound |
guard,hairs |
R2108 |
T3422 |
T3420 |
pobj |
hairs,of |
R2109 |
T3423 |
T3424 |
dep |
that,are |
R2110 |
T3424 |
T3422 |
advcl |
are,hairs |
R2111 |
T3425 |
T3426 |
det |
the,earliest |
R2112 |
T3426 |
T3424 |
attr |
earliest,are |
R2113 |
T3427 |
T3426 |
prep |
of,earliest |
R2114 |
T3428 |
T3429 |
det |
all,hairs |
R2115 |
T3429 |
T3427 |
pobj |
hairs,of |
R2116 |
T3430 |
T3431 |
aux |
to,form |
R2117 |
T3431 |
T3429 |
advcl |
form,hairs |
R2118 |
T3432 |
T3433 |
punct |
(,at |
R2119 |
T3433 |
T3426 |
parataxis |
at,earliest |
R2120 |
T3434 |
T3433 |
pobj |
E13.5,at |
R2121 |
T3435 |
T3433 |
punct |
),at |
R2122 |
T3436 |
T3424 |
punct |
", ",are |
R2123 |
T3437 |
T3424 |
cc |
and,are |
R2124 |
T3438 |
T3439 |
dep |
which,constitute |
R2125 |
T3439 |
T3424 |
conj |
constitute,are |
R2126 |
T3440 |
T3441 |
amod |
less,5 |
R2127 |
T3441 |
T3443 |
nummod |
5,% |
R2128 |
T3442 |
T3441 |
quantmod |
than,5 |
R2129 |
T3443 |
T3439 |
dobj |
%,constitute |
R2130 |
T3444 |
T3443 |
prep |
of,% |
R2131 |
T3445 |
T3446 |
det |
the,coat |
R2132 |
T3446 |
T3444 |
pobj |
coat,of |
R2133 |
T3447 |
T3446 |
compound |
mouse,coat |
R2134 |
T3448 |
T3449 |
punct |
(,data |
R2135 |
T3449 |
T3414 |
meta |
data,found |
R2136 |
T3450 |
T3449 |
amod |
unpublished,data |
R2137 |
T3451 |
T3449 |
punct |
),data |
R2138 |
T3452 |
T3414 |
punct |
.,found |
R2139 |
T3454 |
T3455 |
mark |
As,judged |
R2140 |
T3455 |
T3456 |
advcl |
judged,coincided |
R2141 |
T3457 |
T3455 |
prep |
by,judged |
R2142 |
T3458 |
T3457 |
pobj |
immunofluorescence,by |
R2143 |
T3459 |
T3458 |
prep |
with,immunofluorescence |
R2144 |
T3460 |
T3459 |
pobj |
antibodies,with |
R2145 |
T3461 |
T3460 |
prep |
against,antibodies |
R2146 |
T3462 |
T3463 |
det |
the,antigen |
R2147 |
T3463 |
T3461 |
pobj |
antigen,against |
R2148 |
T3464 |
T3463 |
amod |
proliferating,antigen |
R2149 |
T3465 |
T3463 |
amod |
nuclear,antigen |
R2150 |
T3466 |
T3463 |
appos |
Ki67,antigen |
R2151 |
T3467 |
T3456 |
punct |
", ",coincided |
R2152 |
T3468 |
T3469 |
det |
the,timing |
R2153 |
T3469 |
T3456 |
nsubj |
timing,coincided |
R2154 |
T3470 |
T3469 |
prep |
of,timing |
R2155 |
T3471 |
T3472 |
compound |
Snail,expression |
R2156 |
T3472 |
T3470 |
pobj |
expression,of |
R2157 |
T3473 |
T3456 |
prep |
with,coincided |
R2158 |
T3474 |
T3475 |
det |
the,stage |
R2159 |
T3475 |
T3473 |
pobj |
stage,with |
R2160 |
T3476 |
T3477 |
prep |
at,enhanced |
R2161 |
T3477 |
T3475 |
relcl |
enhanced,stage |
R2162 |
T3478 |
T3476 |
pobj |
which,at |
R2163 |
T3479 |
T3480 |
det |
the,follicle |
R2164 |
T3480 |
T3477 |
nsubj |
follicle,enhanced |
R2165 |
T3481 |
T3480 |
amod |
developing,follicle |
R2166 |
T3482 |
T3483 |
poss |
its,proliferation |
R2167 |
T3483 |
T3477 |
dobj |
proliferation,enhanced |
R2168 |
T3484 |
T3483 |
cc |
and,proliferation |
R2169 |
T3485 |
T3486 |
amod |
down,growth |
R2170 |
T3486 |
T3483 |
conj |
growth,proliferation |
R2171 |
T3487 |
T3486 |
punct |
-,growth |
R2172 |
T3488 |
T3489 |
punct |
(,1F |
R2173 |
T3489 |
T3456 |
parataxis |
1F,coincided |
R2174 |
T3490 |
T3489 |
compound |
Figure,1F |
R2175 |
T3491 |
T3489 |
punct |
),1F |
R2176 |
T3492 |
T3456 |
punct |
.,coincided |
R2177 |
T3494 |
T3495 |
nsubj |
Immunohistochemistry,marked |
R2178 |
T3496 |
T3494 |
prep |
with,Immunohistochemistry |
R2179 |
T3497 |
T3496 |
pobj |
antibodies,with |
R2180 |
T3498 |
T3497 |
prep |
against,antibodies |
R2181 |
T3499 |
T3500 |
det |
the,form |
R2182 |
T3500 |
T3498 |
pobj |
form,against |
R2183 |
T3501 |
T3500 |
amod |
active,form |
R2184 |
T3502 |
T3500 |
punct |
(,form |
R2185 |
T3503 |
T3500 |
amod |
phosphorylated,form |
R2186 |
T3504 |
T3500 |
punct |
),form |
R2187 |
T3505 |
T3500 |
prep |
of,form |
R2188 |
T3506 |
T3505 |
pobj |
MAPK,of |
R2189 |
T3507 |
T3500 |
punct |
(,form |
R2190 |
T3508 |
T3500 |
appos |
pMAPK,form |
R2191 |
T3509 |
T3495 |
punct |
),marked |
R2192 |
T3510 |
T3511 |
det |
a,subset |
R2193 |
T3511 |
T3495 |
dobj |
subset,marked |
R2194 |
T3512 |
T3511 |
prep |
of,subset |
R2195 |
T3513 |
T3514 |
det |
the,cells |
R2196 |
T3514 |
T3512 |
pobj |
cells,of |
R2197 |
T3601 |
T3599 |
punct |
;,1H |
R2198 |
T3515 |
T3514 |
amod |
proliferating,cells |
R2199 |
T3602 |
T3599 |
advcl |
see,1H |
R2200 |
T3516 |
T3514 |
punct |
(,cells |
R2201 |
T3603 |
T3602 |
advmod |
also,see |
R2202 |
T3604 |
T3602 |
punct |
[,see |
R2203 |
T3517 |
T3518 |
npadvmod |
Ki67,positive |
R2204 |
T3605 |
T3602 |
dobj |
4,see |
R2205 |
T3606 |
T3599 |
punct |
],1H |
R2206 |
T3607 |
T3599 |
punct |
),1H |
R2207 |
T3518 |
T3514 |
amod |
positive,cells |
R2208 |
T3608 |
T3583 |
punct |
.,exhibited |
R2209 |
T3519 |
T3518 |
punct |
-,positive |
R2210 |
T3520 |
T3514 |
punct |
),cells |
R2211 |
T3521 |
T3495 |
punct |
", ",marked |
R2212 |
T3522 |
T3495 |
cc |
and,marked |
R2213 |
T3523 |
T3524 |
npadvmod |
pMAPK,positive |
R2214 |
T3524 |
T3526 |
amod |
positive,cells |
R2215 |
T3525 |
T3524 |
punct |
-,positive |
R2216 |
T3526 |
T3527 |
nsubjpass |
cells,enriched |
R2217 |
T3527 |
T3495 |
conj |
enriched,marked |
R2218 |
T3528 |
T3527 |
auxpass |
were,enriched |
R2219 |
T3529 |
T3527 |
prep |
in,enriched |
R2220 |
T3530 |
T3531 |
det |
the,bud |
R2221 |
T3531 |
T3529 |
pobj |
bud,in |
R2222 |
T3532 |
T3531 |
compound |
hair,bud |
R2223 |
T3533 |
T3534 |
punct |
(,1G |
R2224 |
T3534 |
T3527 |
parataxis |
1G,enriched |
R2225 |
T3535 |
T3534 |
compound |
Figure,1G |
R2226 |
T3536 |
T3534 |
punct |
),1G |
R2227 |
T3537 |
T3527 |
punct |
.,enriched |
R2228 |
T3539 |
T3540 |
det |
The,timing |
R2229 |
T3540 |
T3541 |
nsubj |
timing,appeared |
R2230 |
T3542 |
T3540 |
prep |
of,timing |
R2231 |
T3543 |
T3544 |
compound |
Snail,induction |
R2232 |
T3544 |
T3542 |
pobj |
induction,of |
R2233 |
T3545 |
T3544 |
cc |
and,induction |
R2234 |
T3546 |
T3547 |
nmod |
Ki67,enrichment |
R2235 |
T3547 |
T3544 |
conj |
enrichment,induction |
R2236 |
T3548 |
T3546 |
cc |
and,Ki67 |
R2237 |
T3549 |
T3546 |
conj |
pMAPK,Ki67 |
R2238 |
T3550 |
T3540 |
prep |
in,timing |
R2239 |
T3551 |
T3552 |
det |
the,bud |
R2240 |
T3552 |
T3550 |
pobj |
bud,in |
R2241 |
T3553 |
T3552 |
compound |
hair,bud |
R2242 |
T3554 |
T3555 |
aux |
to,follow |
R2243 |
T3555 |
T3541 |
xcomp |
follow,appeared |
R2244 |
T3556 |
T3555 |
advmod |
closely,follow |
R2245 |
T3557 |
T3558 |
det |
the,induction |
R2246 |
T3558 |
T3555 |
dobj |
induction,follow |
R2247 |
T3559 |
T3558 |
prep |
of,induction |
R2248 |
T3560 |
T3561 |
nmod |
LEF,activity |
R2249 |
T3561 |
T3559 |
pobj |
activity,of |
R2250 |
T3562 |
T3560 |
punct |
-,LEF |
R2251 |
T3563 |
T3560 |
nummod |
1,LEF |
R2252 |
T3564 |
T3560 |
punct |
/,LEF |
R2253 |
T3565 |
T3566 |
compound |
β,catenin |
R2254 |
T3566 |
T3560 |
appos |
catenin,LEF |
R2255 |
T3567 |
T3566 |
punct |
-,catenin |
R2256 |
T3568 |
T3561 |
punct |
", ",activity |
R2257 |
T3569 |
T3561 |
acl |
known,activity |
R2258 |
T3570 |
T3571 |
aux |
to,initiate |
R2259 |
T3571 |
T3569 |
xcomp |
initiate,known |
R2260 |
T3572 |
T3571 |
prep |
in,initiate |
R2261 |
T3573 |
T3574 |
det |
the,stage |
R2262 |
T3574 |
T3572 |
pobj |
stage,in |
R2263 |
T3575 |
T3576 |
compound |
hair,placode |
R2264 |
T3576 |
T3574 |
compound |
placode,stage |
R2265 |
T3577 |
T3578 |
punct |
[,20 |
R2266 |
T3578 |
T3555 |
parataxis |
20,follow |
R2267 |
T3579 |
T3578 |
punct |
],20 |
R2268 |
T3580 |
T3541 |
punct |
.,appeared |
R2269 |
T3582 |
T3583 |
advmod |
However,exhibited |
R2270 |
T3584 |
T3583 |
punct |
", ",exhibited |
R2271 |
T3585 |
T3583 |
prep |
like,exhibited |
R2272 |
T3586 |
T3585 |
pobj |
placodes,like |
R2273 |
T3587 |
T3583 |
punct |
", ",exhibited |
R2274 |
T3588 |
T3589 |
compound |
hair,buds |
R2275 |
T3589 |
T3583 |
nsubj |
buds,exhibited |
R2276 |
T3590 |
T3591 |
amod |
down,regulation |
R2277 |
T3591 |
T3583 |
dobj |
regulation,exhibited |
R2278 |
T3592 |
T3591 |
punct |
-,regulation |
R2279 |
T3593 |
T3591 |
prep |
in,regulation |
R2280 |
T3594 |
T3595 |
compound |
E,cadherin |
R2281 |
T3595 |
T3597 |
compound |
cadherin,expression |
R2282 |
T3596 |
T3595 |
punct |
-,cadherin |
R2283 |
T3597 |
T3593 |
pobj |
expression,in |
R2284 |
T3598 |
T3599 |
punct |
(,1H |
R2285 |
T3599 |
T3583 |
parataxis |
1H,exhibited |
R2286 |
T3600 |
T3599 |
compound |
Figure,1H |
R2289 |
T3910 |
T3911 |
amod |
Sustained,Expression |
R2290 |
T3911 |
T3912 |
nsubj |
Expression,Results |
R2291 |
T3913 |
T3911 |
prep |
of,Expression |
R2292 |
T3914 |
T3913 |
pobj |
Snail,of |
R2293 |
T3915 |
T3912 |
prep |
in,Results |
R2294 |
T3916 |
T3917 |
amod |
Epidermal,Hyperproliferation |
R2295 |
T3917 |
T3915 |
pobj |
Hyperproliferation,in |
R2296 |
T3918 |
T3917 |
cc |
and,Hyperproliferation |
R2297 |
T3919 |
T3920 |
compound |
Differentiation,Defects |
R2298 |
T3920 |
T3917 |
conj |
Defects,Hyperproliferation |
R2299 |
T3921 |
T3912 |
prep |
in,Results |
R2300 |
T3922 |
T3923 |
compound |
Tg,Skin |
R2301 |
T3923 |
T3921 |
pobj |
Skin,in |
R2302 |
T3924 |
T3923 |
compound |
Mouse,Skin |
R2303 |
T3926 |
T3927 |
det |
The,spike |
R2304 |
T3927 |
T3929 |
nsubj |
spike,prompted |
R2305 |
T3928 |
T3927 |
amod |
striking,spike |
R2306 |
T3930 |
T3927 |
prep |
of,spike |
R2307 |
T3931 |
T3932 |
compound |
Snail,expression |
R2308 |
T3932 |
T3930 |
pobj |
expression,of |
R2309 |
T3933 |
T3927 |
amod |
coincident,spike |
R2310 |
T3934 |
T3933 |
prep |
with,coincident |
R2311 |
T3935 |
T3936 |
compound |
hair,bud |
R2312 |
T3936 |
T3937 |
compound |
bud,formation |
R2313 |
T3937 |
T3934 |
pobj |
formation,with |
R2314 |
T3938 |
T3937 |
cc |
and,formation |
R2315 |
T3939 |
T3940 |
amod |
enhanced,proliferation |
R2316 |
T3940 |
T3937 |
conj |
proliferation,formation |
R2317 |
T3941 |
T3929 |
dobj |
us,prompted |
R2318 |
T3942 |
T3943 |
aux |
to,examine |
R2319 |
T3943 |
T3929 |
xcomp |
examine,prompted |
R2320 |
T3944 |
T3945 |
det |
the,consequences |
R2321 |
T3945 |
T3943 |
dobj |
consequences,examine |
R2322 |
T3946 |
T3945 |
prep |
of,consequences |
R2323 |
T3947 |
T3948 |
advmod |
ectopically,expressing |
R2324 |
T3948 |
T3946 |
pcomp |
expressing,of |
R2325 |
T3949 |
T3948 |
dobj |
Snail,expressing |
R2326 |
T3950 |
T3948 |
advmod |
elsewhere,expressing |
R2327 |
T3951 |
T3950 |
prep |
in,elsewhere |
R2328 |
T3952 |
T3953 |
compound |
mouse,epidermis |
R2329 |
T3953 |
T3951 |
pobj |
epidermis,in |
R2330 |
T3954 |
T3953 |
compound |
skin,epidermis |
R2331 |
T3955 |
T3929 |
punct |
.,prompted |
R2332 |
T3957 |
T3958 |
aux |
To,distinguish |
R2333 |
T3958 |
T3959 |
advcl |
distinguish,used |
R2334 |
T3960 |
T3958 |
dobj |
Tg,distinguish |
R2335 |
T3961 |
T3958 |
prep |
from,distinguish |
R2336 |
T3962 |
T3963 |
amod |
endogenous,Snail |
R2337 |
T3963 |
T3961 |
pobj |
Snail,from |
R2338 |
T3964 |
T3959 |
punct |
", ",used |
R2339 |
T3965 |
T3959 |
nsubj |
we,used |
R2340 |
T3966 |
T3967 |
det |
the,epitope |
R2341 |
T3967 |
T3959 |
dobj |
epitope,used |
R2342 |
T3968 |
T3967 |
compound |
HA,epitope |
R2343 |
T3969 |
T3967 |
punct |
-,epitope |
R2344 |
T3970 |
T3967 |
punct |
", ",epitope |
R2345 |
T3971 |
T3967 |
acl |
shown,epitope |
R2346 |
T3972 |
T3971 |
advmod |
previously,shown |
R2347 |
T3973 |
T3974 |
neg |
not,alter |
R2348 |
T3974 |
T3971 |
xcomp |
alter,shown |
R2349 |
T3975 |
T3974 |
aux |
to,alter |
R2350 |
T3976 |
T3977 |
poss |
Snail,activity |
R2351 |
T3977 |
T3974 |
dobj |
activity,alter |
R2352 |
T3978 |
T3976 |
case |
's,Snail |
R2353 |
T3979 |
T3977 |
amod |
transcriptional,activity |
R2354 |
T3980 |
T3981 |
punct |
[,12 |
R2355 |
T3981 |
T3959 |
parataxis |
12,used |
R2356 |
T3982 |
T3981 |
punct |
],12 |
R2357 |
T3983 |
T3959 |
punct |
.,used |
R2358 |
T3985 |
T3986 |
prep |
Of,expressed |
R2359 |
T3987 |
T3988 |
nummod |
20,animals |
R2360 |
T3988 |
T3985 |
pobj |
animals,Of |
R2361 |
T3989 |
T3990 |
nmod |
K14,Snail |
R2362 |
T3990 |
T3988 |
nmod |
Snail,animals |
R2363 |
T3991 |
T3990 |
punct |
-,Snail |
R2364 |
T3992 |
T3988 |
punct |
[,animals |
R2365 |
T3993 |
T3988 |
nmod |
HA,animals |
R2366 |
T3994 |
T3988 |
punct |
],animals |
R2367 |
T3995 |
T3988 |
compound |
Tg,animals |
R2368 |
T3996 |
T3988 |
acl |
generated,animals |
R2369 |
T3997 |
T3986 |
punct |
", ",expressed |
R2370 |
T3998 |
T3986 |
nsubj |
three,expressed |
R2371 |
T3999 |
T4000 |
det |
the,transgene |
R2372 |
T4000 |
T3986 |
dobj |
transgene,expressed |
R2373 |
T4001 |
T3986 |
cc |
and,expressed |
R2374 |
T4002 |
T4003 |
nsubj |
all,exhibited |
R2375 |
T4003 |
T3986 |
conj |
exhibited,expressed |
R2376 |
T4004 |
T4005 |
amod |
analogous,phenotypes |
R2377 |
T4005 |
T4003 |
dobj |
phenotypes,exhibited |
R2378 |
T4006 |
T3986 |
punct |
.,expressed |
R2379 |
T4008 |
T4009 |
nsubj |
Mice,died |
R2380 |
T4010 |
T4011 |
dep |
that,integrated |
R2381 |
T4011 |
T4008 |
relcl |
integrated,Mice |
R2382 |
T4012 |
T4013 |
det |
the,transgene |
R2383 |
T4013 |
T4011 |
dobj |
transgene,integrated |
R2384 |
T4014 |
T4011 |
prep |
at,integrated |
R2385 |
T4015 |
T4016 |
det |
the,stage |
R2386 |
T4016 |
T4014 |
pobj |
stage,at |
R2387 |
T4017 |
T4018 |
amod |
single,cell |
R2388 |
T4018 |
T4016 |
compound |
cell,stage |
R2389 |
T4019 |
T4018 |
punct |
-,cell |
R2390 |
T4020 |
T4009 |
prep |
at,died |
R2391 |
T4021 |
T4020 |
cc |
or,at |
R2392 |
T4022 |
T4023 |
advmod |
shortly,after |
R2393 |
T4023 |
T4020 |
conj |
after,at |
R2394 |
T4024 |
T4023 |
pobj |
birth,after |
R2395 |
T4025 |
T4009 |
punct |
.,died |
R2396 |
T4027 |
T4028 |
det |
The,mice |
R2397 |
T4028 |
T4035 |
nsubj |
mice,harbored |
R2398 |
T4029 |
T4028 |
nummod |
three,mice |
R2399 |
T4030 |
T4028 |
amod |
surviving,mice |
R2400 |
T4031 |
T4032 |
amod |
full,Tg |
R2401 |
T4032 |
T4028 |
compound |
Tg,mice |
R2402 |
T4033 |
T4032 |
punct |
-,Tg |
R2403 |
T4034 |
T4028 |
compound |
founder,mice |
R2404 |
T4036 |
T4037 |
compound |
transgene,integrations |
R2405 |
T4037 |
T4035 |
dobj |
integrations,harbored |
R2406 |
T4038 |
T4039 |
dep |
that,gave |
R2407 |
T4039 |
T4037 |
relcl |
gave,integrations |
R2408 |
T4040 |
T4041 |
amod |
stable,transmission |
R2409 |
T4041 |
T4039 |
dobj |
transmission,gave |
R2410 |
T4042 |
T4041 |
prep |
of,transmission |
R2411 |
T4043 |
T4044 |
amod |
mosaic,gene |
R2412 |
T4044 |
T4046 |
compound |
gene,expression |
R2413 |
T4045 |
T4044 |
compound |
Snail,gene |
R2414 |
T4046 |
T4042 |
pobj |
expression,of |
R2415 |
T4047 |
T4039 |
prep |
through,gave |
R2416 |
T4048 |
T4049 |
det |
the,germline |
R2417 |
T4049 |
T4047 |
pobj |
germline,through |
R2418 |
T4050 |
T4035 |
punct |
.,harbored |
R2419 |
T4052 |
T4053 |
advmod |
Progressively,poor |
R2420 |
T4053 |
T4054 |
amod |
poor,health |
R2421 |
T4054 |
T4055 |
nsubj |
health,necessitated |
R2422 |
T4056 |
T4057 |
nsubj |
our,sacrificing |
R2423 |
T4057 |
T4055 |
ccomp |
sacrificing,necessitated |
R2424 |
T4058 |
T4059 |
amod |
most,offspring |
R2425 |
T4059 |
T4057 |
dobj |
offspring,sacrificing |
R2426 |
T4060 |
T4059 |
prep |
from,offspring |
R2427 |
T4061 |
T4062 |
det |
these,lines |
R2428 |
T4062 |
T4060 |
pobj |
lines,from |
R2429 |
T4063 |
T4057 |
prep |
within,sacrificing |
R2430 |
T4064 |
T4065 |
det |
a,year |
R2431 |
T4065 |
T4063 |
pobj |
year,within |
R2432 |
T4066 |
T4065 |
prep |
of,year |
R2433 |
T4067 |
T4066 |
pobj |
birth,of |
R2434 |
T4068 |
T4055 |
punct |
.,necessitated |
R2435 |
T4070 |
T4071 |
mark |
As,grew |
R2436 |
T4071 |
T4075 |
advcl |
grew,became |
R2437 |
T4072 |
T4073 |
compound |
Snail,animals |
R2438 |
T4073 |
T4071 |
nsubj |
animals,grew |
R2439 |
T4074 |
T4073 |
compound |
Tg,animals |
R2440 |
T4076 |
T4075 |
punct |
", ",became |
R2441 |
T4077 |
T4075 |
nsubj |
they,became |
R2442 |
T4078 |
T4075 |
acomp |
distinguished,became |
R2443 |
T4079 |
T4078 |
prep |
by,distinguished |
R2444 |
T4080 |
T4081 |
poss |
their,size |
R2445 |
T4081 |
T4079 |
pobj |
size,by |
R2446 |
T4082 |
T4081 |
amod |
small,size |
R2447 |
T4083 |
T4081 |
punct |
", ",size |
R2448 |
T4084 |
T4085 |
amod |
short,tails |
R2449 |
T4085 |
T4081 |
conj |
tails,size |
R2450 |
T4086 |
T4085 |
punct |
", ",tails |
R2451 |
T4087 |
T4085 |
cc |
and,tails |
R2452 |
T4088 |
T4089 |
amod |
flaky,skin |
R2453 |
T4089 |
T4085 |
conj |
skin,tails |
R2454 |
T4090 |
T4091 |
punct |
(,2A |
R2455 |
T4091 |
T4075 |
parataxis |
2A,became |
R2456 |
T4092 |
T4091 |
compound |
Figure,2A |
R2457 |
T4093 |
T4091 |
punct |
),2A |
R2458 |
T4094 |
T4075 |
punct |
.,became |
R2459 |
T4096 |
T4097 |
amod |
Histological,analyses |
R2460 |
T4097 |
T4098 |
nsubj |
analyses,revealed |
R2461 |
T4099 |
T4097 |
prep |
of,analyses |
R2462 |
T4100 |
T4101 |
nummod |
3,d |
R2463 |
T4101 |
T4103 |
npadvmod |
d,old |
R2464 |
T4102 |
T4101 |
punct |
-,d |
R2465 |
T4103 |
T4104 |
amod |
old,mice |
R2466 |
T4104 |
T4099 |
pobj |
mice,of |
R2467 |
T4105 |
T4106 |
punct |
(,P3 |
R2468 |
T4106 |
T4103 |
parataxis |
P3,old |
R2469 |
T4107 |
T4106 |
punct |
),P3 |
R2470 |
T4108 |
T4109 |
compound |
mosaic,patches |
R2471 |
T4109 |
T4098 |
dobj |
patches,revealed |
R2472 |
T4110 |
T4109 |
acl |
marked,patches |
R2473 |
T4111 |
T4110 |
agent |
by,marked |
R2474 |
T4112 |
T4113 |
amod |
epidermal,thickening |
R2475 |
T4113 |
T4111 |
pobj |
thickening,by |
R2476 |
T4114 |
T4115 |
punct |
(,2B |
R2477 |
T4115 |
T4098 |
parataxis |
2B,revealed |
R2478 |
T4116 |
T4115 |
compound |
Figure,2B |
R2479 |
T4117 |
T4115 |
punct |
),2B |
R2480 |
T4118 |
T4098 |
punct |
.,revealed |
R2481 |
T4120 |
T4121 |
det |
The,morphology |
R2482 |
T4121 |
T4123 |
nsubjpass |
morphology,reflected |
R2483 |
T4122 |
T4121 |
compound |
mosaic,morphology |
R2484 |
T4124 |
T4123 |
auxpass |
was,reflected |
R2485 |
T4125 |
T4123 |
prep |
at,reflected |
R2486 |
T4126 |
T4127 |
det |
the,level |
R2487 |
T4127 |
T4125 |
pobj |
level,at |
R2488 |
T4128 |
T4127 |
prep |
of,level |
R2489 |
T4129 |
T4130 |
compound |
Tg,protein |
R2490 |
T4130 |
T4128 |
pobj |
protein,of |
R2491 |
T4131 |
T4130 |
compound |
Snail,protein |
R2492 |
T4132 |
T4123 |
punct |
", ",reflected |
R2493 |
T4133 |
T4134 |
mark |
with,expressing |
R2494 |
T4134 |
T4123 |
advcl |
expressing,reflected |
R2495 |
T4135 |
T4136 |
advmod |
only,regions |
R2496 |
T4136 |
T4134 |
nsubj |
regions,expressing |
R2497 |
T4137 |
T4136 |
det |
the,regions |
R2498 |
T4138 |
T4136 |
amod |
hyperthickened,regions |
R2499 |
T4139 |
T4140 |
amod |
nuclear,Snail |
R2500 |
T4140 |
T4134 |
dobj |
Snail,expressing |
R2501 |
T4141 |
T4142 |
npadvmod |
HA,tagged |
R2502 |
T4142 |
T4140 |
amod |
tagged,Snail |
R2503 |
T4143 |
T4142 |
punct |
-,tagged |
R2504 |
T4144 |
T4145 |
punct |
(,2C |
R2505 |
T4145 |
T4123 |
parataxis |
2C,reflected |
R2506 |
T4146 |
T4145 |
compound |
Figure,2C |
R2507 |
T4147 |
T4145 |
punct |
),2C |
R2508 |
T4148 |
T4123 |
punct |
.,reflected |
R2509 |
T4150 |
T4151 |
det |
These,areas |
R2510 |
T4151 |
T4153 |
nsubjpass |
areas,marked |
R2511 |
T4152 |
T4151 |
amod |
hyperthickened,areas |
R2512 |
T4154 |
T4153 |
auxpass |
were,marked |
R2513 |
T4155 |
T4153 |
agent |
by,marked |
R2514 |
T4156 |
T4157 |
amod |
excessive,proliferation |
R2515 |
T4157 |
T4155 |
pobj |
proliferation,by |
R2516 |
T4158 |
T4153 |
punct |
", ",marked |
R2517 |
T4159 |
T4160 |
mark |
as,revealed |
R2518 |
T4160 |
T4153 |
advcl |
revealed,marked |
R2519 |
T4161 |
T4160 |
agent |
by,revealed |
R2520 |
T4162 |
T4161 |
pobj |
antibodies,by |
R2521 |
T4163 |
T4162 |
prep |
against,antibodies |
R2522 |
T4164 |
T4165 |
det |
the,antigen |
R2523 |
T4165 |
T4163 |
pobj |
antigen,against |
R2524 |
T4166 |
T4165 |
amod |
proliferating,antigen |
R2525 |
T4167 |
T4165 |
amod |
nuclear,antigen |
R2526 |
T4168 |
T4165 |
appos |
Ki67,antigen |
R2527 |
T4169 |
T4170 |
punct |
(,2D |
R2528 |
T4170 |
T4153 |
parataxis |
2D,marked |
R2529 |
T4171 |
T4170 |
compound |
Figure,2D |
R2530 |
T4172 |
T4170 |
cc |
and,2D |
R2531 |
T4173 |
T4170 |
conj |
2E,2D |
R2532 |
T4174 |
T4170 |
punct |
),2D |
R2533 |
T4175 |
T4153 |
punct |
.,marked |
R2534 |
T4177 |
T4178 |
amod |
Activated,cells |
R2535 |
T4178 |
T4183 |
nsubj |
cells,were |
R2536 |
T4179 |
T4178 |
punct |
", ",cells |
R2537 |
T4180 |
T4181 |
npadvmod |
pMAPK,positive |
R2538 |
T4181 |
T4178 |
amod |
positive,cells |
R2539 |
T4182 |
T4181 |
punct |
-,positive |
R2540 |
T4184 |
T4183 |
advmod |
also,were |
R2541 |
T4185 |
T4183 |
acomp |
prevalent,were |
R2542 |
T4186 |
T4183 |
prep |
in,were |
R2543 |
T4187 |
T4188 |
det |
these,areas |
R2544 |
T4188 |
T4186 |
pobj |
areas,in |
R2545 |
T4189 |
T4190 |
punct |
(,2F |
R2546 |
T4190 |
T4183 |
parataxis |
2F,were |
R2547 |
T4191 |
T4190 |
compound |
Figure,2F |
R2548 |
T4192 |
T4190 |
cc |
and,2F |
R2549 |
T4193 |
T4190 |
conj |
2G,2F |
R2550 |
T4194 |
T4190 |
punct |
),2F |
R2551 |
T4195 |
T4183 |
punct |
", ",were |
R2552 |
T4196 |
T4197 |
mark |
as,were |
R2553 |
T4197 |
T4183 |
advcl |
were,were |
R2554 |
T4198 |
T4197 |
nsubj |
cells,were |
R2555 |
T4199 |
T4198 |
acl |
expressing,cells |
R2556 |
T4200 |
T4199 |
dobj |
keratin,expressing |
R2557 |
T4201 |
T4200 |
nummod |
6,keratin |
R2558 |
T4202 |
T4200 |
punct |
", ",keratin |
R2559 |
T4203 |
T4204 |
det |
a,keratin |
R2560 |
T4204 |
T4200 |
appos |
keratin,keratin |
R2561 |
T4205 |
T4204 |
acl |
induced,keratin |
R2562 |
T4206 |
T4205 |
prep |
in,induced |
R2563 |
T4207 |
T4208 |
det |
the,layers |
R2564 |
T4208 |
T4206 |
pobj |
layers,in |
R2565 |
T4209 |
T4208 |
amod |
suprabasal,layers |
R2566 |
T4210 |
T4208 |
prep |
of,layers |
R2567 |
T4211 |
T4212 |
amod |
hyperproliferative,skin |
R2568 |
T4212 |
T4210 |
pobj |
skin,of |
R2569 |
T4213 |
T4214 |
punct |
(,2H |
R2570 |
T4214 |
T4183 |
parataxis |
2H,were |
R2571 |
T4215 |
T4214 |
compound |
Figure,2H |
R2572 |
T4216 |
T4214 |
cc |
and,2H |
R2573 |
T4217 |
T4214 |
conj |
2I,2H |
R2574 |
T4218 |
T4214 |
punct |
),2H |
R2575 |
T4219 |
T4183 |
punct |
.,were |
R2576 |
T4221 |
T4222 |
nsubj |
Expression,block |
R2577 |
T4223 |
T4221 |
prep |
of,Expression |
R2578 |
T4224 |
T4225 |
det |
the,transgene |
R2579 |
T4225 |
T4223 |
pobj |
transgene,of |
R2580 |
T4226 |
T4225 |
compound |
Snail,transgene |
R2581 |
T4227 |
T4222 |
aux |
did,block |
R2582 |
T4228 |
T4222 |
neg |
not,block |
R2583 |
T4229 |
T4230 |
amod |
terminal,differentiation |
R2584 |
T4230 |
T4222 |
dobj |
differentiation,block |
R2585 |
T4231 |
T4222 |
prep |
in,block |
R2586 |
T4232 |
T4233 |
det |
the,epidermis |
R2587 |
T4233 |
T4231 |
pobj |
epidermis,in |
R2588 |
T4234 |
T4233 |
amod |
hyperproliferative,epidermis |
R2589 |
T4235 |
T4222 |
punct |
", ",block |
R2590 |
T4236 |
T4222 |
cc |
but,block |
R2591 |
T4237 |
T4238 |
nsubj |
it,distorted |
R2592 |
T4238 |
T4222 |
conj |
distorted,block |
R2593 |
T4239 |
T4238 |
dobj |
it,distorted |
R2594 |
T4240 |
T4238 |
advmod |
markedly,distorted |
R2595 |
T4241 |
T4242 |
punct |
(,3A |
R2596 |
T4242 |
T4238 |
parataxis |
3A,distorted |
R2597 |
T4243 |
T4242 |
compound |
Figure,3A |
R2598 |
T4244 |
T4245 |
punct |
–,3H |
R2599 |
T4245 |
T4242 |
prep |
3H,3A |
R2600 |
T4246 |
T4242 |
punct |
),3A |
R2601 |
T4247 |
T4238 |
punct |
.,distorted |
R2602 |
T4249 |
T4250 |
advcl |
Typical,led |
R2603 |
T4251 |
T4249 |
prep |
of,Typical |
R2604 |
T4252 |
T4253 |
amod |
most,conditions |
R2605 |
T4253 |
T4251 |
pobj |
conditions,of |
R2606 |
T4254 |
T4253 |
compound |
hyperproliferating,conditions |
R2607 |
T4255 |
T4250 |
punct |
", ",led |
R2608 |
T4256 |
T4257 |
compound |
Snail,expression |
R2609 |
T4257 |
T4250 |
nsubj |
expression,led |
R2610 |
T4258 |
T4250 |
prep |
to,led |
R2611 |
T4259 |
T4260 |
det |
a,expansion |
R2612 |
T4260 |
T4258 |
pobj |
expansion,to |
R2613 |
T4261 |
T4260 |
amod |
large,expansion |
R2614 |
T4262 |
T4250 |
prep |
in,led |
R2615 |
T4263 |
T4262 |
pobj |
layers,in |
R2616 |
T4264 |
T4263 |
prep |
with,layers |
R2617 |
T4265 |
T4266 |
amod |
spinous,morphology |
R2618 |
T4266 |
T4264 |
pobj |
morphology,with |
R2619 |
T4267 |
T4265 |
cc |
and,spinous |
R2620 |
T4268 |
T4265 |
conj |
granular,spinous |
R2621 |
T4269 |
T4250 |
punct |
.,led |
R2622 |
T4271 |
T4272 |
advmod |
Additionally,was |
R2623 |
T4273 |
T4272 |
punct |
", ",was |
R2624 |
T4274 |
T4272 |
advmod |
however,was |
R2625 |
T4275 |
T4272 |
punct |
", ",was |
R2626 |
T4276 |
T4277 |
det |
a,expansion |
R2627 |
T4277 |
T4272 |
attr |
expansion,was |
R2628 |
T4278 |
T4277 |
amod |
marked,expansion |
R2629 |
T4279 |
T4278 |
cc |
and,marked |
R2630 |
T4280 |
T4278 |
conj |
variable,marked |
R2631 |
T4281 |
T4277 |
prep |
of,expansion |
R2632 |
T4282 |
T4281 |
pobj |
keratin,of |
R2633 |
T4283 |
T4282 |
nummod |
5,keratin |
R2634 |
T4284 |
T4282 |
punct |
(,keratin |
R2635 |
T4285 |
T4282 |
appos |
K5,keratin |
R2636 |
T4286 |
T4282 |
punct |
),keratin |
R2637 |
T4287 |
T4282 |
punct |
", ",keratin |
R2638 |
T4288 |
T4289 |
advmod |
normally,restricted |
R2639 |
T4289 |
T4282 |
acl |
restricted,keratin |
R2640 |
T4290 |
T4289 |
prep |
to,restricted |
R2641 |
T4291 |
T4292 |
det |
the,layer |
R2642 |
T4292 |
T4290 |
pobj |
layer,to |
R2643 |
T4293 |
T4292 |
amod |
innermost,layer |
R2644 |
T4294 |
T4292 |
amod |
basal,layer |
R2645 |
T4295 |
T4296 |
punct |
(,see |
R2646 |
T4296 |
T4272 |
parataxis |
see,was |
R2647 |
T4297 |
T4296 |
dobj |
Figure,see |
R2648 |
T4298 |
T4297 |
nummod |
3,Figure |
R2649 |
T4299 |
T4296 |
punct |
),see |
R2650 |
T4300 |
T4272 |
punct |
.,was |
R2651 |
T4302 |
T4303 |
mark |
Although,precluded |
R2652 |
T4303 |
T4318 |
advcl |
precluded,emerged |
R2653 |
T4304 |
T4305 |
det |
the,failure |
R2654 |
T4305 |
T4303 |
nsubj |
failure,precluded |
R2655 |
T4306 |
T4305 |
prep |
of,failure |
R2656 |
T4307 |
T4308 |
nmod |
Snail,mice |
R2657 |
T4308 |
T4306 |
pobj |
mice,of |
R2658 |
T4309 |
T4307 |
punct |
-,Snail |
R2659 |
T4310 |
T4307 |
amod |
null,Snail |
R2660 |
T4311 |
T4312 |
aux |
to,develop |
R2661 |
T4312 |
T4305 |
acl |
develop,failure |
R2662 |
T4313 |
T4314 |
amod |
past,gastrulation |
R2663 |
T4314 |
T4312 |
dobj |
gastrulation,develop |
R2664 |
T4315 |
T4316 |
punct |
[,21 |
R2665 |
T4316 |
T4305 |
parataxis |
21,failure |
R2666 |
T4317 |
T4316 |
punct |
],21 |
R2667 |
T4319 |
T4320 |
poss |
our,ability |
R2668 |
T4320 |
T4303 |
dobj |
ability,precluded |
R2669 |
T4321 |
T4322 |
aux |
to,study |
R2670 |
T4322 |
T4320 |
acl |
study,ability |
R2671 |
T4323 |
T4324 |
det |
the,loss |
R2672 |
T4324 |
T4322 |
dobj |
loss,study |
R2673 |
T4325 |
T4324 |
prep |
of,loss |
R2674 |
T4326 |
T4327 |
compound |
Snail,function |
R2675 |
T4327 |
T4325 |
pobj |
function,of |
R2676 |
T4328 |
T4324 |
prep |
in,loss |
R2677 |
T4329 |
T4330 |
compound |
skin,development |
R2678 |
T4330 |
T4328 |
pobj |
development,in |
R2679 |
T4331 |
T4318 |
punct |
", ",emerged |
R2680 |
T4332 |
T4333 |
det |
a,correlation |
R2681 |
T4333 |
T4318 |
nsubj |
correlation,emerged |
R2682 |
T4334 |
T4333 |
amod |
good,correlation |
R2683 |
T4335 |
T4318 |
prep |
between,emerged |
R2684 |
T4336 |
T4337 |
det |
the,expression |
R2685 |
T4337 |
T4335 |
pobj |
expression,between |
R2686 |
T4338 |
T4337 |
prep |
of,expression |
R2687 |
T4339 |
T4340 |
compound |
Snail,protein |
R2688 |
T4340 |
T4338 |
pobj |
protein,of |
R2689 |
T4341 |
T4337 |
cc |
and,expression |
R2690 |
T4342 |
T4343 |
det |
the,extension |
R2691 |
T4343 |
T4337 |
conj |
extension,expression |
R2692 |
T4344 |
T4343 |
prep |
of,extension |
R2693 |
T4345 |
T4344 |
pobj |
K5,of |
R2694 |
T4346 |
T4345 |
punct |
", ",K5 |
R2695 |
T4347 |
T4345 |
conj |
Ki67,K5 |
R2696 |
T4348 |
T4347 |
punct |
", ",Ki67 |
R2697 |
T4349 |
T4347 |
cc |
and,Ki67 |
R2698 |
T4350 |
T4347 |
conj |
pMAPK,Ki67 |
R2699 |
T4351 |
T4343 |
advmod |
suprabasally,extension |
R2700 |
T4352 |
T4353 |
punct |
(,compare |
R2701 |
T4353 |
T4318 |
parataxis |
compare,emerged |
R2702 |
T4354 |
T4353 |
dobj |
data,compare |
R2703 |
T4355 |
T4353 |
prep |
in,compare |
R2704 |
T4356 |
T4357 |
nmod |
Figures,2 |
R2705 |
T4357 |
T4355 |
pobj |
2,in |
R2706 |
T4358 |
T4357 |
cc |
and,2 |
R2707 |
T4359 |
T4357 |
conj |
3,2 |
R2708 |
T4360 |
T4353 |
punct |
),compare |
R2709 |
T4361 |
T4318 |
punct |
.,emerged |
R2710 |
T4363 |
T4364 |
det |
The,changes |
R2711 |
T4364 |
T4365 |
nsubjpass |
changes,accompanied |
R2712 |
T4366 |
T4364 |
prep |
in,changes |
R2713 |
T4367 |
T4366 |
pobj |
hyperproliferation,in |
R2714 |
T4368 |
T4367 |
cc |
and,hyperproliferation |
R2715 |
T4369 |
T4367 |
conj |
differentiation,hyperproliferation |
R2716 |
T4370 |
T4365 |
auxpass |
were,accompanied |
R2717 |
T4371 |
T4365 |
neg |
not,accompanied |
R2718 |
T4372 |
T4365 |
advmod |
initially,accompanied |
R2719 |
T4373 |
T4365 |
agent |
by,accompanied |
R2720 |
T4374 |
T4375 |
amod |
gross,signs |
R2721 |
T4375 |
T4373 |
pobj |
signs,by |
R2722 |
T4376 |
T4375 |
prep |
of,signs |
R2723 |
T4377 |
T4378 |
amod |
epithelial,invaginations |
R2724 |
T4378 |
T4376 |
pobj |
invaginations,of |
R2725 |
T4379 |
T4365 |
punct |
.,accompanied |
R2726 |
T4381 |
T4382 |
prep |
With,developed |
R2727 |
T4383 |
T4381 |
pobj |
age,With |
R2728 |
T4384 |
T4382 |
punct |
", ",developed |
R2729 |
T4385 |
T4382 |
advmod |
however,developed |
R2730 |
T4386 |
T4382 |
punct |
", ",developed |
R2731 |
T4387 |
T4388 |
amod |
epidermal,folds |
R2732 |
T4388 |
T4382 |
nsubj |
folds,developed |
R2733 |
T4389 |
T4388 |
cc |
and,folds |
R2734 |
T4390 |
T4388 |
conj |
undulations,folds |
R2735 |
T4391 |
T4382 |
prep |
in,developed |
R2736 |
T4392 |
T4391 |
pobj |
areas,in |
R2737 |
T4393 |
T4394 |
advmod |
where,expressed |
R2738 |
T4394 |
T4392 |
relcl |
expressed,areas |
R2739 |
T4395 |
T4394 |
nsubjpass |
Snail,expressed |
R2740 |
T4396 |
T4394 |
auxpass |
was,expressed |
R2741 |
T4397 |
T4382 |
punct |
", ",developed |
R2742 |
T4398 |
T4382 |
cc |
and,developed |
R2743 |
T4399 |
T4400 |
amod |
proliferative,markers |
R2744 |
T4400 |
T4401 |
nsubj |
markers,persisted |
R2745 |
T4401 |
T4382 |
conj |
persisted,developed |
R2746 |
T4402 |
T4401 |
prep |
in,persisted |
R2747 |
T4403 |
T4404 |
det |
these,regions |
R2748 |
T4404 |
T4402 |
pobj |
regions,in |
R2749 |
T4405 |
T4406 |
punct |
(,staining |
R2750 |
T4406 |
T4401 |
parataxis |
staining,persisted |
R2751 |
T4407 |
T4408 |
compound |
Figure,3I |
R2752 |
T4408 |
T4406 |
dep |
3I,staining |
R2753 |
T4409 |
T4408 |
cc |
and,3I |
R2754 |
T4410 |
T4408 |
conj |
3J,3I |
R2755 |
T4411 |
T4406 |
punct |
;,staining |
R2756 |
T4412 |
T4413 |
amod |
anti-cyclin,D |
R2757 |
T4413 |
T4406 |
compound |
D,staining |
R2758 |
T4414 |
T4406 |
punct |
),staining |
R2759 |
T4415 |
T4382 |
punct |
.,developed |
R2760 |
T4417 |
T4418 |
det |
The,undulations |
R2761 |
T4418 |
T4419 |
nsubjpass |
undulations,accompanied |
R2762 |
T4420 |
T4419 |
auxpass |
were,accompanied |
R2763 |
T4421 |
T4419 |
agent |
by,accompanied |
R2764 |
T4422 |
T4423 |
amod |
partial,dissolution |
R2765 |
T4423 |
T4421 |
pobj |
dissolution,by |
R2766 |
T4424 |
T4423 |
prep |
of,dissolution |
R2767 |
T4425 |
T4426 |
det |
the,membrane |
R2768 |
T4426 |
T4424 |
pobj |
membrane,of |
R2769 |
T4427 |
T4426 |
amod |
underlying,membrane |
R2770 |
T4428 |
T4426 |
compound |
basement,membrane |
R2771 |
T4429 |
T4430 |
punct |
(,3K |
R2772 |
T4430 |
T4419 |
parataxis |
3K,accompanied |
R2773 |
T4431 |
T4430 |
compound |
Figure,3K |
R2774 |
T4432 |
T4430 |
cc |
and,3K |
R2775 |
T4433 |
T4430 |
conj |
3L,3K |
R2776 |
T4434 |
T4430 |
punct |
),3K |
R2777 |
T4435 |
T4419 |
punct |
.,accompanied |
R2778 |
T4437 |
T4438 |
amod |
Aberrant,staining |
R2779 |
T4438 |
T4439 |
nsubjpass |
staining,observed |
R2780 |
T4440 |
T4439 |
auxpass |
was,observed |
R2781 |
T4441 |
T4439 |
advmod |
also,observed |
R2782 |
T4442 |
T4439 |
prep |
with,observed |
R2783 |
T4443 |
T4442 |
pobj |
antibodies,with |
R2784 |
T4444 |
T4443 |
prep |
against,antibodies |
R2785 |
T4445 |
T4444 |
pobj |
components,against |
R2786 |
T4446 |
T4445 |
prep |
of,components |
R2787 |
T4447 |
T4448 |
det |
the,hemidesmosomes |
R2788 |
T4448 |
T4446 |
pobj |
hemidesmosomes,of |
R2789 |
T4449 |
T4445 |
punct |
", ",components |
R2790 |
T4450 |
T4451 |
dep |
which,provide |
R2791 |
T4451 |
T4445 |
relcl |
provide,components |
R2792 |
T4452 |
T4453 |
amod |
strong,adhesion |
R2793 |
T4453 |
T4451 |
dobj |
adhesion,provide |
R2794 |
T4454 |
T4453 |
prep |
of,adhesion |
R2795 |
T4455 |
T4456 |
amod |
basal,cells |
R2796 |
T4456 |
T4454 |
pobj |
cells,of |
R2797 |
T4457 |
T4456 |
amod |
epidermal,cells |
R2798 |
T4458 |
T4451 |
prep |
to,provide |
R2799 |
T4459 |
T4460 |
det |
the,lamina |
R2800 |
T4460 |
T4458 |
pobj |
lamina,to |
R2801 |
T4461 |
T4460 |
amod |
underlying,lamina |
R2802 |
T4462 |
T4460 |
amod |
basal,lamina |
R2803 |
T4463 |
T4464 |
punct |
(,3M |
R2804 |
T4464 |
T4439 |
parataxis |
3M,observed |
R2805 |
T4465 |
T4464 |
compound |
Figure,3M |
R2806 |
T4466 |
T4464 |
cc |
and,3M |
R2807 |
T4467 |
T4464 |
conj |
3N,3M |
R2808 |
T4468 |
T4464 |
punct |
),3M |
R2809 |
T4469 |
T4439 |
punct |
.,observed |
R2810 |
T4471 |
T4472 |
advmod |
Interestingly,occur |
R2811 |
T4473 |
T4472 |
punct |
", ",occur |
R2812 |
T4474 |
T4475 |
amod |
similar,types |
R2813 |
T4475 |
T4472 |
nsubj |
types,occur |
R2814 |
T4476 |
T4475 |
prep |
of,types |
R2815 |
T4477 |
T4476 |
pobj |
alterations,of |
R2816 |
T4478 |
T4472 |
prep |
in,occur |
R2817 |
T4479 |
T4480 |
det |
the,membrane |
R2818 |
T4480 |
T4478 |
pobj |
membrane,in |
R2819 |
T4481 |
T4480 |
compound |
basement,membrane |
R2820 |
T4482 |
T4472 |
prep |
in,occur |
R2821 |
T4483 |
T4484 |
det |
the,bud |
R2822 |
T4484 |
T4482 |
pobj |
bud,in |
R2823 |
T4485 |
T4484 |
compound |
hair,bud |
R2824 |
T4486 |
T4484 |
prep |
of,bud |
R2825 |
T4487 |
T4488 |
amod |
embryonic,mice |
R2826 |
T4488 |
T4486 |
pobj |
mice,of |
R2827 |
T4489 |
T4487 |
cc |
and,embryonic |
R2828 |
T4490 |
T4487 |
conj |
newborn,embryonic |
R2829 |
T4491 |
T4492 |
advmod |
when,expressed |
R2830 |
T4492 |
T4472 |
advcl |
expressed,occur |
R2831 |
T4493 |
T4492 |
nsubjpass |
Snail,expressed |
R2832 |
T4494 |
T4492 |
auxpass |
is,expressed |
R2833 |
T4495 |
T4492 |
advmod |
normally,expressed |
R2834 |
T4496 |
T4472 |
punct |
.,occur |
R2835 |
T4498 |
T4499 |
det |
The,fact |
R2836 |
T4499 |
T4500 |
nsubj |
fact,suggests |
R2837 |
T4501 |
T4502 |
mark |
that,altered |
R2838 |
T4502 |
T4499 |
acl |
altered,fact |
R2839 |
T4503 |
T4504 |
det |
the,membrane |
R2840 |
T4504 |
T4502 |
nsubjpass |
membrane,altered |
R2841 |
T4505 |
T4504 |
compound |
basement,membrane |
R2842 |
T4506 |
T4504 |
acl |
separating,membrane |
R2843 |
T4507 |
T4508 |
det |
the,epidermis |
R2844 |
T4508 |
T4506 |
dobj |
epidermis,separating |
R2845 |
T4509 |
T4506 |
prep |
from,separating |
R2846 |
T4510 |
T4511 |
det |
the,dermis |
R2847 |
T4511 |
T4509 |
pobj |
dermis,from |
R2848 |
T4512 |
T4502 |
auxpass |
is,altered |
R2849 |
T4513 |
T4514 |
advmod |
only,in |
R2850 |
T4514 |
T4502 |
prep |
in,altered |
R2851 |
T4515 |
T4516 |
det |
the,animals |
R2852 |
T4516 |
T4514 |
pobj |
animals,in |
R2853 |
T4517 |
T4516 |
amod |
adult,animals |
R2854 |
T4518 |
T4516 |
compound |
Tg,animals |
R2855 |
T4519 |
T4520 |
det |
the,involvement |
R2856 |
T4520 |
T4500 |
dobj |
involvement,suggests |
R2857 |
T4521 |
T4520 |
prep |
of,involvement |
R2858 |
T4522 |
T4523 |
amod |
intermediary,factors |
R2859 |
T4523 |
T4521 |
pobj |
factors,of |
R2860 |
T4524 |
T4525 |
neg |
not,available |
R2861 |
T4525 |
T4523 |
relcl |
available,factors |
R2862 |
T4526 |
T4527 |
advmod |
as,readily |
R2863 |
T4527 |
T4525 |
advmod |
readily,available |
R2864 |
T4528 |
T4525 |
prep |
in,available |
R2865 |
T4529 |
T4530 |
det |
the,epidermis |
R2866 |
T4530 |
T4528 |
pobj |
epidermis,in |
R2867 |
T4531 |
T4532 |
mark |
as,are |
R2868 |
T4532 |
T4525 |
advcl |
are,available |
R2869 |
T4533 |
T4532 |
nsubj |
they,are |
R2870 |
T4534 |
T4532 |
prep |
in,are |
R2871 |
T4535 |
T4536 |
det |
the,follicle |
R2872 |
T4536 |
T4534 |
pobj |
follicle,in |
R2873 |
T4537 |
T4500 |
punct |
.,suggests |
R2878 |
T5218 |
T5219 |
amod |
Possible,Links |
R2879 |
T5220 |
T5219 |
prep |
between,Links |
R2880 |
T5221 |
T5222 |
amod |
Epidermal,Hyperproliferation |
R2881 |
T5222 |
T5220 |
pobj |
Hyperproliferation,between |
R2882 |
T5223 |
T5222 |
cc |
and,Hyperproliferation |
R2883 |
T5224 |
T5225 |
amod |
Down,regulation |
R2884 |
T5225 |
T5222 |
conj |
regulation,Hyperproliferation |
R2885 |
T5226 |
T5225 |
punct |
-,regulation |
R2886 |
T5227 |
T5225 |
prep |
of,regulation |
R2887 |
T5228 |
T5229 |
compound |
AJ,Proteins |
R2888 |
T5229 |
T5227 |
pobj |
Proteins,of |
R2889 |
T5230 |
T5219 |
prep |
in,Links |
R2890 |
T5231 |
T5232 |
compound |
Snail,Mice |
R2891 |
T5232 |
T5230 |
pobj |
Mice,in |
R2892 |
T5233 |
T5232 |
compound |
Tg,Mice |
R2893 |
T5235 |
T5236 |
prep |
Given,examined |
R2894 |
T5237 |
T5238 |
mark |
that,is |
R2895 |
T5238 |
T5235 |
pcomp |
is,Given |
R2896 |
T5239 |
T5240 |
det |
the,promoter |
R2897 |
T5240 |
T5238 |
nsubj |
promoter,is |
R2898 |
T5241 |
T5242 |
compound |
E,cadherin |
R2899 |
T5242 |
T5240 |
compound |
cadherin,promoter |
R2900 |
T5243 |
T5242 |
punct |
-,cadherin |
R2901 |
T5244 |
T5245 |
det |
a,target |
R2902 |
T5245 |
T5238 |
attr |
target,is |
R2903 |
T5246 |
T5245 |
amod |
direct,target |
R2904 |
T5247 |
T5245 |
prep |
for,target |
R2905 |
T5248 |
T5249 |
npadvmod |
Snail,mediated |
R2906 |
T5249 |
T5251 |
amod |
mediated,repression |
R2907 |
T5250 |
T5249 |
punct |
-,mediated |
R2908 |
T5251 |
T5247 |
pobj |
repression,for |
R2909 |
T5252 |
T5253 |
advmod |
in,vitro |
R2910 |
T5253 |
T5238 |
advmod |
vitro,is |
R2911 |
T5254 |
T5255 |
punct |
[,13 |
R2912 |
T5255 |
T5238 |
parataxis |
13,is |
R2913 |
T5256 |
T5255 |
nummod |
4,13 |
R2914 |
T5257 |
T5255 |
punct |
",",13 |
R2915 |
T5258 |
T5255 |
nummod |
12,13 |
R2916 |
T5259 |
T5255 |
punct |
",",13 |
R2917 |
T5260 |
T5255 |
punct |
],13 |
R2918 |
T5261 |
T5238 |
punct |
", ",is |
R2919 |
T5262 |
T5238 |
cc |
and,is |
R2920 |
T5263 |
T5264 |
mark |
that,regulated |
R2921 |
T5264 |
T5238 |
conj |
regulated,is |
R2922 |
T5265 |
T5266 |
compound |
E,cadherin |
R2923 |
T5266 |
T5264 |
nsubjpass |
cadherin,regulated |
R2924 |
T5267 |
T5266 |
punct |
-,cadherin |
R2925 |
T5268 |
T5264 |
auxpass |
was,regulated |
R2926 |
T5269 |
T5264 |
advmod |
down,regulated |
R2927 |
T5270 |
T5264 |
punct |
-,regulated |
R2928 |
T5271 |
T5264 |
prep |
in,regulated |
R2929 |
T5272 |
T5273 |
npadvmod |
Snail,expressing |
R2930 |
T5273 |
T5275 |
amod |
expressing,buds |
R2931 |
T5274 |
T5273 |
punct |
-,expressing |
R2932 |
T5275 |
T5271 |
pobj |
buds,in |
R2933 |
T5276 |
T5275 |
compound |
hair,buds |
R2934 |
T5277 |
T5236 |
punct |
", ",examined |
R2935 |
T5278 |
T5236 |
nsubj |
we,examined |
R2936 |
T5279 |
T5280 |
det |
the,status |
R2937 |
T5280 |
T5236 |
dobj |
status,examined |
R2938 |
T5281 |
T5280 |
prep |
of,status |
R2939 |
T5282 |
T5283 |
compound |
E,cadherin |
R2940 |
T5283 |
T5281 |
pobj |
cadherin,of |
R2941 |
T5284 |
T5283 |
punct |
-,cadherin |
R2942 |
T5285 |
T5283 |
cc |
and,cadherin |
R2943 |
T5286 |
T5287 |
amod |
other,proteins |
R2944 |
T5287 |
T5283 |
conj |
proteins,cadherin |
R2945 |
T5288 |
T5287 |
compound |
AJ,proteins |
R2946 |
T5289 |
T5236 |
prep |
within,examined |
R2947 |
T5290 |
T5289 |
pobj |
regions,within |
R2948 |
T5291 |
T5290 |
prep |
of,regions |
R2949 |
T5292 |
T5293 |
amod |
hyperproliferative,epidermis |
R2950 |
T5293 |
T5291 |
pobj |
epidermis,of |
R2951 |
T5294 |
T5295 |
advmod |
where,was |
R2952 |
T5295 |
T5290 |
relcl |
was,regions |
R2953 |
T5296 |
T5297 |
compound |
Tg,Snail |
R2954 |
T5297 |
T5295 |
nsubj |
Snail,was |
R2955 |
T5298 |
T5295 |
acomp |
present,was |
R2956 |
T5299 |
T5300 |
punct |
(,4A |
R2957 |
T5300 |
T5236 |
parataxis |
4A,examined |
R2958 |
T5301 |
T5300 |
compound |
Figure,4A |
R2959 |
T5302 |
T5300 |
punct |
),4A |
R2960 |
T5303 |
T5236 |
punct |
.,examined |
R2961 |
T5305 |
T5306 |
prep |
In,diminished |
R2962 |
T5307 |
T5308 |
det |
these,regions |
R2963 |
T5308 |
T5305 |
pobj |
regions,In |
R2964 |
T5309 |
T5306 |
punct |
", ",diminished |
R2965 |
T5310 |
T5311 |
compound |
immunofluorescence,staining |
R2966 |
T5311 |
T5306 |
nsubjpass |
staining,diminished |
R2967 |
T5312 |
T5311 |
prep |
of,staining |
R2968 |
T5313 |
T5314 |
compound |
E,cadherin |
R2969 |
T5314 |
T5312 |
pobj |
cadherin,of |
R2970 |
T5315 |
T5314 |
punct |
-,cadherin |
R2971 |
T5316 |
T5314 |
cc |
and,cadherin |
R2972 |
T5317 |
T5318 |
compound |
α,catenin |
R2973 |
T5318 |
T5314 |
conj |
catenin,cadherin |
R2974 |
T5319 |
T5318 |
punct |
-,catenin |
R2975 |
T5320 |
T5306 |
auxpass |
were,diminished |
R2976 |
T5321 |
T5306 |
advmod |
markedly,diminished |
R2977 |
T5322 |
T5306 |
punct |
.,diminished |
R2978 |
T5324 |
T5325 |
prep |
In,was |
R2979 |
T5326 |
T5324 |
pobj |
contrast,In |
R2980 |
T5327 |
T5325 |
punct |
", ",was |
R2981 |
T5328 |
T5329 |
det |
the,intensity |
R2982 |
T5329 |
T5325 |
nsubj |
intensity,was |
R2983 |
T5330 |
T5329 |
prep |
of,intensity |
R2984 |
T5331 |
T5332 |
compound |
antibody,staining |
R2985 |
T5332 |
T5330 |
pobj |
staining,of |
R2986 |
T5333 |
T5329 |
prep |
for,intensity |
R2987 |
T5334 |
T5335 |
nummod |
two,proteins |
R2988 |
T5335 |
T5333 |
pobj |
proteins,for |
R2989 |
T5336 |
T5335 |
amod |
other,proteins |
R2990 |
T5337 |
T5335 |
compound |
AJ,proteins |
R2991 |
T5338 |
T5335 |
punct |
", ",proteins |
R2992 |
T5339 |
T5340 |
compound |
β,catenin |
R2993 |
T5340 |
T5335 |
appos |
catenin,proteins |
R2994 |
T5341 |
T5340 |
punct |
-,catenin |
R2995 |
T5342 |
T5340 |
cc |
and,catenin |
R2996 |
T5343 |
T5340 |
conj |
Ajuba,catenin |
R2997 |
T5344 |
T5325 |
punct |
", ",was |
R2998 |
T5345 |
T5325 |
advmod |
still,was |
R2999 |
T5346 |
T5325 |
acomp |
strong,was |
R3000 |
T5347 |
T5325 |
punct |
.,was |
R3001 |
T5349 |
T5350 |
advmod |
Interestingly,appeared |
R3002 |
T5351 |
T5350 |
punct |
", ",appeared |
R3003 |
T5352 |
T5350 |
advmod |
however,appeared |
R3004 |
T5353 |
T5350 |
punct |
", ",appeared |
R3005 |
T5354 |
T5350 |
prep |
despite,appeared |
R3006 |
T5355 |
T5356 |
amod |
appreciable,immunofluorescence |
R3007 |
T5356 |
T5354 |
pobj |
immunofluorescence,despite |
R3008 |
T5357 |
T5350 |
punct |
", ",appeared |
R3009 |
T5358 |
T5350 |
nsubj |
localization,appeared |
R3010 |
T5359 |
T5358 |
prep |
of,localization |
R3011 |
T5360 |
T5361 |
compound |
β,catenin |
R3012 |
T5361 |
T5359 |
pobj |
catenin,of |
R3013 |
T5362 |
T5361 |
punct |
-,catenin |
R3014 |
T5363 |
T5361 |
cc |
and,catenin |
R3015 |
T5364 |
T5361 |
conj |
Ajuba,catenin |
R3016 |
T5365 |
T5366 |
aux |
to,be |
R3017 |
T5366 |
T5350 |
xcomp |
be,appeared |
R3018 |
T5367 |
T5368 |
advmod |
largely,cytoplasmic |
R3019 |
T5368 |
T5366 |
acomp |
cytoplasmic,be |
R3020 |
T5369 |
T5370 |
advmod |
rather,than |
R3021 |
T5370 |
T5368 |
cc |
than,cytoplasmic |
R3022 |
T5371 |
T5368 |
conj |
at,cytoplasmic |
R3023 |
T5372 |
T5373 |
compound |
cell,cell |
R3024 |
T5373 |
T5375 |
compound |
cell,borders |
R3025 |
T5374 |
T5373 |
punct |
-,cell |
R3026 |
T5375 |
T5371 |
pobj |
borders,at |
R3027 |
T5376 |
T5377 |
punct |
(,insets |
R3028 |
T5377 |
T5350 |
parataxis |
insets,appeared |
R3029 |
T5378 |
T5379 |
compound |
Figure,4A |
R3030 |
T5379 |
T5377 |
compound |
4A,insets |
R3031 |
T5380 |
T5377 |
punct |
),insets |
R3032 |
T5381 |
T5350 |
punct |
.,appeared |
R3033 |
T5383 |
T5384 |
amod |
Architectural,differences |
R3034 |
T5384 |
T5385 |
nsubj |
differences,made |
R3035 |
T5386 |
T5384 |
prep |
in,differences |
R3036 |
T5387 |
T5388 |
det |
the,epidermis |
R3037 |
T5388 |
T5386 |
pobj |
epidermis,in |
R3038 |
T5389 |
T5390 |
compound |
Western,blot |
R3039 |
T5390 |
T5391 |
compound |
blot,analyses |
R3040 |
T5391 |
T5392 |
nsubj |
analyses,difficult |
R3041 |
T5392 |
T5385 |
ccomp |
difficult,made |
R3042 |
T5393 |
T5392 |
advmod |
somewhat,difficult |
R3043 |
T5394 |
T5395 |
aux |
to,gauge |
R3044 |
T5395 |
T5392 |
advcl |
gauge,difficult |
R3045 |
T5396 |
T5385 |
punct |
.,made |
R3046 |
T5398 |
T5399 |
advmod |
However,accentuated |
R3047 |
T5400 |
T5399 |
punct |
", ",accentuated |
R3048 |
T5401 |
T5399 |
prep |
in,accentuated |
R3049 |
T5402 |
T5401 |
pobj |
regions,in |
R3050 |
T5403 |
T5404 |
amod |
such,as |
R3051 |
T5404 |
T5402 |
prep |
as,regions |
R3052 |
T5405 |
T5406 |
compound |
ear,skin |
R3053 |
T5406 |
T5404 |
pobj |
skin,as |
R3054 |
T5407 |
T5402 |
punct |
", ",regions |
R3055 |
T5408 |
T5409 |
advmod |
where,expressed |
R3056 |
T5409 |
T5402 |
relcl |
expressed,regions |
R3057 |
T5410 |
T5411 |
det |
the,levels |
R3058 |
T5411 |
T5409 |
nsubjpass |
levels,expressed |
R3059 |
T5412 |
T5411 |
amod |
highest,levels |
R3060 |
T5413 |
T5411 |
prep |
of,levels |
R3061 |
T5414 |
T5415 |
compound |
Snail,protein |
R3062 |
T5415 |
T5413 |
pobj |
protein,of |
R3063 |
T5416 |
T5409 |
auxpass |
were,expressed |
R3064 |
T5417 |
T5399 |
punct |
", ",accentuated |
R3065 |
T5418 |
T5419 |
det |
the,effects |
R3066 |
T5419 |
T5399 |
nsubjpass |
effects,accentuated |
R3067 |
T5420 |
T5399 |
auxpass |
were,accentuated |
R3068 |
T5421 |
T5399 |
punct |
.,accentuated |
R3069 |
T5423 |
T5424 |
prep |
In,reduced |
R3070 |
T5425 |
T5426 |
preconj |
both,skin |
R3071 |
T5426 |
T5423 |
pobj |
skin,In |
R3072 |
T5427 |
T5426 |
compound |
back,skin |
R3073 |
T5428 |
T5426 |
cc |
and,skin |
R3074 |
T5429 |
T5430 |
compound |
ear,skin |
R3075 |
T5430 |
T5426 |
conj |
skin,skin |
R3076 |
T5431 |
T5424 |
punct |
", ",reduced |
R3077 |
T5432 |
T5433 |
amod |
overall,levels |
R3078 |
T5433 |
T5424 |
nsubjpass |
levels,reduced |
R3079 |
T5434 |
T5433 |
prep |
of,levels |
R3080 |
T5435 |
T5436 |
compound |
E,cadherin |
R3081 |
T5436 |
T5434 |
pobj |
cadherin,of |
R3082 |
T5437 |
T5436 |
punct |
-,cadherin |
R3083 |
T5438 |
T5436 |
cc |
and,cadherin |
R3084 |
T5439 |
T5440 |
compound |
α,catenin |
R3085 |
T5440 |
T5436 |
conj |
catenin,cadherin |
R3086 |
T5441 |
T5440 |
punct |
-,catenin |
R3087 |
T5442 |
T5424 |
auxpass |
were,reduced |
R3088 |
T5443 |
T5424 |
punct |
", ",reduced |
R3089 |
T5444 |
T5424 |
prep |
under,reduced |
R3090 |
T5445 |
T5444 |
pobj |
conditions,under |
R3091 |
T5446 |
T5447 |
advmod |
where,remained |
R3092 |
T5447 |
T5445 |
relcl |
remained,conditions |
R3093 |
T5448 |
T5449 |
nmod |
β,catenin |
R3094 |
T5449 |
T5451 |
nmod |
catenin,levels |
R3095 |
T5450 |
T5449 |
punct |
-,catenin |
R3096 |
T5451 |
T5447 |
nsubj |
levels,remained |
R3097 |
T5452 |
T5449 |
cc |
and,catenin |
R3098 |
T5453 |
T5449 |
conj |
Ajuba,catenin |
R3099 |
T5454 |
T5447 |
acomp |
unchanged,remained |
R3100 |
T5455 |
T5447 |
advcl |
relative,remained |
R3101 |
T5456 |
T5455 |
prep |
to,relative |
R3102 |
T5457 |
T5456 |
pobj |
controls,to |
R3103 |
T5458 |
T5459 |
punct |
(,4B |
R3104 |
T5459 |
T5424 |
parataxis |
4B,reduced |
R3105 |
T5460 |
T5459 |
compound |
Figure,4B |
R3106 |
T5461 |
T5459 |
punct |
),4B |
R3107 |
T5462 |
T5424 |
punct |
.,reduced |
R3108 |
T5464 |
T5465 |
advcl |
Taken,were |
R3109 |
T5466 |
T5464 |
advmod |
together,Taken |
R3110 |
T5467 |
T5465 |
punct |
", ",were |
R3111 |
T5468 |
T5469 |
det |
these,data |
R3112 |
T5469 |
T5465 |
nsubj |
data,were |
R3113 |
T5470 |
T5465 |
acomp |
consistent,were |
R3114 |
T5471 |
T5470 |
prep |
with,consistent |
R3115 |
T5472 |
T5473 |
poss |
our,results |
R3116 |
T5473 |
T5471 |
pobj |
results,with |
R3117 |
T5474 |
T5473 |
acl |
obtained,results |
R3118 |
T5475 |
T5474 |
prep |
from,obtained |
R3119 |
T5476 |
T5477 |
compound |
immunofluorescence,microscopy |
R3120 |
T5477 |
T5475 |
pobj |
microscopy,from |
R3121 |
T5478 |
T5465 |
punct |
.,were |
R3122 |
T5480 |
T5481 |
advmod |
A,priori |
R3123 |
T5481 |
T5482 |
advmod |
priori,be |
R3124 |
T5483 |
T5482 |
punct |
", ",be |
R3125 |
T5484 |
T5485 |
det |
the,decrease |
R3126 |
T5485 |
T5482 |
nsubj |
decrease,be |
R3127 |
T5486 |
T5485 |
prep |
in,decrease |
R3128 |
T5487 |
T5488 |
compound |
α,catenin |
R3129 |
T5488 |
T5490 |
compound |
catenin,levels |
R3130 |
T5489 |
T5488 |
punct |
-,catenin |
R3131 |
T5490 |
T5486 |
pobj |
levels,in |
R3132 |
T5491 |
T5482 |
aux |
could,be |
R3133 |
T5492 |
T5482 |
prep |
due,be |
R3134 |
T5493 |
T5492 |
pcomp |
to,due |
R3135 |
T5494 |
T5495 |
preconj |
either,repression |
R3136 |
T5495 |
T5492 |
pobj |
repression,due |
R3137 |
T5496 |
T5495 |
amod |
direct,repression |
R3138 |
T5497 |
T5495 |
amod |
transcriptional,repression |
R3139 |
T5498 |
T5495 |
prep |
by,repression |
R3140 |
T5499 |
T5498 |
pobj |
Snail,by |
R3141 |
T5500 |
T5495 |
cc |
or,repression |
R3142 |
T5501 |
T5495 |
conj |
perturbations,repression |
R3143 |
T5502 |
T5501 |
prep |
in,perturbations |
R3144 |
T5503 |
T5504 |
compound |
AJ,formation |
R3145 |
T5504 |
T5502 |
pobj |
formation,in |
R3146 |
T5505 |
T5501 |
acl |
caused,perturbations |
R3147 |
T5506 |
T5505 |
agent |
by,caused |
R3148 |
T5507 |
T5508 |
det |
the,decrease |
R3149 |
T5508 |
T5506 |
pobj |
decrease,by |
R3150 |
T5509 |
T5508 |
prep |
in,decrease |
R3151 |
T5510 |
T5511 |
compound |
E,cadherin |
R3152 |
T5511 |
T5513 |
compound |
cadherin,expression |
R3153 |
T5512 |
T5511 |
punct |
-,cadherin |
R3154 |
T5513 |
T5509 |
pobj |
expression,in |
R3155 |
T5514 |
T5513 |
compound |
gene,expression |
R3156 |
T5515 |
T5482 |
punct |
.,be |
R3157 |
T5517 |
T5518 |
aux |
To,distinguish |
R3158 |
T5518 |
T5519 |
advcl |
distinguish,tested |
R3159 |
T5520 |
T5518 |
prep |
between,distinguish |
R3160 |
T5521 |
T5522 |
det |
these,possibilities |
R3161 |
T5522 |
T5520 |
pobj |
possibilities,between |
R3162 |
T5523 |
T5519 |
punct |
", ",tested |
R3163 |
T5524 |
T5519 |
nsubj |
we,tested |
R3164 |
T5525 |
T5526 |
mark |
whether,restored |
R3165 |
T5526 |
T5519 |
ccomp |
restored,tested |
R3166 |
T5527 |
T5528 |
compound |
α,catenin |
R3167 |
T5528 |
T5530 |
compound |
catenin,levels |
R3168 |
T5529 |
T5528 |
punct |
-,catenin |
R3169 |
T5530 |
T5526 |
nsubjpass |
levels,restored |
R3170 |
T5531 |
T5526 |
aux |
could,restored |
R3171 |
T5532 |
T5526 |
auxpass |
be,restored |
R3172 |
T5533 |
T5526 |
agent |
by,restored |
R3173 |
T5534 |
T5535 |
amod |
exogenous,expression |
R3174 |
T5535 |
T5533 |
pobj |
expression,by |
R3175 |
T5536 |
T5535 |
prep |
of,expression |
R3176 |
T5537 |
T5538 |
compound |
E,cadherin |
R3177 |
T5538 |
T5536 |
pobj |
cadherin,of |
R3178 |
T5539 |
T5538 |
punct |
-,cadherin |
R3179 |
T5540 |
T5526 |
prep |
in,restored |
R3180 |
T5541 |
T5542 |
npadvmod |
Snail,expressing |
R3181 |
T5542 |
T5544 |
amod |
expressing,keratinocytes |
R3182 |
T5543 |
T5542 |
punct |
-,expressing |
R3183 |
T5544 |
T5540 |
pobj |
keratinocytes,in |
R3184 |
T5545 |
T5519 |
punct |
.,tested |
R3185 |
T5547 |
T5548 |
mark |
As,shown |
R3186 |
T5548 |
T5549 |
advcl |
shown,displayed |
R3187 |
T5550 |
T5548 |
prep |
in,shown |
R3188 |
T5551 |
T5552 |
compound |
Figure,4C |
R3189 |
T5552 |
T5550 |
pobj |
4C,in |
R3190 |
T5553 |
T5549 |
punct |
", ",displayed |
R3191 |
T5554 |
T5555 |
advmod |
transiently,transfected |
R3192 |
T5555 |
T5556 |
amod |
transfected,keratinocytes |
R3193 |
T5556 |
T5549 |
nsubj |
keratinocytes,displayed |
R3194 |
T5557 |
T5556 |
acl |
expressing,keratinocytes |
R3195 |
T5558 |
T5559 |
npadvmod |
HA,tagged |
R3196 |
T5559 |
T5561 |
amod |
tagged,Snail |
R3197 |
T5560 |
T5559 |
punct |
-,tagged |
R3198 |
T5561 |
T5557 |
dobj |
Snail,expressing |
R3199 |
T5562 |
T5563 |
det |
a,loss |
R3200 |
T5563 |
T5549 |
dobj |
loss,displayed |
R3201 |
T5564 |
T5563 |
prep |
of,loss |
R3202 |
T5565 |
T5566 |
compound |
E,cadherin |
R3203 |
T5566 |
T5564 |
pobj |
cadherin,of |
R3204 |
T5567 |
T5566 |
punct |
-,cadherin |
R3205 |
T5568 |
T5566 |
cc |
and,cadherin |
R3206 |
T5569 |
T5570 |
compound |
α,catenin |
R3207 |
T5570 |
T5566 |
conj |
catenin,cadherin |
R3208 |
T5571 |
T5570 |
punct |
-,catenin |
R3209 |
T5572 |
T5549 |
prep |
at,displayed |
R3210 |
T5573 |
T5574 |
compound |
cell,cell |
R3211 |
T5574 |
T5576 |
compound |
cell,borders |
R3212 |
T5575 |
T5574 |
punct |
-,cell |
R3213 |
T5576 |
T5572 |
pobj |
borders,at |
R3214 |
T5577 |
T5549 |
punct |
.,displayed |
R3215 |
T5579 |
T5580 |
nsubj |
Coexpression,enabled |
R3216 |
T5581 |
T5579 |
prep |
of,Coexpression |
R3217 |
T5582 |
T5583 |
amod |
exogenous,cadherin |
R3218 |
T5583 |
T5581 |
pobj |
cadherin,of |
R3219 |
T5584 |
T5585 |
npadvmod |
HA,tagged |
R3220 |
T5585 |
T5583 |
amod |
tagged,cadherin |
R3221 |
T5586 |
T5585 |
punct |
-,tagged |
R3222 |
T5587 |
T5583 |
compound |
E,cadherin |
R3223 |
T5588 |
T5583 |
punct |
-,cadherin |
R3224 |
T5589 |
T5580 |
preconj |
not,enabled |
R3225 |
T5590 |
T5589 |
advmod |
only,not |
R3226 |
T5591 |
T5592 |
compound |
cell,cell |
R3227 |
T5592 |
T5594 |
compound |
cell,localization |
R3228 |
T5593 |
T5592 |
punct |
-,cell |
R3229 |
T5594 |
T5580 |
dobj |
localization,enabled |
R3230 |
T5595 |
T5594 |
compound |
border,localization |
R3231 |
T5596 |
T5594 |
prep |
of,localization |
R3232 |
T5597 |
T5598 |
compound |
E,cadherin |
R3233 |
T5598 |
T5600 |
compound |
cadherin,protein |
R3234 |
T5599 |
T5598 |
punct |
-,cadherin |
R3235 |
T5600 |
T5596 |
pobj |
protein,of |
R3236 |
T5601 |
T5580 |
punct |
", ",enabled |
R3237 |
T5602 |
T5580 |
cc |
but,enabled |
R3238 |
T5603 |
T5602 |
advmod |
also,but |
R3239 |
T5604 |
T5580 |
conj |
rescued,enabled |
R3240 |
T5605 |
T5606 |
det |
the,staining |
R3241 |
T5606 |
T5604 |
dobj |
staining,rescued |
R3242 |
T5607 |
T5608 |
compound |
cell,cell |
R3243 |
T5608 |
T5606 |
compound |
cell,staining |
R3244 |
T5609 |
T5608 |
punct |
-,cell |
R3245 |
T5610 |
T5606 |
compound |
border,staining |
R3246 |
T5611 |
T5606 |
prep |
of,staining |
R3247 |
T5612 |
T5613 |
compound |
α,catenin |
R3248 |
T5613 |
T5611 |
pobj |
catenin,of |
R3249 |
T5614 |
T5613 |
punct |
-,catenin |
R3250 |
T5615 |
T5616 |
punct |
(,4C |
R3251 |
T5616 |
T5604 |
parataxis |
4C,rescued |
R3252 |
T5617 |
T5616 |
compound |
Figure,4C |
R3253 |
T5618 |
T5616 |
punct |
),4C |
R3254 |
T5619 |
T5580 |
punct |
.,enabled |
R3255 |
T5621 |
T5622 |
det |
The,ability |
R3256 |
T5622 |
T5623 |
nsubj |
ability,argues |
R3257 |
T5624 |
T5625 |
aux |
to,restore |
R3258 |
T5625 |
T5622 |
acl |
restore,ability |
R3259 |
T5626 |
T5627 |
compound |
α,catenin |
R3260 |
T5627 |
T5625 |
dobj |
catenin,restore |
R3261 |
T5628 |
T5627 |
punct |
-,catenin |
R3262 |
T5629 |
T5627 |
appos |
expression,catenin |
R3263 |
T5630 |
T5629 |
cc |
and,expression |
R3264 |
T5631 |
T5629 |
conj |
localization,expression |
R3265 |
T5632 |
T5625 |
prep |
under,restore |
R3266 |
T5633 |
T5634 |
det |
these,conditions |
R3267 |
T5634 |
T5632 |
pobj |
conditions,under |
R3268 |
T5635 |
T5623 |
prep |
against,argues |
R3269 |
T5636 |
T5637 |
det |
the,notion |
R3270 |
T5637 |
T5635 |
pobj |
notion,against |
R3271 |
T5638 |
T5639 |
mark |
that,represses |
R3272 |
T5639 |
T5637 |
acl |
represses,notion |
R3273 |
T5640 |
T5639 |
nsubj |
Snail,represses |
R3274 |
T5641 |
T5639 |
advmod |
transcriptionally,represses |
R3275 |
T5642 |
T5643 |
compound |
α,catenin |
R3276 |
T5643 |
T5639 |
dobj |
catenin,represses |
R3277 |
T5644 |
T5643 |
punct |
-,catenin |
R3278 |
T5645 |
T5623 |
punct |
.,argues |
R3279 |
T5647 |
T5648 |
advmod |
Rather,are |
R3280 |
T5649 |
T5648 |
punct |
", ",are |
R3281 |
T5650 |
T5651 |
det |
the,findings |
R3282 |
T5651 |
T5648 |
nsubj |
findings,are |
R3283 |
T5652 |
T5648 |
acomp |
consistent,are |
R3284 |
T5653 |
T5652 |
prep |
with,consistent |
R3285 |
T5654 |
T5655 |
det |
a,report |
R3286 |
T5655 |
T5653 |
pobj |
report,with |
R3287 |
T5656 |
T5655 |
amod |
previous,report |
R3288 |
T5657 |
T5658 |
mark |
that,required |
R3289 |
T5658 |
T5655 |
acl |
required,report |
R3290 |
T5659 |
T5660 |
compound |
E,cadherin |
R3291 |
T5660 |
T5658 |
nsubjpass |
cadherin,required |
R3292 |
T5661 |
T5660 |
punct |
-,cadherin |
R3293 |
T5662 |
T5658 |
auxpass |
is,required |
R3294 |
T5663 |
T5658 |
prep |
for,required |
R3295 |
T5664 |
T5665 |
det |
the,translation |
R3296 |
T5665 |
T5663 |
pobj |
translation,for |
R3297 |
T5666 |
T5665 |
prep |
of,translation |
R3298 |
T5667 |
T5668 |
compound |
α,catenin |
R3299 |
T5668 |
T5670 |
compound |
catenin,mRNA |
R3300 |
T5669 |
T5668 |
punct |
-,catenin |
R3301 |
T5670 |
T5666 |
pobj |
mRNA,of |
R3302 |
T5671 |
T5672 |
punct |
[,22 |
R3303 |
T5672 |
T5648 |
parataxis |
22,are |
R3304 |
T5673 |
T5672 |
punct |
],22 |
R3305 |
T5674 |
T5648 |
punct |
.,are |
R3306 |
T5676 |
T5677 |
prep |
Despite,displayed |
R3307 |
T5678 |
T5679 |
det |
the,reductions |
R3308 |
T5679 |
T5676 |
pobj |
reductions,Despite |
R3309 |
T5680 |
T5679 |
prep |
in,reductions |
R3310 |
T5681 |
T5682 |
compound |
AJ,markers |
R3311 |
T5682 |
T5680 |
pobj |
markers,in |
R3312 |
T5683 |
T5677 |
punct |
", ",displayed |
R3313 |
T5684 |
T5685 |
compound |
Tg,skin |
R3314 |
T5685 |
T5677 |
nsubj |
skin,displayed |
R3315 |
T5686 |
T5677 |
advmod |
still,displayed |
R3316 |
T5687 |
T5688 |
amod |
sealed,membranes |
R3317 |
T5688 |
T5677 |
dobj |
membranes,displayed |
R3318 |
T5689 |
T5688 |
cc |
and,membranes |
R3319 |
T5690 |
T5691 |
amod |
intercellular,junctions |
R3320 |
T5691 |
T5688 |
conj |
junctions,membranes |
R3321 |
T5692 |
T5693 |
dep |
that,were |
R3322 |
T5693 |
T5691 |
relcl |
were,junctions |
R3323 |
T5694 |
T5693 |
advmod |
largely,were |
R3324 |
T5695 |
T5693 |
acomp |
intact,were |
R3325 |
T5696 |
T5693 |
punct |
", ",were |
R3326 |
T5697 |
T5698 |
mark |
as,judged |
R3327 |
T5698 |
T5693 |
advcl |
judged,were |
R3328 |
T5699 |
T5698 |
prep |
by,judged |
R3329 |
T5700 |
T5701 |
amod |
ultrastructural,analyses |
R3330 |
T5701 |
T5699 |
pobj |
analyses,by |
R3331 |
T5702 |
T5703 |
punct |
(,data |
R3332 |
T5703 |
T5677 |
meta |
data,displayed |
R3333 |
T5704 |
T5703 |
amod |
unpublished,data |
R3334 |
T5705 |
T5703 |
punct |
),data |
R3335 |
T5706 |
T5677 |
punct |
.,displayed |
R3336 |
T5708 |
T5709 |
prep |
In,resembled |
R3337 |
T5710 |
T5711 |
det |
this,respect |
R3338 |
T5711 |
T5708 |
pobj |
respect,In |
R3339 |
T5712 |
T5709 |
punct |
", ",resembled |
R3340 |
T5713 |
T5714 |
det |
the,epithelium |
R3341 |
T5714 |
T5709 |
nsubj |
epithelium,resembled |
R3342 |
T5715 |
T5714 |
compound |
skin,epithelium |
R3343 |
T5716 |
T5709 |
dobj |
that,resembled |
R3344 |
T5717 |
T5716 |
prep |
of,that |
R3345 |
T5718 |
T5719 |
det |
the,bud |
R3346 |
T5719 |
T5717 |
pobj |
bud,of |
R3347 |
T5720 |
T5719 |
compound |
hair,bud |
R3348 |
T5721 |
T5719 |
punct |
", ",bud |
R3349 |
T5722 |
T5723 |
advmod |
where,is |
R3350 |
T5723 |
T5719 |
relcl |
is,bud |
R3351 |
T5724 |
T5725 |
det |
the,regulation |
R3352 |
T5725 |
T5723 |
nsubj |
regulation,is |
R3353 |
T5726 |
T5725 |
amod |
down,regulation |
R3354 |
T5727 |
T5725 |
punct |
-,regulation |
R3355 |
T5728 |
T5725 |
prep |
in,regulation |
R3356 |
T5729 |
T5730 |
compound |
junction,proteins |
R3357 |
T5730 |
T5728 |
pobj |
proteins,in |
R3358 |
T5731 |
T5723 |
acomp |
permissive,is |
R3359 |
T5732 |
T5723 |
prep |
for,is |
R3360 |
T5733 |
T5734 |
compound |
cell,cell |
R3361 |
T5734 |
T5736 |
compound |
cell,remodeling |
R3362 |
T5735 |
T5734 |
punct |
-,cell |
R3363 |
T5736 |
T5732 |
pobj |
remodeling,for |
R3364 |
T5737 |
T5723 |
prep |
without,is |
R3365 |
T5738 |
T5737 |
pcomp |
abrogating,without |
R3366 |
T5739 |
T5740 |
amod |
intercellular,adhesion |
R3367 |
T5740 |
T5738 |
dobj |
adhesion,abrogating |
R3368 |
T5741 |
T5709 |
punct |
.,resembled |
R3369 |
T5743 |
T5744 |
det |
The,similarities |
R3370 |
T5744 |
T5745 |
nsubj |
similarities,extended |
R3371 |
T5746 |
T5744 |
prep |
between,similarities |
R3372 |
T5747 |
T5748 |
compound |
Snail,epidermis |
R3373 |
T5748 |
T5746 |
pobj |
epidermis,between |
R3374 |
T5749 |
T5748 |
compound |
Tg,epidermis |
R3375 |
T5750 |
T5748 |
cc |
and,epidermis |
R3376 |
T5751 |
T5752 |
compound |
hair,buds |
R3377 |
T5752 |
T5748 |
conj |
buds,epidermis |
R3378 |
T5753 |
T5745 |
prep |
to,extended |
R3379 |
T5754 |
T5755 |
det |
the,state |
R3380 |
T5755 |
T5753 |
pobj |
state,to |
R3381 |
T5756 |
T5755 |
amod |
hyperproliferative,state |
R3382 |
T5757 |
T5745 |
punct |
", ",extended |
R3383 |
T5758 |
T5745 |
advcl |
leading,extended |
R3384 |
T5759 |
T5758 |
dobj |
us,leading |
R3385 |
T5760 |
T5761 |
aux |
to,wonder |
R3386 |
T5761 |
T5758 |
xcomp |
wonder,leading |
R3387 |
T5762 |
T5763 |
mark |
whether,contribute |
R3388 |
T5763 |
T5761 |
ccomp |
contribute,wonder |
R3389 |
T5764 |
T5765 |
det |
the,regulation |
R3390 |
T5765 |
T5763 |
nsubj |
regulation,contribute |
R3391 |
T5766 |
T5765 |
amod |
down,regulation |
R3392 |
T5767 |
T5765 |
punct |
-,regulation |
R3393 |
T5768 |
T5765 |
prep |
of,regulation |
R3394 |
T5769 |
T5770 |
compound |
AJ,proteins |
R3395 |
T5770 |
T5768 |
pobj |
proteins,of |
R3396 |
T5771 |
T5763 |
aux |
might,contribute |
R3397 |
T5772 |
T5763 |
prep |
to,contribute |
R3398 |
T5773 |
T5774 |
det |
this,condition |
R3399 |
T5774 |
T5772 |
pobj |
condition,to |
R3400 |
T5775 |
T5745 |
punct |
.,extended |
R3401 |
T5777 |
T5778 |
prep |
Given,used |
R3402 |
T5779 |
T5780 |
det |
the,increase |
R3403 |
T5780 |
T5777 |
pobj |
increase,Given |
R3404 |
T5781 |
T5780 |
prep |
in,increase |
R3405 |
T5782 |
T5783 |
compound |
pMAPK,staining |
R3406 |
T5783 |
T5781 |
pobj |
staining,in |
R3407 |
T5784 |
T5780 |
prep |
in,increase |
R3408 |
T5785 |
T5786 |
compound |
Snail,epidermis |
R3409 |
T5786 |
T5784 |
pobj |
epidermis,in |
R3410 |
T5787 |
T5786 |
compound |
Tg,epidermis |
R3411 |
T5788 |
T5789 |
punct |
(,see |
R3412 |
T5789 |
T5780 |
parataxis |
see,increase |
R3413 |
T5790 |
T5791 |
compound |
Figure,2G |
R3414 |
T5791 |
T5789 |
dobj |
2G,see |
R3415 |
T5792 |
T5789 |
punct |
),see |
R3416 |
T5793 |
T5778 |
punct |
", ",used |
R3417 |
T5794 |
T5778 |
nsubj |
we,used |
R3418 |
T5795 |
T5796 |
compound |
pMAPK,levels |
R3419 |
T5796 |
T5778 |
dobj |
levels,used |
R3420 |
T5797 |
T5778 |
prep |
as,used |
R3421 |
T5798 |
T5799 |
poss |
our,assay |
R3422 |
T5799 |
T5797 |
pobj |
assay,as |
R3423 |
T5800 |
T5801 |
aux |
to,test |
R3424 |
T5801 |
T5778 |
advcl |
test,used |
R3425 |
T5802 |
T5803 |
mark |
whether,contributed |
R3426 |
T5803 |
T5801 |
ccomp |
contributed,test |
R3427 |
T5804 |
T5805 |
det |
the,loss |
R3428 |
T5805 |
T5803 |
nsubj |
loss,contributed |
R3429 |
T5806 |
T5805 |
prep |
of,loss |
R3430 |
T5807 |
T5808 |
compound |
E,cadherin |
R3431 |
T5808 |
T5806 |
pobj |
cadherin,of |
R3432 |
T5809 |
T5808 |
punct |
-,cadherin |
R3433 |
T5810 |
T5803 |
prep |
to,contributed |
R3434 |
T5811 |
T5812 |
det |
the,increase |
R3435 |
T5812 |
T5810 |
pobj |
increase,to |
R3436 |
T5813 |
T5814 |
npadvmod |
Snail,mediated |
R3437 |
T5814 |
T5812 |
amod |
mediated,increase |
R3438 |
T5815 |
T5814 |
punct |
-,mediated |
R3439 |
T5816 |
T5812 |
prep |
in,increase |
R3440 |
T5817 |
T5816 |
pobj |
proliferation,in |
R3441 |
T5818 |
T5778 |
punct |
.,used |
R3442 |
T5820 |
T5821 |
advcl |
Consistent,exhibited |
R3443 |
T5822 |
T5820 |
prep |
with,Consistent |
R3444 |
T5823 |
T5824 |
poss |
our,observations |
R3445 |
T5824 |
T5822 |
pobj |
observations,with |
R3446 |
T5825 |
T5826 |
advmod |
in,vivo |
R3447 |
T5826 |
T5824 |
amod |
vivo,observations |
R3448 |
T5827 |
T5821 |
punct |
", ",exhibited |
R3449 |
T5828 |
T5829 |
amod |
transfected,keratinocytes |
R3450 |
T5829 |
T5821 |
nsubj |
keratinocytes,exhibited |
R3451 |
T5830 |
T5829 |
acl |
expressing,keratinocytes |
R3452 |
T5831 |
T5830 |
dobj |
Snail,expressing |
R3453 |
T5832 |
T5833 |
det |
a,increase |
R3454 |
T5833 |
T5821 |
dobj |
increase,exhibited |
R3455 |
T5834 |
T5833 |
amod |
substantial,increase |
R3456 |
T5835 |
T5833 |
prep |
in,increase |
R3457 |
T5836 |
T5837 |
compound |
pMAPK,levels |
R3458 |
T5837 |
T5835 |
pobj |
levels,in |
R3459 |
T5838 |
T5833 |
amod |
relative,increase |
R3460 |
T5839 |
T5838 |
prep |
to,relative |
R3461 |
T5840 |
T5841 |
compound |
control,cells |
R3462 |
T5841 |
T5839 |
pobj |
cells,to |
R3463 |
T5842 |
T5843 |
punct |
(,4D |
R3464 |
T5843 |
T5821 |
parataxis |
4D,exhibited |
R3465 |
T5844 |
T5843 |
compound |
Figure,4D |
R3466 |
T5845 |
T5843 |
punct |
),4D |
R3467 |
T5846 |
T5821 |
punct |
.,exhibited |
R3468 |
T5848 |
T5849 |
nsubj |
Coexpression,appeared |
R3469 |
T5850 |
T5848 |
prep |
of,Coexpression |
R3470 |
T5851 |
T5852 |
compound |
E,cadherin |
R3471 |
T5852 |
T5850 |
pobj |
cadherin,of |
R3472 |
T5853 |
T5852 |
punct |
-,cadherin |
R3473 |
T5854 |
T5848 |
prep |
with,Coexpression |
R3474 |
T5855 |
T5854 |
pobj |
Snail,with |
R3475 |
T5856 |
T5857 |
aux |
to,abrogate |
R3476 |
T5857 |
T5849 |
xcomp |
abrogate,appeared |
R3477 |
T5858 |
T5859 |
det |
this,effect |
R3478 |
T5859 |
T5857 |
dobj |
effect,abrogate |
R3479 |
T5860 |
T5849 |
punct |
.,appeared |
R3480 |
T5862 |
T5863 |
advmod |
Together,raised |
R3481 |
T5864 |
T5863 |
punct |
", ",raised |
R3482 |
T5865 |
T5866 |
det |
these,findings |
R3483 |
T5866 |
T5863 |
nsubj |
findings,raised |
R3484 |
T5867 |
T5868 |
det |
the,possibility |
R3485 |
T5868 |
T5863 |
dobj |
possibility,raised |
R3486 |
T5869 |
T5870 |
mark |
that,participate |
R3487 |
T5870 |
T5868 |
acl |
participate,possibility |
R3488 |
T5871 |
T5872 |
det |
an,protein |
R3489 |
T5872 |
T5870 |
nsubj |
protein,participate |
R3490 |
T5873 |
T5874 |
npadvmod |
AJ,associated |
R3491 |
T5874 |
T5872 |
amod |
associated,protein |
R3492 |
T5875 |
T5874 |
punct |
-,associated |
R3493 |
T5876 |
T5877 |
dep |
that,sequestered |
R3494 |
T5877 |
T5872 |
relcl |
sequestered,protein |
R3495 |
T5878 |
T5877 |
auxpass |
is,sequestered |
R3496 |
T5879 |
T5877 |
advmod |
normally,sequestered |
R3497 |
T5880 |
T5877 |
prep |
at,sequestered |
R3498 |
T5881 |
T5882 |
det |
the,membrane |
R3499 |
T5882 |
T5880 |
pobj |
membrane,at |
R3500 |
T5883 |
T5882 |
compound |
plasma,membrane |
R3501 |
T5884 |
T5870 |
aux |
may,participate |
R3502 |
T5885 |
T5870 |
prep |
in,participate |
R3503 |
T5886 |
T5887 |
det |
a,pathway |
R3504 |
T5887 |
T5885 |
pobj |
pathway,in |
R3505 |
T5888 |
T5887 |
compound |
proliferation,pathway |
R3506 |
T5889 |
T5887 |
compound |
signaling,pathway |
R3507 |
T5890 |
T5891 |
advmod |
when,deconstructed |
R3508 |
T5891 |
T5870 |
advcl |
deconstructed,participate |
R3509 |
T5892 |
T5891 |
nsubjpass |
AJs,deconstructed |
R3510 |
T5893 |
T5891 |
auxpass |
are,deconstructed |
R3511 |
T5894 |
T5863 |
punct |
.,raised |
R3512 |
T5896 |
T5897 |
amod |
Numerous,studies |
R3513 |
T5897 |
T5898 |
nsubj |
studies,correlated |
R3514 |
T5899 |
T5898 |
aux |
have,correlated |
R3515 |
T5900 |
T5901 |
det |
a,regulation |
R3516 |
T5901 |
T5898 |
dobj |
regulation,correlated |
R3517 |
T5902 |
T5901 |
amod |
down,regulation |
R3518 |
T5903 |
T5901 |
punct |
-,regulation |
R3519 |
T5904 |
T5901 |
prep |
of,regulation |
R3520 |
T5905 |
T5906 |
compound |
E,cadherin |
R3521 |
T5906 |
T5904 |
pobj |
cadherin,of |
R3522 |
T5907 |
T5906 |
punct |
-,cadherin |
R3523 |
T5908 |
T5898 |
prep |
with,correlated |
R3524 |
T5909 |
T5910 |
det |
a,translocation |
R3525 |
T5910 |
T5908 |
pobj |
translocation,with |
R3526 |
T5911 |
T5910 |
prep |
of,translocation |
R3527 |
T5912 |
T5913 |
compound |
β,catenin |
R3528 |
T5913 |
T5911 |
pobj |
catenin,of |
R3529 |
T5914 |
T5913 |
punct |
-,catenin |
R3530 |
T5915 |
T5910 |
prep |
to,translocation |
R3531 |
T5916 |
T5917 |
det |
the,nucleus |
R3532 |
T5917 |
T5915 |
pobj |
nucleus,to |
R3533 |
T5918 |
T5910 |
cc |
and,translocation |
R3534 |
T5919 |
T5920 |
det |
a,transactivation |
R3535 |
T5920 |
T5910 |
conj |
transactivation,translocation |
R3536 |
T5921 |
T5920 |
prep |
of,transactivation |
R3537 |
T5922 |
T5921 |
pobj |
genes,of |
R3538 |
T5923 |
T5924 |
dep |
that,regulated |
R3539 |
T5924 |
T5922 |
relcl |
regulated,genes |
R3540 |
T5925 |
T5924 |
auxpass |
are,regulated |
R3541 |
T5926 |
T5924 |
agent |
by,regulated |
R3542 |
T5927 |
T5928 |
det |
the,family |
R3543 |
T5928 |
T5926 |
pobj |
family,by |
R3544 |
T5929 |
T5928 |
nmod |
LEF,family |
R3545 |
T5930 |
T5929 |
punct |
-,LEF |
R3546 |
T5931 |
T5929 |
nummod |
1,LEF |
R3547 |
T5932 |
T5929 |
punct |
/,LEF |
R3548 |
T5933 |
T5934 |
compound |
T,cell |
R3549 |
T5934 |
T5935 |
compound |
cell,factor |
R3550 |
T5935 |
T5929 |
appos |
factor,LEF |
R3551 |
T5936 |
T5935 |
punct |
(,factor |
R3552 |
T5937 |
T5935 |
appos |
TCF,factor |
R3553 |
T5938 |
T5928 |
punct |
),family |
R3554 |
T5939 |
T5928 |
prep |
of,family |
R3555 |
T5940 |
T5941 |
npadvmod |
DNA,binding |
R3556 |
T5941 |
T5942 |
amod |
binding,proteins |
R3557 |
T5942 |
T5939 |
pobj |
proteins,of |
R3558 |
T5943 |
T5944 |
punct |
[,25 |
R3559 |
T5944 |
T5898 |
parataxis |
25,correlated |
R3560 |
T5945 |
T5944 |
nummod |
23,25 |
R3561 |
T5946 |
T5944 |
punct |
",",25 |
R3562 |
T5947 |
T5944 |
nummod |
24,25 |
R3563 |
T5948 |
T5944 |
punct |
",",25 |
R3564 |
T5949 |
T5944 |
punct |
],25 |
R3565 |
T5950 |
T5898 |
punct |
.,correlated |
R3566 |
T5952 |
T5953 |
det |
The,presence |
R3567 |
T5953 |
T5954 |
nsubj |
presence,was |
R3568 |
T5955 |
T5953 |
prep |
of,presence |
R3569 |
T5956 |
T5957 |
amod |
nuclear,D |
R3570 |
T5957 |
T5955 |
pobj |
D,of |
R3571 |
T5958 |
T5957 |
compound |
cyclin,D |
R3572 |
T5959 |
T5953 |
prep |
in,presence |
R3573 |
T5960 |
T5961 |
amod |
hyperproliferative,epidermis |
R3574 |
T5961 |
T5959 |
pobj |
epidermis,in |
R3575 |
T5962 |
T5961 |
compound |
Snail,epidermis |
R3576 |
T5963 |
T5961 |
compound |
Tg,epidermis |
R3577 |
T5964 |
T5965 |
advmod |
particularly,intriguing |
R3578 |
T5965 |
T5954 |
acomp |
intriguing,was |
R3579 |
T5966 |
T5967 |
mark |
since,reported |
R3580 |
T5967 |
T5954 |
advcl |
reported,was |
R3581 |
T5968 |
T5969 |
amod |
prior,studies |
R3582 |
T5969 |
T5967 |
nsubj |
studies,reported |
R3583 |
T5970 |
T5967 |
aux |
have,reported |
R3584 |
T5971 |
T5972 |
compound |
cyclin,D |
R3585 |
T5972 |
T5973 |
compound |
D,gene |
R3586 |
T5973 |
T5967 |
dobj |
gene,reported |
R3587 |
T5974 |
T5967 |
prep |
as,reported |
R3588 |
T5975 |
T5976 |
det |
a,target |
R3589 |
T5976 |
T5974 |
pobj |
target,as |
R3590 |
T5977 |
T5976 |
amod |
direct,target |
R3591 |
T5978 |
T5976 |
prep |
of,target |
R3592 |
T5979 |
T5980 |
nmod |
TCF,β |
R3593 |
T5980 |
T5982 |
nmod |
β,transcription |
R3594 |
T5981 |
T5980 |
punct |
/,β |
R3595 |
T5982 |
T5978 |
pobj |
transcription,of |
R3596 |
T5983 |
T5980 |
punct |
-,β |
R3597 |
T5984 |
T5980 |
appos |
catenin,β |
R3598 |
T5985 |
T5986 |
punct |
[,26 |
R3599 |
T5986 |
T5954 |
parataxis |
26,was |
R3600 |
T5987 |
T5986 |
punct |
],26 |
R3601 |
T5988 |
T5954 |
punct |
.,was |
R3602 |
T5990 |
T5991 |
nsubj |
This,said |
R3603 |
T5991 |
T5992 |
advcl |
said,detect |
R3604 |
T5993 |
T5992 |
punct |
", ",detect |
R3605 |
T5994 |
T5992 |
nsubj |
we,detect |
R3606 |
T5995 |
T5992 |
aux |
did,detect |
R3607 |
T5996 |
T5992 |
neg |
not,detect |
R3608 |
T5997 |
T5998 |
amod |
nuclear,catenin |
R3609 |
T5998 |
T5992 |
dobj |
catenin,detect |
R3610 |
T5999 |
T5998 |
compound |
β,catenin |
R3611 |
T6000 |
T5998 |
punct |
-,catenin |
R3612 |
T6001 |
T5992 |
prep |
in,detect |
R3613 |
T6002 |
T6003 |
poss |
our,epidermis |
R3614 |
T6003 |
T6001 |
pobj |
epidermis,in |
R3615 |
T6004 |
T6003 |
compound |
Tg,epidermis |
R3616 |
T6005 |
T5992 |
punct |
", ",detect |
R3617 |
T6006 |
T5992 |
cc |
and,detect |
R3618 |
T6007 |
T6008 |
csubj |
mating,gave |
R3619 |
T6008 |
T5992 |
conj |
gave,detect |
R3620 |
T6009 |
T6010 |
det |
the,mice |
R3621 |
T6010 |
T6007 |
dobj |
mice,mating |
R3622 |
T6011 |
T6010 |
compound |
Snail,mice |
R3623 |
T6012 |
T6010 |
compound |
Tg,mice |
R3624 |
T6013 |
T6007 |
prep |
against,mating |
R3625 |
T6014 |
T6015 |
det |
the,mouse |
R3626 |
T6015 |
T6013 |
pobj |
mouse,against |
R3627 |
T6016 |
T6015 |
compound |
TOPGal,mouse |
R3628 |
T6017 |
T6015 |
compound |
reporter,mouse |
R3629 |
T6018 |
T6019 |
punct |
[,20 |
R3630 |
T6019 |
T6007 |
parataxis |
20,mating |
R3631 |
T6020 |
T6019 |
punct |
],20 |
R3632 |
T6021 |
T6022 |
det |
no,signs |
R3633 |
T6022 |
T6008 |
dobj |
signs,gave |
R3634 |
T6023 |
T6022 |
prep |
of,signs |
R3635 |
T6024 |
T6025 |
amod |
ectopic,activity |
R3636 |
T6025 |
T6023 |
pobj |
activity,of |
R3637 |
T6026 |
T6025 |
nmod |
LEF,activity |
R3638 |
T6027 |
T6026 |
punct |
-,LEF |
R3639 |
T6028 |
T6026 |
nummod |
1,LEF |
R3640 |
T6029 |
T6026 |
punct |
/,LEF |
R3641 |
T6030 |
T6026 |
appos |
Tcf,LEF |
R3642 |
T6031 |
T6026 |
punct |
/,LEF |
R3643 |
T6032 |
T6033 |
compound |
β,catenin |
R3644 |
T6033 |
T6026 |
appos |
catenin,LEF |
R3645 |
T6034 |
T6033 |
punct |
-,catenin |
R3646 |
T6035 |
T6036 |
punct |
(,data |
R3647 |
T6036 |
T6008 |
meta |
data,gave |
R3648 |
T6037 |
T6036 |
amod |
unpublished,data |
R3649 |
T6038 |
T6036 |
punct |
),data |
R3650 |
T6039 |
T5992 |
punct |
.,detect |
R3651 |
T6041 |
T6042 |
nsubj |
We,turned |
R3652 |
T6043 |
T6042 |
advmod |
next,turned |
R3653 |
T6044 |
T6042 |
prep |
to,turned |
R3654 |
T6045 |
T6046 |
det |
the,presence |
R3655 |
T6093 |
T6091 |
nummod |
2,protein |
R3656 |
T6046 |
T6044 |
pobj |
presence,to |
R3657 |
T6094 |
T6091 |
punct |
(,protein |
R3658 |
T6095 |
T6091 |
appos |
Grb,protein |
R3659 |
T6047 |
T6046 |
prep |
of,presence |
R3660 |
T6096 |
T6095 |
punct |
-,Grb |
R3661 |
T6097 |
T6095 |
nummod |
2,Grb |
R3662 |
T6048 |
T6049 |
amod |
cytoplasmic,Ajuba |
R3663 |
T6098 |
T6091 |
punct |
),protein |
R3664 |
T6099 |
T6091 |
punct |
/,protein |
R3665 |
T6100 |
T6091 |
appos |
son,protein |
R3666 |
T6049 |
T6047 |
pobj |
Ajuba,of |
R3667 |
T6101 |
T6100 |
prep |
of,son |
R3668 |
T6102 |
T6101 |
pobj |
sevenless,of |
R3669 |
T6103 |
T6100 |
punct |
(,son |
R3670 |
T6050 |
T6042 |
prep |
for,turned |
R3671 |
T6104 |
T6100 |
appos |
Sos,son |
R3672 |
T6105 |
T6091 |
punct |
),protein |
R3673 |
T6106 |
T6091 |
punct |
", ",protein |
R3674 |
T6051 |
T6052 |
det |
a,link |
R3675 |
T6107 |
T6108 |
det |
the,factor |
R3676 |
T6108 |
T6091 |
appos |
factor,protein |
R3677 |
T6109 |
T6108 |
compound |
nucleotide,factor |
R3678 |
T6052 |
T6050 |
pobj |
link,for |
R3679 |
T6110 |
T6108 |
compound |
exchange,factor |
R3680 |
T6111 |
T6108 |
prep |
for,factor |
R3681 |
T6112 |
T6111 |
pobj |
Ras,for |
R3682 |
T6053 |
T6052 |
amod |
possible,link |
R3683 |
T6113 |
T6112 |
punct |
", ",Ras |
R3684 |
T6114 |
T6115 |
dep |
which,is |
R3685 |
T6115 |
T6112 |
relcl |
is,Ras |
R3686 |
T6054 |
T6052 |
amod |
mechanistic,link |
R3687 |
T6116 |
T6115 |
advmod |
upstream,is |
R3688 |
T6117 |
T6116 |
prep |
from,upstream |
R3689 |
T6118 |
T6117 |
pobj |
activation,from |
R3690 |
T6119 |
T6118 |
prep |
of,activation |
R3691 |
T6055 |
T6052 |
prep |
to,link |
R3694 |
T6056 |
T6057 |
det |
the,increase |
R3695 |
T6122 |
T6067 |
parataxis |
9,associate |
R3696 |
T6123 |
T6122 |
punct |
],9 |
R3697 |
T6124 |
T6067 |
punct |
.,associate |
R3698 |
T6057 |
T6055 |
pobj |
increase,to |
R3699 |
T6126 |
T6127 |
prep |
Given,examined |
R3700 |
T6058 |
T6057 |
amod |
proliferative,increase |
R3701 |
T6128 |
T6129 |
det |
the,increase |
R3702 |
T6129 |
T6126 |
pobj |
increase,Given |
R3703 |
T6130 |
T6129 |
prep |
in,increase |
R3704 |
T6131 |
T6132 |
compound |
pMAPK,staining |
R3705 |
T6059 |
T6057 |
prep |
in,increase |
R3706 |
T6132 |
T6130 |
pobj |
staining,in |
R3707 |
T6060 |
T6061 |
poss |
our,epidermis |
R3708 |
T6133 |
T6129 |
prep |
in,increase |
R3709 |
T6134 |
T6135 |
compound |
Tg,skin |
R3710 |
T6061 |
T6059 |
pobj |
epidermis,in |
R3711 |
T6135 |
T6133 |
pobj |
skin,in |
R3712 |
T6136 |
T6127 |
punct |
", ",examined |
R3713 |
T6137 |
T6127 |
nsubj |
we,examined |
R3714 |
T6062 |
T6061 |
compound |
Snail,epidermis |
R3715 |
T6138 |
T6139 |
det |
the,possibility |
R3716 |
T6139 |
T6127 |
dobj |
possibility,examined |
R3717 |
T6140 |
T6141 |
mark |
that,changed |
R3718 |
T6063 |
T6061 |
compound |
Tg,epidermis |
R3719 |
T6141 |
T6139 |
acl |
changed,possibility |
R3720 |
T6142 |
T6141 |
nsubj |
Ajuba,changed |
R3721 |
T6143 |
T6141 |
aux |
might,changed |
R3722 |
T6064 |
T6042 |
punct |
.,turned |
R3723 |
T6144 |
T6141 |
aux |
have,changed |
R3724 |
T6145 |
T6146 |
poss |
its,partner |
R3725 |
T6146 |
T6141 |
dobj |
partner,changed |
R3726 |
T6066 |
T6067 |
prep |
In,associate |
R3727 |
T6147 |
T6146 |
compound |
binding,partner |
R3728 |
T6148 |
T6141 |
prep |
in,changed |
R3729 |
T6149 |
T6150 |
npadvmod |
Snail,expressing |
R3730 |
T6150 |
T6152 |
amod |
expressing,epidermis |
R3731 |
T6151 |
T6150 |
punct |
-,expressing |
R3732 |
T6068 |
T6066 |
pobj |
addition,In |
R3733 |
T6152 |
T6148 |
pobj |
epidermis,in |
R3734 |
T6153 |
T6127 |
punct |
.,examined |
R3735 |
T6155 |
T6156 |
advmod |
Interestingly,detected |
R3736 |
T6069 |
T6068 |
prep |
to,addition |
R3737 |
T6157 |
T6156 |
punct |
", ",detected |
R3738 |
T6070 |
T6071 |
poss |
its,ability |
R3739 |
T6158 |
T6156 |
nsubjpass |
Ajuba,detected |
R3740 |
T6159 |
T6156 |
auxpass |
was,detected |
R3741 |
T6160 |
T6156 |
advmod |
readily,detected |
R3742 |
T6071 |
T6069 |
pobj |
ability,to |
R3743 |
T6161 |
T6156 |
prep |
in,detected |
R3744 |
T6162 |
T6163 |
amod |
anti-Grb,immunoprecipitates |
R3745 |
T6163 |
T6161 |
pobj |
immunoprecipitates,in |
R3746 |
T6072 |
T6071 |
amod |
documented,ability |
R3747 |
T6164 |
T6162 |
punct |
-,anti-Grb |
R3748 |
T6165 |
T6162 |
advmod |
2,anti-Grb |
R3749 |
T6073 |
T6074 |
aux |
to,bind |
R3750 |
T6166 |
T6163 |
prep |
of,immunoprecipitates |
R3751 |
T6167 |
T6168 |
compound |
protein,lysates |
R3752 |
T6168 |
T6166 |
pobj |
lysates,of |
R3753 |
T6074 |
T6071 |
acl |
bind,ability |
R3754 |
T6169 |
T6168 |
prep |
from,lysates |
R3755 |
T6170 |
T6169 |
pobj |
skins,from |
R3756 |
T6171 |
T6170 |
prep |
of,skins |
R3757 |
T6075 |
T6076 |
compound |
α,catenin |
R3758 |
T6172 |
T6173 |
compound |
Snail,mice |
R3759 |
T6173 |
T6171 |
pobj |
mice,of |
R3760 |
T6076 |
T6074 |
dobj |
catenin,bind |
R3761 |
T6174 |
T6173 |
compound |
Tg,mice |
R3762 |
T6175 |
T6169 |
cc |
but,from |
R3763 |
T6176 |
T6175 |
neg |
not,but |
R3764 |
T6077 |
T6076 |
punct |
-,catenin |
R3765 |
T6177 |
T6169 |
conj |
from,from |
R3766 |
T6178 |
T6179 |
det |
the,animals |
R3767 |
T6078 |
T6079 |
punct |
[,10 |
R3768 |
T6179 |
T6177 |
pobj |
animals,from |
R3769 |
T6180 |
T6179 |
amod |
corresponding,animals |
R3770 |
T6181 |
T6182 |
amod |
wild,type |
R3771 |
T6079 |
T6068 |
parataxis |
10,addition |
R3772 |
T6182 |
T6179 |
nmod |
type,animals |
R3773 |
T6183 |
T6182 |
punct |
-,type |
R3774 |
T6184 |
T6182 |
punct |
(,type |
R3775 |
T6080 |
T6079 |
punct |
],10 |
R3776 |
T6185 |
T6182 |
appos |
WT,type |
R3777 |
T6186 |
T6179 |
punct |
),animals |
R3778 |
T6081 |
T6067 |
punct |
", ",associate |
R3779 |
T6187 |
T6188 |
punct |
(,4E |
R3780 |
T6188 |
T6156 |
parataxis |
4E,detected |
R3781 |
T6189 |
T6188 |
compound |
Figure,4E |
R3782 |
T6082 |
T6067 |
nsubj |
Ajuba,associate |
R3783 |
T6190 |
T6188 |
punct |
),4E |
R3784 |
T6191 |
T6156 |
punct |
.,detected |
R3785 |
T6083 |
T6067 |
aux |
can,associate |
R3786 |
T6193 |
T6194 |
advmod |
When,repeated |
R3787 |
T6194 |
T6198 |
advcl |
repeated,detected |
R3788 |
T6195 |
T6196 |
det |
these,experiments |
R3789 |
T6084 |
T6067 |
advmod |
also,associate |
R3790 |
T6196 |
T6194 |
nsubjpass |
experiments,repeated |
R3791 |
T6197 |
T6194 |
auxpass |
were,repeated |
R3792 |
T6085 |
T6067 |
prep |
with,associate |
R3793 |
T6086 |
T6087 |
compound |
growth,factor |
R3794 |
T6087 |
T6088 |
compound |
factor,receptor |
R3795 |
T6199 |
T6194 |
prep |
with,repeated |
R3796 |
T6088 |
T6089 |
npadvmod |
receptor,bound |
R3797 |
T6200 |
T6201 |
compound |
α,catenin |
R3798 |
T6201 |
T6203 |
npadvmod |
catenin,null |
R3799 |
T6202 |
T6201 |
punct |
-,catenin |
R3800 |
T6089 |
T6091 |
amod |
bound,protein |
R3801 |
T6203 |
T6205 |
amod |
null,epidermis |
R3802 |
T6204 |
T6203 |
punct |
-,null |
R3803 |
T6205 |
T6199 |
pobj |
epidermis,with |
R3804 |
T6090 |
T6089 |
punct |
-,bound |
R3805 |
T6206 |
T6198 |
punct |
", ",detected |
R3806 |
T6207 |
T6208 |
det |
a,association |
R3807 |
T6208 |
T6198 |
nsubjpass |
association,detected |
R3808 |
T6209 |
T6208 |
amod |
similar,association |
R3809 |
T6210 |
T6211 |
nmod |
Grb,Ajuba |
R3810 |
T6211 |
T6208 |
compound |
Ajuba,association |
R3811 |
T6091 |
T6085 |
pobj |
protein,with |
R3812 |
T6212 |
T6211 |
punct |
-,Ajuba |
R3813 |
T6213 |
T6211 |
nummod |
2,Ajuba |
R3814 |
T6214 |
T6211 |
punct |
-,Ajuba |
R3815 |
T6215 |
T6198 |
auxpass |
was,detected |
R3816 |
T6092 |
T6091 |
punct |
-,protein |
R3817 |
T6216 |
T6198 |
punct |
", ",detected |
R3818 |
T6217 |
T6198 |
cc |
and,detected |
R3819 |
T6218 |
T6219 |
advmod |
again,detected |
R3820 |
T6303 |
T6286 |
acomp |
relevant,is |
R3821 |
T6219 |
T6198 |
conj |
detected,detected |
R3822 |
T6220 |
T6219 |
punct |
", ",detected |
R3823 |
T6221 |
T6222 |
det |
this,interaction |
R3824 |
T6222 |
T6219 |
nsubjpass |
interaction,detected |
R3825 |
T6223 |
T6219 |
auxpass |
was,detected |
R3826 |
T6304 |
T6303 |
prep |
to,relevant |
R3827 |
T6224 |
T6219 |
neg |
not,detected |
R3828 |
T6225 |
T6219 |
prep |
in,detected |
R3829 |
T6226 |
T6227 |
det |
the,extracts |
R3830 |
T6227 |
T6225 |
pobj |
extracts,in |
R3831 |
T6305 |
T6306 |
det |
the,state |
R3832 |
T6228 |
T6227 |
compound |
protein,extracts |
R3833 |
T6229 |
T6227 |
prep |
from,extracts |
R3834 |
T6230 |
T6231 |
compound |
control,skin |
R3835 |
T6306 |
T6304 |
pobj |
state,to |
R3836 |
T6231 |
T6229 |
pobj |
skin,from |
R3837 |
T6232 |
T6231 |
compound |
littermate,skin |
R3838 |
T6233 |
T6234 |
punct |
(,4E |
R3839 |
T6307 |
T6306 |
amod |
hyperproliferative,state |
R3840 |
T6234 |
T6219 |
parataxis |
4E,detected |
R3841 |
T6235 |
T6234 |
compound |
Figure,4E |
R3842 |
T6236 |
T6234 |
punct |
),4E |
R3843 |
T6308 |
T6306 |
prep |
of,state |
R3844 |
T6237 |
T6198 |
punct |
.,detected |
R3845 |
T6239 |
T6240 |
advmod |
Together,demonstrate |
R3846 |
T6309 |
T6310 |
det |
a,keratinocyte |
R3847 |
T6241 |
T6240 |
punct |
", ",demonstrate |
R3848 |
T6242 |
T6243 |
det |
these,data |
R3849 |
T6243 |
T6240 |
nsubj |
data,demonstrate |
R3850 |
T6310 |
T6308 |
pobj |
keratinocyte,of |
R3851 |
T6244 |
T6245 |
mark |
that,allows |
R3852 |
T6311 |
T6301 |
punct |
", ",expected |
R3853 |
T6245 |
T6240 |
ccomp |
allows,demonstrate |
R3854 |
T6246 |
T6247 |
det |
the,reduction |
R3855 |
T6312 |
T6301 |
advmod |
then,expected |
R3856 |
T6247 |
T6245 |
nsubj |
reduction,allows |
R3857 |
T6248 |
T6247 |
prep |
in,reduction |
R3858 |
T6249 |
T6250 |
compound |
α,catenin |
R3859 |
T6250 |
T6252 |
compound |
catenin,levels |
R3860 |
T6251 |
T6250 |
punct |
-,catenin |
R3861 |
T6252 |
T6248 |
pobj |
levels,in |
R3862 |
T6253 |
T6247 |
punct |
", ",reduction |
R3863 |
T6313 |
T6301 |
nsubjpass |
overexpression,expected |
R3864 |
T6254 |
T6255 |
preconj |
either,by |
R3865 |
T6255 |
T6247 |
prep |
by,reduction |
R3866 |
T6256 |
T6257 |
npadvmod |
Snail,mediated |
R3867 |
T6314 |
T6313 |
prep |
of,overexpression |
R3868 |
T6257 |
T6259 |
amod |
mediated,regulation |
R3869 |
T6258 |
T6257 |
punct |
-,mediated |
R3870 |
T6259 |
T6255 |
pobj |
regulation,by |
R3871 |
T6315 |
T6314 |
pobj |
Ajuba,of |
R3872 |
T6260 |
T6259 |
amod |
down,regulation |
R3873 |
T6261 |
T6259 |
punct |
-,regulation |
R3874 |
T6262 |
T6259 |
prep |
of,regulation |
R3875 |
T6316 |
T6301 |
aux |
would,expected |
R3876 |
T6263 |
T6264 |
compound |
E,cadherin |
R3877 |
T6264 |
T6262 |
pobj |
cadherin,of |
R3878 |
T6265 |
T6264 |
punct |
-,cadherin |
R3880 |
T6266 |
T6255 |
cc |
or,by |
R3881 |
T6267 |
T6255 |
conj |
by,by |
R3882 |
T6268 |
T6269 |
compound |
α,catenin |
R3883 |
T6318 |
T6319 |
aux |
to,bypass |
R3884 |
T6269 |
T6271 |
npadvmod |
catenin,conditional |
R3885 |
T6270 |
T6269 |
punct |
-,catenin |
R3886 |
T6271 |
T6272 |
amod |
conditional,targeting |
R3887 |
T6319 |
T6301 |
xcomp |
bypass,expected |
R3888 |
T6272 |
T6267 |
pobj |
targeting,by |
R3889 |
T6273 |
T6245 |
punct |
", ",allows |
R3890 |
T6274 |
T6275 |
nsubj |
Ajuba,interact |
R3891 |
T6320 |
T6321 |
det |
the,competition |
R3892 |
T6275 |
T6245 |
ccomp |
interact,allows |
R3893 |
T6276 |
T6275 |
aux |
to,interact |
R3894 |
T6277 |
T6275 |
prep |
with,interact |
R3895 |
T6321 |
T6319 |
dobj |
competition,bypass |
R3896 |
T6278 |
T6277 |
pobj |
Grb,with |
R3897 |
T6279 |
T6278 |
punct |
-,Grb |
R3898 |
T6280 |
T6278 |
nummod |
2,Grb |
R3899 |
T6281 |
T6278 |
punct |
/,Grb |
R3900 |
T6322 |
T6319 |
cc |
and,bypass |
R3901 |
T6282 |
T6278 |
appos |
Sos,Grb |
R3902 |
T6283 |
T6240 |
punct |
.,demonstrate |
R3903 |
T6323 |
T6319 |
conj |
promote,bypass |
R3904 |
T6285 |
T6286 |
mark |
If,is |
R3905 |
T6286 |
T6301 |
advcl |
is,expected |
R3906 |
T6287 |
T6288 |
det |
the,competition |
R3907 |
T6324 |
T6323 |
dobj |
activation,promote |
R3908 |
T6288 |
T6286 |
nsubj |
competition,is |
R3909 |
T6289 |
T6288 |
prep |
between,competition |
R3910 |
T6290 |
T6289 |
pobj |
Grb,between |
R3911 |
T6291 |
T6290 |
punct |
-,Grb |
R3912 |
T6292 |
T6290 |
nummod |
2,Grb |
R3913 |
T6293 |
T6290 |
punct |
/,Grb |
R3914 |
T6294 |
T6290 |
appos |
Sos,Grb |
R3915 |
T6325 |
T6324 |
prep |
of,activation |
R3916 |
T6295 |
T6290 |
cc |
and,Grb |
R3917 |
T6296 |
T6297 |
compound |
α,catenin |
R3918 |
T6297 |
T6290 |
conj |
catenin,Grb |
R3919 |
T6326 |
T6327 |
det |
the,pathway |
R3920 |
T6298 |
T6297 |
punct |
-,catenin |
R3921 |
T6299 |
T6288 |
prep |
for,competition |
R3922 |
T6300 |
T6299 |
pobj |
Ajuba,for |
R3923 |
T6327 |
T6325 |
pobj |
pathway,of |
R3924 |
T6302 |
T6303 |
advmod |
functionally,relevant |
R3925 |
T6328 |
T6329 |
compound |
Ras,MAPK |
R3926 |
T6329 |
T6327 |
compound |
MAPK,pathway |
R3927 |
T6330 |
T6329 |
punct |
-,MAPK |
R3928 |
T6331 |
T6324 |
prep |
in,activation |
R3929 |
T6409 |
T6407 |
oprd |
inh,marked |
R3930 |
T6410 |
T6405 |
punct |
”,see |
R3931 |
T6332 |
T6333 |
compound |
WT,keratinocytes |
R3932 |
T6411 |
T6402 |
punct |
),4F |
R3933 |
T6412 |
T6413 |
punct |
[,27 |
R3934 |
T6413 |
T6380 |
parataxis |
27,abolished |
R3935 |
T6333 |
T6331 |
pobj |
keratinocytes,in |
R3936 |
T6414 |
T6413 |
punct |
],27 |
R3937 |
T6415 |
T6380 |
punct |
.,abolished |
R3938 |
T6334 |
T6301 |
punct |
.,expected |
R3939 |
T6417 |
T6418 |
poss |
Ajuba,domain |
R3940 |
T6418 |
T6421 |
nsubj |
domain,is |
R3941 |
T6419 |
T6417 |
case |
's,Ajuba |
R3942 |
T6336 |
T6337 |
advmod |
Indeed,were |
R3943 |
T6420 |
T6418 |
amod |
pre-LIM,domain |
R3944 |
T6422 |
T6423 |
det |
the,segment |
R3945 |
T6423 |
T6421 |
attr |
segment,is |
R3946 |
T6338 |
T6337 |
punct |
", ",were |
R3947 |
T6424 |
T6425 |
dep |
that,associates |
R3948 |
T6339 |
T6340 |
advmod |
when,transfected |
R3949 |
T6425 |
T6423 |
relcl |
associates,segment |
R3950 |
T6426 |
T6425 |
prep |
with,associates |
R3951 |
T6340 |
T6337 |
advcl |
transfected,were |
R3952 |
T6427 |
T6428 |
poss |
Grb,domain |
R3953 |
T6428 |
T6426 |
pobj |
domain,with |
R3954 |
T6429 |
T6427 |
punct |
-,Grb |
R3955 |
T6341 |
T6342 |
npadvmod |
serum,starved |
R3956 |
T6430 |
T6427 |
nummod |
2,Grb |
R3957 |
T6431 |
T6427 |
case |
's,Grb |
R3958 |
T6432 |
T6433 |
nmod |
Src,homology |
R3959 |
T6433 |
T6428 |
nmod |
homology,domain |
R3960 |
T6342 |
T6344 |
amod |
starved,keratinocytes |
R3961 |
T6434 |
T6433 |
punct |
-,homology |
R3962 |
T6435 |
T6433 |
nummod |
3,homology |
R3963 |
T6436 |
T6437 |
punct |
[,9 |
R3964 |
T6437 |
T6421 |
parataxis |
9,is |
R3965 |
T6438 |
T6437 |
punct |
],9 |
R3966 |
T6439 |
T6421 |
punct |
.,is |
R3967 |
T6343 |
T6342 |
punct |
-,starved |
R3968 |
T6441 |
T6442 |
advmod |
When,overexpressed |
R3969 |
T6442 |
T6446 |
advcl |
overexpressed,observed |
R3970 |
T6344 |
T6340 |
nsubjpass |
keratinocytes,transfected |
R3971 |
T6443 |
T6444 |
det |
this,domain |
R3972 |
T6444 |
T6442 |
nsubjpass |
domain,overexpressed |
R3973 |
T6445 |
T6442 |
auxpass |
was,overexpressed |
R3974 |
T6345 |
T6340 |
auxpass |
were,transfected |
R3975 |
T6447 |
T6442 |
prep |
in,overexpressed |
R3976 |
T6448 |
T6449 |
npadvmod |
serum,starved |
R3977 |
T6346 |
T6340 |
advmod |
transiently,transfected |
R3978 |
T6449 |
T6451 |
amod |
starved,keratinocytes |
R3979 |
T6450 |
T6449 |
punct |
-,starved |
R3980 |
T6451 |
T6447 |
pobj |
keratinocytes,in |
R3981 |
T6347 |
T6340 |
prep |
with,transfected |
R3982 |
T6452 |
T6446 |
punct |
", ",observed |
R3983 |
T6453 |
T6454 |
det |
a,elevation |
R3984 |
T6454 |
T6446 |
nsubjpass |
elevation,observed |
R3985 |
T6348 |
T6349 |
det |
an,vector |
R3986 |
T6455 |
T6454 |
amod |
comparable,elevation |
R3987 |
T6456 |
T6454 |
prep |
in,elevation |
R3988 |
T6457 |
T6456 |
pobj |
pMAPK,in |
R3989 |
T6458 |
T6446 |
auxpass |
was,observed |
R3990 |
T6349 |
T6347 |
pobj |
vector,with |
R3991 |
T6459 |
T6460 |
punct |
(,4F |
R3992 |
T6460 |
T6446 |
parataxis |
4F,observed |
R3993 |
T6461 |
T6460 |
compound |
Figure,4F |
R3994 |
T6350 |
T6351 |
compound |
Ajuba,expression |
R3995 |
T6462 |
T6460 |
punct |
),4F |
R3996 |
T6463 |
T6446 |
punct |
.,observed |
R3997 |
T6351 |
T6349 |
compound |
expression,vector |
R3998 |
T6465 |
T6466 |
mark |
As,expected |
R3999 |
T6466 |
T6467 |
advcl |
expected,blocked |
R4000 |
T6352 |
T6337 |
punct |
", ",were |
R4001 |
T6468 |
T6467 |
punct |
", ",blocked |
R4002 |
T6469 |
T6470 |
det |
the,inhibitor |
R4003 |
T6470 |
T6467 |
nsubj |
inhibitor,blocked |
R4004 |
T6471 |
T6470 |
amod |
small,inhibitor |
R4005 |
T6353 |
T6354 |
det |
the,levels |
R4006 |
T6472 |
T6470 |
compound |
peptide,inhibitor |
R4007 |
T6473 |
T6474 |
dep |
that,interrupts |
R4008 |
T6474 |
T6470 |
relcl |
interrupts,inhibitor |
R4009 |
T6354 |
T6337 |
nsubj |
levels,were |
R4010 |
T6475 |
T6476 |
det |
the,association |
R4011 |
T6476 |
T6474 |
dobj |
association,interrupts |
R4012 |
T6477 |
T6476 |
nmod |
Grb,association |
R4013 |
T6478 |
T6477 |
punct |
-,Grb |
R4014 |
T6479 |
T6477 |
nummod |
2,Grb |
R4015 |
T6355 |
T6354 |
prep |
of,levels |
R4016 |
T6480 |
T6477 |
punct |
/,Grb |
R4017 |
T6481 |
T6477 |
appos |
Sos,Grb |
R4018 |
T6482 |
T6483 |
det |
the,effects |
R4019 |
T6483 |
T6467 |
dobj |
effects,blocked |
R4020 |
T6356 |
T6355 |
pobj |
pMAPK,of |
R4021 |
T6484 |
T6467 |
punct |
.,blocked |
R4022 |
T6486 |
T6487 |
det |
These,data |
R4023 |
T6357 |
T6358 |
preconj |
not,elevated |
R4024 |
T6487 |
T6488 |
nsubj |
data,suggested |
R4025 |
T6489 |
T6490 |
mark |
that,associate |
R4026 |
T6358 |
T6337 |
acomp |
elevated,were |
R4027 |
T6490 |
T6488 |
ccomp |
associate,suggested |
R4028 |
T6491 |
T6490 |
prep |
by,associate |
R4029 |
T6492 |
T6491 |
pcomp |
elevating,by |
R4030 |
T6493 |
T6494 |
amod |
cytosolic,levels |
R4031 |
T6359 |
T6357 |
advmod |
only,not |
R4032 |
T6494 |
T6492 |
dobj |
levels,elevating |
R4033 |
T6495 |
T6494 |
compound |
Ajuba,levels |
R4034 |
T6496 |
T6490 |
punct |
", ",associate |
R4035 |
T6360 |
T6358 |
cc |
but,elevated |
R4036 |
T6497 |
T6498 |
poss |
Ajuba,domain |
R4037 |
T6498 |
T6490 |
nsubj |
domain,associate |
R4038 |
T6499 |
T6497 |
case |
's,Ajuba |
R4039 |
T6500 |
T6498 |
amod |
pre-LIM,domain |
R4040 |
T6361 |
T6360 |
advmod |
also,but |
R4041 |
T6501 |
T6490 |
aux |
may,associate |
R4042 |
T6502 |
T6490 |
prep |
with,associate |
R4043 |
T6503 |
T6502 |
pobj |
Grb,with |
R4044 |
T6362 |
T6358 |
conj |
comparable,elevated |
R4045 |
T6504 |
T6503 |
punct |
-,Grb |
R4046 |
T6505 |
T6503 |
nummod |
2,Grb |
R4047 |
T6506 |
T6503 |
punct |
/,Grb |
R4048 |
T6363 |
T6362 |
prep |
to,comparable |
R4049 |
T6507 |
T6503 |
appos |
Sos,Grb |
R4050 |
T6508 |
T6490 |
prep |
in,associate |
R4051 |
T6509 |
T6510 |
det |
a,manner |
R4052 |
T6364 |
T6363 |
pobj |
those,to |
R4053 |
T6510 |
T6508 |
pobj |
manner,in |
R4054 |
T6511 |
T6512 |
dep |
that,stimulates |
R4055 |
T6365 |
T6364 |
acl |
transfected,those |
R4056 |
T6512 |
T6510 |
relcl |
stimulates,manner |
R4057 |
T6513 |
T6514 |
poss |
its,activity |
R4058 |
T6366 |
T6365 |
prep |
with,transfected |
R4059 |
T6367 |
T6368 |
det |
the,transgene |
R4060 |
T6368 |
T6366 |
pobj |
transgene,with |
R4061 |
T6514 |
T6512 |
dobj |
activity,stimulates |
R4062 |
T6515 |
T6514 |
compound |
nucleotide,activity |
R4063 |
T6516 |
T6514 |
compound |
exchange,activity |
R4064 |
T6369 |
T6370 |
compound |
K14,HASnail |
R4065 |
T6517 |
T6512 |
cc |
and,stimulates |
R4066 |
T6518 |
T6512 |
conj |
leads,stimulates |
R4067 |
T6370 |
T6368 |
compound |
HASnail,transgene |
R4068 |
T6519 |
T6518 |
prep |
to,leads |
R4069 |
T6520 |
T6519 |
pobj |
activation,to |
R4070 |
T6521 |
T6520 |
prep |
of,activation |
R4071 |
T6371 |
T6370 |
punct |
-,HASnail |
R4073 |
T6523 |
T6521 |
pobj |
pathway,of |
R4074 |
T6524 |
T6525 |
compound |
Ras,MAPK |
R4075 |
T6372 |
T6373 |
punct |
(,4F |
R4076 |
T6525 |
T6523 |
compound |
MAPK,pathway |
R4077 |
T6526 |
T6525 |
punct |
-,MAPK |
R4078 |
T6527 |
T6488 |
punct |
.,suggested |
R4079 |
T6373 |
T6337 |
parataxis |
4F,were |
R4080 |
T6529 |
T6530 |
mark |
Although,provides |
R4082 |
T6374 |
T6373 |
compound |
Figure,4F |
R4083 |
T6531 |
T6532 |
det |
this,pathway |
R4084 |
T6532 |
T6530 |
nsubj |
pathway,provides |
R4085 |
T6375 |
T6373 |
punct |
),4F |
R4086 |
T6534 |
T6535 |
nummod |
one,mechanism |
R4087 |
T6535 |
T6530 |
dobj |
mechanism,provides |
R4088 |
T6536 |
T6537 |
prep |
by,coupled |
R4089 |
T6537 |
T6535 |
relcl |
coupled,mechanism |
R4090 |
T6376 |
T6337 |
punct |
.,were |
R4091 |
T6538 |
T6536 |
pobj |
which,by |
R4092 |
T6539 |
T6540 |
compound |
Snail,expression |
R4093 |
T6540 |
T6537 |
nsubjpass |
expression,coupled |
R4094 |
T6378 |
T6379 |
det |
This,activation |
R4095 |
T6541 |
T6540 |
cc |
and,expression |
R4096 |
T6542 |
T6540 |
conj |
proliferation,expression |
R4097 |
T6543 |
T6537 |
aux |
may,coupled |
R4098 |
T6544 |
T6537 |
auxpass |
be,coupled |
R4099 |
T6379 |
T6380 |
nsubjpass |
activation,abolished |
R4100 |
T6545 |
T6537 |
prep |
in,coupled |
R4101 |
T6546 |
T6547 |
compound |
skin,epithelium |
R4102 |
T6547 |
T6545 |
pobj |
epithelium,in |
R4103 |
T6381 |
T6380 |
auxpass |
was,abolished |
R4104 |
T6548 |
T6533 |
punct |
", ",known |
R4105 |
T6549 |
T6550 |
amod |
proliferative,circuitries |
R4106 |
T6550 |
T6533 |
nsubjpass |
circuitries,known |
R4107 |
T6551 |
T6550 |
acl |
involving,circuitries |
R4108 |
T6382 |
T6383 |
advmod |
when,treated |
R4109 |
T6552 |
T6551 |
dobj |
AJs,involving |
R4110 |
T6553 |
T6533 |
auxpass |
are,known |
R4111 |
T6554 |
T6555 |
aux |
to,be |
R4112 |
T6555 |
T6533 |
xcomp |
be,known |
R4113 |
T6383 |
T6380 |
advcl |
treated,abolished |
R4114 |
T6556 |
T6555 |
acomp |
complex,be |
R4115 |
T6557 |
T6556 |
cc |
and,complex |
R4116 |
T6558 |
T6559 |
advmod |
often,interwoven |
R4117 |
T6559 |
T6556 |
conj |
interwoven,complex |
R4118 |
T6560 |
T6533 |
punct |
.,known |
R4119 |
T6384 |
T6383 |
nsubjpass |
cells,treated |
R4120 |
T6562 |
T6563 |
amod |
Future,studies |
R4121 |
T6563 |
T6564 |
nsubjpass |
studies,needed |
R4122 |
T6385 |
T6383 |
auxpass |
were,treated |
R4123 |
T6565 |
T6564 |
aux |
will,needed |
R4124 |
T6566 |
T6564 |
auxpass |
be,needed |
R4125 |
T6567 |
T6568 |
aux |
to,dissect |
R4126 |
T6386 |
T6383 |
prep |
with,treated |
R4127 |
T6568 |
T6564 |
advcl |
dissect,needed |
R4128 |
T6569 |
T6568 |
advmod |
systematically,dissect |
R4129 |
T6570 |
T6571 |
det |
these,intricacies |
R4130 |
T6387 |
T6388 |
det |
a,inhibitor |
R4131 |
T6571 |
T6568 |
dobj |
intricacies,dissect |
R4132 |
T6572 |
T6571 |
amod |
putative,intricacies |
R4133 |
T6573 |
T6568 |
prep |
at,dissect |
R4134 |
T6388 |
T6386 |
pobj |
inhibitor,with |
R4135 |
T6574 |
T6575 |
det |
a,level |
R4136 |
T6575 |
T6573 |
pobj |
level,at |
R4137 |
T6576 |
T6575 |
amod |
molecular,level |
R4138 |
T6389 |
T6388 |
amod |
small,inhibitor |
R4139 |
T6577 |
T6564 |
punct |
.,needed |
R4140 |
T6390 |
T6388 |
compound |
peptide,inhibitor |
R4141 |
T6391 |
T6392 |
dep |
that,interrupts |
R4142 |
T6392 |
T6388 |
relcl |
interrupts,inhibitor |
R4143 |
T6393 |
T6392 |
advmod |
specifically,interrupts |
R4144 |
T6394 |
T6395 |
det |
the,interaction |
R4145 |
T6395 |
T6392 |
dobj |
interaction,interrupts |
R4146 |
T6396 |
T6395 |
nmod |
Grb,interaction |
R4147 |
T6397 |
T6396 |
punct |
-,Grb |
R4148 |
T6398 |
T6396 |
nummod |
2,Grb |
R4149 |
T6399 |
T6396 |
punct |
/,Grb |
R4150 |
T6400 |
T6396 |
appos |
Sos,Grb |
R4151 |
T6401 |
T6402 |
punct |
(,4F |
R4152 |
T6402 |
T6380 |
parataxis |
4F,abolished |
R4153 |
T6403 |
T6402 |
compound |
Figure,4F |
R4154 |
T6404 |
T6402 |
punct |
;,4F |
R4155 |
T6405 |
T6402 |
advcl |
see,4F |
R4156 |
T6406 |
T6405 |
dobj |
lanes,see |
R4157 |
T6407 |
T6406 |
acl |
marked,lanes |
R4158 |
T6408 |
T6409 |
punct |
“,inh |
R4172 |
T7354 |
T7355 |
csubj |
Probing,Reveals |
R4173 |
T7356 |
T7357 |
det |
the,Regulation |
R4174 |
T7357 |
T7354 |
dobj |
Regulation,Probing |
R4175 |
T7358 |
T7357 |
prep |
of,Regulation |
R4176 |
T7359 |
T7360 |
compound |
Snail,Gene |
R4177 |
T7360 |
T7361 |
compound |
Gene,Expression |
R4178 |
T7361 |
T7358 |
pobj |
Expression,of |
R4179 |
T7362 |
T7363 |
det |
an,Link |
R4180 |
T7363 |
T7355 |
dobj |
Link,Reveals |
R4181 |
T7364 |
T7363 |
amod |
Essential,Link |
R4182 |
T7365 |
T7363 |
prep |
to,Link |
R4183 |
T7366 |
T7367 |
compound |
TGF,β2 |
R4184 |
T7367 |
T7369 |
compound |
β2,Signaling |
R4185 |
T7368 |
T7367 |
punct |
-,β2 |
R4186 |
T7369 |
T7365 |
pobj |
Signaling,to |
R4187 |
T7370 |
T7355 |
prep |
in,Reveals |
R4188 |
T7371 |
T7372 |
det |
the,Bud |
R4189 |
T7372 |
T7370 |
pobj |
Bud,in |
R4190 |
T7373 |
T7372 |
amod |
Developing,Bud |
R4191 |
T7374 |
T7372 |
compound |
Hair,Bud |
R4192 |
T7376 |
T7377 |
det |
The,spike |
R4193 |
T7377 |
T7379 |
nsubj |
spike,prompted |
R4194 |
T7378 |
T7377 |
amod |
temporal,spike |
R4195 |
T7380 |
T7377 |
prep |
of,spike |
R4196 |
T7381 |
T7382 |
compound |
Snail,expression |
R4197 |
T7382 |
T7380 |
pobj |
expression,of |
R4198 |
T7383 |
T7382 |
compound |
mRNA,expression |
R4199 |
T7384 |
T7377 |
prep |
in,spike |
R4200 |
T7385 |
T7386 |
det |
the,bud |
R4201 |
T7386 |
T7384 |
pobj |
bud,in |
R4202 |
T7387 |
T7386 |
compound |
hair,bud |
R4203 |
T7388 |
T7379 |
dobj |
us,prompted |
R4204 |
T7389 |
T7390 |
aux |
to,consider |
R4205 |
T7390 |
T7379 |
xcomp |
consider,prompted |
R4206 |
T7391 |
T7392 |
det |
what,factor |
R4207 |
T7392 |
T7393 |
dep |
factor,regulating |
R4208 |
T7393 |
T7390 |
ccomp |
regulating,consider |
R4209 |
T7394 |
T7392 |
punct |
(,factor |
R4210 |
T7395 |
T7392 |
nmod |
s,factor |
R4211 |
T7396 |
T7392 |
punct |
),factor |
R4212 |
T7397 |
T7393 |
aux |
may,regulating |
R4213 |
T7398 |
T7393 |
aux |
be,regulating |
R4214 |
T7399 |
T7400 |
det |
the,gene |
R4215 |
T7400 |
T7393 |
dobj |
gene,regulating |
R4216 |
T7401 |
T7400 |
compound |
Snail,gene |
R4217 |
T7402 |
T7379 |
punct |
.,prompted |
R4218 |
T7404 |
T7405 |
det |
A,variety |
R4219 |
T7405 |
T7406 |
nsubj |
variety,have |
R4220 |
T7407 |
T7405 |
prep |
of,variety |
R4221 |
T7408 |
T7409 |
amod |
extracellular,signals |
R4222 |
T7409 |
T7407 |
pobj |
signals,of |
R4223 |
T7410 |
T7411 |
det |
an,impact |
R4224 |
T7411 |
T7406 |
dobj |
impact,have |
R4225 |
T7412 |
T7411 |
prep |
on,impact |
R4226 |
T7413 |
T7414 |
det |
the,expression |
R4227 |
T7414 |
T7412 |
pobj |
expression,on |
R4228 |
T7415 |
T7416 |
compound |
cell,type |
R4229 |
T7416 |
T7417 |
npadvmod |
type,specific |
R4230 |
T7417 |
T7414 |
amod |
specific,expression |
R4231 |
T7418 |
T7417 |
punct |
-,specific |
R4232 |
T7419 |
T7414 |
prep |
of,expression |
R4233 |
T7420 |
T7421 |
amod |
different,members |
R4234 |
T7421 |
T7419 |
pobj |
members,of |
R4235 |
T7422 |
T7423 |
compound |
Snail,family |
R4236 |
T7423 |
T7421 |
compound |
family,members |
R4237 |
T7424 |
T7406 |
punct |
", ",have |
R4238 |
T7425 |
T7406 |
cc |
and,have |
R4239 |
T7426 |
T7427 |
nsubj |
many,affect |
R4240 |
T7427 |
T7406 |
conj |
affect,have |
R4241 |
T7428 |
T7426 |
prep |
of,many |
R4242 |
T7429 |
T7428 |
pobj |
them,of |
R4243 |
T7430 |
T7426 |
punct |
", ",many |
R4244 |
T7431 |
T7426 |
prep |
including,many |
R4245 |
T7432 |
T7431 |
pobj |
Wnts,including |
R4246 |
T7433 |
T7432 |
punct |
", ",Wnts |
R4247 |
T7434 |
T7432 |
conj |
BMPs,Wnts |
R4248 |
T7435 |
T7434 |
punct |
", ",BMPs |
R4249 |
T7436 |
T7434 |
conj |
FGFs,BMPs |
R4250 |
T7437 |
T7436 |
punct |
", ",FGFs |
R4251 |
T7438 |
T7436 |
cc |
and,FGFs |
R4252 |
T7439 |
T7440 |
compound |
TGF,βs |
R4253 |
T7440 |
T7436 |
conj |
βs,FGFs |
R4254 |
T7441 |
T7440 |
punct |
-,βs |
R4255 |
T7442 |
T7427 |
punct |
", ",affect |
R4256 |
T7443 |
T7427 |
advmod |
also,affect |
R4257 |
T7444 |
T7445 |
compound |
hair,bud |
R4258 |
T7445 |
T7446 |
compound |
bud,development |
R4259 |
T7446 |
T7427 |
dobj |
development,affect |
R4260 |
T7447 |
T7448 |
punct |
[,28 |
R4261 |
T7448 |
T7427 |
parataxis |
28,affect |
R4262 |
T7449 |
T7448 |
nummod |
2,28 |
R4263 |
T7450 |
T7448 |
punct |
",",28 |
R4264 |
T7451 |
T7448 |
nummod |
16,28 |
R4265 |
T7452 |
T7448 |
punct |
",",28 |
R4266 |
T7453 |
T7448 |
punct |
],28 |
R4267 |
T7454 |
T7427 |
punct |
.,affect |
R4268 |
T7456 |
T7457 |
mark |
Since,expressed |
R4269 |
T7457 |
T7461 |
advcl |
expressed,focused |
R4270 |
T7458 |
T7457 |
nsubjpass |
Snail,expressed |
R4271 |
T7459 |
T7457 |
auxpass |
is,expressed |
R4272 |
T7460 |
T7457 |
neg |
not,expressed |
R4273 |
T7462 |
T7457 |
prep |
in,expressed |
R4274 |
T7463 |
T7464 |
amod |
cultured,keratinocytes |
R4275 |
T7464 |
T7462 |
pobj |
keratinocytes,in |
R4276 |
T7465 |
T7464 |
compound |
skin,keratinocytes |
R4277 |
T7466 |
T7467 |
dep |
that,secrete |
R4278 |
T7467 |
T7464 |
relcl |
secrete,keratinocytes |
R4279 |
T7468 |
T7469 |
amod |
active,BMPs |
R4280 |
T7469 |
T7467 |
dobj |
BMPs,secrete |
R4281 |
T7470 |
T7469 |
cc |
and,BMPs |
R4282 |
T7471 |
T7469 |
conj |
FGFs,BMPs |
R4283 |
T7472 |
T7473 |
punct |
(,see |
R4284 |
T7473 |
T7457 |
parataxis |
see,expressed |
R4285 |
T7474 |
T7475 |
compound |
Figure,1B |
R4286 |
T7475 |
T7473 |
dobj |
1B,see |
R4287 |
T7476 |
T7473 |
punct |
),see |
R4288 |
T7477 |
T7461 |
punct |
", ",focused |
R4289 |
T7478 |
T7461 |
nsubj |
we,focused |
R4290 |
T7479 |
T7480 |
poss |
our,attention |
R4291 |
T7480 |
T7461 |
dobj |
attention,focused |
R4292 |
T7481 |
T7461 |
prep |
on,focused |
R4293 |
T7482 |
T7483 |
nmod |
Wnt,signaling |
R4294 |
T7483 |
T7481 |
pobj |
signaling,on |
R4295 |
T7484 |
T7482 |
cc |
and,Wnt |
R4296 |
T7485 |
T7486 |
compound |
TGF,β |
R4297 |
T7486 |
T7482 |
conj |
β,Wnt |
R4298 |
T7487 |
T7486 |
punct |
-,β |
R4299 |
T7488 |
T7483 |
prep |
as,signaling |
R4300 |
T7489 |
T7490 |
advmod |
more,likely |
R4301 |
T7490 |
T7491 |
amod |
likely,candidates |
R4302 |
T7491 |
T7488 |
pobj |
candidates,as |
R4303 |
T7492 |
T7491 |
prep |
for,candidates |
R4304 |
T7493 |
T7494 |
compound |
Snail,induction |
R4305 |
T7494 |
T7492 |
pobj |
induction,for |
R4306 |
T7495 |
T7491 |
prep |
in,candidates |
R4307 |
T7496 |
T7497 |
det |
this,type |
R4308 |
T7497 |
T7495 |
pobj |
type,in |
R4309 |
T7498 |
T7497 |
compound |
cell,type |
R4310 |
T7499 |
T7461 |
punct |
.,focused |
R4311 |
T7501 |
T7502 |
advmod |
Previously,showed |
R4312 |
T7503 |
T7502 |
punct |
", ",showed |
R4313 |
T7504 |
T7502 |
nsubj |
we,showed |
R4314 |
T7505 |
T7506 |
mark |
that,achieved |
R4315 |
T7506 |
T7502 |
ccomp |
achieved,showed |
R4316 |
T7507 |
T7508 |
amod |
effective,transmission |
R4317 |
T7508 |
T7506 |
nsubjpass |
transmission,achieved |
R4318 |
T7509 |
T7508 |
prep |
of,transmission |
R4319 |
T7510 |
T7511 |
det |
a,signal |
R4320 |
T7511 |
T7509 |
pobj |
signal,of |
R4321 |
T7512 |
T7511 |
nmod |
Wnt,signal |
R4322 |
T7513 |
T7512 |
punct |
-,Wnt |
R4323 |
T7514 |
T7512 |
nummod |
3a,Wnt |
R4324 |
T7515 |
T7508 |
prep |
in,transmission |
R4325 |
T7516 |
T7517 |
amod |
cultured,keratinocytes |
R4326 |
T7517 |
T7515 |
pobj |
keratinocytes,in |
R4327 |
T7518 |
T7506 |
aux |
can,achieved |
R4328 |
T7519 |
T7506 |
auxpass |
be,achieved |
R4329 |
T7520 |
T7506 |
prep |
through,achieved |
R4330 |
T7521 |
T7522 |
poss |
their,exposure |
R4331 |
T7522 |
T7520 |
pobj |
exposure,through |
R4332 |
T7523 |
T7522 |
prep |
to,exposure |
R4333 |
T7524 |
T7525 |
det |
the,inhibitor |
R4334 |
T7525 |
T7523 |
pobj |
inhibitor,to |
R4335 |
T7526 |
T7525 |
compound |
BMP,inhibitor |
R4336 |
T7527 |
T7525 |
appos |
noggin,inhibitor |
R4337 |
T7528 |
T7525 |
punct |
", ",inhibitor |
R4338 |
T7529 |
T7530 |
dep |
which,induces |
R4339 |
T7530 |
T7525 |
relcl |
induces,inhibitor |
R4340 |
T7531 |
T7532 |
nmod |
LEF,expression |
R4341 |
T7532 |
T7530 |
dobj |
expression,induces |
R4342 |
T7533 |
T7531 |
punct |
-,LEF |
R4343 |
T7534 |
T7531 |
nummod |
1,LEF |
R4344 |
T7535 |
T7536 |
punct |
[,4 |
R4345 |
T7536 |
T7502 |
parataxis |
4,showed |
R4346 |
T7537 |
T7536 |
punct |
],4 |
R4347 |
T7538 |
T7502 |
punct |
.,showed |
R4348 |
T7540 |
T7541 |
advmod |
In,vitro |
R4349 |
T7541 |
T7542 |
advmod |
vitro,regulated |
R4350 |
T7543 |
T7542 |
punct |
", ",regulated |
R4351 |
T7544 |
T7545 |
det |
these,conditions |
R4352 |
T7545 |
T7542 |
nsubj |
conditions,regulated |
R4353 |
T7546 |
T7542 |
advmod |
down,regulated |
R4354 |
T7547 |
T7542 |
punct |
-,regulated |
R4355 |
T7548 |
T7549 |
det |
the,promoter |
R4356 |
T7549 |
T7542 |
dobj |
promoter,regulated |
R4357 |
T7550 |
T7551 |
compound |
E,cadherin |
R4358 |
T7551 |
T7549 |
compound |
cadherin,promoter |
R4359 |
T7552 |
T7551 |
punct |
-,cadherin |
R4360 |
T7553 |
T7542 |
cc |
and,regulated |
R4361 |
T7554 |
T7542 |
conj |
induced,regulated |
R4362 |
T7555 |
T7556 |
det |
a,gene |
R4363 |
T7556 |
T7554 |
dobj |
gene,induced |
R4364 |
T7557 |
T7558 |
npadvmod |
LEF,sensitive |
R4365 |
T7558 |
T7556 |
amod |
sensitive,gene |
R4366 |
T7559 |
T7557 |
punct |
-,LEF |
R4367 |
T7560 |
T7557 |
nummod |
1,LEF |
R4368 |
T7561 |
T7557 |
punct |
/,LEF |
R4369 |
T7562 |
T7563 |
compound |
β,catenin |
R4370 |
T7563 |
T7557 |
appos |
catenin,LEF |
R4371 |
T7564 |
T7563 |
punct |
-,catenin |
R4372 |
T7565 |
T7558 |
punct |
-,sensitive |
R4373 |
T7566 |
T7556 |
compound |
reporter,gene |
R4374 |
T7567 |
T7556 |
punct |
", ",gene |
R4375 |
T7568 |
T7556 |
appos |
TOPFLASH,gene |
R4376 |
T7569 |
T7570 |
punct |
[,4 |
R4377 |
T7570 |
T7554 |
parataxis |
4,induced |
R4378 |
T7571 |
T7570 |
punct |
],4 |
R4379 |
T7572 |
T7542 |
punct |
.,regulated |
R4380 |
T7574 |
T7575 |
prep |
In,induced |
R4381 |
T7576 |
T7574 |
pobj |
contrast,In |
R4382 |
T7577 |
T7575 |
punct |
", ",induced |
R4383 |
T7578 |
T7579 |
compound |
Snail,expression |
R4384 |
T7579 |
T7575 |
nsubjpass |
expression,induced |
R4385 |
T7580 |
T7575 |
auxpass |
was,induced |
R4386 |
T7581 |
T7575 |
neg |
not,induced |
R4387 |
T7582 |
T7575 |
agent |
by,induced |
R4388 |
T7583 |
T7584 |
det |
these,conditions |
R4389 |
T7584 |
T7582 |
pobj |
conditions,by |
R4390 |
T7585 |
T7586 |
punct |
(,5A |
R4391 |
T7586 |
T7575 |
parataxis |
5A,induced |
R4392 |
T7587 |
T7586 |
compound |
Figure,5A |
R4393 |
T7588 |
T7586 |
punct |
),5A |
R4394 |
T7589 |
T7575 |
punct |
.,induced |
R4395 |
T7591 |
T7592 |
advmod |
Thus,support |
R4396 |
T7593 |
T7592 |
punct |
", ",support |
R4397 |
T7594 |
T7592 |
prep |
despite,support |
R4398 |
T7595 |
T7596 |
amod |
essential,roles |
R4399 |
T7596 |
T7594 |
pobj |
roles,despite |
R4400 |
T7597 |
T7596 |
prep |
for,roles |
R4401 |
T7598 |
T7597 |
pobj |
Wnts,for |
R4402 |
T7599 |
T7598 |
cc |
and,Wnts |
R4403 |
T7600 |
T7598 |
conj |
noggin,Wnts |
R4404 |
T7601 |
T7596 |
prep |
in,roles |
R4405 |
T7602 |
T7603 |
compound |
hair,follicle |
R4406 |
T7603 |
T7604 |
compound |
follicle,specification |
R4407 |
T7604 |
T7601 |
pobj |
specification,in |
R4408 |
T7605 |
T7606 |
punct |
[,30 |
R4409 |
T7606 |
T7596 |
parataxis |
30,roles |
R4410 |
T7607 |
T7606 |
nummod |
4,30 |
R4411 |
T7608 |
T7606 |
punct |
",",30 |
R4412 |
T7609 |
T7606 |
nummod |
29,30 |
R4413 |
T7610 |
T7606 |
punct |
",",30 |
R4414 |
T7611 |
T7606 |
punct |
],30 |
R4415 |
T7612 |
T7592 |
punct |
", ",support |
R4416 |
T7613 |
T7614 |
poss |
our,studies |
R4417 |
T7614 |
T7592 |
nsubj |
studies,support |
R4418 |
T7615 |
T7592 |
aux |
did,support |
R4419 |
T7616 |
T7592 |
neg |
not,support |
R4420 |
T7617 |
T7618 |
det |
an,role |
R4421 |
T7618 |
T7592 |
dobj |
role,support |
R4422 |
T7619 |
T7618 |
amod |
essential,role |
R4423 |
T7620 |
T7618 |
prep |
for,role |
R4424 |
T7621 |
T7622 |
det |
these,signals |
R4425 |
T7622 |
T7620 |
pobj |
signals,for |
R4426 |
T7623 |
T7618 |
prep |
in,role |
R4427 |
T7624 |
T7623 |
pcomp |
governing,in |
R4428 |
T7625 |
T7626 |
compound |
Snail,expression |
R4429 |
T7626 |
T7624 |
dobj |
expression,governing |
R4430 |
T7627 |
T7624 |
prep |
in,governing |
R4431 |
T7628 |
T7627 |
pobj |
keratinocytes,in |
R4432 |
T7629 |
T7592 |
punct |
.,support |
R4433 |
T7631 |
T7632 |
compound |
TGF,β1 |
R4434 |
T7632 |
T7634 |
nsubjpass |
β1,shown |
R4435 |
T7633 |
T7632 |
punct |
-,β1 |
R4436 |
T7635 |
T7634 |
aux |
has,shown |
R4437 |
T7636 |
T7634 |
auxpass |
been,shown |
R4438 |
T7637 |
T7638 |
aux |
to,induce |
R4439 |
T7638 |
T7634 |
xcomp |
induce,shown |
R4440 |
T7639 |
T7640 |
compound |
Snail,members |
R4441 |
T7640 |
T7638 |
dobj |
members,induce |
R4442 |
T7641 |
T7640 |
compound |
family,members |
R4443 |
T7642 |
T7638 |
prep |
in,induce |
R4444 |
T7643 |
T7642 |
pobj |
hepatocytes,in |
R4445 |
T7644 |
T7643 |
cc |
and,hepatocytes |
R4446 |
T7645 |
T7643 |
conj |
heart,hepatocytes |
R4447 |
T7646 |
T7647 |
punct |
[,31 |
R4448 |
T7647 |
T7634 |
parataxis |
31,shown |
R4449 |
T7648 |
T7647 |
nummod |
15,31 |
R4450 |
T7649 |
T7647 |
punct |
", ",31 |
R4451 |
T7650 |
T7647 |
punct |
],31 |
R4452 |
T7651 |
T7634 |
punct |
.,shown |
R4453 |
T7653 |
T7654 |
prep |
In,inhibits |
R4454 |
T7655 |
T7653 |
pobj |
keratinocytes,In |
R4455 |
T7656 |
T7654 |
punct |
", ",inhibits |
R4456 |
T7657 |
T7654 |
advmod |
however,inhibits |
R4457 |
T7658 |
T7654 |
punct |
", ",inhibits |
R4458 |
T7659 |
T7660 |
compound |
TGF,β1 |
R4459 |
T7660 |
T7654 |
nsubj |
β1,inhibits |
R4460 |
T7661 |
T7660 |
punct |
-,β1 |
R4461 |
T7662 |
T7663 |
compound |
keratinocyte,growth |
R4462 |
T7663 |
T7654 |
dobj |
growth,inhibits |
R4463 |
T7664 |
T7654 |
cc |
and,inhibits |
R4464 |
T7665 |
T7654 |
conj |
seems,inhibits |
R4465 |
T7666 |
T7667 |
aux |
to,involved |
R4466 |
T7667 |
T7665 |
xcomp |
involved,seems |
R4467 |
T7668 |
T7667 |
auxpass |
be,involved |
R4468 |
T7669 |
T7667 |
prep |
in,involved |
R4469 |
T7670 |
T7669 |
pcomp |
triggering,in |
R4470 |
T7671 |
T7672 |
det |
the,phase |
R4471 |
T7672 |
T7670 |
dobj |
phase,triggering |
R4472 |
T7673 |
T7672 |
amod |
destructive,phase |
R4473 |
T7674 |
T7672 |
prep |
of,phase |
R4474 |
T7675 |
T7676 |
det |
the,follicle |
R4475 |
T7676 |
T7674 |
pobj |
follicle,of |
R4476 |
T7677 |
T7676 |
amod |
cycling,follicle |
R4477 |
T7678 |
T7676 |
compound |
hair,follicle |
R4478 |
T7679 |
T7680 |
punct |
[,32 |
R4479 |
T7680 |
T7665 |
parataxis |
32,seems |
R4480 |
T7681 |
T7680 |
punct |
],32 |
R4481 |
T7682 |
T7654 |
punct |
.,inhibits |
R4482 |
T7684 |
T7685 |
prep |
Of,blocked |
R4483 |
T7686 |
T7687 |
det |
the,mutations |
R4484 |
T7687 |
T7684 |
pobj |
mutations,Of |
R4485 |
T7688 |
T7687 |
nmod |
loss,mutations |
R4486 |
T7689 |
T7688 |
punct |
-,loss |
R4487 |
T7690 |
T7688 |
prep |
of,loss |
R4488 |
T7691 |
T7690 |
punct |
-,of |
R4489 |
T7692 |
T7690 |
pobj |
function,of |
R4490 |
T7693 |
T7687 |
acl |
generated,mutations |
R4491 |
T7694 |
T7693 |
prep |
in,generated |
R4492 |
T7695 |
T7694 |
pobj |
each,in |
R4493 |
T7696 |
T7695 |
prep |
of,each |
R4494 |
T7697 |
T7698 |
det |
the,genes |
R4495 |
T7698 |
T7696 |
pobj |
genes,of |
R4496 |
T7699 |
T7700 |
compound |
TGF,β |
R4497 |
T7700 |
T7698 |
compound |
β,genes |
R4498 |
T7701 |
T7700 |
punct |
-,β |
R4499 |
T7702 |
T7685 |
punct |
", ",blocked |
R4500 |
T7703 |
T7704 |
advmod |
only,state |
R4501 |
T7704 |
T7685 |
nsubj |
state,blocked |
R4502 |
T7705 |
T7704 |
det |
the,state |
R4503 |
T7706 |
T7707 |
nmod |
TGF,β2 |
R4504 |
T7707 |
T7704 |
nmod |
β2,state |
R4505 |
T7708 |
T7707 |
punct |
-,β2 |
R4506 |
T7709 |
T7704 |
amod |
null,state |
R4507 |
T7710 |
T7711 |
compound |
follicle,development |
R4508 |
T7711 |
T7685 |
dobj |
development,blocked |
R4509 |
T7712 |
T7685 |
prep |
at,blocked |
R4510 |
T7713 |
T7714 |
det |
the,stage |
R4511 |
T7714 |
T7712 |
pobj |
stage,at |
R4512 |
T7715 |
T7716 |
compound |
hair,bud |
R4513 |
T7716 |
T7714 |
compound |
bud,stage |
R4514 |
T7717 |
T7718 |
punct |
[,32 |
R4515 |
T7718 |
T7685 |
parataxis |
32,blocked |
R4516 |
T7719 |
T7718 |
punct |
],32 |
R4517 |
T7720 |
T7685 |
punct |
.,blocked |
R4518 |
T7722 |
T7723 |
advmod |
Thus,turned |
R4519 |
T7724 |
T7723 |
punct |
", ",turned |
R4520 |
T7725 |
T7723 |
nsubj |
we,turned |
R4521 |
T7726 |
T7723 |
prep |
towards,turned |
R4522 |
T7727 |
T7726 |
pcomp |
addressing,towards |
R4523 |
T7728 |
T7729 |
mark |
whether,involved |
R4524 |
T7729 |
T7727 |
ccomp |
involved,addressing |
R4525 |
T7730 |
T7731 |
compound |
TGF,β2 |
R4526 |
T7731 |
T7729 |
nsubjpass |
β2,involved |
R4527 |
T7732 |
T7731 |
punct |
-,β2 |
R4528 |
T7733 |
T7729 |
aux |
might,involved |
R4529 |
T7734 |
T7729 |
auxpass |
be,involved |
R4530 |
T7735 |
T7729 |
prep |
in,involved |
R4531 |
T7736 |
T7735 |
pcomp |
regulating,in |
R4532 |
T7737 |
T7738 |
compound |
Snail,expression |
R4533 |
T7738 |
T7736 |
dobj |
expression,regulating |
R4534 |
T7739 |
T7736 |
prep |
in,regulating |
R4535 |
T7740 |
T7739 |
pobj |
keratinocytes,in |
R4536 |
T7741 |
T7740 |
acl |
isolated,keratinocytes |
R4537 |
T7742 |
T7741 |
prep |
from,isolated |
R4538 |
T7743 |
T7744 |
det |
the,layer |
R4539 |
T7744 |
T7742 |
pobj |
layer,from |
R4540 |
T7745 |
T7744 |
amod |
basal,layer |
R4541 |
T7746 |
T7744 |
prep |
of,layer |
R4542 |
T7747 |
T7748 |
det |
the,epidermis |
R4543 |
T7748 |
T7746 |
pobj |
epidermis,of |
R4544 |
T7749 |
T7723 |
punct |
.,turned |
R4545 |
T7751 |
T7752 |
mark |
Though,is |
R4546 |
T7752 |
T7754 |
advcl |
is,are |
R4547 |
T7753 |
T7752 |
expl |
there,is |
R4548 |
T7755 |
T7756 |
det |
no,system |
R4549 |
T7756 |
T7752 |
attr |
system,is |
R4550 |
T7757 |
T7758 |
compound |
cell,culture |
R4551 |
T7758 |
T7756 |
compound |
culture,system |
R4552 |
T7759 |
T7756 |
amod |
available,system |
R4553 |
T7760 |
T7761 |
aux |
to,study |
R4554 |
T7761 |
T7759 |
xcomp |
study,available |
R4555 |
T7762 |
T7761 |
advmod |
specifically,study |
R4556 |
T7763 |
T7764 |
amod |
placodal,cells |
R4557 |
T7764 |
T7761 |
dobj |
cells,study |
R4558 |
T7765 |
T7754 |
punct |
", ",are |
R4559 |
T7766 |
T7767 |
det |
these,keratinocytes |
R4560 |
T7767 |
T7754 |
nsubj |
keratinocytes,are |
R4561 |
T7768 |
T7769 |
poss |
their,progenitors |
R4562 |
T7769 |
T7754 |
attr |
progenitors,are |
R4563 |
T7770 |
T7754 |
cc |
and,are |
R4564 |
T7771 |
T7754 |
conj |
are,are |
R4565 |
T7772 |
T7773 |
det |
the,approximation |
R4566 |
T7773 |
T7771 |
attr |
approximation,are |
R4567 |
T7774 |
T7773 |
amod |
closest,approximation |
R4568 |
T7775 |
T7773 |
amod |
available,approximation |
R4569 |
T7776 |
T7777 |
aux |
to,study |
R4570 |
T7777 |
T7775 |
xcomp |
study,available |
R4571 |
T7778 |
T7779 |
det |
the,behavior |
R4572 |
T7779 |
T7777 |
dobj |
behavior,study |
R4573 |
T7780 |
T7779 |
prep |
of,behavior |
R4574 |
T7781 |
T7782 |
amod |
epithelial,cells |
R4575 |
T7782 |
T7780 |
pobj |
cells,of |
R4576 |
T7783 |
T7782 |
prep |
of,cells |
R4577 |
T7784 |
T7785 |
det |
the,placode |
R4578 |
T7785 |
T7783 |
pobj |
placode,of |
R4579 |
T7786 |
T7754 |
punct |
.,are |
R4580 |
T7788 |
T7789 |
advmod |
Interestingly,caused |
R4581 |
T7790 |
T7789 |
punct |
", ",caused |
R4582 |
T7791 |
T7789 |
nsubj |
treatment,caused |
R4583 |
T7792 |
T7791 |
prep |
of,treatment |
R4584 |
T7793 |
T7794 |
amod |
cultured,keratinocytes |
R4585 |
T7794 |
T7792 |
pobj |
keratinocytes,of |
R4586 |
T7795 |
T7791 |
prep |
with,treatment |
R4587 |
T7796 |
T7797 |
advmod |
as,5 |
R4588 |
T7797 |
T7800 |
nummod |
5,ng |
R4589 |
T7798 |
T7797 |
amod |
little,5 |
R4590 |
T7799 |
T7797 |
quantmod |
as,5 |
R4591 |
T7800 |
T7795 |
pobj |
ng,with |
R4592 |
T7801 |
T7802 |
punct |
/,ml |
R4593 |
T7802 |
T7800 |
prep |
ml,ng |
R4594 |
T7803 |
T7800 |
prep |
of,ng |
R4595 |
T7804 |
T7805 |
compound |
TGF,β2 |
R4596 |
T7805 |
T7803 |
pobj |
β2,of |
R4597 |
T7806 |
T7805 |
punct |
-,β2 |
R4598 |
T7807 |
T7808 |
det |
a,induction |
R4599 |
T7808 |
T7789 |
dobj |
induction,caused |
R4600 |
T7809 |
T7808 |
amod |
rapid,induction |
R4601 |
T7810 |
T7809 |
cc |
and,rapid |
R4602 |
T7811 |
T7809 |
conj |
transient,rapid |
R4603 |
T7812 |
T7808 |
prep |
of,induction |
R4604 |
T7813 |
T7812 |
pobj |
Snail,of |
R4605 |
T7814 |
T7815 |
punct |
(,5B |
R4606 |
T7815 |
T7789 |
parataxis |
5B,caused |
R4607 |
T7816 |
T7815 |
compound |
Figure,5B |
R4608 |
T7817 |
T7815 |
punct |
),5B |
R4609 |
T7818 |
T7789 |
punct |
.,caused |
R4610 |
T7820 |
T7821 |
prep |
Following,detected |
R4611 |
T7822 |
T7823 |
det |
this,treatment |
R4612 |
T7823 |
T7820 |
pobj |
treatment,Following |
R4613 |
T7824 |
T7821 |
punct |
", ",detected |
R4614 |
T7825 |
T7826 |
compound |
Snail,protein |
R4615 |
T7826 |
T7821 |
nsubjpass |
protein,detected |
R4616 |
T7827 |
T7821 |
auxpass |
was,detected |
R4617 |
T7828 |
T7821 |
prep |
within,detected |
R4618 |
T7829 |
T7830 |
nummod |
30,min |
R4619 |
T7830 |
T7828 |
pobj |
min,within |
R4620 |
T7831 |
T7821 |
punct |
", ",detected |
R4621 |
T7832 |
T7821 |
conj |
peaked,detected |
R4622 |
T7833 |
T7832 |
prep |
at,peaked |
R4623 |
T7834 |
T7835 |
nummod |
2,h |
R4624 |
T7835 |
T7833 |
pobj |
h,at |
R4625 |
T7836 |
T7832 |
punct |
", ",peaked |
R4626 |
T7837 |
T7832 |
cc |
and,peaked |
R4627 |
T7838 |
T7839 |
advmod |
then,declined |
R4628 |
T7839 |
T7832 |
conj |
declined,peaked |
R4629 |
T7840 |
T7839 |
advmod |
thereafter,declined |
R4630 |
T7841 |
T7821 |
punct |
.,detected |
R4631 |
T7843 |
T7844 |
det |
The,induction |
R4632 |
T7844 |
T7845 |
nsubj |
induction,appeared |
R4633 |
T7846 |
T7844 |
prep |
of,induction |
R4634 |
T7847 |
T7846 |
pobj |
Snail,of |
R4635 |
T7848 |
T7849 |
aux |
to,be |
R4636 |
T7849 |
T7845 |
xcomp |
be,appeared |
R4637 |
T7850 |
T7849 |
acomp |
specific,be |
R4638 |
T7851 |
T7850 |
prep |
for,specific |
R4639 |
T7852 |
T7853 |
det |
the,form |
R4640 |
T7853 |
T7851 |
pobj |
form,for |
R4641 |
T7854 |
T7853 |
amod |
active,form |
R4642 |
T7855 |
T7853 |
prep |
of,form |
R4643 |
T7856 |
T7857 |
det |
the,factor |
R4644 |
T7857 |
T7855 |
pobj |
factor,of |
R4645 |
T7858 |
T7857 |
compound |
growth,factor |
R4646 |
T7859 |
T7849 |
punct |
", ",be |
R4647 |
T7860 |
T7861 |
mark |
as,obliterated |
R4648 |
T7861 |
T7849 |
advcl |
obliterated,be |
R4649 |
T7862 |
T7861 |
nsubj |
pretreatment,obliterated |
R4650 |
T7863 |
T7862 |
prep |
of,pretreatment |
R4651 |
T7864 |
T7865 |
compound |
TGF,β2 |
R4652 |
T7865 |
T7863 |
pobj |
β2,of |
R4653 |
T7866 |
T7865 |
punct |
-,β2 |
R4654 |
T7867 |
T7862 |
prep |
for,pretreatment |
R4655 |
T7868 |
T7869 |
nummod |
10,min |
R4656 |
T7869 |
T7867 |
pobj |
min,for |
R4657 |
T7870 |
T7862 |
prep |
at,pretreatment |
R4658 |
T7871 |
T7872 |
nummod |
100,°C |
R4659 |
T7872 |
T7870 |
pobj |
°C,at |
R4660 |
T7873 |
T7874 |
det |
the,response |
R4661 |
T7874 |
T7861 |
dobj |
response,obliterated |
R4662 |
T7875 |
T7876 |
punct |
[,lanes |
R4663 |
T7876 |
T7849 |
parataxis |
lanes,be |
R4664 |
T7877 |
T7878 |
compound |
Figure,5B |
R4665 |
T7878 |
T7876 |
dep |
5B,lanes |
R4666 |
T7879 |
T7876 |
punct |
", ",lanes |
R4667 |
T7880 |
T7876 |
acl |
marked,lanes |
R4668 |
T7881 |
T7880 |
punct |
(,marked |
R4669 |
T7882 |
T7880 |
oprd |
–,marked |
R4670 |
T7883 |
T7876 |
punct |
),lanes |
R4671 |
T7884 |
T7876 |
punct |
],lanes |
R4672 |
T7885 |
T7845 |
punct |
.,appeared |
R4673 |
T7887 |
T7888 |
prep |
By,maintained |
R4674 |
T7889 |
T7887 |
pobj |
contrast,By |
R4675 |
T7890 |
T7888 |
punct |
", ",maintained |
R4676 |
T7891 |
T7892 |
mark |
although,remained |
R4677 |
T7892 |
T7888 |
advcl |
remained,maintained |
R4678 |
T7893 |
T7894 |
compound |
TGF,β |
R4679 |
T7894 |
T7896 |
compound |
β,receptor |
R4680 |
T7895 |
T7894 |
punct |
-,β |
R4681 |
T7896 |
T7897 |
compound |
receptor,activation |
R4682 |
T7897 |
T7892 |
nsubj |
activation,remained |
R4683 |
T7898 |
T7892 |
acomp |
elevated,remained |
R4684 |
T7899 |
T7892 |
prep |
during,remained |
R4685 |
T7900 |
T7901 |
det |
the,duration |
R4686 |
T7901 |
T7899 |
pobj |
duration,during |
R4687 |
T7902 |
T7901 |
prep |
of,duration |
R4688 |
T7903 |
T7904 |
det |
the,experiment |
R4689 |
T7904 |
T7902 |
pobj |
experiment,of |
R4690 |
T7905 |
T7892 |
punct |
(,remained |
R4691 |
T7906 |
T7907 |
mark |
as,measured |
R4692 |
T7907 |
T7892 |
advcl |
measured,remained |
R4693 |
T7908 |
T7907 |
prep |
by,measured |
R4694 |
T7909 |
T7910 |
det |
the,phosphorylation |
R4695 |
T7910 |
T7908 |
pobj |
phosphorylation,by |
R4696 |
T7911 |
T7910 |
amod |
sustained,phosphorylation |
R4697 |
T7912 |
T7910 |
prep |
of,phosphorylation |
R4698 |
T7913 |
T7914 |
det |
the,effector |
R4699 |
T7914 |
T7912 |
pobj |
effector,of |
R4700 |
T7915 |
T7914 |
amod |
downstream,effector |
R4701 |
T7916 |
T7914 |
appos |
SMAD2,effector |
R4702 |
T7917 |
T7888 |
punct |
),maintained |
R4703 |
T7918 |
T7919 |
compound |
Snail,expression |
R4704 |
T7919 |
T7888 |
nsubjpass |
expression,maintained |
R4705 |
T7920 |
T7888 |
aux |
could,maintained |
R4706 |
T7921 |
T7888 |
neg |
not,maintained |
R4707 |
T7922 |
T7888 |
auxpass |
be,maintained |
R4708 |
T7923 |
T7924 |
punct |
(,5B |
R4709 |
T7924 |
T7888 |
parataxis |
5B,maintained |
R4710 |
T7925 |
T7924 |
compound |
Figure,5B |
R4711 |
T7926 |
T7924 |
punct |
),5B |
R4712 |
T7927 |
T7888 |
punct |
.,maintained |
R4713 |
T7929 |
T7930 |
advmod |
Thus,seemed |
R4714 |
T7931 |
T7930 |
punct |
", ",seemed |
R4715 |
T7932 |
T7933 |
mark |
although,correlated |
R4716 |
T7933 |
T7930 |
advcl |
correlated,seemed |
R4717 |
T7934 |
T7935 |
compound |
Snail,expression |
R4718 |
T7935 |
T7933 |
nsubj |
expression,correlated |
R4719 |
T7936 |
T7933 |
prep |
with,correlated |
R4720 |
T7937 |
T7938 |
amod |
phosphorylated,SMAD2 |
R4721 |
T7938 |
T7939 |
nmod |
SMAD2,induction |
R4722 |
T7939 |
T7936 |
pobj |
induction,with |
R4723 |
T7940 |
T7938 |
punct |
(,SMAD2 |
R4724 |
T7941 |
T7938 |
appos |
pSMAD2,SMAD2 |
R4725 |
T7942 |
T7939 |
punct |
),induction |
R4726 |
T7943 |
T7930 |
punct |
", ",seemed |
R4727 |
T7944 |
T7945 |
poss |
its,decline |
R4728 |
T7945 |
T7930 |
nsubj |
decline,seemed |
R4729 |
T7946 |
T7947 |
aux |
to,rely |
R4730 |
T7947 |
T7930 |
xcomp |
rely,seemed |
R4731 |
T7948 |
T7947 |
prep |
on,rely |
R4732 |
T7949 |
T7950 |
amod |
secondary,events |
R4733 |
T7950 |
T7948 |
pobj |
events,on |
R4734 |
T7951 |
T7950 |
amod |
downstream,events |
R4735 |
T7952 |
T7930 |
punct |
.,seemed |
R4736 |
T7954 |
T7955 |
det |
The,kinetics |
R4737 |
T7955 |
T7957 |
nsubjpass |
kinetics,reflected |
R4738 |
T7956 |
T7955 |
amod |
rapid,kinetics |
R4739 |
T7958 |
T7955 |
prep |
of,kinetics |
R4740 |
T7959 |
T7960 |
compound |
Snail,expression |
R4741 |
T7960 |
T7958 |
pobj |
expression,of |
R4742 |
T7961 |
T7957 |
auxpass |
were,reflected |
R4743 |
T7962 |
T7957 |
prep |
at,reflected |
R4744 |
T7963 |
T7964 |
det |
the,level |
R4745 |
T7964 |
T7962 |
pobj |
level,at |
R4746 |
T7965 |
T7964 |
compound |
mRNA,level |
R4747 |
T7966 |
T7957 |
punct |
", ",reflected |
R4748 |
T7967 |
T7957 |
advcl |
suggesting,reflected |
R4749 |
T7968 |
T7969 |
mark |
that,be |
R4750 |
T7969 |
T7967 |
ccomp |
be,suggesting |
R4751 |
T7970 |
T7971 |
compound |
Snail,promoter |
R4752 |
T7971 |
T7972 |
compound |
promoter,activity |
R4753 |
T7972 |
T7969 |
nsubj |
activity,be |
R4754 |
T7973 |
T7972 |
prep |
in,activity |
R4755 |
T7974 |
T7973 |
pobj |
keratinocytes,in |
R4756 |
T7975 |
T7969 |
aux |
might,be |
R4757 |
T7976 |
T7969 |
acomp |
sensitive,be |
R4758 |
T7977 |
T7976 |
prep |
to,sensitive |
R4759 |
T7978 |
T7979 |
compound |
TGF,β2 |
R4760 |
T7979 |
T7981 |
compound |
β2,signaling |
R4761 |
T7980 |
T7979 |
punct |
-,β2 |
R4762 |
T7981 |
T7977 |
pobj |
signaling,to |
R4763 |
T7982 |
T7983 |
punct |
(,5C |
R4764 |
T7983 |
T7957 |
parataxis |
5C,reflected |
R4765 |
T7984 |
T7983 |
compound |
Figure,5C |
R4766 |
T7985 |
T7983 |
punct |
),5C |
R4767 |
T7986 |
T7957 |
punct |
.,reflected |
R4768 |
T7988 |
T7989 |
aux |
To,test |
R4769 |
T7989 |
T7990 |
advcl |
test,engineered |
R4770 |
T7991 |
T7992 |
det |
this,possibility |
R4771 |
T7992 |
T7989 |
dobj |
possibility,test |
R4772 |
T7993 |
T7990 |
punct |
", ",engineered |
R4773 |
T7994 |
T7990 |
nsubj |
we,engineered |
R4774 |
T7995 |
T7996 |
det |
a,transgene |
R4775 |
T7996 |
T7990 |
dobj |
transgene,engineered |
R4776 |
T7997 |
T7996 |
acl |
driving,transgene |
R4777 |
T7998 |
T7999 |
det |
the,reporter |
R4778 |
T7999 |
T7997 |
dobj |
reporter,driving |
R4779 |
T8000 |
T8001 |
compound |
β,galactosidase |
R4780 |
T8001 |
T7999 |
compound |
galactosidase,reporter |
R4781 |
T8002 |
T8001 |
punct |
-,galactosidase |
R4782 |
T8003 |
T7997 |
prep |
under,driving |
R4783 |
T8004 |
T8005 |
det |
the,control |
R4784 |
T8005 |
T8003 |
pobj |
control,under |
R4785 |
T8006 |
T8005 |
prep |
of,control |
R4786 |
T8007 |
T8008 |
advmod |
approximately,2.2 |
R4787 |
T8008 |
T8009 |
nummod |
2.2,kb |
R4788 |
T8009 |
T8006 |
pobj |
kb,of |
R4789 |
T8010 |
T8009 |
prep |
of,kb |
R4790 |
T8011 |
T8012 |
compound |
promoter,sequence |
R4791 |
T8012 |
T8010 |
pobj |
sequence,of |
R4792 |
T8013 |
T8012 |
acl |
located,sequence |
R4793 |
T8014 |
T8013 |
npadvmod |
5,located |
R4794 |
T8015 |
T8014 |
punct |
′,5 |
R4795 |
T8016 |
T8014 |
prep |
from,5 |
R4796 |
T8017 |
T8018 |
det |
the,site |
R4797 |
T8018 |
T8016 |
pobj |
site,from |
R4798 |
T8019 |
T8018 |
compound |
transcription,site |
R4799 |
T8020 |
T8018 |
compound |
initiation,site |
R4800 |
T8021 |
T8018 |
prep |
of,site |
R4801 |
T8022 |
T8023 |
det |
the,gene |
R4802 |
T8023 |
T8021 |
pobj |
gene,of |
R4803 |
T8024 |
T8023 |
compound |
mouse,gene |
R4804 |
T8025 |
T8023 |
compound |
Snail,gene |
R4805 |
T8026 |
T7990 |
punct |
.,engineered |
R4806 |
T8028 |
T8029 |
prep |
At,treated |
R4807 |
T8030 |
T8031 |
nummod |
2,d |
R4808 |
T8031 |
T8028 |
pobj |
d,At |
R4809 |
T8032 |
T8031 |
prep |
after,d |
R4810 |
T8033 |
T8034 |
amod |
transient,transfection |
R4811 |
T8034 |
T8032 |
pobj |
transfection,after |
R4812 |
T8035 |
T8029 |
punct |
", ",treated |
R4813 |
T8036 |
T8029 |
nsubjpass |
keratinocytes,treated |
R4814 |
T8037 |
T8029 |
auxpass |
were,treated |
R4815 |
T8038 |
T8029 |
prep |
with,treated |
R4816 |
T8039 |
T8040 |
compound |
TGF,β2 |
R4817 |
T8040 |
T8038 |
pobj |
β2,with |
R4818 |
T8041 |
T8040 |
punct |
-,β2 |
R4819 |
T8042 |
T8043 |
punct |
(,0 |
R4820 |
T8043 |
T8029 |
parataxis |
0,treated |
R4821 |
T8044 |
T8043 |
nsubj |
t,0 |
R4822 |
T8045 |
T8043 |
punct |
=,0 |
R4823 |
T8046 |
T8043 |
punct |
),0 |
R4824 |
T8047 |
T8029 |
cc |
and,treated |
R4825 |
T8048 |
T8049 |
advmod |
then,assayed |
R4826 |
T8049 |
T8029 |
conj |
assayed,treated |
R4827 |
T8050 |
T8049 |
prep |
for,assayed |
R4828 |
T8051 |
T8052 |
compound |
transgene,activity |
R4829 |
T8052 |
T8050 |
pobj |
activity,for |
R4830 |
T8053 |
T8049 |
prep |
over,assayed |
R4831 |
T8054 |
T8055 |
det |
the,course |
R4832 |
T8055 |
T8053 |
pobj |
course,over |
R4833 |
T8056 |
T8055 |
amod |
same,course |
R4834 |
T8057 |
T8055 |
compound |
time,course |
R4835 |
T8058 |
T8059 |
prep |
in,observed |
R4836 |
T8059 |
T8055 |
relcl |
observed,course |
R4837 |
T8060 |
T8058 |
pobj |
which,in |
R4838 |
T8061 |
T8059 |
nsubj |
we,observed |
R4839 |
T8062 |
T8059 |
aux |
had,observed |
R4840 |
T8063 |
T8064 |
compound |
Snail,protein |
R4841 |
T8064 |
T8065 |
compound |
protein,induction |
R4842 |
T8065 |
T8059 |
dobj |
induction,observed |
R4843 |
T8066 |
T8029 |
punct |
.,treated |
R4844 |
T8068 |
T8069 |
det |
The,results |
R4845 |
T8069 |
T8070 |
nsubjpass |
results,presented |
R4846 |
T8071 |
T8069 |
prep |
of,results |
R4847 |
T8072 |
T8073 |
det |
this,experiment |
R4848 |
T8073 |
T8071 |
pobj |
experiment,of |
R4849 |
T8074 |
T8070 |
auxpass |
are,presented |
R4850 |
T8075 |
T8070 |
prep |
in,presented |
R4851 |
T8076 |
T8077 |
compound |
Figure,5D |
R4852 |
T8077 |
T8075 |
pobj |
5D,in |
R4853 |
T8078 |
T8070 |
punct |
.,presented |
R4854 |
T8080 |
T8081 |
prep |
Within,increased |
R4855 |
T8082 |
T8083 |
nummod |
0.5,h |
R4856 |
T8083 |
T8080 |
pobj |
h,Within |
R4857 |
T8084 |
T8083 |
prep |
of,h |
R4858 |
T8085 |
T8086 |
compound |
TGF,β2 |
R4859 |
T8086 |
T8088 |
compound |
β2,treatment |
R4860 |
T8087 |
T8086 |
punct |
-,β2 |
R4861 |
T8088 |
T8084 |
pobj |
treatment,of |
R4862 |
T8089 |
T8081 |
punct |
", ",increased |
R4863 |
T8090 |
T8091 |
compound |
Snail,promoter |
R4864 |
T8091 |
T8092 |
compound |
promoter,activity |
R4865 |
T8092 |
T8081 |
nsubj |
activity,increased |
R4866 |
T8093 |
T8081 |
aux |
had,increased |
R4867 |
T8094 |
T8081 |
advmod |
3-fold,increased |
R4868 |
T8095 |
T8081 |
punct |
", ",increased |
R4869 |
T8096 |
T8081 |
cc |
and,increased |
R4870 |
T8097 |
T8098 |
prep |
by,peaked |
R4871 |
T8098 |
T8081 |
conj |
peaked,increased |
R4872 |
T8099 |
T8100 |
nummod |
2,h |
R4873 |
T8100 |
T8097 |
pobj |
h,by |
R4874 |
T8101 |
T8098 |
punct |
", ",peaked |
R4875 |
T8102 |
T8098 |
nsubj |
it,peaked |
R4876 |
T8103 |
T8098 |
prep |
to,peaked |
R4877 |
T8104 |
T8105 |
advmod |
approximately,10-fold |
R4878 |
T8105 |
T8103 |
pcomp |
10-fold,to |
R4879 |
T8106 |
T8105 |
prep |
over,10-fold |
R4880 |
T8107 |
T8108 |
compound |
control,levels |
R4881 |
T8108 |
T8106 |
pobj |
levels,over |
R4882 |
T8109 |
T8110 |
punct |
(,5D |
R4883 |
T8110 |
T8098 |
parataxis |
5D,peaked |
R4884 |
T8111 |
T8110 |
compound |
Figure,5D |
R4885 |
T8112 |
T8110 |
punct |
),5D |
R4886 |
T8113 |
T8098 |
punct |
.,peaked |
R4887 |
T8115 |
T8116 |
advmod |
Thereafter,returned |
R4888 |
T8117 |
T8116 |
punct |
", ",returned |
R4889 |
T8118 |
T8119 |
compound |
Snail,promoter |
R4890 |
T8119 |
T8120 |
compound |
promoter,activity |
R4891 |
T8120 |
T8116 |
nsubj |
activity,returned |
R4892 |
T8121 |
T8116 |
advmod |
rapidly,returned |
R4893 |
T8122 |
T8116 |
prep |
to,returned |
R4894 |
T8123 |
T8124 |
det |
the,levels |
R4895 |
T8124 |
T8122 |
pobj |
levels,to |
R4896 |
T8125 |
T8124 |
amod |
basal,levels |
R4897 |
T8126 |
T8124 |
acl |
seen,levels |
R4898 |
T8127 |
T8126 |
prep |
in,seen |
R4899 |
T8128 |
T8129 |
amod |
unstimulated,keratinocytes |
R4900 |
T8129 |
T8127 |
pobj |
keratinocytes,in |
R4901 |
T8130 |
T8116 |
punct |
.,returned |
R4902 |
T8132 |
T8133 |
det |
The,kinetics |
R4903 |
T8133 |
T8134 |
nsubj |
kinetics,paralleled |
R4904 |
T8135 |
T8133 |
prep |
of,kinetics |
R4905 |
T8136 |
T8137 |
compound |
Snail,promoter |
R4906 |
T8137 |
T8138 |
compound |
promoter,activity |
R4907 |
T8138 |
T8135 |
pobj |
activity,of |
R4908 |
T8139 |
T8134 |
advmod |
closely,paralleled |
R4909 |
T8140 |
T8134 |
dobj |
those,paralleled |
R4910 |
T8141 |
T8140 |
acl |
observed,those |
R4911 |
T8142 |
T8141 |
prep |
for,observed |
R4912 |
T8143 |
T8144 |
compound |
Snail,protein |
R4913 |
T8144 |
T8145 |
compound |
protein,induction |
R4914 |
T8145 |
T8142 |
pobj |
induction,for |
R4915 |
T8146 |
T8134 |
punct |
.,paralleled |
R4916 |
T8148 |
T8149 |
advmod |
Moreover,appeared |
R4917 |
T8150 |
T8149 |
punct |
", ",appeared |
R4918 |
T8151 |
T8152 |
det |
the,effects |
R4919 |
T8152 |
T8149 |
nsubj |
effects,appeared |
R4920 |
T8153 |
T8152 |
amod |
stimulatory,effects |
R4921 |
T8154 |
T8155 |
aux |
to,be |
R4922 |
T8155 |
T8149 |
xcomp |
be,appeared |
R4923 |
T8156 |
T8155 |
acomp |
specific,be |
R4924 |
T8157 |
T8156 |
prep |
to,specific |
R4925 |
T8158 |
T8159 |
compound |
TGF,β2 |
R4926 |
T8159 |
T8157 |
pobj |
β2,to |
R4927 |
T8160 |
T8159 |
punct |
-,β2 |
R4928 |
T8161 |
T8155 |
punct |
", ",be |
R4929 |
T8162 |
T8163 |
mark |
since,abrogated |
R4930 |
T8163 |
T8155 |
advcl |
abrogated,be |
R4931 |
T8164 |
T8163 |
nsubjpass |
they,abrogated |
R4932 |
T8165 |
T8163 |
auxpass |
were,abrogated |
R4933 |
T8166 |
T8167 |
preconj |
either,by |
R4934 |
T8167 |
T8163 |
prep |
by,abrogated |
R4935 |
T8168 |
T8169 |
compound |
heat,inactivation |
R4936 |
T8169 |
T8167 |
pobj |
inactivation,by |
R4937 |
T8170 |
T8169 |
prep |
of,inactivation |
R4938 |
T8171 |
T8172 |
det |
the,protein |
R4939 |
T8172 |
T8170 |
pobj |
protein,of |
R4940 |
T8173 |
T8174 |
compound |
TGF,β2 |
R4941 |
T8174 |
T8172 |
compound |
β2,protein |
R4942 |
T8175 |
T8174 |
punct |
-,β2 |
R4943 |
T8176 |
T8167 |
cc |
or,by |
R4944 |
T8177 |
T8167 |
conj |
by,by |
R4945 |
T8178 |
T8177 |
pobj |
mutation,by |
R4946 |
T8179 |
T8178 |
prep |
of,mutation |
R4947 |
T8180 |
T8181 |
det |
a,element |
R4948 |
T8181 |
T8179 |
pobj |
element,of |
R4949 |
T8182 |
T8181 |
amod |
putative,element |
R4950 |
T8183 |
T8184 |
compound |
SMAD,binding |
R4951 |
T8184 |
T8181 |
compound |
binding,element |
R4952 |
T8185 |
T8181 |
acl |
located,element |
R4953 |
T8186 |
T8187 |
quantmod |
about,1.8 |
R4954 |
T8187 |
T8188 |
nummod |
1.8,kb |
R4955 |
T8188 |
T8185 |
npadvmod |
kb,located |
R4956 |
T8189 |
T8188 |
nummod |
5,kb |
R4957 |
T8190 |
T8188 |
punct |
′,kb |
R4958 |
T8191 |
T8188 |
prep |
from,kb |
R4959 |
T8192 |
T8193 |
det |
the,site |
R4960 |
T8193 |
T8191 |
pobj |
site,from |
R4961 |
T8194 |
T8193 |
compound |
Snail,site |
R4962 |
T8195 |
T8193 |
compound |
transcription,site |
R4963 |
T8196 |
T8193 |
compound |
start,site |
R4964 |
T8197 |
T8198 |
punct |
(,5D |
R4965 |
T8198 |
T8163 |
parataxis |
5D,abrogated |
R4966 |
T8199 |
T8198 |
compound |
Figure,5D |
R4967 |
T8200 |
T8198 |
punct |
),5D |
R4968 |
T8201 |
T8149 |
punct |
.,appeared |
R4969 |
T8203 |
T8204 |
advcl |
Taken,suggested |
R4970 |
T8205 |
T8203 |
advmod |
together,Taken |
R4971 |
T8206 |
T8204 |
punct |
", ",suggested |
R4972 |
T8207 |
T8208 |
det |
these,results |
R4973 |
T8208 |
T8204 |
nsubj |
results,suggested |
R4974 |
T8209 |
T8210 |
mark |
that,results |
R4975 |
T8210 |
T8204 |
advcl |
results,suggested |
R4976 |
T8211 |
T8210 |
prep |
in,results |
R4977 |
T8212 |
T8211 |
pobj |
keratinocytes,in |
R4978 |
T8213 |
T8210 |
punct |
", ",results |
R4979 |
T8214 |
T8215 |
compound |
TGF,β2 |
R4980 |
T8215 |
T8217 |
compound |
β2,signaling |
R4981 |
T8216 |
T8215 |
punct |
-,β2 |
R4982 |
T8217 |
T8210 |
nsubj |
signaling,results |
R4983 |
T8218 |
T8210 |
prep |
in,results |
R4984 |
T8219 |
T8220 |
det |
a,activation |
R4985 |
T8220 |
T8218 |
pobj |
activation,in |
R4986 |
T8221 |
T8222 |
npadvmod |
pSMAD2,dependent |
R4987 |
T8222 |
T8220 |
amod |
dependent,activation |
R4988 |
T8223 |
T8222 |
punct |
-,dependent |
R4989 |
T8224 |
T8220 |
amod |
transient,activation |
R4990 |
T8225 |
T8220 |
prep |
of,activation |
R4991 |
T8226 |
T8227 |
det |
the,gene |
R4992 |
T8227 |
T8225 |
pobj |
gene,of |
R4993 |
T8228 |
T8227 |
compound |
Snail,gene |
R4994 |
T8229 |
T8210 |
punct |
", ",results |
R4995 |
T8230 |
T8210 |
cc |
and,results |
R4996 |
T8231 |
T8232 |
mark |
that,relies |
R4997 |
T8232 |
T8210 |
conj |
relies,results |
R4998 |
T8233 |
T8232 |
nsubj |
maintenance,relies |
R4999 |
T8234 |
T8233 |
prep |
of,maintenance |
R5000 |
T8235 |
T8236 |
compound |
Snail,protein |
R5001 |
T8236 |
T8234 |
pobj |
protein,of |
R5002 |
T8237 |
T8232 |
punct |
", ",relies |
R5003 |
T8238 |
T8232 |
prep |
in,relies |
R5004 |
T8239 |
T8238 |
pobj |
part,in |
R5005 |
T8240 |
T8232 |
punct |
", ",relies |
R5006 |
T8241 |
T8232 |
prep |
upon,relies |
R5007 |
T8242 |
T8243 |
amod |
sustained,activity |
R5008 |
T8243 |
T8241 |
pobj |
activity,upon |
R5009 |
T8244 |
T8243 |
compound |
promoter,activity |
R5010 |
T8245 |
T8204 |
punct |
.,suggested |
R5011 |
T8247 |
T8248 |
det |
The,brevity |
R5012 |
T8248 |
T8249 |
nsubj |
brevity,resembled |
R5013 |
T8250 |
T8248 |
prep |
of,brevity |
R5014 |
T8251 |
T8252 |
nmod |
Snail,gene |
R5015 |
T8252 |
T8253 |
nmod |
gene,induction |
R5016 |
T8253 |
T8250 |
pobj |
induction,of |
R5017 |
T8254 |
T8252 |
cc |
and,gene |
R5018 |
T8255 |
T8252 |
conj |
protein,gene |
R5019 |
T8256 |
T8253 |
prep |
in,induction |
R5020 |
T8257 |
T8258 |
compound |
TGF,β2 |
R5021 |
T8258 |
T8260 |
npadvmod |
β2,treated |
R5022 |
T8259 |
T8258 |
punct |
-,β2 |
R5023 |
T8260 |
T8261 |
amod |
treated,keratinocytes |
R5024 |
T8261 |
T8256 |
pobj |
keratinocytes,in |
R5025 |
T8262 |
T8261 |
amod |
cultured,keratinocytes |
R5026 |
T8263 |
T8264 |
det |
the,appearance |
R5027 |
T8264 |
T8249 |
dobj |
appearance,resembled |
R5028 |
T8265 |
T8264 |
amod |
temporal,appearance |
R5029 |
T8266 |
T8264 |
prep |
of,appearance |
R5030 |
T8267 |
T8268 |
compound |
Snail,mRNA |
R5031 |
T8268 |
T8266 |
pobj |
mRNA,of |
R5032 |
T8269 |
T8268 |
cc |
and,mRNA |
R5033 |
T8270 |
T8268 |
conj |
protein,mRNA |
R5034 |
T8271 |
T8264 |
prep |
at,appearance |
R5035 |
T8272 |
T8273 |
det |
the,initiation |
R5036 |
T8273 |
T8271 |
pobj |
initiation,at |
R5037 |
T8274 |
T8273 |
prep |
of,initiation |
R5038 |
T8275 |
T8276 |
compound |
hair,follicle |
R5039 |
T8276 |
T8277 |
compound |
follicle,morphogenesis |
R5040 |
T8277 |
T8274 |
pobj |
morphogenesis,of |
R5041 |
T8278 |
T8249 |
prep |
in,resembled |
R5042 |
T8279 |
T8280 |
amod |
embryonic,skin |
R5043 |
T8280 |
T8278 |
pobj |
skin,in |
R5044 |
T8281 |
T8280 |
compound |
mouse,skin |
R5045 |
T8282 |
T8249 |
punct |
.,resembled |
R5046 |
T8284 |
T8285 |
aux |
To,test |
R5047 |
T8285 |
T8286 |
advcl |
test,analyzed |
R5048 |
T8287 |
T8288 |
mark |
whether,required |
R5049 |
T8288 |
T8285 |
ccomp |
required,test |
R5050 |
T8289 |
T8290 |
compound |
TGF,β2 |
R5051 |
T8290 |
T8288 |
nsubjpass |
β2,required |
R5052 |
T8291 |
T8290 |
punct |
-,β2 |
R5053 |
T8292 |
T8288 |
aux |
might,required |
R5054 |
T8293 |
T8288 |
auxpass |
be,required |
R5055 |
T8294 |
T8288 |
prep |
for,required |
R5056 |
T8295 |
T8296 |
compound |
Snail,induction |
R5057 |
T8296 |
T8294 |
pobj |
induction,for |
R5058 |
T8297 |
T8296 |
prep |
in,induction |
R5059 |
T8298 |
T8299 |
compound |
hair,bud |
R5060 |
T8299 |
T8300 |
compound |
bud,formation |
R5061 |
T8300 |
T8297 |
pobj |
formation,in |
R5062 |
T8301 |
T8302 |
advmod |
in,vivo |
R5063 |
T8302 |
T8288 |
advmod |
vivo,required |
R5064 |
T8303 |
T8286 |
punct |
", ",analyzed |
R5065 |
T8304 |
T8286 |
nsubj |
we,analyzed |
R5066 |
T8305 |
T8286 |
advmod |
first,analyzed |
R5067 |
T8306 |
T8307 |
mark |
whether,expressed |
R5068 |
T8307 |
T8286 |
ccomp |
expressed,analyzed |
R5069 |
T8308 |
T8309 |
compound |
TGF,β2 |
R5070 |
T8309 |
T8307 |
nsubjpass |
β2,expressed |
R5071 |
T8310 |
T8309 |
punct |
-,β2 |
R5072 |
T8311 |
T8307 |
auxpass |
was,expressed |
R5073 |
T8312 |
T8307 |
prep |
in,expressed |
R5074 |
T8313 |
T8312 |
cc |
or,in |
R5075 |
T8314 |
T8312 |
conj |
around,in |
R5076 |
T8315 |
T8316 |
det |
the,bud |
R5077 |
T8316 |
T8314 |
pobj |
bud,around |
R5078 |
T8317 |
T8316 |
compound |
hair,bud |
R5079 |
T8318 |
T8286 |
punct |
.,analyzed |
R5080 |
T8320 |
T8321 |
advcl |
Consistent,labeled |
R5081 |
T8322 |
T8320 |
prep |
with,Consistent |
R5082 |
T8323 |
T8324 |
amod |
previous,observations |
R5083 |
T8324 |
T8322 |
pobj |
observations,with |
R5084 |
T8325 |
T8326 |
punct |
[,33 |
R5085 |
T8326 |
T8320 |
parataxis |
33,Consistent |
R5086 |
T8327 |
T8326 |
punct |
],33 |
R5087 |
T8328 |
T8321 |
punct |
", ",labeled |
R5088 |
T8329 |
T8330 |
det |
an,antibody |
R5089 |
T8330 |
T8321 |
nsubj |
antibody,labeled |
R5090 |
T8331 |
T8332 |
amod |
anti-TGF,β2 |
R5091 |
T8332 |
T8330 |
compound |
β2,antibody |
R5092 |
T8333 |
T8332 |
punct |
-,β2 |
R5093 |
T8334 |
T8335 |
amod |
developing,buds |
R5094 |
T8335 |
T8321 |
dobj |
buds,labeled |
R5095 |
T8336 |
T8335 |
compound |
hair,buds |
R5096 |
T8337 |
T8338 |
punct |
(,6A |
R5097 |
T8338 |
T8321 |
parataxis |
6A,labeled |
R5098 |
T8339 |
T8338 |
compound |
Figure,6A |
R5099 |
T8340 |
T8338 |
punct |
),6A |
R5100 |
T8341 |
T8321 |
punct |
.,labeled |
R5101 |
T8343 |
T8344 |
det |
This,labeling |
R5102 |
T8344 |
T8345 |
nsubj |
labeling,appeared |
R5103 |
T8346 |
T8347 |
aux |
to,be |
R5104 |
T8347 |
T8345 |
xcomp |
be,appeared |
R5105 |
T8348 |
T8347 |
acomp |
specific,be |
R5106 |
T8349 |
T8350 |
mark |
as,judged |
R5107 |
T8350 |
T8347 |
advcl |
judged,be |
R5108 |
T8351 |
T8350 |
prep |
by,judged |
R5109 |
T8352 |
T8353 |
det |
the,lack |
R5110 |
T8353 |
T8351 |
pobj |
lack,by |
R5111 |
T8354 |
T8353 |
prep |
of,lack |
R5112 |
T8355 |
T8354 |
pobj |
staining,of |
R5113 |
T8356 |
T8353 |
prep |
in,lack |
R5114 |
T8357 |
T8358 |
compound |
follicle,buds |
R5115 |
T8358 |
T8356 |
pobj |
buds,in |
R5116 |
T8359 |
T8358 |
prep |
from,buds |
R5117 |
T8360 |
T8359 |
pobj |
mice,from |
R5118 |
T8361 |
T8360 |
amod |
homozygous,mice |
R5119 |
T8362 |
T8361 |
prep |
for,homozygous |
R5120 |
T8363 |
T8364 |
det |
a,mutation |
R5121 |
T8364 |
T8362 |
pobj |
mutation,for |
R5122 |
T8365 |
T8366 |
nmod |
TGF,β2 |
R5123 |
T8366 |
T8364 |
nmod |
β2,mutation |
R5124 |
T8367 |
T8366 |
punct |
-,β2 |
R5125 |
T8368 |
T8364 |
amod |
null,mutation |
R5126 |
T8369 |
T8370 |
punct |
(,34 |
R5127 |
T8370 |
T8345 |
parataxis |
34,appeared |
R5128 |
T8371 |
T8372 |
compound |
Figure,6A |
R5129 |
T8372 |
T8370 |
dep |
6A,34 |
R5130 |
T8373 |
T8370 |
punct |
;,34 |
R5131 |
T8374 |
T8370 |
punct |
[,34 |
R5132 |
T8375 |
T8370 |
punct |
],34 |
R5133 |
T8376 |
T8370 |
punct |
),34 |
R5134 |
T8377 |
T8345 |
punct |
.,appeared |
R5135 |
T8379 |
T8380 |
advmod |
Moreover,expressed |
R5136 |
T8381 |
T8380 |
punct |
", ",expressed |
R5137 |
T8382 |
T8383 |
det |
the,effector |
R5138 |
T8383 |
T8380 |
nsubjpass |
effector,expressed |
R5139 |
T8384 |
T8383 |
amod |
downstream,effector |
R5140 |
T8385 |
T8383 |
prep |
of,effector |
R5141 |
T8386 |
T8387 |
compound |
TGF,β2 |
R5142 |
T8387 |
T8389 |
compound |
β2,signaling |
R5143 |
T8388 |
T8387 |
punct |
-,β2 |
R5144 |
T8389 |
T8385 |
pobj |
signaling,of |
R5145 |
T8390 |
T8383 |
punct |
", ",effector |
R5146 |
T8391 |
T8383 |
appos |
pSMAD2,effector |
R5147 |
T8392 |
T8380 |
punct |
", ",expressed |
R5148 |
T8393 |
T8380 |
auxpass |
was,expressed |
R5149 |
T8394 |
T8380 |
advmod |
also,expressed |
R5150 |
T8395 |
T8380 |
prep |
in,expressed |
R5151 |
T8396 |
T8397 |
nmod |
WT,buds |
R5152 |
T8397 |
T8395 |
pobj |
buds,in |
R5153 |
T8398 |
T8396 |
punct |
", ",WT |
R5154 |
T8399 |
T8396 |
cc |
but,WT |
R5155 |
T8400 |
T8399 |
neg |
not,but |
R5156 |
T8401 |
T8402 |
compound |
TGF,β2 |
R5157 |
T8402 |
T8404 |
npadvmod |
β2,null |
R5158 |
T8403 |
T8402 |
punct |
-,β2 |
R5159 |
T8404 |
T8396 |
conj |
null,WT |
R5160 |
T8405 |
T8404 |
punct |
-,null |
R5161 |
T8406 |
T8397 |
punct |
", ",buds |
R5162 |
T8407 |
T8397 |
compound |
hair,buds |
R5163 |
T8408 |
T8409 |
punct |
(,6B |
R5164 |
T8409 |
T8380 |
parataxis |
6B,expressed |
R5165 |
T8410 |
T8409 |
compound |
Figure,6B |
R5166 |
T8411 |
T8409 |
punct |
),6B |
R5167 |
T8412 |
T8380 |
punct |
.,expressed |
R5168 |
T8414 |
T8415 |
advmod |
Together,underscore |
R5169 |
T8416 |
T8415 |
punct |
", ",underscore |
R5170 |
T8417 |
T8418 |
det |
these,data |
R5171 |
T8418 |
T8415 |
nsubj |
data,underscore |
R5172 |
T8419 |
T8420 |
det |
the,importance |
R5173 |
T8420 |
T8415 |
dobj |
importance,underscore |
R5174 |
T8421 |
T8420 |
prep |
of,importance |
R5175 |
T8422 |
T8423 |
det |
the,isoform |
R5176 |
T8423 |
T8421 |
pobj |
isoform,of |
R5177 |
T8424 |
T8425 |
compound |
TGF,β2 |
R5178 |
T8425 |
T8423 |
compound |
β2,isoform |
R5179 |
T8426 |
T8425 |
punct |
-,β2 |
R5180 |
T8427 |
T8415 |
prep |
despite,underscore |
R5181 |
T8428 |
T8427 |
pobj |
expression,despite |
R5182 |
T8429 |
T8428 |
prep |
of,expression |
R5183 |
T8430 |
T8431 |
preconj |
both,β1 |
R5184 |
T8431 |
T8429 |
pobj |
β1,of |
R5185 |
T8432 |
T8431 |
compound |
TGF,β1 |
R5186 |
T8433 |
T8431 |
punct |
-,β1 |
R5187 |
T8434 |
T8431 |
cc |
and,β1 |
R5188 |
T8435 |
T8436 |
compound |
TGF,β2 |
R5189 |
T8436 |
T8431 |
conj |
β2,β1 |
R5190 |
T8437 |
T8436 |
punct |
-,β2 |
R5191 |
T8438 |
T8428 |
prep |
in,expression |
R5192 |
T8439 |
T8440 |
amod |
developing,buds |
R5193 |
T8440 |
T8438 |
pobj |
buds,in |
R5194 |
T8441 |
T8440 |
compound |
hair,buds |
R5195 |
T8442 |
T8428 |
prep |
at,expression |
R5196 |
T8443 |
T8444 |
det |
this,stage |
R5197 |
T8444 |
T8442 |
pobj |
stage,at |
R5198 |
T8445 |
T8415 |
punct |
.,underscore |
R5199 |
T8447 |
T8448 |
aux |
To,explore |
R5200 |
T8448 |
T8450 |
advcl |
explore,examined |
R5201 |
T8449 |
T8448 |
advmod |
further,explore |
R5202 |
T8451 |
T8452 |
det |
the,relation |
R5203 |
T8452 |
T8448 |
dobj |
relation,explore |
R5204 |
T8453 |
T8452 |
amod |
possible,relation |
R5205 |
T8454 |
T8452 |
prep |
between,relation |
R5206 |
T8455 |
T8454 |
pobj |
Snail,between |
R5207 |
T8456 |
T8455 |
cc |
and,Snail |
R5208 |
T8457 |
T8458 |
compound |
TGF,β2 |
R5209 |
T8458 |
T8455 |
conj |
β2,Snail |
R5210 |
T8459 |
T8458 |
punct |
-,β2 |
R5211 |
T8460 |
T8450 |
punct |
", ",examined |
R5212 |
T8461 |
T8450 |
nsubj |
we,examined |
R5213 |
T8462 |
T8463 |
det |
the,status |
R5214 |
T8463 |
T8450 |
dobj |
status,examined |
R5215 |
T8464 |
T8463 |
prep |
of,status |
R5216 |
T8465 |
T8466 |
compound |
Snail,expression |
R5217 |
T8466 |
T8464 |
pobj |
expression,of |
R5218 |
T8467 |
T8463 |
prep |
in,status |
R5219 |
T8468 |
T8469 |
compound |
TGF,β2 |
R5220 |
T8469 |
T8471 |
npadvmod |
β2,null |
R5221 |
T8470 |
T8469 |
punct |
-,β2 |
R5222 |
T8471 |
T8473 |
amod |
null,buds |
R5223 |
T8472 |
T8471 |
punct |
-,null |
R5224 |
T8473 |
T8467 |
pobj |
buds,in |
R5225 |
T8474 |
T8473 |
compound |
hair,buds |
R5226 |
T8475 |
T8450 |
punct |
.,examined |
R5227 |
T8477 |
T8478 |
mark |
As,judged |
R5228 |
T8478 |
T8479 |
advcl |
judged,was |
R5229 |
T8480 |
T8478 |
prep |
by,judged |
R5230 |
T8481 |
T8480 |
pobj |
immunohistochemistry,by |
R5231 |
T8482 |
T8479 |
punct |
", ",was |
R5232 |
T8483 |
T8484 |
compound |
Snail,protein |
R5233 |
T8484 |
T8479 |
nsubj |
protein,was |
R5234 |
T8485 |
T8479 |
acomp |
absent,was |
R5235 |
T8486 |
T8485 |
prep |
from,absent |
R5236 |
T8487 |
T8488 |
compound |
E17.5,skin |
R5237 |
T8488 |
T8486 |
pobj |
skin,from |
R5238 |
T8489 |
T8488 |
prep |
of,skin |
R5239 |
T8490 |
T8491 |
compound |
TGF,β2 |
R5240 |
T8491 |
T8493 |
npadvmod |
β2,null |
R5241 |
T8492 |
T8491 |
punct |
-,β2 |
R5242 |
T8493 |
T8495 |
amod |
null,embryos |
R5243 |
T8494 |
T8493 |
punct |
-,null |
R5244 |
T8495 |
T8489 |
pobj |
embryos,of |
R5245 |
T8496 |
T8486 |
cc |
but,from |
R5246 |
T8497 |
T8496 |
neg |
not,but |
R5247 |
T8498 |
T8486 |
conj |
from,from |
R5248 |
T8499 |
T8498 |
pobj |
that,from |
R5249 |
T8500 |
T8499 |
prep |
of,that |
R5250 |
T8501 |
T8502 |
compound |
control,littermates |
R5251 |
T8502 |
T8500 |
pobj |
littermates,of |
R5252 |
T8503 |
T8504 |
punct |
(,6C |
R5253 |
T8504 |
T8479 |
parataxis |
6C,was |
R5254 |
T8505 |
T8504 |
compound |
Figure,6C |
R5255 |
T8506 |
T8504 |
punct |
),6C |
R5256 |
T8507 |
T8479 |
punct |
.,was |
R5257 |
T8509 |
T8510 |
det |
This,effect |
R5258 |
T8510 |
T8511 |
nsubj |
effect,appeared |
R5259 |
T8512 |
T8513 |
aux |
to,exerted |
R5260 |
T8513 |
T8511 |
xcomp |
exerted,appeared |
R5261 |
T8514 |
T8513 |
auxpass |
be,exerted |
R5262 |
T8515 |
T8513 |
prep |
at,exerted |
R5263 |
T8516 |
T8517 |
det |
the,level |
R5264 |
T8517 |
T8515 |
pobj |
level,at |
R5265 |
T8518 |
T8517 |
amod |
transcriptional,level |
R5266 |
T8519 |
T8511 |
punct |
", ",appeared |
R5267 |
T8520 |
T8521 |
mark |
since,found |
R5268 |
T8521 |
T8511 |
advcl |
found,appeared |
R5269 |
T8522 |
T8523 |
compound |
Snail,mRNAs |
R5270 |
T8523 |
T8521 |
nsubjpass |
mRNAs,found |
R5271 |
T8524 |
T8521 |
auxpass |
were,found |
R5272 |
T8525 |
T8521 |
advmod |
also,found |
R5273 |
T8526 |
T8521 |
neg |
not,found |
R5274 |
T8527 |
T8521 |
prep |
in,found |
R5275 |
T8528 |
T8529 |
compound |
TGF,β2 |
R5276 |
T8529 |
T8531 |
npadvmod |
β2,null |
R5277 |
T8530 |
T8529 |
punct |
-,β2 |
R5278 |
T8531 |
T8532 |
amod |
null,buds |
R5279 |
T8532 |
T8527 |
pobj |
buds,in |
R5280 |
T8533 |
T8532 |
compound |
hair,buds |
R5281 |
T8534 |
T8521 |
prep |
under,found |
R5282 |
T8535 |
T8534 |
pobj |
conditions,under |
R5283 |
T8536 |
T8537 |
prep |
in,detected |
R5284 |
T8537 |
T8535 |
relcl |
detected,conditions |
R5285 |
T8538 |
T8536 |
pobj |
which,in |
R5286 |
T8539 |
T8540 |
det |
the,signal |
R5287 |
T8559 |
T8557 |
prep |
in,detected |
R5288 |
T8540 |
T8537 |
nsubjpass |
signal,detected |
R5289 |
T8541 |
T8537 |
auxpass |
was,detected |
R5290 |
T8560 |
T8561 |
nummod |
2,wk |
R5291 |
T8561 |
T8563 |
npadvmod |
wk,old |
R5292 |
T8542 |
T8537 |
advmod |
readily,detected |
R5293 |
T8562 |
T8561 |
punct |
-,wk |
R5294 |
T8563 |
T8565 |
amod |
old,mice |
R5295 |
T8564 |
T8563 |
punct |
-,old |
R5296 |
T8543 |
T8537 |
prep |
in,detected |
R5297 |
T8565 |
T8559 |
pobj |
mice,in |
R5298 |
T8566 |
T8567 |
compound |
K14,Smad2 |
R5299 |
T8567 |
T8565 |
compound |
Smad2,mice |
R5300 |
T8568 |
T8567 |
punct |
-,Smad2 |
R5301 |
T8569 |
T8565 |
compound |
Tg,mice |
R5302 |
T8544 |
T8545 |
det |
the,buds |
R5303 |
T8570 |
T8565 |
punct |
", ",mice |
R5304 |
T8571 |
T8572 |
dep |
which,display |
R5305 |
T8572 |
T8565 |
relcl |
display,mice |
R5306 |
T8545 |
T8543 |
pobj |
buds,in |
R5307 |
T8573 |
T8574 |
amod |
elevated,signaling |
R5308 |
T8546 |
T8545 |
compound |
hair,buds |
R5309 |
T8574 |
T8572 |
dobj |
signaling,display |
R5310 |
T8575 |
T8576 |
compound |
TGF,β |
R5311 |
T8547 |
T8545 |
prep |
of,buds |
R5312 |
T8576 |
T8574 |
compound |
β,signaling |
R5313 |
T8577 |
T8576 |
punct |
-,β |
R5314 |
T8578 |
T8572 |
prep |
in,display |
R5315 |
T8548 |
T8549 |
compound |
littermate,skin |
R5316 |
T8549 |
T8547 |
pobj |
skin,of |
R5317 |
T8579 |
T8578 |
pobj |
skin,in |
R5318 |
T8580 |
T8581 |
punct |
[,35 |
R5319 |
T8550 |
T8551 |
punct |
(,6D |
R5320 |
T8581 |
T8559 |
parataxis |
35,in |
R5321 |
T8582 |
T8581 |
punct |
],35 |
R5322 |
T8583 |
T8557 |
punct |
", ",detected |
R5323 |
T8551 |
T8521 |
parataxis |
6D,found |
R5324 |
T8584 |
T8585 |
compound |
Snail,protein |
R5325 |
T8585 |
T8557 |
nsubjpass |
protein,detected |
R5326 |
T8552 |
T8551 |
compound |
Figure,6D |
R5327 |
T8586 |
T8557 |
auxpass |
was,detected |
R5328 |
T8587 |
T8557 |
advmod |
readily,detected |
R5329 |
T8553 |
T8551 |
punct |
),6D |
R5330 |
T8588 |
T8557 |
prep |
by,detected |
R5331 |
T8554 |
T8511 |
punct |
.,appeared |
R5332 |
T8589 |
T8590 |
compound |
Western,blot |
R5333 |
T8590 |
T8591 |
compound |
blot,analyses |
R5334 |
T8591 |
T8588 |
pobj |
analyses,by |
R5335 |
T8592 |
T8557 |
punct |
", ",detected |
R5336 |
T8593 |
T8594 |
advmod |
where,found |
R5337 |
T8556 |
T8557 |
advmod |
Conversely,detected |
R5338 |
T8594 |
T8557 |
advcl |
found,detected |
R5339 |
T8595 |
T8594 |
nsubjpass |
it,found |
R5340 |
T8596 |
T8594 |
auxpass |
was,found |
R5341 |
T8597 |
T8594 |
neg |
not,found |
R5342 |
T8558 |
T8557 |
punct |
", ",detected |
R5343 |
T8598 |
T8594 |
prep |
in,found |
R5344 |
T8599 |
T8600 |
amod |
postnatal,skin |
R5345 |
T8600 |
T8598 |
pobj |
skin,in |
R5346 |
T8601 |
T8602 |
punct |
(,6E |
R5347 |
T8664 |
T8660 |
advmod |
still,formed |
R5348 |
T8602 |
T8557 |
parataxis |
6E,detected |
R5349 |
T8603 |
T8602 |
compound |
Figure,6E |
R5350 |
T8604 |
T8602 |
punct |
),6E |
R5351 |
T8605 |
T8557 |
punct |
.,detected |
R5352 |
T8607 |
T8608 |
advcl |
Taken,provide |
R5353 |
T8609 |
T8607 |
advmod |
together,Taken |
R5354 |
T8610 |
T8608 |
punct |
", ",provide |
R5355 |
T8611 |
T8612 |
det |
these,results |
R5356 |
T8666 |
T8660 |
prep |
in,formed |
R5357 |
T8612 |
T8608 |
nsubj |
results,provide |
R5358 |
T8613 |
T8614 |
amod |
compelling,evidence |
R5359 |
T8614 |
T8608 |
dobj |
evidence,provide |
R5360 |
T8615 |
T8616 |
mark |
that,is |
R5361 |
T8616 |
T8614 |
acl |
is,evidence |
R5362 |
T8667 |
T8668 |
compound |
TGF,β2 |
R5363 |
T8617 |
T8618 |
compound |
TGF,β2 |
R5364 |
T8618 |
T8616 |
nsubj |
β2,is |
R5365 |
T8619 |
T8618 |
punct |
-,β2 |
R5366 |
T8668 |
T8670 |
npadvmod |
β2,null |
R5367 |
T8620 |
T8621 |
advmod |
functionally,important |
R5368 |
T8621 |
T8616 |
acomp |
important,is |
R5369 |
T8669 |
T8668 |
punct |
-,β2 |
R5370 |
T8622 |
T8621 |
prep |
for,important |
R5371 |
T8623 |
T8622 |
pcomp |
inducing,for |
R5372 |
T8624 |
T8625 |
compound |
Snail,expression |
R5373 |
T8670 |
T8671 |
amod |
null,skin |
R5374 |
T8625 |
T8623 |
dobj |
expression,inducing |
R5375 |
T8626 |
T8625 |
compound |
gene,expression |
R5376 |
T8627 |
T8623 |
prep |
in,inducing |
R5377 |
T8671 |
T8666 |
pobj |
skin,in |
R5378 |
T8628 |
T8629 |
det |
a,manner |
R5379 |
T8629 |
T8627 |
pobj |
manner,in |
R5380 |
T8672 |
T8665 |
punct |
", ",reduced |
R5381 |
T8630 |
T8631 |
npadvmod |
pSMAD,dependent |
R5382 |
T8631 |
T8629 |
amod |
dependent,manner |
R5383 |
T8632 |
T8631 |
punct |
-,dependent |
R5384 |
T8673 |
T8674 |
poss |
their,number |
R5385 |
T8633 |
T8623 |
prep |
in,inducing |
R5386 |
T8634 |
T8635 |
amod |
developing,buds |
R5387 |
T8635 |
T8633 |
pobj |
buds,in |
R5388 |
T8674 |
T8665 |
nsubjpass |
number,reduced |
R5389 |
T8636 |
T8635 |
compound |
hair,buds |
R5390 |
T8637 |
T8608 |
punct |
.,provide |
R5391 |
T8675 |
T8665 |
auxpass |
was,reduced |
R5392 |
T8639 |
T8640 |
mark |
Whether,contributes |
R5393 |
T8640 |
T8644 |
csubjpass |
contributes,addressed |
R5394 |
T8676 |
T8665 |
prep |
by,reduced |
R5395 |
T8641 |
T8642 |
compound |
pMARK,activity |
R5396 |
T8642 |
T8640 |
nsubj |
activity,contributes |
R5397 |
T8643 |
T8640 |
advmod |
also,contributes |
R5398 |
T8677 |
T8678 |
advmod |
approximately,50 |
R5399 |
T8645 |
T8640 |
prep |
to,contributes |
R5400 |
T8646 |
T8647 |
compound |
Snail,induction |
R5401 |
T8647 |
T8645 |
pobj |
induction,to |
R5402 |
T8648 |
T8644 |
auxpass |
was,addressed |
R5403 |
T8649 |
T8644 |
neg |
not,addressed |
R5404 |
T8678 |
T8679 |
nummod |
50,% |
R5405 |
T8650 |
T8644 |
prep |
in,addressed |
R5406 |
T8651 |
T8652 |
det |
the,study |
R5407 |
T8652 |
T8650 |
pobj |
study,in |
R5408 |
T8679 |
T8676 |
pobj |
%,by |
R5409 |
T8653 |
T8652 |
amod |
present,study |
R5410 |
T8654 |
T8655 |
punct |
[,15 |
R5411 |
T8655 |
T8644 |
parataxis |
15,addressed |
R5412 |
T8680 |
T8681 |
punct |
[,32 |
R5413 |
T8656 |
T8655 |
punct |
],15 |
R5414 |
T8657 |
T8644 |
punct |
.,addressed |
R5415 |
T8681 |
T8665 |
parataxis |
32,reduced |
R5416 |
T8659 |
T8660 |
mark |
Although,formed |
R5417 |
T8660 |
T8665 |
advcl |
formed,reduced |
R5418 |
T8661 |
T8662 |
det |
some,buds |
R5419 |
T8682 |
T8681 |
punct |
],32 |
R5420 |
T8662 |
T8660 |
nsubj |
buds,formed |
R5421 |
T8663 |
T8662 |
compound |
hair,buds |
R5422 |
T8683 |
T8665 |
punct |
.,reduced |
R5423 |
T8685 |
T8686 |
advmod |
Thus,appear |
R5424 |
T8687 |
T8686 |
punct |
", ",appear |
R5425 |
T8770 |
T8772 |
compound |
β2,signaling |
R5426 |
T8688 |
T8689 |
mark |
although,impacts |
R5427 |
T8689 |
T8686 |
advcl |
impacts,appear |
R5428 |
T8771 |
T8770 |
punct |
-,β2 |
R5429 |
T8772 |
T8766 |
nsubj |
signaling,appeared |
R5430 |
T8690 |
T8691 |
det |
the,pathway |
R5431 |
T8773 |
T8774 |
aux |
to,be |
R5432 |
T8774 |
T8766 |
xcomp |
be,appeared |
R5433 |
T8775 |
T8776 |
det |
an,factor |
R5434 |
T8691 |
T8689 |
nsubj |
pathway,impacts |
R5435 |
T8776 |
T8774 |
attr |
factor,be |
R5436 |
T8777 |
T8776 |
amod |
important,factor |
R5437 |
T8692 |
T8691 |
acl |
mediated,pathway |
R5438 |
T8778 |
T8776 |
prep |
for,factor |
R5439 |
T8779 |
T8780 |
det |
the,proliferation |
R5440 |
T8693 |
T8692 |
prep |
by,mediated |
R5441 |
T8780 |
T8778 |
pobj |
proliferation,for |
R5442 |
T8781 |
T8780 |
amod |
early,proliferation |
R5443 |
T8782 |
T8783 |
dep |
that,occurs |
R5444 |
T8694 |
T8695 |
compound |
TGF,β2 |
R5445 |
T8783 |
T8780 |
relcl |
occurs,proliferation |
R5446 |
T8784 |
T8783 |
prep |
in,occurs |
R5447 |
T8695 |
T8697 |
compound |
β2,signaling |
R5448 |
T8785 |
T8786 |
det |
the,buds |
R5449 |
T8786 |
T8784 |
pobj |
buds,in |
R5450 |
T8787 |
T8786 |
amod |
developing,buds |
R5451 |
T8696 |
T8695 |
punct |
-,β2 |
R5452 |
T8788 |
T8786 |
compound |
hair,buds |
R5453 |
T8789 |
T8774 |
punct |
", ",be |
R5454 |
T8790 |
T8791 |
mark |
as,judged |
R5455 |
T8791 |
T8774 |
advcl |
judged,be |
R5456 |
T8792 |
T8791 |
prep |
by,judged |
R5457 |
T8793 |
T8794 |
amod |
anti-Ki67,immunofluorescence |
R5458 |
T8697 |
T8693 |
pobj |
signaling,by |
R5459 |
T8794 |
T8792 |
pobj |
immunofluorescence,by |
R5460 |
T8795 |
T8793 |
cc |
and,anti-Ki67 |
R5461 |
T8698 |
T8699 |
det |
the,step |
R5462 |
T8796 |
T8793 |
conj |
anti-pMAPK,anti-Ki67 |
R5463 |
T8797 |
T8798 |
punct |
(,6F |
R5464 |
T8798 |
T8774 |
parataxis |
6F,be |
R5465 |
T8699 |
T8689 |
dobj |
step,impacts |
R5466 |
T8799 |
T8798 |
compound |
Figure,6F |
R5467 |
T8800 |
T8798 |
cc |
and,6F |
R5468 |
T8801 |
T8798 |
conj |
6G,6F |
R5469 |
T8700 |
T8699 |
amod |
earliest,step |
R5470 |
T8802 |
T8798 |
punct |
),6F |
R5471 |
T8803 |
T8766 |
punct |
.,appeared |
R5472 |
T8701 |
T8699 |
prep |
of,step |
R5473 |
T8805 |
T8806 |
mark |
If,stimulates |
R5474 |
T8806 |
T8810 |
advcl |
stimulates,expected |
R5475 |
T8702 |
T8703 |
amod |
epithelial,invagination |
R5476 |
T8807 |
T8808 |
compound |
TGF,β2 |
R5477 |
T8808 |
T8806 |
nsubj |
β2,stimulates |
R5478 |
T8809 |
T8808 |
punct |
-,β2 |
R5479 |
T8703 |
T8701 |
pobj |
invagination,of |
R5480 |
T8811 |
T8812 |
compound |
Snail,expression |
R5481 |
T8812 |
T8806 |
dobj |
expression,stimulates |
R5482 |
T8704 |
T8686 |
punct |
", ",appear |
R5483 |
T8813 |
T8806 |
prep |
in,stimulates |
R5484 |
T8814 |
T8815 |
amod |
developing,buds |
R5485 |
T8815 |
T8813 |
pobj |
buds,in |
R5486 |
T8705 |
T8686 |
nsubj |
it,appear |
R5487 |
T8816 |
T8810 |
punct |
", ",expected |
R5488 |
T8817 |
T8810 |
nsubjpass |
loss,expected |
R5489 |
T8818 |
T8817 |
prep |
of,loss |
R5490 |
T8706 |
T8686 |
aux |
does,appear |
R5491 |
T8819 |
T8820 |
det |
this,morphogen |
R5492 |
T8820 |
T8818 |
pobj |
morphogen,of |
R5493 |
T8707 |
T8686 |
neg |
not,appear |
R5494 |
T8821 |
T8810 |
aux |
would,expected |
R5495 |
T8822 |
T8810 |
auxpass |
be,expected |
R5496 |
T8823 |
T8824 |
aux |
to,affect |
R5497 |
T8708 |
T8709 |
aux |
to,be |
R5498 |
T8824 |
T8810 |
xcomp |
affect,expected |
R5499 |
T8825 |
T8826 |
det |
the,expression |
R5500 |
T8826 |
T8824 |
dobj |
expression,affect |
R5501 |
T8709 |
T8686 |
xcomp |
be,appear |
R5502 |
T8827 |
T8826 |
prep |
of,expression |
R5503 |
T8828 |
T8827 |
pobj |
genes,of |
R5504 |
T8829 |
T8830 |
dep |
that,repressed |
R5505 |
T8830 |
T8828 |
relcl |
repressed,genes |
R5506 |
T8831 |
T8830 |
auxpass |
are,repressed |
R5507 |
T8832 |
T8830 |
advmod |
typically,repressed |
R5508 |
T8710 |
T8709 |
acomp |
essential,be |
R5509 |
T8833 |
T8830 |
agent |
by,repressed |
R5510 |
T8834 |
T8833 |
pobj |
Snail,by |
R5511 |
T8835 |
T8810 |
punct |
.,expected |
R5512 |
T8711 |
T8710 |
prep |
for,essential |
R5513 |
T8712 |
T8713 |
compound |
bud,morphogenesis |
R5514 |
T8837 |
T8838 |
mark |
Since,is |
R5515 |
T8713 |
T8711 |
pobj |
morphogenesis,for |
R5516 |
T8838 |
T8847 |
advcl |
is,investigated |
R5517 |
T8839 |
T8840 |
det |
a,target |
R5518 |
T8714 |
T8686 |
punct |
.,appear |
R5519 |
T8840 |
T8838 |
nsubj |
target,is |
R5520 |
T8841 |
T8840 |
amod |
major,target |
R5521 |
T8842 |
T8840 |
prep |
for,target |
R5522 |
T8843 |
T8844 |
npadvmod |
Snail,mediated |
R5523 |
T8716 |
T8717 |
advcl |
Consistent,took |
R5524 |
T8844 |
T8846 |
amod |
mediated,repression |
R5526 |
T8846 |
T8842 |
pobj |
repression,for |
R5527 |
T8718 |
T8716 |
prep |
with,Consistent |
R5528 |
T8848 |
T8849 |
det |
the,gene |
R5529 |
T8849 |
T8838 |
attr |
gene,is |
R5531 |
T8719 |
T8720 |
det |
this,notion |
R5532 |
T8720 |
T8718 |
pobj |
notion,with |
R5533 |
T8721 |
T8717 |
punct |
", ",took |
R5534 |
T8851 |
T8849 |
compound |
cadherin,gene |
R5535 |
T8722 |
T8723 |
compound |
basement,membrane |
R5536 |
T8723 |
T8724 |
compound |
membrane,remodeling |
R5537 |
T8852 |
T8851 |
punct |
-,cadherin |
R5538 |
T8853 |
T8854 |
punct |
[,13 |
R5539 |
T8854 |
T8838 |
parataxis |
13,is |
R5540 |
T8724 |
T8717 |
nsubj |
remodeling,took |
R5541 |
T8855 |
T8854 |
nummod |
12,13 |
R5542 |
T8856 |
T8854 |
punct |
",",13 |
R5543 |
T8725 |
T8717 |
advmod |
still,took |
R5544 |
T8857 |
T8854 |
punct |
],13 |
R5545 |
T8858 |
T8847 |
punct |
", ",investigated |
R5546 |
T8859 |
T8847 |
nsubj |
we,investigated |
R5547 |
T8726 |
T8717 |
dobj |
place,took |
R5548 |
T8860 |
T8861 |
det |
the,status |
R5549 |
T8861 |
T8847 |
dobj |
status,investigated |
R5550 |
T8727 |
T8717 |
prep |
in,took |
R5551 |
T8862 |
T8861 |
prep |
of,status |
R5552 |
T8863 |
T8864 |
compound |
E,cadherin |
R5553 |
T8864 |
T8862 |
pobj |
cadherin,of |
R5554 |
T8728 |
T8729 |
det |
the,buds |
R5555 |
T8865 |
T8864 |
punct |
-,cadherin |
R5556 |
T8866 |
T8847 |
prep |
in,investigated |
R5557 |
T8867 |
T8868 |
compound |
TGF,β2 |
R5558 |
T8868 |
T8870 |
npadvmod |
β2,null |
R5559 |
T8869 |
T8868 |
punct |
-,β2 |
R5560 |
T8870 |
T8872 |
amod |
null,buds |
R5561 |
T8729 |
T8727 |
pobj |
buds,in |
R5562 |
T8871 |
T8870 |
punct |
-,null |
R5563 |
T8872 |
T8866 |
pobj |
buds,in |
R5564 |
T8873 |
T8847 |
punct |
.,investigated |
R5565 |
T8730 |
T8731 |
compound |
TGF,β2 |
R5566 |
T8875 |
T8876 |
mark |
As,shown |
R5567 |
T8731 |
T8733 |
npadvmod |
β2,null |
R5568 |
T8732 |
T8731 |
punct |
-,β2 |
R5569 |
T8733 |
T8729 |
amod |
null,buds |
R5570 |
T8734 |
T8733 |
punct |
-,null |
R5571 |
T8876 |
T8877 |
advcl |
shown,displayed |
R5572 |
T8735 |
T8717 |
punct |
", ",took |
R5573 |
T8878 |
T8876 |
prep |
in,shown |
R5574 |
T8736 |
T8737 |
mark |
as,judged |
R5575 |
T8879 |
T8880 |
compound |
Figure,6H |
R5576 |
T8880 |
T8878 |
pobj |
6H,in |
R5577 |
T8881 |
T8877 |
punct |
", ",displayed |
R5578 |
T8737 |
T8717 |
advcl |
judged,took |
R5579 |
T8882 |
T8883 |
compound |
hair,buds |
R5580 |
T8883 |
T8877 |
nsubj |
buds,displayed |
R5581 |
T8884 |
T8883 |
prep |
in,buds |
R5582 |
T8738 |
T8737 |
prep |
by,judged |
R5583 |
T8885 |
T8886 |
compound |
TGF,β2 |
R5584 |
T8886 |
T8888 |
npadvmod |
β2,null |
R5585 |
T8887 |
T8886 |
punct |
-,β2 |
R5586 |
T8739 |
T8738 |
pobj |
immunofluorescence,by |
R5587 |
T8888 |
T8889 |
amod |
null,skin |
R5588 |
T8889 |
T8884 |
pobj |
skin,in |
R5589 |
T8740 |
T8739 |
prep |
with,immunofluorescence |
R5590 |
T8890 |
T8891 |
amod |
elevated,staining |
R5591 |
T8891 |
T8877 |
dobj |
staining,displayed |
R5592 |
T8892 |
T8891 |
compound |
immunofluorescence,staining |
R5593 |
T8741 |
T8740 |
pobj |
antibodies,with |
R5594 |
T8893 |
T8877 |
advcl |
relative,displayed |
R5595 |
T8894 |
T8893 |
prep |
to,relative |
R5596 |
T8895 |
T8896 |
poss |
their,counterparts |
R5597 |
T8742 |
T8741 |
prep |
against,antibodies |
R5598 |
T8896 |
T8894 |
pobj |
counterparts,to |
R5599 |
T8897 |
T8896 |
compound |
WT,counterparts |
R5600 |
T8898 |
T8877 |
punct |
.,displayed |
R5601 |
T8743 |
T8744 |
compound |
β4,integrin |
R5602 |
T8900 |
T8901 |
advmod |
Previously,demonstrated |
R5603 |
T8744 |
T8742 |
pobj |
integrin,against |
R5604 |
T8902 |
T8901 |
nsubj |
we,demonstrated |
R5605 |
T8903 |
T8904 |
mark |
that,required |
R5606 |
T8745 |
T8744 |
punct |
", ",integrin |
R5607 |
T8904 |
T8901 |
ccomp |
required,demonstrated |
R5608 |
T8905 |
T8906 |
det |
the,action |
R5609 |
T8906 |
T8904 |
nsubjpass |
action,required |
R5610 |
T8907 |
T8906 |
amod |
concerted,action |
R5611 |
T8908 |
T8906 |
prep |
of,action |
R5612 |
T8746 |
T8747 |
det |
an,component |
R5613 |
T8909 |
T8910 |
det |
the,signals |
R5614 |
T8910 |
T8908 |
pobj |
signals,of |
R5615 |
T8911 |
T8910 |
amod |
extracellular,signals |
R5616 |
T8747 |
T8744 |
appos |
component,integrin |
R5617 |
T8912 |
T8910 |
appos |
Wnt,signals |
R5618 |
T8913 |
T8912 |
cc |
and,Wnt |
R5619 |
T8914 |
T8912 |
conj |
noggin,Wnt |
R5620 |
T8748 |
T8747 |
amod |
integral,component |
R5621 |
T8915 |
T8904 |
auxpass |
are,required |
R5622 |
T8916 |
T8917 |
mark |
for,repress |
R5623 |
T8749 |
T8747 |
prep |
of,component |
R5624 |
T8750 |
T8751 |
npadvmod |
keratinocyte,mediated |
R5625 |
T8917 |
T8904 |
advcl |
repress,required |
R5626 |
T8918 |
T8919 |
det |
the,generation |
R5627 |
T8751 |
T8753 |
amod |
mediated,adhesion |
R5628 |
T8919 |
T8917 |
nsubj |
generation,repress |
R5629 |
T8920 |
T8919 |
prep |
of,generation |
R5630 |
T8921 |
T8922 |
det |
a,complex |
R5631 |
T8752 |
T8751 |
punct |
-,mediated |
R5632 |
T8922 |
T8920 |
pobj |
complex,of |
R5633 |
T8923 |
T8922 |
nmod |
LEF,complex |
R5634 |
T8924 |
T8923 |
punct |
-,LEF |
R5635 |
T8753 |
T8749 |
pobj |
adhesion,of |
R5636 |
T8925 |
T8923 |
nummod |
1,LEF |
R5637 |
T8926 |
T8923 |
punct |
/,LEF |
R5638 |
T8927 |
T8928 |
compound |
β,catenin |
R5639 |
T8754 |
T8753 |
prep |
to,adhesion |
R5640 |
T8928 |
T8923 |
appos |
catenin,LEF |
R5641 |
T8929 |
T8928 |
punct |
-,catenin |
R5642 |
T8755 |
T8756 |
poss |
its,membrane |
R5643 |
T8930 |
T8922 |
compound |
transcription,complex |
R5644 |
T8931 |
T8917 |
aux |
to,repress |
R5645 |
T8932 |
T8933 |
compound |
E,cadherin |
R5646 |
T8756 |
T8754 |
pobj |
membrane,to |
R5647 |
T8933 |
T8935 |
compound |
cadherin,transcription |
R5648 |
T8934 |
T8933 |
punct |
-,cadherin |
R5649 |
T8757 |
T8756 |
amod |
underlying,membrane |
R5650 |
T8935 |
T8917 |
dobj |
transcription,repress |
R5651 |
T8936 |
T8917 |
prep |
at,repress |
R5652 |
T8937 |
T8938 |
det |
the,onset |
R5653 |
T8758 |
T8756 |
compound |
basement,membrane |
R5654 |
T8938 |
T8936 |
pobj |
onset,at |
R5655 |
T8939 |
T8938 |
prep |
of,onset |
R5656 |
T8759 |
T8760 |
punct |
(,6F |
R5657 |
T8940 |
T8941 |
compound |
hair,fate |
R5658 |
T8941 |
T8942 |
compound |
fate,specification |
R5659 |
T8942 |
T8939 |
pobj |
specification,of |
R5660 |
T8943 |
T8901 |
punct |
.,demonstrated |
R5661 |
T8760 |
T8717 |
parataxis |
6F,took |
R5662 |
T8945 |
T8946 |
mark |
As,shown |
R5663 |
T8946 |
T8947 |
advcl |
shown,exhibited |
R5664 |
T8948 |
T8946 |
prep |
in,shown |
R5665 |
T8761 |
T8760 |
compound |
Figure,6F |
R5666 |
T8949 |
T8950 |
compound |
Figure,6I |
R5667 |
T8950 |
T8948 |
pobj |
6I,in |
R5668 |
T8762 |
T8760 |
punct |
),6F |
R5669 |
T8951 |
T8950 |
cc |
and,6I |
R5670 |
T8952 |
T8950 |
conj |
6J,6I |
R5671 |
T8953 |
T8947 |
punct |
", ",exhibited |
R5672 |
T8763 |
T8717 |
punct |
.,took |
R5673 |
T8954 |
T8955 |
preconj |
both,WT |
R5674 |
T8955 |
T8956 |
npadvmod |
WT,null |
R5675 |
T8765 |
T8766 |
prep |
In,appeared |
R5676 |
T8956 |
T8961 |
amod |
null,buds |
R5677 |
T8957 |
T8955 |
cc |
and,WT |
R5678 |
T8958 |
T8959 |
compound |
TGF,β2 |
R5679 |
T8959 |
T8955 |
conj |
β2,WT |
R5680 |
T8960 |
T8959 |
punct |
-,β2 |
R5681 |
T8767 |
T8765 |
pobj |
contrast,In |
R5682 |
T8961 |
T8947 |
nsubj |
buds,exhibited |
R5683 |
T8962 |
T8963 |
amod |
nuclear,localization |
R5684 |
T8963 |
T8947 |
dobj |
localization,exhibited |
R5685 |
T8964 |
T8963 |
nmod |
LEF,localization |
R5686 |
T8768 |
T8766 |
punct |
", ",appeared |
R5687 |
T8965 |
T8964 |
punct |
-,LEF |
R5688 |
T8966 |
T8964 |
nummod |
1,LEF |
R5689 |
T8967 |
T8964 |
cc |
and,LEF |
R5690 |
T8769 |
T8770 |
compound |
TGF,β2 |
R5691 |
T8968 |
T8969 |
compound |
β,catenin |
R5692 |
T8969 |
T8964 |
conj |
catenin,LEF |
R5693 |
T8970 |
T8969 |
punct |
-,catenin |
R5694 |
T8982 |
T8947 |
punct |
.,exhibited |
R5695 |
T8971 |
T8947 |
punct |
", ",exhibited |
R5696 |
T8972 |
T8947 |
npadvmod |
signs,exhibited |
R5697 |
T8973 |
T8974 |
mark |
that,was |
R5698 |
T8974 |
T8972 |
acl |
was,signs |
R5699 |
T8975 |
T8976 |
det |
the,pathway |
R5700 |
T8976 |
T8974 |
nsubj |
pathway,was |
R5701 |
T8977 |
T8978 |
compound |
Wnt,noggin |
R5702 |
T8984 |
T8985 |
det |
These,data |
R5703 |
T8978 |
T8976 |
compound |
noggin,pathway |
R5704 |
T8979 |
T8978 |
punct |
-,noggin |
R5705 |
T8980 |
T8976 |
compound |
signaling,pathway |
R5706 |
T8981 |
T8974 |
acomp |
intact,was |
R5707 |
T8985 |
T8986 |
nsubj |
data,suggest |
R5708 |
T8987 |
T8988 |
mark |
that,functions |
R5709 |
T8988 |
T8986 |
ccomp |
functions,suggest |
R5710 |
T8989 |
T8988 |
prep |
during,functions |
R5711 |
T8990 |
T8991 |
compound |
hair,follicle |
R5712 |
T8991 |
T8992 |
compound |
follicle,morphogenesis |
R5713 |
T8992 |
T8989 |
pobj |
morphogenesis,during |
R5714 |
T8993 |
T8988 |
punct |
", ",functions |
R5715 |
T8994 |
T8995 |
compound |
TGF,β2 |
R5716 |
T8995 |
T8988 |
nsubj |
β2,functions |
R5717 |
T8996 |
T8995 |
punct |
-,β2 |
R5718 |
T8997 |
T8988 |
advmod |
subsequently,functions |
R5719 |
T8998 |
T8997 |
prep |
to,subsequently |
R5720 |
T8999 |
T9000 |
compound |
Wnt,noggin |
R5721 |
T9000 |
T9002 |
npadvmod |
noggin,mediated |
R5722 |
T9001 |
T9000 |
punct |
/,noggin |
R5723 |
T9002 |
T9004 |
amod |
mediated,determination |
R5724 |
T9003 |
T9002 |
punct |
-,mediated |
R5725 |
T9004 |
T8998 |
pobj |
determination,to |
R5726 |
T9005 |
T9004 |
prep |
of,determination |
R5727 |
T9006 |
T9007 |
compound |
hair,fate |
R5728 |
T9007 |
T9005 |
pobj |
fate,of |
R5772 |
T9102 |
T9103 |
prep |
During,govern |
R5773 |
T9104 |
T9105 |
compound |
budding,morphogenesis |
R5774 |
T9105 |
T9102 |
pobj |
morphogenesis,During |
R5775 |
T9106 |
T9103 |
punct |
", ",govern |
R5776 |
T9107 |
T9108 |
amod |
intersecting,networks |
R5777 |
T9108 |
T9103 |
nsubj |
networks,govern |
R5778 |
T9109 |
T9108 |
compound |
signaling,networks |
R5779 |
T9110 |
T9108 |
prep |
from,networks |
R5780 |
T9111 |
T9112 |
det |
the,epithelium |
R5781 |
T9112 |
T9110 |
pobj |
epithelium,from |
R5782 |
T9113 |
T9112 |
cc |
and,epithelium |
R5783 |
T9114 |
T9112 |
conj |
mesenchyme,epithelium |
R5784 |
T9115 |
T9116 |
amod |
transcriptional,programs |
R5785 |
T9116 |
T9103 |
dobj |
programs,govern |
R5786 |
T9117 |
T9115 |
punct |
", ",transcriptional |
R5787 |
T9118 |
T9115 |
conj |
adhesive,transcriptional |
R5788 |
T9119 |
T9118 |
punct |
", ",adhesive |
R5789 |
T9120 |
T9118 |
conj |
polarity,adhesive |
R5790 |
T9121 |
T9120 |
punct |
", ",polarity |
R5791 |
T9122 |
T9120 |
cc |
and,polarity |
R5792 |
T9123 |
T9120 |
conj |
motility,polarity |
R5793 |
T9124 |
T9103 |
prep |
in,govern |
R5794 |
T9125 |
T9126 |
det |
these,groups |
R5795 |
T9126 |
T9124 |
pobj |
groups,in |
R5796 |
T9127 |
T9126 |
amod |
select,groups |
R5797 |
T9128 |
T9126 |
prep |
of,groups |
R5798 |
T9129 |
T9128 |
pobj |
cells,of |
R5799 |
T9130 |
T9103 |
punct |
.,govern |
R5800 |
T9132 |
T9133 |
det |
The,changes |
R5801 |
T9133 |
T9138 |
nsubj |
changes,form |
R5802 |
T9134 |
T9133 |
amod |
dynamic,changes |
R5803 |
T9135 |
T9133 |
amod |
nuclear,changes |
R5804 |
T9136 |
T9135 |
cc |
and,nuclear |
R5805 |
T9137 |
T9135 |
conj |
cytosolic,nuclear |
R5806 |
T9139 |
T9140 |
dep |
that,take |
R5807 |
T9140 |
T9133 |
relcl |
take,changes |
R5808 |
T9141 |
T9140 |
dobj |
place,take |
R5809 |
T9142 |
T9140 |
prep |
during,take |
R5810 |
T9143 |
T9144 |
det |
this,time |
R5811 |
T9144 |
T9142 |
pobj |
time,during |
R5812 |
T9145 |
T9146 |
det |
the,cornerstone |
R5813 |
T9146 |
T9138 |
dobj |
cornerstone,form |
R5814 |
T9147 |
T9146 |
prep |
for,cornerstone |
R5815 |
T9148 |
T9149 |
compound |
organ,morphogenesis |
R5816 |
T9149 |
T9147 |
pobj |
morphogenesis,for |
R5817 |
T9150 |
T9138 |
punct |
.,form |
R5818 |
T9152 |
T9153 |
nummod |
Two,challenges |
R5819 |
T9153 |
T9155 |
nsubj |
challenges,are |
R5820 |
T9154 |
T9153 |
amod |
major,challenges |
R5821 |
T9156 |
T9153 |
prep |
in,challenges |
R5822 |
T9157 |
T9156 |
pcomp |
understanding,in |
R5823 |
T9158 |
T9159 |
det |
the,mechanisms |
R5824 |
T9159 |
T9157 |
dobj |
mechanisms,understanding |
R5825 |
T9160 |
T9159 |
acl |
underlying,mechanisms |
R5826 |
T9161 |
T9162 |
det |
a,process |
R5827 |
T9162 |
T9160 |
dobj |
process,underlying |
R5828 |
T9163 |
T9162 |
amod |
particular,process |
R5829 |
T9164 |
T9162 |
compound |
budding,process |
R5830 |
T9165 |
T9166 |
aux |
to,order |
R5831 |
T9166 |
T9155 |
xcomp |
order,are |
R5832 |
T9167 |
T9168 |
det |
the,sequence |
R5833 |
T9168 |
T9166 |
dobj |
sequence,order |
R5834 |
T9169 |
T9168 |
amod |
temporal,sequence |
R5835 |
T9170 |
T9168 |
prep |
of,sequence |
R5836 |
T9171 |
T9172 |
amod |
external,cues |
R5837 |
T9172 |
T9170 |
pobj |
cues,of |
R5838 |
T9173 |
T9172 |
acl |
involved,cues |
R5839 |
T9174 |
T9166 |
cc |
and,order |
R5840 |
T9175 |
T9176 |
advmod |
then,dissect |
R5841 |
T9176 |
T9166 |
conj |
dissect,order |
R5842 |
T9177 |
T9176 |
aux |
to,dissect |
R5843 |
T9178 |
T9179 |
advmod |
how,translate |
R5844 |
T9179 |
T9176 |
ccomp |
translate,dissect |
R5845 |
T9180 |
T9181 |
det |
the,cells |
R5846 |
T9181 |
T9179 |
nsubj |
cells,translate |
R5847 |
T9182 |
T9181 |
prep |
of,cells |
R5848 |
T9183 |
T9184 |
det |
the,bud |
R5849 |
T9184 |
T9182 |
pobj |
bud,of |
R5850 |
T9185 |
T9184 |
amod |
developing,bud |
R5851 |
T9186 |
T9187 |
det |
these,signals |
R5852 |
T9187 |
T9179 |
dobj |
signals,translate |
R5853 |
T9188 |
T9179 |
prep |
into,translate |
R5854 |
T9189 |
T9190 |
det |
the,events |
R5855 |
T9190 |
T9188 |
pobj |
events,into |
R5856 |
T9191 |
T9190 |
amod |
downstream,events |
R5857 |
T9192 |
T9190 |
prep |
of,events |
R5858 |
T9193 |
T9194 |
amod |
cellular,remodeling |
R5859 |
T9194 |
T9192 |
pobj |
remodeling,of |
R5860 |
T9195 |
T9194 |
punct |
", ",remodeling |
R5861 |
T9196 |
T9194 |
conj |
proliferation,remodeling |
R5862 |
T9197 |
T9196 |
punct |
", ",proliferation |
R5863 |
T9198 |
T9196 |
cc |
and,proliferation |
R5864 |
T9199 |
T9196 |
conj |
differentiation,proliferation |
R5865 |
T9200 |
T9155 |
punct |
.,are |
R5866 |
T9202 |
T9203 |
poss |
Our,studies |
R5867 |
T9203 |
T9204 |
nsubj |
studies,provide |
R5868 |
T9205 |
T9203 |
advmod |
here,studies |
R5869 |
T9206 |
T9207 |
det |
some,insights |
R5870 |
T9207 |
T9204 |
dobj |
insights,provide |
R5871 |
T9208 |
T9207 |
prep |
into,insights |
R5872 |
T9209 |
T9210 |
advmod |
how,orchestrated |
R5873 |
T9210 |
T9208 |
pcomp |
orchestrated,into |
R5874 |
T9211 |
T9212 |
det |
these,events |
R5875 |
T9212 |
T9210 |
nsubjpass |
events,orchestrated |
R5876 |
T9213 |
T9210 |
auxpass |
are,orchestrated |
R5877 |
T9214 |
T9210 |
prep |
during,orchestrated |
R5878 |
T9215 |
T9216 |
compound |
hair,bud |
R5879 |
T9216 |
T9217 |
compound |
bud,formation |
R5880 |
T9217 |
T9214 |
pobj |
formation,during |
R5881 |
T9218 |
T9210 |
prep |
in,orchestrated |
R5882 |
T9219 |
T9220 |
amod |
developing,skin |
R5883 |
T9220 |
T9218 |
pobj |
skin,in |
R5884 |
T9221 |
T9204 |
punct |
.,provide |
R5895 |
T9654 |
T9653 |
prep |
during,Signaling |
R5896 |
T9655 |
T9656 |
amod |
Early,Morphogenesis |
R5897 |
T9656 |
T9654 |
pobj |
Morphogenesis,during |
R5898 |
T9657 |
T9658 |
compound |
Hair,Follicle |
R5899 |
T9658 |
T9656 |
compound |
Follicle,Morphogenesis |
R5900 |
T9660 |
T9661 |
amod |
Recent,studies |
R5901 |
T9661 |
T9662 |
nsubj |
studies,suggest |
R5902 |
T9663 |
T9661 |
prep |
on,studies |
R5903 |
T9664 |
T9665 |
compound |
hair,bud |
R5904 |
T9665 |
T9666 |
compound |
bud,morphogenesis |
R5905 |
T9666 |
T9663 |
pobj |
morphogenesis,on |
R5906 |
T9667 |
T9668 |
mark |
that,converge |
R5907 |
T9668 |
T9662 |
ccomp |
converge,suggest |
R5908 |
T9669 |
T9670 |
compound |
Wnt,signals |
R5909 |
T9670 |
T9668 |
nsubj |
signals,converge |
R5910 |
T9671 |
T9672 |
advmod |
likely,from |
R5911 |
T9672 |
T9670 |
prep |
from,signals |
R5912 |
T9673 |
T9674 |
det |
the,epithelium |
R5913 |
T9674 |
T9672 |
pobj |
epithelium,from |
R5914 |
T9675 |
T9670 |
cc |
and,signals |
R5915 |
T9676 |
T9677 |
nmod |
BMP,signals |
R5916 |
T9677 |
T9670 |
conj |
signals,signals |
R5917 |
T9678 |
T9677 |
amod |
inhibitory,signals |
R5918 |
T9679 |
T9677 |
prep |
from,signals |
R5919 |
T9680 |
T9681 |
det |
the,mesenchyme |
R5920 |
T9681 |
T9679 |
pobj |
mesenchyme,from |
R5921 |
T9682 |
T9681 |
amod |
underlying,mesenchyme |
R5922 |
T9683 |
T9684 |
aux |
to,produce |
R5923 |
T9684 |
T9668 |
advcl |
produce,converge |
R5924 |
T9685 |
T9686 |
det |
an,complex |
R5925 |
T9686 |
T9684 |
dobj |
complex,produce |
R5926 |
T9687 |
T9686 |
amod |
active,complex |
R5927 |
T9688 |
T9689 |
compound |
transcription,factor |
R5928 |
T9689 |
T9686 |
compound |
factor,complex |
R5929 |
T9690 |
T9686 |
acl |
involving,complex |
R5930 |
T9691 |
T9692 |
compound |
β,catenin |
R5931 |
T9692 |
T9690 |
dobj |
catenin,involving |
R5932 |
T9693 |
T9692 |
punct |
-,catenin |
R5933 |
T9694 |
T9692 |
cc |
and,catenin |
R5934 |
T9695 |
T9692 |
conj |
LEF,catenin |
R5935 |
T9696 |
T9695 |
punct |
-,LEF |
R5936 |
T9697 |
T9695 |
nummod |
1,LEF |
R5937 |
T9698 |
T9686 |
punct |
", ",complex |
R5938 |
T9699 |
T9700 |
dep |
which,plays |
R5939 |
T9700 |
T9686 |
relcl |
plays,complex |
R5940 |
T9701 |
T9700 |
prep |
in,plays |
R5941 |
T9702 |
T9701 |
pobj |
turn,in |
R5942 |
T9703 |
T9704 |
det |
a,role |
R5943 |
T9704 |
T9700 |
dobj |
role,plays |
R5944 |
T9705 |
T9704 |
amod |
key,role |
R5945 |
T9706 |
T9700 |
prep |
in,plays |
R5946 |
T9707 |
T9706 |
pcomp |
specifying,in |
R5947 |
T9708 |
T9709 |
det |
the,fate |
R5948 |
T9709 |
T9707 |
dobj |
fate,specifying |
R5949 |
T9710 |
T9711 |
compound |
hair,follicle |
R5950 |
T9711 |
T9709 |
compound |
follicle,fate |
R5951 |
T9712 |
T9713 |
punct |
[,37 |
R5952 |
T9713 |
T9684 |
parataxis |
37,produce |
R5953 |
T9714 |
T9713 |
nummod |
4,37 |
R5954 |
T9715 |
T9713 |
punct |
",",37 |
R5955 |
T9716 |
T9713 |
nummod |
29,37 |
R5956 |
T9717 |
T9713 |
punct |
",",37 |
R5957 |
T9718 |
T9713 |
nummod |
30,37 |
R5958 |
T9719 |
T9713 |
punct |
",",37 |
R5959 |
T9720 |
T9713 |
nummod |
36,37 |
R5960 |
T9721 |
T9713 |
punct |
",",37 |
R5961 |
T9722 |
T9713 |
punct |
],37 |
R5962 |
T9723 |
T9662 |
punct |
.,suggest |
R5963 |
T9725 |
T9726 |
amod |
Sonic,hedgehog |
R5964 |
T9726 |
T9727 |
nsubj |
hedgehog,play |
R5965 |
T9728 |
T9726 |
punct |
(,hedgehog |
R5966 |
T9729 |
T9726 |
appos |
Shh,hedgehog |
R5967 |
T9730 |
T9726 |
punct |
),hedgehog |
R5968 |
T9731 |
T9726 |
cc |
and,hedgehog |
R5969 |
T9732 |
T9733 |
compound |
TGF,β2 |
R5970 |
T9733 |
T9735 |
compound |
β2,signaling |
R5971 |
T9734 |
T9733 |
punct |
-,β2 |
R5972 |
T9735 |
T9726 |
conj |
signaling,hedgehog |
R5973 |
T9736 |
T9727 |
advmod |
also,play |
R5974 |
T9737 |
T9738 |
amod |
essential,roles |
R5975 |
T9738 |
T9727 |
dobj |
roles,play |
R5976 |
T9739 |
T9727 |
prep |
in,play |
R5977 |
T9740 |
T9741 |
compound |
follicle,morphogenesis |
R5978 |
T9741 |
T9739 |
pobj |
morphogenesis,in |
R5979 |
T9742 |
T9727 |
punct |
", ",play |
R5980 |
T9743 |
T9727 |
cc |
but,play |
R5981 |
T9744 |
T9745 |
prep |
in,form |
R5982 |
T9745 |
T9727 |
conj |
form,play |
R5983 |
T9746 |
T9744 |
pobj |
contrast,in |
R5984 |
T9747 |
T9746 |
prep |
to,contrast |
R5985 |
T9748 |
T9749 |
compound |
β,catenin |
R5986 |
T9749 |
T9751 |
npadvmod |
catenin,null |
R5987 |
T9750 |
T9749 |
punct |
-,catenin |
R5988 |
T9751 |
T9752 |
amod |
null,skin |
R5989 |
T9752 |
T9747 |
pobj |
skin,to |
R5990 |
T9753 |
T9752 |
punct |
", ",skin |
R5991 |
T9754 |
T9755 |
prep |
in,are |
R5992 |
T9755 |
T9752 |
relcl |
are,skin |
R5993 |
T9756 |
T9754 |
pobj |
which,in |
R5994 |
T9757 |
T9758 |
compound |
follicle,invaginations |
R5995 |
T9758 |
T9755 |
nsubj |
invaginations,are |
R5996 |
T9759 |
T9755 |
acomp |
absent,are |
R5997 |
T9760 |
T9761 |
punct |
[,30 |
R5998 |
T9761 |
T9747 |
parataxis |
30,to |
R5999 |
T9762 |
T9761 |
punct |
],30 |
R6000 |
T9763 |
T9745 |
punct |
", ",form |
R6001 |
T9764 |
T9765 |
det |
some,buds |
R6002 |
T9765 |
T9745 |
nsubj |
buds,form |
R6003 |
T9766 |
T9765 |
compound |
hair,buds |
R6004 |
T9767 |
T9745 |
advmod |
still,form |
R6005 |
T9768 |
T9745 |
prep |
in,form |
R6006 |
T9769 |
T9770 |
det |
the,absence |
R6007 |
T9770 |
T9768 |
pobj |
absence,in |
R6008 |
T9771 |
T9770 |
prep |
of,absence |
R6009 |
T9772 |
T9771 |
pobj |
LEF,of |
R6010 |
T9773 |
T9772 |
punct |
-,LEF |
R6011 |
T9774 |
T9772 |
nummod |
1,LEF |
R6012 |
T9775 |
T9772 |
punct |
", ",LEF |
R6013 |
T9776 |
T9772 |
conj |
Shh,LEF |
R6014 |
T9777 |
T9776 |
punct |
", ",Shh |
R6015 |
T9778 |
T9776 |
cc |
or,Shh |
R6016 |
T9779 |
T9780 |
compound |
TGF,β2 |
R6017 |
T9780 |
T9776 |
conj |
β2,Shh |
R6018 |
T9781 |
T9780 |
punct |
-,β2 |
R6019 |
T9782 |
T9783 |
punct |
[,38 |
R6020 |
T9783 |
T9745 |
parataxis |
38,form |
R6021 |
T9784 |
T9783 |
nummod |
32,38 |
R6022 |
T9785 |
T9783 |
punct |
",",38 |
R6023 |
T9786 |
T9783 |
punct |
],38 |
R6024 |
T9787 |
T9745 |
punct |
.,form |
R6025 |
T9789 |
T9790 |
nsubj |
These,reflect |
R6026 |
T9791 |
T9790 |
advmod |
likely,reflect |
R6027 |
T9792 |
T9793 |
det |
the,wave |
R6028 |
T9793 |
T9790 |
dobj |
wave,reflect |
R6029 |
T9794 |
T9793 |
amod |
first,wave |
R6030 |
T9795 |
T9793 |
prep |
of,wave |
R6031 |
T9796 |
T9797 |
nmod |
follicle,morphogenesis |
R6032 |
T9797 |
T9795 |
pobj |
morphogenesis,of |
R6033 |
T9798 |
T9799 |
punct |
(,hair |
R6034 |
T9799 |
T9797 |
parataxis |
hair,morphogenesis |
R6035 |
T9800 |
T9799 |
advmod |
i.e.,hair |
R6036 |
T9801 |
T9799 |
punct |
", ",hair |
R6037 |
T9802 |
T9799 |
compound |
guard,hair |
R6038 |
T9803 |
T9799 |
punct |
),hair |
R6039 |
T9804 |
T9793 |
punct |
", ",wave |
R6040 |
T9805 |
T9806 |
dep |
which,accounts |
R6041 |
T9806 |
T9793 |
relcl |
accounts,wave |
R6042 |
T9807 |
T9806 |
prep |
for,accounts |
R6043 |
T9808 |
T9809 |
det |
a,number |
R6044 |
T9809 |
T9807 |
pobj |
number,for |
R6045 |
T9810 |
T9809 |
amod |
small,number |
R6046 |
T9811 |
T9809 |
punct |
(,number |
R6047 |
T9812 |
T9813 |
amod |
fewer,5 |
R6048 |
T9813 |
T9815 |
nummod |
5,% |
R6049 |
T9814 |
T9813 |
quantmod |
than,5 |
R6050 |
T9815 |
T9809 |
appos |
%,number |
R6051 |
T9816 |
T9809 |
punct |
),number |
R6052 |
T9817 |
T9809 |
prep |
of,number |
R6053 |
T9818 |
T9817 |
pobj |
hairs,of |
R6054 |
T9819 |
T9806 |
cc |
and,accounts |
R6055 |
T9820 |
T9806 |
conj |
is,accounts |
R6056 |
T9821 |
T9820 |
prep |
under,is |
R6057 |
T9822 |
T9823 |
amod |
distinct,control |
R6058 |
T9823 |
T9821 |
pobj |
control,under |
R6059 |
T9824 |
T9823 |
amod |
regulatory,control |
R6060 |
T9825 |
T9790 |
punct |
.,reflect |
R6061 |
T9827 |
T9828 |
compound |
Guard,hairs |
R6062 |
T9828 |
T9829 |
nsubj |
hairs,form |
R6063 |
T9830 |
T9829 |
prep |
in,form |
R6064 |
T9831 |
T9832 |
det |
the,absence |
R6065 |
T9832 |
T9830 |
pobj |
absence,in |
R6066 |
T9833 |
T9832 |
prep |
of,absence |
R6067 |
T9834 |
T9833 |
pobj |
LEF,of |
R6068 |
T9835 |
T9834 |
punct |
-,LEF |
R6069 |
T9836 |
T9834 |
nummod |
1,LEF |
R6070 |
T9837 |
T9834 |
cc |
and,LEF |
R6071 |
T9838 |
T9839 |
compound |
TGF,β2 |
R6072 |
T9839 |
T9834 |
conj |
β2,LEF |
R6073 |
T9840 |
T9839 |
punct |
-,β2 |
R6074 |
T9841 |
T9829 |
punct |
", ",form |
R6075 |
T9842 |
T9829 |
cc |
and,form |
R6076 |
T9843 |
T9844 |
nsubj |
we,found |
R6077 |
T9844 |
T9829 |
conj |
found,form |
R6078 |
T9845 |
T9844 |
aux |
have,found |
R6079 |
T9846 |
T9847 |
mark |
that,fail |
R6080 |
T9847 |
T9844 |
ccomp |
fail,found |
R6081 |
T9848 |
T9847 |
nsubj |
they,fail |
R6082 |
T9849 |
T9847 |
advmod |
also,fail |
R6083 |
T9850 |
T9851 |
aux |
to,express |
R6084 |
T9851 |
T9847 |
xcomp |
express,fail |
R6085 |
T9852 |
T9851 |
dobj |
Snail,express |
R6086 |
T9853 |
T9847 |
prep |
at,fail |
R6087 |
T9854 |
T9855 |
det |
the,stage |
R6088 |
T9855 |
T9853 |
pobj |
stage,at |
R6089 |
T9856 |
T9855 |
compound |
budding,stage |
R6090 |
T9857 |
T9855 |
prep |
of,stage |
R6091 |
T9858 |
T9857 |
pobj |
development,of |
R6092 |
T9859 |
T9860 |
punct |
(,data |
R6093 |
T9860 |
T9844 |
meta |
data,found |
R6094 |
T9861 |
T9860 |
amod |
unpublished,data |
R6095 |
T9862 |
T9860 |
punct |
),data |
R6096 |
T9863 |
T9844 |
punct |
.,found |
R6097 |
T9865 |
T9866 |
advmod |
How,regulated |
R6098 |
T9866 |
T9871 |
csubj |
regulated,remains |
R6099 |
T9867 |
T9868 |
compound |
E,cadherin |
R6100 |
T9868 |
T9866 |
nsubjpass |
cadherin,regulated |
R6101 |
T9869 |
T9868 |
punct |
-,cadherin |
R6102 |
T9870 |
T9866 |
auxpass |
is,regulated |
R6103 |
T9872 |
T9866 |
prep |
in,regulated |
R6104 |
T9873 |
T9874 |
compound |
guard,hairs |
R6105 |
T9874 |
T9872 |
pobj |
hairs,in |
R6106 |
T9875 |
T9876 |
aux |
to,determined |
R6107 |
T9876 |
T9871 |
xcomp |
determined,remains |
R6108 |
T9877 |
T9876 |
auxpass |
be,determined |
R6109 |
T9878 |
T9871 |
punct |
.,remains |
R6110 |
T9880 |
T9881 |
amod |
Several,candidates |
R6111 |
T9881 |
T9882 |
nsubj |
candidates,include |
R6112 |
T9883 |
T9884 |
amod |
other,members |
R6113 |
T9884 |
T9882 |
dobj |
members,include |
R6114 |
T9885 |
T9884 |
compound |
Snail,members |
R6115 |
T9886 |
T9884 |
compound |
family,members |
R6116 |
T9887 |
T9888 |
amod |
such,as |
R6117 |
T9888 |
T9884 |
prep |
as,members |
R6118 |
T9889 |
T9888 |
pobj |
Slug,as |
R6119 |
T9890 |
T9889 |
cc |
or,Slug |
R6120 |
T9891 |
T9889 |
conj |
twist,Slug |
R6121 |
T9892 |
T9884 |
punct |
", ",members |
R6122 |
T9893 |
T9884 |
cc |
or,members |
R6123 |
T9894 |
T9895 |
advmod |
alternatively,factors |
R6124 |
T9895 |
T9884 |
conj |
factors,members |
R6125 |
T9896 |
T9895 |
punct |
", ",factors |
R6126 |
T9897 |
T9895 |
compound |
transcription,factors |
R6127 |
T9898 |
T9895 |
acl |
involving,factors |
R6128 |
T9899 |
T9900 |
compound |
β,catenin |
R6129 |
T9900 |
T9898 |
dobj |
catenin,involving |
R6130 |
T9901 |
T9900 |
punct |
-,catenin |
R6131 |
T9902 |
T9900 |
cc |
and,catenin |
R6132 |
T9903 |
T9904 |
det |
a,member |
R6133 |
T9904 |
T9900 |
conj |
member,catenin |
R6134 |
T9905 |
T9904 |
amod |
different,member |
R6135 |
T9906 |
T9904 |
prep |
of,member |
R6136 |
T9907 |
T9908 |
det |
the,family |
R6137 |
T9908 |
T9906 |
pobj |
family,of |
R6138 |
T9909 |
T9910 |
nmod |
LEF,box |
R6139 |
T9910 |
T9908 |
nmod |
box,family |
R6140 |
T9911 |
T9909 |
punct |
-,LEF |
R6141 |
T9912 |
T9909 |
nummod |
1,LEF |
R6142 |
T9913 |
T9909 |
punct |
/,LEF |
R6143 |
T9914 |
T9909 |
appos |
TCF,LEF |
R6144 |
T9915 |
T9909 |
punct |
/,LEF |
R6145 |
T9916 |
T9917 |
compound |
Sry,type |
R6146 |
T9917 |
T9909 |
appos |
type,LEF |
R6147 |
T9918 |
T9917 |
punct |
-,type |
R6148 |
T9919 |
T9910 |
nmod |
HMG,box |
R6149 |
T9920 |
T9921 |
punct |
(,known |
R6150 |
T9921 |
T9910 |
parataxis |
known,box |
R6151 |
T9922 |
T9921 |
advmod |
commonly,known |
R6152 |
T9923 |
T9921 |
prep |
as,known |
R6153 |
T9924 |
T9923 |
pobj |
SOX,as |
R6154 |
T9925 |
T9921 |
punct |
),known |
R6155 |
T9926 |
T9927 |
punct |
[,40 |
R6156 |
T9927 |
T9882 |
parataxis |
40,include |
R6157 |
T9928 |
T9927 |
nummod |
39,40 |
R6158 |
T9929 |
T9927 |
punct |
",",40 |
R6159 |
T9930 |
T9927 |
punct |
],40 |
R6160 |
T9931 |
T9882 |
punct |
.,include |
R6161 |
T9933 |
T9934 |
amod |
Further,investigation |
R6162 |
T9934 |
T9935 |
nsubjpass |
investigation,required |
R6163 |
T9936 |
T9935 |
aux |
will,required |
R6164 |
T9937 |
T9935 |
auxpass |
be,required |
R6165 |
T9938 |
T9939 |
aux |
to,determine |
R6166 |
T9939 |
T9935 |
advcl |
determine,required |
R6167 |
T9940 |
T9941 |
mark |
whether,is |
R6168 |
T9941 |
T9939 |
ccomp |
is,determine |
R6169 |
T9942 |
T9943 |
det |
the,pathway |
R6170 |
T9943 |
T9941 |
nsubj |
pathway,is |
R6171 |
T9944 |
T9943 |
compound |
signaling,pathway |
R6172 |
T9945 |
T9946 |
nsubj |
we,elucidated |
R6173 |
T9946 |
T9943 |
advcl |
elucidated,pathway |
R6174 |
T9947 |
T9946 |
aux |
have,elucidated |
R6175 |
T9948 |
T9946 |
advmod |
here,elucidated |
R6176 |
T9949 |
T9950 |
det |
a,theme |
R6177 |
T9950 |
T9941 |
attr |
theme,is |
R6178 |
T9951 |
T9950 |
prep |
with,theme |
R6179 |
T9952 |
T9953 |
amod |
multiple,variations |
R6180 |
T9953 |
T9951 |
pobj |
variations,with |
R6181 |
T9954 |
T9935 |
punct |
.,required |
R6182 |
T9956 |
T9957 |
compound |
TGF,βs |
R6183 |
T9957 |
T9959 |
nsubjpass |
βs,known |
R6184 |
T9958 |
T9957 |
punct |
-,βs |
R6185 |
T9960 |
T9959 |
auxpass |
are,known |
R6186 |
T9961 |
T9962 |
aux |
to,promote |
R6187 |
T9962 |
T9959 |
xcomp |
promote,known |
R6188 |
T9963 |
T9962 |
dobj |
withdrawal,promote |
R6189 |
T9964 |
T9963 |
prep |
of,withdrawal |
R6190 |
T9965 |
T9964 |
pobj |
keratinocytes,of |
R6191 |
T9966 |
T9963 |
prep |
from,withdrawal |
R6192 |
T9967 |
T9968 |
det |
the,cycle |
R6193 |
T9968 |
T9966 |
pobj |
cycle,from |
R6194 |
T9969 |
T9968 |
compound |
cell,cycle |
R6195 |
T9970 |
T9971 |
punct |
[,41 |
R6196 |
T9971 |
T9959 |
parataxis |
41,known |
R6197 |
T9972 |
T9971 |
punct |
],41 |
R6198 |
T9973 |
T9959 |
punct |
.,known |
R6199 |
T9975 |
T9976 |
advmod |
Hence,focused |
R6200 |
T9977 |
T9976 |
punct |
", ",focused |
R6201 |
T9978 |
T9979 |
advmod |
when,detected |
R6202 |
T9979 |
T9976 |
advcl |
detected,focused |
R6203 |
T9980 |
T9981 |
compound |
TGF,β2 |
R6204 |
T9981 |
T9983 |
compound |
β2,protein |
R6205 |
T9982 |
T9981 |
punct |
-,β2 |
R6206 |
T9983 |
T9979 |
nsubjpass |
protein,detected |
R6207 |
T9984 |
T9979 |
auxpass |
was,detected |
R6208 |
T9985 |
T9979 |
prep |
at,detected |
R6209 |
T9986 |
T9987 |
det |
the,transition |
R6210 |
T9987 |
T9985 |
pobj |
transition,at |
R6211 |
T9988 |
T9987 |
prep |
between,transition |
R6212 |
T9989 |
T9990 |
det |
the,phases |
R6213 |
T9990 |
T9988 |
pobj |
phases,between |
R6214 |
T9991 |
T9992 |
npadvmod |
growing,destructive |
R6215 |
T9992 |
T9990 |
amod |
destructive,phases |
R6216 |
T9993 |
T9992 |
cc |
and,destructive |
R6217 |
T9994 |
T9990 |
prep |
of,phases |
R6218 |
T9995 |
T9996 |
det |
the,cycle |
R6219 |
T9996 |
T9994 |
pobj |
cycle,of |
R6220 |
T9997 |
T9996 |
amod |
adult,cycle |
R6221 |
T9998 |
T9996 |
compound |
hair,cycle |
R6222 |
T9999 |
T9976 |
punct |
", ",focused |
R6223 |
T10000 |
T9976 |
nsubj |
research,focused |
R6224 |
T10001 |
T9976 |
advmod |
initially,focused |
R6225 |
T10002 |
T10001 |
cc |
and,initially |
R6226 |
T10003 |
T10001 |
conj |
naturally,initially |
R6227 |
T10004 |
T9976 |
prep |
on,focused |
R6228 |
T10005 |
T10006 |
det |
a,role |
R6229 |
T10006 |
T10004 |
pobj |
role,on |
R6230 |
T10007 |
T10006 |
prep |
for,role |
R6231 |
T10008 |
T10009 |
det |
this,member |
R6232 |
T10009 |
T10007 |
pobj |
member,for |
R6233 |
T10010 |
T10009 |
compound |
family,member |
R6234 |
T10011 |
T10006 |
prep |
in,role |
R6235 |
T10012 |
T10011 |
pobj |
cessation,in |
R6236 |
T10013 |
T10012 |
prep |
of,cessation |
R6237 |
T10014 |
T10013 |
pobj |
growth,of |
R6238 |
T10015 |
T10012 |
cc |
and,cessation |
R6239 |
T10016 |
T10015 |
punct |
/,and |
R6240 |
T10017 |
T10015 |
cc |
or,and |
R6241 |
T10018 |
T10012 |
conj |
triggering,cessation |
R6242 |
T10019 |
T10018 |
dobj |
apoptosis,triggering |
R6243 |
T10020 |
T10021 |
punct |
(,42 |
R6244 |
T10021 |
T9976 |
parataxis |
42,focused |
R6245 |
T10022 |
T10021 |
punct |
[,42 |
R6246 |
T10023 |
T10021 |
punct |
],42 |
R6247 |
T10024 |
T10021 |
cc |
and,42 |
R6248 |
T10025 |
T10021 |
conj |
references,42 |
R6249 |
T10026 |
T10025 |
advmod |
therein,references |
R6250 |
T10027 |
T10021 |
punct |
),42 |
R6251 |
T10028 |
T9976 |
punct |
.,focused |
R6252 |
T10030 |
T10031 |
advmod |
However,displays |
R6253 |
T10032 |
T10031 |
punct |
", ",displays |
R6254 |
T10033 |
T10031 |
prep |
in,displays |
R6255 |
T10034 |
T10033 |
pobj |
contrast,in |
R6256 |
T10035 |
T10034 |
prep |
to,contrast |
R6257 |
T10036 |
T10037 |
compound |
TGF,β1 |
R6258 |
T10037 |
T10039 |
npadvmod |
β1,null |
R6259 |
T10038 |
T10037 |
punct |
-,β1 |
R6260 |
T10039 |
T10041 |
amod |
null,skin |
R6261 |
T10040 |
T10039 |
punct |
-,null |
R6262 |
T10041 |
T10035 |
pobj |
skin,to |
R6263 |
T10042 |
T10041 |
punct |
", ",skin |
R6264 |
T10043 |
T10044 |
dep |
which,exhibits |
R6265 |
T10044 |
T10041 |
relcl |
exhibits,skin |
R6266 |
T10045 |
T10046 |
det |
an,phase |
R6267 |
T10046 |
T10044 |
dobj |
phase,exhibits |
R6268 |
T10047 |
T10046 |
amod |
extended,phase |
R6269 |
T10048 |
T10046 |
compound |
growing,phase |
R6270 |
T10049 |
T10046 |
prep |
of,phase |
R6271 |
T10050 |
T10051 |
amod |
postnatal,follicles |
R6272 |
T10051 |
T10049 |
pobj |
follicles,of |
R6273 |
T10052 |
T10051 |
compound |
hair,follicles |
R6274 |
T10053 |
T10031 |
punct |
", ",displays |
R6275 |
T10054 |
T10055 |
compound |
TGF,β2 |
R6276 |
T10055 |
T10057 |
npadvmod |
β2,null |
R6277 |
T10056 |
T10055 |
punct |
-,β2 |
R6278 |
T10057 |
T10059 |
amod |
null,skin |
R6279 |
T10058 |
T10057 |
punct |
-,null |
R6280 |
T10059 |
T10031 |
nsubj |
skin,displays |
R6281 |
T10060 |
T10061 |
det |
an,block |
R6282 |
T10061 |
T10031 |
dobj |
block,displays |
R6283 |
T10062 |
T10061 |
amod |
embryonic,block |
R6284 |
T10063 |
T10061 |
prep |
in,block |
R6285 |
T10064 |
T10065 |
compound |
follicle,bud |
R6286 |
T10065 |
T10066 |
compound |
bud,progression |
R6287 |
T10066 |
T10063 |
pobj |
progression,in |
R6288 |
T10067 |
T10068 |
punct |
[,32 |
R6289 |
T10068 |
T10031 |
parataxis |
32,displays |
R6290 |
T10069 |
T10068 |
punct |
],32 |
R6291 |
T10070 |
T10031 |
punct |
.,displays |
R6292 |
T10072 |
T10073 |
mark |
Although,is |
R6293 |
T10073 |
T10076 |
advcl |
is,appear |
R6294 |
T10074 |
T10075 |
det |
this,phenotype |
R6295 |
T10075 |
T10073 |
nsubj |
phenotype,is |
R6296 |
T10077 |
T10073 |
acomp |
consistent,is |
R6297 |
T10078 |
T10077 |
prep |
with,consistent |
R6298 |
T10079 |
T10080 |
compound |
TGF,β2 |
R6299 |
T10080 |
T10082 |
poss |
β2,patterns |
R6300 |
T10081 |
T10080 |
punct |
-,β2 |
R6301 |
T10082 |
T10078 |
pobj |
patterns,with |
R6302 |
T10083 |
T10080 |
case |
's,β2 |
R6303 |
T10084 |
T10082 |
amod |
embryonic,patterns |
R6304 |
T10085 |
T10082 |
compound |
expression,patterns |
R6305 |
T10086 |
T10087 |
punct |
[,33 |
R6306 |
T10087 |
T10073 |
parataxis |
33,is |
R6307 |
T10088 |
T10087 |
punct |
],33 |
R6308 |
T10089 |
T10076 |
punct |
", ",appear |
R6309 |
T10090 |
T10091 |
quantmod |
about,50 |
R6310 |
T10091 |
T10092 |
nummod |
50,% |
R6311 |
T10092 |
T10076 |
nsubj |
%,appear |
R6312 |
T10093 |
T10092 |
prep |
of,% |
R6313 |
T10094 |
T10095 |
compound |
TGF,β2 |
R6314 |
T10095 |
T10097 |
npadvmod |
β2,null |
R6315 |
T10096 |
T10095 |
punct |
-,β2 |
R6316 |
T10097 |
T10098 |
amod |
null,buds |
R6317 |
T10098 |
T10093 |
pobj |
buds,of |
R6318 |
T10099 |
T10076 |
oprd |
unable,appear |
R6319 |
T10100 |
T10101 |
aux |
to,progress |
R6320 |
T10101 |
T10099 |
xcomp |
progress,unable |
R6321 |
T10102 |
T10101 |
prep |
to,progress |
R6322 |
T10103 |
T10104 |
det |
the,phase |
R6323 |
T10104 |
T10102 |
pobj |
phase,to |
R6324 |
T10105 |
T10106 |
amod |
down,growth |
R6325 |
T10106 |
T10104 |
compound |
growth,phase |
R6326 |
T10107 |
T10106 |
punct |
-,growth |
R6327 |
T10108 |
T10099 |
punct |
", ",unable |
R6328 |
T10109 |
T10110 |
det |
a,feature |
R6329 |
T10110 |
T10099 |
npadvmod |
feature,unable |
R6330 |
T10111 |
T10112 |
dep |
that,explained |
R6331 |
T10112 |
T10110 |
relcl |
explained,feature |
R6332 |
T10113 |
T10112 |
aux |
can,explained |
R6333 |
T10114 |
T10112 |
neg |
not,explained |
R6334 |
T10115 |
T10112 |
auxpass |
be,explained |
R6335 |
T10116 |
T10112 |
advmod |
readily,explained |
R6336 |
T10117 |
T10112 |
prep |
on,explained |
R6337 |
T10118 |
T10119 |
det |
the,basis |
R6338 |
T10119 |
T10117 |
pobj |
basis,on |
R6339 |
T10120 |
T10119 |
prep |
of,basis |
R6340 |
T10121 |
T10122 |
advmod |
previously,established |
R6341 |
T10122 |
T10123 |
amod |
established,effects |
R6342 |
T10123 |
T10120 |
pobj |
effects,of |
R6343 |
T10124 |
T10123 |
prep |
of,effects |
R6344 |
T10125 |
T10126 |
compound |
TGF,βs |
R6345 |
T10126 |
T10124 |
pobj |
βs,of |
R6346 |
T10127 |
T10126 |
punct |
-,βs |
R6347 |
T10128 |
T10076 |
punct |
.,appear |
R6348 |
T10130 |
T10131 |
poss |
Our,finding |
R6349 |
T10131 |
T10132 |
nsubj |
finding,lends |
R6350 |
T10133 |
T10134 |
mark |
that,is |
R6351 |
T10134 |
T10131 |
acl |
is,finding |
R6352 |
T10135 |
T10136 |
compound |
TGF,β2 |
R6353 |
T10136 |
T10134 |
nsubj |
β2,is |
R6354 |
T10137 |
T10136 |
punct |
-,β2 |
R6355 |
T10138 |
T10134 |
advmod |
upstream,is |
R6356 |
T10139 |
T10138 |
prep |
from,upstream |
R6357 |
T10140 |
T10141 |
compound |
Ki67,expression |
R6358 |
T10141 |
T10139 |
pobj |
expression,from |
R6359 |
T10142 |
T10141 |
cc |
and,expression |
R6360 |
T10143 |
T10144 |
compound |
MAPK,activation |
R6361 |
T10144 |
T10141 |
conj |
activation,expression |
R6362 |
T10145 |
T10146 |
amod |
further,support |
R6363 |
T10146 |
T10132 |
dobj |
support,lends |
R6364 |
T10147 |
T10132 |
dative |
to,lends |
R6365 |
T10148 |
T10149 |
det |
the,notion |
R6366 |
T10149 |
T10147 |
pobj |
notion,to |
R6367 |
T10150 |
T10151 |
mark |
that,react |
R6368 |
T10151 |
T10149 |
acl |
react,notion |
R6369 |
T10152 |
T10153 |
compound |
hair,follicle |
R6370 |
T10153 |
T10154 |
compound |
follicle,keratinocytes |
R6371 |
T10154 |
T10151 |
nsubj |
keratinocytes,react |
R6372 |
T10155 |
T10154 |
prep |
at,keratinocytes |
R6373 |
T10156 |
T10157 |
det |
this,stage |
R6374 |
T10157 |
T10155 |
pobj |
stage,at |
R6375 |
T10158 |
T10157 |
amod |
early,stage |
R6376 |
T10159 |
T10157 |
prep |
of,stage |
R6377 |
T10160 |
T10159 |
pobj |
development,of |
R6378 |
T10161 |
T10151 |
prep |
to,react |
R6379 |
T10162 |
T10163 |
compound |
TGF,β2 |
R6380 |
T10163 |
T10165 |
compound |
β2,signaling |
R6381 |
T10164 |
T10163 |
punct |
-,β2 |
R6382 |
T10165 |
T10161 |
pobj |
signaling,to |
R6383 |
T10166 |
T10151 |
prep |
in,react |
R6384 |
T10167 |
T10168 |
det |
a,fashion |
R6385 |
T10168 |
T10166 |
pobj |
fashion,in |
R6386 |
T10169 |
T10168 |
amod |
opposite,fashion |
R6387 |
T10170 |
T10169 |
prep |
to,opposite |
R6388 |
T10171 |
T10170 |
pobj |
that,to |
R6389 |
T10172 |
T10173 |
advmod |
typically,expected |
R6390 |
T10173 |
T10171 |
acl |
expected,that |
R6391 |
T10174 |
T10173 |
prep |
for,expected |
R6392 |
T10175 |
T10176 |
compound |
TGF,β |
R6393 |
T10176 |
T10178 |
compound |
β,factors |
R6394 |
T10177 |
T10176 |
punct |
-,β |
R6395 |
T10178 |
T10174 |
pobj |
factors,for |
R6396 |
T10179 |
T10132 |
punct |
.,lends |
R6397 |
T10181 |
T10182 |
nsubj |
This,said |
R6398 |
T10182 |
T10183 |
advcl |
said,appeared |
R6399 |
T10184 |
T10183 |
punct |
", ",appeared |
R6400 |
T10185 |
T10183 |
prep |
based,appeared |
R6401 |
T10186 |
T10185 |
prep |
upon,based |
R6402 |
T10187 |
T10188 |
compound |
pSMAD2,immunohistochemistry |
R6403 |
T10188 |
T10186 |
pobj |
immunohistochemistry,upon |
R6404 |
T10189 |
T10183 |
punct |
", ",appeared |
R6405 |
T10190 |
T10191 |
det |
the,steps |
R6406 |
T10191 |
T10183 |
nsubj |
steps,appeared |
R6407 |
T10192 |
T10191 |
amod |
immediate,steps |
R6408 |
T10193 |
T10191 |
prep |
of,steps |
R6409 |
T10194 |
T10195 |
amod |
downstream,signaling |
R6410 |
T10195 |
T10193 |
pobj |
signaling,of |
R6411 |
T10196 |
T10197 |
aux |
to,be |
R6412 |
T10197 |
T10183 |
xcomp |
be,appeared |
R6413 |
T10198 |
T10197 |
acomp |
intact,be |
R6414 |
T10199 |
T10183 |
punct |
.,appeared |
R6415 |
T10201 |
T10202 |
advmod |
Thus,surmise |
R6416 |
T10203 |
T10202 |
punct |
", ",surmise |
R6417 |
T10204 |
T10202 |
nsubj |
we,surmise |
R6418 |
T10205 |
T10206 |
mark |
that,is |
R6419 |
T10206 |
T10202 |
ccomp |
is,surmise |
R6420 |
T10207 |
T10208 |
det |
the,outcome |
R6421 |
T10208 |
T10206 |
nsubj |
outcome,is |
R6422 |
T10209 |
T10208 |
amod |
proliferative,outcome |
R6423 |
T10210 |
T10206 |
acomp |
likely,is |
R6424 |
T10211 |
T10212 |
aux |
to,rooted |
R6425 |
T10212 |
T10210 |
xcomp |
rooted,likely |
R6426 |
T10213 |
T10212 |
auxpass |
be,rooted |
R6427 |
T10214 |
T10212 |
prep |
in,rooted |
R6428 |
T10215 |
T10214 |
pobj |
differences,in |
R6429 |
T10216 |
T10215 |
prep |
in,differences |
R6430 |
T10217 |
T10218 |
det |
the,repertoire |
R6431 |
T10218 |
T10216 |
pobj |
repertoire,in |
R6432 |
T10219 |
T10218 |
prep |
of,repertoire |
R6433 |
T10220 |
T10221 |
amod |
activated,genes |
R6434 |
T10221 |
T10219 |
pobj |
genes,of |
R6435 |
T10222 |
T10221 |
compound |
SMAD,genes |
R6436 |
T10223 |
T10221 |
compound |
target,genes |
R6437 |
T10224 |
T10202 |
punct |
.,surmise |
R6438 |
T10226 |
T10227 |
prep |
In,be |
R6439 |
T10228 |
T10229 |
det |
this,regard |
R6440 |
T10229 |
T10226 |
pobj |
regard,In |
R6441 |
T10230 |
T10227 |
punct |
", ",be |
R6442 |
T10231 |
T10232 |
det |
the,effects |
R6443 |
T10232 |
T10227 |
nsubj |
effects,be |
R6444 |
T10233 |
T10232 |
amod |
positive,effects |
R6445 |
T10234 |
T10232 |
prep |
of,effects |
R6446 |
T10235 |
T10236 |
compound |
TGF,β2 |
R6447 |
T10236 |
T10234 |
pobj |
β2,of |
R6448 |
T10237 |
T10236 |
punct |
-,β2 |
R6449 |
T10238 |
T10232 |
prep |
on,effects |
R6450 |
T10239 |
T10238 |
pobj |
proliferation,on |
R6451 |
T10240 |
T10232 |
prep |
within,effects |
R6452 |
T10241 |
T10242 |
det |
the,bud |
R6453 |
T10242 |
T10240 |
pobj |
bud,within |
R6454 |
T10243 |
T10242 |
compound |
hair,bud |
R6455 |
T10244 |
T10227 |
aux |
may,be |
R6456 |
T10245 |
T10246 |
advmod |
more,analogous |
R6457 |
T10246 |
T10227 |
acomp |
analogous,be |
R6458 |
T10247 |
T10246 |
prep |
to,analogous |
R6459 |
T10248 |
T10249 |
dep |
what,seen |
R6460 |
T10249 |
T10247 |
pobj |
seen,to |
R6461 |
T10250 |
T10249 |
aux |
has,seen |
R6462 |
T10251 |
T10249 |
auxpass |
been,seen |
R6463 |
T10252 |
T10249 |
prep |
in,seen |
R6464 |
T10253 |
T10252 |
pobj |
progression,in |
R6465 |
T10254 |
T10253 |
prep |
of,progression |
R6466 |
T10255 |
T10256 |
amod |
squamous,cell |
R6467 |
T10256 |
T10257 |
compound |
cell,carcinoma |
R6468 |
T10257 |
T10254 |
pobj |
carcinoma,of |
R6469 |
T10258 |
T10253 |
prep |
to,progression |
R6470 |
T10259 |
T10260 |
amod |
metastatic,carcinoma |
R6471 |
T10260 |
T10258 |
pobj |
carcinoma,to |
R6472 |
T10261 |
T10262 |
punct |
[,43 |
R6473 |
T10262 |
T10249 |
parataxis |
43,seen |
R6474 |
T10263 |
T10262 |
punct |
],43 |
R6475 |
T10264 |
T10265 |
advmod |
rather,than |
R6476 |
T10265 |
T10249 |
cc |
than,seen |
R6477 |
T10266 |
T10249 |
conj |
that,seen |
R6478 |
T10267 |
T10268 |
advmod |
typically,observed |
R6479 |
T10268 |
T10266 |
acl |
observed,that |
R6480 |
T10269 |
T10268 |
prep |
for,observed |
R6481 |
T10270 |
T10269 |
pobj |
keratinocytes,for |
R6482 |
T10271 |
T10272 |
punct |
[,46 |
R6483 |
T10272 |
T10227 |
parataxis |
46,be |
R6484 |
T10273 |
T10272 |
nummod |
44,46 |
R6485 |
T10274 |
T10272 |
punct |
",",46 |
R6486 |
T10275 |
T10272 |
nummod |
45,46 |
R6487 |
T10276 |
T10272 |
punct |
",",46 |
R6488 |
T10277 |
T10272 |
punct |
],46 |
R6489 |
T10278 |
T10227 |
punct |
.,be |
R6490 |
T10280 |
T10281 |
det |
The,identification |
R6491 |
T10281 |
T10283 |
nsubj |
identification,was |
R6492 |
T10282 |
T10281 |
amod |
prior,identification |
R6493 |
T10284 |
T10281 |
prep |
of,identification |
R6494 |
T10285 |
T10286 |
det |
the,gene |
R6495 |
T10286 |
T10284 |
pobj |
gene,of |
R6496 |
T10287 |
T10286 |
compound |
Snail,gene |
R6497 |
T10288 |
T10281 |
prep |
as,identification |
R6498 |
T10289 |
T10290 |
det |
a,target |
R6499 |
T10290 |
T10288 |
pobj |
target,as |
R6500 |
T10291 |
T10290 |
amod |
potential,target |
R6501 |
T10292 |
T10290 |
prep |
of,target |
R6502 |
T10293 |
T10294 |
compound |
TGF,β |
R6503 |
T10294 |
T10296 |
compound |
β,signaling |
R6504 |
T10295 |
T10294 |
punct |
-,β |
R6505 |
T10296 |
T10292 |
pobj |
signaling,of |
R6506 |
T10297 |
T10298 |
punct |
[,15 |
R6507 |
T10298 |
T10281 |
parataxis |
15,identification |
R6508 |
T10299 |
T10298 |
punct |
],15 |
R6509 |
T10300 |
T10283 |
acomp |
intriguing,was |
R6510 |
T10301 |
T10283 |
punct |
", ",was |
R6511 |
T10302 |
T10283 |
prep |
given,was |
R6512 |
T10303 |
T10304 |
det |
the,wave |
R6513 |
T10304 |
T10302 |
pobj |
wave,given |
R6514 |
T10305 |
T10304 |
amod |
temporal,wave |
R6515 |
T10306 |
T10304 |
prep |
of,wave |
R6516 |
T10307 |
T10308 |
compound |
Snail,expression |
R6517 |
T10308 |
T10306 |
pobj |
expression,of |
R6518 |
T10309 |
T10308 |
compound |
gene,expression |
R6519 |
T10310 |
T10311 |
dep |
that,occurs |
R6520 |
T10311 |
T10304 |
relcl |
occurs,wave |
R6521 |
T10312 |
T10311 |
prep |
in,occurs |
R6522 |
T10313 |
T10314 |
det |
the,bud |
R6523 |
T10314 |
T10312 |
pobj |
bud,in |
R6524 |
T10315 |
T10314 |
amod |
developing,bud |
R6525 |
T10316 |
T10314 |
compound |
hair,bud |
R6526 |
T10317 |
T10283 |
punct |
.,was |
R6527 |
T10319 |
T10320 |
det |
The,correlation |
R6528 |
T10320 |
T10322 |
nsubj |
correlation,fostered |
R6529 |
T10321 |
T10320 |
amod |
additional,correlation |
R6530 |
T10323 |
T10320 |
prep |
between,correlation |
R6531 |
T10324 |
T10325 |
amod |
epithelial,hyperproliferation |
R6532 |
T10325 |
T10323 |
pobj |
hyperproliferation,between |
R6533 |
T10326 |
T10325 |
cc |
and,hyperproliferation |
R6534 |
T10327 |
T10328 |
compound |
Snail,expression |
R6535 |
T10328 |
T10325 |
conj |
expression,hyperproliferation |
R6536 |
T10329 |
T10328 |
compound |
transgene,expression |
R6537 |
T10330 |
T10322 |
advmod |
further,fostered |
R6538 |
T10331 |
T10332 |
poss |
our,interest |
R6539 |
T10332 |
T10322 |
dobj |
interest,fostered |
R6540 |
T10333 |
T10332 |
prep |
in,interest |
R6541 |
T10334 |
T10335 |
det |
a,link |
R6542 |
T10335 |
T10333 |
pobj |
link,in |
R6543 |
T10336 |
T10335 |
amod |
possible,link |
R6544 |
T10337 |
T10335 |
prep |
between,link |
R6545 |
T10338 |
T10339 |
compound |
TGF,β2 |
R6546 |
T10339 |
T10337 |
pobj |
β2,between |
R6547 |
T10340 |
T10339 |
punct |
-,β2 |
R6548 |
T10341 |
T10339 |
cc |
and,β2 |
R6549 |
T10342 |
T10339 |
conj |
Snail,β2 |
R6550 |
T10343 |
T10322 |
punct |
.,fostered |
R6551 |
T10345 |
T10346 |
poss |
Our,studies |
R6552 |
T10346 |
T10348 |
nsubj |
studies,demonstrate |
R6553 |
T10347 |
T10346 |
amod |
functional,studies |
R6554 |
T10349 |
T10350 |
mark |
that,abolished |
R6555 |
T10350 |
T10348 |
ccomp |
abolished,demonstrate |
R6556 |
T10351 |
T10350 |
prep |
without,abolished |
R6557 |
T10352 |
T10353 |
compound |
TGF,β2 |
R6558 |
T10353 |
T10351 |
pobj |
β2,without |
R6559 |
T10354 |
T10353 |
punct |
-,β2 |
R6560 |
T10355 |
T10350 |
punct |
", ",abolished |
R6561 |
T10356 |
T10357 |
compound |
Snail,expression |
R6562 |
T10357 |
T10350 |
nsubjpass |
expression,abolished |
R6563 |
T10358 |
T10350 |
auxpass |
is,abolished |
R6564 |
T10359 |
T10350 |
prep |
in,abolished |
R6565 |
T10360 |
T10361 |
det |
the,buds |
R6566 |
T10361 |
T10359 |
pobj |
buds,in |
R6567 |
T10362 |
T10361 |
compound |
mutant,buds |
R6568 |
T10363 |
T10361 |
compound |
hair,buds |
R6569 |
T10364 |
T10350 |
punct |
", ",abolished |
R6570 |
T10365 |
T10350 |
cc |
and,abolished |
R6571 |
T10366 |
T10367 |
advmod |
conversely,activated |
R6572 |
T10367 |
T10350 |
conj |
activated,abolished |
R6573 |
T10368 |
T10367 |
punct |
", ",activated |
R6574 |
T10369 |
T10367 |
prep |
in,activated |
R6575 |
T10370 |
T10371 |
compound |
K14,Smad2 |
R6576 |
T10371 |
T10373 |
compound |
Smad2,skin |
R6577 |
T10372 |
T10371 |
punct |
-,Smad2 |
R6578 |
T10373 |
T10369 |
pobj |
skin,in |
R6579 |
T10374 |
T10367 |
punct |
", ",activated |
R6580 |
T10375 |
T10367 |
nsubjpass |
Snail,activated |
R6581 |
T10376 |
T10367 |
auxpass |
is,activated |
R6582 |
T10377 |
T10367 |
advmod |
ectopically,activated |
R6583 |
T10378 |
T10348 |
punct |
.,demonstrate |
R6584 |
T10380 |
T10381 |
advmod |
Moreover,indicate |
R6585 |
T10382 |
T10381 |
punct |
", ",indicate |
R6586 |
T10383 |
T10384 |
poss |
our,studies |
R6587 |
T10384 |
T10381 |
nsubj |
studies,indicate |
R6588 |
T10385 |
T10386 |
advmod |
in,vitro |
R6589 |
T10386 |
T10384 |
amod |
vitro,studies |
R6590 |
T10387 |
T10388 |
mark |
that,cause |
R6591 |
T10388 |
T10381 |
ccomp |
cause,indicate |
R6592 |
T10389 |
T10390 |
advmod |
even,exposure |
R6593 |
T10390 |
T10388 |
nsubj |
exposure,cause |
R6594 |
T10391 |
T10390 |
amod |
sustained,exposure |
R6595 |
T10392 |
T10393 |
compound |
TGF,β2 |
R6596 |
T10393 |
T10390 |
compound |
β2,exposure |
R6597 |
T10394 |
T10393 |
punct |
-,β2 |
R6598 |
T10395 |
T10388 |
aux |
may,cause |
R6599 |
T10396 |
T10397 |
advmod |
only,induction |
R6600 |
T10397 |
T10388 |
dobj |
induction,cause |
R6601 |
T10398 |
T10397 |
det |
a,induction |
R6602 |
T10399 |
T10397 |
amod |
transient,induction |
R6603 |
T10400 |
T10397 |
prep |
of,induction |
R6604 |
T10401 |
T10400 |
pobj |
Snail,of |
R6605 |
T10402 |
T10381 |
punct |
", ",indicate |
R6606 |
T10403 |
T10381 |
advcl |
offering,indicate |
R6607 |
T10404 |
T10405 |
det |
a,explanation |
R6608 |
T10405 |
T10403 |
dobj |
explanation,offering |
R6609 |
T10406 |
T10405 |
amod |
possible,explanation |
R6610 |
T10407 |
T10405 |
prep |
as,explanation |
R6611 |
T10408 |
T10407 |
prep |
to,as |
R6612 |
T10409 |
T10410 |
advmod |
why,expressed |
R6613 |
T10410 |
T10408 |
pcomp |
expressed,to |
R6614 |
T10411 |
T10410 |
nsubjpass |
Snail,expressed |
R6615 |
T10412 |
T10410 |
auxpass |
is,expressed |
R6616 |
T10413 |
T10414 |
advmod |
so,briefly |
R6617 |
T10414 |
T10410 |
advmod |
briefly,expressed |
R6618 |
T10415 |
T10410 |
prep |
during,expressed |
R6619 |
T10416 |
T10417 |
compound |
hair,follicle |
R6620 |
T10417 |
T10418 |
compound |
follicle,morphogenesis |
R6621 |
T10418 |
T10415 |
pobj |
morphogenesis,during |
R6622 |
T10419 |
T10381 |
punct |
.,indicate |
R6623 |
T10421 |
T10422 |
det |
An,point |
R6624 |
T10422 |
T10424 |
nsubj |
point,is |
R6625 |
T10423 |
T10422 |
amod |
additional,point |
R6626 |
T10425 |
T10422 |
amod |
worth,point |
R6627 |
T10426 |
T10425 |
advcl |
mentioning,worth |
R6628 |
T10427 |
T10428 |
mark |
that,resulted |
R6629 |
T10428 |
T10424 |
ccomp |
resulted,is |
R6630 |
T10429 |
T10430 |
amod |
prolonged,expression |
R6631 |
T10430 |
T10428 |
nsubj |
expression,resulted |
R6632 |
T10431 |
T10430 |
prep |
of,expression |
R6633 |
T10432 |
T10433 |
compound |
Tg,Snail |
R6634 |
T10433 |
T10431 |
pobj |
Snail,of |
R6635 |
T10434 |
T10430 |
prep |
in,expression |
R6636 |
T10435 |
T10436 |
amod |
postnatal,skin |
R6637 |
T10436 |
T10434 |
pobj |
skin,in |
R6638 |
T10437 |
T10428 |
prep |
in,resulted |
R6639 |
T10438 |
T10439 |
amod |
morphological,signs |
R6640 |
T10439 |
T10437 |
pobj |
signs,in |
R6641 |
T10440 |
T10438 |
cc |
and,morphological |
R6642 |
T10441 |
T10438 |
conj |
biochemical,morphological |
R6643 |
T10442 |
T10439 |
prep |
of,signs |
R6644 |
T10443 |
T10444 |
amod |
epithelial,transitions |
R6645 |
T10444 |
T10442 |
pobj |
transitions,of |
R6646 |
T10445 |
T10443 |
prep |
to,epithelial |
R6647 |
T10446 |
T10445 |
amod |
mesenchymal,to |
R6648 |
T10447 |
T10448 |
punct |
(,data |
R6649 |
T10448 |
T10428 |
meta |
data,resulted |
R6650 |
T10449 |
T10448 |
amod |
unpublished,data |
R6651 |
T10450 |
T10448 |
punct |
),data |
R6652 |
T10451 |
T10428 |
punct |
", ",resulted |
R6653 |
T10452 |
T10428 |
advcl |
underscoring,resulted |
R6654 |
T10453 |
T10454 |
advmod |
why,be |
R6655 |
T10454 |
T10452 |
ccomp |
be,underscoring |
R6656 |
T10455 |
T10456 |
amod |
transient,expression |
R6657 |
T10456 |
T10454 |
nsubj |
expression,be |
R6658 |
T10457 |
T10456 |
compound |
Snail,expression |
R6659 |
T10458 |
T10454 |
aux |
may,be |
R6660 |
T10459 |
T10460 |
advmod |
so,important |
R6661 |
T10460 |
T10454 |
acomp |
important,be |
R6662 |
T10461 |
T10454 |
prep |
during,be |
R6663 |
T10462 |
T10463 |
amod |
normal,morphogenesis |
R6664 |
T10463 |
T10461 |
pobj |
morphogenesis,during |
R6665 |
T10464 |
T10465 |
compound |
hair,follicle |
R6666 |
T10465 |
T10463 |
compound |
follicle,morphogenesis |
R6667 |
T10466 |
T10467 |
punct |
[,18 |
R6668 |
T10467 |
T10424 |
parataxis |
18,is |
R6669 |
T10468 |
T10467 |
punct |
],18 |
R6670 |
T10469 |
T10424 |
punct |
.,is |
R6671 |
T10471 |
T10472 |
prep |
At,seemed |
R6672 |
T10473 |
T10474 |
amod |
first,glance |
R6673 |
T10474 |
T10471 |
pobj |
glance,At |
R6674 |
T10475 |
T10472 |
punct |
", ",seemed |
R6675 |
T10476 |
T10477 |
det |
the,sparsity |
R6676 |
T10477 |
T10472 |
nsubj |
sparsity,seemed |
R6677 |
T10478 |
T10477 |
prep |
in,sparsity |
R6678 |
T10479 |
T10480 |
compound |
hair,coat |
R6679 |
T10480 |
T10478 |
pobj |
coat,in |
R6680 |
T10481 |
T10480 |
prep |
of,coat |
R6681 |
T10482 |
T10483 |
compound |
K14,Snail |
R6682 |
T10483 |
T10485 |
compound |
Snail,mice |
R6683 |
T10484 |
T10483 |
punct |
-,Snail |
R6684 |
T10485 |
T10481 |
pobj |
mice,of |
R6685 |
T10486 |
T10485 |
compound |
Tg,mice |
R6686 |
T10487 |
T10472 |
oprd |
indicative,seemed |
R6687 |
T10488 |
T10487 |
prep |
of,indicative |
R6688 |
T10489 |
T10490 |
det |
a,defect |
R6689 |
T10490 |
T10488 |
pobj |
defect,of |
R6690 |
T10491 |
T10490 |
prep |
in,defect |
R6691 |
T10492 |
T10493 |
compound |
follicle,formation |
R6692 |
T10493 |
T10491 |
pobj |
formation,in |
R6693 |
T10494 |
T10495 |
punct |
(,see |
R6694 |
T10495 |
T10472 |
parataxis |
see,seemed |
R6695 |
T10496 |
T10497 |
compound |
Figure,2A |
R6696 |
T10497 |
T10495 |
dobj |
2A,see |
R6697 |
T10498 |
T10495 |
punct |
),see |
R6698 |
T10499 |
T10472 |
punct |
.,seemed |
R6699 |
T10501 |
T10502 |
amod |
Closer,inspection |
R6700 |
T10502 |
T10503 |
nsubj |
inspection,revealed |
R6701 |
T10504 |
T10503 |
punct |
", ",revealed |
R6702 |
T10505 |
T10503 |
advmod |
however,revealed |
R6703 |
T10506 |
T10503 |
punct |
", ",revealed |
R6704 |
T10507 |
T10508 |
mark |
that,penetrated |
R6705 |
T10508 |
T10503 |
ccomp |
penetrated,revealed |
R6706 |
T10509 |
T10510 |
neg |
not,hairs |
R6707 |
T10510 |
T10508 |
nsubj |
hairs,penetrated |
R6708 |
T10511 |
T10510 |
det |
all,hairs |
R6709 |
T10512 |
T10513 |
det |
the,epidermis |
R6710 |
T10513 |
T10508 |
dobj |
epidermis,penetrated |
R6711 |
T10514 |
T10513 |
amod |
hyperthickened,epidermis |
R6712 |
T10515 |
T10513 |
compound |
Tg,epidermis |
R6713 |
T10516 |
T10503 |
punct |
.,revealed |
R6714 |
T10518 |
T10519 |
amod |
Several,factors |
R6715 |
T10519 |
T10520 |
nsubj |
factors,contribute |
R6716 |
T10521 |
T10520 |
aux |
may,contribute |
R6717 |
T10522 |
T10520 |
prep |
to,contribute |
R6718 |
T10523 |
T10524 |
det |
the,development |
R6719 |
T10524 |
T10522 |
pobj |
development,to |
R6720 |
T10525 |
T10526 |
advmod |
seemingly,normal |
R6721 |
T10526 |
T10524 |
amod |
normal,development |
R6722 |
T10527 |
T10524 |
compound |
follicle,development |
R6723 |
T10528 |
T10524 |
prep |
in,development |
R6724 |
T10529 |
T10530 |
det |
these,mice |
R6725 |
T10530 |
T10528 |
pobj |
mice,in |
R6726 |
T10531 |
T10520 |
punct |
.,contribute |
R6727 |
T10533 |
T10534 |
nummod |
One,factor |
R6728 |
T10534 |
T10536 |
nsubj |
factor,is |
R6729 |
T10535 |
T10534 |
amod |
obvious,factor |
R6730 |
T10537 |
T10538 |
det |
the,promoter |
R6731 |
T10538 |
T10536 |
attr |
promoter,is |
R6732 |
T10539 |
T10538 |
compound |
K14,promoter |
R6733 |
T10540 |
T10538 |
punct |
", ",promoter |
R6734 |
T10541 |
T10542 |
dep |
which,is |
R6735 |
T10542 |
T10538 |
relcl |
is,promoter |
R6736 |
T10543 |
T10542 |
acomp |
elevated,is |
R6737 |
T10544 |
T10542 |
prep |
in,is |
R6738 |
T10545 |
T10546 |
det |
the,layer |
R6739 |
T10546 |
T10544 |
pobj |
layer,in |
R6740 |
T10547 |
T10546 |
amod |
basal,layer |
R6741 |
T10548 |
T10546 |
prep |
of,layer |
R6742 |
T10549 |
T10550 |
det |
the,epidermis |
R6743 |
T10550 |
T10548 |
pobj |
epidermis,of |
R6744 |
T10551 |
T10546 |
cc |
and,layer |
R6745 |
T10552 |
T10553 |
det |
the,sheath |
R6746 |
T10553 |
T10546 |
conj |
sheath,layer |
R6747 |
T10554 |
T10553 |
amod |
outer,sheath |
R6748 |
T10555 |
T10553 |
compound |
root,sheath |
R6749 |
T10556 |
T10553 |
punct |
(,sheath |
R6750 |
T10557 |
T10553 |
appos |
ORS,sheath |
R6751 |
T10558 |
T10553 |
punct |
),sheath |
R6752 |
T10559 |
T10553 |
prep |
of,sheath |
R6753 |
T10560 |
T10561 |
det |
the,follicle |
R6754 |
T10561 |
T10559 |
pobj |
follicle,of |
R6755 |
T10562 |
T10561 |
compound |
hair,follicle |
R6756 |
T10563 |
T10536 |
punct |
", ",is |
R6757 |
T10564 |
T10536 |
cc |
but,is |
R6758 |
T10565 |
T10566 |
auxpass |
is,regulated |
R6759 |
T10566 |
T10536 |
conj |
regulated,is |
R6760 |
T10567 |
T10566 |
advmod |
markedly,regulated |
R6761 |
T10568 |
T10566 |
advmod |
down,regulated |
R6762 |
T10569 |
T10566 |
punct |
-,regulated |
R6763 |
T10570 |
T10566 |
prep |
in,regulated |
R6764 |
T10571 |
T10572 |
amod |
developing,buds |
R6765 |
T10572 |
T10570 |
pobj |
buds,in |
R6766 |
T10573 |
T10572 |
amod |
embryonic,buds |
R6767 |
T10574 |
T10572 |
compound |
hair,buds |
R6768 |
T10575 |
T10576 |
advmod |
as,as |
R6769 |
T10576 |
T10570 |
cc |
as,in |
R6770 |
T10577 |
T10576 |
advmod |
well,as |
R6771 |
T10578 |
T10570 |
conj |
in,in |
R6772 |
T10579 |
T10580 |
det |
the,cells |
R6773 |
T10580 |
T10578 |
pobj |
cells,in |
R6774 |
T10581 |
T10580 |
amod |
postnatal,cells |
R6775 |
T10582 |
T10580 |
compound |
hair,cells |
R6776 |
T10583 |
T10580 |
compound |
progenitor,cells |
R6777 |
T10584 |
T10536 |
punct |
.,is |
R6778 |
T10586 |
T10587 |
det |
The,promoter |
R6779 |
T10587 |
T10589 |
nsubj |
promoter,is |
R6780 |
T10588 |
T10587 |
compound |
K14,promoter |
R6781 |
T10590 |
T10589 |
advmod |
also,is |
R6782 |
T10591 |
T10592 |
advmod |
less,active |
R6783 |
T10592 |
T10589 |
acomp |
active,is |
R6784 |
T10593 |
T10592 |
prep |
in,active |
R6785 |
T10594 |
T10595 |
det |
the,ORS |
R6786 |
T10595 |
T10593 |
pobj |
ORS,in |
R6787 |
T10596 |
T10592 |
prep |
than,active |
R6788 |
T10597 |
T10596 |
pcomp |
epidermis,than |
R6789 |
T10598 |
T10589 |
cc |
and,is |
R6790 |
T10599 |
T10600 |
advmod |
hence,account |
R6791 |
T10600 |
T10589 |
conj |
account,is |
R6792 |
T10601 |
T10600 |
nsubj |
this,account |
R6793 |
T10602 |
T10600 |
aux |
might,account |
R6794 |
T10603 |
T10600 |
advmod |
also,account |
R6795 |
T10604 |
T10600 |
prep |
for,account |
R6796 |
T10605 |
T10606 |
det |
the,lack |
R6797 |
T10606 |
T10604 |
pobj |
lack,for |
R6798 |
T10607 |
T10606 |
prep |
of,lack |
R6799 |
T10608 |
T10609 |
amod |
apparent,response |
R6800 |
T10609 |
T10607 |
pobj |
response,of |
R6801 |
T10610 |
T10609 |
prep |
of,response |
R6802 |
T10611 |
T10612 |
det |
the,ORS |
R6803 |
T10612 |
T10610 |
pobj |
ORS,of |
R6804 |
T10613 |
T10609 |
prep |
to,response |
R6805 |
T10614 |
T10615 |
amod |
ectopic,Snail |
R6806 |
T10615 |
T10613 |
pobj |
Snail,to |
R6807 |
T10616 |
T10600 |
punct |
.,account |
R6808 |
T10618 |
T10619 |
amod |
Additional,factors |
R6809 |
T10619 |
T10621 |
nsubj |
factors,be |
R6810 |
T10620 |
T10619 |
amod |
contributing,factors |
R6811 |
T10622 |
T10621 |
aux |
could,be |
R6812 |
T10623 |
T10624 |
det |
the,multiplicity |
R6813 |
T10624 |
T10621 |
attr |
multiplicity,be |
R6814 |
T10625 |
T10624 |
prep |
of,multiplicity |
R6815 |
T10626 |
T10627 |
compound |
Snail,members |
R6816 |
T10627 |
T10625 |
pobj |
members,of |
R6817 |
T10628 |
T10627 |
compound |
family,members |
R6818 |
T10629 |
T10627 |
cc |
and,members |
R6819 |
T10630 |
T10631 |
poss |
their,expression |
R6820 |
T10631 |
T10627 |
conj |
expression,members |
R6821 |
T10632 |
T10631 |
amod |
differential,expression |
R6822 |
T10633 |
T10627 |
punct |
", ",members |
R6823 |
T10634 |
T10635 |
det |
the,saturation |
R6824 |
T10635 |
T10627 |
appos |
saturation,members |
R6825 |
T10636 |
T10635 |
punct |
", ",saturation |
R6826 |
T10637 |
T10635 |
cc |
and,saturation |
R6827 |
T10638 |
T10637 |
punct |
/,and |
R6828 |
T10639 |
T10637 |
cc |
or,and |
R6829 |
T10640 |
T10635 |
conj |
diversity,saturation |
R6830 |
T10641 |
T10635 |
prep |
of,saturation |
R6831 |
T10642 |
T10643 |
amod |
regulatory,mechanisms |
R6832 |
T10643 |
T10641 |
pobj |
mechanisms,of |
R6833 |
T10644 |
T10645 |
dep |
that,govern |
R6834 |
T10645 |
T10643 |
relcl |
govern,mechanisms |
R6835 |
T10646 |
T10647 |
compound |
AJ,formation |
R6836 |
T10647 |
T10645 |
dobj |
formation,govern |
R6837 |
T10648 |
T10647 |
punct |
", ",formation |
R6838 |
T10649 |
T10647 |
conj |
migration,formation |
R6839 |
T10650 |
T10649 |
punct |
", ",migration |
R6840 |
T10651 |
T10649 |
cc |
and,migration |
R6841 |
T10652 |
T10649 |
conj |
proliferation,migration |
R6842 |
T10653 |
T10645 |
prep |
in,govern |
R6843 |
T10654 |
T10655 |
det |
the,ORS |
R6844 |
T10655 |
T10653 |
pobj |
ORS,in |
R6845 |
T10656 |
T10655 |
compound |
follicle,ORS |
R6846 |
T10657 |
T10621 |
punct |
.,be |
R6847 |
T10659 |
T10660 |
csubj |
Distinguishing,await |
R6848 |
T10661 |
T10659 |
prep |
between,Distinguishing |
R6849 |
T10662 |
T10663 |
det |
these,possibilities |
R6850 |
T10663 |
T10661 |
pobj |
possibilities,between |
R6851 |
T10664 |
T10660 |
aux |
must,await |
R6852 |
T10665 |
T10666 |
det |
the,generation |
R6853 |
T10666 |
T10660 |
dobj |
generation,await |
R6854 |
T10667 |
T10666 |
prep |
of,generation |
R6855 |
T10668 |
T10667 |
pobj |
mice,of |
R6856 |
T10669 |
T10668 |
acl |
harboring,mice |
R6857 |
T10670 |
T10671 |
npadvmod |
skin,specific |
R6858 |
T10671 |
T10673 |
amod |
specific,mutations |
R6859 |
T10672 |
T10671 |
punct |
-,specific |
R6860 |
T10673 |
T10669 |
dobj |
mutations,harboring |
R6861 |
T10674 |
T10673 |
nmod |
loss,mutations |
R6862 |
T10675 |
T10674 |
punct |
-,loss |
R6863 |
T10676 |
T10674 |
prep |
of,loss |
R6864 |
T10677 |
T10676 |
punct |
-,of |
R6865 |
T10678 |
T10676 |
pobj |
function,of |
R6866 |
T10679 |
T10673 |
compound |
Snail,mutations |
R6867 |
T10680 |
T10660 |
punct |
.,await |
R6876 |
T11058 |
T11057 |
prep |
between,Links |
R6877 |
T11059 |
T11058 |
pobj |
Signaling,between |
R6878 |
T11060 |
T11059 |
punct |
", ",Signaling |
R6879 |
T11061 |
T11062 |
amod |
Transcriptional,Cascades |
R6880 |
T11062 |
T11059 |
conj |
Cascades,Signaling |
R6881 |
T11063 |
T11062 |
punct |
", ",Cascades |
R6882 |
T11064 |
T11065 |
amod |
Epithelial,Remodeling |
R6883 |
T11065 |
T11062 |
conj |
Remodeling,Cascades |
R6884 |
T11066 |
T11065 |
punct |
", ",Remodeling |
R6885 |
T11067 |
T11065 |
cc |
and,Remodeling |
R6886 |
T11068 |
T11065 |
conj |
Proliferation,Remodeling |
R6887 |
T11069 |
T11057 |
prep |
in,Links |
R6888 |
T11070 |
T11071 |
det |
the,Bud |
R6889 |
T11071 |
T11069 |
pobj |
Bud,in |
R6890 |
T11072 |
T11071 |
compound |
Hair,Bud |
R6891 |
T11074 |
T11075 |
advmod |
Previously,discovered |
R6892 |
T11076 |
T11075 |
punct |
", ",discovered |
R6893 |
T11077 |
T11075 |
nsubj |
we,discovered |
R6894 |
T11078 |
T11079 |
mark |
that,regulated |
R6895 |
T11079 |
T11075 |
ccomp |
regulated,discovered |
R6896 |
T11080 |
T11079 |
advmod |
early,regulated |
R6897 |
T11081 |
T11080 |
prep |
during,early |
R6898 |
T11082 |
T11083 |
compound |
hair,follicle |
R6899 |
T11083 |
T11084 |
compound |
follicle,morphogenesis |
R6900 |
T11084 |
T11081 |
pobj |
morphogenesis,during |
R6901 |
T11085 |
T11079 |
punct |
", ",regulated |
R6902 |
T11086 |
T11087 |
compound |
E,cadherin |
R6903 |
T11087 |
T11089 |
compound |
cadherin,expression |
R6904 |
T11088 |
T11087 |
punct |
-,cadherin |
R6905 |
T11089 |
T11079 |
nsubjpass |
expression,regulated |
R6906 |
T11090 |
T11089 |
compound |
gene,expression |
R6907 |
T11091 |
T11079 |
auxpass |
is,regulated |
R6908 |
T11092 |
T11079 |
advmod |
down,regulated |
R6909 |
T11093 |
T11079 |
punct |
-,regulated |
R6910 |
T11094 |
T11079 |
advmod |
concomitantly,regulated |
R6911 |
T11095 |
T11079 |
prep |
with,regulated |
R6912 |
T11096 |
T11097 |
det |
the,invagination |
R6913 |
T11097 |
T11095 |
pobj |
invagination,with |
R6914 |
T11098 |
T11097 |
prep |
of,invagination |
R6915 |
T11099 |
T11100 |
amod |
developing,cells |
R6916 |
T11100 |
T11098 |
pobj |
cells,of |
R6917 |
T11101 |
T11100 |
compound |
bud,cells |
R6918 |
T11102 |
T11097 |
prep |
into,invagination |
R6919 |
T11103 |
T11104 |
det |
the,skin |
R6920 |
T11104 |
T11102 |
pobj |
skin,into |
R6921 |
T11105 |
T11106 |
punct |
[,4 |
R6922 |
T11106 |
T11075 |
parataxis |
4,discovered |
R6923 |
T11107 |
T11106 |
punct |
],4 |
R6924 |
T11108 |
T11075 |
punct |
.,discovered |
R6925 |
T11110 |
T11111 |
mark |
Because,correlated |
R6926 |
T11111 |
T11117 |
advcl |
correlated,intrigued |
R6927 |
T11112 |
T11113 |
det |
the,timing |
R6928 |
T11113 |
T11111 |
nsubj |
timing,correlated |
R6929 |
T11114 |
T11113 |
prep |
of,timing |
R6930 |
T11115 |
T11116 |
det |
this,event |
R6931 |
T11116 |
T11114 |
pobj |
event,of |
R6932 |
T11118 |
T11111 |
prep |
with,correlated |
R6933 |
T11119 |
T11120 |
det |
the,activation |
R6934 |
T11120 |
T11118 |
pobj |
activation,with |
R6935 |
T11121 |
T11120 |
prep |
of,activation |
R6936 |
T11122 |
T11123 |
det |
a,complex |
R6937 |
T11123 |
T11121 |
pobj |
complex,of |
R6938 |
T11124 |
T11125 |
nmod |
LEF,factor |
R6939 |
T11125 |
T11123 |
compound |
factor,complex |
R6940 |
T11126 |
T11124 |
punct |
-,LEF |
R6941 |
T11127 |
T11124 |
nummod |
1,LEF |
R6942 |
T11128 |
T11124 |
punct |
/,LEF |
R6943 |
T11129 |
T11130 |
compound |
β,catenin |
R6944 |
T11130 |
T11124 |
appos |
catenin,LEF |
R6945 |
T11131 |
T11130 |
punct |
-,catenin |
R6946 |
T11132 |
T11125 |
compound |
transcription,factor |
R6947 |
T11133 |
T11134 |
punct |
[,20 |
R6948 |
T11134 |
T11111 |
parataxis |
20,correlated |
R6949 |
T11135 |
T11134 |
punct |
],20 |
R6950 |
T11136 |
T11117 |
punct |
", ",intrigued |
R6951 |
T11137 |
T11117 |
nsubjpass |
we,intrigued |
R6952 |
T11138 |
T11117 |
auxpass |
were,intrigued |
R6953 |
T11139 |
T11117 |
agent |
by,intrigued |
R6954 |
T11140 |
T11141 |
det |
the,presence |
R6955 |
T11141 |
T11139 |
pobj |
presence,by |
R6956 |
T11142 |
T11141 |
prep |
of,presence |
R6957 |
T11143 |
T11144 |
det |
a,site |
R6958 |
T11144 |
T11142 |
pobj |
site,of |
R6959 |
T11145 |
T11144 |
amod |
putative,site |
R6960 |
T11146 |
T11144 |
nmod |
LEF,site |
R6961 |
T11147 |
T11146 |
punct |
-,LEF |
R6962 |
T11148 |
T11146 |
nummod |
1,LEF |
R6963 |
T11149 |
T11146 |
punct |
/,LEF |
R6964 |
T11150 |
T11146 |
appos |
TCF,LEF |
R6965 |
T11151 |
T11144 |
compound |
binding,site |
R6966 |
T11152 |
T11141 |
prep |
in,presence |
R6967 |
T11153 |
T11154 |
det |
the,promoter |
R6968 |
T11154 |
T11152 |
pobj |
promoter,in |
R6969 |
T11155 |
T11156 |
compound |
E,cadherin |
R6970 |
T11156 |
T11154 |
compound |
cadherin,promoter |
R6971 |
T11157 |
T11156 |
punct |
-,cadherin |
R6972 |
T11158 |
T11117 |
punct |
.,intrigued |
R6973 |
T11160 |
T11161 |
nsubj |
This,prompted |
R6974 |
T11162 |
T11163 |
det |
an,investigation |
R6975 |
T11163 |
T11161 |
dobj |
investigation,prompted |
R6976 |
T11164 |
T11165 |
dep |
that,led |
R6977 |
T11165 |
T11163 |
relcl |
led,investigation |
R6978 |
T11166 |
T11165 |
advmod |
subsequently,led |
R6979 |
T11167 |
T11165 |
prep |
to,led |
R6980 |
T11168 |
T11169 |
poss |
our,discovery |
R6981 |
T11169 |
T11167 |
pobj |
discovery,to |
R6982 |
T11170 |
T11171 |
mark |
that,contribute |
R6983 |
T11171 |
T11169 |
acl |
contribute,discovery |
R6984 |
T11172 |
T11171 |
nsubj |
LEF,contribute |
R6985 |
T11173 |
T11172 |
punct |
-,LEF |
R6986 |
T11174 |
T11172 |
nummod |
1,LEF |
R6987 |
T11175 |
T11172 |
punct |
/,LEF |
R6988 |
T11176 |
T11177 |
compound |
β,catenin |
R6989 |
T11177 |
T11172 |
appos |
catenin,LEF |
R6990 |
T11178 |
T11177 |
punct |
-,catenin |
R6991 |
T11179 |
T11171 |
aux |
can,contribute |
R6992 |
T11180 |
T11171 |
prep |
to,contribute |
R6993 |
T11181 |
T11180 |
pobj |
repression,to |
R6994 |
T11182 |
T11181 |
prep |
of,repression |
R6995 |
T11183 |
T11184 |
compound |
E,cadherin |
R6996 |
T11184 |
T11186 |
compound |
cadherin,expression |
R6997 |
T11185 |
T11184 |
punct |
-,cadherin |
R6998 |
T11186 |
T11182 |
pobj |
expression,of |
R6999 |
T11187 |
T11186 |
compound |
gene,expression |
R7000 |
T11188 |
T11171 |
prep |
in,contribute |
R7001 |
T11189 |
T11190 |
compound |
skin,keratinocytes |
R7002 |
T11190 |
T11188 |
pobj |
keratinocytes,in |
R7003 |
T11191 |
T11192 |
punct |
[,4 |
R7004 |
T11192 |
T11161 |
parataxis |
4,prompted |
R7005 |
T11193 |
T11192 |
punct |
],4 |
R7006 |
T11194 |
T11161 |
punct |
.,prompted |
R7007 |
T11196 |
T11197 |
prep |
In,noted |
R7008 |
T11198 |
T11199 |
det |
the,course |
R7009 |
T11199 |
T11196 |
pobj |
course,In |
R7010 |
T11200 |
T11199 |
prep |
of,course |
R7011 |
T11201 |
T11202 |
det |
these,studies |
R7012 |
T11202 |
T11200 |
pobj |
studies,of |
R7013 |
T11203 |
T11197 |
punct |
", ",noted |
R7014 |
T11204 |
T11197 |
nsubj |
we,noted |
R7015 |
T11205 |
T11197 |
advmod |
also,noted |
R7016 |
T11206 |
T11207 |
mark |
that,contribute |
R7017 |
T11207 |
T11197 |
ccomp |
contribute,noted |
R7018 |
T11208 |
T11207 |
nsubj |
Snail,contribute |
R7019 |
T11209 |
T11207 |
aux |
can,contribute |
R7020 |
T11210 |
T11207 |
advmod |
also,contribute |
R7021 |
T11211 |
T11207 |
prep |
to,contribute |
R7022 |
T11212 |
T11213 |
det |
this,process |
R7023 |
T11213 |
T11211 |
pobj |
process,to |
R7024 |
T11214 |
T11207 |
prep |
in,contribute |
R7025 |
T11215 |
T11214 |
pobj |
keratinocytes,in |
R7026 |
T11216 |
T11217 |
advmod |
in,vitro |
R7027 |
T11217 |
T11207 |
advmod |
vitro,contribute |
R7028 |
T11218 |
T11197 |
punct |
", ",noted |
R7029 |
T11219 |
T11197 |
cc |
and,noted |
R7030 |
T11220 |
T11221 |
poss |
our,studies |
R7031 |
T11221 |
T11223 |
nsubj |
studies,revealed |
R7032 |
T11222 |
T11221 |
amod |
present,studies |
R7033 |
T11223 |
T11197 |
conj |
revealed,noted |
R7034 |
T11224 |
T11225 |
mark |
that,expressed |
R7035 |
T11225 |
T11223 |
ccomp |
expressed,revealed |
R7036 |
T11226 |
T11225 |
nsubjpass |
Snail,expressed |
R7037 |
T11227 |
T11225 |
auxpass |
is,expressed |
R7038 |
T11228 |
T11225 |
prep |
at,expressed |
R7039 |
T11229 |
T11230 |
det |
the,place |
R7040 |
T11230 |
T11228 |
pobj |
place,at |
R7041 |
T11231 |
T11230 |
amod |
right,place |
R7042 |
T11232 |
T11230 |
cc |
and,place |
R7043 |
T11233 |
T11230 |
conj |
time,place |
R7044 |
T11234 |
T11235 |
aux |
to,be |
R7045 |
T11235 |
T11230 |
advcl |
be,place |
R7046 |
T11236 |
T11237 |
advmod |
physiologically,relevant |
R7047 |
T11237 |
T11235 |
acomp |
relevant,be |
R7048 |
T11238 |
T11235 |
prep |
in,be |
R7049 |
T11239 |
T11240 |
det |
the,process |
R7050 |
T11240 |
T11238 |
pobj |
process,in |
R7051 |
T11241 |
T11223 |
punct |
.,revealed |
R7052 |
T11243 |
T11244 |
prep |
In,abrogated |
R7053 |
T11245 |
T11246 |
npadvmod |
noggin,null |
R7054 |
T11246 |
T11248 |
amod |
null,skin |
R7055 |
T11247 |
T11246 |
punct |
-,null |
R7056 |
T11248 |
T11243 |
pobj |
skin,In |
R7057 |
T11249 |
T11248 |
amod |
embryonic,skin |
R7058 |
T11250 |
T11244 |
punct |
", ",abrogated |
R7059 |
T11251 |
T11252 |
nmod |
LEF,expression |
R7060 |
T11252 |
T11244 |
nsubjpass |
expression,abrogated |
R7061 |
T11253 |
T11251 |
punct |
-,LEF |
R7062 |
T11254 |
T11251 |
nummod |
1,LEF |
R7063 |
T11255 |
T11252 |
cc |
and,expression |
R7064 |
T11256 |
T11257 |
amod |
subsequent,activation |
R7065 |
T11257 |
T11252 |
conj |
activation,expression |
R7066 |
T11258 |
T11257 |
prep |
of,activation |
R7067 |
T11259 |
T11260 |
det |
the,gene |
R7068 |
T11260 |
T11258 |
pobj |
gene,of |
R7069 |
T11261 |
T11260 |
nmod |
LEF,gene |
R7070 |
T11262 |
T11261 |
punct |
-,LEF |
R7071 |
T11263 |
T11261 |
nummod |
1,LEF |
R7072 |
T11264 |
T11261 |
punct |
/,LEF |
R7073 |
T11265 |
T11266 |
compound |
β,catenin |
R7074 |
T11266 |
T11261 |
appos |
catenin,LEF |
R7075 |
T11267 |
T11266 |
punct |
-,catenin |
R7076 |
T11268 |
T11260 |
compound |
reporter,gene |
R7077 |
T11269 |
T11244 |
auxpass |
is,abrogated |
R7078 |
T11270 |
T11244 |
prep |
in,abrogated |
R7079 |
T11271 |
T11272 |
det |
the,placodes |
R7080 |
T11272 |
T11270 |
pobj |
placodes,in |
R7081 |
T11273 |
T11272 |
amod |
developing,placodes |
R7082 |
T11274 |
T11244 |
punct |
.,abrogated |
R7083 |
T11276 |
T11277 |
det |
The,failure |
R7084 |
T11277 |
T11279 |
nsubj |
failure,underscores |
R7085 |
T11278 |
T11277 |
amod |
corresponding,failure |
R7086 |
T11280 |
T11277 |
prep |
of,failure |
R7087 |
T11281 |
T11282 |
nmod |
E,cadherin |
R7088 |
T11282 |
T11284 |
nmod |
cadherin,regulation |
R7089 |
T11283 |
T11282 |
punct |
-,cadherin |
R7090 |
T11284 |
T11280 |
pobj |
regulation,of |
R7091 |
T11285 |
T11284 |
amod |
down,regulation |
R7092 |
T11286 |
T11284 |
punct |
-,regulation |
R7093 |
T11287 |
T11288 |
det |
the,importance |
R7094 |
T11288 |
T11279 |
dobj |
importance,underscores |
R7095 |
T11289 |
T11288 |
prep |
of,importance |
R7096 |
T11290 |
T11291 |
compound |
Wnt,noggin |
R7097 |
T11291 |
T11293 |
compound |
noggin,signaling |
R7098 |
T11292 |
T11291 |
punct |
/,noggin |
R7099 |
T11293 |
T11289 |
pobj |
signaling,of |
R7100 |
T11294 |
T11288 |
prep |
in,importance |
R7101 |
T11295 |
T11294 |
pcomp |
regulating,in |
R7102 |
T11296 |
T11297 |
det |
this,event |
R7103 |
T11297 |
T11295 |
dobj |
event,regulating |
R7104 |
T11298 |
T11295 |
prep |
in,regulating |
R7105 |
T11299 |
T11300 |
compound |
follicle,morphogenesis |
R7106 |
T11300 |
T11298 |
pobj |
morphogenesis,in |
R7107 |
T11301 |
T11302 |
punct |
[,4 |
R7108 |
T11302 |
T11279 |
parataxis |
4,underscores |
R7109 |
T11303 |
T11302 |
punct |
],4 |
R7110 |
T11304 |
T11279 |
punct |
.,underscores |
R7111 |
T11306 |
T11307 |
amod |
Conditional,studies |
R7112 |
T11307 |
T11310 |
nsubj |
studies,be |
R7113 |
T11308 |
T11309 |
compound |
gene,targeting |
R7114 |
T11309 |
T11307 |
compound |
targeting,studies |
R7115 |
T11311 |
T11310 |
aux |
will,be |
R7116 |
T11312 |
T11310 |
acomp |
necessary,be |
R7117 |
T11313 |
T11314 |
aux |
to,establish |
R7118 |
T11314 |
T11310 |
advcl |
establish,be |
R7119 |
T11315 |
T11316 |
mark |
whether,contribute |
R7120 |
T11316 |
T11314 |
ccomp |
contribute,establish |
R7121 |
T11317 |
T11318 |
compound |
Snail,members |
R7122 |
T11318 |
T11316 |
nsubj |
members,contribute |
R7123 |
T11319 |
T11318 |
compound |
family,members |
R7124 |
T11320 |
T11316 |
advmod |
also,contribute |
R7125 |
T11321 |
T11316 |
prep |
to,contribute |
R7126 |
T11322 |
T11323 |
det |
the,regulation |
R7127 |
T11323 |
T11321 |
pobj |
regulation,to |
R7128 |
T11324 |
T11323 |
amod |
down,regulation |
R7129 |
T11325 |
T11323 |
punct |
-,regulation |
R7130 |
T11326 |
T11323 |
prep |
in,regulation |
R7131 |
T11327 |
T11328 |
compound |
E,cadherin |
R7132 |
T11328 |
T11330 |
compound |
cadherin,expression |
R7133 |
T11329 |
T11328 |
punct |
-,cadherin |
R7134 |
T11330 |
T11326 |
pobj |
expression,in |
R7135 |
T11331 |
T11330 |
compound |
gene,expression |
R7136 |
T11332 |
T11333 |
dep |
that,occurs |
R7137 |
T11333 |
T11323 |
relcl |
occurs,regulation |
R7138 |
T11334 |
T11333 |
prep |
during,occurs |
R7139 |
T11335 |
T11336 |
compound |
follicle,formation |
R7140 |
T11336 |
T11334 |
pobj |
formation,during |
R7141 |
T11337 |
T11310 |
punct |
.,be |
R7142 |
T11339 |
T11340 |
advmod |
However,is |
R7143 |
T11341 |
T11340 |
punct |
", ",is |
R7144 |
T11342 |
T11340 |
nsubj |
it,is |
R7145 |
T11343 |
T11340 |
acomp |
intriguing,is |
R7146 |
T11344 |
T11345 |
mark |
that,displayed |
R7147 |
T11345 |
T11340 |
ccomp |
displayed,is |
R7148 |
T11346 |
T11347 |
compound |
K14,Snail |
R7149 |
T11347 |
T11349 |
compound |
Snail,epidermis |
R7150 |
T11348 |
T11347 |
punct |
-,Snail |
R7151 |
T11349 |
T11345 |
nsubj |
epidermis,displayed |
R7152 |
T11350 |
T11349 |
compound |
Tg,epidermis |
R7153 |
T11351 |
T11352 |
det |
a,regulation |
R7154 |
T11352 |
T11345 |
dobj |
regulation,displayed |
R7155 |
T11353 |
T11352 |
amod |
marked,regulation |
R7156 |
T11354 |
T11352 |
amod |
down,regulation |
R7157 |
T11355 |
T11352 |
punct |
-,regulation |
R7158 |
T11356 |
T11352 |
prep |
in,regulation |
R7159 |
T11357 |
T11358 |
compound |
E,cadherin |
R7160 |
T11358 |
T11360 |
compound |
cadherin,expression |
R7161 |
T11359 |
T11358 |
punct |
-,cadherin |
R7162 |
T11360 |
T11356 |
pobj |
expression,in |
R7163 |
T11361 |
T11345 |
punct |
", ",displayed |
R7164 |
T11362 |
T11363 |
advmod |
thereby,demonstrating |
R7165 |
T11363 |
T11345 |
advcl |
demonstrating,displayed |
R7166 |
T11364 |
T11365 |
poss |
its,potential |
R7167 |
T11365 |
T11363 |
dobj |
potential,demonstrating |
R7168 |
T11366 |
T11367 |
aux |
to,do |
R7169 |
T11367 |
T11365 |
acl |
do,potential |
R7170 |
T11368 |
T11367 |
advmod |
so,do |
R7171 |
T11369 |
T11367 |
prep |
in,do |
R7172 |
T11370 |
T11369 |
pobj |
skin,in |
R7173 |
T11371 |
T11340 |
punct |
.,is |
R7174 |
T11373 |
T11374 |
poss |
Our,findings |
R7175 |
T11374 |
T11376 |
nsubj |
findings,showed |
R7176 |
T11375 |
T11374 |
amod |
prior,findings |
R7177 |
T11377 |
T11378 |
mark |
that,impaired |
R7178 |
T11378 |
T11376 |
ccomp |
impaired,showed |
R7179 |
T11379 |
T11378 |
prep |
by,impaired |
R7180 |
T11380 |
T11379 |
pcomp |
elevating,by |
R7181 |
T11381 |
T11382 |
compound |
E,cadherin |
R7182 |
T11382 |
T11384 |
compound |
cadherin,levels |
R7183 |
T11383 |
T11382 |
punct |
-,cadherin |
R7184 |
T11384 |
T11380 |
dobj |
levels,elevating |
R7185 |
T11385 |
T11379 |
cc |
or,by |
R7186 |
T11386 |
T11379 |
conj |
by,by |
R7187 |
T11387 |
T11388 |
advmod |
conditionally,ablating |
R7188 |
T11388 |
T11386 |
pcomp |
ablating,by |
R7189 |
T11389 |
T11390 |
compound |
α,catenin |
R7190 |
T11390 |
T11388 |
dobj |
catenin,ablating |
R7191 |
T11391 |
T11390 |
punct |
-,catenin |
R7192 |
T11392 |
T11378 |
punct |
", ",impaired |
R7193 |
T11393 |
T11394 |
compound |
hair,follicle |
R7194 |
T11394 |
T11395 |
compound |
follicle,morphogenesis |
R7195 |
T11395 |
T11378 |
nsubjpass |
morphogenesis,impaired |
R7196 |
T11396 |
T11378 |
aux |
can,impaired |
R7197 |
T11397 |
T11378 |
auxpass |
be,impaired |
R7198 |
T11398 |
T11399 |
punct |
[,7 |
R7199 |
T11399 |
T11376 |
parataxis |
7,showed |
R7200 |
T11400 |
T11399 |
nummod |
4,7 |
R7201 |
T11401 |
T11399 |
punct |
",",7 |
R7202 |
T11402 |
T11399 |
punct |
],7 |
R7203 |
T11403 |
T11376 |
punct |
.,showed |
R7204 |
T11405 |
T11406 |
det |
The,hyperproliferation |
R7205 |
T11406 |
T11409 |
nsubj |
hyperproliferation,led |
R7206 |
T11407 |
T11406 |
amod |
marked,hyperproliferation |
R7207 |
T11408 |
T11406 |
amod |
epidermal,hyperproliferation |
R7208 |
T11410 |
T11406 |
acl |
seen,hyperproliferation |
R7209 |
T11411 |
T11410 |
prep |
in,seen |
R7210 |
T11412 |
T11413 |
det |
the,skin |
R7211 |
T11413 |
T11411 |
pobj |
skin,in |
R7212 |
T11414 |
T11415 |
compound |
K14,Snail |
R7213 |
T11415 |
T11413 |
compound |
Snail,skin |
R7214 |
T11416 |
T11415 |
punct |
-,Snail |
R7215 |
T11417 |
T11413 |
compound |
Tg,skin |
R7216 |
T11418 |
T11406 |
punct |
", ",hyperproliferation |
R7217 |
T11419 |
T11406 |
acl |
coupled,hyperproliferation |
R7218 |
T11420 |
T11419 |
prep |
with,coupled |
R7219 |
T11421 |
T11422 |
det |
the,suppression |
R7220 |
T11422 |
T11420 |
pobj |
suppression,with |
R7221 |
T11423 |
T11422 |
amod |
converse,suppression |
R7222 |
T11424 |
T11422 |
prep |
of,suppression |
R7223 |
T11425 |
T11424 |
pobj |
proliferation,of |
R7224 |
T11426 |
T11425 |
cc |
and,proliferation |
R7225 |
T11427 |
T11425 |
conj |
Snail,proliferation |
R7226 |
T11428 |
T11422 |
prep |
in,suppression |
R7227 |
T11429 |
T11430 |
compound |
TGF,β2 |
R7228 |
T11430 |
T11432 |
npadvmod |
β2,null |
R7229 |
T11431 |
T11430 |
punct |
-,β2 |
R7230 |
T11432 |
T11434 |
amod |
null,buds |
R7231 |
T11433 |
T11432 |
punct |
-,null |
R7232 |
T11434 |
T11428 |
pobj |
buds,in |
R7233 |
T11435 |
T11434 |
compound |
hair,buds |
R7234 |
T11436 |
T11409 |
dobj |
us,led |
R7235 |
T11437 |
T11438 |
aux |
to,wonder |
R7236 |
T11438 |
T11409 |
xcomp |
wonder,led |
R7237 |
T11439 |
T11440 |
mark |
whether,have |
R7238 |
T11440 |
T11438 |
ccomp |
have,wonder |
R7239 |
T11441 |
T11442 |
det |
the,regulation |
R7240 |
T11442 |
T11440 |
nsubj |
regulation,have |
R7241 |
T11443 |
T11442 |
amod |
down,regulation |
R7242 |
T11444 |
T11442 |
punct |
-,regulation |
R7243 |
T11445 |
T11442 |
prep |
of,regulation |
R7244 |
T11446 |
T11447 |
compound |
E,cadherin |
R7245 |
T11447 |
T11445 |
pobj |
cadherin,of |
R7246 |
T11448 |
T11447 |
punct |
-,cadherin |
R7247 |
T11449 |
T11442 |
prep |
during,regulation |
R7248 |
T11450 |
T11451 |
compound |
follicle,morphogenesis |
R7249 |
T11451 |
T11449 |
pobj |
morphogenesis,during |
R7250 |
T11452 |
T11440 |
aux |
might,have |
R7251 |
T11453 |
T11454 |
det |
a,impact |
R7252 |
T11454 |
T11440 |
dobj |
impact,have |
R7253 |
T11455 |
T11454 |
amod |
direct,impact |
R7254 |
T11456 |
T11454 |
prep |
on,impact |
R7255 |
T11457 |
T11456 |
pcomp |
elevating,on |
R7256 |
T11458 |
T11459 |
det |
the,state |
R7257 |
T11459 |
T11457 |
dobj |
state,elevating |
R7258 |
T11460 |
T11459 |
amod |
proliferative,state |
R7259 |
T11461 |
T11459 |
prep |
of,state |
R7260 |
T11462 |
T11463 |
det |
these,cells |
R7261 |
T11463 |
T11461 |
pobj |
cells,of |
R7262 |
T11464 |
T11409 |
punct |
.,led |
R7263 |
T11466 |
T11467 |
poss |
Our,studies |
R7264 |
T11467 |
T11469 |
nsubj |
studies,suggested |
R7265 |
T11468 |
T11467 |
compound |
Tg,studies |
R7266 |
T11470 |
T11471 |
mark |
that,is |
R7267 |
T11471 |
T11469 |
ccomp |
is,suggested |
R7268 |
T11472 |
T11471 |
punct |
", ",is |
R7269 |
T11473 |
T11474 |
advmod |
at,least |
R7270 |
T11474 |
T11475 |
advmod |
least,in |
R7271 |
T11475 |
T11476 |
prep |
in,through |
R7272 |
T11476 |
T11471 |
prep |
through,is |
R7273 |
T11477 |
T11475 |
pobj |
part,in |
R7274 |
T11478 |
T11479 |
poss |
its,regulation |
R7275 |
T11479 |
T11476 |
pobj |
regulation,through |
R7276 |
T11480 |
T11479 |
prep |
of,regulation |
R7277 |
T11481 |
T11482 |
compound |
E,cadherin |
R7278 |
T11482 |
T11480 |
pobj |
cadherin,of |
R7279 |
T11483 |
T11482 |
punct |
-,cadherin |
R7280 |
T11484 |
T11471 |
punct |
", ",is |
R7281 |
T11485 |
T11471 |
nsubj |
Snail,is |
R7282 |
T11486 |
T11471 |
acomp |
able,is |
R7283 |
T11487 |
T11488 |
aux |
to,influence |
R7284 |
T11488 |
T11486 |
xcomp |
influence,able |
R7285 |
T11489 |
T11490 |
det |
the,localization |
R7286 |
T11490 |
T11488 |
dobj |
localization,influence |
R7287 |
T11491 |
T11490 |
amod |
subcellular,localization |
R7288 |
T11492 |
T11490 |
prep |
of,localization |
R7289 |
T11493 |
T11494 |
det |
a,variety |
R7290 |
T11494 |
T11492 |
pobj |
variety,of |
R7291 |
T11495 |
T11494 |
prep |
of,variety |
R7292 |
T11496 |
T11497 |
npadvmod |
AJ,associated |
R7293 |
T11497 |
T11499 |
amod |
associated,proteins |
R7294 |
T11498 |
T11497 |
punct |
-,associated |
R7295 |
T11499 |
T11495 |
pobj |
proteins,of |
R7296 |
T11500 |
T11469 |
punct |
.,suggested |
R7297 |
T11502 |
T11503 |
nsubj |
One,appears |
R7298 |
T11504 |
T11502 |
prep |
of,One |
R7299 |
T11505 |
T11504 |
pobj |
these,of |
R7300 |
T11506 |
T11507 |
aux |
to,be |
R7301 |
T11507 |
T11503 |
xcomp |
be,appears |
R7302 |
T11508 |
T11507 |
attr |
Ajuba,be |
R7303 |
T11509 |
T11508 |
punct |
", ",Ajuba |
R7304 |
T11510 |
T11511 |
dep |
which,shown |
R7305 |
T11511 |
T11508 |
relcl |
shown,Ajuba |
R7306 |
T11512 |
T11511 |
auxpass |
was,shown |
R7307 |
T11513 |
T11511 |
advmod |
previously,shown |
R7308 |
T11514 |
T11515 |
aux |
to,have |
R7309 |
T11515 |
T11511 |
xcomp |
have,shown |
R7310 |
T11516 |
T11517 |
det |
the,capacity |
R7311 |
T11517 |
T11515 |
dobj |
capacity,have |
R7312 |
T11518 |
T11517 |
amod |
dual,capacity |
R7313 |
T11519 |
T11520 |
aux |
to,bind |
R7314 |
T11520 |
T11517 |
acl |
bind,capacity |
R7315 |
T11521 |
T11520 |
dobj |
Grb,bind |
R7316 |
T11522 |
T11521 |
punct |
-,Grb |
R7317 |
T11523 |
T11521 |
nummod |
2,Grb |
R7318 |
T11524 |
T11525 |
advmod |
as,as |
R7319 |
T11525 |
T11521 |
cc |
as,Grb |
R7320 |
T11526 |
T11525 |
advmod |
well,as |
R7321 |
T11527 |
T11528 |
compound |
α,catenin |
R7322 |
T11528 |
T11521 |
conj |
catenin,Grb |
R7323 |
T11529 |
T11528 |
punct |
-,catenin |
R7324 |
T11530 |
T11531 |
punct |
[,10 |
R7325 |
T11531 |
T11503 |
parataxis |
10,appears |
R7326 |
T11532 |
T11531 |
nummod |
9,10 |
R7327 |
T11533 |
T11531 |
punct |
",",10 |
R7328 |
T11534 |
T11531 |
punct |
],10 |
R7329 |
T11535 |
T11503 |
punct |
.,appears |
R7330 |
T11537 |
T11538 |
poss |
Our,studies |
R7331 |
T11538 |
T11539 |
nsubj |
studies,revealed |
R7332 |
T11540 |
T11541 |
mark |
that,develops |
R7333 |
T11541 |
T11539 |
ccomp |
develops,revealed |
R7334 |
T11542 |
T11541 |
prep |
in,develops |
R7335 |
T11543 |
T11544 |
compound |
skin,keratinocytes |
R7336 |
T11544 |
T11542 |
pobj |
keratinocytes,in |
R7337 |
T11545 |
T11546 |
dep |
that,harbor |
R7338 |
T11546 |
T11544 |
advcl |
harbor,keratinocytes |
R7339 |
T11547 |
T11546 |
preconj |
either,harbor |
R7340 |
T11548 |
T11549 |
det |
a,mutation |
R7341 |
T11549 |
T11546 |
dobj |
mutation,harbor |
R7342 |
T11550 |
T11549 |
amod |
conditional,mutation |
R7343 |
T11551 |
T11549 |
amod |
null,mutation |
R7344 |
T11552 |
T11546 |
prep |
in,harbor |
R7345 |
T11553 |
T11554 |
compound |
α,catenin |
R7346 |
T11554 |
T11552 |
pobj |
catenin,in |
R7347 |
T11555 |
T11554 |
punct |
-,catenin |
R7348 |
T11556 |
T11546 |
cc |
or,harbor |
R7349 |
T11557 |
T11558 |
dep |
that,overexpress |
R7350 |
T11558 |
T11546 |
conj |
overexpress,harbor |
R7351 |
T11559 |
T11558 |
dobj |
Snail,overexpress |
R7352 |
T11560 |
T11541 |
punct |
", ",develops |
R7353 |
T11561 |
T11541 |
nsubj |
Ajuba,develops |
R7354 |
T11562 |
T11563 |
det |
an,interaction |
R7355 |
T11563 |
T11541 |
dobj |
interaction,develops |
R7356 |
T11564 |
T11563 |
prep |
with,interaction |
R7357 |
T11565 |
T11564 |
pobj |
Grb,with |
R7358 |
T11566 |
T11565 |
punct |
-,Grb |
R7359 |
T11567 |
T11565 |
nummod |
2,Grb |
R7360 |
T11568 |
T11569 |
dep |
that,observed |
R7361 |
T11569 |
T11563 |
relcl |
observed,interaction |
R7362 |
T11570 |
T11569 |
auxpass |
is,observed |
R7363 |
T11571 |
T11569 |
advmod |
otherwise,observed |
R7364 |
T11572 |
T11569 |
neg |
not,observed |
R7365 |
T11573 |
T11569 |
prep |
in,observed |
R7366 |
T11574 |
T11575 |
compound |
WT,keratinocytes |
R7367 |
T11575 |
T11573 |
pobj |
keratinocytes,in |
R7368 |
T11576 |
T11539 |
punct |
.,revealed |
R7369 |
T11578 |
T11579 |
det |
The,abilities |
R7370 |
T11579 |
T11581 |
nsubj |
abilities,suggest |
R7371 |
T11580 |
T11579 |
amod |
corresponding,abilities |
R7372 |
T11582 |
T11579 |
prep |
of,abilities |
R7373 |
T11583 |
T11584 |
preconj |
either,keratinocytes |
R7374 |
T11584 |
T11582 |
pobj |
keratinocytes,of |
R7375 |
T11585 |
T11586 |
npadvmod |
Snail,transfected |
R7376 |
T11586 |
T11584 |
amod |
transfected,keratinocytes |
R7377 |
T11587 |
T11586 |
punct |
-,transfected |
R7378 |
T11588 |
T11586 |
cc |
or,transfected |
R7379 |
T11589 |
T11590 |
npadvmod |
Ajuba,transfected |
R7380 |
T11590 |
T11586 |
conj |
transfected,transfected |
R7381 |
T11591 |
T11590 |
punct |
-,transfected |
R7382 |
T11592 |
T11593 |
aux |
to,exhibit |
R7383 |
T11593 |
T11579 |
acl |
exhibit,abilities |
R7384 |
T11594 |
T11595 |
amod |
elevated,activation |
R7385 |
T11595 |
T11593 |
dobj |
activation,exhibit |
R7386 |
T11596 |
T11595 |
prep |
of,activation |
R7387 |
T11597 |
T11598 |
det |
the,pathway |
R7388 |
T11598 |
T11596 |
pobj |
pathway,of |
R7389 |
T11599 |
T11600 |
compound |
Ras,MAPK |
R7390 |
T11600 |
T11598 |
compound |
MAPK,pathway |
R7391 |
T11601 |
T11600 |
punct |
-,MAPK |
R7392 |
T11602 |
T11603 |
mark |
that,be |
R7393 |
T11603 |
T11581 |
ccomp |
be,suggest |
R7394 |
T11604 |
T11605 |
det |
the,association |
R7395 |
T11605 |
T11603 |
nsubj |
association,be |
R7396 |
T11606 |
T11605 |
nmod |
Grb,association |
R7397 |
T11607 |
T11606 |
punct |
-,Grb |
R7398 |
T11608 |
T11606 |
nummod |
2,Grb |
R7399 |
T11609 |
T11605 |
prep |
of,association |
R7400 |
T11610 |
T11609 |
pobj |
Ajuba,of |
R7401 |
T11611 |
T11603 |
prep |
under,be |
R7402 |
T11612 |
T11611 |
pobj |
conditions,under |
R7403 |
T11613 |
T11612 |
prep |
of,conditions |
R7404 |
T11614 |
T11615 |
amod |
reduced,levels |
R7405 |
T11615 |
T11613 |
pobj |
levels,of |
R7406 |
T11616 |
T11615 |
prep |
of,levels |
R7407 |
T11617 |
T11618 |
compound |
AJ,proteins |
R7408 |
T11618 |
T11616 |
pobj |
proteins,of |
R7409 |
T11619 |
T11603 |
aux |
may,be |
R7410 |
T11620 |
T11621 |
advmod |
directly,relevant |
R7411 |
T11621 |
T11603 |
acomp |
relevant,be |
R7412 |
T11622 |
T11621 |
prep |
to,relevant |
R7413 |
T11623 |
T11624 |
det |
the,parallel |
R7414 |
T11624 |
T11622 |
pobj |
parallel,to |
R7415 |
T11625 |
T11624 |
prep |
in,parallel |
R7416 |
T11626 |
T11625 |
pobj |
hyperproliferation,in |
R7417 |
T11627 |
T11581 |
punct |
.,suggest |
R7418 |
T11629 |
T11630 |
prep |
In,shown |
R7419 |
T11631 |
T11632 |
amod |
stable,lines |
R7420 |
T11632 |
T11629 |
pobj |
lines,In |
R7421 |
T11633 |
T11632 |
amod |
epithelial,lines |
R7422 |
T11634 |
T11635 |
punct |
(,kidney |
R7423 |
T11635 |
T11632 |
parataxis |
kidney,lines |
R7424 |
T11636 |
T11635 |
advmod |
i.e.,kidney |
R7425 |
T11637 |
T11635 |
punct |
", ",kidney |
R7426 |
T11638 |
T11639 |
nmod |
Madin,Darby |
R7427 |
T11639 |
T11635 |
nmod |
Darby,kidney |
R7428 |
T11640 |
T11639 |
punct |
-,Darby |
R7429 |
T11641 |
T11635 |
amod |
canine,kidney |
R7430 |
T11642 |
T11635 |
punct |
", ",kidney |
R7431 |
T11643 |
T11635 |
cc |
or,kidney |
R7432 |
T11644 |
T11635 |
conj |
MDCK,kidney |
R7433 |
T11645 |
T11635 |
punct |
),kidney |
R7434 |
T11646 |
T11632 |
compound |
cell,lines |
R7435 |
T11647 |
T11630 |
punct |
", ",shown |
R7436 |
T11648 |
T11630 |
nsubjpass |
Snail,shown |
R7437 |
T11649 |
T11630 |
aux |
has,shown |
R7438 |
T11650 |
T11630 |
auxpass |
been,shown |
R7439 |
T11651 |
T11652 |
aux |
to,block |
R7440 |
T11652 |
T11630 |
xcomp |
block,shown |
R7441 |
T11653 |
T11654 |
compound |
cell,cycle |
R7442 |
T11654 |
T11655 |
compound |
cycle,progression |
R7443 |
T11655 |
T11652 |
dobj |
progression,block |
R7444 |
T11656 |
T11652 |
cc |
and,block |
R7445 |
T11657 |
T11652 |
conj |
promote,block |
R7446 |
T11658 |
T11659 |
nmod |
motility,changes |
R7447 |
T11659 |
T11657 |
dobj |
changes,promote |
R7448 |
T11660 |
T11658 |
cc |
and,motility |
R7449 |
T11661 |
T11658 |
conj |
shape,motility |
R7450 |
T11662 |
T11657 |
prep |
for,promote |
R7451 |
T11663 |
T11662 |
pobj |
invasion,for |
R7452 |
T11664 |
T11665 |
punct |
[,47 |
R7453 |
T11665 |
T11630 |
parataxis |
47,shown |
R7454 |
T11666 |
T11665 |
punct |
],47 |
R7455 |
T11667 |
T11630 |
punct |
.,shown |
R7456 |
T11669 |
T11670 |
mark |
While,are |
R7457 |
T11670 |
T11675 |
advcl |
are,differ |
R7458 |
T11671 |
T11672 |
poss |
our,studies |
R7459 |
T11672 |
T11670 |
nsubj |
studies,are |
R7460 |
T11673 |
T11674 |
advmod |
in,vivo |
R7461 |
T11674 |
T11672 |
amod |
vivo,studies |
R7462 |
T11676 |
T11670 |
acomp |
consistent,are |
R7463 |
T11677 |
T11676 |
prep |
with,consistent |
R7464 |
T11678 |
T11679 |
det |
a,role |
R7465 |
T11679 |
T11677 |
pobj |
role,with |
R7466 |
T11680 |
T11679 |
prep |
for,role |
R7467 |
T11681 |
T11680 |
pobj |
Snail,for |
R7468 |
T11682 |
T11679 |
prep |
in,role |
R7469 |
T11683 |
T11684 |
nmod |
motility,remodeling |
R7470 |
T11684 |
T11682 |
pobj |
remodeling,in |
R7471 |
T11685 |
T11683 |
cc |
and,motility |
R7472 |
T11686 |
T11683 |
conj |
epithelial,motility |
R7473 |
T11687 |
T11675 |
punct |
", ",differ |
R7474 |
T11688 |
T11675 |
nsubj |
they,differ |
R7475 |
T11689 |
T11675 |
prep |
with,differ |
R7476 |
T11690 |
T11689 |
pobj |
respect,with |
R7477 |
T11691 |
T11690 |
prep |
to,respect |
R7478 |
T11692 |
T11693 |
poss |
Snail,effects |
R7479 |
T11693 |
T11691 |
pobj |
effects,to |
R7480 |
T11694 |
T11692 |
case |
's,Snail |
R7481 |
T11695 |
T11693 |
amod |
apparent,effects |
R7482 |
T11696 |
T11693 |
amod |
proliferative,effects |
R7483 |
T11697 |
T11675 |
punct |
.,differ |
R7484 |
T11699 |
T11700 |
advmod |
A,priori |
R7485 |
T11700 |
T11701 |
advmod |
priori,be |
R7486 |
T11702 |
T11701 |
punct |
", ",be |
R7487 |
T11703 |
T11701 |
nsubj |
this,be |
R7488 |
T11704 |
T11701 |
aux |
could,be |
R7489 |
T11705 |
T11701 |
advmod |
simply,be |
R7490 |
T11706 |
T11701 |
prep |
due,be |
R7491 |
T11707 |
T11706 |
pcomp |
to,due |
R7492 |
T11708 |
T11706 |
pobj |
variations,due |
R7493 |
T11709 |
T11708 |
prep |
in,variations |
R7494 |
T11710 |
T11711 |
det |
the,response |
R7495 |
T11711 |
T11709 |
pobj |
response,in |
R7496 |
T11712 |
T11711 |
prep |
of,response |
R7497 |
T11713 |
T11714 |
amod |
different,types |
R7498 |
T11714 |
T11712 |
pobj |
types,of |
R7499 |
T11715 |
T11714 |
compound |
cell,types |
R7500 |
T11716 |
T11711 |
prep |
to,response |
R7501 |
T11717 |
T11718 |
compound |
Snail,expression |
R7502 |
T11718 |
T11716 |
pobj |
expression,to |
R7503 |
T11719 |
T11701 |
punct |
.,be |
R7504 |
T11721 |
T11722 |
advmod |
Alternatively,be |
R7505 |
T11723 |
T11722 |
punct |
", ",be |
R7506 |
T11724 |
T11725 |
det |
these,differences |
R7507 |
T11725 |
T11722 |
nsubj |
differences,be |
R7508 |
T11726 |
T11722 |
aux |
may,be |
R7509 |
T11727 |
T11722 |
acomp |
relevant,be |
R7510 |
T11728 |
T11727 |
prep |
to,relevant |
R7511 |
T11729 |
T11730 |
det |
the,benefit |
R7512 |
T11730 |
T11728 |
pobj |
benefit,to |
R7513 |
T11731 |
T11730 |
prep |
of,benefit |
R7514 |
T11732 |
T11731 |
pcomp |
using,of |
R7515 |
T11733 |
T11734 |
compound |
mouse,models |
R7516 |
T11734 |
T11732 |
dobj |
models,using |
R7517 |
T11735 |
T11736 |
aux |
to,reveal |
R7518 |
T11736 |
T11732 |
advcl |
reveal,using |
R7519 |
T11737 |
T11736 |
dobj |
functions,reveal |
R7520 |
T11738 |
T11739 |
neg |
not,recapitulated |
R7521 |
T11739 |
T11737 |
acl |
recapitulated,functions |
R7522 |
T11740 |
T11739 |
advmod |
always,recapitulated |
R7523 |
T11741 |
T11739 |
prep |
in,recapitulated |
R7524 |
T11742 |
T11743 |
amod |
stable,models |
R7525 |
T11743 |
T11741 |
pobj |
models,in |
R7526 |
T11744 |
T11745 |
compound |
cell,line |
R7527 |
T11745 |
T11743 |
compound |
line,models |
R7528 |
T11746 |
T11722 |
punct |
.,be |
R7529 |
T11748 |
T11749 |
amod |
Future,studies |
R7530 |
T11749 |
T11750 |
nsubj |
studies,highlight |
R7531 |
T11751 |
T11750 |
aux |
should,highlight |
R7532 |
T11752 |
T11753 |
det |
the,reasons |
R7533 |
T11753 |
T11750 |
dobj |
reasons,highlight |
R7534 |
T11754 |
T11753 |
amod |
underlying,reasons |
R7535 |
T11755 |
T11753 |
prep |
for,reasons |
R7536 |
T11756 |
T11757 |
det |
these,results |
R7537 |
T11757 |
T11755 |
pobj |
results,for |
R7538 |
T11758 |
T11757 |
amod |
opposing,results |
R7539 |
T11759 |
T11750 |
punct |
.,highlight |
R7540 |
T11761 |
T11762 |
advcl |
Irrespective,stand |
R7541 |
T11763 |
T11761 |
prep |
of,Irrespective |
R7542 |
T11764 |
T11765 |
det |
these,differences |
R7543 |
T11765 |
T11763 |
pobj |
differences,of |
R7544 |
T11766 |
T11762 |
punct |
", ",stand |
R7545 |
T11767 |
T11768 |
poss |
our,studies |
R7546 |
T11768 |
T11762 |
nsubj |
studies,stand |
R7547 |
T11769 |
T11770 |
advmod |
in,vivo |
R7548 |
T11770 |
T11768 |
amod |
vivo,studies |
R7549 |
T11771 |
T11762 |
aux |
do,stand |
R7550 |
T11772 |
T11762 |
neg |
not,stand |
R7551 |
T11773 |
T11762 |
advmod |
alone,stand |
R7552 |
T11774 |
T11762 |
punct |
", ",stand |
R7553 |
T11775 |
T11776 |
mark |
as,are |
R7554 |
T11776 |
T11762 |
advcl |
are,stand |
R7555 |
T11777 |
T11776 |
expl |
there,are |
R7556 |
T11778 |
T11779 |
amod |
many,situations |
R7557 |
T11779 |
T11776 |
attr |
situations,are |
R7558 |
T11780 |
T11781 |
prep |
in,correlate |
R7559 |
T11781 |
T11779 |
relcl |
correlate,situations |
R7560 |
T11782 |
T11780 |
pobj |
which,in |
R7561 |
T11783 |
T11784 |
det |
a,regulation |
R7562 |
T11784 |
T11781 |
nsubj |
regulation,correlate |
R7563 |
T11785 |
T11784 |
amod |
down,regulation |
R7564 |
T11786 |
T11784 |
punct |
-,regulation |
R7565 |
T11787 |
T11784 |
prep |
in,regulation |
R7566 |
T11788 |
T11789 |
compound |
AJ,proteins |
R7567 |
T11789 |
T11787 |
pobj |
proteins,in |
R7568 |
T11790 |
T11781 |
prep |
with,correlate |
R7569 |
T11791 |
T11792 |
amod |
enhanced,proliferation |
R7570 |
T11792 |
T11790 |
pobj |
proliferation,with |
R7571 |
T11793 |
T11762 |
punct |
.,stand |
R7572 |
T11795 |
T11796 |
prep |
In,implicated |
R7573 |
T11797 |
T11795 |
pobj |
fact,In |
R7574 |
T11798 |
T11796 |
punct |
", ",implicated |
R7575 |
T11799 |
T11800 |
det |
a,myriad |
R7576 |
T11800 |
T11796 |
nsubjpass |
myriad,implicated |
R7577 |
T11801 |
T11800 |
prep |
of,myriad |
R7578 |
T11802 |
T11803 |
amod |
diverse,mechanisms |
R7579 |
T11803 |
T11801 |
pobj |
mechanisms,of |
R7580 |
T11804 |
T11796 |
aux |
have,implicated |
R7581 |
T11805 |
T11796 |
auxpass |
been,implicated |
R7582 |
T11806 |
T11796 |
prep |
in,implicated |
R7583 |
T11807 |
T11806 |
pcomp |
activating,in |
R7584 |
T11808 |
T11809 |
amod |
epithelial,proliferation |
R7585 |
T11809 |
T11807 |
dobj |
proliferation,activating |
R7586 |
T11810 |
T11807 |
prep |
upon,activating |
R7587 |
T11811 |
T11812 |
amod |
down,regulation |
R7588 |
T11812 |
T11810 |
pobj |
regulation,upon |
R7589 |
T11813 |
T11812 |
punct |
-,regulation |
R7590 |
T11814 |
T11812 |
prep |
of,regulation |
R7591 |
T11815 |
T11816 |
compound |
AJ,proteins |
R7592 |
T11816 |
T11814 |
pobj |
proteins,of |
R7593 |
T11817 |
T11818 |
punct |
[,48 |
R7594 |
T11818 |
T11796 |
parataxis |
48,implicated |
R7595 |
T11819 |
T11818 |
nummod |
7,48 |
R7596 |
T11820 |
T11818 |
punct |
",",48 |
R7597 |
T11821 |
T11818 |
nummod |
23,48 |
R7598 |
T11822 |
T11818 |
punct |
",",48 |
R7599 |
T11823 |
T11818 |
nummod |
24,48 |
R7600 |
T11824 |
T11818 |
punct |
",",48 |
R7601 |
T11825 |
T11818 |
punct |
],48 |
R7602 |
T11826 |
T11796 |
punct |
.,implicated |
R7603 |
T11828 |
T11829 |
csubj |
Sifting,is |
R7604 |
T11830 |
T11828 |
prep |
through,Sifting |
R7605 |
T11831 |
T11832 |
det |
these,pathways |
R7606 |
T11832 |
T11830 |
pobj |
pathways,through |
R7607 |
T11833 |
T11832 |
amod |
converging,pathways |
R7608 |
T11834 |
T11829 |
acomp |
likely,is |
R7609 |
T11835 |
T11836 |
aux |
to,be |
R7610 |
T11836 |
T11834 |
xcomp |
be,likely |
R7611 |
T11837 |
T11838 |
det |
a,process |
R7612 |
T11838 |
T11836 |
attr |
process,be |
R7613 |
T11839 |
T11838 |
amod |
difficult,process |
R7614 |
T11840 |
T11839 |
cc |
and,difficult |
R7615 |
T11841 |
T11839 |
conj |
painstaking,difficult |
R7616 |
T11842 |
T11829 |
punct |
.,is |
R7617 |
T11844 |
T11845 |
nsubj |
This,said |
R7618 |
T11845 |
T11846 |
advcl |
said,begin |
R7619 |
T11847 |
T11846 |
punct |
", ",begin |
R7620 |
T11848 |
T11846 |
prep |
by,begin |
R7621 |
T11849 |
T11848 |
pcomp |
identifying,by |
R7622 |
T11850 |
T11851 |
det |
the,status |
R7623 |
T11851 |
T11849 |
dobj |
status,identifying |
R7624 |
T11852 |
T11851 |
prep |
of,status |
R7625 |
T11853 |
T11854 |
amod |
different,players |
R7626 |
T11854 |
T11852 |
pobj |
players,of |
R7627 |
T11855 |
T11854 |
acl |
involved,players |
R7628 |
T11856 |
T11849 |
prep |
in,identifying |
R7629 |
T11857 |
T11858 |
amod |
specific,types |
R7630 |
T11858 |
T11856 |
pobj |
types,in |
R7631 |
T11859 |
T11858 |
compound |
cell,types |
R7632 |
T11860 |
T11856 |
cc |
and,in |
R7633 |
T11861 |
T11856 |
conj |
at,in |
R7634 |
T11862 |
T11863 |
amod |
specific,stages |
R7635 |
T11863 |
T11861 |
pobj |
stages,at |
R7636 |
T11864 |
T11863 |
prep |
in,stages |
R7637 |
T11865 |
T11864 |
pobj |
development,in |
R7638 |
T11866 |
T11846 |
punct |
", ",begin |
R7639 |
T11867 |
T11868 |
poss |
our,understanding |
R7640 |
T11868 |
T11846 |
nsubj |
understanding,begin |
R7641 |
T11869 |
T11868 |
amod |
mechanistic,understanding |
R7642 |
T11870 |
T11868 |
prep |
of,understanding |
R7643 |
T11871 |
T11872 |
advmod |
how,linked |
R7644 |
T11872 |
T11870 |
pcomp |
linked,of |
R7645 |
T11873 |
T11874 |
amod |
intercellular,remodeling |
R7646 |
T11874 |
T11872 |
nsubjpass |
remodeling,linked |
R7647 |
T11875 |
T11872 |
auxpass |
is,linked |
R7648 |
T11876 |
T11872 |
prep |
to,linked |
R7649 |
T11877 |
T11876 |
pobj |
proliferation,to |
R7650 |
T11878 |
T11872 |
prep |
in,linked |
R7651 |
T11879 |
T11880 |
amod |
epithelial,morphogenesis |
R7652 |
T11880 |
T11878 |
pobj |
morphogenesis,in |
R7653 |
T11881 |
T11846 |
aux |
should,begin |
R7654 |
T11882 |
T11883 |
aux |
to,surface |
R7655 |
T11883 |
T11846 |
xcomp |
surface,begin |
R7656 |
T11884 |
T11883 |
prep |
in,surface |
R7657 |
T11885 |
T11886 |
det |
the,future |
R7658 |
T11886 |
T11884 |
pobj |
future,in |
R7659 |
T11887 |
T11846 |
punct |
.,begin |
R7660 |
T11889 |
T11890 |
csubj |
Elucidating,is |
R7661 |
T11891 |
T11892 |
det |
the,mechanisms |
R7662 |
T11892 |
T11889 |
dobj |
mechanisms,Elucidating |
R7663 |
T11893 |
T11892 |
amod |
molecular,mechanisms |
R7664 |
T11894 |
T11895 |
prep |
through,converge |
R7665 |
T11895 |
T11892 |
relcl |
converge,mechanisms |
R7666 |
T11896 |
T11894 |
pobj |
which,through |
R7667 |
T11897 |
T11898 |
det |
these,networks |
R7668 |
T11898 |
T11895 |
nsubj |
networks,converge |
R7669 |
T11899 |
T11890 |
advmod |
also,is |
R7670 |
T11900 |
T11901 |
det |
a,prerequisite |
R7671 |
T11901 |
T11890 |
attr |
prerequisite,is |
R7672 |
T11902 |
T11901 |
prep |
for,prerequisite |
R7673 |
T11903 |
T11902 |
pcomp |
understanding,for |
R7674 |
T11904 |
T11905 |
advmod |
how,go |
R7675 |
T11905 |
T11903 |
ccomp |
go,understanding |
R7676 |
T11906 |
T11907 |
det |
these,processes |
R7677 |
T11907 |
T11905 |
nsubj |
processes,go |
R7678 |
T11908 |
T11905 |
advmod |
awry,go |
R7679 |
T11909 |
T11905 |
prep |
during,go |
R7680 |
T11910 |
T11909 |
pobj |
tumorigenesis,during |
R7681 |
T11911 |
T11890 |
punct |
.,is |
R7682 |
T12023 |
T12024 |
amod |
Primary,antibodies |
R7683 |
T12024 |
T12025 |
nsubj |
antibodies,were |
R7684 |
T12026 |
T12024 |
acl |
used,antibodies |
R7685 |
T12027 |
T12025 |
prep |
against,were |
R7686 |
T12028 |
T12027 |
punct |
: ,against |
R7687 |
T12029 |
T12030 |
compound |
E,cadherin |
R7688 |
T12030 |
T12027 |
pobj |
cadherin,against |
R7689 |
T12031 |
T12030 |
punct |
-,cadherin |
R7690 |
T12032 |
T12033 |
punct |
(,Takeichi |
R7691 |
T12033 |
T12030 |
parataxis |
Takeichi,cadherin |
R7692 |
T12034 |
T12033 |
compound |
M.,Takeichi |
R7693 |
T12035 |
T12033 |
punct |
", ",Takeichi |
R7694 |
T12036 |
T12037 |
compound |
Kyoto,University |
R7695 |
T12037 |
T12033 |
npadvmod |
University,Takeichi |
R7696 |
T12038 |
T12033 |
punct |
", ",Takeichi |
R7697 |
T12039 |
T12033 |
npadvmod |
Japan,Takeichi |
R7698 |
T12040 |
T12033 |
punct |
),Takeichi |
R7699 |
T12041 |
T12030 |
punct |
;,cadherin |
R7700 |
T12042 |
T12043 |
compound |
α,catenin |
R7701 |
T12043 |
T12030 |
conj |
catenin,cadherin |
R7702 |
T12044 |
T12043 |
punct |
-,catenin |
R7703 |
T12045 |
T12043 |
punct |
", ",catenin |
R7704 |
T12046 |
T12047 |
compound |
β,catenin |
R7705 |
T12047 |
T12043 |
appos |
catenin,catenin |
R7706 |
T12048 |
T12047 |
punct |
-,catenin |
R7707 |
T12049 |
T12043 |
punct |
", ",catenin |
R7708 |
T12050 |
T12043 |
appos |
pMAPK,catenin |
R7709 |
T12051 |
T12043 |
punct |
", ",catenin |
R7710 |
T12052 |
T12043 |
appos |
tubulin,catenin |
R7711 |
T12053 |
T12054 |
punct |
(,Sigma |
R7712 |
T12054 |
T12043 |
parataxis |
Sigma,catenin |
R7713 |
T12055 |
T12054 |
punct |
", ",Sigma |
R7714 |
T12056 |
T12057 |
compound |
St.,Louis |
R7715 |
T12057 |
T12054 |
npadvmod |
Louis,Sigma |
R7716 |
T12058 |
T12054 |
punct |
", ",Sigma |
R7717 |
T12059 |
T12054 |
npadvmod |
Missouri,Sigma |
R7718 |
T12060 |
T12054 |
punct |
", ",Sigma |
R7719 |
T12061 |
T12062 |
compound |
United,States |
R7720 |
T12062 |
T12054 |
npadvmod |
States,Sigma |
R7721 |
T12063 |
T12054 |
punct |
),Sigma |
R7722 |
T12064 |
T12043 |
punct |
", ",catenin |
R7723 |
T12065 |
T12043 |
conj |
Ajuba,catenin |
R7724 |
T12066 |
T12067 |
punct |
(,Longmore |
R7725 |
T12067 |
T12065 |
parataxis |
Longmore,Ajuba |
R7726 |
T12068 |
T12067 |
compound |
G.,Longmore |
R7727 |
T12069 |
T12067 |
punct |
", ",Longmore |
R7728 |
T12070 |
T12071 |
compound |
Washington,University |
R7729 |
T12071 |
T12067 |
npadvmod |
University,Longmore |
R7730 |
T12072 |
T12067 |
punct |
", ",Longmore |
R7731 |
T12073 |
T12074 |
compound |
St.,Louis |
R7732 |
T12074 |
T12067 |
npadvmod |
Louis,Longmore |
R7733 |
T12075 |
T12067 |
punct |
", ",Longmore |
R7734 |
T12076 |
T12067 |
npadvmod |
Missouri,Longmore |
R7735 |
T12077 |
T12067 |
punct |
", ",Longmore |
R7736 |
T12078 |
T12079 |
compound |
United,States |
R7737 |
T12079 |
T12067 |
npadvmod |
States,Longmore |
R7738 |
T12080 |
T12067 |
punct |
),Longmore |
R7739 |
T12081 |
T12065 |
punct |
;,Ajuba |
R7740 |
T12082 |
T12083 |
compound |
β4,integrin |
R7741 |
T12083 |
T12065 |
conj |
integrin,Ajuba |
R7742 |
T12084 |
T12083 |
punct |
/,integrin |
R7743 |
T12085 |
T12083 |
appos |
CD104,integrin |
R7744 |
T12086 |
T12087 |
punct |
(,Pharmingen |
R7745 |
T12087 |
T12083 |
parataxis |
Pharmingen,integrin |
R7746 |
T12088 |
T12087 |
compound |
BD,Pharmingen |
R7747 |
T12089 |
T12087 |
punct |
", ",Pharmingen |
R7748 |
T12090 |
T12091 |
compound |
San,Diego |
R7749 |
T12091 |
T12087 |
npadvmod |
Diego,Pharmingen |
R7750 |
T12092 |
T12087 |
punct |
", ",Pharmingen |
R7751 |
T12093 |
T12087 |
npadvmod |
California,Pharmingen |
R7752 |
T12094 |
T12087 |
punct |
", ",Pharmingen |
R7753 |
T12095 |
T12096 |
compound |
United,States |
R7754 |
T12096 |
T12087 |
npadvmod |
States,Pharmingen |
R7755 |
T12097 |
T12087 |
punct |
),Pharmingen |
R7756 |
T12098 |
T12083 |
punct |
", ",integrin |
R7757 |
T12099 |
T12083 |
conj |
laminin,integrin |
R7758 |
T12100 |
T12099 |
nummod |
5,laminin |
R7759 |
T12101 |
T12102 |
punct |
(,Burgeson |
R7760 |
T12102 |
T12099 |
parataxis |
Burgeson,laminin |
R7761 |
T12103 |
T12102 |
compound |
R.,Burgeson |
R7762 |
T12104 |
T12102 |
punct |
", ",Burgeson |
R7763 |
T12105 |
T12106 |
compound |
Harvard,University |
R7764 |
T12106 |
T12102 |
npadvmod |
University,Burgeson |
R7765 |
T12107 |
T12102 |
punct |
", ",Burgeson |
R7766 |
T12108 |
T12102 |
npadvmod |
Cambridge,Burgeson |
R7767 |
T12109 |
T12102 |
punct |
", ",Burgeson |
R7768 |
T12110 |
T12102 |
npadvmod |
Massachusetts,Burgeson |
R7769 |
T12111 |
T12102 |
punct |
", ",Burgeson |
R7770 |
T12112 |
T12113 |
compound |
United,States |
R7771 |
T12113 |
T12102 |
npadvmod |
States,Burgeson |
R7772 |
T12114 |
T12102 |
punct |
),Burgeson |
R7773 |
T12115 |
T12099 |
punct |
", ",laminin |
R7774 |
T12116 |
T12099 |
conj |
K5,laminin |
R7775 |
T12117 |
T12116 |
punct |
", ",K5 |
R7776 |
T12118 |
T12116 |
conj |
K1,K5 |
R7777 |
T12119 |
T12118 |
punct |
", ",K1 |
R7778 |
T12120 |
T12118 |
conj |
loricrin,K1 |
R7779 |
T12121 |
T12122 |
punct |
(,Lab |
R7780 |
T12122 |
T12120 |
parataxis |
Lab,loricrin |
R7781 |
T12123 |
T12122 |
compound |
Fuchs,Lab |
R7782 |
T12124 |
T12122 |
punct |
),Lab |
R7783 |
T12125 |
T12120 |
punct |
", ",loricrin |
R7784 |
T12126 |
T12120 |
conj |
involucrin,loricrin |
R7785 |
T12127 |
T12126 |
punct |
", ",involucrin |
R7786 |
T12128 |
T12126 |
conj |
fillagrin,involucrin |
R7787 |
T12129 |
T12130 |
punct |
(,Covance |
R7788 |
T12130 |
T12128 |
parataxis |
Covance,fillagrin |
R7789 |
T12131 |
T12130 |
punct |
", ",Covance |
R7790 |
T12132 |
T12130 |
npadvmod |
Berkeley,Covance |
R7791 |
T12133 |
T12130 |
punct |
", ",Covance |
R7792 |
T12134 |
T12130 |
npadvmod |
California,Covance |
R7793 |
T12135 |
T12130 |
punct |
", ",Covance |
R7794 |
T12136 |
T12137 |
compound |
United,States |
R7795 |
T12137 |
T12130 |
npadvmod |
States,Covance |
R7796 |
T12138 |
T12130 |
punct |
),Covance |
R7797 |
T12139 |
T12128 |
punct |
", ",fillagrin |
R7798 |
T12140 |
T12128 |
conj |
MAPK,fillagrin |
R7799 |
T12141 |
T12140 |
punct |
", ",MAPK |
R7800 |
T12142 |
T12140 |
conj |
pSMAD2,MAPK |
R7801 |
T12143 |
T12144 |
punct |
(,Signaling |
R7802 |
T12144 |
T12142 |
parataxis |
Signaling,pSMAD2 |
R7803 |
T12145 |
T12144 |
compound |
Cell,Signaling |
R7804 |
T12146 |
T12144 |
punct |
", ",Signaling |
R7805 |
T12147 |
T12144 |
npadvmod |
Beverly,Signaling |
R7806 |
T12148 |
T12144 |
punct |
", ",Signaling |
R7807 |
T12149 |
T12144 |
npadvmod |
Massachusetts,Signaling |
R7808 |
T12150 |
T12144 |
punct |
", ",Signaling |
R7809 |
T12151 |
T12152 |
compound |
United,States |
R7810 |
T12152 |
T12144 |
npadvmod |
States,Signaling |
R7811 |
T12153 |
T12144 |
punct |
),Signaling |
R7812 |
T12154 |
T12142 |
punct |
;,pSMAD2 |
R7813 |
T12155 |
T12142 |
conj |
Grb,pSMAD2 |
R7814 |
T12156 |
T12155 |
punct |
-,Grb |
R7815 |
T12157 |
T12155 |
nummod |
2,Grb |
R7816 |
T12158 |
T12159 |
punct |
(,Biotech |
R7817 |
T12159 |
T12155 |
parataxis |
Biotech,Grb |
R7818 |
T12160 |
T12161 |
compound |
Santa,Cruz |
R7819 |
T12161 |
T12159 |
compound |
Cruz,Biotech |
R7820 |
T12162 |
T12159 |
punct |
", ",Biotech |
R7821 |
T12163 |
T12164 |
compound |
Santa,Cruz |
R7822 |
T12164 |
T12159 |
npadvmod |
Cruz,Biotech |
R7823 |
T12165 |
T12159 |
punct |
", ",Biotech |
R7824 |
T12166 |
T12159 |
npadvmod |
California,Biotech |
R7825 |
T12167 |
T12159 |
punct |
", ",Biotech |
R7826 |
T12168 |
T12169 |
compound |
United,States |
R7827 |
T12169 |
T12159 |
npadvmod |
States,Biotech |
R7828 |
T12170 |
T12159 |
punct |
),Biotech |
R7829 |
T12171 |
T12155 |
punct |
;,Grb |
R7830 |
T12172 |
T12173 |
compound |
P,cadherin |
R7831 |
T12173 |
T12155 |
conj |
cadherin,Grb |
R7832 |
T12174 |
T12173 |
punct |
-,cadherin |
R7833 |
T12175 |
T12176 |
punct |
(,Laboratories |
R7834 |
T12176 |
T12173 |
parataxis |
Laboratories,cadherin |
R7835 |
T12177 |
T12176 |
compound |
Zymed,Laboratories |
R7836 |
T12178 |
T12176 |
punct |
", ",Laboratories |
R7837 |
T12179 |
T12180 |
amod |
South,Francisco |
R7838 |
T12180 |
T12176 |
npadvmod |
Francisco,Laboratories |
R7839 |
T12181 |
T12180 |
compound |
San,Francisco |
R7840 |
T12182 |
T12176 |
punct |
", ",Laboratories |
R7841 |
T12183 |
T12176 |
npadvmod |
California,Laboratories |
R7842 |
T12184 |
T12176 |
punct |
", ",Laboratories |
R7843 |
T12185 |
T12186 |
compound |
United,States |
R7844 |
T12186 |
T12176 |
npadvmod |
States,Laboratories |
R7845 |
T12187 |
T12176 |
punct |
),Laboratories |
R7846 |
T12188 |
T12173 |
punct |
;,cadherin |
R7847 |
T12189 |
T12173 |
conj |
HA,cadherin |
R7848 |
T12190 |
T12191 |
punct |
(,Biochemicals |
R7849 |
T12191 |
T12189 |
parataxis |
Biochemicals,HA |
R7850 |
T12192 |
T12191 |
compound |
Roche,Biochemicals |
R7851 |
T12193 |
T12191 |
punct |
),Biochemicals |
R7852 |
T12194 |
T12189 |
punct |
", ",HA |
R7853 |
T12195 |
T12189 |
conj |
vimentin,HA |
R7854 |
T12196 |
T12197 |
punct |
(,Chemicon |
R7855 |
T12197 |
T12195 |
parataxis |
Chemicon,vimentin |
R7856 |
T12198 |
T12197 |
punct |
", ",Chemicon |
R7857 |
T12199 |
T12197 |
npadvmod |
Temecula,Chemicon |
R7858 |
T12200 |
T12197 |
punct |
", ",Chemicon |
R7859 |
T12201 |
T12197 |
npadvmod |
California,Chemicon |
R7860 |
T12202 |
T12197 |
punct |
", ",Chemicon |
R7861 |
T12203 |
T12204 |
compound |
United,States |
R7862 |
T12204 |
T12197 |
npadvmod |
States,Chemicon |
R7863 |
T12205 |
T12197 |
punct |
),Chemicon |
R7864 |
T12206 |
T12195 |
punct |
", ",vimentin |
R7865 |
T12207 |
T12195 |
conj |
Ki67,vimentin |
R7866 |
T12208 |
T12209 |
punct |
(,Castra |
R7867 |
T12209 |
T12207 |
parataxis |
Castra,Ki67 |
R7868 |
T12210 |
T12209 |
compound |
Novo,Castra |
R7869 |
T12211 |
T12209 |
punct |
", ",Castra |
R7870 |
T12212 |
T12209 |
npadvmod |
Newcastle,Castra |
R7871 |
T12213 |
T12212 |
prep |
Upon,Newcastle |
R7872 |
T12214 |
T12213 |
pobj |
Tyne,Upon |
R7873 |
T12215 |
T12209 |
punct |
", ",Castra |
R7874 |
T12216 |
T12217 |
compound |
United,Kingdom |
R7875 |
T12217 |
T12209 |
npadvmod |
Kingdom,Castra |
R7876 |
T12218 |
T12209 |
punct |
),Castra |
R7877 |
T12219 |
T12207 |
punct |
", ",Ki67 |
R7878 |
T12220 |
T12207 |
conj |
keratin,Ki67 |
R7879 |
T12221 |
T12220 |
nummod |
6,keratin |
R7880 |
T12222 |
T12223 |
punct |
(,Coulombe |
R7881 |
T12223 |
T12220 |
parataxis |
Coulombe,keratin |
R7882 |
T12224 |
T12223 |
compound |
P.,Coulombe |
R7883 |
T12225 |
T12223 |
punct |
", ",Coulombe |
R7884 |
T12226 |
T12227 |
compound |
John,Hopkins |
R7885 |
T12227 |
T12228 |
compound |
Hopkins,University |
R7886 |
T12228 |
T12223 |
npadvmod |
University,Coulombe |
R7887 |
T12229 |
T12223 |
punct |
", ",Coulombe |
R7888 |
T12230 |
T12223 |
npadvmod |
Baltimore,Coulombe |
R7889 |
T12231 |
T12223 |
punct |
", ",Coulombe |
R7890 |
T12232 |
T12223 |
npadvmod |
Maryland,Coulombe |
R7891 |
T12233 |
T12223 |
punct |
", ",Coulombe |
R7892 |
T12234 |
T12235 |
compound |
United,States |
R7893 |
T12235 |
T12223 |
npadvmod |
States,Coulombe |
R7894 |
T12236 |
T12223 |
punct |
),Coulombe |
R7895 |
T12237 |
T12220 |
punct |
", ",keratin |
R7896 |
T12238 |
T12239 |
compound |
cyclin,D |
R7897 |
T12239 |
T12220 |
conj |
D,keratin |
R7898 |
T12240 |
T12241 |
punct |
(,Oncogene |
R7899 |
T12241 |
T12239 |
parataxis |
Oncogene,D |
R7900 |
T12242 |
T12241 |
punct |
", ",Oncogene |
R7901 |
T12243 |
T12244 |
compound |
San,Diego |
R7902 |
T12244 |
T12241 |
npadvmod |
Diego,Oncogene |
R7903 |
T12245 |
T12241 |
punct |
", ",Oncogene |
R7904 |
T12246 |
T12241 |
npadvmod |
California,Oncogene |
R7905 |
T12247 |
T12241 |
punct |
", ",Oncogene |
R7906 |
T12248 |
T12249 |
compound |
United,States |
R7907 |
T12249 |
T12241 |
npadvmod |
States,Oncogene |
R7908 |
T12250 |
T12241 |
punct |
),Oncogene |
R7909 |
T12251 |
T12239 |
punct |
", ",D |
R7910 |
T12252 |
T12239 |
cc |
and,D |
R7911 |
T12253 |
T12254 |
compound |
TGF,β2 |
R7912 |
T12254 |
T12239 |
conj |
β2,D |
R7913 |
T12255 |
T12254 |
punct |
-,β2 |
R7914 |
T12256 |
T12257 |
punct |
(,Gold |
R7915 |
T12257 |
T12254 |
parataxis |
Gold,β2 |
R7916 |
T12258 |
T12257 |
compound |
L.,Gold |
R7917 |
T12259 |
T12257 |
punct |
", ",Gold |
R7918 |
T12260 |
T12261 |
compound |
New,York |
R7919 |
T12261 |
T12262 |
compound |
York,University |
R7920 |
T12262 |
T12257 |
npadvmod |
University,Gold |
R7921 |
T12263 |
T12257 |
punct |
", ",Gold |
R7922 |
T12264 |
T12265 |
compound |
New,York |
R7923 |
T12265 |
T12257 |
npadvmod |
York,Gold |
R7924 |
T12266 |
T12257 |
punct |
", ",Gold |
R7925 |
T12267 |
T12268 |
compound |
New,York |
R7926 |
T12268 |
T12257 |
npadvmod |
York,Gold |
R7927 |
T12269 |
T12257 |
punct |
", ",Gold |
R7928 |
T12270 |
T12271 |
compound |
United,States |
R7929 |
T12271 |
T12257 |
npadvmod |
States,Gold |
R7930 |
T12272 |
T12257 |
punct |
),Gold |
R7931 |
T12273 |
T12025 |
punct |
.,were |
R7932 |
T12275 |
T12276 |
npadvmod |
FITC,conjugated |
R7933 |
T12276 |
T12286 |
amod |
conjugated,antibodies |
R7934 |
T12277 |
T12275 |
punct |
-,FITC |
R7935 |
T12278 |
T12275 |
punct |
", ",FITC |
R7936 |
T12279 |
T12280 |
compound |
Texas,Red |
R7937 |
T12280 |
T12275 |
conj |
Red,FITC |
R7938 |
T12281 |
T12280 |
punct |
-,Red |
R7939 |
T12282 |
T12280 |
punct |
", ",Red |
R7940 |
T12283 |
T12280 |
cc |
or,Red |
R7941 |
T12284 |
T12280 |
conj |
HRP,Red |
R7942 |
T12285 |
T12276 |
punct |
-,conjugated |
R7943 |
T12286 |
T12288 |
nsubj |
antibodies,were |
R7944 |
T12287 |
T12286 |
amod |
secondary,antibodies |
R7945 |
T12289 |
T12288 |
prep |
from,were |
R7946 |
T12290 |
T12291 |
compound |
Jackson,ImmunoResearch |
R7947 |
T12291 |
T12289 |
pobj |
ImmunoResearch,from |
R7948 |
T12292 |
T12293 |
punct |
(,Grove |
R7949 |
T12293 |
T12291 |
parataxis |
Grove,ImmunoResearch |
R7950 |
T12294 |
T12293 |
compound |
West,Grove |
R7951 |
T12295 |
T12293 |
punct |
", ",Grove |
R7952 |
T12296 |
T12293 |
npadvmod |
Pennsylvania,Grove |
R7953 |
T12297 |
T12293 |
punct |
", ",Grove |
R7954 |
T12298 |
T12299 |
compound |
United,States |
R7955 |
T12299 |
T12293 |
npadvmod |
States,Grove |
R7956 |
T12300 |
T12293 |
punct |
),Grove |
R7957 |
T12301 |
T12288 |
punct |
.,were |
R7958 |
T12303 |
T12304 |
amod |
Biotinylated,antibodies |
R7959 |
T12304 |
T12306 |
nsubj |
antibodies,were |
R7960 |
T12305 |
T12304 |
amod |
secondary,antibodies |
R7961 |
T12307 |
T12306 |
prep |
from,were |
R7962 |
T12308 |
T12309 |
compound |
Vector,Labs |
R7963 |
T12309 |
T12307 |
pobj |
Labs,from |
R7964 |
T12310 |
T12311 |
punct |
(,Burlingame |
R7965 |
T12311 |
T12309 |
parataxis |
Burlingame,Labs |
R7966 |
T12312 |
T12311 |
punct |
", ",Burlingame |
R7967 |
T12313 |
T12311 |
npadvmod |
California,Burlingame |
R7968 |
T12314 |
T12311 |
punct |
", ",Burlingame |
R7969 |
T12315 |
T12316 |
compound |
United,States |
R7970 |
T12316 |
T12311 |
npadvmod |
States,Burlingame |
R7971 |
T12317 |
T12311 |
punct |
),Burlingame |
R7972 |
T12318 |
T12306 |
punct |
.,were |
R7973 |
T12320 |
T12321 |
nsubj |
Dilutions,were |
R7974 |
T12322 |
T12321 |
prep |
according,were |
R7975 |
T12323 |
T12322 |
prep |
to,according |
R7976 |
T12324 |
T12325 |
det |
the,manufacturer |
R7977 |
T12325 |
T12326 |
poss |
manufacturer,recommendation |
R7978 |
T12326 |
T12323 |
pobj |
recommendation,to |
R7979 |
T12327 |
T12325 |
case |
's,manufacturer |
R7980 |
T12328 |
T12321 |
punct |
.,were |
R7981 |
T12330 |
T12331 |
det |
The,antibody |
R7982 |
T12331 |
T12333 |
nsubjpass |
antibody,generated |
R7983 |
T12332 |
T12331 |
compound |
Snail,antibody |
R7984 |
T12334 |
T12333 |
auxpass |
was,generated |
R7985 |
T12335 |
T12333 |
prep |
in,generated |
R7986 |
T12336 |
T12337 |
compound |
Guinea,pigs |
R7987 |
T12337 |
T12335 |
pobj |
pigs,in |
R7988 |
T12338 |
T12333 |
prep |
by,generated |
R7989 |
T12339 |
T12338 |
pcomp |
inoculating,by |
R7990 |
T12340 |
T12339 |
dobj |
them,inoculating |
R7991 |
T12341 |
T12339 |
prep |
with,inoculating |
R7992 |
T12342 |
T12343 |
det |
the,sequence |
R7993 |
T12343 |
T12341 |
pobj |
sequence,with |
R7994 |
T12344 |
T12345 |
npadvmod |
N,terminal |
R7995 |
T12345 |
T12343 |
amod |
terminal,sequence |
R7996 |
T12346 |
T12345 |
punct |
-,terminal |
R7997 |
T12347 |
T12343 |
prep |
of,sequence |
R7998 |
T12348 |
T12349 |
amod |
murine,Snail |
R7999 |
T12349 |
T12347 |
pobj |
Snail,of |
R8000 |
T12350 |
T12343 |
acl |
fused,sequence |
R8001 |
T12351 |
T12350 |
prep |
to,fused |
R8002 |
T12352 |
T12351 |
pobj |
GST,to |
R8003 |
T12353 |
T12354 |
punct |
(,Covance |
R8004 |
T12354 |
T12352 |
parataxis |
Covance,GST |
R8005 |
T12355 |
T12354 |
punct |
", ",Covance |
R8006 |
T12356 |
T12354 |
npadvmod |
Princeton,Covance |
R8007 |
T12357 |
T12354 |
punct |
", ",Covance |
R8008 |
T12358 |
T12359 |
compound |
New,Jersey |
R8009 |
T12359 |
T12354 |
npadvmod |
Jersey,Covance |
R8010 |
T12360 |
T12354 |
punct |
", ",Covance |
R8011 |
T12361 |
T12362 |
compound |
United,States |
R8012 |
T12362 |
T12354 |
npadvmod |
States,Covance |
R8013 |
T12363 |
T12354 |
punct |
),Covance |
R8014 |
T12364 |
T12333 |
punct |
.,generated |
R8015 |
T12366 |
T12367 |
amod |
Recombinant,β2 |
R8016 |
T12367 |
T12371 |
nsubjpass |
β2,purchased |
R8017 |
T12368 |
T12367 |
amod |
human,β2 |
R8018 |
T12369 |
T12367 |
compound |
TGF,β2 |
R8019 |
T12370 |
T12367 |
punct |
-,β2 |
R8020 |
T12372 |
T12371 |
auxpass |
was,purchased |
R8021 |
T12373 |
T12371 |
prep |
from,purchased |
R8022 |
T12374 |
T12373 |
pobj |
R,from |
R8023 |
T12375 |
T12374 |
cc |
&,R |
R8024 |
T12376 |
T12374 |
conj |
D,R |
R8025 |
T12377 |
T12378 |
punct |
(,Minneapolis |
R8026 |
T12378 |
T12376 |
parataxis |
Minneapolis,D |
R8027 |
T12379 |
T12378 |
punct |
", ",Minneapolis |
R8028 |
T12380 |
T12378 |
npadvmod |
Minnesota,Minneapolis |
R8029 |
T12381 |
T12378 |
punct |
", ",Minneapolis |
R8030 |
T12382 |
T12383 |
compound |
United,States |
R8031 |
T12383 |
T12378 |
npadvmod |
States,Minneapolis |
R8032 |
T12384 |
T12378 |
punct |
),Minneapolis |
R8033 |
T12385 |
T12371 |
punct |
.,purchased |
R8034 |
T12387 |
T12388 |
npadvmod |
Heat,inactivated |
R8035 |
T12388 |
T12389 |
amod |
inactivated,β2 |
R8036 |
T12389 |
T12392 |
nsubjpass |
β2,generated |
R8037 |
T12390 |
T12389 |
compound |
TGF,β2 |
R8038 |
T12391 |
T12389 |
punct |
-,β2 |
R8039 |
T12393 |
T12392 |
auxpass |
was,generated |
R8040 |
T12394 |
T12392 |
prep |
by,generated |
R8041 |
T12395 |
T12394 |
pcomp |
heating,by |
R8042 |
T12396 |
T12397 |
det |
the,protein |
R8043 |
T12397 |
T12395 |
dobj |
protein,heating |
R8044 |
T12398 |
T12397 |
amod |
recombinant,protein |
R8045 |
T12399 |
T12395 |
prep |
at,heating |
R8046 |
T12400 |
T12401 |
nummod |
100,°C |
R8047 |
T12401 |
T12399 |
pobj |
°C,at |
R8048 |
T12402 |
T12395 |
prep |
for,heating |
R8049 |
T12403 |
T12404 |
nummod |
10,min |
R8050 |
T12404 |
T12402 |
pobj |
min,for |
R8051 |
T12405 |
T12392 |
punct |
.,generated |
R8052 |
T12466 |
T12467 |
det |
The,mouse |
R8053 |
T12467 |
T12472 |
nsubjpass |
mouse,generated |
R8054 |
T12468 |
T12469 |
compound |
K14,Snail |
R8055 |
T12469 |
T12467 |
compound |
Snail,mouse |
R8056 |
T12470 |
T12469 |
punct |
-,Snail |
R8057 |
T12471 |
T12467 |
compound |
Tg,mouse |
R8058 |
T12473 |
T12472 |
auxpass |
was,generated |
R8059 |
T12474 |
T12472 |
prep |
by,generated |
R8060 |
T12475 |
T12474 |
pcomp |
digesting,by |
R8061 |
T12476 |
T12477 |
det |
the,plasmid |
R8062 |
T12477 |
T12475 |
dobj |
plasmid,digesting |
R8063 |
T12478 |
T12479 |
compound |
pcDNA3,mm |
R8064 |
T12479 |
T12477 |
compound |
mm,plasmid |
R8065 |
T12480 |
T12479 |
punct |
-,mm |
R8066 |
T12481 |
T12482 |
compound |
Snail,HA |
R8067 |
T12482 |
T12477 |
compound |
HA,plasmid |
R8068 |
T12483 |
T12482 |
punct |
-,HA |
R8069 |
T12484 |
T12485 |
punct |
(,Herreros |
R8070 |
T12485 |
T12477 |
parataxis |
Herreros,plasmid |
R8071 |
T12486 |
T12485 |
compound |
G.,Herreros |
R8072 |
T12487 |
T12485 |
compound |
de,Herreros |
R8073 |
T12488 |
T12485 |
punct |
", ",Herreros |
R8074 |
T12489 |
T12490 |
compound |
Universitat,Pompeu |
R8075 |
T12490 |
T12485 |
npadvmod |
Pompeu,Herreros |
R8076 |
T12491 |
T12485 |
punct |
", ",Herreros |
R8077 |
T12492 |
T12485 |
npadvmod |
Fabra,Herreros |
R8078 |
T12493 |
T12485 |
punct |
", ",Herreros |
R8079 |
T12494 |
T12485 |
npadvmod |
Barcelona,Herreros |
R8080 |
T12495 |
T12485 |
punct |
", ",Herreros |
R8081 |
T12496 |
T12485 |
npadvmod |
Spain,Herreros |
R8082 |
T12497 |
T12485 |
punct |
),Herreros |
R8083 |
T12498 |
T12475 |
prep |
with,digesting |
R8084 |
T12499 |
T12498 |
pobj |
BamHI,with |
R8085 |
T12500 |
T12499 |
cc |
and,BamHI |
R8086 |
T12501 |
T12499 |
conj |
NotI,BamHI |
R8087 |
T12502 |
T12472 |
cc |
and,generated |
R8088 |
T12503 |
T12472 |
conj |
subcloned,generated |
R8089 |
T12504 |
T12503 |
prep |
into,subcloned |
R8090 |
T12505 |
T12506 |
det |
the,vector |
R8091 |
T12506 |
T12504 |
pobj |
vector,into |
R8092 |
T12507 |
T12506 |
compound |
K14,vector |
R8093 |
T12508 |
T12509 |
punct |
[,49 |
R8094 |
T12509 |
T12503 |
parataxis |
49,subcloned |
R8095 |
T12510 |
T12509 |
punct |
],49 |
R8096 |
T12511 |
T12472 |
punct |
.,generated |
R8097 |
T12513 |
T12514 |
det |
The,construct |
R8098 |
T12514 |
T12516 |
nsubjpass |
construct,injected |
R8099 |
T12515 |
T12514 |
amod |
linearized,construct |
R8100 |
T12517 |
T12516 |
auxpass |
was,injected |
R8101 |
T12518 |
T12516 |
prep |
into,injected |
R8102 |
T12519 |
T12520 |
det |
the,nucleus |
R8103 |
T12520 |
T12518 |
pobj |
nucleus,into |
R8104 |
T12521 |
T12520 |
prep |
of,nucleus |
R8105 |
T12522 |
T12521 |
pobj |
embryos,of |
R8106 |
T12523 |
T12522 |
prep |
from,embryos |
R8107 |
T12524 |
T12525 |
compound |
CD1,mice |
R8108 |
T12525 |
T12523 |
pobj |
mice,from |
R8109 |
T12526 |
T12516 |
punct |
.,injected |
R8110 |
T12528 |
T12529 |
det |
The,mouse |
R8111 |
T12529 |
T12535 |
nsubjpass |
mouse,reported |
R8112 |
T12530 |
T12531 |
nmod |
K14,Smad |
R8113 |
T12531 |
T12529 |
nmod |
Smad,mouse |
R8114 |
T12532 |
T12531 |
punct |
-,Smad |
R8115 |
T12533 |
T12534 |
nummod |
2,Tg |
R8116 |
T12534 |
T12529 |
compound |
Tg,mouse |
R8117 |
T12536 |
T12535 |
auxpass |
was,reported |
R8118 |
T12537 |
T12535 |
prep |
in,reported |
R8119 |
T12538 |
T12537 |
pobj |
Ito,in |
R8120 |
T12539 |
T12540 |
advmod |
et,al. |
R8121 |
T12540 |
T12538 |
advmod |
al.,Ito |
R8122 |
T12541 |
T12538 |
punct |
", ",Ito |
R8123 |
T12542 |
T12538 |
npadvmod |
2001,Ito |
R8124 |
T12543 |
T12535 |
punct |
.,reported |
R8125 |
T12545 |
T12546 |
det |
The,mouse |
R8126 |
T12546 |
T12554 |
nsubjpass |
mouse,described |
R8127 |
T12547 |
T12548 |
nmod |
TGF,β2 |
R8128 |
T12548 |
T12546 |
nmod |
β2,mouse |
R8129 |
T12549 |
T12548 |
punct |
-,β2 |
R8130 |
T12550 |
T12548 |
appos |
knockout,β2 |
R8131 |
T12551 |
T12550 |
punct |
(,knockout |
R8132 |
T12552 |
T12550 |
appos |
KO,knockout |
R8133 |
T12553 |
T12546 |
punct |
),mouse |
R8134 |
T12555 |
T12554 |
auxpass |
was,described |
R8135 |
T12556 |
T12554 |
prep |
in,described |
R8136 |
T12557 |
T12558 |
punct |
[,34 |
R8137 |
T12558 |
T12556 |
pobj |
34,in |
R8138 |
T12559 |
T12554 |
punct |
],described |
R8139 |
T12560 |
T12554 |
punct |
.,described |
R8140 |
T12562 |
T12563 |
det |
The,mouse |
R8141 |
T12563 |
T12566 |
nsubjpass |
mouse,reported |
R8142 |
T12564 |
T12565 |
compound |
shh,KO |
R8143 |
T12565 |
T12563 |
compound |
KO,mouse |
R8144 |
T12567 |
T12568 |
punct |
[,38 |
R8145 |
T12568 |
T12563 |
parataxis |
38,mouse |
R8146 |
T12569 |
T12568 |
punct |
],38 |
R8147 |
T12570 |
T12563 |
cc |
and,mouse |
R8148 |
T12571 |
T12572 |
compound |
TOPGal,mouse |
R8149 |
T12572 |
T12563 |
conj |
mouse,mouse |
R8150 |
T12573 |
T12574 |
punct |
[,20 |
R8151 |
T12574 |
T12572 |
parataxis |
20,mouse |
R8152 |
T12575 |
T12574 |
punct |
],20 |
R8153 |
T12576 |
T12566 |
aux |
have,reported |
R8154 |
T12577 |
T12566 |
advmod |
previously,reported |
R8155 |
T12578 |
T12566 |
auxpass |
been,reported |
R8156 |
T12579 |
T12566 |
punct |
.,reported |
R8157 |
T12687 |
T12688 |
compound |
Western,blot |
R8158 |
T12689 |
T12688 |
cc |
and,blot |
R8159 |
T12690 |
T12688 |
conj |
immunoprecipitation,blot |
R8160 |
T12692 |
T12693 |
compound |
Protein,extracts |
R8161 |
T12693 |
T12694 |
nsubjpass |
extracts,generated |
R8162 |
T12695 |
T12693 |
prep |
from,extracts |
R8163 |
T12696 |
T12697 |
amod |
primary,keratinocytes |
R8164 |
T12697 |
T12695 |
pobj |
keratinocytes,from |
R8165 |
T12698 |
T12694 |
auxpass |
were,generated |
R8166 |
T12699 |
T12700 |
preconj |
either,by |
R8167 |
T12700 |
T12694 |
prep |
by,generated |
R8168 |
T12701 |
T12700 |
pcomp |
lysing,by |
R8169 |
T12702 |
T12701 |
dobj |
cells,lysing |
R8170 |
T12703 |
T12701 |
prep |
in,lysing |
R8171 |
T12704 |
T12705 |
compound |
lysis,buffer |
R8172 |
T12705 |
T12703 |
pobj |
buffer,in |
R8173 |
T12706 |
T12707 |
punct |
(,NP |
R8174 |
T12707 |
T12705 |
parataxis |
NP,buffer |
R8175 |
T12708 |
T12709 |
nummod |
1,% |
R8176 |
T12709 |
T12707 |
compound |
%,NP |
R8177 |
T12710 |
T12707 |
punct |
-,NP |
R8178 |
T12711 |
T12707 |
nummod |
40,NP |
R8179 |
T12712 |
T12707 |
punct |
", ",NP |
R8180 |
T12713 |
T12714 |
nummod |
1,% |
R8181 |
T12714 |
T12715 |
compound |
%,deoxycholate |
R8182 |
T12715 |
T12707 |
conj |
deoxycholate,NP |
R8183 |
T12716 |
T12715 |
compound |
sodium,deoxycholate |
R8184 |
T12717 |
T12715 |
punct |
", ",deoxycholate |
R8185 |
T12718 |
T12719 |
nummod |
20,mM |
R8186 |
T12719 |
T12720 |
compound |
mM,Cl |
R8187 |
T12720 |
T12715 |
conj |
Cl,deoxycholate |
R8188 |
T12721 |
T12720 |
compound |
Tris,Cl |
R8189 |
T12722 |
T12720 |
punct |
-,Cl |
R8190 |
T12723 |
T12720 |
punct |
[,Cl |
R8191 |
T12724 |
T12720 |
npadvmod |
pH,Cl |
R8192 |
T12725 |
T12724 |
nummod |
7.4,pH |
R8193 |
T12726 |
T12720 |
punct |
],Cl |
R8194 |
T12727 |
T12720 |
punct |
", ",Cl |
R8195 |
T12728 |
T12729 |
nummod |
140,mM |
R8196 |
T12729 |
T12730 |
compound |
mM,NaCl |
R8197 |
T12730 |
T12720 |
conj |
NaCl,Cl |
R8198 |
T12731 |
T12730 |
acl |
containing,NaCl |
R8199 |
T12732 |
T12733 |
nummod |
1,mM |
R8200 |
T12733 |
T12734 |
compound |
mM,vanadate |
R8201 |
T12734 |
T12731 |
dobj |
vanadate,containing |
R8202 |
T12735 |
T12734 |
compound |
sodium,vanadate |
R8203 |
T12736 |
T12730 |
punct |
", ",NaCl |
R8204 |
T12737 |
T12738 |
nummod |
2,mM |
R8205 |
T12738 |
T12739 |
compound |
mM,fluoride |
R8206 |
T12739 |
T12730 |
conj |
fluoride,NaCl |
R8207 |
T12740 |
T12739 |
compound |
phenylmethylsulfonyl,fluoride |
R8208 |
T12741 |
T12739 |
punct |
", ",fluoride |
R8209 |
T12742 |
T12739 |
cc |
and,fluoride |
R8210 |
T12743 |
T12744 |
compound |
protease,inhibitors |
R8211 |
T12744 |
T12739 |
conj |
inhibitors,fluoride |
R8212 |
T12745 |
T12707 |
punct |
),NP |
R8213 |
T12746 |
T12703 |
cc |
or,in |
R8214 |
T12747 |
T12748 |
advmod |
directly,in |
R8215 |
T12748 |
T12703 |
conj |
in,in |
R8216 |
T12749 |
T12750 |
compound |
Laemmli,bβuffer |
R8217 |
T12750 |
T12748 |
pobj |
bβuffer,in |
R8218 |
T12751 |
T12694 |
cc |
and,generated |
R8219 |
T12752 |
T12694 |
conj |
boiled,generated |
R8220 |
T12753 |
T12694 |
punct |
.,generated |
R8221 |
T12755 |
T12756 |
prep |
For,pulverized |
R8222 |
T12757 |
T12758 |
compound |
skin,tissue |
R8223 |
T12758 |
T12755 |
pobj |
tissue,For |
R8224 |
T12759 |
T12756 |
punct |
: ,pulverized |
R8225 |
T12760 |
T12761 |
amod |
Frozen,tissue |
R8226 |
T12761 |
T12756 |
nsubjpass |
tissue,pulverized |
R8227 |
T12762 |
T12756 |
auxpass |
was,pulverized |
R8228 |
T12763 |
T12756 |
prep |
in,pulverized |
R8229 |
T12764 |
T12765 |
det |
a,Gevebesmascher |
R8230 |
T12765 |
T12763 |
pobj |
Gevebesmascher,in |
R8231 |
T12766 |
T12767 |
amod |
liquid,nitrogen |
R8232 |
T12767 |
T12768 |
npadvmod |
nitrogen,cooled |
R8233 |
T12768 |
T12765 |
amod |
cooled,Gevebesmascher |
R8234 |
T12769 |
T12768 |
punct |
-,cooled |
R8235 |
T12770 |
T12756 |
cc |
and,pulverized |
R8236 |
T12771 |
T12772 |
det |
the,powder |
R8237 |
T12772 |
T12773 |
nsubj |
powder,scraped |
R8238 |
T12773 |
T12756 |
conj |
scraped,pulverized |
R8239 |
T12774 |
T12773 |
prep |
into,scraped |
R8240 |
T12775 |
T12776 |
det |
a,tube |
R8241 |
T12776 |
T12774 |
pobj |
tube,into |
R8242 |
T12777 |
T12776 |
amod |
chilled,tube |
R8243 |
T12778 |
T12776 |
compound |
microcentrifuge,tube |
R8244 |
T12779 |
T12756 |
punct |
.,pulverized |
R8245 |
T12781 |
T12782 |
compound |
RIPA,buffer |
R8246 |
T12782 |
T12783 |
nsubjpass |
buffer,added |
R8247 |
T12784 |
T12785 |
punct |
(,X |
R8248 |
T12785 |
T12782 |
parataxis |
X,buffer |
R8249 |
T12786 |
T12787 |
nummod |
1,% |
R8250 |
T12787 |
T12785 |
compound |
%,X |
R8251 |
T12788 |
T12785 |
compound |
Triton,X |
R8252 |
T12789 |
T12785 |
punct |
-,X |
R8253 |
T12790 |
T12785 |
nummod |
100,X |
R8254 |
T12791 |
T12785 |
prep |
in,X |
R8255 |
T12792 |
T12791 |
pobj |
PBS,in |
R8256 |
T12793 |
T12785 |
prep |
with,X |
R8257 |
T12794 |
T12795 |
nummod |
10,mM |
R8258 |
T12795 |
T12796 |
compound |
mM,EDTA |
R8259 |
T12796 |
T12793 |
pobj |
EDTA,with |
R8260 |
T12797 |
T12796 |
punct |
", ",EDTA |
R8261 |
T12798 |
T12799 |
nummod |
150,mN |
R8262 |
T12799 |
T12800 |
compound |
mN,NaCl |
R8263 |
T12800 |
T12796 |
conj |
NaCl,EDTA |
R8264 |
T12801 |
T12800 |
punct |
", ",NaCl |
R8265 |
T12802 |
T12803 |
nummod |
1,% |
R8266 |
T12803 |
T12804 |
compound |
%,deoxycholate |
R8267 |
T12804 |
T12800 |
conj |
deoxycholate,NaCl |
R8268 |
T12805 |
T12804 |
compound |
sodium,deoxycholate |
R8269 |
T12806 |
T12804 |
punct |
", ",deoxycholate |
R8270 |
T12807 |
T12804 |
cc |
and,deoxycholate |
R8271 |
T12808 |
T12809 |
nummod |
0.1,% |
R8272 |
T12809 |
T12810 |
compound |
%,SDS |
R8273 |
T12810 |
T12804 |
conj |
SDS,deoxycholate |
R8274 |
T12811 |
T12785 |
punct |
),X |
R8275 |
T12812 |
T12782 |
cc |
and,buffer |
R8276 |
T12813 |
T12814 |
compound |
protease,inhibitors |
R8277 |
T12814 |
T12782 |
conj |
inhibitors,buffer |
R8278 |
T12815 |
T12814 |
cc |
or,inhibitors |
R8279 |
T12816 |
T12817 |
compound |
Laemmli,buffer |
R8280 |
T12817 |
T12814 |
conj |
buffer,inhibitors |
R8281 |
T12818 |
T12783 |
auxpass |
was,added |
R8282 |
T12819 |
T12783 |
punct |
.,added |
R8283 |
T12821 |
T12822 |
det |
The,suspension |
R8284 |
T12822 |
T12824 |
nsubjpass |
suspension,sonicated |
R8285 |
T12823 |
T12822 |
compound |
cell,suspension |
R8286 |
T12825 |
T12824 |
auxpass |
was,sonicated |
R8287 |
T12826 |
T12827 |
nummod |
three,times |
R8288 |
T12827 |
T12824 |
npadvmod |
times,sonicated |
R8289 |
T12828 |
T12824 |
prep |
for,sonicated |
R8290 |
T12829 |
T12830 |
nummod |
15,s |
R8291 |
T12830 |
T12828 |
pobj |
s,for |
R8292 |
T12831 |
T12824 |
cc |
and,sonicated |
R8293 |
T12832 |
T12824 |
conj |
centrifuged,sonicated |
R8294 |
T12833 |
T12832 |
prep |
at,centrifuged |
R8295 |
T12834 |
T12835 |
nummod |
"14,000",rpm |
R8296 |
T12835 |
T12833 |
pobj |
rpm,at |
R8297 |
T12836 |
T12832 |
prep |
at,centrifuged |
R8298 |
T12837 |
T12838 |
nummod |
4,°C |
R8299 |
T12838 |
T12836 |
pobj |
°C,at |
R8300 |
T12839 |
T12824 |
punct |
.,sonicated |
R8301 |
T12841 |
T12842 |
det |
The,supernatant |
R8302 |
T12842 |
T12843 |
nsubjpass |
supernatant,separated |
R8303 |
T12844 |
T12843 |
auxpass |
was,separated |
R8304 |
T12845 |
T12843 |
prep |
from,separated |
R8305 |
T12846 |
T12847 |
det |
the,pellet |
R8306 |
T12847 |
T12845 |
pobj |
pellet,from |
R8307 |
T12848 |
T12843 |
cc |
and,separated |
R8308 |
T12849 |
T12843 |
conj |
used,separated |
R8309 |
T12850 |
T12849 |
prep |
in,used |
R8310 |
T12851 |
T12852 |
det |
the,experiments |
R8311 |
T12852 |
T12850 |
pobj |
experiments,in |
R8312 |
T12853 |
T12843 |
punct |
.,separated |
R8313 |
T12855 |
T12856 |
nsubjpass |
Extracts,precleared |
R8314 |
T12857 |
T12855 |
acl |
subjected,Extracts |
R8315 |
T12858 |
T12857 |
prep |
to,subjected |
R8316 |
T12859 |
T12858 |
pobj |
immunoprecipitation,to |
R8317 |
T12860 |
T12856 |
auxpass |
were,precleared |
R8318 |
T12861 |
T12856 |
prep |
with,precleared |
R8319 |
T12862 |
T12863 |
compound |
Protein,G |
R8320 |
T12863 |
T12864 |
compound |
G,Sepharose |
R8321 |
T12864 |
T12861 |
pobj |
Sepharose,with |
R8322 |
T12865 |
T12866 |
punct |
(,Amersham |
R8323 |
T12866 |
T12864 |
parataxis |
Amersham,Sepharose |
R8324 |
T12867 |
T12866 |
punct |
", ",Amersham |
R8325 |
T12868 |
T12866 |
npadvmod |
Piscataway,Amersham |
R8326 |
T12869 |
T12866 |
punct |
", ",Amersham |
R8327 |
T12870 |
T12871 |
compound |
New,York |
R8328 |
T12871 |
T12866 |
npadvmod |
York,Amersham |
R8329 |
T12872 |
T12866 |
punct |
", ",Amersham |
R8330 |
T12873 |
T12874 |
compound |
United,States |
R8331 |
T12874 |
T12866 |
npadvmod |
States,Amersham |
R8332 |
T12875 |
T12866 |
punct |
),Amersham |
R8333 |
T12876 |
T12856 |
cc |
and,precleared |
R8334 |
T12877 |
T12856 |
conj |
incubated,precleared |
R8335 |
T12878 |
T12877 |
prep |
with,incubated |
R8336 |
T12879 |
T12878 |
pobj |
antibody,with |
R8337 |
T12880 |
T12877 |
prep |
with,incubated |
R8338 |
T12881 |
T12880 |
pobj |
rocking,with |
R8339 |
T12882 |
T12877 |
advmod |
overnight,incubated |
R8340 |
T12883 |
T12877 |
prep |
at,incubated |
R8341 |
T12884 |
T12885 |
nummod |
4,°C |
R8342 |
T12885 |
T12883 |
pobj |
°C,at |
R8343 |
T12886 |
T12856 |
punct |
.,precleared |
R8344 |
T12888 |
T12889 |
compound |
Protein,G |
R8345 |
T12889 |
T12890 |
compound |
G,Sepharose |
R8346 |
T12890 |
T12891 |
nsubjpass |
Sepharose,added |
R8347 |
T12892 |
T12891 |
auxpass |
was,added |
R8348 |
T12893 |
T12891 |
cc |
and,added |
R8349 |
T12894 |
T12895 |
nsubjpass |
samples,incubated |
R8350 |
T12895 |
T12891 |
conj |
incubated,added |
R8351 |
T12896 |
T12895 |
auxpass |
were,incubated |
R8352 |
T12897 |
T12895 |
prep |
for,incubated |
R8353 |
T12898 |
T12899 |
nummod |
1,h |
R8354 |
T12899 |
T12897 |
pobj |
h,for |
R8355 |
T12900 |
T12895 |
prep |
at,incubated |
R8356 |
T12901 |
T12902 |
nummod |
4,°C |
R8357 |
T12902 |
T12900 |
pobj |
°C,at |
R8358 |
T12903 |
T12895 |
prep |
with,incubated |
R8359 |
T12904 |
T12903 |
pobj |
rocking,with |
R8360 |
T12905 |
T12895 |
punct |
.,incubated |
R8361 |
T12907 |
T12908 |
nsubjpass |
Samples,washed |
R8362 |
T12909 |
T12908 |
auxpass |
were,washed |
R8363 |
T12910 |
T12911 |
nummod |
three,times |
R8364 |
T12911 |
T12908 |
npadvmod |
times,washed |
R8365 |
T12912 |
T12908 |
prep |
for,washed |
R8366 |
T12913 |
T12914 |
nummod |
5,min |
R8367 |
T12914 |
T12912 |
pobj |
min,for |
R8368 |
T12915 |
T12914 |
advmod |
each,min |
R8369 |
T12916 |
T12908 |
prep |
in,washed |
R8370 |
T12917 |
T12918 |
compound |
lysis,buffer |
R8371 |
T12918 |
T12916 |
pobj |
buffer,in |
R8372 |
T12919 |
T12908 |
punct |
", ",washed |
R8373 |
T12920 |
T12908 |
cc |
and,washed |
R8374 |
T12921 |
T12922 |
det |
the,pellet |
R8375 |
T12922 |
T12930 |
nsubjpass |
pellet,resuspended |
R8376 |
T12923 |
T12924 |
compound |
Protein,G |
R8377 |
T12924 |
T12925 |
compound |
G,antigen |
R8378 |
T12925 |
T12922 |
compound |
antigen,pellet |
R8379 |
T12926 |
T12925 |
compound |
Sepharose,antigen |
R8380 |
T12927 |
T12925 |
punct |
-,antigen |
R8381 |
T12928 |
T12925 |
compound |
antibody,antigen |
R8382 |
T12929 |
T12925 |
punct |
-,antigen |
R8383 |
T12930 |
T12908 |
conj |
resuspended,washed |
R8384 |
T12931 |
T12930 |
auxpass |
was,resuspended |
R8385 |
T12932 |
T12930 |
prep |
in,resuspended |
R8386 |
T12933 |
T12934 |
compound |
Laemmli,buffer |
R8387 |
T12934 |
T12932 |
pobj |
buffer,in |
R8388 |
T12935 |
T12930 |
cc |
and,resuspended |
R8389 |
T12936 |
T12930 |
conj |
boiled,resuspended |
R8390 |
T12937 |
T12936 |
prep |
for,boiled |
R8391 |
T12938 |
T12939 |
nummod |
10,min |
R8392 |
T12939 |
T12937 |
pobj |
min,for |
R8393 |
T12940 |
T12930 |
punct |
.,resuspended |
R8394 |
T12942 |
T12943 |
nsubjpass |
Samples,run |
R8395 |
T12944 |
T12943 |
auxpass |
were,run |
R8396 |
T12945 |
T12943 |
prep |
on,run |
R8397 |
T12946 |
T12947 |
compound |
SDS,PAGE |
R8398 |
T12947 |
T12945 |
pobj |
PAGE,on |
R8399 |
T12948 |
T12947 |
punct |
-,PAGE |
R8400 |
T12949 |
T12943 |
cc |
and,run |
R8401 |
T12950 |
T12943 |
conj |
transferred,run |
R8402 |
T12951 |
T12950 |
prep |
to,transferred |
R8403 |
T12952 |
T12953 |
compound |
nitrocellulose,membrane |
R8404 |
T12953 |
T12951 |
pobj |
membrane,to |
R8405 |
T12954 |
T12955 |
punct |
(,Bioscience |
R8406 |
T12955 |
T12953 |
parataxis |
Bioscience,membrane |
R8407 |
T12956 |
T12955 |
nmod |
Schleicher,Bioscience |
R8408 |
T12957 |
T12956 |
cc |
and,Schleicher |
R8409 |
T12958 |
T12956 |
conj |
Schuell,Schleicher |
R8410 |
T12959 |
T12955 |
punct |
", ",Bioscience |
R8411 |
T12960 |
T12955 |
npadvmod |
Keene,Bioscience |
R8412 |
T12961 |
T12955 |
punct |
", ",Bioscience |
R8413 |
T12962 |
T12963 |
compound |
New,Hampshire |
R8414 |
T12963 |
T12955 |
npadvmod |
Hampshire,Bioscience |
R8415 |
T12964 |
T12955 |
punct |
", ",Bioscience |
R8416 |
T12965 |
T12966 |
compound |
United,States |
R8417 |
T12966 |
T12955 |
npadvmod |
States,Bioscience |
R8418 |
T12967 |
T12955 |
punct |
),Bioscience |
R8419 |
T12968 |
T12943 |
punct |
.,run |
R8420 |
T12970 |
T12971 |
compound |
Western,blot |
R8421 |
T12971 |
T12972 |
compound |
blot,signals |
R8422 |
T12972 |
T12973 |
nsubjpass |
signals,developed |
R8423 |
T12974 |
T12973 |
auxpass |
were,developed |
R8424 |
T12975 |
T12973 |
advcl |
using,developed |
R8425 |
T12976 |
T12977 |
det |
the,kit |
R8426 |
T12977 |
T12975 |
dobj |
kit,using |
R8427 |
T12978 |
T12977 |
amod |
enhanced,kit |
R8428 |
T12979 |
T12977 |
compound |
chemiluminescence,kit |
R8429 |
T12980 |
T12977 |
prep |
from,kit |
R8430 |
T12981 |
T12980 |
pobj |
Amersham,from |
R8431 |
T13041 |
T13042 |
compound |
Cell,culture |
R8432 |
T13044 |
T13045 |
amod |
Primary,keratinocytes |
R8433 |
T13045 |
T13046 |
nsubjpass |
keratinocytes,culture |
R8434 |
T13047 |
T13046 |
auxpass |
were,culture |
R8435 |
T13048 |
T13046 |
prep |
in,culture |
R8436 |
T13049 |
T13050 |
amod |
low,calcium |
R8437 |
T13050 |
T13052 |
compound |
calcium,medium |
R8438 |
T13051 |
T13050 |
punct |
-,calcium |
R8439 |
T13052 |
T13048 |
pobj |
medium,in |
R8440 |
T13053 |
T13054 |
mark |
as,described |
R8441 |
T13054 |
T13046 |
advcl |
described,culture |
R8442 |
T13055 |
T13054 |
advmod |
previously,described |
R8443 |
T13056 |
T13057 |
punct |
[,4 |
R8444 |
T13057 |
T13046 |
parataxis |
4,culture |
R8445 |
T13058 |
T13057 |
punct |
],4 |
R8446 |
T13059 |
T13046 |
punct |
.,culture |
R8447 |
T13061 |
T13062 |
amod |
Transient,transfections |
R8448 |
T13062 |
T13063 |
nsubjpass |
transfections,carried |
R8449 |
T13064 |
T13063 |
auxpass |
were,carried |
R8450 |
T13065 |
T13063 |
prt |
out,carried |
R8451 |
T13066 |
T13063 |
prep |
with,carried |
R8452 |
T13067 |
T13068 |
compound |
FuGENE6,reagent |
R8453 |
T13068 |
T13066 |
pobj |
reagent,with |
R8454 |
T13069 |
T13070 |
punct |
(,Roche |
R8455 |
T13070 |
T13068 |
parataxis |
Roche,reagent |
R8456 |
T13071 |
T13070 |
punct |
", ",Roche |
R8457 |
T13072 |
T13070 |
npadvmod |
Indianapolis,Roche |
R8458 |
T13073 |
T13070 |
punct |
", ",Roche |
R8459 |
T13074 |
T13070 |
npadvmod |
Indiana,Roche |
R8460 |
T13075 |
T13070 |
punct |
", ",Roche |
R8461 |
T13076 |
T13077 |
compound |
United,States |
R8462 |
T13077 |
T13070 |
npadvmod |
States,Roche |
R8463 |
T13078 |
T13070 |
punct |
),Roche |
R8464 |
T13079 |
T13063 |
prep |
according,carried |
R8465 |
T13080 |
T13079 |
prep |
to,according |
R8466 |
T13081 |
T13082 |
det |
the,manufacturer |
R8467 |
T13082 |
T13083 |
poss |
manufacturer,protocol |
R8468 |
T13083 |
T13080 |
pobj |
protocol,to |
R8469 |
T13084 |
T13082 |
case |
's,manufacturer |
R8470 |
T13085 |
T13063 |
punct |
.,carried |
R8471 |
T13087 |
T13088 |
nsubjpass |
Measurement,carried |
R8472 |
T13089 |
T13087 |
prep |
of,Measurement |
R8473 |
T13090 |
T13091 |
nmod |
β,galactosidase |
R8474 |
T13091 |
T13093 |
nmod |
galactosidase,levels |
R8475 |
T13092 |
T13091 |
punct |
-,galactosidase |
R8476 |
T13093 |
T13089 |
pobj |
levels,of |
R8477 |
T13094 |
T13091 |
cc |
or,galactosidase |
R8478 |
T13095 |
T13091 |
conj |
luciferase,galactosidase |
R8479 |
T13096 |
T13088 |
prep |
in,carried |
R8480 |
T13097 |
T13098 |
compound |
promoter,activity |
R8481 |
T13098 |
T13099 |
compound |
activity,studies |
R8482 |
T13099 |
T13096 |
pobj |
studies,in |
R8483 |
T13100 |
T13088 |
auxpass |
were,carried |
R8484 |
T13101 |
T13088 |
prt |
out,carried |
R8485 |
T13102 |
T13088 |
prep |
with,carried |
R8486 |
T13103 |
T13104 |
det |
the,kit |
R8487 |
T13104 |
T13102 |
pobj |
kit,with |
R8488 |
T13105 |
T13106 |
compound |
Galacto,Lite |
R8489 |
T13106 |
T13104 |
compound |
Lite,kit |
R8490 |
T13107 |
T13106 |
punct |
-,Lite |
R8491 |
T13108 |
T13104 |
compound |
assay,kit |
R8492 |
T13109 |
T13110 |
punct |
(,TROPIX |
R8493 |
T13110 |
T13104 |
parataxis |
TROPIX,kit |
R8494 |
T13111 |
T13110 |
punct |
", ",TROPIX |
R8495 |
T13112 |
T13110 |
npadvmod |
Bedford,TROPIX |
R8496 |
T13113 |
T13110 |
punct |
", ",TROPIX |
R8497 |
T13114 |
T13110 |
npadvmod |
Massachusetts,TROPIX |
R8498 |
T13115 |
T13110 |
punct |
", ",TROPIX |
R8499 |
T13116 |
T13117 |
compound |
United,States |
R8500 |
T13117 |
T13110 |
npadvmod |
States,TROPIX |
R8501 |
T13118 |
T13110 |
punct |
),TROPIX |
R8502 |
T13119 |
T13104 |
cc |
and,kit |
R8503 |
T13120 |
T13121 |
det |
the,luciferase |
R8504 |
T13121 |
T13104 |
conj |
luciferase,kit |
R8505 |
T13122 |
T13121 |
amod |
Dual,luciferase |
R8506 |
T13123 |
T13124 |
punct |
(,Promega |
R8507 |
T13124 |
T13121 |
parataxis |
Promega,luciferase |
R8508 |
T13125 |
T13124 |
punct |
", ",Promega |
R8509 |
T13126 |
T13124 |
npadvmod |
Madison,Promega |
R8510 |
T13127 |
T13124 |
punct |
", ",Promega |
R8511 |
T13128 |
T13124 |
npadvmod |
Wisconsin,Promega |
R8512 |
T13129 |
T13124 |
punct |
", ",Promega |
R8513 |
T13130 |
T13131 |
compound |
United,States |
R8514 |
T13131 |
T13124 |
npadvmod |
States,Promega |
R8515 |
T13132 |
T13124 |
punct |
),Promega |
R8516 |
T13133 |
T13121 |
punct |
", ",luciferase |
R8517 |
T13134 |
T13088 |
advmod |
respectively,carried |
R8518 |
T13135 |
T13088 |
punct |
.,carried |
R8519 |
T13137 |
T13138 |
compound |
Runella,luciferase |
R8520 |
T13138 |
T13139 |
nsubjpass |
luciferase,cotransfected |
R8521 |
T13140 |
T13139 |
auxpass |
was,cotransfected |
R8522 |
T13141 |
T13139 |
prep |
into,cotransfected |
R8523 |
T13142 |
T13141 |
pobj |
cells,into |
R8524 |
T13143 |
T13144 |
aux |
to,correct |
R8525 |
T13144 |
T13139 |
advcl |
correct,cotransfected |
R8526 |
T13145 |
T13144 |
prep |
for,correct |
R8527 |
T13146 |
T13147 |
compound |
transfection,efficiency |
R8528 |
T13147 |
T13145 |
pobj |
efficiency,for |
R8529 |
T13148 |
T13139 |
punct |
.,cotransfected |
R8530 |
T13150 |
T13151 |
nsubjpass |
Experiments,done |
R8531 |
T13152 |
T13151 |
auxpass |
were,done |
R8532 |
T13153 |
T13151 |
prep |
in,done |
R8533 |
T13154 |
T13153 |
pobj |
triplicate,in |
R8534 |
T13155 |
T13151 |
cc |
and,done |
R8535 |
T13156 |
T13151 |
conj |
repeated,done |
R8536 |
T13157 |
T13158 |
advmod |
at,three |
R8537 |
T13158 |
T13160 |
nummod |
three,times |
R8538 |
T13159 |
T13158 |
advmod |
least,three |
R8539 |
T13160 |
T13156 |
npadvmod |
times,repeated |
R8540 |
T13161 |
T13151 |
punct |
.,done |
R8541 |
T13163 |
T13164 |
nsubjpass |
Measurements,done |
R8542 |
T13165 |
T13164 |
auxpass |
were,done |
R8543 |
T13166 |
T13164 |
prep |
on,done |
R8544 |
T13167 |
T13168 |
det |
a,luminometer |
R8545 |
T13168 |
T13166 |
pobj |
luminometer,on |
R8546 |
T13169 |
T13170 |
punct |
(,Instruments |
R8547 |
T13170 |
T13168 |
parataxis |
Instruments,luminometer |
R8548 |
T13171 |
T13170 |
compound |
MGM,Instruments |
R8549 |
T13172 |
T13170 |
punct |
", ",Instruments |
R8550 |
T13173 |
T13170 |
npadvmod |
Hamden,Instruments |
R8551 |
T13174 |
T13170 |
punct |
", ",Instruments |
R8552 |
T13175 |
T13170 |
npadvmod |
Connecticut,Instruments |
R8553 |
T13176 |
T13170 |
punct |
", ",Instruments |
R8554 |
T13177 |
T13178 |
compound |
United,States |
R8555 |
T13178 |
T13170 |
npadvmod |
States,Instruments |
R8556 |
T13179 |
T13170 |
punct |
),Instruments |
R8557 |
T13180 |
T13164 |
punct |
.,done |
R8558 |
T13182 |
T13183 |
prep |
For,starved |
R8559 |
T13184 |
T13182 |
pobj |
experiments,For |
R8560 |
T13185 |
T13184 |
acl |
measuring,experiments |
R8561 |
T13186 |
T13185 |
dobj |
phosphorylation,measuring |
R8562 |
T13187 |
T13186 |
prep |
of,phosphorylation |
R8563 |
T13188 |
T13187 |
pobj |
MAPK,of |
R8564 |
T13189 |
T13183 |
punct |
", ",starved |
R8565 |
T13190 |
T13183 |
nsubjpass |
keratinocytes,starved |
R8566 |
T13191 |
T13183 |
auxpass |
were,starved |
R8567 |
T13192 |
T13183 |
dep |
serum,starved |
R8568 |
T13193 |
T13183 |
prep |
for,starved |
R8569 |
T13194 |
T13195 |
nummod |
3,h |
R8570 |
T13195 |
T13193 |
pobj |
h,for |
R8571 |
T13196 |
T13197 |
amod |
prior,to |
R8572 |
T13197 |
T13183 |
prep |
to,starved |
R8573 |
T13198 |
T13197 |
pobj |
harvesting,to |
R8574 |
T13199 |
T13198 |
prep |
of,harvesting |
R8575 |
T13200 |
T13199 |
pobj |
cells,of |
R8576 |
T13201 |
T13198 |
prep |
by,harvesting |
R8577 |
T13202 |
T13201 |
pobj |
incubation,by |
R8578 |
T13203 |
T13202 |
prep |
in,incubation |
R8579 |
T13204 |
T13203 |
pobj |
medium,in |
R8580 |
T13205 |
T13204 |
acl |
lacking,medium |
R8581 |
T13206 |
T13205 |
dobj |
serum,lacking |
R8582 |
T13207 |
T13183 |
punct |
.,starved |
R8583 |
T13209 |
T13210 |
nsubjpass |
Treatment,described |
R8584 |
T13211 |
T13209 |
prep |
of,Treatment |
R8585 |
T13212 |
T13211 |
pobj |
cells,of |
R8586 |
T13213 |
T13209 |
prep |
with,Treatment |
R8587 |
T13214 |
T13215 |
npadvmod |
Wnt,conditioned |
R8588 |
T13215 |
T13220 |
amod |
conditioned,medium |
R8589 |
T13216 |
T13214 |
punct |
-,Wnt |
R8590 |
T13217 |
T13214 |
cc |
and,Wnt |
R8591 |
T13218 |
T13214 |
conj |
noggin,Wnt |
R8592 |
T13219 |
T13215 |
punct |
-,conditioned |
R8593 |
T13220 |
T13213 |
pobj |
medium,with |
R8594 |
T13221 |
T13210 |
auxpass |
was,described |
R8595 |
T13222 |
T13210 |
advmod |
previously,described |
R8596 |
T13223 |
T13224 |
punct |
[,4 |
R8597 |
T13224 |
T13210 |
parataxis |
4,described |
R8598 |
T13225 |
T13224 |
punct |
],4 |
R8599 |
T13226 |
T13210 |
punct |
.,described |
R8600 |
T13310 |
T13311 |
det |
The,promoter |
R8601 |
T13311 |
T13317 |
nsubjpass |
promoter,generated |
R8602 |
T13312 |
T13313 |
nummod |
2.2,kb |
R8603 |
T13313 |
T13311 |
nmod |
kb,promoter |
R8604 |
T13314 |
T13313 |
punct |
-,kb |
R8605 |
T13315 |
T13311 |
amod |
murine,promoter |
R8606 |
T13316 |
T13311 |
compound |
Snail,promoter |
R8607 |
T13318 |
T13317 |
auxpass |
was,generated |
R8608 |
T13319 |
T13317 |
prep |
by,generated |
R8609 |
T13320 |
T13319 |
pobj |
PCR,by |
R8610 |
T13321 |
T13317 |
advcl |
using,generated |
R8611 |
T13322 |
T13323 |
det |
a,primer |
R8612 |
T13323 |
T13321 |
dobj |
primer,using |
R8613 |
T13324 |
T13323 |
amod |
forward,primer |
R8614 |
T13325 |
T13321 |
prep |
with,using |
R8615 |
T13326 |
T13327 |
det |
an,sequence |
R8616 |
T13327 |
T13325 |
pobj |
sequence,with |
R8617 |
T13328 |
T13327 |
compound |
XbaI,sequence |
R8618 |
T13329 |
T13327 |
compound |
linker,sequence |
R8619 |
T13330 |
T13327 |
punct |
", ",sequence |
R8620 |
T13331 |
T13332 |
nummod |
5,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8621 |
T13332 |
T13327 |
appos |
TCTAGAATTGTTTGCTGCTGTATGGTCTTC,sequence |
R8622 |
T13333 |
T13331 |
punct |
′,5 |
R8623 |
T13334 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8624 |
T13335 |
T13332 |
punct |
-,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8625 |
T13336 |
T13332 |
nummod |
3,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8626 |
T13337 |
T13332 |
punct |
′,TCTAGAATTGTTTGCTGCTGTATGGTCTTC |
R8627 |
T13338 |
T13327 |
punct |
", ",sequence |
R8628 |
T13339 |
T13327 |
cc |
along,sequence |
R8629 |
T13340 |
T13339 |
dep |
with,along |
R8630 |
T13341 |
T13342 |
det |
a,primer |
R8631 |
T13342 |
T13327 |
conj |
primer,sequence |
R8632 |
T13343 |
T13342 |
amod |
reverse,primer |
R8633 |
T13344 |
T13342 |
prep |
with,primer |
R8634 |
T13345 |
T13346 |
det |
a,sequence |
R8635 |
T13346 |
T13344 |
pobj |
sequence,with |
R8636 |
T13347 |
T13346 |
compound |
BglII,sequence |
R8637 |
T13348 |
T13346 |
compound |
linker,sequence |
R8638 |
T13349 |
T13346 |
punct |
", ",sequence |
R8639 |
T13350 |
T13351 |
nummod |
5,GTAG |
R8640 |
T13351 |
T13346 |
appos |
GTAG,sequence |
R8641 |
T13352 |
T13350 |
punct |
′,5 |
R8642 |
T13353 |
T13351 |
punct |
-,GTAG |
R8643 |
T13354 |
T13351 |
compound |
AGATCTGTTGGCCAGAGCGACCTAG,GTAG |
R8644 |
T13355 |
T13351 |
punct |
-,GTAG |
R8645 |
T13356 |
T13351 |
punct |
-,GTAG |
R8646 |
T13357 |
T13351 |
nummod |
3,GTAG |
R8647 |
T13358 |
T13351 |
punct |
′,GTAG |
R8648 |
T13359 |
T13342 |
punct |
", ",primer |
R8649 |
T13360 |
T13342 |
cc |
and,primer |
R8650 |
T13361 |
T13362 |
nmod |
mouse,DNA |
R8651 |
T13362 |
T13342 |
conj |
DNA,primer |
R8652 |
T13363 |
T13362 |
amod |
genomic,DNA |
R8653 |
T13364 |
T13362 |
prep |
as,DNA |
R8654 |
T13365 |
T13366 |
det |
a,template |
R8655 |
T13366 |
T13364 |
pobj |
template,as |
R8656 |
T13367 |
T13317 |
punct |
.,generated |
R8657 |
T13369 |
T13370 |
det |
The,product |
R8658 |
T13370 |
T13372 |
nsubjpass |
product,purified |
R8659 |
T13371 |
T13370 |
compound |
PCR,product |
R8660 |
T13373 |
T13372 |
auxpass |
was,purified |
R8661 |
T13374 |
T13372 |
prep |
with,purified |
R8662 |
T13375 |
T13376 |
det |
the,Kit |
R8663 |
T13376 |
T13374 |
pobj |
Kit,with |
R8664 |
T13377 |
T13378 |
compound |
Gel,Extraction |
R8665 |
T13378 |
T13376 |
compound |
Extraction,Kit |
R8666 |
T13379 |
T13380 |
punct |
(,Qiagen |
R8667 |
T13380 |
T13376 |
parataxis |
Qiagen,Kit |
R8668 |
T13381 |
T13380 |
punct |
", ",Qiagen |
R8669 |
T13382 |
T13380 |
npadvmod |
Valencia,Qiagen |
R8670 |
T13383 |
T13380 |
punct |
", ",Qiagen |
R8671 |
T13384 |
T13380 |
npadvmod |
California,Qiagen |
R8672 |
T13385 |
T13380 |
punct |
", ",Qiagen |
R8673 |
T13386 |
T13387 |
compound |
United,States |
R8674 |
T13387 |
T13380 |
npadvmod |
States,Qiagen |
R8675 |
T13388 |
T13380 |
punct |
),Qiagen |
R8676 |
T13389 |
T13372 |
cc |
and,purified |
R8677 |
T13390 |
T13372 |
conj |
ligated,purified |
R8678 |
T13391 |
T13390 |
prep |
into,ligated |
R8679 |
T13392 |
T13393 |
compound |
pCRII,TOPO |
R8680 |
T13393 |
T13395 |
compound |
TOPO,vector |
R8681 |
T13394 |
T13393 |
punct |
-,TOPO |
R8682 |
T13395 |
T13391 |
pobj |
vector,into |
R8683 |
T13396 |
T13395 |
compound |
TA,vector |
R8684 |
T13397 |
T13398 |
punct |
(,Invitrogen |
R8685 |
T13398 |
T13395 |
parataxis |
Invitrogen,vector |
R8686 |
T13399 |
T13398 |
punct |
", ",Invitrogen |
R8687 |
T13400 |
T13398 |
npadvmod |
Carlsbad,Invitrogen |
R8688 |
T13401 |
T13398 |
punct |
", ",Invitrogen |
R8689 |
T13402 |
T13398 |
npadvmod |
California,Invitrogen |
R8690 |
T13403 |
T13398 |
punct |
", ",Invitrogen |
R8691 |
T13404 |
T13405 |
compound |
United,States |
R8692 |
T13405 |
T13398 |
npadvmod |
States,Invitrogen |
R8693 |
T13406 |
T13398 |
punct |
),Invitrogen |
R8694 |
T13407 |
T13372 |
punct |
.,purified |
R8695 |
T13409 |
T13410 |
det |
The,promoter |
R8696 |
T13410 |
T13411 |
nsubjpass |
promoter,verified |
R8697 |
T13412 |
T13411 |
auxpass |
was,verified |
R8698 |
T13413 |
T13411 |
prep |
by,verified |
R8699 |
T13414 |
T13413 |
pobj |
sequencing,by |
R8700 |
T13415 |
T13411 |
cc |
and,verified |
R8701 |
T13416 |
T13411 |
conj |
digested,verified |
R8702 |
T13417 |
T13416 |
prep |
with,digested |
R8703 |
T13418 |
T13417 |
pobj |
XbaI,with |
R8704 |
T13419 |
T13418 |
cc |
and,XbaI |
R8705 |
T13420 |
T13418 |
conj |
BglII,XbaI |
R8706 |
T13421 |
T13416 |
cc |
and,digested |
R8707 |
T13422 |
T13416 |
conj |
subcloned,digested |
R8708 |
T13423 |
T13422 |
prep |
into,subcloned |
R8709 |
T13424 |
T13425 |
det |
the,vector |
R8710 |
T13425 |
T13423 |
pobj |
vector,into |
R8711 |
T13426 |
T13427 |
compound |
pβ,gal |
R8712 |
T13427 |
T13425 |
compound |
gal,vector |
R8713 |
T13428 |
T13427 |
punct |
-,gal |
R8714 |
T13429 |
T13425 |
compound |
BASIC,vector |
R8715 |
T13430 |
T13431 |
punct |
(,Clontech |
R8716 |
T13431 |
T13425 |
parataxis |
Clontech,vector |
R8717 |
T13432 |
T13431 |
compound |
BD,Clontech |
R8718 |
T13433 |
T13431 |
compound |
Biosciences,Clontech |
R8719 |
T13434 |
T13431 |
punct |
", ",Clontech |
R8720 |
T13435 |
T13436 |
compound |
Palo,Alto |
R8721 |
T13436 |
T13431 |
npadvmod |
Alto,Clontech |
R8722 |
T13437 |
T13431 |
punct |
", ",Clontech |
R8723 |
T13438 |
T13431 |
npadvmod |
California,Clontech |
R8724 |
T13439 |
T13431 |
punct |
", ",Clontech |
R8725 |
T13440 |
T13441 |
compound |
United,States |
R8726 |
T13441 |
T13431 |
npadvmod |
States,Clontech |
R8727 |
T13442 |
T13431 |
punct |
),Clontech |
R8728 |
T13443 |
T13411 |
punct |
.,verified |
R8729 |
T13445 |
T13446 |
det |
The,mutations |
R8730 |
T13446 |
T13448 |
nsubjpass |
mutations,generated |
R8731 |
T13447 |
T13446 |
compound |
point,mutations |
R8732 |
T13449 |
T13446 |
prep |
in,mutations |
R8733 |
T13450 |
T13451 |
det |
the,element |
R8734 |
T13451 |
T13449 |
pobj |
element,in |
R8735 |
T13452 |
T13451 |
compound |
SMAD,element |
R8736 |
T13453 |
T13451 |
compound |
binding,element |
R8737 |
T13454 |
T13448 |
auxpass |
was,generated |
R8738 |
T13455 |
T13448 |
prep |
with,generated |
R8739 |
T13456 |
T13457 |
det |
the,Kit |
R8740 |
T13457 |
T13455 |
pobj |
Kit,with |
R8741 |
T13458 |
T13459 |
compound |
Quik,Change |
R8742 |
T13459 |
T13457 |
compound |
Change,Kit |
R8743 |
T13460 |
T13459 |
punct |
-,Change |
R8744 |
T13461 |
T13462 |
punct |
(,Stratagene |
R8745 |
T13462 |
T13457 |
parataxis |
Stratagene,Kit |
R8746 |
T13463 |
T13462 |
punct |
", ",Stratagene |
R8747 |
T13464 |
T13465 |
compound |
La,Jolla |
R8748 |
T13465 |
T13462 |
npadvmod |
Jolla,Stratagene |
R8749 |
T13466 |
T13462 |
punct |
", ",Stratagene |
R8750 |
T13467 |
T13462 |
npadvmod |
California,Stratagene |
R8751 |
T13468 |
T13462 |
punct |
", ",Stratagene |
R8752 |
T13469 |
T13470 |
compound |
United,States |
R8753 |
T13470 |
T13462 |
npadvmod |
States,Stratagene |
R8754 |
T13471 |
T13462 |
punct |
),Stratagene |
R8755 |
T13472 |
T13448 |
advcl |
using,generated |
R8756 |
T13473 |
T13474 |
det |
the,primer |
R8757 |
T13474 |
T13472 |
dobj |
primer,using |
R8758 |
T13475 |
T13474 |
amod |
forward,primer |
R8759 |
T13476 |
T13477 |
nummod |
5,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8760 |
T13477 |
T13474 |
appos |
GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC,primer |
R8761 |
T13478 |
T13476 |
punct |
′,5 |
R8762 |
T13479 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8763 |
T13480 |
T13477 |
punct |
-,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8764 |
T13481 |
T13477 |
nummod |
3,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8765 |
T13482 |
T13477 |
punct |
′,GGGCGGGCTTAGGTGTTTTCATTTACTCTTGAGGAAAAGCTTGGC |
R8766 |
T13483 |
T13474 |
cc |
and,primer |
R8767 |
T13484 |
T13485 |
det |
the,primer |
R8768 |
T13485 |
T13474 |
conj |
primer,primer |
R8769 |
T13486 |
T13485 |
amod |
reverse,primer |
R8770 |
T13487 |
T13488 |
nummod |
5,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8771 |
T13488 |
T13485 |
appos |
CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC,primer |
R8772 |
T13489 |
T13487 |
punct |
′,5 |
R8773 |
T13490 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8774 |
T13491 |
T13488 |
compound |
GCTTTT,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8775 |
T13492 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8776 |
T13493 |
T13488 |
punct |
-,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8777 |
T13494 |
T13488 |
nummod |
3,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8778 |
T13495 |
T13488 |
punct |
′,CCTCAAGAGTAAATGAAAACACCTAAGCCCGCCCTGCCC |
R8779 |
T13496 |
T13448 |
punct |
.,generated |
R8780 |
T13498 |
T13499 |
det |
The,probes |
R8781 |
T13499 |
T13500 |
nsubjpass |
probes,generated |
R8782 |
T13501 |
T13499 |
prep |
for,probes |
R8783 |
T13502 |
T13503 |
det |
the,hybridization |
R8784 |
T13503 |
T13501 |
pobj |
hybridization,for |
R8785 |
T13504 |
T13503 |
nmod |
Snail,hybridization |
R8786 |
T13505 |
T13506 |
advmod |
in,situ |
R8787 |
T13506 |
T13503 |
amod |
situ,hybridization |
R8788 |
T13507 |
T13500 |
auxpass |
were,generated |
R8789 |
T13508 |
T13500 |
prep |
against,generated |
R8790 |
T13509 |
T13510 |
det |
the,UTR |
R8791 |
T13510 |
T13508 |
pobj |
UTR,against |
R8792 |
T13511 |
T13510 |
nummod |
3,UTR |
R8793 |
T13512 |
T13511 |
punct |
′,3 |
R8794 |
T13513 |
T13500 |
prep |
by,generated |
R8795 |
T13514 |
T13513 |
pobj |
PCR,by |
R8796 |
T13515 |
T13500 |
advcl |
using,generated |
R8797 |
T13516 |
T13517 |
det |
the,primer |
R8798 |
T13517 |
T13515 |
dobj |
primer,using |
R8799 |
T13518 |
T13517 |
amod |
forward,primer |
R8800 |
T13519 |
T13520 |
nummod |
5,ACCTTCTCCCGCATGTCCTTGCTCC |
R8801 |
T13520 |
T13517 |
appos |
ACCTTCTCCCGCATGTCCTTGCTCC,primer |
R8802 |
T13521 |
T13519 |
punct |
′,5 |
R8803 |
T13522 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
R8804 |
T13523 |
T13520 |
punct |
-,ACCTTCTCCCGCATGTCCTTGCTCC |
R8805 |
T13524 |
T13520 |
nummod |
3,ACCTTCTCCCGCATGTCCTTGCTCC |
R8806 |
T13525 |
T13520 |
punct |
′,ACCTTCTCCCGCATGTCCTTGCTCC |
R8807 |
T13526 |
T13517 |
cc |
and,primer |
R8808 |
T13527 |
T13528 |
det |
the,primer |
R8809 |
T13528 |
T13517 |
conj |
primer,primer |
R8810 |
T13529 |
T13528 |
amod |
reverse,primer |
R8811 |
T13530 |
T13531 |
nummod |
5,CTGCTGAGGCATGGTTACAGCTGG |
R8812 |
T13531 |
T13528 |
appos |
CTGCTGAGGCATGGTTACAGCTGG,primer |
R8813 |
T13532 |
T13530 |
punct |
′,5 |
R8814 |
T13533 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
R8815 |
T13534 |
T13531 |
punct |
-,CTGCTGAGGCATGGTTACAGCTGG |
R8816 |
T13535 |
T13531 |
nummod |
3,CTGCTGAGGCATGGTTACAGCTGG |
R8817 |
T13536 |
T13531 |
punct |
′,CTGCTGAGGCATGGTTACAGCTGG |
R8818 |
T13537 |
T13528 |
punct |
", ",primer |
R8819 |
T13538 |
T13528 |
cc |
and,primer |
R8820 |
T13539 |
T13540 |
amod |
genomic,DNA |
R8821 |
T13540 |
T13528 |
conj |
DNA,primer |
R8822 |
T13541 |
T13540 |
prep |
as,DNA |
R8823 |
T13542 |
T13543 |
det |
a,template |
R8824 |
T13543 |
T13541 |
pobj |
template,as |
R8825 |
T13544 |
T13500 |
punct |
.,generated |
R8826 |
T13546 |
T13547 |
det |
The,product |
R8827 |
T13547 |
T13549 |
nsubjpass |
product,purified |
R8828 |
T13548 |
T13547 |
compound |
PCR,product |
R8829 |
T13550 |
T13549 |
auxpass |
was,purified |
R8830 |
T13551 |
T13549 |
dep |
gel,purified |
R8831 |
T13552 |
T13549 |
cc |
and,purified |
R8832 |
T13553 |
T13549 |
conj |
ligated,purified |
R8833 |
T13554 |
T13553 |
prep |
into,ligated |
R8834 |
T13555 |
T13556 |
compound |
pCRII,TOPO |
R8835 |
T13556 |
T13558 |
compound |
TOPO,vector |
R8836 |
T13557 |
T13556 |
punct |
-,TOPO |
R8837 |
T13558 |
T13554 |
pobj |
vector,into |
R8838 |
T13559 |
T13558 |
compound |
TA,vector |
R8839 |
T13560 |
T13549 |
punct |
.,purified |
R8840 |
T13562 |
T13563 |
det |
The,domain |
R8841 |
T13563 |
T13565 |
nsubjpass |
domain,generated |
R8842 |
T13564 |
T13563 |
amod |
pre-LIM,domain |
R8843 |
T13566 |
T13563 |
prep |
of,domain |
R8844 |
T13567 |
T13566 |
pobj |
Ajuba,of |
R8845 |
T13568 |
T13565 |
auxpass |
was,generated |
R8846 |
T13569 |
T13565 |
advmod |
essentially,generated |
R8847 |
T13570 |
T13571 |
mark |
as,described |
R8848 |
T13571 |
T13565 |
advcl |
described,generated |
R8849 |
T13572 |
T13573 |
punct |
[,9 |
R8850 |
T13573 |
T13571 |
parataxis |
9,described |
R8851 |
T13574 |
T13573 |
punct |
],9 |
R8852 |
T13575 |
T13565 |
punct |
", ",generated |
R8853 |
T13576 |
T13565 |
cc |
but,generated |
R8854 |
T13577 |
T13578 |
auxpass |
was,fused |
R8855 |
T13578 |
T13565 |
conj |
fused,generated |
R8856 |
T13579 |
T13578 |
prep |
to,fused |
R8857 |
T13580 |
T13579 |
pobj |
GFP,to |
R8858 |
T13581 |
T13578 |
prep |
by,fused |
R8859 |
T13582 |
T13581 |
pcomp |
subcloning,by |
R8860 |
T13583 |
T13582 |
prep |
from,subcloning |
R8861 |
T13584 |
T13585 |
det |
the,vector |
R8862 |
T13585 |
T13583 |
pobj |
vector,from |
R8863 |
T13586 |
T13587 |
nmod |
pEGFP,N1 |
R8864 |
T13587 |
T13585 |
nmod |
N1,vector |
R8865 |
T13588 |
T13587 |
punct |
-,N1 |
R8866 |
T13589 |
T13585 |
nummod |
20,vector |
R8867 |
T13590 |
T13591 |
punct |
(,Clontech |
R8868 |
T13591 |
T13585 |
parataxis |
Clontech,vector |
R8869 |
T13592 |
T13591 |
compound |
BD,Clontech |
R8870 |
T13593 |
T13591 |
compound |
Biosciences,Clontech |
R8871 |
T13594 |
T13591 |
punct |
),Clontech |
R8874 |
T13649 |
T13650 |
advmod |
In,situ |
R8875 |
T13650 |
T13651 |
amod |
situ,hybridization |
R8876 |
T13653 |
T13654 |
det |
The,vector |
R8877 |
T13654 |
T13659 |
nsubjpass |
vector,used |
R8878 |
T13655 |
T13656 |
compound |
pCRII,TOPO |
R8879 |
T13656 |
T13654 |
compound |
TOPO,vector |
R8880 |
T13657 |
T13656 |
punct |
-,TOPO |
R8881 |
T13658 |
T13654 |
compound |
TA,vector |
R8882 |
T13660 |
T13654 |
acl |
containing,vector |
R8883 |
T13661 |
T13662 |
det |
a,region |
R8884 |
T13662 |
T13660 |
dobj |
region,containing |
R8885 |
T13663 |
T13662 |
prep |
of,region |
R8886 |
T13664 |
T13665 |
det |
the,UTR |
R8887 |
T13665 |
T13663 |
pobj |
UTR,of |
R8888 |
T13666 |
T13665 |
nummod |
3,UTR |
R8889 |
T13667 |
T13666 |
punct |
′,3 |
R8890 |
T13668 |
T13665 |
prep |
of,UTR |
R8891 |
T13669 |
T13668 |
pobj |
Snail,of |
R8892 |
T13670 |
T13659 |
auxpass |
was,used |
R8893 |
T13671 |
T13659 |
prep |
as,used |
R8894 |
T13672 |
T13673 |
det |
a,template |
R8895 |
T13673 |
T13671 |
pobj |
template,as |
R8896 |
T13674 |
T13675 |
aux |
to,generate |
R8897 |
T13675 |
T13659 |
advcl |
generate,used |
R8898 |
T13676 |
T13677 |
npadvmod |
digoxigenin,labeled |
R8899 |
T13677 |
T13679 |
amod |
labeled,riboprobes |
R8900 |
T13678 |
T13677 |
punct |
-,labeled |
R8901 |
T13679 |
T13675 |
dobj |
riboprobes,generate |
R8902 |
T13680 |
T13679 |
nmod |
sense,riboprobes |
R8903 |
T13681 |
T13680 |
cc |
and,sense |
R8904 |
T13682 |
T13680 |
conj |
antisense,sense |
R8905 |
T13683 |
T13684 |
punct |
(,Roche |
R8906 |
T13684 |
T13679 |
parataxis |
Roche,riboprobes |
R8907 |
T13685 |
T13684 |
punct |
),Roche |
R8908 |
T13686 |
T13659 |
punct |
.,used |
R8909 |
T13688 |
T13689 |
det |
The,probes |
R8910 |
T13689 |
T13691 |
nsubjpass |
probes,obtained |
R8911 |
T13690 |
T13689 |
amod |
respective,probes |
R8912 |
T13692 |
T13691 |
auxpass |
were,obtained |
R8913 |
T13693 |
T13691 |
prep |
by,obtained |
R8914 |
T13694 |
T13695 |
nmod |
XhoI,digestions |
R8915 |
T13695 |
T13693 |
pobj |
digestions,by |
R8916 |
T13696 |
T13694 |
cc |
and,XhoI |
R8917 |
T13697 |
T13694 |
conj |
BamH1,XhoI |
R8918 |
T13698 |
T13691 |
punct |
.,obtained |
R8919 |
T13700 |
T13701 |
advmod |
In,situ |
R8920 |
T13701 |
T13702 |
amod |
situ,hybridizations |
R8921 |
T13702 |
T13703 |
nsubjpass |
hybridizations,performed |
R8922 |
T13704 |
T13703 |
auxpass |
were,performed |
R8923 |
T13705 |
T13703 |
prep |
on,performed |
R8924 |
T13706 |
T13707 |
nummod |
10,μm |
R8925 |
T13707 |
T13709 |
npadvmod |
μm,thick |
R8926 |
T13708 |
T13707 |
punct |
-,μm |
R8927 |
T13709 |
T13710 |
amod |
thick,sections |
R8928 |
T13710 |
T13705 |
pobj |
sections,on |
R8929 |
T13711 |
T13710 |
prep |
of,sections |
R8930 |
T13712 |
T13713 |
compound |
E17.5,embryos |
R8931 |
T13713 |
T13711 |
pobj |
embryos,of |
R8932 |
T13714 |
T13713 |
compound |
mouse,embryos |
R8933 |
T13715 |
T13703 |
punct |
.,performed |
R8934 |
T13717 |
T13718 |
det |
The,sections |
R8935 |
T13718 |
T13719 |
nsubjpass |
sections,fixed |
R8936 |
T13720 |
T13719 |
auxpass |
were,fixed |
R8937 |
T13721 |
T13719 |
prep |
with,fixed |
R8938 |
T13722 |
T13723 |
nummod |
4,% |
R8939 |
T13723 |
T13724 |
compound |
%,PFA |
R8940 |
T13724 |
T13721 |
pobj |
PFA,with |
R8941 |
T13725 |
T13719 |
prep |
for,fixed |
R8942 |
T13726 |
T13727 |
nummod |
10,min |
R8943 |
T13727 |
T13725 |
pobj |
min,for |
R8944 |
T13728 |
T13719 |
prep |
at,fixed |
R8945 |
T13729 |
T13730 |
compound |
room,temperature |
R8946 |
T13730 |
T13728 |
pobj |
temperature,at |
R8947 |
T13731 |
T13719 |
punct |
", ",fixed |
R8948 |
T13732 |
T13719 |
conj |
prehybridized,fixed |
R8949 |
T13733 |
T13732 |
prep |
at,prehybridized |
R8950 |
T13734 |
T13735 |
compound |
room,temperature |
R8951 |
T13735 |
T13733 |
pobj |
temperature,at |
R8952 |
T13736 |
T13732 |
prep |
for,prehybridized |
R8953 |
T13737 |
T13738 |
nummod |
4.5,h |
R8954 |
T13738 |
T13736 |
pobj |
h,for |
R8955 |
T13739 |
T13732 |
punct |
", ",prehybridized |
R8956 |
T13740 |
T13732 |
conj |
hybridized,prehybridized |
R8957 |
T13741 |
T13740 |
prep |
with,hybridized |
R8958 |
T13742 |
T13743 |
det |
the,probe |
R8959 |
T13743 |
T13741 |
pobj |
probe,with |
R8960 |
T13744 |
T13745 |
punct |
(,μg |
R8961 |
T13745 |
T13743 |
parataxis |
μg,probe |
R8962 |
T13746 |
T13745 |
nummod |
2,μg |
R8963 |
T13747 |
T13748 |
punct |
/,ml |
R8964 |
T13748 |
T13745 |
prep |
ml,μg |
R8965 |
T13749 |
T13745 |
punct |
),μg |
R8966 |
T13750 |
T13740 |
prep |
at,hybridized |
R8967 |
T13751 |
T13752 |
nummod |
55,°C |
R8968 |
T13752 |
T13750 |
pobj |
°C,at |
R8969 |
T13753 |
T13740 |
prep |
for,hybridized |
R8970 |
T13754 |
T13755 |
quantmod |
12,14 |
R8971 |
T13755 |
T13757 |
nummod |
14,h |
R8972 |
T13756 |
T13755 |
punct |
–,14 |
R8973 |
T13757 |
T13753 |
pobj |
h,for |
R8974 |
T13758 |
T13740 |
punct |
", ",hybridized |
R8975 |
T13759 |
T13740 |
conj |
blocked,hybridized |
R8976 |
T13760 |
T13759 |
prep |
with,blocked |
R8977 |
T13761 |
T13762 |
nummod |
10,% |
R8978 |
T13762 |
T13763 |
compound |
%,NGS |
R8979 |
T13763 |
T13760 |
pobj |
NGS,with |
R8980 |
T13764 |
T13759 |
punct |
", ",blocked |
R8981 |
T13765 |
T13759 |
cc |
and,blocked |
R8982 |
T13766 |
T13759 |
conj |
treated,blocked |
R8983 |
T13767 |
T13766 |
prep |
with,treated |
R8984 |
T13768 |
T13769 |
amod |
anti-dig,antibody |
R8985 |
T13769 |
T13767 |
pobj |
antibody,with |
R8986 |
T13770 |
T13771 |
compound |
Fab,AP |
R8987 |
T13771 |
T13769 |
compound |
AP,antibody |
R8988 |
T13772 |
T13771 |
punct |
-,AP |
R8989 |
T13773 |
T13774 |
punct |
(,Roche |
R8990 |
T13774 |
T13769 |
parataxis |
Roche,antibody |
R8991 |
T13775 |
T13774 |
punct |
#,Roche |
R8992 |
T13776 |
T13774 |
nummod |
1093274,Roche |
R8993 |
T13777 |
T13774 |
punct |
),Roche |
R8994 |
T13778 |
T13766 |
prep |
at,treated |
R8995 |
T13779 |
T13780 |
det |
a,dilution |
R8996 |
T13780 |
T13778 |
pobj |
dilution,at |
R8997 |
T13781 |
T13782 |
quantmod |
1,"2,500" |
R8998 |
T13782 |
T13780 |
nummod |
"2,500",dilution |
R8999 |
T13783 |
T13782 |
punct |
:,"2,500" |
R9000 |
T13784 |
T13766 |
prep |
for,treated |
R9001 |
T13785 |
T13786 |
nummod |
3,h |
R9002 |
T13786 |
T13784 |
pobj |
h,for |
R9003 |
T13787 |
T13719 |
punct |
.,fixed |
R9004 |
T13789 |
T13790 |
det |
The,sections |
R9005 |
T13790 |
T13791 |
nsubjpass |
sections,incubated |
R9006 |
T13792 |
T13791 |
auxpass |
were,incubated |
R9007 |
T13793 |
T13791 |
prep |
with,incubated |
R9008 |
T13794 |
T13793 |
pobj |
NBT,with |
R9009 |
T13795 |
T13794 |
cc |
and,NBT |
R9010 |
T13796 |
T13794 |
conj |
BCIP,NBT |
R9011 |
T13797 |
T13798 |
mark |
until,detected |
R9012 |
T13798 |
T13791 |
advcl |
detected,incubated |
R9013 |
T13799 |
T13800 |
amod |
adequate,signal |
R9014 |
T13800 |
T13798 |
nsubjpass |
signal,detected |
R9015 |
T13801 |
T13798 |
auxpass |
was,detected |
R9016 |
T13802 |
T13791 |
punct |
.,incubated |
R9017 |
T13829 |
T13828 |
cc |
and,Immunofluorescence |
R9018 |
T13830 |
T13828 |
conj |
immunohistochemistry,Immunofluorescence |
R9019 |
T13832 |
T13833 |
compound |
Tissue,samples |
R9020 |
T13833 |
T13834 |
nsubjpass |
samples,frozen |
R9021 |
T13835 |
T13833 |
prep |
for,samples |
R9022 |
T13836 |
T13835 |
pobj |
immunofluorescence,for |
R9023 |
T13837 |
T13834 |
auxpass |
were,frozen |
R9024 |
T13838 |
T13834 |
prep |
in,frozen |
R9025 |
T13839 |
T13838 |
pobj |
OCT,in |
R9026 |
T13840 |
T13834 |
cc |
and,frozen |
R9027 |
T13841 |
T13834 |
conj |
sectioned,frozen |
R9028 |
T13842 |
T13843 |
nummod |
10,μm |
R9029 |
T13843 |
T13844 |
npadvmod |
μm,thick |
R9030 |
T13844 |
T13841 |
advcl |
thick,sectioned |
R9031 |
T13845 |
T13841 |
prep |
on,sectioned |
R9032 |
T13846 |
T13847 |
det |
a,cryostat |
R9033 |
T13847 |
T13845 |
pobj |
cryostat,on |
R9034 |
T13848 |
T13834 |
punct |
.,frozen |
R9035 |
T13850 |
T13851 |
nsubjpass |
Sections,fixed |
R9036 |
T13852 |
T13851 |
auxpass |
were,fixed |
R9037 |
T13853 |
T13851 |
prep |
in,fixed |
R9038 |
T13854 |
T13855 |
nummod |
4,% |
R9039 |
T13855 |
T13856 |
compound |
%,paraformaldehyde |
R9040 |
T13856 |
T13853 |
pobj |
paraformaldehyde,in |
R9041 |
T13857 |
T13851 |
prep |
for,fixed |
R9042 |
T13858 |
T13859 |
nummod |
10,min |
R9043 |
T13859 |
T13857 |
pobj |
min,for |
R9044 |
T13860 |
T13851 |
prep |
at,fixed |
R9045 |
T13861 |
T13862 |
compound |
room,temperature |
R9046 |
T13862 |
T13860 |
pobj |
temperature,at |
R9047 |
T13863 |
T13851 |
punct |
", ",fixed |
R9048 |
T13864 |
T13851 |
conj |
blocked,fixed |
R9049 |
T13865 |
T13864 |
punct |
", ",blocked |
R9050 |
T13866 |
T13864 |
cc |
and,blocked |
R9051 |
T13867 |
T13864 |
conj |
stained,blocked |
R9052 |
T13868 |
T13867 |
prep |
with,stained |
R9053 |
T13869 |
T13868 |
pobj |
antibodies,with |
R9054 |
T13870 |
T13851 |
punct |
.,fixed |
R9055 |
T13872 |
T13873 |
compound |
Tissue,samples |
R9056 |
T13873 |
T13874 |
nsubjpass |
samples,fixed |
R9057 |
T13875 |
T13873 |
prep |
for,samples |
R9058 |
T13876 |
T13875 |
pobj |
immunohistochemistry,for |
R9059 |
T13877 |
T13874 |
auxpass |
were,fixed |
R9060 |
T13878 |
T13874 |
prep |
in,fixed |
R9061 |
T13879 |
T13880 |
nummod |
4,% |
R9062 |
T13880 |
T13881 |
compound |
%,paraformaldehyde |
R9063 |
T13881 |
T13878 |
pobj |
paraformaldehyde,in |
R9064 |
T13882 |
T13874 |
punct |
", ",fixed |
R9065 |
T13883 |
T13874 |
conj |
dehydrated,fixed |
R9066 |
T13884 |
T13883 |
punct |
", ",dehydrated |
R9067 |
T13885 |
T13883 |
cc |
and,dehydrated |
R9068 |
T13886 |
T13883 |
conj |
embedded,dehydrated |
R9069 |
T13887 |
T13886 |
prep |
in,embedded |
R9070 |
T13888 |
T13887 |
pobj |
paraffin,in |
R9071 |
T13889 |
T13874 |
punct |
.,fixed |
R9072 |
T13891 |
T13892 |
nsubjpass |
Samples,sectioned |
R9073 |
T13893 |
T13892 |
auxpass |
were,sectioned |
R9074 |
T13894 |
T13892 |
prep |
on,sectioned |
R9075 |
T13895 |
T13896 |
det |
a,microtome |
R9076 |
T13896 |
T13894 |
pobj |
microtome,on |
R9077 |
T13897 |
T13898 |
punct |
(,thick |
R9078 |
T13898 |
T13892 |
parataxis |
thick,sectioned |
R9079 |
T13899 |
T13900 |
nummod |
10,μm |
R9080 |
T13900 |
T13898 |
npadvmod |
μm,thick |
R9081 |
T13901 |
T13898 |
punct |
),thick |
R9082 |
T13902 |
T13892 |
cc |
and,sectioned |
R9083 |
T13903 |
T13892 |
conj |
rehydrated,sectioned |
R9084 |
T13904 |
T13903 |
prep |
prior,rehydrated |
R9085 |
T13905 |
T13904 |
pcomp |
to,prior |
R9086 |
T13906 |
T13904 |
pcomp |
staining,prior |
R9087 |
T13907 |
T13906 |
prep |
with,staining |
R9088 |
T13908 |
T13907 |
pobj |
antibody,with |
R9089 |
T13909 |
T13892 |
punct |
.,sectioned |
R9090 |
T13911 |
T13912 |
nsubjpass |
Samples,unmasked |
R9091 |
T13913 |
T13911 |
acl |
stained,Samples |
R9092 |
T13914 |
T13913 |
prep |
with,stained |
R9093 |
T13915 |
T13914 |
pobj |
Snail,with |
R9094 |
T13916 |
T13915 |
punct |
", ",Snail |
R9095 |
T13917 |
T13915 |
conj |
pMAPK,Snail |
R9096 |
T13918 |
T13917 |
punct |
", ",pMAPK |
R9097 |
T13919 |
T13917 |
conj |
pSmad2,pMAPK |
R9098 |
T13920 |
T13919 |
punct |
", ",pSmad2 |
R9099 |
T13921 |
T13919 |
cc |
and,pSmad2 |
R9100 |
T13922 |
T13923 |
compound |
cyclin,D |
R9101 |
T13923 |
T13919 |
conj |
D,pSmad2 |
R9102 |
T13924 |
T13912 |
auxpass |
were,unmasked |
R9103 |
T13925 |
T13912 |
dep |
antigen,unmasked |
R9104 |
T13926 |
T13912 |
prep |
with,unmasked |
R9105 |
T13927 |
T13928 |
nummod |
10,mM |
R9106 |
T13928 |
T13929 |
compound |
mM,citrate |
R9107 |
T13929 |
T13926 |
pobj |
citrate,with |
R9108 |
T13930 |
T13929 |
compound |
sodium,citrate |
R9109 |
T13931 |
T13929 |
punct |
(,citrate |
R9110 |
T13932 |
T13929 |
npadvmod |
pH,citrate |
R9111 |
T13933 |
T13932 |
nummod |
6,pH |
R9112 |
T13934 |
T13929 |
punct |
),citrate |
R9113 |
T13935 |
T13912 |
prep |
in,unmasked |
R9114 |
T13936 |
T13937 |
det |
an,Retriever |
R9115 |
T13937 |
T13935 |
pobj |
Retriever,in |
R9116 |
T13938 |
T13937 |
compound |
Antigen,Retriever |
R9117 |
T13939 |
T13937 |
nummod |
2100,Retriever |
R9118 |
T13940 |
T13941 |
punct |
(,Laboratories |
R9119 |
T13941 |
T13937 |
parataxis |
Laboratories,Retriever |
R9120 |
T13942 |
T13941 |
compound |
Pickcell,Laboratories |
R9121 |
T13943 |
T13941 |
punct |
", ",Laboratories |
R9122 |
T13944 |
T13941 |
npadvmod |
Leiden,Laboratories |
R9123 |
T13945 |
T13941 |
punct |
", ",Laboratories |
R9124 |
T13946 |
T13941 |
npadvmod |
Netherlands,Laboratories |
R9125 |
T13947 |
T13941 |
punct |
),Laboratories |
R9126 |
T13948 |
T13912 |
punct |
.,unmasked |
R9127 |
T13950 |
T13951 |
det |
The,kit |
R9128 |
T13951 |
T13954 |
nsubjpass |
kit,used |
R9129 |
T13952 |
T13953 |
compound |
DAB,substrate |
R9130 |
T13953 |
T13951 |
compound |
substrate,kit |
R9131 |
T13955 |
T13956 |
punct |
(,Labs |
R9132 |
T13956 |
T13951 |
parataxis |
Labs,kit |
R9133 |
T13957 |
T13956 |
compound |
Vector,Labs |
R9134 |
T13958 |
T13956 |
punct |
),Labs |
R9135 |
T13959 |
T13954 |
auxpass |
was,used |
R9136 |
T13960 |
T13954 |
prep |
according,used |
R9137 |
T13961 |
T13960 |
prep |
to,according |
R9138 |
T13962 |
T13963 |
poss |
manufacturer,instructions |
R9139 |
T13963 |
T13961 |
pobj |
instructions,to |
R9140 |
T13964 |
T13962 |
case |
's,manufacturer |
R9141 |
T13965 |
T13966 |
aux |
to,develop |
R9142 |
T13966 |
T13954 |
advcl |
develop,used |
R9143 |
T13967 |
T13968 |
det |
the,signal |
R9144 |
T13968 |
T13966 |
dobj |
signal,develop |
R9145 |
T13969 |
T13954 |
punct |
.,used |
R9146 |
T14008 |
T14009 |
compound |
RT,PCR |
R9147 |
T14010 |
T14009 |
punct |
-,PCR |
R9148 |
T14012 |
T14013 |
nsubjpass |
RNA,extracted |
R9149 |
T14014 |
T14013 |
auxpass |
was,extracted |
R9150 |
T14015 |
T14013 |
prep |
from,extracted |
R9151 |
T14016 |
T14015 |
pobj |
keratinocytes,from |
R9152 |
T14017 |
T14016 |
cc |
or,keratinocytes |
R9153 |
T14018 |
T14019 |
compound |
skin,tissue |
R9154 |
T14019 |
T14016 |
conj |
tissue,keratinocytes |
R9155 |
T14020 |
T14013 |
prep |
with,extracted |
R9156 |
T14021 |
T14020 |
pobj |
Trizol,with |
R9157 |
T14022 |
T14023 |
punct |
(,Invitrogen |
R9158 |
T14023 |
T14021 |
parataxis |
Invitrogen,Trizol |
R9159 |
T14024 |
T14023 |
punct |
),Invitrogen |
R9160 |
T14025 |
T14013 |
prep |
according,extracted |
R9161 |
T14026 |
T14025 |
prep |
to,according |
R9162 |
T14027 |
T14028 |
det |
the,manufacturer |
R9163 |
T14028 |
T14029 |
poss |
manufacturer,protocol |
R9164 |
T14029 |
T14026 |
pobj |
protocol,to |
R9165 |
T14030 |
T14028 |
case |
's,manufacturer |
R9166 |
T14031 |
T14013 |
punct |
.,extracted |
R9167 |
T14033 |
T14034 |
nsubjpass |
cDNA,generated |
R9168 |
T14035 |
T14034 |
auxpass |
was,generated |
R9169 |
T14036 |
T14034 |
advcl |
using,generated |
R9170 |
T14037 |
T14038 |
compound |
oligo,dT |
R9171 |
T14038 |
T14040 |
compound |
dT,primers |
R9172 |
T14039 |
T14038 |
punct |
-,dT |
R9173 |
T14040 |
T14036 |
dobj |
primers,using |
R9174 |
T14041 |
T14040 |
cc |
and,primers |
R9175 |
T14042 |
T14043 |
det |
the,kit |
R9176 |
T14043 |
T14040 |
conj |
kit,primers |
R9177 |
T14044 |
T14043 |
nmod |
Superscript,kit |
R9178 |
T14045 |
T14044 |
nummod |
II,Superscript |
R9179 |
T14046 |
T14047 |
punct |
(,Invitrogen |
R9180 |
T14047 |
T14043 |
parataxis |
Invitrogen,kit |
R9181 |
T14048 |
T14047 |
punct |
),Invitrogen |
R9182 |
T14049 |
T14034 |
punct |
.,generated |
R9183 |
T14051 |
T14052 |
det |
The,primers |
R9184 |
T14052 |
T14053 |
nsubj |
primers,were |
R9185 |
T14054 |
T14052 |
acl |
used,primers |
R9186 |
T14055 |
T14054 |
prep |
for,used |
R9187 |
T14056 |
T14055 |
pobj |
PCR,for |
R9188 |
T14057 |
T14058 |
compound |
Snail,forward |
R9189 |
T14058 |
T14053 |
attr |
forward,were |
R9190 |
T14059 |
T14058 |
punct |
: ,forward |
R9191 |
T14060 |
T14061 |
nummod |
5,CAGCTGGCCAGGCTCTCGGT |
R9192 |
T14061 |
T14058 |
appos |
CAGCTGGCCAGGCTCTCGGT,forward |
R9193 |
T14062 |
T14060 |
punct |
′,5 |
R9194 |
T14063 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
R9195 |
T14064 |
T14061 |
punct |
-,CAGCTGGCCAGGCTCTCGGT |
R9196 |
T14065 |
T14061 |
nummod |
3,CAGCTGGCCAGGCTCTCGGT |
R9197 |
T14066 |
T14061 |
punct |
′,CAGCTGGCCAGGCTCTCGGT |
R9198 |
T14067 |
T14058 |
punct |
;,forward |
R9199 |
T14068 |
T14069 |
compound |
Snail,reverse |
R9200 |
T14069 |
T14058 |
conj |
reverse,forward |
R9201 |
T14070 |
T14069 |
punct |
: ,reverse |
R9202 |
T14071 |
T14072 |
nummod |
5,GCGAGGGCCTCCGGAGCA |
R9203 |
T14072 |
T14069 |
appos |
GCGAGGGCCTCCGGAGCA,reverse |
R9204 |
T14073 |
T14071 |
punct |
′,5 |
R9205 |
T14074 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
R9206 |
T14075 |
T14072 |
punct |
-,GCGAGGGCCTCCGGAGCA |
R9207 |
T14076 |
T14072 |
nummod |
3,GCGAGGGCCTCCGGAGCA |
R9208 |
T14077 |
T14072 |
punct |
′,GCGAGGGCCTCCGGAGCA |
R9209 |
T14078 |
T14069 |
punct |
;,reverse |
R9210 |
T14079 |
T14080 |
compound |
GAPDH,forward |
R9211 |
T14080 |
T14069 |
conj |
forward,reverse |
R9212 |
T14081 |
T14082 |
nummod |
5,CGTAGACAAAATGGTGAAGGTCGG |
R9213 |
T14082 |
T14080 |
appos |
CGTAGACAAAATGGTGAAGGTCGG,forward |
R9214 |
T14083 |
T14081 |
punct |
′,5 |
R9215 |
T14084 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
R9216 |
T14085 |
T14082 |
punct |
-,CGTAGACAAAATGGTGAAGGTCGG |
R9217 |
T14086 |
T14082 |
nummod |
3,CGTAGACAAAATGGTGAAGGTCGG |
R9218 |
T14087 |
T14082 |
punct |
′,CGTAGACAAAATGGTGAAGGTCGG |
R9219 |
T14088 |
T14080 |
punct |
;,forward |
R9220 |
T14089 |
T14080 |
cc |
and,forward |
R9221 |
T14090 |
T14091 |
compound |
GAPDH,reverse |
R9222 |
T14091 |
T14080 |
conj |
reverse,forward |
R9223 |
T14092 |
T14091 |
punct |
: ,reverse |
R9224 |
T14093 |
T14094 |
nummod |
5,AAGCAGTTGGTGGTGCAGGATG |
R9225 |
T14094 |
T14091 |
appos |
AAGCAGTTGGTGGTGCAGGATG,reverse |
R9226 |
T14095 |
T14093 |
punct |
′,5 |
R9227 |
T14096 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
R9228 |
T14097 |
T14094 |
punct |
-,AAGCAGTTGGTGGTGCAGGATG |
R9229 |
T14098 |
T14094 |
nummod |
3,AAGCAGTTGGTGGTGCAGGATG |
R9230 |
T14099 |
T14094 |
punct |
′,AAGCAGTTGGTGGTGCAGGATG |
R9231 |
T14100 |
T14053 |
punct |
.,were |
R2 |
T149 |
T147 |
compound |
Signaling,Pathway |
R3 |
T150 |
T147 |
acl |
Involving,Pathway |
R4 |
T151 |
T152 |
compound |
TGF,β2 |
R7 |
T154 |
T152 |
cc |
and,β2 |
R8 |
T155 |
T152 |
conj |
Snail,β2 |
R9 |
T156 |
T147 |
prep |
in,Pathway |
R10 |
T157 |
T158 |
compound |
Hair,Follicle |
R11 |
T158 |
T159 |
compound |
Follicle,Morphogenesis |
R12 |
T159 |
T156 |
pobj |
Morphogenesis,in |
R13 |
T162 |
T163 |
prep |
In,exchange |
R14 |
T164 |
T165 |
det |
a,theme |
R17 |
T167 |
T165 |
prep |
of,theme |
R18 |
T168 |
T167 |
pobj |
organogenesis,of |
R19 |
T169 |
T163 |
punct |
", ",exchange |
R20 |
T170 |
T171 |
amod |
certain,cells |
R21 |
T171 |
T163 |
nsubj |
cells,exchange |
R22 |
T172 |
T171 |
prep |
within,cells |
R23 |
T173 |
T174 |
det |
a,sheet |
R27 |
T177 |
T163 |
dobj |
signals,exchange |
R28 |
T178 |
T163 |
prep |
with,exchange |
R29 |
T179 |
T180 |
poss |
their,neighbors |
R30 |
T180 |
T178 |
pobj |
neighbors,with |
R31 |
T181 |
T163 |
cc |
and,exchange |
R32 |
T182 |
T163 |
conj |
develop,exchange |
R33 |
T183 |
T182 |
prep |
into,develop |
R34 |
T184 |
T185 |
det |
a,structure |
R37 |
T187 |
T163 |
punct |
.,exchange |
R38 |
T189 |
T190 |
advcl |
Using,employed |
R39 |
T191 |
T192 |
compound |
hair,bud |
R40 |
T192 |
T193 |
compound |
bud,morphogenesis |
R41 |
T193 |
T189 |
dobj |
morphogenesis,Using |
R42 |
T194 |
T189 |
prep |
as,Using |
R43 |
T195 |
T196 |
det |
a,paradigm |
R44 |
T196 |
T194 |
pobj |
paradigm,as |
R45 |
T197 |
T190 |
punct |
", ",employed |
R46 |
T198 |
T190 |
nsubj |
we,employed |
R47 |
T199 |
T200 |
compound |
mutant,mouse |
R48 |
T200 |
T201 |
compound |
mouse,models |
R49 |
T201 |
T190 |
dobj |
models,employed |
R50 |
T202 |
T201 |
cc |
and,models |
R51 |
T203 |
T204 |
amod |
cultured,keratinocytes |
R52 |
T204 |
T201 |
conj |
keratinocytes,models |
R53 |
T205 |
T206 |
aux |
to,dissect |
R54 |
T206 |
T190 |
advcl |
dissect,employed |
R55 |
T207 |
T208 |
det |
the,contributions |
R56 |
T208 |
T206 |
dobj |
contributions,dissect |
R57 |
T209 |
T208 |
prep |
of,contributions |
R58 |
T210 |
T211 |
amod |
multiple,cues |
R61 |
T213 |
T208 |
prep |
in,contributions |
R62 |
T214 |
T213 |
pcomp |
orchestrating,in |
R63 |
T215 |
T216 |
compound |
adhesion,dynamics |
R64 |
T216 |
T214 |
dobj |
dynamics,orchestrating |
R65 |
T217 |
T216 |
cc |
and,dynamics |
R66 |
T218 |
T216 |
conj |
proliferation,dynamics |
R67 |
T219 |
T220 |
aux |
to,shape |
R68 |
T220 |
T214 |
advcl |
shape,orchestrating |
R69 |
T221 |
T222 |
det |
the,cluster |
R70 |
T222 |
T220 |
dobj |
cluster,shape |
R71 |
T223 |
T222 |
prep |
of,cluster |
R72 |
T224 |
T223 |
pobj |
cells,of |
R73 |
T225 |
T222 |
acl |
involved,cluster |
R74 |
T226 |
T190 |
punct |
.,employed |
R75 |
T228 |
T229 |
nsubj |
We,found |
R76 |
T230 |
T231 |
mark |
that,is |
R80 |
T234 |
T236 |
compound |
β2,signaling |
R83 |
T237 |
T231 |
acomp |
necessary,is |
R84 |
T238 |
T239 |
aux |
to,induce |
R87 |
T241 |
T242 |
det |
the,Snail |
R91 |
T245 |
T239 |
cc |
and,induce |
R92 |
T246 |
T239 |
conj |
activate,induce |
R93 |
T247 |
T248 |
det |
the,pathway |
R105 |
T259 |
T246 |
prep |
in,activate |
R106 |
T260 |
T261 |
det |
the,bud |
R107 |
T261 |
T259 |
pobj |
bud,in |
R108 |
T262 |
T229 |
punct |
.,found |
R109 |
T264 |
T265 |
prep |
In,leads |
R110 |
T266 |
T267 |
det |
the,epidermis |
R111 |
T267 |
T264 |
pobj |
epidermis,In |
R112 |
T268 |
T265 |
punct |
", ",leads |
R113 |
T269 |
T270 |
compound |
Snail,misexpression |
R114 |
T270 |
T265 |
nsubj |
misexpression,leads |
R115 |
T271 |
T265 |
prep |
to,leads |
R116 |
T272 |
T271 |
pobj |
hyperproliferation,to |
R117 |
T273 |
T272 |
cc |
and,hyperproliferation |
R118 |
T274 |
T275 |
det |
a,reduction |
R119 |
T275 |
T272 |
conj |
reduction,hyperproliferation |
R120 |
T276 |
T275 |
prep |
in,reduction |
R121 |
T277 |
T278 |
amod |
intercellular,adhesion |
R122 |
T278 |
T276 |
pobj |
adhesion,in |
R123 |
T279 |
T265 |
punct |
.,leads |
R124 |
T281 |
T282 |
advmod |
When,regulated |
R127 |
T284 |
T282 |
nsubjpass |
cadherin,regulated |
R133 |
T291 |
T290 |
punct |
", ",released |
R134 |
T292 |
T293 |
amod |
associated,proteins |
R137 |
T295 |
T293 |
prep |
with,proteins |
R138 |
T296 |
T297 |
amod |
dual,functions |
R139 |
T297 |
T295 |
pobj |
functions,with |
R140 |
T298 |
T297 |
prep |
in,functions |
R141 |
T299 |
T298 |
pobj |
signaling,in |
R142 |
T300 |
T290 |
auxpass |
are,released |
R143 |
T301 |
T290 |
prep |
from,released |
R144 |
T302 |
T303 |
compound |
cell,cell |
R147 |
T305 |
T301 |
pobj |
contacts,from |
R148 |
T306 |
T290 |
punct |
", ",released |
R149 |
T307 |
T308 |
det |
a,process |
R150 |
T308 |
T290 |
npadvmod |
process,released |
R151 |
T309 |
T310 |
dep |
which,demonstrate |
R154 |
T312 |
T310 |
advcl |
leads,demonstrate |
R155 |
T313 |
T312 |
prep |
to,leads |
R156 |
T314 |
T315 |
compound |
Ras,MAPK |
R159 |
T317 |
T313 |
pobj |
activation,to |
R160 |
T318 |
T290 |
punct |
.,released |
R161 |
T320 |
T321 |
det |
These,studies |
R162 |
T321 |
T322 |
nsubj |
studies,provide |
R163 |
T323 |
T322 |
dobj |
insights,provide |
R164 |
T324 |
T323 |
prep |
into,insights |
R165 |
T325 |
T326 |
advmod |
how,stimulated |
R173 |
T333 |
T334 |
aux |
to,undergo |
R174 |
T334 |
T326 |
advcl |
undergo,stimulated |
R175 |
T335 |
T336 |
amod |
transcriptional,changes |
R176 |
T336 |
T334 |
dobj |
changes,undergo |
R177 |
T337 |
T338 |
dep |
that,result |
R178 |
T338 |
T336 |
relcl |
result,changes |
R179 |
T339 |
T338 |
prep |
in,result |
R180 |
T340 |
T339 |
pobj |
proliferation,in |
R181 |
T341 |
T340 |
punct |
", ",proliferation |
R182 |
T342 |
T343 |
amod |
junctional,remodeling |
R183 |
T343 |
T340 |
conj |
remodeling,proliferation |
R184 |
T344 |
T343 |
punct |
", ",remodeling |
R185 |
T345 |
T343 |
cc |
and,remodeling |
R186 |
T346 |
T347 |
compound |
bud,formation |
R187 |
T347 |
T343 |
conj |
formation,remodeling |
R188 |
T348 |
T322 |
punct |
.,provide |
R189 |
T350 |
T351 |
det |
This,pathway |
R193 |
T355 |
T354 |
advmod |
further,weaves |
R194 |
T356 |
T354 |
prt |
together,weaves |
R195 |
T357 |
T358 |
det |
the,web |
R196 |
T358 |
T354 |
dobj |
web,weaves |
R197 |
T359 |
T358 |
prep |
of,web |
R198 |
T360 |
T361 |
amod |
different,morphogens |
R199 |
T361 |
T359 |
pobj |
morphogens,of |
R200 |
T362 |
T361 |
cc |
and,morphogens |
R201 |
T363 |
T364 |
amod |
downstream,events |
R204 |
T366 |
T367 |
dep |
that,guide |
R205 |
T367 |
T358 |
relcl |
guide,web |
R206 |
T368 |
T369 |
compound |
hair,bud |
R207 |
T369 |
T370 |
compound |
bud,formation |
R208 |
T370 |
T367 |
dobj |
formation,guide |
R209 |
T371 |
T367 |
prep |
within,guide |
R210 |
T372 |
T373 |
det |
the,skin |
R213 |
T375 |
T354 |
punct |
.,weaves |
R1368 |
T2241 |
T2240 |
nmod |
follicle,growth |
R1369 |
T2242 |
T2240 |
amod |
down,growth |
R3692 |
T6120 |
T6119 |
pobj |
MAPK,of |
R3693 |
T6121 |
T6122 |
punct |
[,9 |
R3879 |
T6317 |
T6301 |
auxpass |
be,expected |
R4072 |
T6522 |
T6523 |
det |
the,pathway |
R4081 |
T6530 |
T6533 |
advcl |
provides,known |
R5525 |
T8845 |
T8844 |
punct |
-,mediated |
R5530 |
T8850 |
T8851 |
compound |
E,cadherin |
R5729 |
T9008 |
T8986 |
punct |
.,suggest |
R5730 |
T9010 |
T9011 |
advmod |
Moreover,appears |
R5731 |
T9012 |
T9011 |
punct |
", ",appears |
R5732 |
T9013 |
T9011 |
prep |
through,appears |
R5733 |
T9014 |
T9013 |
pobj |
activation,through |
R5734 |
T9015 |
T9014 |
prep |
of,activation |
R5735 |
T9016 |
T9017 |
compound |
Snail,expression |
R5736 |
T9017 |
T9015 |
pobj |
expression,of |
R5737 |
T9018 |
T9017 |
compound |
gene,expression |
R5738 |
T9019 |
T9011 |
punct |
", ",appears |
R5739 |
T9020 |
T9021 |
compound |
TGF,β2 |
R5740 |
T9021 |
T9011 |
nsubj |
β2,appears |
R5741 |
T9022 |
T9021 |
punct |
-,β2 |
R5742 |
T9023 |
T9024 |
aux |
to,work |
R5743 |
T9024 |
T9011 |
xcomp |
work,appears |
R5744 |
T9025 |
T9024 |
prep |
in,work |
R5745 |
T9026 |
T9025 |
pobj |
tandem,in |
R5746 |
T9027 |
T9026 |
prep |
with,tandem |
R5747 |
T9028 |
T9029 |
det |
these,morphogens |
R5748 |
T9029 |
T9027 |
pobj |
morphogens,with |
R5749 |
T9030 |
T9029 |
amod |
other,morphogens |
R5750 |
T9031 |
T9032 |
aux |
to,regulate |
R5751 |
T9032 |
T9024 |
advcl |
regulate,work |
R5752 |
T9033 |
T9032 |
advmod |
down,regulate |
R5753 |
T9034 |
T9032 |
punct |
-,regulate |
R5754 |
T9035 |
T9036 |
compound |
E,cadherin |
R5755 |
T9036 |
T9038 |
compound |
cadherin,levels |
R5756 |
T9037 |
T9036 |
punct |
-,cadherin |
R5757 |
T9038 |
T9032 |
dobj |
levels,regulate |
R5758 |
T9039 |
T9024 |
punct |
", ",work |
R5759 |
T9040 |
T9041 |
dep |
which,contributes |
R5760 |
T9041 |
T9024 |
advcl |
contributes,work |
R5761 |
T9042 |
T9041 |
prep |
to,contributes |
R5762 |
T9043 |
T9044 |
det |
the,activation |
R5763 |
T9044 |
T9042 |
pobj |
activation,to |
R5764 |
T9045 |
T9044 |
prep |
of,activation |
R5765 |
T9046 |
T9047 |
amod |
proliferative,circuitries |
R5766 |
T9047 |
T9045 |
pobj |
circuitries,of |
R5767 |
T9048 |
T9011 |
punct |
.,appears |