| Id |
Subject |
Object |
Predicate |
Lexical cue |
| T9671 |
42844-42848 |
IN |
denotes |
that |
| T237 |
0-3 |
NN |
denotes |
BMP |
| T238 |
4-12 |
NN |
denotes |
Receptor |
| T239 |
0-83 |
sentence |
denotes |
BMP Receptor Signaling Is Required for Postnatal Maintenance of Articular Cartilage |
| T240 |
13-22 |
NN |
denotes |
Signaling |
| T241 |
26-34 |
VBN |
denotes |
Required |
| T242 |
23-25 |
VBZ |
denotes |
Is |
| T243 |
35-38 |
IN |
denotes |
for |
| T244 |
39-48 |
JJ |
denotes |
Postnatal |
| T245 |
49-60 |
NN |
denotes |
Maintenance |
| T246 |
61-63 |
IN |
denotes |
of |
| T247 |
64-73 |
JJ |
denotes |
Articular |
| T248 |
74-83 |
NN |
denotes |
Cartilage |
| T250 |
128-275 |
sentence |
denotes |
Articular cartilage plays an essential role in health and mobility, but is frequently damaged or lost in millions of people that develop arthritis. |
| T251 |
128-137 |
JJ |
denotes |
Articular |
| T252 |
138-147 |
NN |
denotes |
cartilage |
| T253 |
148-153 |
VBZ |
denotes |
plays |
| T254 |
154-156 |
DT |
denotes |
an |
| T255 |
167-171 |
NN |
denotes |
role |
| T256 |
157-166 |
JJ |
denotes |
essential |
| T257 |
172-174 |
IN |
denotes |
in |
| T258 |
175-181 |
NN |
denotes |
health |
| T259 |
182-185 |
CC |
denotes |
and |
| T260 |
186-194 |
NN |
denotes |
mobility |
| T261 |
194-196 |
, |
denotes |
, |
| T262 |
196-199 |
CC |
denotes |
but |
| T263 |
200-202 |
VBZ |
denotes |
is |
| T264 |
214-221 |
VBN |
denotes |
damaged |
| T265 |
203-213 |
RB |
denotes |
frequently |
| T266 |
222-224 |
CC |
denotes |
or |
| T267 |
225-229 |
VBN |
denotes |
lost |
| T268 |
230-232 |
IN |
denotes |
in |
| T269 |
233-241 |
NNS |
denotes |
millions |
| T270 |
242-244 |
IN |
denotes |
of |
| T271 |
245-251 |
NNS |
denotes |
people |
| T272 |
252-256 |
WDT |
denotes |
that |
| T273 |
257-264 |
VBP |
denotes |
develop |
| T274 |
265-274 |
NN |
denotes |
arthritis |
| T275 |
274-275 |
. |
denotes |
. |
| T276 |
275-532 |
sentence |
denotes |
The molecular mechanisms that create and maintain this thin layer of cartilage that covers the surface of bones in joint regions are poorly understood, in part because tools to manipulate gene expression specifically in this tissue have not been available. |
| T277 |
276-279 |
DT |
denotes |
The |
| T278 |
290-300 |
NNS |
denotes |
mechanisms |
| T279 |
280-289 |
JJ |
denotes |
molecular |
| T280 |
416-426 |
VBN |
denotes |
understood |
| T281 |
301-305 |
WDT |
denotes |
that |
| T282 |
306-312 |
VBP |
denotes |
create |
| T283 |
313-316 |
CC |
denotes |
and |
| T284 |
317-325 |
VBP |
denotes |
maintain |
| T285 |
326-330 |
DT |
denotes |
this |
| T286 |
336-341 |
NN |
denotes |
layer |
| T287 |
331-335 |
JJ |
denotes |
thin |
| T288 |
342-344 |
IN |
denotes |
of |
| T289 |
345-354 |
NN |
denotes |
cartilage |
| T290 |
355-359 |
WDT |
denotes |
that |
| T291 |
360-366 |
VBZ |
denotes |
covers |
| T292 |
367-370 |
DT |
denotes |
the |
| T293 |
371-378 |
NN |
denotes |
surface |
| T294 |
379-381 |
IN |
denotes |
of |
| T295 |
382-387 |
NNS |
denotes |
bones |
| T296 |
388-390 |
IN |
denotes |
in |
| T297 |
391-396 |
NN |
denotes |
joint |
| T298 |
397-404 |
NNS |
denotes |
regions |
| T299 |
405-408 |
VBP |
denotes |
are |
| T300 |
409-415 |
RB |
denotes |
poorly |
| T301 |
426-428 |
, |
denotes |
, |
| T302 |
428-430 |
IN |
denotes |
in |
| T303 |
517-521 |
VBN |
denotes |
been |
| T304 |
431-435 |
JJ |
denotes |
part |
| T305 |
436-443 |
IN |
denotes |
because |
| T306 |
444-449 |
NNS |
denotes |
tools |
| T307 |
450-452 |
TO |
denotes |
to |
| T308 |
453-463 |
VB |
denotes |
manipulate |
| T309 |
464-468 |
NN |
denotes |
gene |
| T310 |
469-479 |
NN |
denotes |
expression |
| T311 |
480-492 |
RB |
denotes |
specifically |
| T312 |
493-495 |
IN |
denotes |
in |
| T313 |
496-500 |
DT |
denotes |
this |
| T314 |
501-507 |
NN |
denotes |
tissue |
| T315 |
508-512 |
VBP |
denotes |
have |
| T316 |
513-516 |
RB |
denotes |
not |
| T317 |
522-531 |
JJ |
denotes |
available |
| T318 |
531-532 |
. |
denotes |
. |
| T319 |
532-761 |
sentence |
denotes |
Here we use regulatory information from the mouse Gdf5 gene (a bone morphogenetic protein [BMP] family member) to develop new mouse lines that can be used to either activate or inactivate genes specifically in developing joints. |
| T320 |
533-537 |
RB |
denotes |
Here |
| T321 |
541-544 |
VBP |
denotes |
use |
| T322 |
538-540 |
PRP |
denotes |
we |
| T323 |
545-555 |
JJ |
denotes |
regulatory |
| T324 |
556-567 |
NN |
denotes |
information |
| T325 |
568-572 |
IN |
denotes |
from |
| T326 |
573-576 |
DT |
denotes |
the |
| T327 |
588-592 |
NN |
denotes |
gene |
| T328 |
577-582 |
NN |
denotes |
mouse |
| T329 |
583-587 |
NN |
denotes |
Gdf5 |
| T330 |
593-594 |
-LRB- |
denotes |
( |
| T331 |
636-642 |
NN |
denotes |
member |
| T332 |
594-595 |
DT |
denotes |
a |
| T333 |
596-600 |
NN |
denotes |
bone |
| T334 |
615-622 |
NN |
denotes |
protein |
| T335 |
601-614 |
JJ |
denotes |
morphogenetic |
| T336 |
623-624 |
-LRB- |
denotes |
[ |
| T337 |
624-627 |
NN |
denotes |
BMP |
| T338 |
627-628 |
-RRB- |
denotes |
] |
| T339 |
629-635 |
NN |
denotes |
family |
| T340 |
642-643 |
-RRB- |
denotes |
) |
| T341 |
644-646 |
TO |
denotes |
to |
| T342 |
647-654 |
VB |
denotes |
develop |
| T343 |
655-658 |
JJ |
denotes |
new |
| T344 |
665-670 |
NNS |
denotes |
lines |
| T345 |
659-664 |
NN |
denotes |
mouse |
| T346 |
671-675 |
WDT |
denotes |
that |
| T347 |
683-687 |
VBN |
denotes |
used |
| T348 |
676-679 |
MD |
denotes |
can |
| T349 |
680-682 |
VB |
denotes |
be |
| T350 |
688-690 |
TO |
denotes |
to |
| T351 |
698-706 |
VB |
denotes |
activate |
| T352 |
691-697 |
CC |
denotes |
either |
| T353 |
707-709 |
CC |
denotes |
or |
| T354 |
710-720 |
VB |
denotes |
inactivate |
| T355 |
721-726 |
NNS |
denotes |
genes |
| T356 |
727-739 |
RB |
denotes |
specifically |
| T357 |
740-742 |
IN |
denotes |
in |
| T358 |
743-753 |
VBG |
denotes |
developing |
| T359 |
754-760 |
NNS |
denotes |
joints |
| T360 |
760-761 |
. |
denotes |
. |
| T361 |
761-1014 |
sentence |
denotes |
Expression of Cre recombinase from Gdf5 bacterial artificial chromosome clones leads to specific activation or inactivation of floxed target genes in developing joints, including early joint interzones, adult articular cartilage, and the joint capsule. |
| T362 |
762-772 |
NN |
denotes |
Expression |
| T363 |
841-846 |
VBZ |
denotes |
leads |
| T364 |
773-775 |
IN |
denotes |
of |
| T365 |
776-779 |
NN |
denotes |
Cre |
| T366 |
780-791 |
NN |
denotes |
recombinase |
| T367 |
792-796 |
IN |
denotes |
from |
| T368 |
797-801 |
NN |
denotes |
Gdf5 |
| T369 |
823-833 |
NN |
denotes |
chromosome |
| T370 |
802-811 |
JJ |
denotes |
bacterial |
| T371 |
812-822 |
JJ |
denotes |
artificial |
| T372 |
834-840 |
NNS |
denotes |
clones |
| T373 |
847-849 |
IN |
denotes |
to |
| T374 |
850-858 |
JJ |
denotes |
specific |
| T375 |
859-869 |
NN |
denotes |
activation |
| T376 |
870-872 |
CC |
denotes |
or |
| T377 |
873-885 |
NN |
denotes |
inactivation |
| T378 |
886-888 |
IN |
denotes |
of |
| T379 |
889-895 |
VBN |
denotes |
floxed |
| T380 |
903-908 |
NNS |
denotes |
genes |
| T381 |
896-902 |
NN |
denotes |
target |
| T382 |
909-911 |
IN |
denotes |
in |
| T383 |
912-922 |
VBG |
denotes |
developing |
| T384 |
923-929 |
NNS |
denotes |
joints |
| T385 |
929-931 |
, |
denotes |
, |
| T386 |
931-940 |
VBG |
denotes |
including |
| T387 |
941-946 |
JJ |
denotes |
early |
| T388 |
953-963 |
NNS |
denotes |
interzones |
| T389 |
947-952 |
NN |
denotes |
joint |
| T390 |
963-965 |
, |
denotes |
, |
| T391 |
965-970 |
NN |
denotes |
adult |
| T392 |
981-990 |
NN |
denotes |
cartilage |
| T393 |
971-980 |
JJ |
denotes |
articular |
| T394 |
990-992 |
, |
denotes |
, |
| T395 |
992-995 |
CC |
denotes |
and |
| T396 |
996-999 |
DT |
denotes |
the |
| T397 |
1006-1013 |
NN |
denotes |
capsule |
| T398 |
1000-1005 |
NN |
denotes |
joint |
| T399 |
1013-1014 |
. |
denotes |
. |
| T400 |
1014-1104 |
sentence |
denotes |
We have used this system to test the role of BMP receptor signaling in joint development. |
| T401 |
1015-1017 |
PRP |
denotes |
We |
| T402 |
1023-1027 |
VBN |
denotes |
used |
| T403 |
1018-1022 |
VBP |
denotes |
have |
| T404 |
1028-1032 |
DT |
denotes |
this |
| T405 |
1033-1039 |
NN |
denotes |
system |
| T406 |
1040-1042 |
TO |
denotes |
to |
| T407 |
1043-1047 |
VB |
denotes |
test |
| T408 |
1048-1051 |
DT |
denotes |
the |
| T409 |
1052-1056 |
NN |
denotes |
role |
| T410 |
1057-1059 |
IN |
denotes |
of |
| T411 |
1060-1063 |
NN |
denotes |
BMP |
| T412 |
1073-1082 |
NN |
denotes |
signaling |
| T413 |
1064-1072 |
NN |
denotes |
receptor |
| T414 |
1083-1085 |
IN |
denotes |
in |
| T415 |
1086-1091 |
NN |
denotes |
joint |
| T416 |
1092-1103 |
NN |
denotes |
development |
| T417 |
1103-1104 |
. |
denotes |
. |
| T418 |
1104-1202 |
sentence |
denotes |
Mice with null mutations in Bmpr1a are known to die early in embryogenesis with multiple defects. |
| T419 |
1105-1109 |
NNS |
denotes |
Mice |
| T420 |
1144-1149 |
VBN |
denotes |
known |
| T421 |
1110-1114 |
IN |
denotes |
with |
| T422 |
1115-1119 |
JJ |
denotes |
null |
| T423 |
1120-1129 |
NNS |
denotes |
mutations |
| T424 |
1130-1132 |
IN |
denotes |
in |
| T425 |
1133-1139 |
NN |
denotes |
Bmpr1a |
| T426 |
1140-1143 |
VBP |
denotes |
are |
| T427 |
1150-1152 |
TO |
denotes |
to |
| T428 |
1153-1156 |
VB |
denotes |
die |
| T429 |
1157-1162 |
RB |
denotes |
early |
| T430 |
1163-1165 |
IN |
denotes |
in |
| T431 |
1166-1179 |
NN |
denotes |
embryogenesis |
| T432 |
1180-1184 |
IN |
denotes |
with |
| T433 |
1185-1193 |
JJ |
denotes |
multiple |
| T434 |
1194-1201 |
NNS |
denotes |
defects |
| T435 |
1201-1202 |
. |
denotes |
. |
| T436 |
1202-1403 |
sentence |
denotes |
However, combining a floxed Bmpr1a allele with the Gdf5-Cre driver bypasses this embryonic lethality, and leads to birth and postnatal development of mice missing the Bmpr1a gene in articular regions. |
| T437 |
1203-1210 |
RB |
denotes |
However |
| T438 |
1270-1278 |
VBZ |
denotes |
bypasses |
| T439 |
1210-1212 |
, |
denotes |
, |
| T440 |
1212-1221 |
VBG |
denotes |
combining |
| T441 |
1222-1223 |
DT |
denotes |
a |
| T442 |
1238-1244 |
NN |
denotes |
allele |
| T443 |
1224-1230 |
VBN |
denotes |
floxed |
| T444 |
1231-1237 |
NN |
denotes |
Bmpr1a |
| T445 |
1245-1249 |
IN |
denotes |
with |
| T446 |
1250-1253 |
DT |
denotes |
the |
| T447 |
1263-1269 |
NN |
denotes |
driver |
| T448 |
1254-1258 |
NN |
denotes |
Gdf5 |
| T449 |
1259-1262 |
NN |
denotes |
Cre |
| T450 |
1258-1259 |
HYPH |
denotes |
- |
| T451 |
1279-1283 |
DT |
denotes |
this |
| T452 |
1294-1303 |
NN |
denotes |
lethality |
| T453 |
1284-1293 |
JJ |
denotes |
embryonic |
| T454 |
1303-1305 |
, |
denotes |
, |
| T455 |
1305-1308 |
CC |
denotes |
and |
| T456 |
1309-1314 |
VBZ |
denotes |
leads |
| T457 |
1315-1317 |
IN |
denotes |
to |
| T458 |
1318-1323 |
NN |
denotes |
birth |
| T459 |
1324-1327 |
CC |
denotes |
and |
| T460 |
1328-1337 |
JJ |
denotes |
postnatal |
| T461 |
1338-1349 |
NN |
denotes |
development |
| T462 |
1350-1352 |
IN |
denotes |
of |
| T463 |
1353-1357 |
NNS |
denotes |
mice |
| T464 |
1358-1365 |
VBG |
denotes |
missing |
| T465 |
1366-1369 |
DT |
denotes |
the |
| T466 |
1377-1381 |
NN |
denotes |
gene |
| T467 |
1370-1376 |
NN |
denotes |
Bmpr1a |
| T468 |
1382-1384 |
IN |
denotes |
in |
| T469 |
1385-1394 |
JJ |
denotes |
articular |
| T470 |
1395-1402 |
NNS |
denotes |
regions |
| T471 |
1402-1403 |
. |
denotes |
. |
| T472 |
1403-1485 |
sentence |
denotes |
Most joints in the body form normally in the absence of Bmpr1a receptor function. |
| T473 |
1404-1408 |
JJS |
denotes |
Most |
| T474 |
1409-1415 |
NNS |
denotes |
joints |
| T475 |
1428-1432 |
VBP |
denotes |
form |
| T476 |
1416-1418 |
IN |
denotes |
in |
| T477 |
1419-1422 |
DT |
denotes |
the |
| T478 |
1423-1427 |
NN |
denotes |
body |
| T479 |
1433-1441 |
RB |
denotes |
normally |
| T480 |
1442-1444 |
IN |
denotes |
in |
| T481 |
1445-1448 |
DT |
denotes |
the |
| T482 |
1449-1456 |
NN |
denotes |
absence |
| T483 |
1457-1459 |
IN |
denotes |
of |
| T484 |
1460-1466 |
NN |
denotes |
Bmpr1a |
| T485 |
1467-1475 |
NN |
denotes |
receptor |
| T486 |
1476-1484 |
NN |
denotes |
function |
| T487 |
1484-1485 |
. |
denotes |
. |
| T488 |
1485-1638 |
sentence |
denotes |
However, articular cartilage within the joints gradually wears away in receptor-deficient mice after birth in a process resembling human osteoarthritis. |
| T489 |
1486-1493 |
RB |
denotes |
However |
| T490 |
1543-1548 |
VBZ |
denotes |
wears |
| T491 |
1493-1495 |
, |
denotes |
, |
| T492 |
1495-1504 |
JJ |
denotes |
articular |
| T493 |
1505-1514 |
NN |
denotes |
cartilage |
| T494 |
1515-1521 |
IN |
denotes |
within |
| T495 |
1522-1525 |
DT |
denotes |
the |
| T496 |
1526-1532 |
NNS |
denotes |
joints |
| T497 |
1533-1542 |
RB |
denotes |
gradually |
| T498 |
1549-1553 |
RP |
denotes |
away |
| T499 |
1554-1556 |
IN |
denotes |
in |
| T500 |
1557-1565 |
NN |
denotes |
receptor |
| T501 |
1576-1580 |
NNS |
denotes |
mice |
| T502 |
1565-1566 |
HYPH |
denotes |
- |
| T503 |
1566-1575 |
JJ |
denotes |
deficient |
| T504 |
1581-1586 |
IN |
denotes |
after |
| T505 |
1587-1592 |
NN |
denotes |
birth |
| T506 |
1593-1595 |
IN |
denotes |
in |
| T507 |
1596-1597 |
DT |
denotes |
a |
| T508 |
1598-1605 |
NN |
denotes |
process |
| T509 |
1606-1616 |
VBG |
denotes |
resembling |
| T510 |
1617-1622 |
JJ |
denotes |
human |
| T511 |
1623-1637 |
NN |
denotes |
osteoarthritis |
| T512 |
1637-1638 |
. |
denotes |
. |
| T513 |
1638-1742 |
sentence |
denotes |
Gdf5-Cre mice provide a general system that can be used to test the role of genes in articular regions. |
| T514 |
1639-1643 |
NN |
denotes |
Gdf5 |
| T515 |
1644-1647 |
NN |
denotes |
Cre |
| T516 |
1643-1644 |
HYPH |
denotes |
- |
| T517 |
1648-1652 |
NNS |
denotes |
mice |
| T518 |
1653-1660 |
VBP |
denotes |
provide |
| T519 |
1661-1662 |
DT |
denotes |
a |
| T520 |
1671-1677 |
NN |
denotes |
system |
| T521 |
1663-1670 |
JJ |
denotes |
general |
| T522 |
1678-1682 |
WDT |
denotes |
that |
| T523 |
1690-1694 |
VBN |
denotes |
used |
| T524 |
1683-1686 |
MD |
denotes |
can |
| T525 |
1687-1689 |
VB |
denotes |
be |
| T526 |
1695-1697 |
TO |
denotes |
to |
| T527 |
1698-1702 |
VB |
denotes |
test |
| T528 |
1703-1706 |
DT |
denotes |
the |
| T529 |
1707-1711 |
NN |
denotes |
role |
| T530 |
1712-1714 |
IN |
denotes |
of |
| T531 |
1715-1720 |
NNS |
denotes |
genes |
| T532 |
1721-1723 |
IN |
denotes |
in |
| T533 |
1724-1733 |
JJ |
denotes |
articular |
| T534 |
1734-1741 |
NNS |
denotes |
regions |
| T535 |
1741-1742 |
. |
denotes |
. |
| T536 |
1742-1911 |
sentence |
denotes |
BMP receptor signaling is required not only for early development and creation of multiple tissues, but also for ongoing maintenance of articular cartilage after birth. |
| T537 |
1743-1746 |
NN |
denotes |
BMP |
| T538 |
1747-1755 |
NN |
denotes |
receptor |
| T539 |
1756-1765 |
NN |
denotes |
signaling |
| T540 |
1769-1777 |
VBN |
denotes |
required |
| T541 |
1766-1768 |
VBZ |
denotes |
is |
| T542 |
1778-1781 |
RB |
denotes |
not |
| T543 |
1787-1790 |
IN |
denotes |
for |
| T544 |
1782-1786 |
RB |
denotes |
only |
| T545 |
1791-1796 |
JJ |
denotes |
early |
| T546 |
1797-1808 |
NN |
denotes |
development |
| T547 |
1809-1812 |
CC |
denotes |
and |
| T548 |
1813-1821 |
NN |
denotes |
creation |
| T549 |
1822-1824 |
IN |
denotes |
of |
| T550 |
1825-1833 |
JJ |
denotes |
multiple |
| T551 |
1834-1841 |
NNS |
denotes |
tissues |
| T552 |
1841-1843 |
, |
denotes |
, |
| T553 |
1843-1846 |
CC |
denotes |
but |
| T554 |
1847-1851 |
RB |
denotes |
also |
| T555 |
1852-1855 |
IN |
denotes |
for |
| T556 |
1856-1863 |
JJ |
denotes |
ongoing |
| T557 |
1864-1875 |
NN |
denotes |
maintenance |
| T558 |
1876-1878 |
IN |
denotes |
of |
| T559 |
1879-1888 |
JJ |
denotes |
articular |
| T560 |
1889-1898 |
NN |
denotes |
cartilage |
| T561 |
1899-1904 |
IN |
denotes |
after |
| T562 |
1905-1910 |
NN |
denotes |
birth |
| T563 |
1910-1911 |
. |
denotes |
. |
| T564 |
1911-2191 |
sentence |
denotes |
Genetic variation in the strength of BMP receptor signaling may be an important risk factor in human osteoarthritis, and treatments that mimic or augment BMP receptor signaling should be investigated as a possible therapeutic strategy for maintaining the health of joint linings. |
| T565 |
1912-1919 |
JJ |
denotes |
Genetic |
| T566 |
1920-1929 |
NN |
denotes |
variation |
| T567 |
1976-1978 |
VB |
denotes |
be |
| T568 |
1930-1932 |
IN |
denotes |
in |
| T569 |
1933-1936 |
DT |
denotes |
the |
| T570 |
1937-1945 |
NN |
denotes |
strength |
| T571 |
1946-1948 |
IN |
denotes |
of |
| T572 |
1949-1952 |
NN |
denotes |
BMP |
| T573 |
1953-1961 |
NN |
denotes |
receptor |
| T574 |
1962-1971 |
NN |
denotes |
signaling |
| T575 |
1972-1975 |
MD |
denotes |
may |
| T576 |
1979-1981 |
DT |
denotes |
an |
| T577 |
1997-2003 |
NN |
denotes |
factor |
| T578 |
1982-1991 |
JJ |
denotes |
important |
| T579 |
1992-1996 |
NN |
denotes |
risk |
| T580 |
2004-2006 |
IN |
denotes |
in |
| T581 |
2007-2012 |
JJ |
denotes |
human |
| T582 |
2013-2027 |
NN |
denotes |
osteoarthritis |
| T583 |
2027-2029 |
, |
denotes |
, |
| T584 |
2029-2032 |
CC |
denotes |
and |
| T585 |
2033-2043 |
NNS |
denotes |
treatments |
| T586 |
2099-2111 |
VBN |
denotes |
investigated |
| T587 |
2044-2048 |
WDT |
denotes |
that |
| T588 |
2049-2054 |
VBP |
denotes |
mimic |
| T589 |
2055-2057 |
CC |
denotes |
or |
| T590 |
2058-2065 |
VBP |
denotes |
augment |
| T591 |
2066-2069 |
NN |
denotes |
BMP |
| T592 |
2070-2078 |
NN |
denotes |
receptor |
| T593 |
2079-2088 |
NN |
denotes |
signaling |
| T594 |
2089-2095 |
MD |
denotes |
should |
| T595 |
2096-2098 |
VB |
denotes |
be |
| T596 |
2112-2114 |
IN |
denotes |
as |
| T597 |
2115-2116 |
DT |
denotes |
a |
| T598 |
2138-2146 |
NN |
denotes |
strategy |
| T599 |
2117-2125 |
JJ |
denotes |
possible |
| T600 |
2126-2137 |
JJ |
denotes |
therapeutic |
| T601 |
2147-2150 |
IN |
denotes |
for |
| T602 |
2151-2162 |
VBG |
denotes |
maintaining |
| T603 |
2163-2166 |
DT |
denotes |
the |
| T604 |
2167-2173 |
NN |
denotes |
health |
| T605 |
2174-2176 |
IN |
denotes |
of |
| T606 |
2177-2182 |
NN |
denotes |
joint |
| T607 |
2183-2190 |
NNS |
denotes |
linings |
| T608 |
2190-2191 |
. |
denotes |
. |
| T1083 |
2378-2382 |
JJ |
denotes |
Thin |
| T1084 |
2383-2389 |
NNS |
denotes |
layers |
| T1085 |
2413-2417 |
VBP |
denotes |
line |
| T1086 |
2390-2392 |
IN |
denotes |
of |
| T1087 |
2393-2402 |
JJ |
denotes |
articular |
| T1088 |
2403-2412 |
NN |
denotes |
cartilage |
| T1089 |
2418-2421 |
DT |
denotes |
the |
| T1090 |
2422-2427 |
NNS |
denotes |
bones |
| T1091 |
2428-2430 |
IN |
denotes |
of |
| T1092 |
2431-2439 |
JJ |
denotes |
synovial |
| T1093 |
2440-2446 |
NNS |
denotes |
joints |
| T1094 |
2447-2450 |
CC |
denotes |
and |
| T1095 |
2451-2458 |
VBP |
denotes |
provide |
| T1096 |
2459-2460 |
DT |
denotes |
a |
| T1097 |
2484-2493 |
NN |
denotes |
structure |
| T1098 |
2461-2467 |
JJ |
denotes |
smooth |
| T1099 |
2467-2469 |
, |
denotes |
, |
| T1100 |
2469-2473 |
NN |
denotes |
wear |
| T1101 |
2474-2483 |
JJ |
denotes |
resistant |
| T1102 |
2473-2474 |
HYPH |
denotes |
- |
| T1103 |
2494-2498 |
WDT |
denotes |
that |
| T1104 |
2499-2506 |
VBZ |
denotes |
reduces |
| T1105 |
2507-2515 |
NN |
denotes |
friction |
| T1106 |
2516-2519 |
CC |
denotes |
and |
| T1107 |
2520-2527 |
VBZ |
denotes |
absorbs |
| T1108 |
2528-2534 |
NN |
denotes |
impact |
| T1109 |
2535-2541 |
NNS |
denotes |
forces |
| T1110 |
2542-2543 |
-LRB- |
denotes |
( |
| T1111 |
2543-2549 |
NNP |
denotes |
Brandt |
| T1112 |
2550-2552 |
FW |
denotes |
et |
| T1113 |
2553-2556 |
FW |
denotes |
al. |
| T1114 |
2557-2561 |
CD |
denotes |
1998 |
| T1115 |
2561-2562 |
-RRB- |
denotes |
) |
| T1116 |
2562-2563 |
. |
denotes |
. |
| T1117 |
2563-2725 |
sentence |
denotes |
Loss or damage to articular cartilage is a hallmark of arthritic diseases and is one of the most common reasons that both young and old adults seek medical care. |
| T1118 |
2564-2568 |
NN |
denotes |
Loss |
| T1119 |
2602-2604 |
VBZ |
denotes |
is |
| T1120 |
2569-2571 |
CC |
denotes |
or |
| T1121 |
2572-2578 |
NN |
denotes |
damage |
| T1122 |
2579-2581 |
IN |
denotes |
to |
| T1123 |
2582-2591 |
JJ |
denotes |
articular |
| T1124 |
2592-2601 |
NN |
denotes |
cartilage |
| T1125 |
2605-2606 |
DT |
denotes |
a |
| T1126 |
2607-2615 |
NN |
denotes |
hallmark |
| T1127 |
2616-2618 |
IN |
denotes |
of |
| T1128 |
2619-2628 |
JJ |
denotes |
arthritic |
| T1129 |
2629-2637 |
NNS |
denotes |
diseases |
| T1130 |
2638-2641 |
CC |
denotes |
and |
| T1131 |
2642-2644 |
VBZ |
denotes |
is |
| T1132 |
2645-2648 |
CD |
denotes |
one |
| T1133 |
2649-2651 |
IN |
denotes |
of |
| T1134 |
2652-2655 |
DT |
denotes |
the |
| T1135 |
2668-2675 |
NNS |
denotes |
reasons |
| T1136 |
2656-2660 |
RBS |
denotes |
most |
| T1137 |
2661-2667 |
JJ |
denotes |
common |
| T1138 |
2676-2680 |
IN |
denotes |
that |
| T1139 |
2707-2711 |
VBP |
denotes |
seek |
| T1140 |
2681-2685 |
CC |
denotes |
both |
| T1141 |
2686-2691 |
JJ |
denotes |
young |
| T1142 |
2700-2706 |
NNS |
denotes |
adults |
| T1143 |
2692-2695 |
CC |
denotes |
and |
| T1144 |
2696-2699 |
JJ |
denotes |
old |
| T1145 |
2712-2719 |
JJ |
denotes |
medical |
| T1146 |
2720-2724 |
NN |
denotes |
care |
| T1147 |
2724-2725 |
. |
denotes |
. |
| T1148 |
2725-2884 |
sentence |
denotes |
Millions of people are afflicted with arthritis, and it ultimately affects more than half of people over the age of 65 (Badley 1995; Yelin and Callahan 1995). |
| T1149 |
2726-2734 |
NNS |
denotes |
Millions |
| T1150 |
2745-2748 |
VBP |
denotes |
are |
| T1151 |
2735-2737 |
IN |
denotes |
of |
| T1152 |
2738-2744 |
NNS |
denotes |
people |
| T1153 |
2749-2758 |
JJ |
denotes |
afflicted |
| T1154 |
2759-2763 |
IN |
denotes |
with |
| T1155 |
2764-2773 |
NN |
denotes |
arthritis |
| T1156 |
2773-2775 |
, |
denotes |
, |
| T1157 |
2775-2778 |
CC |
denotes |
and |
| T1158 |
2779-2781 |
PRP |
denotes |
it |
| T1159 |
2793-2800 |
VBZ |
denotes |
affects |
| T1160 |
2782-2792 |
RB |
denotes |
ultimately |
| T1161 |
2801-2805 |
JJR |
denotes |
more |
| T1162 |
2811-2815 |
NN |
denotes |
half |
| T1163 |
2806-2810 |
IN |
denotes |
than |
| T1164 |
2816-2818 |
IN |
denotes |
of |
| T1165 |
2819-2825 |
NNS |
denotes |
people |
| T1166 |
2826-2830 |
IN |
denotes |
over |
| T1167 |
2831-2834 |
DT |
denotes |
the |
| T1168 |
2835-2838 |
NN |
denotes |
age |
| T1169 |
2839-2841 |
IN |
denotes |
of |
| T1170 |
2842-2844 |
CD |
denotes |
65 |
| T1171 |
2845-2846 |
-LRB- |
denotes |
( |
| T1172 |
2846-2852 |
NNP |
denotes |
Badley |
| T1173 |
2853-2857 |
CD |
denotes |
1995 |
| T1174 |
2857-2858 |
: |
denotes |
; |
| T1175 |
2859-2864 |
NNP |
denotes |
Yelin |
| T1176 |
2865-2868 |
CC |
denotes |
and |
| T1177 |
2869-2877 |
NNP |
denotes |
Callahan |
| T1178 |
2878-2882 |
CD |
denotes |
1995 |
| T1179 |
2882-2883 |
-RRB- |
denotes |
) |
| T1180 |
2883-2884 |
. |
denotes |
. |
| T1181 |
2884-3078 |
sentence |
denotes |
A better understanding of the molecular mechanisms that create and maintain articular cartilage is crucial for discovering the causes of joint disorders and providing useful medical treatments. |
| T1182 |
2885-2886 |
DT |
denotes |
A |
| T1183 |
2894-2907 |
NN |
denotes |
understanding |
| T1184 |
2887-2893 |
JJR |
denotes |
better |
| T1185 |
2981-2983 |
VBZ |
denotes |
is |
| T1186 |
2908-2910 |
IN |
denotes |
of |
| T1187 |
2911-2914 |
DT |
denotes |
the |
| T1188 |
2925-2935 |
NNS |
denotes |
mechanisms |
| T1189 |
2915-2924 |
JJ |
denotes |
molecular |
| T1190 |
2936-2940 |
WDT |
denotes |
that |
| T1191 |
2941-2947 |
VBP |
denotes |
create |
| T1192 |
2948-2951 |
CC |
denotes |
and |
| T1193 |
2952-2960 |
VBP |
denotes |
maintain |
| T1194 |
2961-2970 |
JJ |
denotes |
articular |
| T1195 |
2971-2980 |
NN |
denotes |
cartilage |
| T1196 |
2984-2991 |
JJ |
denotes |
crucial |
| T1197 |
2992-2995 |
IN |
denotes |
for |
| T1198 |
2996-3007 |
VBG |
denotes |
discovering |
| T1199 |
3008-3011 |
DT |
denotes |
the |
| T1200 |
3012-3018 |
NNS |
denotes |
causes |
| T1201 |
3019-3021 |
IN |
denotes |
of |
| T1202 |
3022-3027 |
NN |
denotes |
joint |
| T1203 |
3028-3037 |
NNS |
denotes |
disorders |
| T1204 |
3038-3041 |
CC |
denotes |
and |
| T1205 |
3042-3051 |
VBG |
denotes |
providing |
| T1206 |
3052-3058 |
JJ |
denotes |
useful |
| T1207 |
3067-3077 |
NNS |
denotes |
treatments |
| T1208 |
3059-3066 |
JJ |
denotes |
medical |
| T1209 |
3077-3078 |
. |
denotes |
. |
| T1210 |
3078-3233 |
sentence |
denotes |
Joint formation begins during embryogenesis, when stripes of high cell density called interzones form across developing skeletal precursors (Haines 1947). |
| T1211 |
3079-3084 |
NN |
denotes |
Joint |
| T1212 |
3085-3094 |
NN |
denotes |
formation |
| T1213 |
3095-3101 |
VBZ |
denotes |
begins |
| T1214 |
3102-3108 |
IN |
denotes |
during |
| T1215 |
3109-3122 |
NN |
denotes |
embryogenesis |
| T1216 |
3122-3124 |
, |
denotes |
, |
| T1217 |
3124-3128 |
WRB |
denotes |
when |
| T1218 |
3176-3180 |
VBP |
denotes |
form |
| T1219 |
3129-3136 |
NNS |
denotes |
stripes |
| T1220 |
3137-3139 |
IN |
denotes |
of |
| T1221 |
3140-3144 |
JJ |
denotes |
high |
| T1222 |
3150-3157 |
NN |
denotes |
density |
| T1223 |
3145-3149 |
NN |
denotes |
cell |
| T1224 |
3158-3164 |
VBN |
denotes |
called |
| T1225 |
3165-3175 |
NNS |
denotes |
interzones |
| T1226 |
3181-3187 |
IN |
denotes |
across |
| T1227 |
3188-3198 |
VBG |
denotes |
developing |
| T1228 |
3208-3218 |
NNS |
denotes |
precursors |
| T1229 |
3199-3207 |
JJ |
denotes |
skeletal |
| T1230 |
3219-3220 |
-LRB- |
denotes |
( |
| T1231 |
3220-3226 |
NNP |
denotes |
Haines |
| T1232 |
3227-3231 |
CD |
denotes |
1947 |
| T1233 |
3231-3232 |
-RRB- |
denotes |
) |
| T1234 |
3232-3233 |
. |
denotes |
. |
| T1235 |
3233-3404 |
sentence |
denotes |
Programmed cell death occurs within the interzone, and a three-layered interzone forms that has two layers of higher cell density flanking a region of lower cell density. |
| T1236 |
3234-3244 |
VBN |
denotes |
Programmed |
| T1237 |
3250-3255 |
NN |
denotes |
death |
| T1238 |
3245-3249 |
NN |
denotes |
cell |
| T1239 |
3256-3262 |
VBZ |
denotes |
occurs |
| T1240 |
3263-3269 |
IN |
denotes |
within |
| T1241 |
3270-3273 |
DT |
denotes |
the |
| T1242 |
3274-3283 |
NN |
denotes |
interzone |
| T1243 |
3283-3285 |
, |
denotes |
, |
| T1244 |
3285-3288 |
CC |
denotes |
and |
| T1245 |
3289-3290 |
DT |
denotes |
a |
| T1246 |
3305-3314 |
NN |
denotes |
interzone |
| T1247 |
3291-3296 |
CD |
denotes |
three |
| T1248 |
3297-3304 |
VBN |
denotes |
layered |
| T1249 |
3296-3297 |
HYPH |
denotes |
- |
| T1250 |
3315-3320 |
VBZ |
denotes |
forms |
| T1251 |
3321-3325 |
WDT |
denotes |
that |
| T1252 |
3326-3329 |
VBZ |
denotes |
has |
| T1253 |
3330-3333 |
CD |
denotes |
two |
| T1254 |
3334-3340 |
NNS |
denotes |
layers |
| T1255 |
3341-3343 |
IN |
denotes |
of |
| T1256 |
3344-3350 |
JJR |
denotes |
higher |
| T1257 |
3356-3363 |
NN |
denotes |
density |
| T1258 |
3351-3355 |
NN |
denotes |
cell |
| T1259 |
3364-3372 |
VBG |
denotes |
flanking |
| T1260 |
3373-3374 |
DT |
denotes |
a |
| T1261 |
3375-3381 |
NN |
denotes |
region |
| T1262 |
3382-3384 |
IN |
denotes |
of |
| T1263 |
3385-3390 |
JJR |
denotes |
lower |
| T1264 |
3396-3403 |
NN |
denotes |
density |
| T1265 |
3391-3395 |
NN |
denotes |
cell |
| T1266 |
3403-3404 |
. |
denotes |
. |
| T1267 |
3404-3520 |
sentence |
denotes |
Non-joint precursors of the skeleton typically develop into cartilage, which hypertrophies and is replaced by bone. |
| T1268 |
3405-3414 |
NN |
denotes |
Non-joint |
| T1269 |
3415-3425 |
NNS |
denotes |
precursors |
| T1270 |
3452-3459 |
VBP |
denotes |
develop |
| T1271 |
3426-3428 |
IN |
denotes |
of |
| T1272 |
3429-3432 |
DT |
denotes |
the |
| T1273 |
3433-3441 |
NN |
denotes |
skeleton |
| T1274 |
3442-3451 |
RB |
denotes |
typically |
| T1275 |
3460-3464 |
IN |
denotes |
into |
| T1276 |
3465-3474 |
NN |
denotes |
cartilage |
| T1277 |
3474-3476 |
, |
denotes |
, |
| T1278 |
3476-3481 |
WDT |
denotes |
which |
| T1279 |
3482-3495 |
VBZ |
denotes |
hypertrophies |
| T1280 |
3496-3499 |
CC |
denotes |
and |
| T1281 |
3500-3502 |
VBZ |
denotes |
is |
| T1282 |
3503-3511 |
VBN |
denotes |
replaced |
| T1283 |
3512-3514 |
IN |
denotes |
by |
| T1284 |
3515-3519 |
NN |
denotes |
bone |
| T1285 |
3519-3520 |
. |
denotes |
. |
| T1286 |
3520-3718 |
sentence |
denotes |
However, cells within the high-density layers of the interzone are excluded from this process and develop into the permanent layers of articular cartilage found in the mature joint (Mitrovic 1978). |
| T1287 |
3521-3528 |
RB |
denotes |
However |
| T1288 |
3588-3596 |
VBN |
denotes |
excluded |
| T1289 |
3528-3530 |
, |
denotes |
, |
| T1290 |
3530-3535 |
NNS |
denotes |
cells |
| T1291 |
3536-3542 |
IN |
denotes |
within |
| T1292 |
3543-3546 |
DT |
denotes |
the |
| T1293 |
3560-3566 |
NNS |
denotes |
layers |
| T1294 |
3547-3551 |
JJ |
denotes |
high |
| T1295 |
3552-3559 |
NN |
denotes |
density |
| T1296 |
3551-3552 |
HYPH |
denotes |
- |
| T1297 |
3567-3569 |
IN |
denotes |
of |
| T1298 |
3570-3573 |
DT |
denotes |
the |
| T1299 |
3574-3583 |
NN |
denotes |
interzone |
| T1300 |
3584-3587 |
VBP |
denotes |
are |
| T1301 |
3597-3601 |
IN |
denotes |
from |
| T1302 |
3602-3606 |
DT |
denotes |
this |
| T1303 |
3607-3614 |
NN |
denotes |
process |
| T1304 |
3615-3618 |
CC |
denotes |
and |
| T1305 |
3619-3626 |
VBP |
denotes |
develop |
| T1306 |
3627-3631 |
IN |
denotes |
into |
| T1307 |
3632-3635 |
DT |
denotes |
the |
| T1308 |
3646-3652 |
NNS |
denotes |
layers |
| T1309 |
3636-3645 |
JJ |
denotes |
permanent |
| T1310 |
3653-3655 |
IN |
denotes |
of |
| T1311 |
3656-3665 |
JJ |
denotes |
articular |
| T1312 |
3666-3675 |
NN |
denotes |
cartilage |
| T1313 |
3676-3681 |
VBN |
denotes |
found |
| T1314 |
3682-3684 |
IN |
denotes |
in |
| T1315 |
3685-3688 |
DT |
denotes |
the |
| T1316 |
3696-3701 |
NN |
denotes |
joint |
| T1317 |
3689-3695 |
JJ |
denotes |
mature |
| T1318 |
3702-3703 |
-LRB- |
denotes |
( |
| T1319 |
3703-3711 |
NNP |
denotes |
Mitrovic |
| T1320 |
3712-3716 |
CD |
denotes |
1978 |
| T1321 |
3716-3717 |
-RRB- |
denotes |
) |
| T1322 |
3717-3718 |
. |
denotes |
. |
| T1323 |
3718-3856 |
sentence |
denotes |
Studies over the last 10 y have begun to elucidate some of the signaling pathways that contribute to the early stages of joint formation. |
| T1324 |
3719-3726 |
NNS |
denotes |
Studies |
| T1325 |
3751-3756 |
VBN |
denotes |
begun |
| T1326 |
3727-3731 |
IN |
denotes |
over |
| T1327 |
3732-3735 |
DT |
denotes |
the |
| T1328 |
3744-3745 |
NN |
denotes |
y |
| T1329 |
3736-3740 |
JJ |
denotes |
last |
| T1330 |
3741-3743 |
CD |
denotes |
10 |
| T1331 |
3746-3750 |
VBP |
denotes |
have |
| T1332 |
3757-3759 |
TO |
denotes |
to |
| T1333 |
3760-3769 |
VB |
denotes |
elucidate |
| T1334 |
3770-3774 |
DT |
denotes |
some |
| T1335 |
3775-3777 |
IN |
denotes |
of |
| T1336 |
3778-3781 |
DT |
denotes |
the |
| T1337 |
3792-3800 |
NNS |
denotes |
pathways |
| T1338 |
3782-3791 |
NN |
denotes |
signaling |
| T1339 |
3801-3805 |
WDT |
denotes |
that |
| T1340 |
3806-3816 |
VBP |
denotes |
contribute |
| T1341 |
3817-3819 |
IN |
denotes |
to |
| T1342 |
3820-3823 |
DT |
denotes |
the |
| T1343 |
3830-3836 |
NNS |
denotes |
stages |
| T1344 |
3824-3829 |
JJ |
denotes |
early |
| T1345 |
3837-3839 |
IN |
denotes |
of |
| T1346 |
3840-3845 |
NN |
denotes |
joint |
| T1347 |
3846-3855 |
NN |
denotes |
formation |
| T1348 |
3855-3856 |
. |
denotes |
. |
| T1349 |
3856-4061 |
sentence |
denotes |
Wnt14 is expressed in stripes at the sites where joints will form, and it is capable of inducing expression of other joint markers when misexpressed at new locations in the limb (Hartmann and Tabin 2001). |
| T1350 |
3857-3862 |
NN |
denotes |
Wnt14 |
| T1351 |
3866-3875 |
VBN |
denotes |
expressed |
| T1352 |
3863-3865 |
VBZ |
denotes |
is |
| T1353 |
3876-3878 |
IN |
denotes |
in |
| T1354 |
3879-3886 |
NNS |
denotes |
stripes |
| T1355 |
3887-3889 |
IN |
denotes |
at |
| T1356 |
3890-3893 |
DT |
denotes |
the |
| T1357 |
3894-3899 |
NNS |
denotes |
sites |
| T1358 |
3900-3905 |
WRB |
denotes |
where |
| T1359 |
3918-3922 |
VB |
denotes |
form |
| T1360 |
3906-3912 |
NNS |
denotes |
joints |
| T1361 |
3913-3917 |
MD |
denotes |
will |
| T1362 |
3922-3924 |
, |
denotes |
, |
| T1363 |
3924-3927 |
CC |
denotes |
and |
| T1364 |
3928-3930 |
PRP |
denotes |
it |
| T1365 |
3931-3933 |
VBZ |
denotes |
is |
| T1366 |
3934-3941 |
JJ |
denotes |
capable |
| T1367 |
3942-3944 |
IN |
denotes |
of |
| T1368 |
3945-3953 |
VBG |
denotes |
inducing |
| T1369 |
3954-3964 |
NN |
denotes |
expression |
| T1370 |
3965-3967 |
IN |
denotes |
of |
| T1371 |
3968-3973 |
JJ |
denotes |
other |
| T1372 |
3980-3987 |
NNS |
denotes |
markers |
| T1373 |
3974-3979 |
NN |
denotes |
joint |
| T1374 |
3988-3992 |
WRB |
denotes |
when |
| T1375 |
3993-4005 |
VBN |
denotes |
misexpressed |
| T1376 |
4006-4008 |
IN |
denotes |
at |
| T1377 |
4009-4012 |
JJ |
denotes |
new |
| T1378 |
4013-4022 |
NNS |
denotes |
locations |
| T1379 |
4023-4025 |
IN |
denotes |
in |
| T1380 |
4026-4029 |
DT |
denotes |
the |
| T1381 |
4030-4034 |
NN |
denotes |
limb |
| T1382 |
4035-4036 |
-LRB- |
denotes |
( |
| T1383 |
4036-4044 |
NNP |
denotes |
Hartmann |
| T1384 |
4045-4048 |
CC |
denotes |
and |
| T1385 |
4049-4054 |
NNP |
denotes |
Tabin |
| T1386 |
4055-4059 |
CD |
denotes |
2001 |
| T1387 |
4059-4060 |
-RRB- |
denotes |
) |
| T1388 |
4060-4061 |
. |
denotes |
. |
| T1389 |
4061-4383 |
sentence |
denotes |
Several members of the bone morphogenetic protein (BMP) family of secreted signaling molecules are also expressed in stripes at sites where joints will form, including those encoded by the genes Gdf5, Gdf6, Gdf7, Bmp2, and Bmp4 (Storm and Kingsley 1996; Wolfman et al. 1997; Francis-West et al. 1999; Settle et al. 2003). |
| T1390 |
4062-4069 |
JJ |
denotes |
Several |
| T1391 |
4070-4077 |
NNS |
denotes |
members |
| T1392 |
4166-4175 |
VBN |
denotes |
expressed |
| T1393 |
4078-4080 |
IN |
denotes |
of |
| T1394 |
4081-4084 |
DT |
denotes |
the |
| T1395 |
4118-4124 |
NN |
denotes |
family |
| T1396 |
4085-4089 |
NN |
denotes |
bone |
| T1397 |
4104-4111 |
NN |
denotes |
protein |
| T1398 |
4090-4103 |
JJ |
denotes |
morphogenetic |
| T1399 |
4112-4113 |
-LRB- |
denotes |
( |
| T1400 |
4113-4116 |
NNP |
denotes |
BMP |
| T1401 |
4116-4117 |
-RRB- |
denotes |
) |
| T1402 |
4125-4127 |
IN |
denotes |
of |
| T1403 |
4128-4136 |
VBN |
denotes |
secreted |
| T1404 |
4147-4156 |
NNS |
denotes |
molecules |
| T1405 |
4137-4146 |
NN |
denotes |
signaling |
| T1406 |
4157-4160 |
VBP |
denotes |
are |
| T1407 |
4161-4165 |
RB |
denotes |
also |
| T1408 |
4176-4178 |
IN |
denotes |
in |
| T1409 |
4179-4186 |
NNS |
denotes |
stripes |
| T1410 |
4187-4189 |
IN |
denotes |
at |
| T1411 |
4190-4195 |
NNS |
denotes |
sites |
| T1412 |
4196-4201 |
WRB |
denotes |
where |
| T1413 |
4214-4218 |
VB |
denotes |
form |
| T1414 |
4202-4208 |
NNS |
denotes |
joints |
| T1415 |
4209-4213 |
MD |
denotes |
will |
| T1416 |
4218-4220 |
, |
denotes |
, |
| T1417 |
4220-4229 |
VBG |
denotes |
including |
| T1418 |
4230-4235 |
DT |
denotes |
those |
| T1419 |
4236-4243 |
VBN |
denotes |
encoded |
| T1420 |
4244-4246 |
IN |
denotes |
by |
| T1421 |
4247-4250 |
DT |
denotes |
the |
| T1422 |
4251-4256 |
NNS |
denotes |
genes |
| T1423 |
4257-4261 |
NN |
denotes |
Gdf5 |
| T1424 |
4261-4263 |
, |
denotes |
, |
| T1425 |
4263-4267 |
NN |
denotes |
Gdf6 |
| T1426 |
4267-4269 |
, |
denotes |
, |
| T1427 |
4269-4273 |
NN |
denotes |
Gdf7 |
| T1428 |
4273-4275 |
, |
denotes |
, |
| T1429 |
4275-4279 |
NN |
denotes |
Bmp2 |
| T1430 |
4279-4281 |
, |
denotes |
, |
| T1431 |
4281-4284 |
CC |
denotes |
and |
| T1432 |
4285-4289 |
NN |
denotes |
Bmp4 |
| T1433 |
4290-4291 |
-LRB- |
denotes |
( |
| T1434 |
4291-4296 |
NNP |
denotes |
Storm |
| T1435 |
4297-4300 |
CC |
denotes |
and |
| T1436 |
4301-4309 |
NNP |
denotes |
Kingsley |
| T1437 |
4310-4314 |
CD |
denotes |
1996 |
| T1438 |
4314-4315 |
: |
denotes |
; |
| T1439 |
4316-4323 |
NNP |
denotes |
Wolfman |
| T1440 |
4324-4326 |
FW |
denotes |
et |
| T1441 |
4327-4330 |
FW |
denotes |
al. |
| T1442 |
4331-4335 |
CD |
denotes |
1997 |
| T1443 |
4335-4336 |
: |
denotes |
; |
| T1444 |
4337-4344 |
NNP |
denotes |
Francis |
| T1445 |
4344-4345 |
HYPH |
denotes |
- |
| T1446 |
4345-4349 |
NNP |
denotes |
West |
| T1447 |
4350-4352 |
FW |
denotes |
et |
| T1448 |
4353-4356 |
FW |
denotes |
al. |
| T1449 |
4357-4361 |
CD |
denotes |
1999 |
| T1450 |
4361-4362 |
: |
denotes |
; |
| T1451 |
4363-4369 |
NNP |
denotes |
Settle |
| T1452 |
4370-4372 |
FW |
denotes |
et |
| T1453 |
4373-4376 |
FW |
denotes |
al. |
| T1454 |
4377-4381 |
CD |
denotes |
2003 |
| T1455 |
4381-4382 |
-RRB- |
denotes |
) |
| T1456 |
4382-4383 |
. |
denotes |
. |
| T1457 |
4383-4534 |
sentence |
denotes |
Of these, Gdf5 expression is most strikingly limited to regions where joints will develop and is one of the earliest known markers of joint formation. |
| T1458 |
4384-4386 |
IN |
denotes |
Of |
| T1459 |
4410-4412 |
VBZ |
denotes |
is |
| T1460 |
4387-4392 |
DT |
denotes |
these |
| T1461 |
4392-4394 |
, |
denotes |
, |
| T1462 |
4394-4398 |
NN |
denotes |
Gdf5 |
| T1463 |
4399-4409 |
NN |
denotes |
expression |
| T1464 |
4413-4417 |
RBS |
denotes |
most |
| T1465 |
4418-4428 |
RB |
denotes |
strikingly |
| T1466 |
4429-4436 |
VBN |
denotes |
limited |
| T1467 |
4437-4439 |
IN |
denotes |
to |
| T1468 |
4440-4447 |
NNS |
denotes |
regions |
| T1469 |
4448-4453 |
WRB |
denotes |
where |
| T1470 |
4466-4473 |
VB |
denotes |
develop |
| T1471 |
4454-4460 |
NNS |
denotes |
joints |
| T1472 |
4461-4465 |
MD |
denotes |
will |
| T1473 |
4474-4477 |
CC |
denotes |
and |
| T1474 |
4478-4480 |
VBZ |
denotes |
is |
| T1475 |
4481-4484 |
CD |
denotes |
one |
| T1476 |
4485-4487 |
IN |
denotes |
of |
| T1477 |
4488-4491 |
DT |
denotes |
the |
| T1478 |
4507-4514 |
NNS |
denotes |
markers |
| T1479 |
4492-4500 |
JJS |
denotes |
earliest |
| T1480 |
4501-4506 |
VBN |
denotes |
known |
| T1481 |
4515-4517 |
IN |
denotes |
of |
| T1482 |
4518-4523 |
NN |
denotes |
joint |
| T1483 |
4524-4533 |
NN |
denotes |
formation |
| T1484 |
4533-4534 |
. |
denotes |
. |
| T1485 |
4534-4780 |
sentence |
denotes |
Mutations in either Gdf5 or the closely related Gdf6 gene also block formation of joints at specific locations, providing strong evidence that these molecules are essential for the joint formation process (Storm et al. 1994; Settle et al. 2003). |
| T1486 |
4535-4544 |
NNS |
denotes |
Mutations |
| T1487 |
4598-4603 |
VBP |
denotes |
block |
| T1488 |
4545-4547 |
IN |
denotes |
in |
| T1489 |
4548-4554 |
CC |
denotes |
either |
| T1490 |
4555-4559 |
NN |
denotes |
Gdf5 |
| T1491 |
4560-4562 |
CC |
denotes |
or |
| T1492 |
4563-4566 |
DT |
denotes |
the |
| T1493 |
4588-4592 |
NN |
denotes |
gene |
| T1494 |
4567-4574 |
RB |
denotes |
closely |
| T1495 |
4575-4582 |
JJ |
denotes |
related |
| T1496 |
4583-4587 |
NN |
denotes |
Gdf6 |
| T1497 |
4593-4597 |
RB |
denotes |
also |
| T1498 |
4604-4613 |
NN |
denotes |
formation |
| T1499 |
4614-4616 |
IN |
denotes |
of |
| T1500 |
4617-4623 |
NNS |
denotes |
joints |
| T1501 |
4624-4626 |
IN |
denotes |
at |
| T1502 |
4627-4635 |
JJ |
denotes |
specific |
| T1503 |
4636-4645 |
NNS |
denotes |
locations |
| T1504 |
4645-4647 |
, |
denotes |
, |
| T1505 |
4647-4656 |
VBG |
denotes |
providing |
| T1506 |
4657-4663 |
JJ |
denotes |
strong |
| T1507 |
4664-4672 |
NN |
denotes |
evidence |
| T1508 |
4673-4677 |
IN |
denotes |
that |
| T1509 |
4694-4697 |
VBP |
denotes |
are |
| T1510 |
4678-4683 |
DT |
denotes |
these |
| T1511 |
4684-4693 |
NNS |
denotes |
molecules |
| T1512 |
4698-4707 |
JJ |
denotes |
essential |
| T1513 |
4708-4711 |
IN |
denotes |
for |
| T1514 |
4712-4715 |
DT |
denotes |
the |
| T1515 |
4732-4739 |
NN |
denotes |
process |
| T1516 |
4716-4721 |
NN |
denotes |
joint |
| T1517 |
4722-4731 |
NN |
denotes |
formation |
| T1518 |
4740-4741 |
-LRB- |
denotes |
( |
| T1519 |
4741-4746 |
NNP |
denotes |
Storm |
| T1520 |
4747-4749 |
FW |
denotes |
et |
| T1521 |
4750-4753 |
FW |
denotes |
al. |
| T1522 |
4754-4758 |
CD |
denotes |
1994 |
| T1523 |
4758-4759 |
: |
denotes |
; |
| T1524 |
4760-4766 |
NNP |
denotes |
Settle |
| T1525 |
4767-4769 |
FW |
denotes |
et |
| T1526 |
4770-4773 |
FW |
denotes |
al. |
| T1527 |
4774-4778 |
CD |
denotes |
2003 |
| T1528 |
4778-4779 |
-RRB- |
denotes |
) |
| T1529 |
4779-4780 |
. |
denotes |
. |
| T1530 |
4780-4953 |
sentence |
denotes |
However, mutations in Bmp2 or Bmp4 cause early embryonic lethality, making it difficult to test their role in joint formation (Winnier et al. 1995; Zhang and Bradley 1996). |
| T1531 |
4781-4788 |
RB |
denotes |
However |
| T1532 |
4816-4821 |
VBP |
denotes |
cause |
| T1533 |
4788-4790 |
, |
denotes |
, |
| T1534 |
4790-4799 |
NNS |
denotes |
mutations |
| T1535 |
4800-4802 |
IN |
denotes |
in |
| T1536 |
4803-4807 |
NN |
denotes |
Bmp2 |
| T1537 |
4808-4810 |
CC |
denotes |
or |
| T1538 |
4811-4815 |
NN |
denotes |
Bmp4 |
| T1539 |
4822-4827 |
JJ |
denotes |
early |
| T1540 |
4838-4847 |
NN |
denotes |
lethality |
| T1541 |
4828-4837 |
JJ |
denotes |
embryonic |
| T1542 |
4847-4849 |
, |
denotes |
, |
| T1543 |
4849-4855 |
VBG |
denotes |
making |
| T1544 |
4856-4858 |
PRP |
denotes |
it |
| T1545 |
4859-4868 |
JJ |
denotes |
difficult |
| T1546 |
4869-4871 |
TO |
denotes |
to |
| T1547 |
4872-4876 |
VB |
denotes |
test |
| T1548 |
4877-4882 |
PRP$ |
denotes |
their |
| T1549 |
4883-4887 |
NN |
denotes |
role |
| T1550 |
4888-4890 |
IN |
denotes |
in |
| T1551 |
4891-4896 |
NN |
denotes |
joint |
| T1552 |
4897-4906 |
NN |
denotes |
formation |
| T1553 |
4907-4908 |
-LRB- |
denotes |
( |
| T1554 |
4908-4915 |
NNP |
denotes |
Winnier |
| T1555 |
4916-4918 |
FW |
denotes |
et |
| T1556 |
4919-4922 |
FW |
denotes |
al. |
| T1557 |
4923-4927 |
CD |
denotes |
1995 |
| T1558 |
4927-4928 |
: |
denotes |
; |
| T1559 |
4929-4934 |
NNP |
denotes |
Zhang |
| T1560 |
4935-4938 |
CC |
denotes |
and |
| T1561 |
4939-4946 |
NNP |
denotes |
Bradley |
| T1562 |
4947-4951 |
CD |
denotes |
1996 |
| T1563 |
4951-4952 |
-RRB- |
denotes |
) |
| T1564 |
4952-4953 |
. |
denotes |
. |
| T1565 |
4953-5086 |
sentence |
denotes |
Much less is known about how signaling pathways function during the subsequent maturation and maintenance of adult joint structures. |
| T1566 |
4954-4958 |
RB |
denotes |
Much |
| T1567 |
4959-4963 |
JJR |
denotes |
less |
| T1568 |
4967-4972 |
VBN |
denotes |
known |
| T1569 |
4964-4966 |
VBZ |
denotes |
is |
| T1570 |
4973-4978 |
IN |
denotes |
about |
| T1571 |
4979-4982 |
WRB |
denotes |
how |
| T1572 |
5002-5010 |
VBP |
denotes |
function |
| T1573 |
4983-4992 |
NN |
denotes |
signaling |
| T1574 |
4993-5001 |
NNS |
denotes |
pathways |
| T1575 |
5011-5017 |
IN |
denotes |
during |
| T1576 |
5018-5021 |
DT |
denotes |
the |
| T1577 |
5033-5043 |
NN |
denotes |
maturation |
| T1578 |
5022-5032 |
JJ |
denotes |
subsequent |
| T1579 |
5044-5047 |
CC |
denotes |
and |
| T1580 |
5048-5059 |
NN |
denotes |
maintenance |
| T1581 |
5060-5062 |
IN |
denotes |
of |
| T1582 |
5063-5068 |
NN |
denotes |
adult |
| T1583 |
5075-5085 |
NNS |
denotes |
structures |
| T1584 |
5069-5074 |
NN |
denotes |
joint |
| T1585 |
5085-5086 |
. |
denotes |
. |
| T1586 |
5086-5379 |
sentence |
denotes |
Importantly, BMP signaling components are present in adult articular cartilage, suggesting that they may function during the late development or maintenance of this critical structure (Erlacher et al. 1998; Chubinskaya et al. 2000; Muehleman et al. 2002; Bau et al. 2002; Bobacz et al. 2003). |
| T1587 |
5087-5098 |
RB |
denotes |
Importantly |
| T1588 |
5125-5128 |
VBP |
denotes |
are |
| T1589 |
5098-5100 |
, |
denotes |
, |
| T1590 |
5100-5103 |
NN |
denotes |
BMP |
| T1591 |
5104-5113 |
NN |
denotes |
signaling |
| T1592 |
5114-5124 |
NNS |
denotes |
components |
| T1593 |
5129-5136 |
JJ |
denotes |
present |
| T1594 |
5137-5139 |
IN |
denotes |
in |
| T1595 |
5140-5145 |
NN |
denotes |
adult |
| T1596 |
5156-5165 |
NN |
denotes |
cartilage |
| T1597 |
5146-5155 |
JJ |
denotes |
articular |
| T1598 |
5165-5167 |
, |
denotes |
, |
| T1599 |
5167-5177 |
VBG |
denotes |
suggesting |
| T1600 |
5178-5182 |
IN |
denotes |
that |
| T1601 |
5192-5200 |
VB |
denotes |
function |
| T1602 |
5183-5187 |
PRP |
denotes |
they |
| T1603 |
5188-5191 |
MD |
denotes |
may |
| T1604 |
5201-5207 |
IN |
denotes |
during |
| T1605 |
5208-5211 |
DT |
denotes |
the |
| T1606 |
5217-5228 |
NN |
denotes |
development |
| T1607 |
5212-5216 |
JJ |
denotes |
late |
| T1608 |
5229-5231 |
CC |
denotes |
or |
| T1609 |
5232-5243 |
NN |
denotes |
maintenance |
| T1610 |
5244-5246 |
IN |
denotes |
of |
| T1611 |
5247-5251 |
DT |
denotes |
this |
| T1612 |
5261-5270 |
NN |
denotes |
structure |
| T1613 |
5252-5260 |
JJ |
denotes |
critical |
| T1614 |
5271-5272 |
-LRB- |
denotes |
( |
| T1615 |
5272-5280 |
NNP |
denotes |
Erlacher |
| T1616 |
5281-5283 |
FW |
denotes |
et |
| T1617 |
5284-5287 |
FW |
denotes |
al. |
| T1618 |
5288-5292 |
CD |
denotes |
1998 |
| T1619 |
5292-5293 |
: |
denotes |
; |
| T1620 |
5294-5305 |
NNP |
denotes |
Chubinskaya |
| T1621 |
5306-5308 |
FW |
denotes |
et |
| T1622 |
5309-5312 |
FW |
denotes |
al. |
| T1623 |
5313-5317 |
CD |
denotes |
2000 |
| T1624 |
5317-5318 |
: |
denotes |
; |
| T1625 |
5319-5328 |
NNP |
denotes |
Muehleman |
| T1626 |
5329-5331 |
FW |
denotes |
et |
| T1627 |
5332-5335 |
FW |
denotes |
al. |
| T1628 |
5336-5340 |
CD |
denotes |
2002 |
| T1629 |
5340-5341 |
: |
denotes |
; |
| T1630 |
5342-5345 |
NNP |
denotes |
Bau |
| T1631 |
5346-5348 |
FW |
denotes |
et |
| T1632 |
5349-5352 |
FW |
denotes |
al. |
| T1633 |
5353-5357 |
CD |
denotes |
2002 |
| T1634 |
5357-5358 |
: |
denotes |
; |
| T1635 |
5359-5365 |
NNP |
denotes |
Bobacz |
| T1636 |
5366-5368 |
FW |
denotes |
et |
| T1637 |
5369-5372 |
FW |
denotes |
al. |
| T1638 |
5373-5377 |
CD |
denotes |
2003 |
| T1639 |
5377-5378 |
-RRB- |
denotes |
) |
| T1640 |
5378-5379 |
. |
denotes |
. |
| T1641 |
5379-5489 |
sentence |
denotes |
BMPs bind tetrameric complexes of two type I and two type II transmembrane serine-threonine kinase receptors. |
| T1642 |
5380-5384 |
NNS |
denotes |
BMPs |
| T1643 |
5385-5389 |
VBP |
denotes |
bind |
| T1644 |
5390-5400 |
JJ |
denotes |
tetrameric |
| T1645 |
5401-5410 |
NNS |
denotes |
complexes |
| T1646 |
5411-5413 |
IN |
denotes |
of |
| T1647 |
5414-5417 |
CD |
denotes |
two |
| T1648 |
5418-5422 |
NN |
denotes |
type |
| T1649 |
5423-5424 |
CD |
denotes |
I |
| T1650 |
5425-5428 |
CC |
denotes |
and |
| T1651 |
5429-5432 |
CD |
denotes |
two |
| T1652 |
5433-5437 |
NN |
denotes |
type |
| T1653 |
5479-5488 |
NNS |
denotes |
receptors |
| T1654 |
5438-5440 |
CD |
denotes |
II |
| T1655 |
5441-5454 |
JJ |
denotes |
transmembrane |
| T1656 |
5455-5461 |
NN |
denotes |
serine |
| T1657 |
5462-5471 |
NN |
denotes |
threonine |
| T1658 |
5461-5462 |
HYPH |
denotes |
- |
| T1659 |
5472-5478 |
NN |
denotes |
kinase |
| T1660 |
5488-5489 |
. |
denotes |
. |
| T1661 |
5489-5630 |
sentence |
denotes |
Upon BMP binding, these complexes transduce a signal by phosphorylating members of the Smad family of transcription factors (Massague 1996). |
| T1662 |
5490-5494 |
IN |
denotes |
Upon |
| T1663 |
5524-5533 |
VBP |
denotes |
transduce |
| T1664 |
5495-5498 |
NN |
denotes |
BMP |
| T1665 |
5499-5506 |
NN |
denotes |
binding |
| T1666 |
5506-5508 |
, |
denotes |
, |
| T1667 |
5508-5513 |
DT |
denotes |
these |
| T1668 |
5514-5523 |
NNS |
denotes |
complexes |
| T1669 |
5534-5535 |
DT |
denotes |
a |
| T1670 |
5536-5542 |
NN |
denotes |
signal |
| T1671 |
5543-5545 |
IN |
denotes |
by |
| T1672 |
5546-5561 |
VBG |
denotes |
phosphorylating |
| T1673 |
5562-5569 |
NNS |
denotes |
members |
| T1674 |
5570-5572 |
IN |
denotes |
of |
| T1675 |
5573-5576 |
DT |
denotes |
the |
| T1676 |
5582-5588 |
NN |
denotes |
family |
| T1677 |
5577-5581 |
NN |
denotes |
Smad |
| T1678 |
5589-5591 |
IN |
denotes |
of |
| T1679 |
5592-5605 |
NN |
denotes |
transcription |
| T1680 |
5606-5613 |
NNS |
denotes |
factors |
| T1681 |
5614-5615 |
-LRB- |
denotes |
( |
| T1682 |
5615-5623 |
NNP |
denotes |
Massague |
| T1683 |
5624-5628 |
CD |
denotes |
1996 |
| T1684 |
5628-5629 |
-RRB- |
denotes |
) |
| T1685 |
5629-5630 |
. |
denotes |
. |
| T1686 |
5630-5743 |
sentence |
denotes |
Recent experiments have implicated two different BMP type I receptors in skeletal patterning, BMPR1A and BMPR1B. |
| T1687 |
5631-5637 |
JJ |
denotes |
Recent |
| T1688 |
5638-5649 |
NNS |
denotes |
experiments |
| T1689 |
5655-5665 |
VBN |
denotes |
implicated |
| T1690 |
5650-5654 |
VBP |
denotes |
have |
| T1691 |
5666-5669 |
CD |
denotes |
two |
| T1692 |
5691-5700 |
NNS |
denotes |
receptors |
| T1693 |
5670-5679 |
JJ |
denotes |
different |
| T1694 |
5680-5683 |
NN |
denotes |
BMP |
| T1695 |
5684-5688 |
NN |
denotes |
type |
| T1696 |
5689-5690 |
CD |
denotes |
I |
| T1697 |
5701-5703 |
IN |
denotes |
in |
| T1698 |
5704-5712 |
JJ |
denotes |
skeletal |
| T1699 |
5713-5723 |
NN |
denotes |
patterning |
| T1700 |
5723-5725 |
, |
denotes |
, |
| T1701 |
5725-5731 |
NN |
denotes |
BMPR1A |
| T1702 |
5732-5735 |
CC |
denotes |
and |
| T1703 |
5736-5742 |
NN |
denotes |
BMPR1B |
| T1704 |
5742-5743 |
. |
denotes |
. |
| T1705 |
5743-5944 |
sentence |
denotes |
Both receptors can bind BMP2, BMP4, and GDF5, although GDF5 shows higher affinity for BMPR1B (Koenig et al. 1994; ten Dijke et al. 1994; Yamaji et al. 1994; Nishitoh et al. 1996; Chalaux et al. 1998). |
| T1706 |
5744-5748 |
DT |
denotes |
Both |
| T1707 |
5749-5758 |
NNS |
denotes |
receptors |
| T1708 |
5763-5767 |
VB |
denotes |
bind |
| T1709 |
5759-5762 |
MD |
denotes |
can |
| T1710 |
5768-5772 |
NN |
denotes |
BMP2 |
| T1711 |
5772-5774 |
, |
denotes |
, |
| T1712 |
5774-5778 |
NN |
denotes |
BMP4 |
| T1713 |
5778-5780 |
, |
denotes |
, |
| T1714 |
5780-5783 |
CC |
denotes |
and |
| T1715 |
5784-5788 |
NN |
denotes |
GDF5 |
| T1716 |
5788-5790 |
, |
denotes |
, |
| T1717 |
5790-5798 |
IN |
denotes |
although |
| T1718 |
5804-5809 |
VBZ |
denotes |
shows |
| T1719 |
5799-5803 |
NN |
denotes |
GDF5 |
| T1720 |
5810-5816 |
JJR |
denotes |
higher |
| T1721 |
5817-5825 |
NN |
denotes |
affinity |
| T1722 |
5826-5829 |
IN |
denotes |
for |
| T1723 |
5830-5836 |
NN |
denotes |
BMPR1B |
| T1724 |
5837-5838 |
-LRB- |
denotes |
( |
| T1725 |
5838-5844 |
NNP |
denotes |
Koenig |
| T1726 |
5845-5847 |
FW |
denotes |
et |
| T1727 |
5848-5851 |
FW |
denotes |
al. |
| T1728 |
5852-5856 |
CD |
denotes |
1994 |
| T1729 |
5856-5857 |
: |
denotes |
; |
| T1730 |
5858-5861 |
NNP |
denotes |
ten |
| T1731 |
5862-5867 |
NNP |
denotes |
Dijke |
| T1732 |
5868-5870 |
FW |
denotes |
et |
| T1733 |
5871-5874 |
FW |
denotes |
al. |
| T1734 |
5875-5879 |
CD |
denotes |
1994 |
| T1735 |
5879-5880 |
: |
denotes |
; |
| T1736 |
5881-5887 |
NNP |
denotes |
Yamaji |
| T1737 |
5888-5890 |
FW |
denotes |
et |
| T1738 |
5891-5894 |
FW |
denotes |
al. |
| T1739 |
5895-5899 |
CD |
denotes |
1994 |
| T1740 |
5899-5900 |
: |
denotes |
; |
| T1741 |
5901-5909 |
NNP |
denotes |
Nishitoh |
| T1742 |
5910-5912 |
FW |
denotes |
et |
| T1743 |
5913-5916 |
FW |
denotes |
al. |
| T1744 |
5917-5921 |
CD |
denotes |
1996 |
| T1745 |
5921-5922 |
: |
denotes |
; |
| T1746 |
5923-5930 |
NNP |
denotes |
Chalaux |
| T1747 |
5931-5933 |
FW |
denotes |
et |
| T1748 |
5934-5937 |
FW |
denotes |
al. |
| T1749 |
5938-5942 |
CD |
denotes |
1998 |
| T1750 |
5942-5943 |
-RRB- |
denotes |
) |
| T1751 |
5943-5944 |
. |
denotes |
. |
| T1752 |
5944-6025 |
sentence |
denotes |
Both receptors are also expressed in dynamic patterns during normal development. |
| T1753 |
5945-5949 |
DT |
denotes |
Both |
| T1754 |
5950-5959 |
NNS |
denotes |
receptors |
| T1755 |
5969-5978 |
VBN |
denotes |
expressed |
| T1756 |
5960-5963 |
VBP |
denotes |
are |
| T1757 |
5964-5968 |
RB |
denotes |
also |
| T1758 |
5979-5981 |
IN |
denotes |
in |
| T1759 |
5982-5989 |
JJ |
denotes |
dynamic |
| T1760 |
5990-5998 |
NNS |
denotes |
patterns |
| T1761 |
5999-6005 |
IN |
denotes |
during |
| T1762 |
6006-6012 |
JJ |
denotes |
normal |
| T1763 |
6013-6024 |
NN |
denotes |
development |
| T1764 |
6024-6025 |
. |
denotes |
. |
| T1765 |
6025-6194 |
sentence |
denotes |
In limbs, Bmpr1a expression becomes restricted to joint interzones, perichondrium, periarticular cartilage, hypertrophic chondrocytes, and interdigital limb mesenchyme. |
| T1766 |
6026-6028 |
IN |
denotes |
In |
| T1767 |
6054-6061 |
VBZ |
denotes |
becomes |
| T1768 |
6029-6034 |
NNS |
denotes |
limbs |
| T1769 |
6034-6036 |
, |
denotes |
, |
| T1770 |
6036-6042 |
NN |
denotes |
Bmpr1a |
| T1771 |
6043-6053 |
NN |
denotes |
expression |
| T1772 |
6062-6072 |
JJ |
denotes |
restricted |
| T1773 |
6073-6075 |
IN |
denotes |
to |
| T1774 |
6076-6081 |
NN |
denotes |
joint |
| T1775 |
6082-6092 |
NNS |
denotes |
interzones |
| T1776 |
6092-6094 |
, |
denotes |
, |
| T1777 |
6094-6107 |
NN |
denotes |
perichondrium |
| T1778 |
6107-6109 |
, |
denotes |
, |
| T1779 |
6109-6122 |
JJ |
denotes |
periarticular |
| T1780 |
6123-6132 |
NN |
denotes |
cartilage |
| T1781 |
6132-6134 |
, |
denotes |
, |
| T1782 |
6134-6146 |
JJ |
denotes |
hypertrophic |
| T1783 |
6147-6159 |
NNS |
denotes |
chondrocytes |
| T1784 |
6159-6161 |
, |
denotes |
, |
| T1785 |
6161-6164 |
CC |
denotes |
and |
| T1786 |
6165-6177 |
JJ |
denotes |
interdigital |
| T1787 |
6183-6193 |
NN |
denotes |
mesenchyme |
| T1788 |
6178-6182 |
NN |
denotes |
limb |
| T1789 |
6193-6194 |
. |
denotes |
. |
| T1790 |
6194-6451 |
sentence |
denotes |
In comparison, Bmpr1b expression is seen primarily in condensing precartilaginous mesenchymal cells, regions flanking joint interzones, perichondrium, and periarticular cartilage (Dewulf et al. 1995; Mishina et al. 1995; Zou et al. 1997; Baur et al. 2000). |
| T1791 |
6195-6197 |
IN |
denotes |
In |
| T1792 |
6231-6235 |
VBN |
denotes |
seen |
| T1793 |
6198-6208 |
NN |
denotes |
comparison |
| T1794 |
6208-6210 |
, |
denotes |
, |
| T1795 |
6210-6216 |
NN |
denotes |
Bmpr1b |
| T1796 |
6217-6227 |
NN |
denotes |
expression |
| T1797 |
6228-6230 |
VBZ |
denotes |
is |
| T1798 |
6236-6245 |
RB |
denotes |
primarily |
| T1799 |
6246-6248 |
IN |
denotes |
in |
| T1800 |
6249-6259 |
VBG |
denotes |
condensing |
| T1801 |
6289-6294 |
NNS |
denotes |
cells |
| T1802 |
6260-6276 |
JJ |
denotes |
precartilaginous |
| T1803 |
6277-6288 |
JJ |
denotes |
mesenchymal |
| T1804 |
6294-6296 |
, |
denotes |
, |
| T1805 |
6296-6303 |
NNS |
denotes |
regions |
| T1806 |
6304-6312 |
VBG |
denotes |
flanking |
| T1807 |
6313-6318 |
NN |
denotes |
joint |
| T1808 |
6319-6329 |
NNS |
denotes |
interzones |
| T1809 |
6329-6331 |
, |
denotes |
, |
| T1810 |
6331-6344 |
NN |
denotes |
perichondrium |
| T1811 |
6344-6346 |
, |
denotes |
, |
| T1812 |
6346-6349 |
CC |
denotes |
and |
| T1813 |
6350-6363 |
JJ |
denotes |
periarticular |
| T1814 |
6364-6373 |
NN |
denotes |
cartilage |
| T1815 |
6374-6375 |
-LRB- |
denotes |
( |
| T1816 |
6375-6381 |
NNP |
denotes |
Dewulf |
| T1817 |
6382-6384 |
FW |
denotes |
et |
| T1818 |
6385-6388 |
FW |
denotes |
al. |
| T1819 |
6389-6393 |
CD |
denotes |
1995 |
| T1820 |
6393-6394 |
: |
denotes |
; |
| T1821 |
6395-6402 |
NNP |
denotes |
Mishina |
| T1822 |
6403-6405 |
FW |
denotes |
et |
| T1823 |
6406-6409 |
FW |
denotes |
al. |
| T1824 |
6410-6414 |
CD |
denotes |
1995 |
| T1825 |
6414-6415 |
: |
denotes |
; |
| T1826 |
6416-6419 |
NNP |
denotes |
Zou |
| T1827 |
6420-6422 |
FW |
denotes |
et |
| T1828 |
6423-6426 |
FW |
denotes |
al. |
| T1829 |
6427-6431 |
CD |
denotes |
1997 |
| T1830 |
6431-6432 |
: |
denotes |
; |
| T1831 |
6433-6437 |
NNP |
denotes |
Baur |
| T1832 |
6438-6440 |
FW |
denotes |
et |
| T1833 |
6441-6444 |
FW |
denotes |
al. |
| T1834 |
6445-6449 |
CD |
denotes |
2000 |
| T1835 |
6449-6450 |
-RRB- |
denotes |
) |
| T1836 |
6450-6451 |
. |
denotes |
. |
| T1837 |
6451-6661 |
sentence |
denotes |
Null mutations in the Bmpr1b gene produce viable mice with defects in bone and joint formation that closely resemble those seen in mice missing Gdf5 (Storm and Kingsley 1996; Baur et al. 2000; Yi et al. 2000). |
| T1838 |
6452-6456 |
JJ |
denotes |
Null |
| T1839 |
6457-6466 |
NNS |
denotes |
mutations |
| T1840 |
6486-6493 |
VBP |
denotes |
produce |
| T1841 |
6467-6469 |
IN |
denotes |
in |
| T1842 |
6470-6473 |
DT |
denotes |
the |
| T1843 |
6481-6485 |
NN |
denotes |
gene |
| T1844 |
6474-6480 |
NN |
denotes |
Bmpr1b |
| T1845 |
6494-6500 |
JJ |
denotes |
viable |
| T1846 |
6501-6505 |
NNS |
denotes |
mice |
| T1847 |
6506-6510 |
IN |
denotes |
with |
| T1848 |
6511-6518 |
NNS |
denotes |
defects |
| T1849 |
6519-6521 |
IN |
denotes |
in |
| T1850 |
6522-6526 |
NN |
denotes |
bone |
| T1851 |
6537-6546 |
NN |
denotes |
formation |
| T1852 |
6527-6530 |
CC |
denotes |
and |
| T1853 |
6531-6536 |
NN |
denotes |
joint |
| T1854 |
6547-6551 |
WDT |
denotes |
that |
| T1855 |
6560-6568 |
VBP |
denotes |
resemble |
| T1856 |
6552-6559 |
RB |
denotes |
closely |
| T1857 |
6569-6574 |
DT |
denotes |
those |
| T1858 |
6575-6579 |
VBN |
denotes |
seen |
| T1859 |
6580-6582 |
IN |
denotes |
in |
| T1860 |
6583-6587 |
NNS |
denotes |
mice |
| T1861 |
6588-6595 |
VBG |
denotes |
missing |
| T1862 |
6596-6600 |
NN |
denotes |
Gdf5 |
| T1863 |
6601-6602 |
-LRB- |
denotes |
( |
| T1864 |
6602-6607 |
NNP |
denotes |
Storm |
| T1865 |
6608-6611 |
CC |
denotes |
and |
| T1866 |
6612-6620 |
NNP |
denotes |
Kingsley |
| T1867 |
6621-6625 |
CD |
denotes |
1996 |
| T1868 |
6625-6626 |
: |
denotes |
; |
| T1869 |
6627-6631 |
NNP |
denotes |
Baur |
| T1870 |
6632-6634 |
FW |
denotes |
et |
| T1871 |
6635-6638 |
FW |
denotes |
al. |
| T1872 |
6639-6643 |
CD |
denotes |
2000 |
| T1873 |
6643-6644 |
: |
denotes |
; |
| T1874 |
6645-6647 |
NNP |
denotes |
Yi |
| T1875 |
6648-6650 |
FW |
denotes |
et |
| T1876 |
6651-6654 |
FW |
denotes |
al. |
| T1877 |
6655-6659 |
CD |
denotes |
2000 |
| T1878 |
6659-6660 |
-RRB- |
denotes |
) |
| T1879 |
6660-6661 |
. |
denotes |
. |
| T1880 |
6661-6845 |
sentence |
denotes |
Null mutations in Bmpr1a cause early embryonic lethality, with defects in gastrulation similar to those seen in mice with mutations in Bmp4 (Mishina et al. 1995; Winnier et al. 1995). |
| T1881 |
6662-6666 |
JJ |
denotes |
Null |
| T1882 |
6667-6676 |
NNS |
denotes |
mutations |
| T1883 |
6687-6692 |
VBP |
denotes |
cause |
| T1884 |
6677-6679 |
IN |
denotes |
in |
| T1885 |
6680-6686 |
NN |
denotes |
Bmpr1a |
| T1886 |
6693-6698 |
JJ |
denotes |
early |
| T1887 |
6709-6718 |
NN |
denotes |
lethality |
| T1888 |
6699-6708 |
JJ |
denotes |
embryonic |
| T1889 |
6718-6720 |
, |
denotes |
, |
| T1890 |
6720-6724 |
IN |
denotes |
with |
| T1891 |
6749-6756 |
JJ |
denotes |
similar |
| T1892 |
6725-6732 |
NNS |
denotes |
defects |
| T1893 |
6733-6735 |
IN |
denotes |
in |
| T1894 |
6736-6748 |
NN |
denotes |
gastrulation |
| T1895 |
6757-6759 |
IN |
denotes |
to |
| T1896 |
6760-6765 |
DT |
denotes |
those |
| T1897 |
6766-6770 |
VBN |
denotes |
seen |
| T1898 |
6771-6773 |
IN |
denotes |
in |
| T1899 |
6774-6778 |
NNS |
denotes |
mice |
| T1900 |
6779-6783 |
IN |
denotes |
with |
| T1901 |
6784-6793 |
NNS |
denotes |
mutations |
| T1902 |
6794-6796 |
IN |
denotes |
in |
| T1903 |
6797-6801 |
NN |
denotes |
Bmp4 |
| T1904 |
6802-6803 |
-LRB- |
denotes |
( |
| T1905 |
6803-6810 |
NNP |
denotes |
Mishina |
| T1906 |
6811-6813 |
FW |
denotes |
et |
| T1907 |
6814-6817 |
FW |
denotes |
al. |
| T1908 |
6818-6822 |
CD |
denotes |
1995 |
| T1909 |
6822-6823 |
: |
denotes |
; |
| T1910 |
6824-6831 |
NNP |
denotes |
Winnier |
| T1911 |
6832-6834 |
FW |
denotes |
et |
| T1912 |
6835-6838 |
FW |
denotes |
al. |
| T1913 |
6839-6843 |
CD |
denotes |
1995 |
| T1914 |
6843-6844 |
-RRB- |
denotes |
) |
| T1915 |
6844-6845 |
. |
denotes |
. |
| T1916 |
6845-7037 |
sentence |
denotes |
Recent studies with floxed alleles suggest that Bmpr1a is also required for many later developmental events, but its roles in bone and joint formation have not yet been tested (Mishina 2003). |
| T1917 |
6846-6852 |
JJ |
denotes |
Recent |
| T1918 |
6853-6860 |
NNS |
denotes |
studies |
| T1919 |
6881-6888 |
VBP |
denotes |
suggest |
| T1920 |
6861-6865 |
IN |
denotes |
with |
| T1921 |
6866-6872 |
VBN |
denotes |
floxed |
| T1922 |
6873-6880 |
NNS |
denotes |
alleles |
| T1923 |
6889-6893 |
IN |
denotes |
that |
| T1924 |
6909-6917 |
VBN |
denotes |
required |
| T1925 |
6894-6900 |
NN |
denotes |
Bmpr1a |
| T1926 |
6901-6903 |
VBZ |
denotes |
is |
| T1927 |
6904-6908 |
RB |
denotes |
also |
| T1928 |
6918-6921 |
IN |
denotes |
for |
| T1929 |
6922-6926 |
JJ |
denotes |
many |
| T1930 |
6947-6953 |
NNS |
denotes |
events |
| T1931 |
6927-6932 |
JJ |
denotes |
later |
| T1932 |
6933-6946 |
JJ |
denotes |
developmental |
| T1933 |
6953-6955 |
, |
denotes |
, |
| T1934 |
6955-6958 |
CC |
denotes |
but |
| T1935 |
6959-6962 |
PRP$ |
denotes |
its |
| T1936 |
6963-6968 |
NNS |
denotes |
roles |
| T1937 |
7015-7021 |
VBN |
denotes |
tested |
| T1938 |
6969-6971 |
IN |
denotes |
in |
| T1939 |
6972-6976 |
NN |
denotes |
bone |
| T1940 |
6987-6996 |
NN |
denotes |
formation |
| T1941 |
6977-6980 |
CC |
denotes |
and |
| T1942 |
6981-6986 |
NN |
denotes |
joint |
| T1943 |
6997-7001 |
VBP |
denotes |
have |
| T1944 |
7002-7005 |
RB |
denotes |
not |
| T1945 |
7006-7009 |
RB |
denotes |
yet |
| T1946 |
7010-7014 |
VBN |
denotes |
been |
| T1947 |
7022-7023 |
-LRB- |
denotes |
( |
| T1948 |
7023-7030 |
NNP |
denotes |
Mishina |
| T1949 |
7031-7035 |
CD |
denotes |
2003 |
| T1950 |
7035-7036 |
-RRB- |
denotes |
) |
| T1951 |
7036-7037 |
. |
denotes |
. |
| T1952 |
7037-7206 |
sentence |
denotes |
A genetic system for activating or inactivating genes specifically in joint tissues would be particularly useful for further studies of joint formation and maintenance. |
| T1953 |
7038-7039 |
DT |
denotes |
A |
| T1954 |
7048-7054 |
NN |
denotes |
system |
| T1955 |
7040-7047 |
JJ |
denotes |
genetic |
| T1956 |
7128-7130 |
VB |
denotes |
be |
| T1957 |
7055-7058 |
IN |
denotes |
for |
| T1958 |
7059-7069 |
VBG |
denotes |
activating |
| T1959 |
7070-7072 |
CC |
denotes |
or |
| T1960 |
7073-7085 |
VBG |
denotes |
inactivating |
| T1961 |
7086-7091 |
NNS |
denotes |
genes |
| T1962 |
7092-7104 |
RB |
denotes |
specifically |
| T1963 |
7105-7107 |
IN |
denotes |
in |
| T1964 |
7108-7113 |
NN |
denotes |
joint |
| T1965 |
7114-7121 |
NNS |
denotes |
tissues |
| T1966 |
7122-7127 |
MD |
denotes |
would |
| T1967 |
7131-7143 |
RB |
denotes |
particularly |
| T1968 |
7144-7150 |
JJ |
denotes |
useful |
| T1969 |
7151-7154 |
IN |
denotes |
for |
| T1970 |
7155-7162 |
JJ |
denotes |
further |
| T1971 |
7163-7170 |
NNS |
denotes |
studies |
| T1972 |
7171-7173 |
IN |
denotes |
of |
| T1973 |
7174-7179 |
NN |
denotes |
joint |
| T1974 |
7180-7189 |
NN |
denotes |
formation |
| T1975 |
7190-7193 |
CC |
denotes |
and |
| T1976 |
7194-7205 |
NN |
denotes |
maintenance |
| T1977 |
7205-7206 |
. |
denotes |
. |
| T1978 |
7206-7408 |
sentence |
denotes |
Here we take advantage of the tissue-specific expression pattern of the Gdf5 gene to engineer a Cre/loxP system (Nagy 2000), Gdf5-Cre, that can be used to remove or ectopically express genes in joints. |
| T1979 |
7207-7211 |
RB |
denotes |
Here |
| T1980 |
7215-7219 |
VBP |
denotes |
take |
| T1981 |
7212-7214 |
PRP |
denotes |
we |
| T1982 |
7220-7229 |
NN |
denotes |
advantage |
| T1983 |
7230-7232 |
IN |
denotes |
of |
| T1984 |
7233-7236 |
DT |
denotes |
the |
| T1985 |
7264-7271 |
NN |
denotes |
pattern |
| T1986 |
7237-7243 |
NN |
denotes |
tissue |
| T1987 |
7244-7252 |
JJ |
denotes |
specific |
| T1988 |
7243-7244 |
HYPH |
denotes |
- |
| T1989 |
7253-7263 |
NN |
denotes |
expression |
| T1990 |
7272-7274 |
IN |
denotes |
of |
| T1991 |
7275-7278 |
DT |
denotes |
the |
| T1992 |
7284-7288 |
NN |
denotes |
gene |
| T1993 |
7279-7283 |
NN |
denotes |
Gdf5 |
| T1994 |
7289-7291 |
TO |
denotes |
to |
| T1995 |
7292-7300 |
VB |
denotes |
engineer |
| T1996 |
7301-7302 |
DT |
denotes |
a |
| T1997 |
7312-7318 |
NN |
denotes |
system |
| T1998 |
7303-7306 |
NN |
denotes |
Cre |
| T1999 |
7307-7311 |
NN |
denotes |
loxP |
| T2000 |
7306-7307 |
HYPH |
denotes |
/ |
| T2001 |
7319-7320 |
-LRB- |
denotes |
( |
| T2002 |
7320-7324 |
NNP |
denotes |
Nagy |
| T2003 |
7325-7329 |
CD |
denotes |
2000 |
| T2004 |
7329-7330 |
-RRB- |
denotes |
) |
| T2005 |
7330-7332 |
, |
denotes |
, |
| T2006 |
7332-7336 |
NN |
denotes |
Gdf5 |
| T2007 |
7337-7340 |
NN |
denotes |
Cre |
| T2008 |
7336-7337 |
HYPH |
denotes |
- |
| T2009 |
7340-7342 |
, |
denotes |
, |
| T2010 |
7342-7346 |
WDT |
denotes |
that |
| T2011 |
7354-7358 |
VBN |
denotes |
used |
| T2012 |
7347-7350 |
MD |
denotes |
can |
| T2013 |
7351-7353 |
VB |
denotes |
be |
| T2014 |
7359-7361 |
TO |
denotes |
to |
| T2015 |
7362-7368 |
VB |
denotes |
remove |
| T2016 |
7369-7371 |
CC |
denotes |
or |
| T2017 |
7372-7383 |
RB |
denotes |
ectopically |
| T2018 |
7384-7391 |
VB |
denotes |
express |
| T2019 |
7392-7397 |
NNS |
denotes |
genes |
| T2020 |
7398-7400 |
IN |
denotes |
in |
| T2021 |
7401-7407 |
NNS |
denotes |
joints |
| T2022 |
7407-7408 |
. |
denotes |
. |
| T2023 |
7408-7638 |
sentence |
denotes |
Tests with reporter mice show that this system is capable of modifying genes in all of the structures of the mature synovial joint, including the ligaments of the joint capsule, the synovial membrane, and the articular cartilage. |
| T2024 |
7409-7414 |
NNS |
denotes |
Tests |
| T2025 |
7434-7438 |
VBP |
denotes |
show |
| T2026 |
7415-7419 |
IN |
denotes |
with |
| T2027 |
7420-7428 |
NN |
denotes |
reporter |
| T2028 |
7429-7433 |
NNS |
denotes |
mice |
| T2029 |
7439-7443 |
IN |
denotes |
that |
| T2030 |
7456-7458 |
VBZ |
denotes |
is |
| T2031 |
7444-7448 |
DT |
denotes |
this |
| T2032 |
7449-7455 |
NN |
denotes |
system |
| T2033 |
7459-7466 |
JJ |
denotes |
capable |
| T2034 |
7467-7469 |
IN |
denotes |
of |
| T2035 |
7470-7479 |
VBG |
denotes |
modifying |
| T2036 |
7480-7485 |
NNS |
denotes |
genes |
| T2037 |
7486-7488 |
IN |
denotes |
in |
| T2038 |
7489-7492 |
DT |
denotes |
all |
| T2039 |
7493-7495 |
IN |
denotes |
of |
| T2040 |
7496-7499 |
DT |
denotes |
the |
| T2041 |
7500-7510 |
NNS |
denotes |
structures |
| T2042 |
7511-7513 |
IN |
denotes |
of |
| T2043 |
7514-7517 |
DT |
denotes |
the |
| T2044 |
7534-7539 |
NN |
denotes |
joint |
| T2045 |
7518-7524 |
JJ |
denotes |
mature |
| T2046 |
7525-7533 |
JJ |
denotes |
synovial |
| T2047 |
7539-7541 |
, |
denotes |
, |
| T2048 |
7541-7550 |
VBG |
denotes |
including |
| T2049 |
7551-7554 |
DT |
denotes |
the |
| T2050 |
7555-7564 |
NNS |
denotes |
ligaments |
| T2051 |
7565-7567 |
IN |
denotes |
of |
| T2052 |
7568-7571 |
DT |
denotes |
the |
| T2053 |
7578-7585 |
NN |
denotes |
capsule |
| T2054 |
7572-7577 |
NN |
denotes |
joint |
| T2055 |
7585-7587 |
, |
denotes |
, |
| T2056 |
7587-7590 |
DT |
denotes |
the |
| T2057 |
7600-7608 |
NN |
denotes |
membrane |
| T2058 |
7591-7599 |
JJ |
denotes |
synovial |
| T2059 |
7608-7610 |
, |
denotes |
, |
| T2060 |
7610-7613 |
CC |
denotes |
and |
| T2061 |
7614-7617 |
DT |
denotes |
the |
| T2062 |
7628-7637 |
NN |
denotes |
cartilage |
| T2063 |
7618-7627 |
JJ |
denotes |
articular |
| T2064 |
7637-7638 |
. |
denotes |
. |
| T2065 |
7638-7885 |
sentence |
denotes |
Gdf5-Cre recombination bypasses the early embryonic lethality of null mutations in Bmpr1a, and shows that this receptor is required for early joint formation at some locations and for initiation of programmed cell death in webbing between digits. |
| T2066 |
7639-7643 |
NN |
denotes |
Gdf5 |
| T2067 |
7644-7647 |
NN |
denotes |
Cre |
| T2068 |
7643-7644 |
HYPH |
denotes |
- |
| T2069 |
7648-7661 |
NN |
denotes |
recombination |
| T2070 |
7662-7670 |
VBZ |
denotes |
bypasses |
| T2071 |
7671-7674 |
DT |
denotes |
the |
| T2072 |
7691-7700 |
NN |
denotes |
lethality |
| T2073 |
7675-7680 |
JJ |
denotes |
early |
| T2074 |
7681-7690 |
JJ |
denotes |
embryonic |
| T2075 |
7701-7703 |
IN |
denotes |
of |
| T2076 |
7704-7708 |
JJ |
denotes |
null |
| T2077 |
7709-7718 |
NNS |
denotes |
mutations |
| T2078 |
7719-7721 |
IN |
denotes |
in |
| T2079 |
7722-7728 |
NN |
denotes |
Bmpr1a |
| T2080 |
7728-7730 |
, |
denotes |
, |
| T2081 |
7730-7733 |
CC |
denotes |
and |
| T2082 |
7734-7739 |
VBZ |
denotes |
shows |
| T2083 |
7740-7744 |
IN |
denotes |
that |
| T2084 |
7762-7770 |
VBN |
denotes |
required |
| T2085 |
7745-7749 |
DT |
denotes |
this |
| T2086 |
7750-7758 |
NN |
denotes |
receptor |
| T2087 |
7759-7761 |
VBZ |
denotes |
is |
| T2088 |
7771-7774 |
IN |
denotes |
for |
| T2089 |
7775-7780 |
JJ |
denotes |
early |
| T2090 |
7787-7796 |
NN |
denotes |
formation |
| T2091 |
7781-7786 |
NN |
denotes |
joint |
| T2092 |
7797-7799 |
IN |
denotes |
at |
| T2093 |
7800-7804 |
DT |
denotes |
some |
| T2094 |
7805-7814 |
NNS |
denotes |
locations |
| T2095 |
7815-7818 |
CC |
denotes |
and |
| T2096 |
7819-7822 |
IN |
denotes |
for |
| T2097 |
7823-7833 |
NN |
denotes |
initiation |
| T2098 |
7834-7836 |
IN |
denotes |
of |
| T2099 |
7837-7847 |
VBN |
denotes |
programmed |
| T2100 |
7853-7858 |
NN |
denotes |
death |
| T2101 |
7848-7852 |
NN |
denotes |
cell |
| T2102 |
7859-7861 |
IN |
denotes |
in |
| T2103 |
7862-7869 |
VBG |
denotes |
webbing |
| T2104 |
7870-7877 |
IN |
denotes |
between |
| T2105 |
7878-7884 |
NNS |
denotes |
digits |
| T2106 |
7884-7885 |
. |
denotes |
. |
| T2107 |
7885-8006 |
sentence |
denotes |
Interestingly, Bmpr1a is also required for postnatal maintenance of articular cartilage throughout most of the skeleton. |
| T2108 |
7886-7899 |
RB |
denotes |
Interestingly |
| T2109 |
7908-7910 |
VBZ |
denotes |
is |
| T2110 |
7899-7901 |
, |
denotes |
, |
| T2111 |
7901-7907 |
NN |
denotes |
Bmpr1a |
| T2112 |
7911-7915 |
RB |
denotes |
also |
| T2113 |
7916-7924 |
VBN |
denotes |
required |
| T2114 |
7925-7928 |
IN |
denotes |
for |
| T2115 |
7929-7938 |
JJ |
denotes |
postnatal |
| T2116 |
7939-7950 |
NN |
denotes |
maintenance |
| T2117 |
7951-7953 |
IN |
denotes |
of |
| T2118 |
7954-7963 |
JJ |
denotes |
articular |
| T2119 |
7964-7973 |
NN |
denotes |
cartilage |
| T2120 |
7974-7984 |
IN |
denotes |
throughout |
| T2121 |
7985-7989 |
JJS |
denotes |
most |
| T2122 |
7990-7992 |
IN |
denotes |
of |
| T2123 |
7993-7996 |
DT |
denotes |
the |
| T2124 |
7997-8005 |
NN |
denotes |
skeleton |
| T2125 |
8005-8006 |
. |
denotes |
. |
| T2126 |
8006-8162 |
sentence |
denotes |
In Gdf5-Cre/Bmpr1afloxP mice, articular cartilage initially forms normally, but subsequently loses expression of several key cartilage markers after birth. |
| T2127 |
8007-8009 |
IN |
denotes |
In |
| T2128 |
8067-8072 |
VBZ |
denotes |
forms |
| T2129 |
8010-8014 |
NN |
denotes |
Gdf5 |
| T2130 |
8015-8018 |
NN |
denotes |
Cre |
| T2131 |
8014-8015 |
HYPH |
denotes |
- |
| T2132 |
8031-8035 |
NNS |
denotes |
mice |
| T2133 |
8018-8019 |
HYPH |
denotes |
/ |
| T2134 |
8019-8030 |
NN |
denotes |
Bmpr1afloxP |
| T2135 |
8035-8037 |
, |
denotes |
, |
| T2136 |
8037-8046 |
JJ |
denotes |
articular |
| T2137 |
8047-8056 |
NN |
denotes |
cartilage |
| T2138 |
8057-8066 |
RB |
denotes |
initially |
| T2139 |
8073-8081 |
RB |
denotes |
normally |
| T2140 |
8081-8083 |
, |
denotes |
, |
| T2141 |
8083-8086 |
CC |
denotes |
but |
| T2142 |
8087-8099 |
RB |
denotes |
subsequently |
| T2143 |
8100-8105 |
VBZ |
denotes |
loses |
| T2144 |
8106-8116 |
NN |
denotes |
expression |
| T2145 |
8117-8119 |
IN |
denotes |
of |
| T2146 |
8120-8127 |
JJ |
denotes |
several |
| T2147 |
8142-8149 |
NNS |
denotes |
markers |
| T2148 |
8128-8131 |
JJ |
denotes |
key |
| T2149 |
8132-8141 |
NN |
denotes |
cartilage |
| T2150 |
8150-8155 |
IN |
denotes |
after |
| T2151 |
8156-8161 |
NN |
denotes |
birth |
| T2152 |
8161-8162 |
. |
denotes |
. |
| T2153 |
8162-8262 |
sentence |
denotes |
It ultimately fibrillates and degenerates, resulting in severe osteoarthritis and loss of mobility. |
| T2154 |
8163-8165 |
PRP |
denotes |
It |
| T2155 |
8177-8188 |
VBZ |
denotes |
fibrillates |
| T2156 |
8166-8176 |
RB |
denotes |
ultimately |
| T2157 |
8189-8192 |
CC |
denotes |
and |
| T2158 |
8193-8204 |
VBZ |
denotes |
degenerates |
| T2159 |
8204-8206 |
, |
denotes |
, |
| T2160 |
8206-8215 |
VBG |
denotes |
resulting |
| T2161 |
8216-8218 |
IN |
denotes |
in |
| T2162 |
8219-8225 |
JJ |
denotes |
severe |
| T2163 |
8226-8240 |
NN |
denotes |
osteoarthritis |
| T2164 |
8241-8244 |
CC |
denotes |
and |
| T2165 |
8245-8249 |
NN |
denotes |
loss |
| T2166 |
8250-8252 |
IN |
denotes |
of |
| T2167 |
8253-8261 |
NN |
denotes |
mobility |
| T2168 |
8261-8262 |
. |
denotes |
. |
| T2169 |
8262-8470 |
sentence |
denotes |
These experiments suggest that BMP signaling is required for normal maintenance of postnatal articular cartilage, and that modulation of the BMP signaling pathway may play an important role in joint disease. |
| T2170 |
8263-8268 |
DT |
denotes |
These |
| T2171 |
8269-8280 |
NNS |
denotes |
experiments |
| T2172 |
8281-8288 |
VBP |
denotes |
suggest |
| T2173 |
8289-8293 |
IN |
denotes |
that |
| T2174 |
8311-8319 |
VBN |
denotes |
required |
| T2175 |
8294-8297 |
NN |
denotes |
BMP |
| T2176 |
8298-8307 |
NN |
denotes |
signaling |
| T2177 |
8308-8310 |
VBZ |
denotes |
is |
| T2178 |
8320-8323 |
IN |
denotes |
for |
| T2179 |
8324-8330 |
JJ |
denotes |
normal |
| T2180 |
8331-8342 |
NN |
denotes |
maintenance |
| T2181 |
8343-8345 |
IN |
denotes |
of |
| T2182 |
8346-8355 |
JJ |
denotes |
postnatal |
| T2183 |
8366-8375 |
NN |
denotes |
cartilage |
| T2184 |
8356-8365 |
JJ |
denotes |
articular |
| T2185 |
8375-8377 |
, |
denotes |
, |
| T2186 |
8377-8380 |
CC |
denotes |
and |
| T2187 |
8381-8385 |
IN |
denotes |
that |
| T2188 |
8430-8434 |
VB |
denotes |
play |
| T2189 |
8386-8396 |
NN |
denotes |
modulation |
| T2190 |
8397-8399 |
IN |
denotes |
of |
| T2191 |
8400-8403 |
DT |
denotes |
the |
| T2192 |
8418-8425 |
NN |
denotes |
pathway |
| T2193 |
8404-8407 |
NN |
denotes |
BMP |
| T2194 |
8408-8417 |
NN |
denotes |
signaling |
| T2195 |
8426-8429 |
MD |
denotes |
may |
| T2196 |
8435-8437 |
DT |
denotes |
an |
| T2197 |
8448-8452 |
NN |
denotes |
role |
| T2198 |
8438-8447 |
JJ |
denotes |
important |
| T2199 |
8453-8455 |
IN |
denotes |
in |
| T2200 |
8456-8461 |
NN |
denotes |
joint |
| T2201 |
8462-8469 |
NN |
denotes |
disease |
| T2202 |
8469-8470 |
. |
denotes |
. |
| T9672 |
42908-42915 |
VBN |
denotes |
delayed |
| T9673 |
42849-42862 |
NN |
denotes |
recombination |
| T2682 |
8481-8488 |
JJ |
denotes |
Genetic |
| T2683 |
8489-8495 |
NN |
denotes |
System |
| T2684 |
8496-8499 |
IN |
denotes |
for |
| T2685 |
8500-8507 |
VBG |
denotes |
Testing |
| T2686 |
8508-8511 |
DT |
denotes |
the |
| T2687 |
8512-8520 |
NN |
denotes |
Function |
| T2688 |
8521-8523 |
IN |
denotes |
of |
| T2689 |
8524-8529 |
NNS |
denotes |
Genes |
| T2690 |
8530-8532 |
IN |
denotes |
in |
| T2691 |
8533-8538 |
NN |
denotes |
Joint |
| T2692 |
8539-8550 |
NN |
denotes |
Development |
| T2693 |
8550-8752 |
sentence |
denotes |
To generate a general system capable of specifically testing genes for functions in skeletal joint development, we engineered transgenic mice to express Cre recombinase in developing joints (Figure 1). |
| T2694 |
8551-8553 |
TO |
denotes |
To |
| T2695 |
8554-8562 |
VB |
denotes |
generate |
| T2696 |
8666-8676 |
VBD |
denotes |
engineered |
| T2697 |
8563-8564 |
DT |
denotes |
a |
| T2698 |
8573-8579 |
NN |
denotes |
system |
| T2699 |
8565-8572 |
JJ |
denotes |
general |
| T2700 |
8580-8587 |
JJ |
denotes |
capable |
| T2701 |
8588-8590 |
IN |
denotes |
of |
| T2702 |
8591-8603 |
RB |
denotes |
specifically |
| T2703 |
8604-8611 |
VBG |
denotes |
testing |
| T2704 |
8612-8617 |
NNS |
denotes |
genes |
| T2705 |
8618-8621 |
IN |
denotes |
for |
| T2706 |
8622-8631 |
NNS |
denotes |
functions |
| T2707 |
8632-8634 |
IN |
denotes |
in |
| T2708 |
8635-8643 |
JJ |
denotes |
skeletal |
| T2709 |
8650-8661 |
NN |
denotes |
development |
| T2710 |
8644-8649 |
NN |
denotes |
joint |
| T2711 |
8661-8663 |
, |
denotes |
, |
| T2712 |
8663-8665 |
PRP |
denotes |
we |
| T2713 |
8677-8687 |
JJ |
denotes |
transgenic |
| T2714 |
8688-8692 |
NNS |
denotes |
mice |
| T2715 |
8693-8695 |
TO |
denotes |
to |
| T2716 |
8696-8703 |
VB |
denotes |
express |
| T2717 |
8704-8707 |
NN |
denotes |
Cre |
| T2718 |
8708-8719 |
NN |
denotes |
recombinase |
| T2719 |
8720-8722 |
IN |
denotes |
in |
| T2720 |
8723-8733 |
VBG |
denotes |
developing |
| T2721 |
8734-8740 |
NNS |
denotes |
joints |
| T2722 |
8741-8742 |
-LRB- |
denotes |
( |
| T2723 |
8742-8748 |
NN |
denotes |
Figure |
| T2724 |
8749-8750 |
CD |
denotes |
1 |
| T2725 |
8750-8751 |
-RRB- |
denotes |
) |
| T2726 |
8751-8752 |
. |
denotes |
. |
| T2727 |
8752-8867 |
sentence |
denotes |
Gdf5 is a gene strongly expressed in stripes across developing skeletal elements during embryonic joint formation. |
| T2728 |
8753-8757 |
NN |
denotes |
Gdf5 |
| T2729 |
8758-8760 |
VBZ |
denotes |
is |
| T2730 |
8761-8762 |
DT |
denotes |
a |
| T2731 |
8763-8767 |
NN |
denotes |
gene |
| T2732 |
8768-8776 |
RB |
denotes |
strongly |
| T2733 |
8777-8786 |
VBN |
denotes |
expressed |
| T2734 |
8787-8789 |
IN |
denotes |
in |
| T2735 |
8790-8797 |
NNS |
denotes |
stripes |
| T2736 |
8798-8804 |
IN |
denotes |
across |
| T2737 |
8805-8815 |
VBG |
denotes |
developing |
| T2738 |
8825-8833 |
NNS |
denotes |
elements |
| T2739 |
8816-8824 |
JJ |
denotes |
skeletal |
| T2740 |
8834-8840 |
IN |
denotes |
during |
| T2741 |
8841-8850 |
JJ |
denotes |
embryonic |
| T2742 |
8857-8866 |
NN |
denotes |
formation |
| T2743 |
8851-8856 |
NN |
denotes |
joint |
| T2744 |
8866-8867 |
. |
denotes |
. |
| T2745 |
8867-9154 |
sentence |
denotes |
A bacterial artificial chromosome (BAC) containing the Gdf5 locus was modified by homologous recombination in bacteria to insert a cassette encoding Cre-internal ribosome entry site (IRES)-human placental alkaline phosphatase (hPLAP) into the translation start site of Gdf5 (Figure 1A). |
| T2746 |
8868-8869 |
DT |
denotes |
A |
| T2747 |
8891-8901 |
NN |
denotes |
chromosome |
| T2748 |
8870-8879 |
JJ |
denotes |
bacterial |
| T2749 |
8880-8890 |
JJ |
denotes |
artificial |
| T2750 |
8938-8946 |
VBN |
denotes |
modified |
| T2751 |
8902-8903 |
-LRB- |
denotes |
( |
| T2752 |
8903-8906 |
NN |
denotes |
BAC |
| T2753 |
8906-8907 |
-RRB- |
denotes |
) |
| T2754 |
8908-8918 |
VBG |
denotes |
containing |
| T2755 |
8919-8922 |
DT |
denotes |
the |
| T2756 |
8928-8933 |
NN |
denotes |
locus |
| T2757 |
8923-8927 |
NN |
denotes |
Gdf5 |
| T2758 |
8934-8937 |
VBD |
denotes |
was |
| T2759 |
8947-8949 |
IN |
denotes |
by |
| T2760 |
8950-8960 |
JJ |
denotes |
homologous |
| T2761 |
8961-8974 |
NN |
denotes |
recombination |
| T2762 |
8975-8977 |
IN |
denotes |
in |
| T2763 |
8978-8986 |
NNS |
denotes |
bacteria |
| T2764 |
8987-8989 |
TO |
denotes |
to |
| T2765 |
8990-8996 |
VB |
denotes |
insert |
| T2766 |
8997-8998 |
DT |
denotes |
a |
| T2767 |
8999-9007 |
NN |
denotes |
cassette |
| T2768 |
9008-9016 |
VBG |
denotes |
encoding |
| T2769 |
9017-9020 |
NN |
denotes |
Cre |
| T2770 |
9082-9093 |
NN |
denotes |
phosphatase |
| T2771 |
9020-9021 |
HYPH |
denotes |
- |
| T2772 |
9021-9029 |
JJ |
denotes |
internal |
| T2773 |
9039-9044 |
NN |
denotes |
entry |
| T2774 |
9030-9038 |
NN |
denotes |
ribosome |
| T2775 |
9045-9049 |
NN |
denotes |
site |
| T2776 |
9050-9051 |
-LRB- |
denotes |
( |
| T2777 |
9051-9055 |
NN |
denotes |
IRES |
| T2778 |
9055-9056 |
-RRB- |
denotes |
) |
| T2779 |
9056-9057 |
HYPH |
denotes |
- |
| T2780 |
9057-9062 |
JJ |
denotes |
human |
| T2781 |
9063-9072 |
JJ |
denotes |
placental |
| T2782 |
9073-9081 |
NN |
denotes |
alkaline |
| T2783 |
9094-9095 |
-LRB- |
denotes |
( |
| T2784 |
9095-9100 |
NN |
denotes |
hPLAP |
| T2785 |
9100-9101 |
-RRB- |
denotes |
) |
| T2786 |
9102-9106 |
IN |
denotes |
into |
| T2787 |
9107-9110 |
DT |
denotes |
the |
| T2788 |
9129-9133 |
NN |
denotes |
site |
| T2789 |
9111-9122 |
NN |
denotes |
translation |
| T2790 |
9123-9128 |
NN |
denotes |
start |
| T2791 |
9134-9136 |
IN |
denotes |
of |
| T2792 |
9137-9141 |
NN |
denotes |
Gdf5 |
| T2793 |
9142-9143 |
-LRB- |
denotes |
( |
| T2794 |
9143-9149 |
NN |
denotes |
Figure |
| T2795 |
9150-9152 |
CD |
denotes |
1A |
| T2796 |
9152-9153 |
-RRB- |
denotes |
) |
| T2797 |
9153-9154 |
. |
denotes |
. |
| T2798 |
9154-9220 |
sentence |
denotes |
This modified BAC was then used to make lines of transgenic mice. |
| T2799 |
9155-9159 |
DT |
denotes |
This |
| T2800 |
9169-9172 |
NN |
denotes |
BAC |
| T2801 |
9160-9168 |
VBN |
denotes |
modified |
| T2802 |
9182-9186 |
VBN |
denotes |
used |
| T2803 |
9173-9176 |
VBD |
denotes |
was |
| T2804 |
9177-9181 |
RB |
denotes |
then |
| T2805 |
9187-9189 |
TO |
denotes |
to |
| T2806 |
9190-9194 |
VB |
denotes |
make |
| T2807 |
9195-9200 |
NNS |
denotes |
lines |
| T2808 |
9201-9203 |
IN |
denotes |
of |
| T2809 |
9204-9214 |
JJ |
denotes |
transgenic |
| T2810 |
9215-9219 |
NNS |
denotes |
mice |
| T2811 |
9219-9220 |
. |
denotes |
. |
| T2812 |
9220-9478 |
sentence |
denotes |
The resulting Gdf5-Cre transgenic mice were tested for transgene expression and Cre recombinase activity by crossing them to R26R reporter mice that activate the expression of lacZ after Cre-mediated removal of transcriptional stop sequences (Soriano 1999). |
| T2813 |
9221-9224 |
DT |
denotes |
The |
| T2814 |
9255-9259 |
NNS |
denotes |
mice |
| T2815 |
9225-9234 |
VBG |
denotes |
resulting |
| T2816 |
9235-9239 |
NN |
denotes |
Gdf5 |
| T2817 |
9240-9243 |
NN |
denotes |
Cre |
| T2818 |
9239-9240 |
HYPH |
denotes |
- |
| T2819 |
9244-9254 |
JJ |
denotes |
transgenic |
| T2820 |
9265-9271 |
VBN |
denotes |
tested |
| T2821 |
9260-9264 |
VBD |
denotes |
were |
| T2822 |
9272-9275 |
IN |
denotes |
for |
| T2823 |
9276-9285 |
NN |
denotes |
transgene |
| T2824 |
9286-9296 |
NN |
denotes |
expression |
| T2825 |
9297-9300 |
CC |
denotes |
and |
| T2826 |
9301-9304 |
NN |
denotes |
Cre |
| T2827 |
9305-9316 |
NN |
denotes |
recombinase |
| T2828 |
9317-9325 |
NN |
denotes |
activity |
| T2829 |
9326-9328 |
IN |
denotes |
by |
| T2830 |
9329-9337 |
VBG |
denotes |
crossing |
| T2831 |
9338-9342 |
PRP |
denotes |
them |
| T2832 |
9343-9345 |
IN |
denotes |
to |
| T2833 |
9346-9350 |
NN |
denotes |
R26R |
| T2834 |
9351-9359 |
NN |
denotes |
reporter |
| T2835 |
9360-9364 |
NNS |
denotes |
mice |
| T2836 |
9365-9369 |
WDT |
denotes |
that |
| T2837 |
9370-9378 |
VBP |
denotes |
activate |
| T2838 |
9379-9382 |
DT |
denotes |
the |
| T2839 |
9383-9393 |
NN |
denotes |
expression |
| T2840 |
9394-9396 |
IN |
denotes |
of |
| T2841 |
9397-9401 |
NN |
denotes |
lacZ |
| T2842 |
9402-9407 |
IN |
denotes |
after |
| T2843 |
9408-9411 |
NN |
denotes |
Cre |
| T2844 |
9412-9420 |
VBN |
denotes |
mediated |
| T2845 |
9411-9412 |
HYPH |
denotes |
- |
| T2846 |
9421-9428 |
NN |
denotes |
removal |
| T2847 |
9429-9431 |
IN |
denotes |
of |
| T2848 |
9432-9447 |
JJ |
denotes |
transcriptional |
| T2849 |
9453-9462 |
NNS |
denotes |
sequences |
| T2850 |
9448-9452 |
NN |
denotes |
stop |
| T2851 |
9463-9464 |
-LRB- |
denotes |
( |
| T2852 |
9464-9471 |
NNP |
denotes |
Soriano |
| T2853 |
9472-9476 |
CD |
denotes |
1999 |
| T2854 |
9476-9477 |
-RRB- |
denotes |
) |
| T2855 |
9477-9478 |
. |
denotes |
. |
| T2856 |
9478-9634 |
sentence |
denotes |
The resulting progeny were analyzed both for expression of the transgene by assaying HPLAP activity and for recombination of DNA by assaying LACZ activity. |
| T2857 |
9479-9482 |
DT |
denotes |
The |
| T2858 |
9493-9500 |
NN |
denotes |
progeny |
| T2859 |
9483-9492 |
VBG |
denotes |
resulting |
| T2860 |
9506-9514 |
VBN |
denotes |
analyzed |
| T2861 |
9501-9505 |
VBD |
denotes |
were |
| T2862 |
9515-9519 |
CC |
denotes |
both |
| T2863 |
9520-9523 |
IN |
denotes |
for |
| T2864 |
9524-9534 |
NN |
denotes |
expression |
| T2865 |
9535-9537 |
IN |
denotes |
of |
| T2866 |
9538-9541 |
DT |
denotes |
the |
| T2867 |
9542-9551 |
NN |
denotes |
transgene |
| T2868 |
9552-9554 |
IN |
denotes |
by |
| T2869 |
9555-9563 |
VBG |
denotes |
assaying |
| T2870 |
9564-9569 |
NN |
denotes |
HPLAP |
| T2871 |
9570-9578 |
NN |
denotes |
activity |
| T2872 |
9579-9582 |
CC |
denotes |
and |
| T2873 |
9583-9586 |
IN |
denotes |
for |
| T2874 |
9587-9600 |
NN |
denotes |
recombination |
| T2875 |
9601-9603 |
IN |
denotes |
of |
| T2876 |
9604-9607 |
NN |
denotes |
DNA |
| T2877 |
9608-9610 |
IN |
denotes |
by |
| T2878 |
9611-9619 |
VBG |
denotes |
assaying |
| T2879 |
9620-9624 |
NN |
denotes |
LACZ |
| T2880 |
9625-9633 |
NN |
denotes |
activity |
| T2881 |
9633-9634 |
. |
denotes |
. |
| T2882 |
9634-9798 |
sentence |
denotes |
The progeny from all three lines showed strong LACZ expression primarily in joints, and in two of three lines HPLAP expression could also be seen in joint regions. |
| T2883 |
9635-9638 |
DT |
denotes |
The |
| T2884 |
9639-9646 |
NN |
denotes |
progeny |
| T2885 |
9668-9674 |
VBD |
denotes |
showed |
| T2886 |
9647-9651 |
IN |
denotes |
from |
| T2887 |
9652-9655 |
DT |
denotes |
all |
| T2888 |
9662-9667 |
NNS |
denotes |
lines |
| T2889 |
9656-9661 |
CD |
denotes |
three |
| T2890 |
9675-9681 |
JJ |
denotes |
strong |
| T2891 |
9687-9697 |
NN |
denotes |
expression |
| T2892 |
9682-9686 |
NN |
denotes |
LACZ |
| T2893 |
9698-9707 |
RB |
denotes |
primarily |
| T2894 |
9708-9710 |
IN |
denotes |
in |
| T2895 |
9711-9717 |
NNS |
denotes |
joints |
| T2896 |
9717-9719 |
, |
denotes |
, |
| T2897 |
9719-9722 |
CC |
denotes |
and |
| T2898 |
9723-9725 |
IN |
denotes |
in |
| T2899 |
9776-9780 |
VBN |
denotes |
seen |
| T2900 |
9726-9729 |
CD |
denotes |
two |
| T2901 |
9733-9738 |
CD |
denotes |
three |
| T2902 |
9730-9732 |
IN |
denotes |
of |
| T2903 |
9739-9744 |
NNS |
denotes |
lines |
| T2904 |
9745-9750 |
NN |
denotes |
HPLAP |
| T2905 |
9751-9761 |
NN |
denotes |
expression |
| T2906 |
9762-9767 |
MD |
denotes |
could |
| T2907 |
9768-9772 |
RB |
denotes |
also |
| T2908 |
9773-9775 |
VB |
denotes |
be |
| T2909 |
9781-9783 |
IN |
denotes |
in |
| T2910 |
9784-9789 |
NN |
denotes |
joint |
| T2911 |
9790-9797 |
NNS |
denotes |
regions |
| T2912 |
9797-9798 |
. |
denotes |
. |
| T2913 |
9798-10036 |
sentence |
denotes |
Interestingly, HPLAP expression in the Gdf5-Cre transgenic GAC(A) line used for all subsequent breeding experiments was seen to precede LACZ expression during successive development of joints in the digits (Figure 1C) (unpublished data). |
| T2914 |
9799-9812 |
RB |
denotes |
Interestingly |
| T2915 |
9919-9923 |
VBN |
denotes |
seen |
| T2916 |
9812-9814 |
, |
denotes |
, |
| T2917 |
9814-9819 |
NN |
denotes |
HPLAP |
| T2918 |
9820-9830 |
NN |
denotes |
expression |
| T2919 |
9831-9833 |
IN |
denotes |
in |
| T2920 |
9834-9837 |
DT |
denotes |
the |
| T2921 |
9865-9869 |
NN |
denotes |
line |
| T2922 |
9838-9842 |
NN |
denotes |
Gdf5 |
| T2923 |
9843-9846 |
NN |
denotes |
Cre |
| T2924 |
9842-9843 |
HYPH |
denotes |
- |
| T2925 |
9847-9857 |
JJ |
denotes |
transgenic |
| T2926 |
9858-9861 |
NN |
denotes |
GAC |
| T2927 |
9862-9863 |
NN |
denotes |
A |
| T2928 |
9861-9862 |
-LRB- |
denotes |
( |
| T2929 |
9863-9864 |
-RRB- |
denotes |
) |
| T2930 |
9870-9874 |
VBN |
denotes |
used |
| T2931 |
9875-9878 |
IN |
denotes |
for |
| T2932 |
9879-9882 |
DT |
denotes |
all |
| T2933 |
9903-9914 |
NNS |
denotes |
experiments |
| T2934 |
9883-9893 |
JJ |
denotes |
subsequent |
| T2935 |
9894-9902 |
NN |
denotes |
breeding |
| T2936 |
9915-9918 |
VBD |
denotes |
was |
| T2937 |
9924-9926 |
TO |
denotes |
to |
| T2938 |
9927-9934 |
VB |
denotes |
precede |
| T2939 |
9935-9939 |
NN |
denotes |
LACZ |
| T2940 |
9940-9950 |
NN |
denotes |
expression |
| T2941 |
9951-9957 |
IN |
denotes |
during |
| T2942 |
9958-9968 |
JJ |
denotes |
successive |
| T2943 |
9969-9980 |
NN |
denotes |
development |
| T2944 |
9981-9983 |
IN |
denotes |
of |
| T2945 |
9984-9990 |
NNS |
denotes |
joints |
| T2946 |
9991-9993 |
IN |
denotes |
in |
| T2947 |
9994-9997 |
DT |
denotes |
the |
| T2948 |
9998-10004 |
NNS |
denotes |
digits |
| T2949 |
10005-10006 |
-LRB- |
denotes |
( |
| T2950 |
10006-10012 |
NN |
denotes |
Figure |
| T2951 |
10013-10015 |
CD |
denotes |
1C |
| T2952 |
10015-10016 |
-RRB- |
denotes |
) |
| T2953 |
10017-10018 |
-LRB- |
denotes |
( |
| T2954 |
10030-10034 |
NNS |
denotes |
data |
| T2955 |
10018-10029 |
JJ |
denotes |
unpublished |
| T2956 |
10034-10035 |
-RRB- |
denotes |
) |
| T2957 |
10035-10036 |
. |
denotes |
. |
| T2958 |
10036-10186 |
sentence |
denotes |
These experiments clearly demonstrate that the Gdf5-Cre transgene expresses Cre recombinase and causes DNA recombination in developing joint regions. |
| T2959 |
10037-10042 |
DT |
denotes |
These |
| T2960 |
10043-10054 |
NNS |
denotes |
experiments |
| T2961 |
10063-10074 |
VBP |
denotes |
demonstrate |
| T2962 |
10055-10062 |
RB |
denotes |
clearly |
| T2963 |
10075-10079 |
IN |
denotes |
that |
| T2964 |
10103-10112 |
VBZ |
denotes |
expresses |
| T2965 |
10080-10083 |
DT |
denotes |
the |
| T2966 |
10093-10102 |
NN |
denotes |
transgene |
| T2967 |
10084-10088 |
NN |
denotes |
Gdf5 |
| T2968 |
10089-10092 |
NN |
denotes |
Cre |
| T2969 |
10088-10089 |
HYPH |
denotes |
- |
| T2970 |
10113-10116 |
NN |
denotes |
Cre |
| T2971 |
10117-10128 |
NN |
denotes |
recombinase |
| T2972 |
10129-10132 |
CC |
denotes |
and |
| T2973 |
10133-10139 |
VBZ |
denotes |
causes |
| T2974 |
10140-10143 |
NN |
denotes |
DNA |
| T2975 |
10144-10157 |
NN |
denotes |
recombination |
| T2976 |
10158-10160 |
IN |
denotes |
in |
| T2977 |
10161-10171 |
VBG |
denotes |
developing |
| T2978 |
10178-10185 |
NNS |
denotes |
regions |
| T2979 |
10172-10177 |
NN |
denotes |
joint |
| T2980 |
10185-10186 |
. |
denotes |
. |
| T2981 |
10186-12005 |
sentence |
denotes |
Figure 1 A Genetic System to Drive Gene Recombination in Developing Joints
(A) A 140-kb BAC from the Gdf5 locus was modified by inserting Cre-IRES-hPLAP into the translation start site of Gdf5 and used to make transgenic mice. Not to scale. See Materials and Methods for details.
(B–E) Visualization of Gdf5-Cre driven recombination patterns based on activation of lacZ expression from the R26R Cre reporter allele. (B) LACZ activity is visible as blue staining in the ear (ea) and the joints of the shoulder (s), elbow (eb), wrist (w), knee (k), ankle (a), vertebra (vj), and phalanges (black arrowheads) of an E14.5 mouse embryo. (C) E14.5 hindlimb double-stained to show both HPLAP expression from the transgene (grey/purple staining) and LACZ expression from the rearranged R26R allele (blue staining). Note that both markers are visible in the oldest, proximal interphalangeal joint (black arrowhead), only HPLAP activity is visible in the more recently formed medial interphalangeal joint (black arrow), and neither HPLAP nor LACZ expression is visible in the youngest, most distal joint of the digit (white arrowhead). (D) Newborn (P0) forelimb with skin partially removed showing LACZ activity expressed in all phalangeal joints (red Salmon gal staining, black arrowheads) and regions of some tendons (asterisk). (E) Section through the most distal phalangeal joint of a P0 hindlimb stained with Alcian blue to mark cartilage showing LACZ expression (stained red) in all tissues of developing joints: articular cartilage (black arrowhead), precursors of ligaments and synovial membranes (black arrow), and cells where cavitation is occurring (asterisk). GAC(A) mice were crossed with lacZ ROSA26 Cre reporter strain (R26R) mice to analyze the pattern of Cre-mediated lacZ recombination throughout development. |
| T2982 |
11850-11853 |
NN |
denotes |
GAC |
| T2983 |
11854-11855 |
NN |
denotes |
A |
| T2984 |
11853-11854 |
-LRB- |
denotes |
( |
| T2985 |
11857-11861 |
NNS |
denotes |
mice |
| T2986 |
11855-11856 |
-RRB- |
denotes |
) |
| T2987 |
11867-11874 |
VBN |
denotes |
crossed |
| T2988 |
11862-11866 |
VBD |
denotes |
were |
| T2989 |
11875-11879 |
IN |
denotes |
with |
| T2990 |
11880-11884 |
NN |
denotes |
lacZ |
| T2991 |
11892-11895 |
NN |
denotes |
Cre |
| T2992 |
11885-11891 |
NN |
denotes |
ROSA26 |
| T2993 |
11896-11904 |
NN |
denotes |
reporter |
| T2994 |
11905-11911 |
NN |
denotes |
strain |
| T2995 |
11919-11923 |
NNS |
denotes |
mice |
| T2996 |
11912-11913 |
-LRB- |
denotes |
( |
| T2997 |
11913-11917 |
NN |
denotes |
R26R |
| T2998 |
11917-11918 |
-RRB- |
denotes |
) |
| T2999 |
11924-11926 |
TO |
denotes |
to |
| T3000 |
11927-11934 |
VB |
denotes |
analyze |
| T3001 |
11935-11938 |
DT |
denotes |
the |
| T3002 |
11939-11946 |
NN |
denotes |
pattern |
| T3003 |
11947-11949 |
IN |
denotes |
of |
| T3004 |
11950-11953 |
NN |
denotes |
Cre |
| T3005 |
11954-11962 |
VBN |
denotes |
mediated |
| T3006 |
11953-11954 |
HYPH |
denotes |
- |
| T3007 |
11968-11981 |
NN |
denotes |
recombination |
| T3008 |
11963-11967 |
NN |
denotes |
lacZ |
| T3009 |
11982-11992 |
IN |
denotes |
throughout |
| T3010 |
11993-12004 |
NN |
denotes |
development |
| T3011 |
12004-12005 |
. |
denotes |
. |
| T3012 |
12005-12136 |
sentence |
denotes |
Joints in developing limbs begin forming in a proximal-distal pattern such that the shoulder joint forms prior to the elbow joint. |
| T3013 |
12006-12012 |
NNS |
denotes |
Joints |
| T3014 |
12033-12038 |
VBP |
denotes |
begin |
| T3015 |
12013-12015 |
IN |
denotes |
in |
| T3016 |
12016-12026 |
VBG |
denotes |
developing |
| T3017 |
12027-12032 |
NNS |
denotes |
limbs |
| T3018 |
12039-12046 |
VBG |
denotes |
forming |
| T3019 |
12047-12049 |
IN |
denotes |
in |
| T3020 |
12050-12051 |
DT |
denotes |
a |
| T3021 |
12068-12075 |
NN |
denotes |
pattern |
| T3022 |
12052-12060 |
JJ |
denotes |
proximal |
| T3023 |
12061-12067 |
JJ |
denotes |
distal |
| T3024 |
12060-12061 |
HYPH |
denotes |
- |
| T3025 |
12076-12080 |
JJ |
denotes |
such |
| T3026 |
12105-12110 |
VBZ |
denotes |
forms |
| T3027 |
12081-12085 |
IN |
denotes |
that |
| T3028 |
12086-12089 |
DT |
denotes |
the |
| T3029 |
12099-12104 |
NN |
denotes |
joint |
| T3030 |
12090-12098 |
NN |
denotes |
shoulder |
| T3031 |
12111-12116 |
RB |
denotes |
prior |
| T3032 |
12117-12119 |
IN |
denotes |
to |
| T3033 |
12120-12123 |
DT |
denotes |
the |
| T3034 |
12130-12135 |
NN |
denotes |
joint |
| T3035 |
12124-12129 |
NN |
denotes |
elbow |
| T3036 |
12135-12136 |
. |
denotes |
. |
| T3037 |
12136-12327 |
sentence |
denotes |
In addition, three major stages of early joint development have been defined by histology as (1) interzone formation, (2) three-layer interzone formation, and (3) cavitation (Mitrovic 1978). |
| T3038 |
12137-12139 |
IN |
denotes |
In |
| T3039 |
12206-12213 |
VBN |
denotes |
defined |
| T3040 |
12140-12148 |
NN |
denotes |
addition |
| T3041 |
12148-12150 |
, |
denotes |
, |
| T3042 |
12150-12155 |
CD |
denotes |
three |
| T3043 |
12162-12168 |
NNS |
denotes |
stages |
| T3044 |
12156-12161 |
JJ |
denotes |
major |
| T3045 |
12169-12171 |
IN |
denotes |
of |
| T3046 |
12172-12177 |
JJ |
denotes |
early |
| T3047 |
12184-12195 |
NN |
denotes |
development |
| T3048 |
12178-12183 |
NN |
denotes |
joint |
| T3049 |
12196-12200 |
VBP |
denotes |
have |
| T3050 |
12201-12205 |
VBN |
denotes |
been |
| T3051 |
12214-12216 |
IN |
denotes |
by |
| T3052 |
12217-12226 |
NN |
denotes |
histology |
| T3053 |
12227-12229 |
IN |
denotes |
as |
| T3054 |
12230-12231 |
-LRB- |
denotes |
( |
| T3055 |
12231-12232 |
LS |
denotes |
1 |
| T3056 |
12244-12253 |
NN |
denotes |
formation |
| T3057 |
12232-12233 |
-RRB- |
denotes |
) |
| T3058 |
12234-12243 |
NN |
denotes |
interzone |
| T3059 |
12253-12255 |
, |
denotes |
, |
| T3060 |
12255-12256 |
-LRB- |
denotes |
( |
| T3061 |
12256-12257 |
LS |
denotes |
2 |
| T3062 |
12281-12290 |
NN |
denotes |
formation |
| T3063 |
12257-12258 |
-RRB- |
denotes |
) |
| T3064 |
12259-12264 |
CD |
denotes |
three |
| T3065 |
12265-12270 |
NN |
denotes |
layer |
| T3066 |
12264-12265 |
HYPH |
denotes |
- |
| T3067 |
12271-12280 |
NN |
denotes |
interzone |
| T3068 |
12290-12292 |
, |
denotes |
, |
| T3069 |
12292-12295 |
CC |
denotes |
and |
| T3070 |
12296-12297 |
-LRB- |
denotes |
( |
| T3071 |
12297-12298 |
LS |
denotes |
3 |
| T3072 |
12300-12310 |
NN |
denotes |
cavitation |
| T3073 |
12298-12299 |
-RRB- |
denotes |
) |
| T3074 |
12311-12312 |
-LRB- |
denotes |
( |
| T3075 |
12312-12320 |
NNP |
denotes |
Mitrovic |
| T3076 |
12321-12325 |
CD |
denotes |
1978 |
| T3077 |
12325-12326 |
-RRB- |
denotes |
) |
| T3078 |
12326-12327 |
. |
denotes |
. |
| T3079 |
12327-12539 |
sentence |
denotes |
Consistent with the proximal-distal pattern of joint development in the limbs, LACZ activity is seen at embryonic day 12.5 (E12.5) in the more proximal joints, including the shoulder and knee (unpublished data). |
| T3080 |
12328-12338 |
JJ |
denotes |
Consistent |
| T3081 |
12424-12428 |
VBN |
denotes |
seen |
| T3082 |
12339-12343 |
IN |
denotes |
with |
| T3083 |
12344-12347 |
DT |
denotes |
the |
| T3084 |
12364-12371 |
NN |
denotes |
pattern |
| T3085 |
12348-12356 |
JJ |
denotes |
proximal |
| T3086 |
12357-12363 |
JJ |
denotes |
distal |
| T3087 |
12356-12357 |
HYPH |
denotes |
- |
| T3088 |
12372-12374 |
IN |
denotes |
of |
| T3089 |
12375-12380 |
NN |
denotes |
joint |
| T3090 |
12381-12392 |
NN |
denotes |
development |
| T3091 |
12393-12395 |
IN |
denotes |
in |
| T3092 |
12396-12399 |
DT |
denotes |
the |
| T3093 |
12400-12405 |
NNS |
denotes |
limbs |
| T3094 |
12405-12407 |
, |
denotes |
, |
| T3095 |
12407-12411 |
NN |
denotes |
LACZ |
| T3096 |
12412-12420 |
NN |
denotes |
activity |
| T3097 |
12421-12423 |
VBZ |
denotes |
is |
| T3098 |
12429-12431 |
IN |
denotes |
at |
| T3099 |
12432-12441 |
JJ |
denotes |
embryonic |
| T3100 |
12442-12445 |
NN |
denotes |
day |
| T3101 |
12446-12450 |
CD |
denotes |
12.5 |
| T3102 |
12451-12452 |
-LRB- |
denotes |
( |
| T3103 |
12452-12457 |
NN |
denotes |
E12.5 |
| T3104 |
12457-12458 |
-RRB- |
denotes |
) |
| T3105 |
12459-12461 |
IN |
denotes |
in |
| T3106 |
12462-12465 |
DT |
denotes |
the |
| T3107 |
12480-12486 |
NNS |
denotes |
joints |
| T3108 |
12466-12470 |
RBR |
denotes |
more |
| T3109 |
12471-12479 |
JJ |
denotes |
proximal |
| T3110 |
12486-12488 |
, |
denotes |
, |
| T3111 |
12488-12497 |
VBG |
denotes |
including |
| T3112 |
12498-12501 |
DT |
denotes |
the |
| T3113 |
12502-12510 |
NN |
denotes |
shoulder |
| T3114 |
12511-12514 |
CC |
denotes |
and |
| T3115 |
12515-12519 |
NN |
denotes |
knee |
| T3116 |
12520-12521 |
-LRB- |
denotes |
( |
| T3117 |
12533-12537 |
NNS |
denotes |
data |
| T3118 |
12521-12532 |
JJ |
denotes |
unpublished |
| T3119 |
12537-12538 |
-RRB- |
denotes |
) |
| T3120 |
12538-12539 |
. |
denotes |
. |
| T3121 |
12539-12741 |
sentence |
denotes |
By E14.5, LACZ expression is typically seen in all but the most distal joints of the limbs (Figure 1B and 1C), but with some variability in both strength and extent of expression from embryo to embryo. |
| T3122 |
12540-12542 |
IN |
denotes |
By |
| T3123 |
12579-12583 |
VBN |
denotes |
seen |
| T3124 |
12543-12548 |
NN |
denotes |
E14.5 |
| T3125 |
12548-12550 |
, |
denotes |
, |
| T3126 |
12550-12554 |
NN |
denotes |
LACZ |
| T3127 |
12555-12565 |
NN |
denotes |
expression |
| T3128 |
12566-12568 |
VBZ |
denotes |
is |
| T3129 |
12569-12578 |
RB |
denotes |
typically |
| T3130 |
12584-12586 |
IN |
denotes |
in |
| T3131 |
12587-12590 |
DT |
denotes |
all |
| T3132 |
12591-12594 |
IN |
denotes |
but |
| T3133 |
12595-12598 |
DT |
denotes |
the |
| T3134 |
12611-12617 |
NNS |
denotes |
joints |
| T3135 |
12599-12603 |
RBS |
denotes |
most |
| T3136 |
12604-12610 |
JJ |
denotes |
distal |
| T3137 |
12618-12620 |
IN |
denotes |
of |
| T3138 |
12621-12624 |
DT |
denotes |
the |
| T3139 |
12625-12630 |
NNS |
denotes |
limbs |
| T3140 |
12631-12632 |
-LRB- |
denotes |
( |
| T3141 |
12639-12641 |
CD |
denotes |
1B |
| T3142 |
12632-12638 |
NN |
denotes |
Figure |
| T3143 |
12642-12645 |
CC |
denotes |
and |
| T3144 |
12646-12648 |
CD |
denotes |
1C |
| T3145 |
12648-12649 |
-RRB- |
denotes |
) |
| T3146 |
12649-12651 |
, |
denotes |
, |
| T3147 |
12651-12654 |
CC |
denotes |
but |
| T3148 |
12655-12659 |
IN |
denotes |
with |
| T3149 |
12660-12664 |
DT |
denotes |
some |
| T3150 |
12665-12676 |
NN |
denotes |
variability |
| T3151 |
12677-12679 |
IN |
denotes |
in |
| T3152 |
12680-12684 |
CC |
denotes |
both |
| T3153 |
12685-12693 |
NN |
denotes |
strength |
| T3154 |
12694-12697 |
CC |
denotes |
and |
| T3155 |
12698-12704 |
NN |
denotes |
extent |
| T3156 |
12705-12707 |
IN |
denotes |
of |
| T3157 |
12708-12718 |
NN |
denotes |
expression |
| T3158 |
12719-12723 |
IN |
denotes |
from |
| T3159 |
12724-12730 |
NN |
denotes |
embryo |
| T3160 |
12731-12733 |
IN |
denotes |
to |
| T3161 |
12734-12740 |
NN |
denotes |
embryo |
| T3162 |
12740-12741 |
. |
denotes |
. |
| T3163 |
12741-12924 |
sentence |
denotes |
The strongest-staining embryos often have additional staining in fingertips (not seen in the E14.5 embryo in Figure 1C, but clearly detectable in the E13.5 embryo shown in Figure 2). |
| T3164 |
12742-12745 |
DT |
denotes |
The |
| T3165 |
12765-12772 |
NNS |
denotes |
embryos |
| T3166 |
12746-12755 |
RBS |
denotes |
strongest |
| T3167 |
12756-12764 |
VBG |
denotes |
staining |
| T3168 |
12755-12756 |
HYPH |
denotes |
- |
| T3169 |
12779-12783 |
VBP |
denotes |
have |
| T3170 |
12773-12778 |
RB |
denotes |
often |
| T3171 |
12784-12794 |
JJ |
denotes |
additional |
| T3172 |
12795-12803 |
NN |
denotes |
staining |
| T3173 |
12804-12806 |
IN |
denotes |
in |
| T3174 |
12807-12817 |
NNS |
denotes |
fingertips |
| T3175 |
12818-12819 |
-LRB- |
denotes |
( |
| T3176 |
12823-12827 |
VBN |
denotes |
seen |
| T3177 |
12819-12822 |
RB |
denotes |
not |
| T3178 |
12828-12830 |
IN |
denotes |
in |
| T3179 |
12831-12834 |
DT |
denotes |
the |
| T3180 |
12841-12847 |
NN |
denotes |
embryo |
| T3181 |
12835-12840 |
NN |
denotes |
E14.5 |
| T3182 |
12848-12850 |
IN |
denotes |
in |
| T3183 |
12851-12857 |
NN |
denotes |
Figure |
| T3184 |
12858-12860 |
CD |
denotes |
1C |
| T3185 |
12860-12862 |
, |
denotes |
, |
| T3186 |
12862-12865 |
CC |
denotes |
but |
| T3187 |
12866-12873 |
RB |
denotes |
clearly |
| T3188 |
12874-12884 |
JJ |
denotes |
detectable |
| T3189 |
12885-12887 |
IN |
denotes |
in |
| T3190 |
12888-12891 |
DT |
denotes |
the |
| T3191 |
12898-12904 |
NN |
denotes |
embryo |
| T3192 |
12892-12897 |
NN |
denotes |
E13.5 |
| T3193 |
12905-12910 |
VBN |
denotes |
shown |
| T3194 |
12911-12913 |
IN |
denotes |
in |
| T3195 |
12914-12920 |
NN |
denotes |
Figure |
| T3196 |
12921-12922 |
CD |
denotes |
2 |
| T3197 |
12922-12923 |
-RRB- |
denotes |
) |
| T3198 |
12923-12924 |
. |
denotes |
. |
| T3199 |
12924-13042 |
sentence |
denotes |
Sections through developing joints show that LACZ is present in many cells at the interzone stage (unpublished data). |
| T3200 |
12925-12933 |
NNS |
denotes |
Sections |
| T3201 |
12960-12964 |
VBP |
denotes |
show |
| T3202 |
12934-12941 |
IN |
denotes |
through |
| T3203 |
12942-12952 |
VBG |
denotes |
developing |
| T3204 |
12953-12959 |
NNS |
denotes |
joints |
| T3205 |
12965-12969 |
IN |
denotes |
that |
| T3206 |
12975-12977 |
VBZ |
denotes |
is |
| T3207 |
12970-12974 |
NN |
denotes |
LACZ |
| T3208 |
12978-12985 |
JJ |
denotes |
present |
| T3209 |
12986-12988 |
IN |
denotes |
in |
| T3210 |
12989-12993 |
JJ |
denotes |
many |
| T3211 |
12994-12999 |
NNS |
denotes |
cells |
| T3212 |
13000-13002 |
IN |
denotes |
at |
| T3213 |
13003-13006 |
DT |
denotes |
the |
| T3214 |
13017-13022 |
NN |
denotes |
stage |
| T3215 |
13007-13016 |
NN |
denotes |
interzone |
| T3216 |
13023-13024 |
-LRB- |
denotes |
( |
| T3217 |
13036-13040 |
NNS |
denotes |
data |
| T3218 |
13024-13035 |
JJ |
denotes |
unpublished |
| T3219 |
13040-13041 |
-RRB- |
denotes |
) |
| T3220 |
13041-13042 |
. |
denotes |
. |
| T3221 |
13042-13259 |
sentence |
denotes |
However, expression of LACZ in nearly 100% of joint cells is not achieved until the three-layer interzone stage (for example, in the knee joint at E14.5 or in any of the phalangeal joints at E16.5 (unpublished data). |
| T3222 |
13043-13050 |
RB |
denotes |
However |
| T3223 |
13108-13116 |
VBN |
denotes |
achieved |
| T3224 |
13050-13052 |
, |
denotes |
, |
| T3225 |
13052-13062 |
NN |
denotes |
expression |
| T3226 |
13063-13065 |
IN |
denotes |
of |
| T3227 |
13066-13070 |
NN |
denotes |
LACZ |
| T3228 |
13071-13073 |
IN |
denotes |
in |
| T3229 |
13074-13080 |
RB |
denotes |
nearly |
| T3230 |
13081-13084 |
CD |
denotes |
100 |
| T3231 |
13084-13085 |
NN |
denotes |
% |
| T3232 |
13086-13088 |
IN |
denotes |
of |
| T3233 |
13089-13094 |
NN |
denotes |
joint |
| T3234 |
13095-13100 |
NNS |
denotes |
cells |
| T3235 |
13101-13103 |
VBZ |
denotes |
is |
| T3236 |
13104-13107 |
RB |
denotes |
not |
| T3237 |
13117-13122 |
IN |
denotes |
until |
| T3238 |
13123-13126 |
DT |
denotes |
the |
| T3239 |
13149-13154 |
NN |
denotes |
stage |
| T3240 |
13127-13132 |
CD |
denotes |
three |
| T3241 |
13133-13138 |
NN |
denotes |
layer |
| T3242 |
13132-13133 |
HYPH |
denotes |
- |
| T3243 |
13139-13148 |
NN |
denotes |
interzone |
| T3244 |
13155-13156 |
-LRB- |
denotes |
( |
| T3245 |
13156-13159 |
IN |
denotes |
for |
| T3246 |
13160-13167 |
NN |
denotes |
example |
| T3247 |
13167-13169 |
, |
denotes |
, |
| T3248 |
13169-13171 |
IN |
denotes |
in |
| T3249 |
13172-13175 |
DT |
denotes |
the |
| T3250 |
13181-13186 |
NN |
denotes |
joint |
| T3251 |
13176-13180 |
NN |
denotes |
knee |
| T3252 |
13187-13189 |
IN |
denotes |
at |
| T3253 |
13190-13195 |
NN |
denotes |
E14.5 |
| T3254 |
13196-13198 |
CC |
denotes |
or |
| T3255 |
13199-13201 |
IN |
denotes |
in |
| T3256 |
13202-13205 |
DT |
denotes |
any |
| T3257 |
13206-13208 |
IN |
denotes |
of |
| T3258 |
13209-13212 |
DT |
denotes |
the |
| T3259 |
13224-13230 |
NNS |
denotes |
joints |
| T3260 |
13213-13223 |
JJ |
denotes |
phalangeal |
| T3261 |
13231-13233 |
IN |
denotes |
at |
| T3262 |
13234-13239 |
NN |
denotes |
E16.5 |
| T3263 |
13240-13241 |
-LRB- |
denotes |
( |
| T3264 |
13253-13257 |
NNS |
denotes |
data |
| T3265 |
13241-13252 |
JJ |
denotes |
unpublished |
| T3266 |
13257-13258 |
-RRB- |
denotes |
) |
| T3267 |
13258-13259 |
. |
denotes |
. |
| T3268 |
13259-13385 |
sentence |
denotes |
Within the developing skeleton, Cre-mediated expression of LACZ remains strikingly specific to joints throughout development. |
| T3269 |
13260-13266 |
IN |
denotes |
Within |
| T3270 |
13324-13331 |
VBZ |
denotes |
remains |
| T3271 |
13267-13270 |
DT |
denotes |
the |
| T3272 |
13282-13290 |
NN |
denotes |
skeleton |
| T3273 |
13271-13281 |
VBG |
denotes |
developing |
| T3274 |
13290-13292 |
, |
denotes |
, |
| T3275 |
13292-13295 |
NN |
denotes |
Cre |
| T3276 |
13296-13304 |
VBN |
denotes |
mediated |
| T3277 |
13295-13296 |
HYPH |
denotes |
- |
| T3278 |
13305-13315 |
NN |
denotes |
expression |
| T3279 |
13316-13318 |
IN |
denotes |
of |
| T3280 |
13319-13323 |
NN |
denotes |
LACZ |
| T3281 |
13332-13342 |
RB |
denotes |
strikingly |
| T3282 |
13343-13351 |
JJ |
denotes |
specific |
| T3283 |
13352-13354 |
IN |
denotes |
to |
| T3284 |
13355-13361 |
NNS |
denotes |
joints |
| T3285 |
13362-13372 |
IN |
denotes |
throughout |
| T3286 |
13373-13384 |
NN |
denotes |
development |
| T3287 |
13384-13385 |
. |
denotes |
. |
| T3288 |
13385-13571 |
sentence |
denotes |
Furthermore, it is seen in all the structures of postnatal synovial joints including the articular cartilage, joint capsule, and synovial membrane (Figure 1D and 1E) (unpublished data). |
| T3289 |
13386-13397 |
RB |
denotes |
Furthermore |
| T3290 |
13405-13409 |
VBN |
denotes |
seen |
| T3291 |
13397-13399 |
, |
denotes |
, |
| T3292 |
13399-13401 |
PRP |
denotes |
it |
| T3293 |
13402-13404 |
VBZ |
denotes |
is |
| T3294 |
13410-13412 |
IN |
denotes |
in |
| T3295 |
13413-13416 |
PDT |
denotes |
all |
| T3296 |
13421-13431 |
NNS |
denotes |
structures |
| T3297 |
13417-13420 |
DT |
denotes |
the |
| T3298 |
13432-13434 |
IN |
denotes |
of |
| T3299 |
13435-13444 |
JJ |
denotes |
postnatal |
| T3300 |
13454-13460 |
NNS |
denotes |
joints |
| T3301 |
13445-13453 |
JJ |
denotes |
synovial |
| T3302 |
13461-13470 |
VBG |
denotes |
including |
| T3303 |
13471-13474 |
DT |
denotes |
the |
| T3304 |
13485-13494 |
NN |
denotes |
cartilage |
| T3305 |
13475-13484 |
JJ |
denotes |
articular |
| T3306 |
13494-13496 |
, |
denotes |
, |
| T3307 |
13496-13501 |
NN |
denotes |
joint |
| T3308 |
13502-13509 |
NN |
denotes |
capsule |
| T3309 |
13509-13511 |
, |
denotes |
, |
| T3310 |
13511-13514 |
CC |
denotes |
and |
| T3311 |
13515-13523 |
JJ |
denotes |
synovial |
| T3312 |
13524-13532 |
NN |
denotes |
membrane |
| T3313 |
13533-13534 |
-LRB- |
denotes |
( |
| T3314 |
13534-13540 |
NN |
denotes |
Figure |
| T3315 |
13541-13543 |
CD |
denotes |
1D |
| T3316 |
13544-13547 |
CC |
denotes |
and |
| T3317 |
13548-13550 |
CD |
denotes |
1E |
| T3318 |
13550-13551 |
-RRB- |
denotes |
) |
| T3319 |
13552-13553 |
-LRB- |
denotes |
( |
| T3320 |
13565-13569 |
NNS |
denotes |
data |
| T3321 |
13553-13564 |
JJ |
denotes |
unpublished |
| T3322 |
13569-13570 |
-RRB- |
denotes |
) |
| T3323 |
13570-13571 |
. |
denotes |
. |
| T3324 |
13571-13723 |
sentence |
denotes |
These patterns are consistent with the well-established expression of Gdf5 in interzone regions during embryonic development (Storm and Kingsley 1996). |
| T3325 |
13572-13577 |
DT |
denotes |
These |
| T3326 |
13578-13586 |
NNS |
denotes |
patterns |
| T3327 |
13587-13590 |
VBP |
denotes |
are |
| T3328 |
13591-13601 |
JJ |
denotes |
consistent |
| T3329 |
13602-13606 |
IN |
denotes |
with |
| T3330 |
13607-13610 |
DT |
denotes |
the |
| T3331 |
13628-13638 |
NN |
denotes |
expression |
| T3332 |
13611-13615 |
RB |
denotes |
well |
| T3333 |
13616-13627 |
VBN |
denotes |
established |
| T3334 |
13615-13616 |
HYPH |
denotes |
- |
| T3335 |
13639-13641 |
IN |
denotes |
of |
| T3336 |
13642-13646 |
NN |
denotes |
Gdf5 |
| T3337 |
13647-13649 |
IN |
denotes |
in |
| T3338 |
13650-13659 |
NN |
denotes |
interzone |
| T3339 |
13660-13667 |
NNS |
denotes |
regions |
| T3340 |
13668-13674 |
IN |
denotes |
during |
| T3341 |
13675-13684 |
JJ |
denotes |
embryonic |
| T3342 |
13685-13696 |
NN |
denotes |
development |
| T3343 |
13697-13698 |
-LRB- |
denotes |
( |
| T3344 |
13698-13703 |
NNP |
denotes |
Storm |
| T3345 |
13704-13707 |
CC |
denotes |
and |
| T3346 |
13708-13716 |
NNP |
denotes |
Kingsley |
| T3347 |
13717-13721 |
CD |
denotes |
1996 |
| T3348 |
13721-13722 |
-RRB- |
denotes |
) |
| T3349 |
13722-13723 |
. |
denotes |
. |
| T3350 |
13723-13980 |
sentence |
denotes |
Adult expression patterns of the Gdf5 gene are not as well characterized, but Gdf5 expression has previously been detected in adult articular cartilage using both RT-PCR and immunocytochemistry (Chang et al. 1994; Erlacher et al. 1998; Bobacz et al. 2002). |
| T3351 |
13724-13729 |
NN |
denotes |
Adult |
| T3352 |
13741-13749 |
NNS |
denotes |
patterns |
| T3353 |
13730-13740 |
NN |
denotes |
expression |
| T3354 |
13767-13770 |
VBP |
denotes |
are |
| T3355 |
13750-13752 |
IN |
denotes |
of |
| T3356 |
13753-13756 |
DT |
denotes |
the |
| T3357 |
13762-13766 |
NN |
denotes |
gene |
| T3358 |
13757-13761 |
NN |
denotes |
Gdf5 |
| T3359 |
13771-13774 |
RB |
denotes |
not |
| T3360 |
13775-13777 |
RB |
denotes |
as |
| T3361 |
13783-13796 |
VBN |
denotes |
characterized |
| T3362 |
13778-13782 |
RB |
denotes |
well |
| T3363 |
13796-13798 |
, |
denotes |
, |
| T3364 |
13798-13801 |
CC |
denotes |
but |
| T3365 |
13802-13806 |
NN |
denotes |
Gdf5 |
| T3366 |
13807-13817 |
NN |
denotes |
expression |
| T3367 |
13838-13846 |
VBN |
denotes |
detected |
| T3368 |
13818-13821 |
VBZ |
denotes |
has |
| T3369 |
13822-13832 |
RB |
denotes |
previously |
| T3370 |
13833-13837 |
VBN |
denotes |
been |
| T3371 |
13847-13849 |
IN |
denotes |
in |
| T3372 |
13850-13855 |
NN |
denotes |
adult |
| T3373 |
13866-13875 |
NN |
denotes |
cartilage |
| T3374 |
13856-13865 |
JJ |
denotes |
articular |
| T3375 |
13876-13881 |
VBG |
denotes |
using |
| T3376 |
13882-13886 |
CC |
denotes |
both |
| T3377 |
13890-13893 |
NN |
denotes |
PCR |
| T3378 |
13887-13889 |
NN |
denotes |
RT |
| T3379 |
13889-13890 |
HYPH |
denotes |
- |
| T3380 |
13894-13897 |
CC |
denotes |
and |
| T3381 |
13898-13917 |
NN |
denotes |
immunocytochemistry |
| T3382 |
13918-13919 |
-LRB- |
denotes |
( |
| T3383 |
13919-13924 |
NNP |
denotes |
Chang |
| T3384 |
13925-13927 |
FW |
denotes |
et |
| T3385 |
13928-13931 |
FW |
denotes |
al. |
| T3386 |
13932-13936 |
CD |
denotes |
1994 |
| T3387 |
13936-13937 |
: |
denotes |
; |
| T3388 |
13938-13946 |
NNP |
denotes |
Erlacher |
| T3389 |
13947-13949 |
FW |
denotes |
et |
| T3390 |
13950-13953 |
FW |
denotes |
al. |
| T3391 |
13954-13958 |
CD |
denotes |
1998 |
| T3392 |
13958-13959 |
: |
denotes |
; |
| T3393 |
13960-13966 |
NNP |
denotes |
Bobacz |
| T3394 |
13967-13969 |
FW |
denotes |
et |
| T3395 |
13970-13973 |
FW |
denotes |
al. |
| T3396 |
13974-13978 |
CD |
denotes |
2002 |
| T3397 |
13978-13979 |
-RRB- |
denotes |
) |
| T3398 |
13979-13980 |
. |
denotes |
. |
| T3399 |
13980-15452 |
sentence |
denotes |
Figure 2 Bmpr1a Is Required for Webbing Regression and Apoptosis in Specific Regions of the Limb
(A and B) Control E14.5 forelimb (A) compared to a, E14.5 mutant forelimb (B) showing webbing between digits 1 and 2 (arrowheads) and extra tissue at the posterior of digit 5 (arrows).
(C) Gdf5-Cre induced lacZ expression from R26R in an E13.5 forelimb showing LACZ staining (blue) in metacarpal-phalangeal joints, between digits 1 and 2 (arrowhead), and in a region posterior to digit 5 (arrow).
(D and E) Sections of E14.5 hindlimbs showing apoptosis visualized by TUNEL staining (green) and proliferation visualized by staining for histone H3 phosphorylation (red). Controls show strong, uniform TUNEL staining between digits 1 and 2 (D, arrowhead) while mutants show patchy TUNEL staining interspersed with mitotic cells in similar regions (E). Scale bar = 200 μm.
(F) Quantitation of TUNEL staining and mitotic cells in the posterior region of the fifth digit shows apoptosis is reduced 30% while proliferation is increased 20% (asterisks indicate statistically significant difference).
(G and H) By E15.5, interdigital tissue has regressed in controls (G, arrowhead). In contrast, tissue remains in mutants at this location, primarily derived from cells that have undergone Gdf5-Cre-mediated recombination that inactivates Bmpr1a function and activates expression of LACZ (H). Scale bar = 75 μm. Other sites besides limb joints also have Cre-mediated lacZ expression. |
| T3400 |
15381-15386 |
JJ |
denotes |
Other |
| T3401 |
15387-15392 |
NNS |
denotes |
sites |
| T3402 |
15418-15422 |
VBP |
denotes |
have |
| T3403 |
15393-15400 |
IN |
denotes |
besides |
| T3404 |
15401-15405 |
NN |
denotes |
limb |
| T3405 |
15406-15412 |
NNS |
denotes |
joints |
| T3406 |
15413-15417 |
RB |
denotes |
also |
| T3407 |
15423-15426 |
NN |
denotes |
Cre |
| T3408 |
15427-15435 |
VBN |
denotes |
mediated |
| T3409 |
15426-15427 |
HYPH |
denotes |
- |
| T3410 |
15441-15451 |
NN |
denotes |
expression |
| T3411 |
15436-15440 |
NN |
denotes |
lacZ |
| T3412 |
15451-15452 |
. |
denotes |
. |
| T3413 |
15452-15562 |
sentence |
denotes |
Starting at E13.5, LACZ activity is detected in an anterior and posterior domain of the limb bud (Figure 2C). |
| T3414 |
15453-15461 |
VBG |
denotes |
Starting |
| T3415 |
15489-15497 |
VBN |
denotes |
detected |
| T3416 |
15462-15464 |
IN |
denotes |
at |
| T3417 |
15465-15470 |
NN |
denotes |
E13.5 |
| T3418 |
15470-15472 |
, |
denotes |
, |
| T3419 |
15472-15476 |
NN |
denotes |
LACZ |
| T3420 |
15477-15485 |
NN |
denotes |
activity |
| T3421 |
15486-15488 |
VBZ |
denotes |
is |
| T3422 |
15498-15500 |
IN |
denotes |
in |
| T3423 |
15501-15503 |
DT |
denotes |
an |
| T3424 |
15527-15533 |
NN |
denotes |
domain |
| T3425 |
15504-15512 |
JJ |
denotes |
anterior |
| T3426 |
15513-15516 |
CC |
denotes |
and |
| T3427 |
15517-15526 |
JJ |
denotes |
posterior |
| T3428 |
15534-15536 |
IN |
denotes |
of |
| T3429 |
15537-15540 |
DT |
denotes |
the |
| T3430 |
15546-15549 |
NN |
denotes |
bud |
| T3431 |
15541-15545 |
NN |
denotes |
limb |
| T3432 |
15550-15551 |
-LRB- |
denotes |
( |
| T3433 |
15551-15557 |
NN |
denotes |
Figure |
| T3434 |
15558-15560 |
CD |
denotes |
2C |
| T3435 |
15560-15561 |
-RRB- |
denotes |
) |
| T3436 |
15561-15562 |
. |
denotes |
. |
| T3437 |
15562-15744 |
sentence |
denotes |
At E14.5, LACZ activity is detectable in the developing ear pinnae, ribs, sternum, tissues in the face, and some regions of the brain and spinal cord (Figure 1B) (unpublished data). |
| T3438 |
15563-15565 |
IN |
denotes |
At |
| T3439 |
15587-15589 |
VBZ |
denotes |
is |
| T3440 |
15566-15571 |
NN |
denotes |
E14.5 |
| T3441 |
15571-15573 |
, |
denotes |
, |
| T3442 |
15573-15577 |
NN |
denotes |
LACZ |
| T3443 |
15578-15586 |
NN |
denotes |
activity |
| T3444 |
15590-15600 |
JJ |
denotes |
detectable |
| T3445 |
15601-15603 |
IN |
denotes |
in |
| T3446 |
15604-15607 |
DT |
denotes |
the |
| T3447 |
15623-15629 |
NNS |
denotes |
pinnae |
| T3448 |
15608-15618 |
VBG |
denotes |
developing |
| T3449 |
15619-15622 |
NN |
denotes |
ear |
| T3450 |
15629-15631 |
, |
denotes |
, |
| T3451 |
15631-15635 |
NNS |
denotes |
ribs |
| T3452 |
15635-15637 |
, |
denotes |
, |
| T3453 |
15637-15644 |
NN |
denotes |
sternum |
| T3454 |
15644-15646 |
, |
denotes |
, |
| T3455 |
15646-15653 |
NNS |
denotes |
tissues |
| T3456 |
15654-15656 |
IN |
denotes |
in |
| T3457 |
15657-15660 |
DT |
denotes |
the |
| T3458 |
15661-15665 |
NN |
denotes |
face |
| T3459 |
15665-15667 |
, |
denotes |
, |
| T3460 |
15667-15670 |
CC |
denotes |
and |
| T3461 |
15671-15675 |
DT |
denotes |
some |
| T3462 |
15676-15683 |
NNS |
denotes |
regions |
| T3463 |
15684-15686 |
IN |
denotes |
of |
| T3464 |
15687-15690 |
DT |
denotes |
the |
| T3465 |
15691-15696 |
NN |
denotes |
brain |
| T3466 |
15697-15700 |
CC |
denotes |
and |
| T3467 |
15701-15707 |
JJ |
denotes |
spinal |
| T3468 |
15708-15712 |
NN |
denotes |
cord |
| T3469 |
15713-15714 |
-LRB- |
denotes |
( |
| T3470 |
15714-15720 |
NN |
denotes |
Figure |
| T3471 |
15721-15723 |
CD |
denotes |
1B |
| T3472 |
15723-15724 |
-RRB- |
denotes |
) |
| T3473 |
15725-15726 |
-LRB- |
denotes |
( |
| T3474 |
15738-15742 |
NNS |
denotes |
data |
| T3475 |
15726-15737 |
JJ |
denotes |
unpublished |
| T3476 |
15742-15743 |
-RRB- |
denotes |
) |
| T3477 |
15743-15744 |
. |
denotes |
. |
| T3478 |
15744-15926 |
sentence |
denotes |
At birth, LACZ is also expressed in tendons running along the vertebral column, regions of tendons in the wrist and ankle, and some tendon insertions (Figure 1D) (unpublished data). |
| T3479 |
15745-15747 |
IN |
denotes |
At |
| T3480 |
15768-15777 |
VBN |
denotes |
expressed |
| T3481 |
15748-15753 |
NN |
denotes |
birth |
| T3482 |
15753-15755 |
, |
denotes |
, |
| T3483 |
15755-15759 |
NN |
denotes |
LACZ |
| T3484 |
15760-15762 |
VBZ |
denotes |
is |
| T3485 |
15763-15767 |
RB |
denotes |
also |
| T3486 |
15778-15780 |
IN |
denotes |
in |
| T3487 |
15781-15788 |
NNS |
denotes |
tendons |
| T3488 |
15789-15796 |
VBG |
denotes |
running |
| T3489 |
15797-15802 |
IN |
denotes |
along |
| T3490 |
15803-15806 |
DT |
denotes |
the |
| T3491 |
15817-15823 |
NN |
denotes |
column |
| T3492 |
15807-15816 |
JJ |
denotes |
vertebral |
| T3493 |
15823-15825 |
, |
denotes |
, |
| T3494 |
15825-15832 |
NNS |
denotes |
regions |
| T3495 |
15833-15835 |
IN |
denotes |
of |
| T3496 |
15836-15843 |
NNS |
denotes |
tendons |
| T3497 |
15844-15846 |
IN |
denotes |
in |
| T3498 |
15847-15850 |
DT |
denotes |
the |
| T3499 |
15851-15856 |
NN |
denotes |
wrist |
| T3500 |
15857-15860 |
CC |
denotes |
and |
| T3501 |
15861-15866 |
NN |
denotes |
ankle |
| T3502 |
15866-15868 |
, |
denotes |
, |
| T3503 |
15868-15871 |
CC |
denotes |
and |
| T3504 |
15872-15876 |
DT |
denotes |
some |
| T3505 |
15884-15894 |
NNS |
denotes |
insertions |
| T3506 |
15877-15883 |
NN |
denotes |
tendon |
| T3507 |
15895-15896 |
-LRB- |
denotes |
( |
| T3508 |
15896-15902 |
NN |
denotes |
Figure |
| T3509 |
15903-15905 |
CD |
denotes |
1D |
| T3510 |
15905-15906 |
-RRB- |
denotes |
) |
| T3511 |
15907-15908 |
-LRB- |
denotes |
( |
| T3512 |
15920-15924 |
NNS |
denotes |
data |
| T3513 |
15908-15919 |
JJ |
denotes |
unpublished |
| T3514 |
15924-15925 |
-RRB- |
denotes |
) |
| T3515 |
15925-15926 |
. |
denotes |
. |
| T3516 |
15926-16115 |
sentence |
denotes |
By 5 wk of age, LACZ is also expressed in the hair follicles, ear cartilage, some cells in the growth plate of the long bones, and portions of the brain and spinal cord (unpublished data). |
| T3517 |
15927-15929 |
IN |
denotes |
By |
| T3518 |
15956-15965 |
VBN |
denotes |
expressed |
| T3519 |
15930-15931 |
CD |
denotes |
5 |
| T3520 |
15932-15934 |
NNS |
denotes |
wk |
| T3521 |
15935-15937 |
IN |
denotes |
of |
| T3522 |
15938-15941 |
NN |
denotes |
age |
| T3523 |
15941-15943 |
, |
denotes |
, |
| T3524 |
15943-15947 |
NN |
denotes |
LACZ |
| T3525 |
15948-15950 |
VBZ |
denotes |
is |
| T3526 |
15951-15955 |
RB |
denotes |
also |
| T3527 |
15966-15968 |
IN |
denotes |
in |
| T3528 |
15969-15972 |
DT |
denotes |
the |
| T3529 |
15978-15987 |
NNS |
denotes |
follicles |
| T3530 |
15973-15977 |
NN |
denotes |
hair |
| T3531 |
15987-15989 |
, |
denotes |
, |
| T3532 |
15989-15992 |
NN |
denotes |
ear |
| T3533 |
15993-16002 |
NN |
denotes |
cartilage |
| T3534 |
16002-16004 |
, |
denotes |
, |
| T3535 |
16004-16008 |
DT |
denotes |
some |
| T3536 |
16009-16014 |
NNS |
denotes |
cells |
| T3537 |
16015-16017 |
IN |
denotes |
in |
| T3538 |
16018-16021 |
DT |
denotes |
the |
| T3539 |
16029-16034 |
NN |
denotes |
plate |
| T3540 |
16022-16028 |
NN |
denotes |
growth |
| T3541 |
16035-16037 |
IN |
denotes |
of |
| T3542 |
16038-16041 |
DT |
denotes |
the |
| T3543 |
16047-16052 |
NNS |
denotes |
bones |
| T3544 |
16042-16046 |
JJ |
denotes |
long |
| T3545 |
16052-16054 |
, |
denotes |
, |
| T3546 |
16054-16057 |
CC |
denotes |
and |
| T3547 |
16058-16066 |
NNS |
denotes |
portions |
| T3548 |
16067-16069 |
IN |
denotes |
of |
| T3549 |
16070-16073 |
DT |
denotes |
the |
| T3550 |
16074-16079 |
NN |
denotes |
brain |
| T3551 |
16080-16083 |
CC |
denotes |
and |
| T3552 |
16084-16090 |
JJ |
denotes |
spinal |
| T3553 |
16091-16095 |
NN |
denotes |
cord |
| T3554 |
16096-16097 |
-LRB- |
denotes |
( |
| T3555 |
16109-16113 |
NNS |
denotes |
data |
| T3556 |
16097-16108 |
JJ |
denotes |
unpublished |
| T3557 |
16113-16114 |
-RRB- |
denotes |
) |
| T3558 |
16114-16115 |
. |
denotes |
. |
| T3559 |
16115-16298 |
sentence |
denotes |
Surprisingly, 23 of 63, or 37% of transgenic mice analyzed also show some degree of wider “ectopic” LACZ expression, which can extend throughout many different tissues in the animal. |
| T3560 |
16116-16128 |
RB |
denotes |
Surprisingly |
| T3561 |
16180-16184 |
VBP |
denotes |
show |
| T3562 |
16128-16130 |
, |
denotes |
, |
| T3563 |
16130-16132 |
CD |
denotes |
23 |
| T3564 |
16136-16138 |
CD |
denotes |
63 |
| T3565 |
16133-16135 |
IN |
denotes |
of |
| T3566 |
16138-16140 |
, |
denotes |
, |
| T3567 |
16140-16142 |
CC |
denotes |
or |
| T3568 |
16143-16145 |
CD |
denotes |
37 |
| T3569 |
16145-16146 |
NN |
denotes |
% |
| T3570 |
16147-16149 |
IN |
denotes |
of |
| T3571 |
16150-16160 |
JJ |
denotes |
transgenic |
| T3572 |
16161-16165 |
NNS |
denotes |
mice |
| T3573 |
16166-16174 |
VBN |
denotes |
analyzed |
| T3574 |
16175-16179 |
RB |
denotes |
also |
| T3575 |
16185-16189 |
DT |
denotes |
some |
| T3576 |
16190-16196 |
NN |
denotes |
degree |
| T3577 |
16197-16199 |
IN |
denotes |
of |
| T3578 |
16200-16205 |
JJR |
denotes |
wider |
| T3579 |
16221-16231 |
NN |
denotes |
expression |
| T3580 |
16206-16207 |
`` |
denotes |
“ |
| T3581 |
16207-16214 |
JJ |
denotes |
ectopic |
| T3582 |
16214-16215 |
'' |
denotes |
” |
| T3583 |
16216-16220 |
NN |
denotes |
LACZ |
| T3584 |
16231-16233 |
, |
denotes |
, |
| T3585 |
16233-16238 |
WDT |
denotes |
which |
| T3586 |
16243-16249 |
VB |
denotes |
extend |
| T3587 |
16239-16242 |
MD |
denotes |
can |
| T3588 |
16250-16260 |
IN |
denotes |
throughout |
| T3589 |
16261-16265 |
JJ |
denotes |
many |
| T3590 |
16276-16283 |
NNS |
denotes |
tissues |
| T3591 |
16266-16275 |
JJ |
denotes |
different |
| T3592 |
16284-16286 |
IN |
denotes |
in |
| T3593 |
16287-16290 |
DT |
denotes |
the |
| T3594 |
16291-16297 |
NN |
denotes |
animal |
| T3595 |
16297-16298 |
. |
denotes |
. |
| T3596 |
16298-16532 |
sentence |
denotes |
However, sustained expression of the transgene itself, as assayed by HPLAP activity, is still restricted primarily to joints in animals that show evidence of more generalized recombination based on LACZ expression (unpublished data). |
| T3597 |
16299-16306 |
RB |
denotes |
However |
| T3598 |
16384-16386 |
VBZ |
denotes |
is |
| T3599 |
16306-16308 |
, |
denotes |
, |
| T3600 |
16308-16317 |
VBN |
denotes |
sustained |
| T3601 |
16318-16328 |
NN |
denotes |
expression |
| T3602 |
16329-16331 |
IN |
denotes |
of |
| T3603 |
16332-16335 |
DT |
denotes |
the |
| T3604 |
16336-16345 |
NN |
denotes |
transgene |
| T3605 |
16346-16352 |
PRP |
denotes |
itself |
| T3606 |
16352-16354 |
, |
denotes |
, |
| T3607 |
16354-16356 |
IN |
denotes |
as |
| T3608 |
16357-16364 |
VBN |
denotes |
assayed |
| T3609 |
16365-16367 |
IN |
denotes |
by |
| T3610 |
16368-16373 |
NN |
denotes |
HPLAP |
| T3611 |
16374-16382 |
NN |
denotes |
activity |
| T3612 |
16382-16384 |
, |
denotes |
, |
| T3613 |
16387-16392 |
RB |
denotes |
still |
| T3614 |
16393-16403 |
VBN |
denotes |
restricted |
| T3615 |
16404-16413 |
RB |
denotes |
primarily |
| T3616 |
16414-16416 |
IN |
denotes |
to |
| T3617 |
16417-16423 |
NNS |
denotes |
joints |
| T3618 |
16424-16426 |
IN |
denotes |
in |
| T3619 |
16427-16434 |
NNS |
denotes |
animals |
| T3620 |
16435-16439 |
WDT |
denotes |
that |
| T3621 |
16440-16444 |
VBP |
denotes |
show |
| T3622 |
16445-16453 |
NN |
denotes |
evidence |
| T3623 |
16454-16456 |
IN |
denotes |
of |
| T3624 |
16457-16461 |
RBR |
denotes |
more |
| T3625 |
16462-16473 |
VBN |
denotes |
generalized |
| T3626 |
16474-16487 |
NN |
denotes |
recombination |
| T3627 |
16488-16493 |
VBN |
denotes |
based |
| T3628 |
16494-16496 |
IN |
denotes |
on |
| T3629 |
16497-16501 |
NN |
denotes |
LACZ |
| T3630 |
16502-16512 |
NN |
denotes |
expression |
| T3631 |
16513-16514 |
-LRB- |
denotes |
( |
| T3632 |
16526-16530 |
NNS |
denotes |
data |
| T3633 |
16514-16525 |
JJ |
denotes |
unpublished |
| T3634 |
16530-16531 |
-RRB- |
denotes |
) |
| T3635 |
16531-16532 |
. |
denotes |
. |
| T3636 |
16532-16711 |
sentence |
denotes |
This suggests that in a fraction of animals, sporadic expression of Cre at some time early in development is sufficient to lead to both ectopic recombination and LACZ expression. |
| T3637 |
16533-16537 |
DT |
denotes |
This |
| T3638 |
16538-16546 |
VBZ |
denotes |
suggests |
| T3639 |
16547-16551 |
IN |
denotes |
that |
| T3640 |
16639-16641 |
VBZ |
denotes |
is |
| T3641 |
16552-16554 |
IN |
denotes |
in |
| T3642 |
16555-16556 |
DT |
denotes |
a |
| T3643 |
16557-16565 |
NN |
denotes |
fraction |
| T3644 |
16566-16568 |
IN |
denotes |
of |
| T3645 |
16569-16576 |
NNS |
denotes |
animals |
| T3646 |
16576-16578 |
, |
denotes |
, |
| T3647 |
16578-16586 |
JJ |
denotes |
sporadic |
| T3648 |
16587-16597 |
NN |
denotes |
expression |
| T3649 |
16598-16600 |
IN |
denotes |
of |
| T3650 |
16601-16604 |
NN |
denotes |
Cre |
| T3651 |
16605-16607 |
IN |
denotes |
at |
| T3652 |
16608-16612 |
DT |
denotes |
some |
| T3653 |
16613-16617 |
NN |
denotes |
time |
| T3654 |
16618-16623 |
RB |
denotes |
early |
| T3655 |
16624-16626 |
IN |
denotes |
in |
| T3656 |
16627-16638 |
NN |
denotes |
development |
| T3657 |
16642-16652 |
JJ |
denotes |
sufficient |
| T3658 |
16653-16655 |
TO |
denotes |
to |
| T3659 |
16656-16660 |
VB |
denotes |
lead |
| T3660 |
16661-16663 |
IN |
denotes |
to |
| T3661 |
16664-16668 |
CC |
denotes |
both |
| T3662 |
16677-16690 |
NN |
denotes |
recombination |
| T3663 |
16669-16676 |
JJ |
denotes |
ectopic |
| T3664 |
16691-16694 |
CC |
denotes |
and |
| T3665 |
16695-16699 |
NN |
denotes |
LACZ |
| T3666 |
16700-16710 |
NN |
denotes |
expression |
| T3667 |
16710-16711 |
. |
denotes |
. |
| T3668 |
16711-17005 |
sentence |
denotes |
While the fraction of animals with broader recombination patterns must be tracked and accounted for during experiments, these animals offer the potential benefit of revealing additional new functions of target genes that could be subsequently studied with additional site-specific Cre drivers. |
| T3669 |
16712-16717 |
IN |
denotes |
While |
| T3670 |
16786-16793 |
VBN |
denotes |
tracked |
| T3671 |
16718-16721 |
DT |
denotes |
the |
| T3672 |
16722-16730 |
NN |
denotes |
fraction |
| T3673 |
16731-16733 |
IN |
denotes |
of |
| T3674 |
16734-16741 |
NNS |
denotes |
animals |
| T3675 |
16742-16746 |
IN |
denotes |
with |
| T3676 |
16747-16754 |
JJR |
denotes |
broader |
| T3677 |
16769-16777 |
NNS |
denotes |
patterns |
| T3678 |
16755-16768 |
NN |
denotes |
recombination |
| T3679 |
16778-16782 |
MD |
denotes |
must |
| T3680 |
16783-16785 |
VB |
denotes |
be |
| T3681 |
16846-16851 |
VBP |
denotes |
offer |
| T3682 |
16794-16797 |
CC |
denotes |
and |
| T3683 |
16798-16807 |
VBN |
denotes |
accounted |
| T3684 |
16808-16811 |
IN |
denotes |
for |
| T3685 |
16812-16818 |
IN |
denotes |
during |
| T3686 |
16819-16830 |
NNS |
denotes |
experiments |
| T3687 |
16830-16832 |
, |
denotes |
, |
| T3688 |
16832-16837 |
DT |
denotes |
these |
| T3689 |
16838-16845 |
NNS |
denotes |
animals |
| T3690 |
16852-16855 |
DT |
denotes |
the |
| T3691 |
16866-16873 |
NN |
denotes |
benefit |
| T3692 |
16856-16865 |
JJ |
denotes |
potential |
| T3693 |
16874-16876 |
IN |
denotes |
of |
| T3694 |
16877-16886 |
VBG |
denotes |
revealing |
| T3695 |
16887-16897 |
JJ |
denotes |
additional |
| T3696 |
16902-16911 |
NNS |
denotes |
functions |
| T3697 |
16898-16901 |
JJ |
denotes |
new |
| T3698 |
16912-16914 |
IN |
denotes |
of |
| T3699 |
16915-16921 |
NN |
denotes |
target |
| T3700 |
16922-16927 |
NNS |
denotes |
genes |
| T3701 |
16928-16932 |
WDT |
denotes |
that |
| T3702 |
16955-16962 |
VBN |
denotes |
studied |
| T3703 |
16933-16938 |
MD |
denotes |
could |
| T3704 |
16939-16941 |
VB |
denotes |
be |
| T3705 |
16942-16954 |
RB |
denotes |
subsequently |
| T3706 |
16963-16967 |
IN |
denotes |
with |
| T3707 |
16968-16978 |
JJ |
denotes |
additional |
| T3708 |
16997-17004 |
NNS |
denotes |
drivers |
| T3709 |
16979-16983 |
NN |
denotes |
site |
| T3710 |
16983-16984 |
HYPH |
denotes |
- |
| T3711 |
16984-16992 |
JJ |
denotes |
specific |
| T3712 |
16993-16996 |
NN |
denotes |
Cre |
| T3713 |
17004-17005 |
. |
denotes |
. |
| T3948 |
17007-17011 |
NN |
denotes |
Gdf5 |
| T3949 |
17012-17015 |
NN |
denotes |
Cre |
| T3950 |
17011-17012 |
HYPH |
denotes |
- |
| T3951 |
17028-17035 |
NNS |
denotes |
Animals |
| T3952 |
17015-17016 |
HYPH |
denotes |
/ |
| T3953 |
17016-17027 |
NN |
denotes |
Bmpr1afloxP |
| T3954 |
17036-17043 |
VBP |
denotes |
Survive |
| T3955 |
17044-17046 |
IN |
denotes |
to |
| T3956 |
17047-17056 |
NN |
denotes |
Adulthood |
| T3957 |
17057-17061 |
IN |
denotes |
with |
| T3958 |
17062-17065 |
NN |
denotes |
Ear |
| T3959 |
17086-17093 |
NNS |
denotes |
Defects |
| T3960 |
17065-17067 |
, |
denotes |
, |
| T3961 |
17067-17074 |
NN |
denotes |
Webbing |
| T3962 |
17074-17076 |
, |
denotes |
, |
| T3963 |
17076-17079 |
CC |
denotes |
and |
| T3964 |
17080-17085 |
NN |
denotes |
Joint |
| T3965 |
17093-17193 |
sentence |
denotes |
We next used the Gdf5-Cre system to test the role of BMP signaling during normal joint development. |
| T3966 |
17094-17096 |
PRP |
denotes |
We |
| T3967 |
17102-17106 |
VBD |
denotes |
used |
| T3968 |
17097-17101 |
RB |
denotes |
next |
| T3969 |
17107-17110 |
DT |
denotes |
the |
| T3970 |
17120-17126 |
NN |
denotes |
system |
| T3971 |
17111-17115 |
NN |
denotes |
Gdf5 |
| T3972 |
17116-17119 |
NN |
denotes |
Cre |
| T3973 |
17115-17116 |
HYPH |
denotes |
- |
| T3974 |
17127-17129 |
TO |
denotes |
to |
| T3975 |
17130-17134 |
VB |
denotes |
test |
| T3976 |
17135-17138 |
DT |
denotes |
the |
| T3977 |
17139-17143 |
NN |
denotes |
role |
| T3978 |
17144-17146 |
IN |
denotes |
of |
| T3979 |
17147-17150 |
NN |
denotes |
BMP |
| T3980 |
17151-17160 |
NN |
denotes |
signaling |
| T3981 |
17161-17167 |
IN |
denotes |
during |
| T3982 |
17168-17174 |
JJ |
denotes |
normal |
| T3983 |
17181-17192 |
NN |
denotes |
development |
| T3984 |
17175-17180 |
NN |
denotes |
joint |
| T3985 |
17192-17193 |
. |
denotes |
. |
| T3986 |
17193-17484 |
sentence |
denotes |
Gdf5-Cre transgenic mice were bred to animals carrying a conditional floxed allele of the Bmpr1a locus (Mishina et al. 2002), usually in the presence of the R26R reporter allele to facilitate simultaneous visualization of Cre-mediated recombination patterns (see typical cross in Figure 3). |
| T3987 |
17194-17198 |
NN |
denotes |
Gdf5 |
| T3988 |
17199-17202 |
NN |
denotes |
Cre |
| T3989 |
17198-17199 |
HYPH |
denotes |
- |
| T3990 |
17214-17218 |
NNS |
denotes |
mice |
| T3991 |
17203-17213 |
JJ |
denotes |
transgenic |
| T3992 |
17224-17228 |
VBN |
denotes |
bred |
| T3993 |
17219-17223 |
VBD |
denotes |
were |
| T3994 |
17229-17231 |
IN |
denotes |
to |
| T3995 |
17232-17239 |
NNS |
denotes |
animals |
| T3996 |
17240-17248 |
VBG |
denotes |
carrying |
| T3997 |
17249-17250 |
DT |
denotes |
a |
| T3998 |
17270-17276 |
NN |
denotes |
allele |
| T3999 |
17251-17262 |
JJ |
denotes |
conditional |
| T4000 |
17263-17269 |
VBN |
denotes |
floxed |
| T4001 |
17277-17279 |
IN |
denotes |
of |
| T4002 |
17280-17283 |
DT |
denotes |
the |
| T4003 |
17291-17296 |
NN |
denotes |
locus |
| T4004 |
17284-17290 |
NN |
denotes |
Bmpr1a |
| T4005 |
17297-17298 |
-LRB- |
denotes |
( |
| T4006 |
17298-17305 |
NNP |
denotes |
Mishina |
| T4007 |
17306-17308 |
FW |
denotes |
et |
| T4008 |
17309-17312 |
FW |
denotes |
al. |
| T4009 |
17313-17317 |
CD |
denotes |
2002 |
| T4010 |
17317-17318 |
-RRB- |
denotes |
) |
| T4011 |
17318-17320 |
, |
denotes |
, |
| T4012 |
17320-17327 |
RB |
denotes |
usually |
| T4013 |
17328-17330 |
IN |
denotes |
in |
| T4014 |
17331-17334 |
DT |
denotes |
the |
| T4015 |
17335-17343 |
NN |
denotes |
presence |
| T4016 |
17344-17346 |
IN |
denotes |
of |
| T4017 |
17347-17350 |
DT |
denotes |
the |
| T4018 |
17365-17371 |
NN |
denotes |
allele |
| T4019 |
17351-17355 |
NN |
denotes |
R26R |
| T4020 |
17356-17364 |
NN |
denotes |
reporter |
| T4021 |
17372-17374 |
TO |
denotes |
to |
| T4022 |
17375-17385 |
VB |
denotes |
facilitate |
| T4023 |
17386-17398 |
JJ |
denotes |
simultaneous |
| T4024 |
17399-17412 |
NN |
denotes |
visualization |
| T4025 |
17413-17415 |
IN |
denotes |
of |
| T4026 |
17416-17419 |
NN |
denotes |
Cre |
| T4027 |
17420-17428 |
VBN |
denotes |
mediated |
| T4028 |
17419-17420 |
HYPH |
denotes |
- |
| T4029 |
17443-17451 |
NNS |
denotes |
patterns |
| T4030 |
17429-17442 |
NN |
denotes |
recombination |
| T4031 |
17452-17453 |
-LRB- |
denotes |
( |
| T4032 |
17453-17456 |
VB |
denotes |
see |
| T4033 |
17457-17464 |
JJ |
denotes |
typical |
| T4034 |
17465-17470 |
NN |
denotes |
cross |
| T4035 |
17471-17473 |
IN |
denotes |
in |
| T4036 |
17474-17480 |
NN |
denotes |
Figure |
| T4037 |
17481-17482 |
CD |
denotes |
3 |
| T4038 |
17482-17483 |
-RRB- |
denotes |
) |
| T4039 |
17483-17484 |
. |
denotes |
. |
| T4040 |
17484-17628 |
sentence |
denotes |
PCR amplification confirmed that a key exon of the Bmpr1a gene was deleted in mice that also carried the Gdf5-Cre transgene (unpublished data). |
| T4041 |
17485-17488 |
NN |
denotes |
PCR |
| T4042 |
17489-17502 |
NN |
denotes |
amplification |
| T4043 |
17503-17512 |
VBD |
denotes |
confirmed |
| T4044 |
17513-17517 |
IN |
denotes |
that |
| T4045 |
17552-17559 |
VBN |
denotes |
deleted |
| T4046 |
17518-17519 |
DT |
denotes |
a |
| T4047 |
17524-17528 |
NN |
denotes |
exon |
| T4048 |
17520-17523 |
JJ |
denotes |
key |
| T4049 |
17529-17531 |
IN |
denotes |
of |
| T4050 |
17532-17535 |
DT |
denotes |
the |
| T4051 |
17543-17547 |
NN |
denotes |
gene |
| T4052 |
17536-17542 |
NN |
denotes |
Bmpr1a |
| T4053 |
17548-17551 |
VBD |
denotes |
was |
| T4054 |
17560-17562 |
IN |
denotes |
in |
| T4055 |
17563-17567 |
NNS |
denotes |
mice |
| T4056 |
17568-17572 |
WDT |
denotes |
that |
| T4057 |
17578-17585 |
VBD |
denotes |
carried |
| T4058 |
17573-17577 |
RB |
denotes |
also |
| T4059 |
17586-17589 |
DT |
denotes |
the |
| T4060 |
17599-17608 |
NN |
denotes |
transgene |
| T4061 |
17590-17594 |
NN |
denotes |
Gdf5 |
| T4062 |
17595-17598 |
NN |
denotes |
Cre |
| T4063 |
17594-17595 |
HYPH |
denotes |
- |
| T4064 |
17609-17610 |
-LRB- |
denotes |
( |
| T4065 |
17622-17626 |
NNS |
denotes |
data |
| T4066 |
17610-17621 |
JJ |
denotes |
unpublished |
| T4067 |
17626-17627 |
-RRB- |
denotes |
) |
| T4068 |
17627-17628 |
. |
denotes |
. |
| T4069 |
17628-17797 |
sentence |
denotes |
Previous studies have shown that the recombined Bmpr1afloxP allele mimics a null allele of the Bmpr1a locus when transmitted through the germline (Mishina et al. 2002). |
| T4070 |
17629-17637 |
JJ |
denotes |
Previous |
| T4071 |
17638-17645 |
NNS |
denotes |
studies |
| T4072 |
17651-17656 |
VBN |
denotes |
shown |
| T4073 |
17646-17650 |
VBP |
denotes |
have |
| T4074 |
17657-17661 |
IN |
denotes |
that |
| T4075 |
17696-17702 |
VBZ |
denotes |
mimics |
| T4076 |
17662-17665 |
DT |
denotes |
the |
| T4077 |
17689-17695 |
NN |
denotes |
allele |
| T4078 |
17666-17676 |
JJ |
denotes |
recombined |
| T4079 |
17677-17688 |
NN |
denotes |
Bmpr1afloxP |
| T4080 |
17703-17704 |
DT |
denotes |
a |
| T4081 |
17710-17716 |
NN |
denotes |
allele |
| T4082 |
17705-17709 |
JJ |
denotes |
null |
| T4083 |
17717-17719 |
IN |
denotes |
of |
| T4084 |
17720-17723 |
DT |
denotes |
the |
| T4085 |
17731-17736 |
NN |
denotes |
locus |
| T4086 |
17724-17730 |
NN |
denotes |
Bmpr1a |
| T4087 |
17737-17741 |
WRB |
denotes |
when |
| T4088 |
17742-17753 |
VBN |
denotes |
transmitted |
| T4089 |
17754-17761 |
IN |
denotes |
through |
| T4090 |
17762-17765 |
DT |
denotes |
the |
| T4091 |
17766-17774 |
NN |
denotes |
germline |
| T4092 |
17775-17776 |
-LRB- |
denotes |
( |
| T4093 |
17776-17783 |
NNP |
denotes |
Mishina |
| T4094 |
17784-17786 |
FW |
denotes |
et |
| T4095 |
17787-17790 |
FW |
denotes |
al. |
| T4096 |
17791-17795 |
CD |
denotes |
2002 |
| T4097 |
17795-17796 |
-RRB- |
denotes |
) |
| T4098 |
17796-17797 |
. |
denotes |
. |
| T4099 |
17797-18056 |
sentence |
denotes |
The Gdf5-Cre/Bmpr1afloxP conditional knockout mice were viable and survived to adulthood, showing that the Gdf5-Cre driver can bypass the early embryonic lethality previously reported in animals with a null mutation in the Bmpr1a locus (Mishina et al. 1995). |
| T4100 |
17798-17801 |
DT |
denotes |
The |
| T4101 |
17844-17848 |
NNS |
denotes |
mice |
| T4102 |
17802-17806 |
NN |
denotes |
Gdf5 |
| T4103 |
17807-17810 |
NN |
denotes |
Cre |
| T4104 |
17806-17807 |
HYPH |
denotes |
- |
| T4105 |
17811-17822 |
NN |
denotes |
Bmpr1afloxP |
| T4106 |
17810-17811 |
HYPH |
denotes |
/ |
| T4107 |
17835-17843 |
NN |
denotes |
knockout |
| T4108 |
17823-17834 |
JJ |
denotes |
conditional |
| T4109 |
17849-17853 |
VBD |
denotes |
were |
| T4110 |
17854-17860 |
JJ |
denotes |
viable |
| T4111 |
17861-17864 |
CC |
denotes |
and |
| T4112 |
17865-17873 |
VBD |
denotes |
survived |
| T4113 |
17874-17876 |
IN |
denotes |
to |
| T4114 |
17877-17886 |
NN |
denotes |
adulthood |
| T4115 |
17886-17888 |
, |
denotes |
, |
| T4116 |
17888-17895 |
VBG |
denotes |
showing |
| T4117 |
17896-17900 |
IN |
denotes |
that |
| T4118 |
17925-17931 |
VB |
denotes |
bypass |
| T4119 |
17901-17904 |
DT |
denotes |
the |
| T4120 |
17914-17920 |
NN |
denotes |
driver |
| T4121 |
17905-17909 |
NN |
denotes |
Gdf5 |
| T4122 |
17910-17913 |
NN |
denotes |
Cre |
| T4123 |
17909-17910 |
HYPH |
denotes |
- |
| T4124 |
17921-17924 |
MD |
denotes |
can |
| T4125 |
17932-17935 |
DT |
denotes |
the |
| T4126 |
17952-17961 |
NN |
denotes |
lethality |
| T4127 |
17936-17941 |
JJ |
denotes |
early |
| T4128 |
17942-17951 |
JJ |
denotes |
embryonic |
| T4129 |
17962-17972 |
RB |
denotes |
previously |
| T4130 |
17973-17981 |
VBN |
denotes |
reported |
| T4131 |
17982-17984 |
IN |
denotes |
in |
| T4132 |
17985-17992 |
NNS |
denotes |
animals |
| T4133 |
17993-17997 |
IN |
denotes |
with |
| T4134 |
17998-17999 |
DT |
denotes |
a |
| T4135 |
18005-18013 |
NN |
denotes |
mutation |
| T4136 |
18000-18004 |
JJ |
denotes |
null |
| T4137 |
18014-18016 |
IN |
denotes |
in |
| T4138 |
18017-18020 |
DT |
denotes |
the |
| T4139 |
18028-18033 |
NN |
denotes |
locus |
| T4140 |
18021-18027 |
NN |
denotes |
Bmpr1a |
| T4141 |
18034-18035 |
-LRB- |
denotes |
( |
| T4142 |
18035-18042 |
NNP |
denotes |
Mishina |
| T4143 |
18043-18045 |
FW |
denotes |
et |
| T4144 |
18046-18049 |
FW |
denotes |
al. |
| T4145 |
18050-18054 |
CD |
denotes |
1995 |
| T4146 |
18054-18055 |
-RRB- |
denotes |
) |
| T4147 |
18055-18056 |
. |
denotes |
. |
| T4148 |
18056-18946 |
sentence |
denotes |
Figure 3 Gdf5-Cre-Mediated Deletion of Bmpr1a
(A) Breeding strategy simultaneously deletes Bmpr1afloxP and allows visualization of Gdf5-Cre-mediated recombination by lacZ expression from R26R.
(B–E) 5-week-old mutant and control mice stained with Alcian blue to mark cartilage and alizarin red to mark bone. (B) Ankle of control with strong blue staining lining each joint (arrowheads). (C) Ankle of mutant showing an absence of blue staining in most regions (arrowheads) and a joint fusion between the central (c) and second (2) tarsals (arrow). (D) Control and (E) mutant metatarsal/phalangeal joint which lacks blue staining in articular regions (arrowheads) but retains staining in the growth plate (asterisks).
(F) Control forelimb.
(G) Mutant forelimb with webbing between the first and second digit (black arrowhead). The viable Gdf5-Cre/Bmpr1afloxP mice showed several phenotypes. |
| T4149 |
18883-18886 |
DT |
denotes |
The |
| T4150 |
18915-18919 |
NNS |
denotes |
mice |
| T4151 |
18887-18893 |
JJ |
denotes |
viable |
| T4152 |
18894-18898 |
NN |
denotes |
Gdf5 |
| T4153 |
18899-18902 |
NN |
denotes |
Cre |
| T4154 |
18898-18899 |
HYPH |
denotes |
- |
| T4155 |
18903-18914 |
NN |
denotes |
Bmpr1afloxP |
| T4156 |
18902-18903 |
HYPH |
denotes |
/ |
| T4157 |
18920-18926 |
VBD |
denotes |
showed |
| T4158 |
18927-18934 |
JJ |
denotes |
several |
| T4159 |
18935-18945 |
NNS |
denotes |
phenotypes |
| T4160 |
18945-18946 |
. |
denotes |
. |
| T4161 |
18946-19139 |
sentence |
denotes |
First, the conditional knockout mice had shorter ears that often lay flatter against their heads than controls (controls 13.1 ± 0.1 mm long, n = 38; mutants 11.8 ± 0.2 mm, n = 11; p < 0.0001). |
| T4162 |
18947-18952 |
RB |
denotes |
First |
| T4163 |
18984-18987 |
VBD |
denotes |
had |
| T4164 |
18952-18954 |
, |
denotes |
, |
| T4165 |
18954-18957 |
DT |
denotes |
the |
| T4166 |
18979-18983 |
NNS |
denotes |
mice |
| T4167 |
18958-18969 |
JJ |
denotes |
conditional |
| T4168 |
18970-18978 |
NN |
denotes |
knockout |
| T4169 |
18988-18995 |
JJR |
denotes |
shorter |
| T4170 |
18996-19000 |
NNS |
denotes |
ears |
| T4171 |
19001-19005 |
WDT |
denotes |
that |
| T4172 |
19012-19015 |
VBP |
denotes |
lay |
| T4173 |
19006-19011 |
RB |
denotes |
often |
| T4174 |
19016-19023 |
JJR |
denotes |
flatter |
| T4175 |
19024-19031 |
IN |
denotes |
against |
| T4176 |
19032-19037 |
PRP$ |
denotes |
their |
| T4177 |
19038-19043 |
NNS |
denotes |
heads |
| T4178 |
19044-19048 |
IN |
denotes |
than |
| T4179 |
19049-19057 |
NNS |
denotes |
controls |
| T4180 |
19058-19059 |
-LRB- |
denotes |
( |
| T4181 |
19131-19137 |
CD |
denotes |
0.0001 |
| T4182 |
19059-19067 |
NNS |
denotes |
controls |
| T4183 |
19079-19081 |
NNS |
denotes |
mm |
| T4184 |
19068-19072 |
CD |
denotes |
13.1 |
| T4185 |
19075-19078 |
CD |
denotes |
0.1 |
| T4186 |
19073-19074 |
SYM |
denotes |
± |
| T4187 |
19082-19086 |
RB |
denotes |
long |
| T4188 |
19086-19088 |
, |
denotes |
, |
| T4189 |
19088-19089 |
NN |
denotes |
n |
| T4190 |
19092-19094 |
CD |
denotes |
38 |
| T4191 |
19090-19091 |
SYM |
denotes |
= |
| T4192 |
19094-19095 |
: |
denotes |
; |
| T4193 |
19096-19103 |
NNS |
denotes |
mutants |
| T4194 |
19115-19117 |
NNS |
denotes |
mm |
| T4195 |
19104-19108 |
CD |
denotes |
11.8 |
| T4196 |
19111-19114 |
CD |
denotes |
0.2 |
| T4197 |
19109-19110 |
SYM |
denotes |
± |
| T4198 |
19117-19119 |
, |
denotes |
, |
| T4199 |
19119-19120 |
NN |
denotes |
n |
| T4200 |
19123-19125 |
CD |
denotes |
11 |
| T4201 |
19121-19122 |
SYM |
denotes |
= |
| T4202 |
19125-19126 |
: |
denotes |
; |
| T4203 |
19127-19128 |
NN |
denotes |
p |
| T4204 |
19129-19130 |
SYM |
denotes |
< |
| T4205 |
19137-19138 |
-RRB- |
denotes |
) |
| T4206 |
19138-19139 |
. |
denotes |
. |
| T4207 |
19139-19365 |
sentence |
denotes |
BMP signaling is known to be required for growth of the external ear of mice (Kingsley et al. 1992), and this phenotype likely reflects loss of Bmpr1a function in the fraction of ear cells that express the Gdf5-Cre transgene. |
| T4208 |
19140-19143 |
NN |
denotes |
BMP |
| T4209 |
19144-19153 |
NN |
denotes |
signaling |
| T4210 |
19157-19162 |
VBN |
denotes |
known |
| T4211 |
19154-19156 |
VBZ |
denotes |
is |
| T4212 |
19163-19165 |
TO |
denotes |
to |
| T4213 |
19169-19177 |
VBN |
denotes |
required |
| T4214 |
19166-19168 |
VB |
denotes |
be |
| T4215 |
19178-19181 |
IN |
denotes |
for |
| T4216 |
19182-19188 |
NN |
denotes |
growth |
| T4217 |
19189-19191 |
IN |
denotes |
of |
| T4218 |
19192-19195 |
DT |
denotes |
the |
| T4219 |
19205-19208 |
NN |
denotes |
ear |
| T4220 |
19196-19204 |
JJ |
denotes |
external |
| T4221 |
19209-19211 |
IN |
denotes |
of |
| T4222 |
19212-19216 |
NNS |
denotes |
mice |
| T4223 |
19217-19218 |
-LRB- |
denotes |
( |
| T4224 |
19218-19226 |
NNP |
denotes |
Kingsley |
| T4225 |
19227-19229 |
FW |
denotes |
et |
| T4226 |
19230-19233 |
FW |
denotes |
al. |
| T4227 |
19234-19238 |
CD |
denotes |
1992 |
| T4228 |
19238-19239 |
-RRB- |
denotes |
) |
| T4229 |
19239-19241 |
, |
denotes |
, |
| T4230 |
19241-19244 |
CC |
denotes |
and |
| T4231 |
19245-19249 |
DT |
denotes |
this |
| T4232 |
19250-19259 |
NN |
denotes |
phenotype |
| T4233 |
19267-19275 |
VBZ |
denotes |
reflects |
| T4234 |
19260-19266 |
RB |
denotes |
likely |
| T4235 |
19276-19280 |
NN |
denotes |
loss |
| T4236 |
19281-19283 |
IN |
denotes |
of |
| T4237 |
19284-19290 |
NN |
denotes |
Bmpr1a |
| T4238 |
19291-19299 |
NN |
denotes |
function |
| T4239 |
19300-19302 |
IN |
denotes |
in |
| T4240 |
19303-19306 |
DT |
denotes |
the |
| T4241 |
19307-19315 |
NN |
denotes |
fraction |
| T4242 |
19316-19318 |
IN |
denotes |
of |
| T4243 |
19319-19322 |
NN |
denotes |
ear |
| T4244 |
19323-19328 |
NNS |
denotes |
cells |
| T4245 |
19329-19333 |
WDT |
denotes |
that |
| T4246 |
19334-19341 |
VBP |
denotes |
express |
| T4247 |
19342-19345 |
DT |
denotes |
the |
| T4248 |
19355-19364 |
NN |
denotes |
transgene |
| T4249 |
19346-19350 |
NN |
denotes |
Gdf5 |
| T4250 |
19351-19354 |
NN |
denotes |
Cre |
| T4251 |
19350-19351 |
HYPH |
denotes |
- |
| T4252 |
19364-19365 |
. |
denotes |
. |
| T4253 |
19365-19631 |
sentence |
denotes |
Most mutant mice also showed soft tissue syndactyly or retention of webbing between the first and second digits of their feet, a phenotype that was more frequent and more severe in the forelimbs (201 of 220, or 91%, of forefeet and 109 of 220, or 50%, of hindfeet). |
| T4254 |
19366-19370 |
JJS |
denotes |
Most |
| T4255 |
19378-19382 |
NNS |
denotes |
mice |
| T4256 |
19371-19377 |
NN |
denotes |
mutant |
| T4257 |
19388-19394 |
VBD |
denotes |
showed |
| T4258 |
19383-19387 |
RB |
denotes |
also |
| T4259 |
19395-19399 |
JJ |
denotes |
soft |
| T4260 |
19400-19406 |
NN |
denotes |
tissue |
| T4261 |
19407-19417 |
NN |
denotes |
syndactyly |
| T4262 |
19418-19420 |
CC |
denotes |
or |
| T4263 |
19421-19430 |
NN |
denotes |
retention |
| T4264 |
19431-19433 |
IN |
denotes |
of |
| T4265 |
19434-19441 |
NN |
denotes |
webbing |
| T4266 |
19442-19449 |
IN |
denotes |
between |
| T4267 |
19450-19453 |
DT |
denotes |
the |
| T4268 |
19471-19477 |
NNS |
denotes |
digits |
| T4269 |
19454-19459 |
JJ |
denotes |
first |
| T4270 |
19460-19463 |
CC |
denotes |
and |
| T4271 |
19464-19470 |
JJ |
denotes |
second |
| T4272 |
19478-19480 |
IN |
denotes |
of |
| T4273 |
19481-19486 |
PRP$ |
denotes |
their |
| T4274 |
19487-19491 |
NNS |
denotes |
feet |
| T4275 |
19491-19493 |
, |
denotes |
, |
| T4276 |
19493-19494 |
DT |
denotes |
a |
| T4277 |
19495-19504 |
NN |
denotes |
phenotype |
| T4278 |
19505-19509 |
WDT |
denotes |
that |
| T4279 |
19510-19513 |
VBD |
denotes |
was |
| T4280 |
19514-19518 |
RBR |
denotes |
more |
| T4281 |
19519-19527 |
JJ |
denotes |
frequent |
| T4282 |
19528-19531 |
CC |
denotes |
and |
| T4283 |
19532-19536 |
RBR |
denotes |
more |
| T4284 |
19537-19543 |
JJ |
denotes |
severe |
| T4285 |
19544-19546 |
IN |
denotes |
in |
| T4286 |
19547-19550 |
DT |
denotes |
the |
| T4287 |
19551-19560 |
NNS |
denotes |
forelimbs |
| T4288 |
19561-19562 |
-LRB- |
denotes |
( |
| T4289 |
19569-19572 |
CD |
denotes |
220 |
| T4290 |
19562-19565 |
CD |
denotes |
201 |
| T4291 |
19566-19568 |
IN |
denotes |
of |
| T4292 |
19572-19574 |
, |
denotes |
, |
| T4293 |
19574-19576 |
CC |
denotes |
or |
| T4294 |
19577-19579 |
CD |
denotes |
91 |
| T4295 |
19579-19580 |
NN |
denotes |
% |
| T4296 |
19580-19582 |
, |
denotes |
, |
| T4297 |
19582-19584 |
IN |
denotes |
of |
| T4298 |
19585-19593 |
NNS |
denotes |
forefeet |
| T4299 |
19594-19597 |
CC |
denotes |
and |
| T4300 |
19598-19601 |
CD |
denotes |
109 |
| T4301 |
19605-19608 |
CD |
denotes |
220 |
| T4302 |
19602-19604 |
IN |
denotes |
of |
| T4303 |
19608-19610 |
, |
denotes |
, |
| T4304 |
19610-19612 |
CC |
denotes |
or |
| T4305 |
19613-19615 |
CD |
denotes |
50 |
| T4306 |
19615-19616 |
NN |
denotes |
% |
| T4307 |
19616-19618 |
, |
denotes |
, |
| T4308 |
19618-19620 |
IN |
denotes |
of |
| T4309 |
19621-19629 |
NN |
denotes |
hindfeet |
| T4310 |
19629-19630 |
-RRB- |
denotes |
) |
| T4311 |
19630-19631 |
. |
denotes |
. |
| T4312 |
19631-19725 |
sentence |
denotes |
Finally, mutant animals showed obvious skeletal changes in whole-mount skeletal preparations. |
| T4313 |
19632-19639 |
RB |
denotes |
Finally |
| T4314 |
19656-19662 |
VBD |
denotes |
showed |
| T4315 |
19639-19641 |
, |
denotes |
, |
| T4316 |
19641-19647 |
NN |
denotes |
mutant |
| T4317 |
19648-19655 |
NNS |
denotes |
animals |
| T4318 |
19663-19670 |
JJ |
denotes |
obvious |
| T4319 |
19680-19687 |
NNS |
denotes |
changes |
| T4320 |
19671-19679 |
JJ |
denotes |
skeletal |
| T4321 |
19688-19690 |
IN |
denotes |
in |
| T4322 |
19691-19696 |
JJ |
denotes |
whole |
| T4323 |
19697-19702 |
NN |
denotes |
mount |
| T4324 |
19696-19697 |
HYPH |
denotes |
- |
| T4325 |
19712-19724 |
NNS |
denotes |
preparations |
| T4326 |
19703-19711 |
JJ |
denotes |
skeletal |
| T4327 |
19724-19725 |
. |
denotes |
. |
| T4328 |
19725-19846 |
sentence |
denotes |
At some sites in the ankles, joints seemed to be missing entirely, with fusion of bones that would normally be separate. |
| T4329 |
19726-19728 |
IN |
denotes |
At |
| T4330 |
19762-19768 |
VBD |
denotes |
seemed |
| T4331 |
19729-19733 |
DT |
denotes |
some |
| T4332 |
19734-19739 |
NNS |
denotes |
sites |
| T4333 |
19740-19742 |
IN |
denotes |
in |
| T4334 |
19743-19746 |
DT |
denotes |
the |
| T4335 |
19747-19753 |
NNS |
denotes |
ankles |
| T4336 |
19753-19755 |
, |
denotes |
, |
| T4337 |
19755-19761 |
NNS |
denotes |
joints |
| T4338 |
19769-19771 |
TO |
denotes |
to |
| T4339 |
19772-19774 |
VB |
denotes |
be |
| T4340 |
19775-19782 |
VBG |
denotes |
missing |
| T4341 |
19783-19791 |
RB |
denotes |
entirely |
| T4342 |
19791-19793 |
, |
denotes |
, |
| T4343 |
19793-19797 |
IN |
denotes |
with |
| T4344 |
19798-19804 |
NN |
denotes |
fusion |
| T4345 |
19805-19807 |
IN |
denotes |
of |
| T4346 |
19808-19813 |
NNS |
denotes |
bones |
| T4347 |
19814-19818 |
WDT |
denotes |
that |
| T4348 |
19834-19836 |
VB |
denotes |
be |
| T4349 |
19819-19824 |
MD |
denotes |
would |
| T4350 |
19825-19833 |
RB |
denotes |
normally |
| T4351 |
19837-19845 |
JJ |
denotes |
separate |
| T4352 |
19845-19846 |
. |
denotes |
. |
| T4353 |
19846-20049 |
sentence |
denotes |
For example, the second distal tarsal was fused to the central tarsal bone in every conditional knockout animal examined (18 of 18), a phenotype not observed in controls (zero of 18) (Figure 3B and 3C). |
| T4354 |
19847-19850 |
IN |
denotes |
For |
| T4355 |
19889-19894 |
VBN |
denotes |
fused |
| T4356 |
19851-19858 |
NN |
denotes |
example |
| T4357 |
19858-19860 |
, |
denotes |
, |
| T4358 |
19860-19863 |
DT |
denotes |
the |
| T4359 |
19878-19884 |
JJ |
denotes |
tarsal |
| T4360 |
19864-19870 |
JJ |
denotes |
second |
| T4361 |
19871-19877 |
JJ |
denotes |
distal |
| T4362 |
19885-19888 |
VBD |
denotes |
was |
| T4363 |
19895-19897 |
IN |
denotes |
to |
| T4364 |
19898-19901 |
DT |
denotes |
the |
| T4365 |
19917-19921 |
NN |
denotes |
bone |
| T4366 |
19902-19909 |
JJ |
denotes |
central |
| T4367 |
19910-19916 |
JJ |
denotes |
tarsal |
| T4368 |
19922-19924 |
IN |
denotes |
in |
| T4369 |
19925-19930 |
DT |
denotes |
every |
| T4370 |
19952-19958 |
NN |
denotes |
animal |
| T4371 |
19931-19942 |
JJ |
denotes |
conditional |
| T4372 |
19943-19951 |
NN |
denotes |
knockout |
| T4373 |
19959-19967 |
VBN |
denotes |
examined |
| T4374 |
19968-19969 |
-LRB- |
denotes |
( |
| T4375 |
19975-19977 |
CD |
denotes |
18 |
| T4376 |
19969-19971 |
CD |
denotes |
18 |
| T4377 |
19972-19974 |
IN |
denotes |
of |
| T4378 |
19977-19978 |
-RRB- |
denotes |
) |
| T4379 |
19978-19980 |
, |
denotes |
, |
| T4380 |
19980-19981 |
DT |
denotes |
a |
| T4381 |
19982-19991 |
NN |
denotes |
phenotype |
| T4382 |
19992-19995 |
RB |
denotes |
not |
| T4383 |
19996-20004 |
VBN |
denotes |
observed |
| T4384 |
20005-20007 |
IN |
denotes |
in |
| T4385 |
20008-20016 |
NNS |
denotes |
controls |
| T4386 |
20017-20018 |
-LRB- |
denotes |
( |
| T4387 |
20026-20028 |
CD |
denotes |
18 |
| T4388 |
20018-20022 |
CD |
denotes |
zero |
| T4389 |
20023-20025 |
IN |
denotes |
of |
| T4390 |
20028-20029 |
-RRB- |
denotes |
) |
| T4391 |
20030-20031 |
-LRB- |
denotes |
( |
| T4392 |
20031-20037 |
NN |
denotes |
Figure |
| T4393 |
20038-20040 |
CD |
denotes |
3B |
| T4394 |
20041-20044 |
CC |
denotes |
and |
| T4395 |
20045-20047 |
CD |
denotes |
3C |
| T4396 |
20047-20048 |
-RRB- |
denotes |
) |
| T4397 |
20048-20049 |
. |
denotes |
. |
| T4398 |
20049-20212 |
sentence |
denotes |
At other locations, joints had clearly formed but showed dramatic loss of staining with the cartilage matrix marker Alcian blue (Figure 3B–3E) (unpublished data). |
| T4399 |
20050-20052 |
IN |
denotes |
At |
| T4400 |
20089-20095 |
VBN |
denotes |
formed |
| T4401 |
20053-20058 |
JJ |
denotes |
other |
| T4402 |
20059-20068 |
NNS |
denotes |
locations |
| T4403 |
20068-20070 |
, |
denotes |
, |
| T4404 |
20070-20076 |
NNS |
denotes |
joints |
| T4405 |
20077-20080 |
VBD |
denotes |
had |
| T4406 |
20081-20088 |
RB |
denotes |
clearly |
| T4407 |
20096-20099 |
CC |
denotes |
but |
| T4408 |
20100-20106 |
VBD |
denotes |
showed |
| T4409 |
20107-20115 |
JJ |
denotes |
dramatic |
| T4410 |
20116-20120 |
NN |
denotes |
loss |
| T4411 |
20121-20123 |
IN |
denotes |
of |
| T4412 |
20124-20132 |
NN |
denotes |
staining |
| T4413 |
20133-20137 |
IN |
denotes |
with |
| T4414 |
20138-20141 |
DT |
denotes |
the |
| T4415 |
20159-20165 |
NN |
denotes |
marker |
| T4416 |
20142-20151 |
NN |
denotes |
cartilage |
| T4417 |
20152-20158 |
NN |
denotes |
matrix |
| T4418 |
20166-20172 |
JJ |
denotes |
Alcian |
| T4419 |
20173-20177 |
NN |
denotes |
blue |
| T4420 |
20178-20179 |
-LRB- |
denotes |
( |
| T4421 |
20186-20188 |
NN |
denotes |
3B |
| T4422 |
20179-20185 |
NN |
denotes |
Figure |
| T4423 |
20188-20189 |
SYM |
denotes |
– |
| T4424 |
20189-20191 |
NN |
denotes |
3E |
| T4425 |
20191-20192 |
-RRB- |
denotes |
) |
| T4426 |
20193-20194 |
-LRB- |
denotes |
( |
| T4427 |
20206-20210 |
NNS |
denotes |
data |
| T4428 |
20194-20205 |
JJ |
denotes |
unpublished |
| T4429 |
20210-20211 |
-RRB- |
denotes |
) |
| T4430 |
20211-20212 |
. |
denotes |
. |
| T4431 |
20212-20344 |
sentence |
denotes |
Normal Alcian blue staining was seen in non-articular regions, such as the cartilaginous growth plate (Figure 3D and 3E, asterisk). |
| T4432 |
20213-20219 |
JJ |
denotes |
Normal |
| T4433 |
20232-20240 |
NN |
denotes |
staining |
| T4434 |
20220-20226 |
JJ |
denotes |
Alcian |
| T4435 |
20227-20231 |
NN |
denotes |
blue |
| T4436 |
20245-20249 |
VBN |
denotes |
seen |
| T4437 |
20241-20244 |
VBD |
denotes |
was |
| T4438 |
20250-20252 |
IN |
denotes |
in |
| T4439 |
20253-20266 |
JJ |
denotes |
non-articular |
| T4440 |
20267-20274 |
NNS |
denotes |
regions |
| T4441 |
20274-20276 |
, |
denotes |
, |
| T4442 |
20276-20280 |
JJ |
denotes |
such |
| T4443 |
20281-20283 |
IN |
denotes |
as |
| T4444 |
20284-20287 |
DT |
denotes |
the |
| T4445 |
20309-20314 |
NN |
denotes |
plate |
| T4446 |
20288-20301 |
JJ |
denotes |
cartilaginous |
| T4447 |
20302-20308 |
NN |
denotes |
growth |
| T4448 |
20315-20316 |
-LRB- |
denotes |
( |
| T4449 |
20334-20342 |
NN |
denotes |
asterisk |
| T4450 |
20316-20322 |
NN |
denotes |
Figure |
| T4451 |
20323-20325 |
CD |
denotes |
3D |
| T4452 |
20326-20329 |
CC |
denotes |
and |
| T4453 |
20330-20332 |
CD |
denotes |
3E |
| T4454 |
20332-20334 |
, |
denotes |
, |
| T4455 |
20342-20343 |
-RRB- |
denotes |
) |
| T4456 |
20343-20344 |
. |
denotes |
. |
| T4457 |
20344-20551 |
sentence |
denotes |
These data suggest that Bmpr1a function is required for the formation of specific joints in the ankle region and for either generation or maintenance of articular cartilage in most other joints of the limb. |
| T4458 |
20345-20350 |
DT |
denotes |
These |
| T4459 |
20351-20355 |
NNS |
denotes |
data |
| T4460 |
20356-20363 |
VBP |
denotes |
suggest |
| T4461 |
20364-20368 |
IN |
denotes |
that |
| T4462 |
20385-20387 |
VBZ |
denotes |
is |
| T4463 |
20369-20375 |
NN |
denotes |
Bmpr1a |
| T4464 |
20376-20384 |
NN |
denotes |
function |
| T4465 |
20388-20396 |
VBN |
denotes |
required |
| T4466 |
20397-20400 |
IN |
denotes |
for |
| T4467 |
20401-20404 |
DT |
denotes |
the |
| T4468 |
20405-20414 |
NN |
denotes |
formation |
| T4469 |
20415-20417 |
IN |
denotes |
of |
| T4470 |
20418-20426 |
JJ |
denotes |
specific |
| T4471 |
20427-20433 |
NNS |
denotes |
joints |
| T4472 |
20434-20436 |
IN |
denotes |
in |
| T4473 |
20437-20440 |
DT |
denotes |
the |
| T4474 |
20447-20453 |
NN |
denotes |
region |
| T4475 |
20441-20446 |
NN |
denotes |
ankle |
| T4476 |
20454-20457 |
CC |
denotes |
and |
| T4477 |
20458-20461 |
IN |
denotes |
for |
| T4478 |
20462-20468 |
CC |
denotes |
either |
| T4479 |
20469-20479 |
NN |
denotes |
generation |
| T4480 |
20480-20482 |
CC |
denotes |
or |
| T4481 |
20483-20494 |
NN |
denotes |
maintenance |
| T4482 |
20495-20497 |
IN |
denotes |
of |
| T4483 |
20498-20507 |
JJ |
denotes |
articular |
| T4484 |
20508-20517 |
NN |
denotes |
cartilage |
| T4485 |
20518-20520 |
IN |
denotes |
in |
| T4486 |
20521-20525 |
JJS |
denotes |
most |
| T4487 |
20532-20538 |
NNS |
denotes |
joints |
| T4488 |
20526-20531 |
JJ |
denotes |
other |
| T4489 |
20539-20541 |
IN |
denotes |
of |
| T4490 |
20542-20545 |
DT |
denotes |
the |
| T4491 |
20546-20550 |
NN |
denotes |
limb |
| T4492 |
20550-20551 |
. |
denotes |
. |
| T4677 |
20553-20566 |
JJ |
denotes |
Developmental |
| T4678 |
20567-20573 |
NN |
denotes |
Origin |
| T4679 |
20574-20576 |
IN |
denotes |
of |
| T4680 |
20577-20584 |
NN |
denotes |
Webbing |
| T4681 |
20585-20594 |
NN |
denotes |
Phenotype |
| T4682 |
20594-20911 |
sentence |
denotes |
Interdigital mesenchyme is normally eliminated by apoptosis during embryonic development, a process that can be stimulated by BMP beads, inhibited by Noggin, or blocked by overexpression of dominant-negative BMP receptors (Garcia-Martinez et al. 1993; Yokouchi et al. 1996; Zou and Niswander 1996; Guha et al. 2002). |
| T4683 |
20595-20607 |
JJ |
denotes |
Interdigital |
| T4684 |
20608-20618 |
NN |
denotes |
mesenchyme |
| T4685 |
20631-20641 |
VBN |
denotes |
eliminated |
| T4686 |
20619-20621 |
VBZ |
denotes |
is |
| T4687 |
20622-20630 |
RB |
denotes |
normally |
| T4688 |
20642-20644 |
IN |
denotes |
by |
| T4689 |
20645-20654 |
NN |
denotes |
apoptosis |
| T4690 |
20655-20661 |
IN |
denotes |
during |
| T4691 |
20662-20671 |
JJ |
denotes |
embryonic |
| T4692 |
20672-20683 |
NN |
denotes |
development |
| T4693 |
20683-20685 |
, |
denotes |
, |
| T4694 |
20685-20686 |
DT |
denotes |
a |
| T4695 |
20687-20694 |
NN |
denotes |
process |
| T4696 |
20695-20699 |
WDT |
denotes |
that |
| T4697 |
20707-20717 |
VBN |
denotes |
stimulated |
| T4698 |
20700-20703 |
MD |
denotes |
can |
| T4699 |
20704-20706 |
VB |
denotes |
be |
| T4700 |
20718-20720 |
IN |
denotes |
by |
| T4701 |
20721-20724 |
NN |
denotes |
BMP |
| T4702 |
20725-20730 |
NNS |
denotes |
beads |
| T4703 |
20730-20732 |
, |
denotes |
, |
| T4704 |
20732-20741 |
VBN |
denotes |
inhibited |
| T4705 |
20742-20744 |
IN |
denotes |
by |
| T4706 |
20745-20751 |
NN |
denotes |
Noggin |
| T4707 |
20751-20753 |
, |
denotes |
, |
| T4708 |
20753-20755 |
CC |
denotes |
or |
| T4709 |
20756-20763 |
VBN |
denotes |
blocked |
| T4710 |
20764-20766 |
IN |
denotes |
by |
| T4711 |
20767-20781 |
NN |
denotes |
overexpression |
| T4712 |
20782-20784 |
IN |
denotes |
of |
| T4713 |
20785-20793 |
JJ |
denotes |
dominant |
| T4714 |
20794-20802 |
JJ |
denotes |
negative |
| T4715 |
20793-20794 |
HYPH |
denotes |
- |
| T4716 |
20807-20816 |
NNS |
denotes |
receptors |
| T4717 |
20803-20806 |
NN |
denotes |
BMP |
| T4718 |
20817-20818 |
-LRB- |
denotes |
( |
| T4719 |
20818-20824 |
NNP |
denotes |
Garcia |
| T4720 |
20824-20825 |
HYPH |
denotes |
- |
| T4721 |
20825-20833 |
NNP |
denotes |
Martinez |
| T4722 |
20834-20836 |
FW |
denotes |
et |
| T4723 |
20837-20840 |
FW |
denotes |
al. |
| T4724 |
20841-20845 |
CD |
denotes |
1993 |
| T4725 |
20845-20846 |
: |
denotes |
; |
| T4726 |
20847-20855 |
NNP |
denotes |
Yokouchi |
| T4727 |
20856-20858 |
FW |
denotes |
et |
| T4728 |
20859-20862 |
FW |
denotes |
al. |
| T4729 |
20863-20867 |
CD |
denotes |
1996 |
| T4730 |
20867-20868 |
: |
denotes |
; |
| T4731 |
20869-20872 |
NNP |
denotes |
Zou |
| T4732 |
20873-20876 |
CC |
denotes |
and |
| T4733 |
20877-20886 |
NNP |
denotes |
Niswander |
| T4734 |
20887-20891 |
CD |
denotes |
1996 |
| T4735 |
20891-20892 |
: |
denotes |
; |
| T4736 |
20893-20897 |
NNP |
denotes |
Guha |
| T4737 |
20898-20900 |
FW |
denotes |
et |
| T4738 |
20901-20904 |
FW |
denotes |
al. |
| T4739 |
20905-20909 |
CD |
denotes |
2002 |
| T4740 |
20909-20910 |
-RRB- |
denotes |
) |
| T4741 |
20910-20911 |
. |
denotes |
. |
| T4742 |
20911-21185 |
sentence |
denotes |
Limbs of Gdf5-Cre/Bmpr1afloxP mutant embryos showed obvious retention of interdigital webbing between the first and second, but not other, digits of E14.5 forelimbs (Figure 2A and 2B), a pattern that corresponds to the presence or absence of webbing seen in the adult limb. |
| T4743 |
20912-20917 |
NNS |
denotes |
Limbs |
| T4744 |
20957-20963 |
VBD |
denotes |
showed |
| T4745 |
20918-20920 |
IN |
denotes |
of |
| T4746 |
20921-20925 |
NN |
denotes |
Gdf5 |
| T4747 |
20926-20929 |
NN |
denotes |
Cre |
| T4748 |
20925-20926 |
HYPH |
denotes |
- |
| T4749 |
20930-20941 |
NN |
denotes |
Bmpr1afloxP |
| T4750 |
20929-20930 |
HYPH |
denotes |
/ |
| T4751 |
20942-20948 |
JJ |
denotes |
mutant |
| T4752 |
20949-20956 |
NNS |
denotes |
embryos |
| T4753 |
20964-20971 |
JJ |
denotes |
obvious |
| T4754 |
20972-20981 |
NN |
denotes |
retention |
| T4755 |
20982-20984 |
IN |
denotes |
of |
| T4756 |
20985-20997 |
JJ |
denotes |
interdigital |
| T4757 |
20998-21005 |
NN |
denotes |
webbing |
| T4758 |
21006-21013 |
IN |
denotes |
between |
| T4759 |
21014-21017 |
DT |
denotes |
the |
| T4760 |
21051-21057 |
NNS |
denotes |
digits |
| T4761 |
21018-21023 |
JJ |
denotes |
first |
| T4762 |
21024-21027 |
CC |
denotes |
and |
| T4763 |
21028-21034 |
JJ |
denotes |
second |
| T4764 |
21034-21036 |
, |
denotes |
, |
| T4765 |
21036-21039 |
CC |
denotes |
but |
| T4766 |
21040-21043 |
RB |
denotes |
not |
| T4767 |
21044-21049 |
JJ |
denotes |
other |
| T4768 |
21049-21051 |
, |
denotes |
, |
| T4769 |
21058-21060 |
IN |
denotes |
of |
| T4770 |
21061-21066 |
NN |
denotes |
E14.5 |
| T4771 |
21067-21076 |
NNS |
denotes |
forelimbs |
| T4772 |
21077-21078 |
-LRB- |
denotes |
( |
| T4773 |
21078-21084 |
NN |
denotes |
Figure |
| T4774 |
21085-21087 |
CD |
denotes |
2A |
| T4775 |
21088-21091 |
CC |
denotes |
and |
| T4776 |
21092-21094 |
CD |
denotes |
2B |
| T4777 |
21094-21095 |
-RRB- |
denotes |
) |
| T4778 |
21095-21097 |
, |
denotes |
, |
| T4779 |
21097-21098 |
DT |
denotes |
a |
| T4780 |
21099-21106 |
NN |
denotes |
pattern |
| T4781 |
21107-21111 |
WDT |
denotes |
that |
| T4782 |
21112-21123 |
VBZ |
denotes |
corresponds |
| T4783 |
21124-21126 |
IN |
denotes |
to |
| T4784 |
21127-21130 |
DT |
denotes |
the |
| T4785 |
21131-21139 |
NN |
denotes |
presence |
| T4786 |
21140-21142 |
CC |
denotes |
or |
| T4787 |
21143-21150 |
NN |
denotes |
absence |
| T4788 |
21151-21153 |
IN |
denotes |
of |
| T4789 |
21154-21161 |
NN |
denotes |
webbing |
| T4790 |
21162-21166 |
VBN |
denotes |
seen |
| T4791 |
21167-21169 |
IN |
denotes |
in |
| T4792 |
21170-21173 |
DT |
denotes |
the |
| T4793 |
21180-21184 |
NN |
denotes |
limb |
| T4794 |
21174-21179 |
NN |
denotes |
adult |
| T4795 |
21184-21185 |
. |
denotes |
. |
| T4796 |
21185-21279 |
sentence |
denotes |
They also showed excess tissue on the posterior margin of the fifth digit (Figure 2B, arrow). |
| T4797 |
21186-21190 |
PRP |
denotes |
They |
| T4798 |
21196-21202 |
VBD |
denotes |
showed |
| T4799 |
21191-21195 |
RB |
denotes |
also |
| T4800 |
21203-21209 |
JJ |
denotes |
excess |
| T4801 |
21210-21216 |
NN |
denotes |
tissue |
| T4802 |
21217-21219 |
IN |
denotes |
on |
| T4803 |
21220-21223 |
DT |
denotes |
the |
| T4804 |
21234-21240 |
NN |
denotes |
margin |
| T4805 |
21224-21233 |
JJ |
denotes |
posterior |
| T4806 |
21241-21243 |
IN |
denotes |
of |
| T4807 |
21244-21247 |
DT |
denotes |
the |
| T4808 |
21254-21259 |
NN |
denotes |
digit |
| T4809 |
21248-21253 |
JJ |
denotes |
fifth |
| T4810 |
21260-21261 |
-LRB- |
denotes |
( |
| T4811 |
21272-21277 |
NN |
denotes |
arrow |
| T4812 |
21261-21267 |
NN |
denotes |
Figure |
| T4813 |
21268-21270 |
CD |
denotes |
2B |
| T4814 |
21270-21272 |
, |
denotes |
, |
| T4815 |
21277-21278 |
-RRB- |
denotes |
) |
| T4816 |
21278-21279 |
. |
denotes |
. |
| T4817 |
21279-21523 |
sentence |
denotes |
Analysis of LACZ expression in Gdf5-Cre/R26R reporter embryos showed that Cre-mediated recombination has occurred by E13.5 in the metacarpal-phalangeal joints, and in the interdigital region between the first and second, but not other, digits. |
| T4818 |
21280-21288 |
NN |
denotes |
Analysis |
| T4819 |
21342-21348 |
VBD |
denotes |
showed |
| T4820 |
21289-21291 |
IN |
denotes |
of |
| T4821 |
21292-21296 |
NN |
denotes |
LACZ |
| T4822 |
21297-21307 |
NN |
denotes |
expression |
| T4823 |
21308-21310 |
IN |
denotes |
in |
| T4824 |
21311-21315 |
NN |
denotes |
Gdf5 |
| T4825 |
21316-21319 |
NN |
denotes |
Cre |
| T4826 |
21315-21316 |
HYPH |
denotes |
- |
| T4827 |
21320-21324 |
NN |
denotes |
R26R |
| T4828 |
21319-21320 |
HYPH |
denotes |
/ |
| T4829 |
21334-21341 |
NNS |
denotes |
embryos |
| T4830 |
21325-21333 |
NN |
denotes |
reporter |
| T4831 |
21349-21353 |
IN |
denotes |
that |
| T4832 |
21385-21393 |
VBN |
denotes |
occurred |
| T4833 |
21354-21357 |
NN |
denotes |
Cre |
| T4834 |
21358-21366 |
VBN |
denotes |
mediated |
| T4835 |
21357-21358 |
HYPH |
denotes |
- |
| T4836 |
21367-21380 |
NN |
denotes |
recombination |
| T4837 |
21381-21384 |
VBZ |
denotes |
has |
| T4838 |
21394-21396 |
IN |
denotes |
by |
| T4839 |
21397-21402 |
NN |
denotes |
E13.5 |
| T4840 |
21403-21405 |
IN |
denotes |
in |
| T4841 |
21406-21409 |
DT |
denotes |
the |
| T4842 |
21432-21438 |
NNS |
denotes |
joints |
| T4843 |
21410-21420 |
JJ |
denotes |
metacarpal |
| T4844 |
21421-21431 |
JJ |
denotes |
phalangeal |
| T4845 |
21420-21421 |
HYPH |
denotes |
- |
| T4846 |
21438-21440 |
, |
denotes |
, |
| T4847 |
21440-21443 |
CC |
denotes |
and |
| T4848 |
21444-21446 |
IN |
denotes |
in |
| T4849 |
21447-21450 |
DT |
denotes |
the |
| T4850 |
21464-21470 |
NN |
denotes |
region |
| T4851 |
21451-21463 |
JJ |
denotes |
interdigital |
| T4852 |
21471-21478 |
IN |
denotes |
between |
| T4853 |
21479-21482 |
DT |
denotes |
the |
| T4854 |
21516-21522 |
NNS |
denotes |
digits |
| T4855 |
21483-21488 |
JJ |
denotes |
first |
| T4856 |
21489-21492 |
CC |
denotes |
and |
| T4857 |
21493-21499 |
JJ |
denotes |
second |
| T4858 |
21499-21501 |
, |
denotes |
, |
| T4859 |
21501-21504 |
CC |
denotes |
but |
| T4860 |
21505-21508 |
RB |
denotes |
not |
| T4861 |
21509-21514 |
JJ |
denotes |
other |
| T4862 |
21514-21516 |
, |
denotes |
, |
| T4863 |
21522-21523 |
. |
denotes |
. |
| T4864 |
21523-21665 |
sentence |
denotes |
In addition, a domain of recombination and expression of LACZ is also reproducibly seen in the posterior half of the fifth digit (Figure 2C). |
| T4865 |
21524-21526 |
IN |
denotes |
In |
| T4866 |
21607-21611 |
VBN |
denotes |
seen |
| T4867 |
21527-21535 |
NN |
denotes |
addition |
| T4868 |
21535-21537 |
, |
denotes |
, |
| T4869 |
21537-21538 |
DT |
denotes |
a |
| T4870 |
21539-21545 |
NN |
denotes |
domain |
| T4871 |
21546-21548 |
IN |
denotes |
of |
| T4872 |
21549-21562 |
NN |
denotes |
recombination |
| T4873 |
21563-21566 |
CC |
denotes |
and |
| T4874 |
21567-21577 |
NN |
denotes |
expression |
| T4875 |
21578-21580 |
IN |
denotes |
of |
| T4876 |
21581-21585 |
NN |
denotes |
LACZ |
| T4877 |
21586-21588 |
VBZ |
denotes |
is |
| T4878 |
21589-21593 |
RB |
denotes |
also |
| T4879 |
21594-21606 |
RB |
denotes |
reproducibly |
| T4880 |
21612-21614 |
IN |
denotes |
in |
| T4881 |
21615-21618 |
DT |
denotes |
the |
| T4882 |
21629-21633 |
NN |
denotes |
half |
| T4883 |
21619-21628 |
JJ |
denotes |
posterior |
| T4884 |
21634-21636 |
IN |
denotes |
of |
| T4885 |
21637-21640 |
DT |
denotes |
the |
| T4886 |
21647-21652 |
NN |
denotes |
digit |
| T4887 |
21641-21646 |
JJ |
denotes |
fifth |
| T4888 |
21653-21654 |
-LRB- |
denotes |
( |
| T4889 |
21654-21660 |
NN |
denotes |
Figure |
| T4890 |
21661-21663 |
CD |
denotes |
2C |
| T4891 |
21663-21664 |
-RRB- |
denotes |
) |
| T4892 |
21664-21665 |
. |
denotes |
. |
| T4893 |
21665-22004 |
sentence |
denotes |
Terminal deoxynucleotidyl transferase–mediated deoxyuridine triphosphate nick end labeling (TUNEL) staining of interdigital mesenchyme between the first and second digits (Figure 2D and 2E) and the fifth digit flanking mesenchyme showed a decreased number of dying cells in the regions where excess tissue is retained in the mutant limbs. |
| T4894 |
21666-21674 |
JJ |
denotes |
Terminal |
| T4895 |
21748-21756 |
NN |
denotes |
labeling |
| T4896 |
21675-21691 |
NN |
denotes |
deoxynucleotidyl |
| T4897 |
21692-21703 |
NN |
denotes |
transferase |
| T4898 |
21704-21712 |
VBN |
denotes |
mediated |
| T4899 |
21703-21704 |
HYPH |
denotes |
– |
| T4900 |
21713-21725 |
NN |
denotes |
deoxyuridine |
| T4901 |
21726-21738 |
NN |
denotes |
triphosphate |
| T4902 |
21739-21743 |
NN |
denotes |
nick |
| T4903 |
21744-21747 |
NN |
denotes |
end |
| T4904 |
21765-21773 |
NN |
denotes |
staining |
| T4905 |
21757-21758 |
-LRB- |
denotes |
( |
| T4906 |
21758-21763 |
NN |
denotes |
TUNEL |
| T4907 |
21763-21764 |
-RRB- |
denotes |
) |
| T4908 |
21896-21902 |
VBD |
denotes |
showed |
| T4909 |
21774-21776 |
IN |
denotes |
of |
| T4910 |
21777-21789 |
JJ |
denotes |
interdigital |
| T4911 |
21790-21800 |
NN |
denotes |
mesenchyme |
| T4912 |
21801-21808 |
IN |
denotes |
between |
| T4913 |
21809-21812 |
DT |
denotes |
the |
| T4914 |
21830-21836 |
NNS |
denotes |
digits |
| T4915 |
21813-21818 |
JJ |
denotes |
first |
| T4916 |
21819-21822 |
CC |
denotes |
and |
| T4917 |
21823-21829 |
JJ |
denotes |
second |
| T4918 |
21837-21838 |
-LRB- |
denotes |
( |
| T4919 |
21838-21844 |
NN |
denotes |
Figure |
| T4920 |
21845-21847 |
CD |
denotes |
2D |
| T4921 |
21848-21851 |
CC |
denotes |
and |
| T4922 |
21852-21854 |
CD |
denotes |
2E |
| T4923 |
21854-21855 |
-RRB- |
denotes |
) |
| T4924 |
21856-21859 |
CC |
denotes |
and |
| T4925 |
21860-21863 |
DT |
denotes |
the |
| T4926 |
21870-21875 |
NN |
denotes |
digit |
| T4927 |
21864-21869 |
JJ |
denotes |
fifth |
| T4928 |
21876-21884 |
VBG |
denotes |
flanking |
| T4929 |
21885-21895 |
NN |
denotes |
mesenchyme |
| T4930 |
21903-21904 |
DT |
denotes |
a |
| T4931 |
21915-21921 |
NN |
denotes |
number |
| T4932 |
21905-21914 |
VBN |
denotes |
decreased |
| T4933 |
21922-21924 |
IN |
denotes |
of |
| T4934 |
21925-21930 |
VBG |
denotes |
dying |
| T4935 |
21931-21936 |
NNS |
denotes |
cells |
| T4936 |
21937-21939 |
IN |
denotes |
in |
| T4937 |
21940-21943 |
DT |
denotes |
the |
| T4938 |
21944-21951 |
NNS |
denotes |
regions |
| T4939 |
21952-21957 |
WRB |
denotes |
where |
| T4940 |
21975-21983 |
VBN |
denotes |
retained |
| T4941 |
21958-21964 |
JJ |
denotes |
excess |
| T4942 |
21965-21971 |
NN |
denotes |
tissue |
| T4943 |
21972-21974 |
VBZ |
denotes |
is |
| T4944 |
21984-21986 |
IN |
denotes |
in |
| T4945 |
21987-21990 |
DT |
denotes |
the |
| T4946 |
21998-22003 |
NNS |
denotes |
limbs |
| T4947 |
21991-21997 |
NN |
denotes |
mutant |
| T4948 |
22003-22004 |
. |
denotes |
. |
| T4949 |
22004-22118 |
sentence |
denotes |
Numbers of phosphorylated histone H3-labeled proliferating cells were also elevated in these regions (Figure 2F). |
| T4950 |
22005-22012 |
NNS |
denotes |
Numbers |
| T4951 |
22080-22088 |
VBN |
denotes |
elevated |
| T4952 |
22013-22015 |
IN |
denotes |
of |
| T4953 |
22016-22030 |
VBN |
denotes |
phosphorylated |
| T4954 |
22039-22041 |
NN |
denotes |
H3 |
| T4955 |
22031-22038 |
NN |
denotes |
histone |
| T4956 |
22042-22049 |
VBN |
denotes |
labeled |
| T4957 |
22041-22042 |
HYPH |
denotes |
- |
| T4958 |
22064-22069 |
NNS |
denotes |
cells |
| T4959 |
22050-22063 |
VBG |
denotes |
proliferating |
| T4960 |
22070-22074 |
VBD |
denotes |
were |
| T4961 |
22075-22079 |
RB |
denotes |
also |
| T4962 |
22089-22091 |
IN |
denotes |
in |
| T4963 |
22092-22097 |
DT |
denotes |
these |
| T4964 |
22098-22105 |
NNS |
denotes |
regions |
| T4965 |
22106-22107 |
-LRB- |
denotes |
( |
| T4966 |
22107-22113 |
NN |
denotes |
Figure |
| T4967 |
22114-22116 |
CD |
denotes |
2F |
| T4968 |
22116-22117 |
-RRB- |
denotes |
) |
| T4969 |
22117-22118 |
. |
denotes |
. |
| T4970 |
22118-22277 |
sentence |
denotes |
Most cells found in the webbed region between the first and second digits at E15.5 strongly expressed LACZ in Gdf5-Cre/Bmpr1afloxP mutant embryos (Figure 2H). |
| T4971 |
22119-22123 |
JJS |
denotes |
Most |
| T4972 |
22124-22129 |
NNS |
denotes |
cells |
| T4973 |
22211-22220 |
VBD |
denotes |
expressed |
| T4974 |
22130-22135 |
VBN |
denotes |
found |
| T4975 |
22136-22138 |
IN |
denotes |
in |
| T4976 |
22139-22142 |
DT |
denotes |
the |
| T4977 |
22150-22156 |
NN |
denotes |
region |
| T4978 |
22143-22149 |
VBN |
denotes |
webbed |
| T4979 |
22157-22164 |
IN |
denotes |
between |
| T4980 |
22165-22168 |
DT |
denotes |
the |
| T4981 |
22186-22192 |
NNS |
denotes |
digits |
| T4982 |
22169-22174 |
JJ |
denotes |
first |
| T4983 |
22175-22178 |
CC |
denotes |
and |
| T4984 |
22179-22185 |
JJ |
denotes |
second |
| T4985 |
22193-22195 |
IN |
denotes |
at |
| T4986 |
22196-22201 |
NN |
denotes |
E15.5 |
| T4987 |
22202-22210 |
RB |
denotes |
strongly |
| T4988 |
22221-22225 |
NN |
denotes |
LACZ |
| T4989 |
22226-22228 |
IN |
denotes |
in |
| T4990 |
22229-22233 |
NN |
denotes |
Gdf5 |
| T4991 |
22234-22237 |
NN |
denotes |
Cre |
| T4992 |
22233-22234 |
HYPH |
denotes |
- |
| T4993 |
22238-22249 |
NN |
denotes |
Bmpr1afloxP |
| T4994 |
22237-22238 |
HYPH |
denotes |
/ |
| T4995 |
22257-22264 |
NNS |
denotes |
embryos |
| T4996 |
22250-22256 |
NN |
denotes |
mutant |
| T4997 |
22265-22266 |
-LRB- |
denotes |
( |
| T4998 |
22266-22272 |
NN |
denotes |
Figure |
| T4999 |
22273-22275 |
CD |
denotes |
2H |
| T5000 |
22275-22276 |
-RRB- |
denotes |
) |
| T5001 |
22276-22277 |
. |
denotes |
. |
| T5002 |
22277-22491 |
sentence |
denotes |
These data suggest that regional loss of BMPR1A receptor signaling blocks programmed cell death in interdigital mesenchyme, and that the recombined cells survive and proliferate in the absence of BMPR1A signaling. |
| T5003 |
22278-22283 |
DT |
denotes |
These |
| T5004 |
22284-22288 |
NNS |
denotes |
data |
| T5005 |
22289-22296 |
VBP |
denotes |
suggest |
| T5006 |
22297-22301 |
IN |
denotes |
that |
| T5007 |
22345-22351 |
VBZ |
denotes |
blocks |
| T5008 |
22302-22310 |
JJ |
denotes |
regional |
| T5009 |
22311-22315 |
NN |
denotes |
loss |
| T5010 |
22316-22318 |
IN |
denotes |
of |
| T5011 |
22319-22325 |
NN |
denotes |
BMPR1A |
| T5012 |
22335-22344 |
NN |
denotes |
signaling |
| T5013 |
22326-22334 |
NN |
denotes |
receptor |
| T5014 |
22352-22362 |
VBN |
denotes |
programmed |
| T5015 |
22368-22373 |
NN |
denotes |
death |
| T5016 |
22363-22367 |
NN |
denotes |
cell |
| T5017 |
22374-22376 |
IN |
denotes |
in |
| T5018 |
22377-22389 |
JJ |
denotes |
interdigital |
| T5019 |
22390-22400 |
NN |
denotes |
mesenchyme |
| T5020 |
22400-22402 |
, |
denotes |
, |
| T5021 |
22402-22405 |
CC |
denotes |
and |
| T5022 |
22406-22410 |
IN |
denotes |
that |
| T5023 |
22432-22439 |
VBP |
denotes |
survive |
| T5024 |
22411-22414 |
DT |
denotes |
the |
| T5025 |
22426-22431 |
NNS |
denotes |
cells |
| T5026 |
22415-22425 |
VBN |
denotes |
recombined |
| T5027 |
22440-22443 |
CC |
denotes |
and |
| T5028 |
22444-22455 |
VBP |
denotes |
proliferate |
| T5029 |
22456-22458 |
IN |
denotes |
in |
| T5030 |
22459-22462 |
DT |
denotes |
the |
| T5031 |
22463-22470 |
NN |
denotes |
absence |
| T5032 |
22471-22473 |
IN |
denotes |
of |
| T5033 |
22474-22480 |
NN |
denotes |
BMPR1A |
| T5034 |
22481-22490 |
NN |
denotes |
signaling |
| T5035 |
22490-22491 |
. |
denotes |
. |
| T5185 |
22644-22645 |
. |
denotes |
. |
| T5186 |
22645-22821 |
sentence |
denotes |
In situ hybridization showed that the gene is also expressed in the interzones of ankle joints and prospective articular cartilage regions of digit joints at E15.5 (Figure 4). |
| T5187 |
22646-22648 |
FW |
denotes |
In |
| T5188 |
22649-22653 |
FW |
denotes |
situ |
| T5189 |
22654-22667 |
NN |
denotes |
hybridization |
| T5190 |
22668-22674 |
VBD |
denotes |
showed |
| T5191 |
22675-22679 |
IN |
denotes |
that |
| T5192 |
22697-22706 |
VBN |
denotes |
expressed |
| T5193 |
22680-22683 |
DT |
denotes |
the |
| T5194 |
22684-22688 |
NN |
denotes |
gene |
| T5195 |
22689-22691 |
VBZ |
denotes |
is |
| T5196 |
22692-22696 |
RB |
denotes |
also |
| T5197 |
22707-22709 |
IN |
denotes |
in |
| T5198 |
22710-22713 |
DT |
denotes |
the |
| T5199 |
22714-22724 |
NNS |
denotes |
interzones |
| T5200 |
22725-22727 |
IN |
denotes |
of |
| T5201 |
22728-22733 |
NN |
denotes |
ankle |
| T5202 |
22734-22740 |
NNS |
denotes |
joints |
| T5203 |
22741-22744 |
CC |
denotes |
and |
| T5204 |
22745-22756 |
JJ |
denotes |
prospective |
| T5205 |
22777-22784 |
NNS |
denotes |
regions |
| T5206 |
22757-22766 |
JJ |
denotes |
articular |
| T5207 |
22767-22776 |
NN |
denotes |
cartilage |
| T5208 |
22785-22787 |
IN |
denotes |
of |
| T5209 |
22788-22793 |
NN |
denotes |
digit |
| T5210 |
22794-22800 |
NNS |
denotes |
joints |
| T5211 |
22801-22803 |
IN |
denotes |
at |
| T5212 |
22804-22809 |
NN |
denotes |
E15.5 |
| T5213 |
22810-22811 |
-LRB- |
denotes |
( |
| T5214 |
22811-22817 |
NN |
denotes |
Figure |
| T5215 |
22818-22819 |
CD |
denotes |
4 |
| T5216 |
22819-22820 |
-RRB- |
denotes |
) |
| T5217 |
22820-22821 |
. |
denotes |
. |
| T5218 |
22821-22988 |
sentence |
denotes |
LACZ staining indicated that Cre-mediated recombination begins to occur in ankle joints around E14.5, and is extensive by E15.5 (Figure 4G and 4J) (unpublished data). |
| T5219 |
22822-22826 |
NN |
denotes |
LACZ |
| T5220 |
22827-22835 |
NN |
denotes |
staining |
| T5221 |
22836-22845 |
VBD |
denotes |
indicated |
| T5222 |
22846-22850 |
IN |
denotes |
that |
| T5223 |
22878-22884 |
VBZ |
denotes |
begins |
| T5224 |
22851-22854 |
NN |
denotes |
Cre |
| T5225 |
22855-22863 |
VBN |
denotes |
mediated |
| T5226 |
22854-22855 |
HYPH |
denotes |
- |
| T5227 |
22864-22877 |
NN |
denotes |
recombination |
| T5228 |
22885-22887 |
TO |
denotes |
to |
| T5229 |
22888-22893 |
VB |
denotes |
occur |
| T5230 |
22894-22896 |
IN |
denotes |
in |
| T5231 |
22897-22902 |
NN |
denotes |
ankle |
| T5232 |
22903-22909 |
NNS |
denotes |
joints |
| T5233 |
22910-22916 |
IN |
denotes |
around |
| T5234 |
22917-22922 |
NN |
denotes |
E14.5 |
| T5235 |
22922-22924 |
, |
denotes |
, |
| T5236 |
22924-22927 |
CC |
denotes |
and |
| T5237 |
22928-22930 |
VBZ |
denotes |
is |
| T5238 |
22931-22940 |
JJ |
denotes |
extensive |
| T5239 |
22941-22943 |
IN |
denotes |
by |
| T5240 |
22944-22949 |
NN |
denotes |
E15.5 |
| T5241 |
22950-22951 |
-LRB- |
denotes |
( |
| T5242 |
22951-22957 |
NN |
denotes |
Figure |
| T5243 |
22958-22960 |
CD |
denotes |
4G |
| T5244 |
22961-22964 |
CC |
denotes |
and |
| T5245 |
22965-22967 |
CD |
denotes |
4J |
| T5246 |
22967-22968 |
-RRB- |
denotes |
) |
| T5247 |
22969-22970 |
-LRB- |
denotes |
( |
| T5248 |
22982-22986 |
NNS |
denotes |
data |
| T5249 |
22970-22981 |
JJ |
denotes |
unpublished |
| T5250 |
22986-22987 |
-RRB- |
denotes |
) |
| T5251 |
22987-22988 |
. |
denotes |
. |
| T5252 |
22988-23144 |
sentence |
denotes |
In the ankle joint regions that were obviously fused in postnatal mutant animals, alterations in early joint marker expression could also be seen by E15.5. |
| T5253 |
22989-22991 |
IN |
denotes |
In |
| T5254 |
23130-23134 |
VBN |
denotes |
seen |
| T5255 |
22992-22995 |
DT |
denotes |
the |
| T5256 |
23008-23015 |
NNS |
denotes |
regions |
| T5257 |
22996-23001 |
NN |
denotes |
ankle |
| T5258 |
23002-23007 |
NN |
denotes |
joint |
| T5259 |
23016-23020 |
WDT |
denotes |
that |
| T5260 |
23036-23041 |
VBN |
denotes |
fused |
| T5261 |
23021-23025 |
VBD |
denotes |
were |
| T5262 |
23026-23035 |
RB |
denotes |
obviously |
| T5263 |
23042-23044 |
IN |
denotes |
in |
| T5264 |
23045-23054 |
JJ |
denotes |
postnatal |
| T5265 |
23062-23069 |
NNS |
denotes |
animals |
| T5266 |
23055-23061 |
NN |
denotes |
mutant |
| T5267 |
23069-23071 |
, |
denotes |
, |
| T5268 |
23071-23082 |
NNS |
denotes |
alterations |
| T5269 |
23083-23085 |
IN |
denotes |
in |
| T5270 |
23086-23091 |
JJ |
denotes |
early |
| T5271 |
23105-23115 |
NN |
denotes |
expression |
| T5272 |
23092-23097 |
NN |
denotes |
joint |
| T5273 |
23098-23104 |
NN |
denotes |
marker |
| T5274 |
23116-23121 |
MD |
denotes |
could |
| T5275 |
23122-23126 |
RB |
denotes |
also |
| T5276 |
23127-23129 |
VB |
denotes |
be |
| T5277 |
23135-23137 |
IN |
denotes |
by |
| T5278 |
23138-23143 |
NN |
denotes |
E15.5 |
| T5279 |
23143-23144 |
. |
denotes |
. |
| T5280 |
23144-23386 |
sentence |
denotes |
At this stage, the Gdf5 gene is normally expressed in stripes that mark the sites of joint formation (Figure 4F), and the gene for the major collagen protein of cartilage matrix (Col2a1) is down-regulated in the interzone region (Figure 4E). |
| T5281 |
23145-23147 |
IN |
denotes |
At |
| T5282 |
23186-23195 |
VBN |
denotes |
expressed |
| T5283 |
23148-23152 |
DT |
denotes |
this |
| T5284 |
23153-23158 |
NN |
denotes |
stage |
| T5285 |
23158-23160 |
, |
denotes |
, |
| T5286 |
23160-23163 |
DT |
denotes |
the |
| T5287 |
23169-23173 |
NN |
denotes |
gene |
| T5288 |
23164-23168 |
NN |
denotes |
Gdf5 |
| T5289 |
23174-23176 |
VBZ |
denotes |
is |
| T5290 |
23177-23185 |
RB |
denotes |
normally |
| T5291 |
23196-23198 |
IN |
denotes |
in |
| T5292 |
23199-23206 |
NNS |
denotes |
stripes |
| T5293 |
23207-23211 |
WDT |
denotes |
that |
| T5294 |
23212-23216 |
VBP |
denotes |
mark |
| T5295 |
23217-23220 |
DT |
denotes |
the |
| T5296 |
23221-23226 |
NNS |
denotes |
sites |
| T5297 |
23227-23229 |
IN |
denotes |
of |
| T5298 |
23230-23235 |
NN |
denotes |
joint |
| T5299 |
23236-23245 |
NN |
denotes |
formation |
| T5300 |
23246-23247 |
-LRB- |
denotes |
( |
| T5301 |
23247-23253 |
NN |
denotes |
Figure |
| T5302 |
23254-23256 |
CD |
denotes |
4F |
| T5303 |
23256-23257 |
-RRB- |
denotes |
) |
| T5304 |
23257-23259 |
, |
denotes |
, |
| T5305 |
23259-23262 |
CC |
denotes |
and |
| T5306 |
23263-23266 |
DT |
denotes |
the |
| T5307 |
23267-23271 |
NN |
denotes |
gene |
| T5308 |
23340-23349 |
VBN |
denotes |
regulated |
| T5309 |
23272-23275 |
IN |
denotes |
for |
| T5310 |
23276-23279 |
DT |
denotes |
the |
| T5311 |
23295-23302 |
NN |
denotes |
protein |
| T5312 |
23280-23285 |
JJ |
denotes |
major |
| T5313 |
23286-23294 |
NN |
denotes |
collagen |
| T5314 |
23303-23305 |
IN |
denotes |
of |
| T5315 |
23306-23315 |
NN |
denotes |
cartilage |
| T5316 |
23316-23322 |
NN |
denotes |
matrix |
| T5317 |
23323-23324 |
-LRB- |
denotes |
( |
| T5318 |
23324-23330 |
NN |
denotes |
Col2a1 |
| T5319 |
23330-23331 |
-RRB- |
denotes |
) |
| T5320 |
23332-23334 |
VBZ |
denotes |
is |
| T5321 |
23335-23339 |
RB |
denotes |
down |
| T5322 |
23339-23340 |
HYPH |
denotes |
- |
| T5323 |
23350-23352 |
IN |
denotes |
in |
| T5324 |
23353-23356 |
DT |
denotes |
the |
| T5325 |
23367-23373 |
NN |
denotes |
region |
| T5326 |
23357-23366 |
NN |
denotes |
interzone |
| T5327 |
23374-23375 |
-LRB- |
denotes |
( |
| T5328 |
23375-23381 |
NN |
denotes |
Figure |
| T5329 |
23382-23384 |
CD |
denotes |
4E |
| T5330 |
23384-23385 |
-RRB- |
denotes |
) |
| T5331 |
23385-23386 |
. |
denotes |
. |
| T5332 |
23386-23678 |
sentence |
denotes |
In contrast, Col2a1 staining extended completely through the joint region between the second and central tarsal of Gdf5-Cre/Bmpr1afloxP mutants (Figure 4H, black arrow), and Gdf5 expression was seen only as a small notch extending into where the joint should be forming (Figure 4I, bracket). |
| T5333 |
23387-23389 |
IN |
denotes |
In |
| T5334 |
23416-23424 |
VBD |
denotes |
extended |
| T5335 |
23390-23398 |
NN |
denotes |
contrast |
| T5336 |
23398-23400 |
, |
denotes |
, |
| T5337 |
23400-23406 |
NN |
denotes |
Col2a1 |
| T5338 |
23407-23415 |
NN |
denotes |
staining |
| T5339 |
23425-23435 |
RB |
denotes |
completely |
| T5340 |
23436-23443 |
IN |
denotes |
through |
| T5341 |
23444-23447 |
DT |
denotes |
the |
| T5342 |
23454-23460 |
NN |
denotes |
region |
| T5343 |
23448-23453 |
NN |
denotes |
joint |
| T5344 |
23461-23468 |
IN |
denotes |
between |
| T5345 |
23469-23472 |
DT |
denotes |
the |
| T5346 |
23492-23498 |
NN |
denotes |
tarsal |
| T5347 |
23473-23479 |
JJ |
denotes |
second |
| T5348 |
23480-23483 |
CC |
denotes |
and |
| T5349 |
23484-23491 |
JJ |
denotes |
central |
| T5350 |
23499-23501 |
IN |
denotes |
of |
| T5351 |
23502-23506 |
NN |
denotes |
Gdf5 |
| T5352 |
23507-23510 |
NN |
denotes |
Cre |
| T5353 |
23506-23507 |
HYPH |
denotes |
- |
| T5354 |
23511-23522 |
NN |
denotes |
Bmpr1afloxP |
| T5355 |
23510-23511 |
HYPH |
denotes |
/ |
| T5356 |
23523-23530 |
NNS |
denotes |
mutants |
| T5357 |
23531-23532 |
-LRB- |
denotes |
( |
| T5358 |
23549-23554 |
NN |
denotes |
arrow |
| T5359 |
23532-23538 |
NN |
denotes |
Figure |
| T5360 |
23539-23541 |
CD |
denotes |
4H |
| T5361 |
23541-23543 |
, |
denotes |
, |
| T5362 |
23543-23548 |
JJ |
denotes |
black |
| T5363 |
23554-23555 |
-RRB- |
denotes |
) |
| T5364 |
23555-23557 |
, |
denotes |
, |
| T5365 |
23557-23560 |
CC |
denotes |
and |
| T5366 |
23561-23565 |
NN |
denotes |
Gdf5 |
| T5367 |
23566-23576 |
NN |
denotes |
expression |
| T5368 |
23581-23585 |
VBN |
denotes |
seen |
| T5369 |
23577-23580 |
VBD |
denotes |
was |
| T5370 |
23586-23590 |
RB |
denotes |
only |
| T5371 |
23591-23593 |
IN |
denotes |
as |
| T5372 |
23594-23595 |
DT |
denotes |
a |
| T5373 |
23602-23607 |
NN |
denotes |
notch |
| T5374 |
23596-23601 |
JJ |
denotes |
small |
| T5375 |
23608-23617 |
VBG |
denotes |
extending |
| T5376 |
23618-23622 |
IN |
denotes |
into |
| T5377 |
23623-23628 |
WRB |
denotes |
where |
| T5378 |
23649-23656 |
VBG |
denotes |
forming |
| T5379 |
23629-23632 |
DT |
denotes |
the |
| T5380 |
23633-23638 |
NN |
denotes |
joint |
| T5381 |
23639-23645 |
MD |
denotes |
should |
| T5382 |
23646-23648 |
VB |
denotes |
be |
| T5383 |
23657-23658 |
-LRB- |
denotes |
( |
| T5384 |
23669-23676 |
NN |
denotes |
bracket |
| T5385 |
23658-23664 |
NN |
denotes |
Figure |
| T5386 |
23665-23667 |
CD |
denotes |
4I |
| T5387 |
23667-23669 |
, |
denotes |
, |
| T5388 |
23676-23677 |
-RRB- |
denotes |
) |
| T5389 |
23677-23678 |
. |
denotes |
. |
| T5390 |
23678-23914 |
sentence |
denotes |
These data suggest that the fusions seen between ankle bones in postnatal mutant skeletons are the result of incomplete segmentation of skeletal precursors during embryonic development, a defect confined to some locations in the ankle. |
| T5391 |
23679-23684 |
DT |
denotes |
These |
| T5392 |
23685-23689 |
NNS |
denotes |
data |
| T5393 |
23690-23697 |
VBP |
denotes |
suggest |
| T5394 |
23698-23702 |
IN |
denotes |
that |
| T5395 |
23770-23773 |
VBP |
denotes |
are |
| T5396 |
23703-23706 |
DT |
denotes |
the |
| T5397 |
23707-23714 |
NNS |
denotes |
fusions |
| T5398 |
23715-23719 |
VBN |
denotes |
seen |
| T5399 |
23720-23727 |
IN |
denotes |
between |
| T5400 |
23728-23733 |
NN |
denotes |
ankle |
| T5401 |
23734-23739 |
NNS |
denotes |
bones |
| T5402 |
23740-23742 |
IN |
denotes |
in |
| T5403 |
23743-23752 |
JJ |
denotes |
postnatal |
| T5404 |
23760-23769 |
NNS |
denotes |
skeletons |
| T5405 |
23753-23759 |
NN |
denotes |
mutant |
| T5406 |
23774-23777 |
DT |
denotes |
the |
| T5407 |
23778-23784 |
NN |
denotes |
result |
| T5408 |
23785-23787 |
IN |
denotes |
of |
| T5409 |
23788-23798 |
JJ |
denotes |
incomplete |
| T5410 |
23799-23811 |
NN |
denotes |
segmentation |
| T5411 |
23812-23814 |
IN |
denotes |
of |
| T5412 |
23815-23823 |
JJ |
denotes |
skeletal |
| T5413 |
23824-23834 |
NNS |
denotes |
precursors |
| T5414 |
23835-23841 |
IN |
denotes |
during |
| T5415 |
23842-23851 |
JJ |
denotes |
embryonic |
| T5416 |
23852-23863 |
NN |
denotes |
development |
| T5417 |
23863-23865 |
, |
denotes |
, |
| T5418 |
23865-23866 |
DT |
denotes |
a |
| T5419 |
23867-23873 |
NN |
denotes |
defect |
| T5420 |
23874-23882 |
VBN |
denotes |
confined |
| T5421 |
23883-23885 |
IN |
denotes |
to |
| T5422 |
23886-23890 |
DT |
denotes |
some |
| T5423 |
23891-23900 |
NNS |
denotes |
locations |
| T5424 |
23901-23903 |
IN |
denotes |
in |
| T5425 |
23904-23907 |
DT |
denotes |
the |
| T5426 |
23908-23913 |
NN |
denotes |
ankle |
| T5427 |
23913-23914 |
. |
denotes |
. |
| T5886 |
25410-25417 |
NN |
denotes |
Failure |
| T5887 |
25418-25420 |
TO |
denotes |
to |
| T5888 |
25421-25429 |
VB |
denotes |
Maintain |
| T5889 |
25430-25439 |
JJ |
denotes |
Articular |
| T5890 |
25440-25449 |
NN |
denotes |
Cartilage |
| T5891 |
25450-25452 |
IN |
denotes |
in |
| T5892 |
25453-25458 |
JJ |
denotes |
Other |
| T5893 |
25459-25465 |
NNS |
denotes |
Joints |
| T5894 |
25465-25582 |
sentence |
denotes |
In most joints of Bmpr1a conditional knockout mice, embryonic segmentation of skeletal precursors occurred normally. |
| T5895 |
25466-25468 |
IN |
denotes |
In |
| T5896 |
25564-25572 |
VBD |
denotes |
occurred |
| T5897 |
25469-25473 |
JJS |
denotes |
most |
| T5898 |
25474-25480 |
NNS |
denotes |
joints |
| T5899 |
25481-25483 |
IN |
denotes |
of |
| T5900 |
25484-25490 |
NN |
denotes |
Bmpr1a |
| T5901 |
25503-25511 |
NN |
denotes |
knockout |
| T5902 |
25491-25502 |
JJ |
denotes |
conditional |
| T5903 |
25512-25516 |
NNS |
denotes |
mice |
| T5904 |
25516-25518 |
, |
denotes |
, |
| T5905 |
25518-25527 |
JJ |
denotes |
embryonic |
| T5906 |
25528-25540 |
NN |
denotes |
segmentation |
| T5907 |
25541-25543 |
IN |
denotes |
of |
| T5908 |
25544-25552 |
JJ |
denotes |
skeletal |
| T5909 |
25553-25563 |
NNS |
denotes |
precursors |
| T5910 |
25573-25581 |
RB |
denotes |
normally |
| T5911 |
25581-25582 |
. |
denotes |
. |
| T5912 |
25582-25854 |
sentence |
denotes |
Although Gdf5-Cre-mediated recombination was seen as early as E13.5 in digit interzone regions (see Figure 2C), no changes in cell death or cell proliferation could be seen in the metacarpal-phalangeal or metatarsal-phalangeal joints at E13.5 or E14.5 (unpublished data). |
| T5913 |
25583-25591 |
IN |
denotes |
Although |
| T5914 |
25628-25632 |
VBN |
denotes |
seen |
| T5915 |
25592-25596 |
NN |
denotes |
Gdf5 |
| T5916 |
25597-25600 |
NN |
denotes |
Cre |
| T5917 |
25596-25597 |
HYPH |
denotes |
- |
| T5918 |
25601-25609 |
VBN |
denotes |
mediated |
| T5919 |
25600-25601 |
HYPH |
denotes |
- |
| T5920 |
25610-25623 |
NN |
denotes |
recombination |
| T5921 |
25624-25627 |
VBD |
denotes |
was |
| T5922 |
25751-25755 |
VBN |
denotes |
seen |
| T5923 |
25633-25635 |
RB |
denotes |
as |
| T5924 |
25636-25641 |
RB |
denotes |
early |
| T5925 |
25642-25644 |
IN |
denotes |
as |
| T5926 |
25645-25650 |
NN |
denotes |
E13.5 |
| T5927 |
25651-25653 |
IN |
denotes |
in |
| T5928 |
25654-25659 |
NN |
denotes |
digit |
| T5929 |
25670-25677 |
NNS |
denotes |
regions |
| T5930 |
25660-25669 |
NN |
denotes |
interzone |
| T5931 |
25678-25679 |
-LRB- |
denotes |
( |
| T5932 |
25679-25682 |
VB |
denotes |
see |
| T5933 |
25683-25689 |
NN |
denotes |
Figure |
| T5934 |
25690-25692 |
CD |
denotes |
2C |
| T5935 |
25692-25693 |
-RRB- |
denotes |
) |
| T5936 |
25693-25695 |
, |
denotes |
, |
| T5937 |
25695-25697 |
DT |
denotes |
no |
| T5938 |
25698-25705 |
NNS |
denotes |
changes |
| T5939 |
25706-25708 |
IN |
denotes |
in |
| T5940 |
25709-25713 |
NN |
denotes |
cell |
| T5941 |
25714-25719 |
NN |
denotes |
death |
| T5942 |
25720-25722 |
CC |
denotes |
or |
| T5943 |
25723-25727 |
NN |
denotes |
cell |
| T5944 |
25728-25741 |
NN |
denotes |
proliferation |
| T5945 |
25742-25747 |
MD |
denotes |
could |
| T5946 |
25748-25750 |
VB |
denotes |
be |
| T5947 |
25756-25758 |
IN |
denotes |
in |
| T5948 |
25759-25762 |
DT |
denotes |
the |
| T5949 |
25810-25816 |
NNS |
denotes |
joints |
| T5950 |
25763-25773 |
JJ |
denotes |
metacarpal |
| T5951 |
25774-25784 |
JJ |
denotes |
phalangeal |
| T5952 |
25773-25774 |
HYPH |
denotes |
- |
| T5953 |
25785-25787 |
CC |
denotes |
or |
| T5954 |
25788-25798 |
JJ |
denotes |
metatarsal |
| T5955 |
25799-25809 |
JJ |
denotes |
phalangeal |
| T5956 |
25798-25799 |
HYPH |
denotes |
- |
| T5957 |
25817-25819 |
IN |
denotes |
at |
| T5958 |
25820-25825 |
NN |
denotes |
E13.5 |
| T5959 |
25826-25828 |
CC |
denotes |
or |
| T5960 |
25829-25834 |
NN |
denotes |
E14.5 |
| T5961 |
25835-25836 |
-LRB- |
denotes |
( |
| T5962 |
25848-25852 |
NNS |
denotes |
data |
| T5963 |
25836-25847 |
JJ |
denotes |
unpublished |
| T5964 |
25852-25853 |
-RRB- |
denotes |
) |
| T5965 |
25853-25854 |
. |
denotes |
. |
| T5966 |
25854-26135 |
sentence |
denotes |
Similarly, although clear LACZ expression was seen by E15.5 in interphalangeal joints and periarticular regions (Figure 4D), no difference in morphology or expression of Col2a1, Gdf5, or Bmpr1b was seen in the articular regions of the phalanges at these stages (unpublished data). |
| T5967 |
25855-25864 |
RB |
denotes |
Similarly |
| T5968 |
26053-26057 |
VBN |
denotes |
seen |
| T5969 |
25864-25866 |
, |
denotes |
, |
| T5970 |
25866-25874 |
IN |
denotes |
although |
| T5971 |
25901-25905 |
VBN |
denotes |
seen |
| T5972 |
25875-25880 |
JJ |
denotes |
clear |
| T5973 |
25886-25896 |
NN |
denotes |
expression |
| T5974 |
25881-25885 |
NN |
denotes |
LACZ |
| T5975 |
25897-25900 |
VBD |
denotes |
was |
| T5976 |
25906-25908 |
IN |
denotes |
by |
| T5977 |
25909-25914 |
NN |
denotes |
E15.5 |
| T5978 |
25915-25917 |
IN |
denotes |
in |
| T5979 |
25918-25933 |
JJ |
denotes |
interphalangeal |
| T5980 |
25934-25940 |
NNS |
denotes |
joints |
| T5981 |
25941-25944 |
CC |
denotes |
and |
| T5982 |
25945-25958 |
JJ |
denotes |
periarticular |
| T5983 |
25959-25966 |
NNS |
denotes |
regions |
| T5984 |
25967-25968 |
-LRB- |
denotes |
( |
| T5985 |
25968-25974 |
NN |
denotes |
Figure |
| T5986 |
25975-25977 |
CD |
denotes |
4D |
| T5987 |
25977-25978 |
-RRB- |
denotes |
) |
| T5988 |
25978-25980 |
, |
denotes |
, |
| T5989 |
25980-25982 |
DT |
denotes |
no |
| T5990 |
25983-25993 |
NN |
denotes |
difference |
| T5991 |
25994-25996 |
IN |
denotes |
in |
| T5992 |
25997-26007 |
NN |
denotes |
morphology |
| T5993 |
26008-26010 |
CC |
denotes |
or |
| T5994 |
26011-26021 |
NN |
denotes |
expression |
| T5995 |
26022-26024 |
IN |
denotes |
of |
| T5996 |
26025-26031 |
NN |
denotes |
Col2a1 |
| T5997 |
26031-26033 |
, |
denotes |
, |
| T5998 |
26033-26037 |
NN |
denotes |
Gdf5 |
| T5999 |
26037-26039 |
, |
denotes |
, |
| T6000 |
26039-26041 |
CC |
denotes |
or |
| T6001 |
26042-26048 |
NN |
denotes |
Bmpr1b |
| T6002 |
26049-26052 |
VBD |
denotes |
was |
| T6003 |
26058-26060 |
IN |
denotes |
in |
| T6004 |
26061-26064 |
DT |
denotes |
the |
| T6005 |
26075-26082 |
NNS |
denotes |
regions |
| T6006 |
26065-26074 |
JJ |
denotes |
articular |
| T6007 |
26083-26085 |
IN |
denotes |
of |
| T6008 |
26086-26089 |
DT |
denotes |
the |
| T6009 |
26090-26099 |
NNS |
denotes |
phalanges |
| T6010 |
26100-26102 |
IN |
denotes |
at |
| T6011 |
26103-26108 |
DT |
denotes |
these |
| T6012 |
26109-26115 |
NNS |
denotes |
stages |
| T6013 |
26116-26117 |
-LRB- |
denotes |
( |
| T6014 |
26129-26133 |
NNS |
denotes |
data |
| T6015 |
26117-26128 |
JJ |
denotes |
unpublished |
| T6016 |
26133-26134 |
-RRB- |
denotes |
) |
| T6017 |
26134-26135 |
. |
denotes |
. |
| T6018 |
26135-26405 |
sentence |
denotes |
At birth, digit joints were generally indistinguishable from those in control animals; chondrocytes were abundant in articular regions and were surrounded by typical cartilage matrix with normal staining by Safranin O, a histological stain for proteoglycans (Figure 5). |
| T6019 |
26136-26138 |
IN |
denotes |
At |
| T6020 |
26159-26163 |
VBD |
denotes |
were |
| T6021 |
26139-26144 |
NN |
denotes |
birth |
| T6022 |
26144-26146 |
, |
denotes |
, |
| T6023 |
26146-26151 |
NN |
denotes |
digit |
| T6024 |
26152-26158 |
NNS |
denotes |
joints |
| T6025 |
26236-26240 |
VBD |
denotes |
were |
| T6026 |
26164-26173 |
RB |
denotes |
generally |
| T6027 |
26174-26191 |
JJ |
denotes |
indistinguishable |
| T6028 |
26192-26196 |
IN |
denotes |
from |
| T6029 |
26197-26202 |
DT |
denotes |
those |
| T6030 |
26203-26205 |
IN |
denotes |
in |
| T6031 |
26206-26213 |
NN |
denotes |
control |
| T6032 |
26214-26221 |
NNS |
denotes |
animals |
| T6033 |
26221-26222 |
: |
denotes |
; |
| T6034 |
26223-26235 |
NNS |
denotes |
chondrocytes |
| T6035 |
26241-26249 |
JJ |
denotes |
abundant |
| T6036 |
26250-26252 |
IN |
denotes |
in |
| T6037 |
26253-26262 |
JJ |
denotes |
articular |
| T6038 |
26263-26270 |
NNS |
denotes |
regions |
| T6039 |
26271-26274 |
CC |
denotes |
and |
| T6040 |
26275-26279 |
VBD |
denotes |
were |
| T6041 |
26280-26290 |
VBN |
denotes |
surrounded |
| T6042 |
26291-26293 |
IN |
denotes |
by |
| T6043 |
26294-26301 |
JJ |
denotes |
typical |
| T6044 |
26312-26318 |
NN |
denotes |
matrix |
| T6045 |
26302-26311 |
NN |
denotes |
cartilage |
| T6046 |
26319-26323 |
IN |
denotes |
with |
| T6047 |
26324-26330 |
JJ |
denotes |
normal |
| T6048 |
26331-26339 |
NN |
denotes |
staining |
| T6049 |
26340-26342 |
IN |
denotes |
by |
| T6050 |
26343-26351 |
NN |
denotes |
Safranin |
| T6051 |
26352-26353 |
NN |
denotes |
O |
| T6052 |
26353-26355 |
, |
denotes |
, |
| T6053 |
26355-26356 |
DT |
denotes |
a |
| T6054 |
26370-26375 |
NN |
denotes |
stain |
| T6055 |
26357-26369 |
JJ |
denotes |
histological |
| T6056 |
26376-26379 |
IN |
denotes |
for |
| T6057 |
26380-26393 |
NNS |
denotes |
proteoglycans |
| T6058 |
26394-26395 |
-LRB- |
denotes |
( |
| T6059 |
26395-26401 |
NN |
denotes |
Figure |
| T6060 |
26402-26403 |
CD |
denotes |
5 |
| T6061 |
26403-26404 |
-RRB- |
denotes |
) |
| T6062 |
26404-26405 |
. |
denotes |
. |
| T6063 |
26405-26638 |
sentence |
denotes |
At this stage, both wild-type and mutant cells in articular regions also expressed high levels of Col2a1 and Aggrecan (Agg), the genes encoding the major structural proteins of cartilage matrix (Figure 5B and 5G) (unpublished data). |
| T6064 |
26406-26408 |
IN |
denotes |
At |
| T6065 |
26479-26488 |
VBD |
denotes |
expressed |
| T6066 |
26409-26413 |
DT |
denotes |
this |
| T6067 |
26414-26419 |
NN |
denotes |
stage |
| T6068 |
26419-26421 |
, |
denotes |
, |
| T6069 |
26421-26425 |
CC |
denotes |
both |
| T6070 |
26431-26435 |
NN |
denotes |
type |
| T6071 |
26426-26430 |
JJ |
denotes |
wild |
| T6072 |
26430-26431 |
HYPH |
denotes |
- |
| T6073 |
26447-26452 |
NNS |
denotes |
cells |
| T6074 |
26436-26439 |
CC |
denotes |
and |
| T6075 |
26440-26446 |
JJ |
denotes |
mutant |
| T6076 |
26453-26455 |
IN |
denotes |
in |
| T6077 |
26456-26465 |
JJ |
denotes |
articular |
| T6078 |
26466-26473 |
NNS |
denotes |
regions |
| T6079 |
26474-26478 |
RB |
denotes |
also |
| T6080 |
26489-26493 |
JJ |
denotes |
high |
| T6081 |
26494-26500 |
NNS |
denotes |
levels |
| T6082 |
26501-26503 |
IN |
denotes |
of |
| T6083 |
26504-26510 |
NN |
denotes |
Col2a1 |
| T6084 |
26511-26514 |
CC |
denotes |
and |
| T6085 |
26515-26523 |
NN |
denotes |
Aggrecan |
| T6086 |
26524-26525 |
-LRB- |
denotes |
( |
| T6087 |
26525-26528 |
NN |
denotes |
Agg |
| T6088 |
26528-26529 |
-RRB- |
denotes |
) |
| T6089 |
26529-26531 |
, |
denotes |
, |
| T6090 |
26531-26534 |
DT |
denotes |
the |
| T6091 |
26535-26540 |
NNS |
denotes |
genes |
| T6092 |
26541-26549 |
VBG |
denotes |
encoding |
| T6093 |
26550-26553 |
DT |
denotes |
the |
| T6094 |
26571-26579 |
NN |
denotes |
proteins |
| T6095 |
26554-26559 |
JJ |
denotes |
major |
| T6096 |
26560-26570 |
JJ |
denotes |
structural |
| T6097 |
26580-26582 |
IN |
denotes |
of |
| T6098 |
26583-26592 |
NN |
denotes |
cartilage |
| T6099 |
26593-26599 |
NN |
denotes |
matrix |
| T6100 |
26600-26601 |
-LRB- |
denotes |
( |
| T6101 |
26601-26607 |
NN |
denotes |
Figure |
| T6102 |
26608-26610 |
CD |
denotes |
5B |
| T6103 |
26611-26614 |
CC |
denotes |
and |
| T6104 |
26615-26617 |
CD |
denotes |
5G |
| T6105 |
26617-26618 |
-RRB- |
denotes |
) |
| T6106 |
26619-26620 |
-LRB- |
denotes |
( |
| T6107 |
26632-26636 |
NNS |
denotes |
data |
| T6108 |
26620-26631 |
JJ |
denotes |
unpublished |
| T6109 |
26636-26637 |
-RRB- |
denotes |
) |
| T6110 |
26637-26638 |
. |
denotes |
. |
| T6111 |
26638-26726 |
sentence |
denotes |
No alterations in cellular apoptosis or proliferation were observed (unpublished data). |
| T6112 |
26639-26641 |
DT |
denotes |
No |
| T6113 |
26642-26653 |
NNS |
denotes |
alterations |
| T6114 |
26698-26706 |
VBN |
denotes |
observed |
| T6115 |
26654-26656 |
IN |
denotes |
in |
| T6116 |
26657-26665 |
JJ |
denotes |
cellular |
| T6117 |
26666-26675 |
NN |
denotes |
apoptosis |
| T6118 |
26676-26678 |
CC |
denotes |
or |
| T6119 |
26679-26692 |
NN |
denotes |
proliferation |
| T6120 |
26693-26697 |
VBD |
denotes |
were |
| T6121 |
26707-26708 |
-LRB- |
denotes |
( |
| T6122 |
26720-26724 |
NNS |
denotes |
data |
| T6123 |
26708-26719 |
JJ |
denotes |
unpublished |
| T6124 |
26724-26725 |
-RRB- |
denotes |
) |
| T6125 |
26725-26726 |
. |
denotes |
. |
| T6126 |
26726-28235 |
sentence |
denotes |
Figure 5 Bmpr1a Is Required to Maintain Expression of ECM Components in Articular Cartilage
In situ hybridization or LACZ staining on near adjacent sections of metacarpal-phalangeal joints (A–C and F–H) and the tarsal 2-metatarsal II joint (D–E and I–J) of P0 mice. At birth, articular cartilage of controls (A–E) and mutants (F–J) appears similar by Safranin O staining (A and F), and Col2 expression (B, G). Mat4 expression confirms that articular cartilage is initially specified in mutants (D andI, brackets). LACZ expression confirms Cre-mediated recombination has occurred in articular cartilage (C, H, E, and J). (K–T) Near adjacent sections of the metacarpal-phalangeal joints of P14 mice. Two weeks after birth, articular cartilage of controls stains with pericellular Safranin O (orange staining, K), and expresses Col2 (L), Agg (M), and SOX9 (N). In contrast, mutant articular cells are smaller and more densely packed, lack pericellular Safranin O staining (P), have reduced expression of Col2 (Q) and Agg (R), but retain normal levels of SOX9 protein (S, brackets; dashed line marks faint edges of articular surfaces). LACZ expression confirms Cre-mediated recombination has occurred in articular cells (O ansd T, brackets). (A and K) Scale bar = 75 μm. To determine whether articular cells were properly specified in mutants, we also analyzed expression of Matrilin-4 (Mat4), a gene expressed specifically in the periarticular and perichondral regions of developing joints (Klatt et al. 2001). |
| T6127 |
27995-27997 |
TO |
denotes |
To |
| T6128 |
27998-28007 |
VB |
denotes |
determine |
| T6129 |
28076-28084 |
VBD |
denotes |
analyzed |
| T6130 |
28008-28015 |
IN |
denotes |
whether |
| T6131 |
28046-28055 |
VBN |
denotes |
specified |
| T6132 |
28016-28025 |
JJ |
denotes |
articular |
| T6133 |
28026-28031 |
NNS |
denotes |
cells |
| T6134 |
28032-28036 |
VBD |
denotes |
were |
| T6135 |
28037-28045 |
RB |
denotes |
properly |
| T6136 |
28056-28058 |
IN |
denotes |
in |
| T6137 |
28059-28066 |
NNS |
denotes |
mutants |
| T6138 |
28066-28068 |
, |
denotes |
, |
| T6139 |
28068-28070 |
PRP |
denotes |
we |
| T6140 |
28071-28075 |
RB |
denotes |
also |
| T6141 |
28085-28095 |
NN |
denotes |
expression |
| T6142 |
28096-28098 |
IN |
denotes |
of |
| T6143 |
28099-28107 |
NN |
denotes |
Matrilin |
| T6144 |
28107-28108 |
HYPH |
denotes |
- |
| T6145 |
28108-28109 |
CD |
denotes |
4 |
| T6146 |
28110-28111 |
-LRB- |
denotes |
( |
| T6147 |
28111-28115 |
NN |
denotes |
Mat4 |
| T6148 |
28115-28116 |
-RRB- |
denotes |
) |
| T6149 |
28116-28118 |
, |
denotes |
, |
| T6150 |
28118-28119 |
DT |
denotes |
a |
| T6151 |
28120-28124 |
NN |
denotes |
gene |
| T6152 |
28125-28134 |
VBN |
denotes |
expressed |
| T6153 |
28135-28147 |
RB |
denotes |
specifically |
| T6154 |
28148-28150 |
IN |
denotes |
in |
| T6155 |
28151-28154 |
DT |
denotes |
the |
| T6156 |
28186-28193 |
NNS |
denotes |
regions |
| T6157 |
28155-28168 |
JJ |
denotes |
periarticular |
| T6158 |
28169-28172 |
CC |
denotes |
and |
| T6159 |
28173-28185 |
JJ |
denotes |
perichondral |
| T6160 |
28194-28196 |
IN |
denotes |
of |
| T6161 |
28197-28207 |
VBG |
denotes |
developing |
| T6162 |
28208-28214 |
NNS |
denotes |
joints |
| T6163 |
28215-28216 |
-LRB- |
denotes |
( |
| T6164 |
28216-28221 |
NNP |
denotes |
Klatt |
| T6165 |
28222-28224 |
FW |
denotes |
et |
| T6166 |
28225-28228 |
FW |
denotes |
al. |
| T6167 |
28229-28233 |
CD |
denotes |
2001 |
| T6168 |
28233-28234 |
-RRB- |
denotes |
) |
| T6169 |
28234-28235 |
. |
denotes |
. |
| T6170 |
28235-28388 |
sentence |
denotes |
In both control and mutant animals, transcription of Mat4 was clearly detectable in the articular cartilage layers of newborn joints (Figure 5D and 5I). |
| T6171 |
28236-28238 |
IN |
denotes |
In |
| T6172 |
28294-28297 |
VBD |
denotes |
was |
| T6173 |
28239-28243 |
CC |
denotes |
both |
| T6174 |
28244-28251 |
NN |
denotes |
control |
| T6175 |
28263-28270 |
NNS |
denotes |
animals |
| T6176 |
28252-28255 |
CC |
denotes |
and |
| T6177 |
28256-28262 |
JJ |
denotes |
mutant |
| T6178 |
28270-28272 |
, |
denotes |
, |
| T6179 |
28272-28285 |
NN |
denotes |
transcription |
| T6180 |
28286-28288 |
IN |
denotes |
of |
| T6181 |
28289-28293 |
NN |
denotes |
Mat4 |
| T6182 |
28298-28305 |
RB |
denotes |
clearly |
| T6183 |
28306-28316 |
JJ |
denotes |
detectable |
| T6184 |
28317-28319 |
IN |
denotes |
in |
| T6185 |
28320-28323 |
DT |
denotes |
the |
| T6186 |
28344-28350 |
NNS |
denotes |
layers |
| T6187 |
28324-28333 |
JJ |
denotes |
articular |
| T6188 |
28334-28343 |
NN |
denotes |
cartilage |
| T6189 |
28351-28353 |
IN |
denotes |
of |
| T6190 |
28354-28361 |
JJ |
denotes |
newborn |
| T6191 |
28362-28368 |
NNS |
denotes |
joints |
| T6192 |
28369-28370 |
-LRB- |
denotes |
( |
| T6193 |
28377-28379 |
CD |
denotes |
5D |
| T6194 |
28370-28376 |
NN |
denotes |
Figure |
| T6195 |
28380-28383 |
CC |
denotes |
and |
| T6196 |
28384-28386 |
CD |
denotes |
5I |
| T6197 |
28386-28387 |
-RRB- |
denotes |
) |
| T6198 |
28387-28388 |
. |
denotes |
. |
| T6199 |
28388-28573 |
sentence |
denotes |
In all experiments, expression of LACZ throughout articular regions indicated that Cre-mediated recombination had occurred throughout the articular regions (Figure 5C, 5H, 5E, and 5J). |
| T6200 |
28389-28391 |
IN |
denotes |
In |
| T6201 |
28457-28466 |
VBD |
denotes |
indicated |
| T6202 |
28392-28395 |
DT |
denotes |
all |
| T6203 |
28396-28407 |
NNS |
denotes |
experiments |
| T6204 |
28407-28409 |
, |
denotes |
, |
| T6205 |
28409-28419 |
NN |
denotes |
expression |
| T6206 |
28420-28422 |
IN |
denotes |
of |
| T6207 |
28423-28427 |
NN |
denotes |
LACZ |
| T6208 |
28428-28438 |
IN |
denotes |
throughout |
| T6209 |
28439-28448 |
JJ |
denotes |
articular |
| T6210 |
28449-28456 |
NNS |
denotes |
regions |
| T6211 |
28467-28471 |
IN |
denotes |
that |
| T6212 |
28503-28511 |
VBN |
denotes |
occurred |
| T6213 |
28472-28475 |
NN |
denotes |
Cre |
| T6214 |
28476-28484 |
VBN |
denotes |
mediated |
| T6215 |
28475-28476 |
HYPH |
denotes |
- |
| T6216 |
28485-28498 |
NN |
denotes |
recombination |
| T6217 |
28499-28502 |
VBD |
denotes |
had |
| T6218 |
28512-28522 |
IN |
denotes |
throughout |
| T6219 |
28523-28526 |
DT |
denotes |
the |
| T6220 |
28537-28544 |
NNS |
denotes |
regions |
| T6221 |
28527-28536 |
JJ |
denotes |
articular |
| T6222 |
28545-28546 |
-LRB- |
denotes |
( |
| T6223 |
28546-28552 |
NN |
denotes |
Figure |
| T6224 |
28553-28555 |
CD |
denotes |
5C |
| T6225 |
28555-28557 |
, |
denotes |
, |
| T6226 |
28557-28559 |
CD |
denotes |
5H |
| T6227 |
28559-28561 |
, |
denotes |
, |
| T6228 |
28561-28563 |
CD |
denotes |
5E |
| T6229 |
28563-28565 |
, |
denotes |
, |
| T6230 |
28565-28568 |
CC |
denotes |
and |
| T6231 |
28569-28571 |
CD |
denotes |
5J |
| T6232 |
28571-28572 |
-RRB- |
denotes |
) |
| T6233 |
28572-28573 |
. |
denotes |
. |
| T6234 |
28573-28769 |
sentence |
denotes |
The normal histological appearance, staining properties, and marker gene expression patterns suggest that Bmpr1a is not required for the initial formation or specification of articular cartilage. |
| T6235 |
28574-28577 |
DT |
denotes |
The |
| T6236 |
28598-28608 |
NN |
denotes |
appearance |
| T6237 |
28578-28584 |
JJ |
denotes |
normal |
| T6238 |
28585-28597 |
JJ |
denotes |
histological |
| T6239 |
28667-28674 |
VBP |
denotes |
suggest |
| T6240 |
28608-28610 |
, |
denotes |
, |
| T6241 |
28610-28618 |
VBG |
denotes |
staining |
| T6242 |
28619-28629 |
NNS |
denotes |
properties |
| T6243 |
28629-28631 |
, |
denotes |
, |
| T6244 |
28631-28634 |
CC |
denotes |
and |
| T6245 |
28635-28641 |
NN |
denotes |
marker |
| T6246 |
28642-28646 |
NN |
denotes |
gene |
| T6247 |
28658-28666 |
NNS |
denotes |
patterns |
| T6248 |
28647-28657 |
NN |
denotes |
expression |
| T6249 |
28675-28679 |
IN |
denotes |
that |
| T6250 |
28694-28702 |
VBN |
denotes |
required |
| T6251 |
28680-28686 |
NN |
denotes |
Bmpr1a |
| T6252 |
28687-28689 |
VBZ |
denotes |
is |
| T6253 |
28690-28693 |
RB |
denotes |
not |
| T6254 |
28703-28706 |
IN |
denotes |
for |
| T6255 |
28707-28710 |
DT |
denotes |
the |
| T6256 |
28719-28728 |
NN |
denotes |
formation |
| T6257 |
28711-28718 |
JJ |
denotes |
initial |
| T6258 |
28729-28731 |
CC |
denotes |
or |
| T6259 |
28732-28745 |
NN |
denotes |
specification |
| T6260 |
28746-28748 |
IN |
denotes |
of |
| T6261 |
28749-28758 |
JJ |
denotes |
articular |
| T6262 |
28759-28768 |
NN |
denotes |
cartilage |
| T6263 |
28768-28769 |
. |
denotes |
. |
| T6264 |
28769-28875 |
sentence |
denotes |
By 1 wk after birth, obvious differences began to be detected in the articular regions of mutant animals. |
| T6265 |
28770-28772 |
IN |
denotes |
By |
| T6266 |
28811-28816 |
VBD |
denotes |
began |
| T6267 |
28773-28774 |
CD |
denotes |
1 |
| T6268 |
28775-28777 |
NN |
denotes |
wk |
| T6269 |
28778-28783 |
IN |
denotes |
after |
| T6270 |
28784-28789 |
NN |
denotes |
birth |
| T6271 |
28789-28791 |
, |
denotes |
, |
| T6272 |
28791-28798 |
JJ |
denotes |
obvious |
| T6273 |
28799-28810 |
NNS |
denotes |
differences |
| T6274 |
28817-28819 |
TO |
denotes |
to |
| T6275 |
28823-28831 |
VBN |
denotes |
detected |
| T6276 |
28820-28822 |
VB |
denotes |
be |
| T6277 |
28832-28834 |
IN |
denotes |
in |
| T6278 |
28835-28838 |
DT |
denotes |
the |
| T6279 |
28849-28856 |
NNS |
denotes |
regions |
| T6280 |
28839-28848 |
JJ |
denotes |
articular |
| T6281 |
28857-28859 |
IN |
denotes |
of |
| T6282 |
28860-28866 |
NN |
denotes |
mutant |
| T6283 |
28867-28874 |
NNS |
denotes |
animals |
| T6284 |
28874-28875 |
. |
denotes |
. |
| T6285 |
28875-29025 |
sentence |
denotes |
The expression of Col2a1 was reduced throughout the articular surfaces of the carpals, metacarpals, and phalanges of the forefeet (unpublished data). |
| T6286 |
28876-28879 |
DT |
denotes |
The |
| T6287 |
28880-28890 |
NN |
denotes |
expression |
| T6288 |
28905-28912 |
VBN |
denotes |
reduced |
| T6289 |
28891-28893 |
IN |
denotes |
of |
| T6290 |
28894-28900 |
NN |
denotes |
Col2a1 |
| T6291 |
28901-28904 |
VBD |
denotes |
was |
| T6292 |
28913-28923 |
IN |
denotes |
throughout |
| T6293 |
28924-28927 |
DT |
denotes |
the |
| T6294 |
28938-28946 |
NNS |
denotes |
surfaces |
| T6295 |
28928-28937 |
JJ |
denotes |
articular |
| T6296 |
28947-28949 |
IN |
denotes |
of |
| T6297 |
28950-28953 |
DT |
denotes |
the |
| T6298 |
28954-28961 |
NNS |
denotes |
carpals |
| T6299 |
28961-28963 |
, |
denotes |
, |
| T6300 |
28963-28974 |
NNS |
denotes |
metacarpals |
| T6301 |
28974-28976 |
, |
denotes |
, |
| T6302 |
28976-28979 |
CC |
denotes |
and |
| T6303 |
28980-28989 |
NNS |
denotes |
phalanges |
| T6304 |
28990-28992 |
IN |
denotes |
of |
| T6305 |
28993-28996 |
DT |
denotes |
the |
| T6306 |
28997-29005 |
NNS |
denotes |
forefeet |
| T6307 |
29006-29007 |
-LRB- |
denotes |
( |
| T6308 |
29019-29023 |
NNS |
denotes |
data |
| T6309 |
29007-29018 |
JJ |
denotes |
unpublished |
| T6310 |
29023-29024 |
-RRB- |
denotes |
) |
| T6311 |
29024-29025 |
. |
denotes |
. |
| T6312 |
29025-29145 |
sentence |
denotes |
Less severe reductions were also seen in articular cells of tarsals and metatarsals in the hindfeet (unpublished data). |
| T6313 |
29026-29030 |
RBR |
denotes |
Less |
| T6314 |
29031-29037 |
JJ |
denotes |
severe |
| T6315 |
29038-29048 |
NNS |
denotes |
reductions |
| T6316 |
29059-29063 |
VBN |
denotes |
seen |
| T6317 |
29049-29053 |
VBD |
denotes |
were |
| T6318 |
29054-29058 |
RB |
denotes |
also |
| T6319 |
29064-29066 |
IN |
denotes |
in |
| T6320 |
29067-29076 |
JJ |
denotes |
articular |
| T6321 |
29077-29082 |
NNS |
denotes |
cells |
| T6322 |
29083-29085 |
IN |
denotes |
of |
| T6323 |
29086-29093 |
NNS |
denotes |
tarsals |
| T6324 |
29094-29097 |
CC |
denotes |
and |
| T6325 |
29098-29109 |
NNS |
denotes |
metatarsals |
| T6326 |
29110-29112 |
IN |
denotes |
in |
| T6327 |
29113-29116 |
DT |
denotes |
the |
| T6328 |
29117-29125 |
NN |
denotes |
hindfeet |
| T6329 |
29126-29127 |
-LRB- |
denotes |
( |
| T6330 |
29139-29143 |
NNS |
denotes |
data |
| T6331 |
29127-29138 |
JJ |
denotes |
unpublished |
| T6332 |
29143-29144 |
-RRB- |
denotes |
) |
| T6333 |
29144-29145 |
. |
denotes |
. |
| T6334 |
29145-29525 |
sentence |
denotes |
By 2 wk of age, Col2a1 expression was reduced in most cells of the articular region (Figure 5L and 5Q), accompanied by markedly reduced Safranin O staining (Figure 5K and 5P), and decreased expression of Agg and two genes normally expressed in more mature articular cartilage cells, Collagen 3 (Col3a1) and Collagen 10 (Col10a1) (Figure 5M and 5R) (unpublished data) (Eyre 2002). |
| T6335 |
29146-29148 |
IN |
denotes |
By |
| T6336 |
29184-29191 |
VBN |
denotes |
reduced |
| T6337 |
29149-29150 |
CD |
denotes |
2 |
| T6338 |
29151-29153 |
NNS |
denotes |
wk |
| T6339 |
29154-29156 |
IN |
denotes |
of |
| T6340 |
29157-29160 |
NN |
denotes |
age |
| T6341 |
29160-29162 |
, |
denotes |
, |
| T6342 |
29162-29168 |
NN |
denotes |
Col2a1 |
| T6343 |
29169-29179 |
NN |
denotes |
expression |
| T6344 |
29180-29183 |
VBD |
denotes |
was |
| T6345 |
29192-29194 |
IN |
denotes |
in |
| T6346 |
29195-29199 |
JJS |
denotes |
most |
| T6347 |
29200-29205 |
NNS |
denotes |
cells |
| T6348 |
29206-29208 |
IN |
denotes |
of |
| T6349 |
29209-29212 |
DT |
denotes |
the |
| T6350 |
29223-29229 |
NN |
denotes |
region |
| T6351 |
29213-29222 |
JJ |
denotes |
articular |
| T6352 |
29230-29231 |
-LRB- |
denotes |
( |
| T6353 |
29231-29237 |
NN |
denotes |
Figure |
| T6354 |
29238-29240 |
CD |
denotes |
5L |
| T6355 |
29241-29244 |
CC |
denotes |
and |
| T6356 |
29245-29247 |
CD |
denotes |
5Q |
| T6357 |
29247-29248 |
-RRB- |
denotes |
) |
| T6358 |
29248-29250 |
, |
denotes |
, |
| T6359 |
29250-29261 |
VBN |
denotes |
accompanied |
| T6360 |
29262-29264 |
IN |
denotes |
by |
| T6361 |
29265-29273 |
RB |
denotes |
markedly |
| T6362 |
29274-29281 |
VBN |
denotes |
reduced |
| T6363 |
29293-29301 |
NN |
denotes |
staining |
| T6364 |
29282-29290 |
NN |
denotes |
Safranin |
| T6365 |
29291-29292 |
NN |
denotes |
O |
| T6366 |
29302-29303 |
-LRB- |
denotes |
( |
| T6367 |
29303-29309 |
NN |
denotes |
Figure |
| T6368 |
29310-29312 |
CD |
denotes |
5K |
| T6369 |
29313-29316 |
CC |
denotes |
and |
| T6370 |
29317-29319 |
CD |
denotes |
5P |
| T6371 |
29319-29320 |
-RRB- |
denotes |
) |
| T6372 |
29320-29322 |
, |
denotes |
, |
| T6373 |
29322-29325 |
CC |
denotes |
and |
| T6374 |
29326-29335 |
VBN |
denotes |
decreased |
| T6375 |
29336-29346 |
NN |
denotes |
expression |
| T6376 |
29347-29349 |
IN |
denotes |
of |
| T6377 |
29350-29353 |
NN |
denotes |
Agg |
| T6378 |
29354-29357 |
CC |
denotes |
and |
| T6379 |
29358-29361 |
CD |
denotes |
two |
| T6380 |
29362-29367 |
NNS |
denotes |
genes |
| T6381 |
29368-29376 |
RB |
denotes |
normally |
| T6382 |
29377-29386 |
VBN |
denotes |
expressed |
| T6383 |
29387-29389 |
IN |
denotes |
in |
| T6384 |
29390-29394 |
RBR |
denotes |
more |
| T6385 |
29395-29401 |
JJ |
denotes |
mature |
| T6386 |
29422-29427 |
NNS |
denotes |
cells |
| T6387 |
29402-29411 |
JJ |
denotes |
articular |
| T6388 |
29412-29421 |
NN |
denotes |
cartilage |
| T6389 |
29427-29429 |
, |
denotes |
, |
| T6390 |
29429-29437 |
NN |
denotes |
Collagen |
| T6391 |
29438-29439 |
CD |
denotes |
3 |
| T6392 |
29440-29441 |
-LRB- |
denotes |
( |
| T6393 |
29441-29447 |
NN |
denotes |
Col3a1 |
| T6394 |
29447-29448 |
-RRB- |
denotes |
) |
| T6395 |
29449-29452 |
CC |
denotes |
and |
| T6396 |
29453-29461 |
NN |
denotes |
Collagen |
| T6397 |
29462-29464 |
CD |
denotes |
10 |
| T6398 |
29465-29466 |
-LRB- |
denotes |
( |
| T6399 |
29466-29473 |
NN |
denotes |
Col10a1 |
| T6400 |
29473-29474 |
-RRB- |
denotes |
) |
| T6401 |
29475-29476 |
-LRB- |
denotes |
( |
| T6402 |
29476-29482 |
NN |
denotes |
Figure |
| T6403 |
29483-29485 |
CD |
denotes |
5M |
| T6404 |
29486-29489 |
CC |
denotes |
and |
| T6405 |
29490-29492 |
CD |
denotes |
5R |
| T6406 |
29492-29493 |
-RRB- |
denotes |
) |
| T6407 |
29494-29495 |
-LRB- |
denotes |
( |
| T6408 |
29507-29511 |
NNS |
denotes |
data |
| T6409 |
29495-29506 |
JJ |
denotes |
unpublished |
| T6410 |
29511-29512 |
-RRB- |
denotes |
) |
| T6411 |
29513-29514 |
-LRB- |
denotes |
( |
| T6412 |
29514-29518 |
NN |
denotes |
Eyre |
| T6413 |
29519-29523 |
CD |
denotes |
2002 |
| T6414 |
29523-29524 |
-RRB- |
denotes |
) |
| T6415 |
29524-29525 |
. |
denotes |
. |
| T6416 |
29525-29767 |
sentence |
denotes |
Inhibition of BMP signaling in cultured chondrocytes has previously been reported to induce Collagen 1 (Col1a1) expression, increase proliferation, and result in cells with flattened, fibroblast-like morphology (Enomoto-Iwamoto et al. 1998). |
| T6417 |
29526-29536 |
NN |
denotes |
Inhibition |
| T6418 |
29599-29607 |
VBN |
denotes |
reported |
| T6419 |
29537-29539 |
IN |
denotes |
of |
| T6420 |
29540-29543 |
NN |
denotes |
BMP |
| T6421 |
29544-29553 |
NN |
denotes |
signaling |
| T6422 |
29554-29556 |
IN |
denotes |
in |
| T6423 |
29557-29565 |
VBN |
denotes |
cultured |
| T6424 |
29566-29578 |
NNS |
denotes |
chondrocytes |
| T6425 |
29579-29582 |
VBZ |
denotes |
has |
| T6426 |
29583-29593 |
RB |
denotes |
previously |
| T6427 |
29594-29598 |
VBN |
denotes |
been |
| T6428 |
29608-29610 |
TO |
denotes |
to |
| T6429 |
29611-29617 |
VB |
denotes |
induce |
| T6430 |
29618-29626 |
NN |
denotes |
Collagen |
| T6431 |
29638-29648 |
NN |
denotes |
expression |
| T6432 |
29627-29628 |
CD |
denotes |
1 |
| T6433 |
29629-29630 |
-LRB- |
denotes |
( |
| T6434 |
29630-29636 |
NN |
denotes |
Col1a1 |
| T6435 |
29636-29637 |
-RRB- |
denotes |
) |
| T6436 |
29648-29650 |
, |
denotes |
, |
| T6437 |
29650-29658 |
VB |
denotes |
increase |
| T6438 |
29659-29672 |
NN |
denotes |
proliferation |
| T6439 |
29672-29674 |
, |
denotes |
, |
| T6440 |
29674-29677 |
CC |
denotes |
and |
| T6441 |
29678-29684 |
VB |
denotes |
result |
| T6442 |
29685-29687 |
IN |
denotes |
in |
| T6443 |
29688-29693 |
NNS |
denotes |
cells |
| T6444 |
29694-29698 |
IN |
denotes |
with |
| T6445 |
29699-29708 |
VBN |
denotes |
flattened |
| T6446 |
29726-29736 |
NN |
denotes |
morphology |
| T6447 |
29708-29710 |
, |
denotes |
, |
| T6448 |
29710-29720 |
NN |
denotes |
fibroblast |
| T6449 |
29721-29725 |
JJ |
denotes |
like |
| T6450 |
29720-29721 |
HYPH |
denotes |
- |
| T6451 |
29737-29738 |
-LRB- |
denotes |
( |
| T6452 |
29738-29745 |
NNP |
denotes |
Enomoto |
| T6453 |
29745-29746 |
HYPH |
denotes |
- |
| T6454 |
29746-29753 |
NNP |
denotes |
Iwamoto |
| T6455 |
29754-29756 |
FW |
denotes |
et |
| T6456 |
29757-29760 |
FW |
denotes |
al. |
| T6457 |
29761-29765 |
CD |
denotes |
1998 |
| T6458 |
29765-29766 |
-RRB- |
denotes |
) |
| T6459 |
29766-29767 |
. |
denotes |
. |
| T6460 |
29767-29963 |
sentence |
denotes |
However, we saw no increase in the expression of Col1a1 in mutant articular cartilage, and no proliferation was detected in articular cells of either mutant or control animals (unpublished data). |
| T6461 |
29768-29775 |
RB |
denotes |
However |
| T6462 |
29780-29783 |
VBD |
denotes |
saw |
| T6463 |
29775-29777 |
, |
denotes |
, |
| T6464 |
29777-29779 |
PRP |
denotes |
we |
| T6465 |
29784-29786 |
DT |
denotes |
no |
| T6466 |
29787-29795 |
NN |
denotes |
increase |
| T6467 |
29796-29798 |
IN |
denotes |
in |
| T6468 |
29799-29802 |
DT |
denotes |
the |
| T6469 |
29803-29813 |
NN |
denotes |
expression |
| T6470 |
29814-29816 |
IN |
denotes |
of |
| T6471 |
29817-29823 |
NN |
denotes |
Col1a1 |
| T6472 |
29824-29826 |
IN |
denotes |
in |
| T6473 |
29827-29833 |
NN |
denotes |
mutant |
| T6474 |
29844-29853 |
NN |
denotes |
cartilage |
| T6475 |
29834-29843 |
JJ |
denotes |
articular |
| T6476 |
29853-29855 |
, |
denotes |
, |
| T6477 |
29855-29858 |
CC |
denotes |
and |
| T6478 |
29859-29861 |
DT |
denotes |
no |
| T6479 |
29862-29875 |
NN |
denotes |
proliferation |
| T6480 |
29880-29888 |
VBN |
denotes |
detected |
| T6481 |
29876-29879 |
VBD |
denotes |
was |
| T6482 |
29889-29891 |
IN |
denotes |
in |
| T6483 |
29892-29901 |
JJ |
denotes |
articular |
| T6484 |
29902-29907 |
NNS |
denotes |
cells |
| T6485 |
29908-29910 |
IN |
denotes |
of |
| T6486 |
29911-29917 |
CC |
denotes |
either |
| T6487 |
29918-29924 |
JJ |
denotes |
mutant |
| T6488 |
29936-29943 |
NNS |
denotes |
animals |
| T6489 |
29925-29927 |
CC |
denotes |
or |
| T6490 |
29928-29935 |
NN |
denotes |
control |
| T6491 |
29944-29945 |
-LRB- |
denotes |
( |
| T6492 |
29957-29961 |
NNS |
denotes |
data |
| T6493 |
29945-29956 |
JJ |
denotes |
unpublished |
| T6494 |
29961-29962 |
-RRB- |
denotes |
) |
| T6495 |
29962-29963 |
. |
denotes |
. |
| T6496 |
29963-30194 |
sentence |
denotes |
While recombined LACZ marker expression was detected in most articular cartilage cells, it was also observed in scattered subarticular chondrocytes, growth plate chondrocytes, and osteoblasts (Figure 5O and 5T) (unpublished data). |
| T6497 |
29964-29969 |
IN |
denotes |
While |
| T6498 |
30008-30016 |
VBN |
denotes |
detected |
| T6499 |
29970-29980 |
VBN |
denotes |
recombined |
| T6500 |
29993-30003 |
NN |
denotes |
expression |
| T6501 |
29981-29985 |
NN |
denotes |
LACZ |
| T6502 |
29986-29992 |
NN |
denotes |
marker |
| T6503 |
30004-30007 |
VBD |
denotes |
was |
| T6504 |
30064-30072 |
VBN |
denotes |
observed |
| T6505 |
30017-30019 |
IN |
denotes |
in |
| T6506 |
30020-30024 |
JJS |
denotes |
most |
| T6507 |
30045-30050 |
NNS |
denotes |
cells |
| T6508 |
30025-30034 |
JJ |
denotes |
articular |
| T6509 |
30035-30044 |
NN |
denotes |
cartilage |
| T6510 |
30050-30052 |
, |
denotes |
, |
| T6511 |
30052-30054 |
PRP |
denotes |
it |
| T6512 |
30055-30058 |
VBD |
denotes |
was |
| T6513 |
30059-30063 |
RB |
denotes |
also |
| T6514 |
30073-30075 |
IN |
denotes |
in |
| T6515 |
30076-30085 |
VBN |
denotes |
scattered |
| T6516 |
30099-30111 |
NNS |
denotes |
chondrocytes |
| T6517 |
30086-30098 |
JJ |
denotes |
subarticular |
| T6518 |
30111-30113 |
, |
denotes |
, |
| T6519 |
30113-30119 |
NN |
denotes |
growth |
| T6520 |
30120-30125 |
NN |
denotes |
plate |
| T6521 |
30126-30138 |
NNS |
denotes |
chondrocytes |
| T6522 |
30138-30140 |
, |
denotes |
, |
| T6523 |
30140-30143 |
CC |
denotes |
and |
| T6524 |
30144-30155 |
NNS |
denotes |
osteoblasts |
| T6525 |
30156-30157 |
-LRB- |
denotes |
( |
| T6526 |
30157-30163 |
NN |
denotes |
Figure |
| T6527 |
30164-30166 |
CD |
denotes |
5O |
| T6528 |
30167-30170 |
CC |
denotes |
and |
| T6529 |
30171-30173 |
CD |
denotes |
5T |
| T6530 |
30173-30174 |
-RRB- |
denotes |
) |
| T6531 |
30175-30176 |
-LRB- |
denotes |
( |
| T6532 |
30188-30192 |
NNS |
denotes |
data |
| T6533 |
30176-30187 |
JJ |
denotes |
unpublished |
| T6534 |
30192-30193 |
-RRB- |
denotes |
) |
| T6535 |
30193-30194 |
. |
denotes |
. |
| T6536 |
30194-30336 |
sentence |
denotes |
Although this implies that BMP signaling was defective in multiple cell types, the observed defects were confined to the articular cartilage. |
| T6537 |
30195-30203 |
IN |
denotes |
Although |
| T6538 |
30209-30216 |
VBZ |
denotes |
implies |
| T6539 |
30204-30208 |
DT |
denotes |
this |
| T6540 |
30300-30308 |
VBN |
denotes |
confined |
| T6541 |
30217-30221 |
IN |
denotes |
that |
| T6542 |
30236-30239 |
VBD |
denotes |
was |
| T6543 |
30222-30225 |
NN |
denotes |
BMP |
| T6544 |
30226-30235 |
NN |
denotes |
signaling |
| T6545 |
30240-30249 |
JJ |
denotes |
defective |
| T6546 |
30250-30252 |
IN |
denotes |
in |
| T6547 |
30253-30261 |
JJ |
denotes |
multiple |
| T6548 |
30267-30272 |
NNS |
denotes |
types |
| T6549 |
30262-30266 |
NN |
denotes |
cell |
| T6550 |
30272-30274 |
, |
denotes |
, |
| T6551 |
30274-30277 |
DT |
denotes |
the |
| T6552 |
30287-30294 |
NNS |
denotes |
defects |
| T6553 |
30278-30286 |
VBN |
denotes |
observed |
| T6554 |
30295-30299 |
VBD |
denotes |
were |
| T6555 |
30309-30311 |
IN |
denotes |
to |
| T6556 |
30312-30315 |
DT |
denotes |
the |
| T6557 |
30326-30335 |
NN |
denotes |
cartilage |
| T6558 |
30316-30325 |
JJ |
denotes |
articular |
| T6559 |
30335-30336 |
. |
denotes |
. |
| T6560 |
30336-30434 |
sentence |
denotes |
For example, Osteocalcin and Col1a1 expression appeared normal in osteoblasts (unpublished data). |
| T6561 |
30337-30340 |
IN |
denotes |
For |
| T6562 |
30384-30392 |
VBD |
denotes |
appeared |
| T6563 |
30341-30348 |
NN |
denotes |
example |
| T6564 |
30348-30350 |
, |
denotes |
, |
| T6565 |
30350-30361 |
NN |
denotes |
Osteocalcin |
| T6566 |
30373-30383 |
NN |
denotes |
expression |
| T6567 |
30362-30365 |
CC |
denotes |
and |
| T6568 |
30366-30372 |
NN |
denotes |
Col1a1 |
| T6569 |
30393-30399 |
JJ |
denotes |
normal |
| T6570 |
30400-30402 |
IN |
denotes |
in |
| T6571 |
30403-30414 |
NNS |
denotes |
osteoblasts |
| T6572 |
30415-30416 |
-LRB- |
denotes |
( |
| T6573 |
30428-30432 |
NNS |
denotes |
data |
| T6574 |
30416-30427 |
JJ |
denotes |
unpublished |
| T6575 |
30432-30433 |
-RRB- |
denotes |
) |
| T6576 |
30433-30434 |
. |
denotes |
. |
| T6577 |
30434-30624 |
sentence |
denotes |
Together, these data suggest that BMPR1A activity is required in postnatal joint articular cartilage to maintain expression of many genes encoding structural components of cartilage matrix. |
| T6578 |
30435-30443 |
RB |
denotes |
Together |
| T6579 |
30456-30463 |
VBP |
denotes |
suggest |
| T6580 |
30443-30445 |
, |
denotes |
, |
| T6581 |
30445-30450 |
DT |
denotes |
these |
| T6582 |
30451-30455 |
NNS |
denotes |
data |
| T6583 |
30464-30468 |
IN |
denotes |
that |
| T6584 |
30488-30496 |
VBN |
denotes |
required |
| T6585 |
30469-30475 |
NN |
denotes |
BMPR1A |
| T6586 |
30476-30484 |
NN |
denotes |
activity |
| T6587 |
30485-30487 |
VBZ |
denotes |
is |
| T6588 |
30497-30499 |
IN |
denotes |
in |
| T6589 |
30500-30509 |
JJ |
denotes |
postnatal |
| T6590 |
30526-30535 |
NN |
denotes |
cartilage |
| T6591 |
30510-30515 |
NN |
denotes |
joint |
| T6592 |
30516-30525 |
JJ |
denotes |
articular |
| T6593 |
30536-30538 |
TO |
denotes |
to |
| T6594 |
30539-30547 |
VB |
denotes |
maintain |
| T6595 |
30548-30558 |
NN |
denotes |
expression |
| T6596 |
30559-30561 |
IN |
denotes |
of |
| T6597 |
30562-30566 |
JJ |
denotes |
many |
| T6598 |
30567-30572 |
NNS |
denotes |
genes |
| T6599 |
30573-30581 |
VBG |
denotes |
encoding |
| T6600 |
30582-30592 |
JJ |
denotes |
structural |
| T6601 |
30593-30603 |
NNS |
denotes |
components |
| T6602 |
30604-30606 |
IN |
denotes |
of |
| T6603 |
30607-30616 |
NN |
denotes |
cartilage |
| T6604 |
30617-30623 |
NN |
denotes |
matrix |
| T6605 |
30623-30624 |
. |
denotes |
. |
| T6606 |
30624-30948 |
sentence |
denotes |
Previous studies have shown that Sox9 is required for normal cartilage differentiation, for expression of cartilage extracellular matrix (ECM) genes including Agg, and is a direct transcriptional regulator of the key cartilage matrix gene Col2a1 (Bell et al. 1997; Lefebvre et al. 1997; Bi et al. 1999; Sekiya et al. 2000). |
| T6607 |
30625-30633 |
JJ |
denotes |
Previous |
| T6608 |
30634-30641 |
NNS |
denotes |
studies |
| T6609 |
30647-30652 |
VBN |
denotes |
shown |
| T6610 |
30642-30646 |
VBP |
denotes |
have |
| T6611 |
30653-30657 |
IN |
denotes |
that |
| T6612 |
30666-30674 |
VBN |
denotes |
required |
| T6613 |
30658-30662 |
NN |
denotes |
Sox9 |
| T6614 |
30663-30665 |
VBZ |
denotes |
is |
| T6615 |
30675-30678 |
IN |
denotes |
for |
| T6616 |
30679-30685 |
JJ |
denotes |
normal |
| T6617 |
30696-30711 |
NN |
denotes |
differentiation |
| T6618 |
30686-30695 |
NN |
denotes |
cartilage |
| T6619 |
30711-30713 |
, |
denotes |
, |
| T6620 |
30713-30716 |
IN |
denotes |
for |
| T6621 |
30717-30727 |
NN |
denotes |
expression |
| T6622 |
30728-30730 |
IN |
denotes |
of |
| T6623 |
30731-30740 |
NN |
denotes |
cartilage |
| T6624 |
30755-30761 |
NN |
denotes |
matrix |
| T6625 |
30741-30754 |
JJ |
denotes |
extracellular |
| T6626 |
30768-30773 |
NNS |
denotes |
genes |
| T6627 |
30762-30763 |
-LRB- |
denotes |
( |
| T6628 |
30763-30766 |
NN |
denotes |
ECM |
| T6629 |
30766-30767 |
-RRB- |
denotes |
) |
| T6630 |
30774-30783 |
VBG |
denotes |
including |
| T6631 |
30784-30787 |
NN |
denotes |
Agg |
| T6632 |
30787-30789 |
, |
denotes |
, |
| T6633 |
30789-30792 |
CC |
denotes |
and |
| T6634 |
30793-30795 |
VBZ |
denotes |
is |
| T6635 |
30796-30797 |
DT |
denotes |
a |
| T6636 |
30821-30830 |
NN |
denotes |
regulator |
| T6637 |
30798-30804 |
JJ |
denotes |
direct |
| T6638 |
30805-30820 |
JJ |
denotes |
transcriptional |
| T6639 |
30831-30833 |
IN |
denotes |
of |
| T6640 |
30834-30837 |
DT |
denotes |
the |
| T6641 |
30864-30870 |
NN |
denotes |
Col2a1 |
| T6642 |
30838-30841 |
JJ |
denotes |
key |
| T6643 |
30842-30851 |
NN |
denotes |
cartilage |
| T6644 |
30852-30858 |
NN |
denotes |
matrix |
| T6645 |
30859-30863 |
NN |
denotes |
gene |
| T6646 |
30871-30872 |
-LRB- |
denotes |
( |
| T6647 |
30872-30876 |
NNP |
denotes |
Bell |
| T6648 |
30877-30879 |
FW |
denotes |
et |
| T6649 |
30880-30883 |
FW |
denotes |
al. |
| T6650 |
30884-30888 |
CD |
denotes |
1997 |
| T6651 |
30888-30889 |
: |
denotes |
; |
| T6652 |
30890-30898 |
NNP |
denotes |
Lefebvre |
| T6653 |
30899-30901 |
FW |
denotes |
et |
| T6654 |
30902-30905 |
FW |
denotes |
al. |
| T6655 |
30906-30910 |
CD |
denotes |
1997 |
| T6656 |
30910-30911 |
: |
denotes |
; |
| T6657 |
30912-30914 |
NNP |
denotes |
Bi |
| T6658 |
30915-30917 |
FW |
denotes |
et |
| T6659 |
30918-30921 |
FW |
denotes |
al. |
| T6660 |
30922-30926 |
CD |
denotes |
1999 |
| T6661 |
30926-30927 |
: |
denotes |
; |
| T6662 |
30928-30934 |
NNP |
denotes |
Sekiya |
| T6663 |
30935-30937 |
FW |
denotes |
et |
| T6664 |
30938-30941 |
FW |
denotes |
al. |
| T6665 |
30942-30946 |
CD |
denotes |
2000 |
| T6666 |
30946-30947 |
-RRB- |
denotes |
) |
| T6667 |
30947-30948 |
. |
denotes |
. |
| T6668 |
30948-31232 |
sentence |
denotes |
Notably, despite reduced expression of many cartilage matrix marker genes in Bmpr1a mutant mice, the SOX9 protein was present at normal levels in articular regions at all stages examined, including newborn, 2-wk-old, 7-wk-old, and 9-mo-old mice (Figure 5N and 5S) (unpublished data). |
| T6669 |
30949-30956 |
RB |
denotes |
Notably |
| T6670 |
31063-31066 |
VBD |
denotes |
was |
| T6671 |
30956-30958 |
, |
denotes |
, |
| T6672 |
30958-30965 |
IN |
denotes |
despite |
| T6673 |
30966-30973 |
VBN |
denotes |
reduced |
| T6674 |
30974-30984 |
NN |
denotes |
expression |
| T6675 |
30985-30987 |
IN |
denotes |
of |
| T6676 |
30988-30992 |
JJ |
denotes |
many |
| T6677 |
31017-31022 |
NNS |
denotes |
genes |
| T6678 |
30993-31002 |
NN |
denotes |
cartilage |
| T6679 |
31003-31009 |
NN |
denotes |
matrix |
| T6680 |
31010-31016 |
NN |
denotes |
marker |
| T6681 |
31023-31025 |
IN |
denotes |
in |
| T6682 |
31026-31032 |
NN |
denotes |
Bmpr1a |
| T6683 |
31033-31039 |
JJ |
denotes |
mutant |
| T6684 |
31040-31044 |
NNS |
denotes |
mice |
| T6685 |
31044-31046 |
, |
denotes |
, |
| T6686 |
31046-31049 |
DT |
denotes |
the |
| T6687 |
31055-31062 |
NN |
denotes |
protein |
| T6688 |
31050-31054 |
NN |
denotes |
SOX9 |
| T6689 |
31067-31074 |
JJ |
denotes |
present |
| T6690 |
31075-31077 |
IN |
denotes |
at |
| T6691 |
31078-31084 |
JJ |
denotes |
normal |
| T6692 |
31085-31091 |
NNS |
denotes |
levels |
| T6693 |
31092-31094 |
IN |
denotes |
in |
| T6694 |
31095-31104 |
JJ |
denotes |
articular |
| T6695 |
31105-31112 |
NNS |
denotes |
regions |
| T6696 |
31113-31115 |
IN |
denotes |
at |
| T6697 |
31116-31119 |
DT |
denotes |
all |
| T6698 |
31120-31126 |
NNS |
denotes |
stages |
| T6699 |
31127-31135 |
VBN |
denotes |
examined |
| T6700 |
31135-31137 |
, |
denotes |
, |
| T6701 |
31137-31146 |
VBG |
denotes |
including |
| T6702 |
31147-31154 |
JJ |
denotes |
newborn |
| T6703 |
31189-31193 |
NNS |
denotes |
mice |
| T6704 |
31154-31156 |
, |
denotes |
, |
| T6705 |
31156-31157 |
CD |
denotes |
2 |
| T6706 |
31158-31160 |
NN |
denotes |
wk |
| T6707 |
31157-31158 |
HYPH |
denotes |
- |
| T6708 |
31161-31164 |
JJ |
denotes |
old |
| T6709 |
31160-31161 |
HYPH |
denotes |
- |
| T6710 |
31164-31166 |
, |
denotes |
, |
| T6711 |
31166-31167 |
CD |
denotes |
7 |
| T6712 |
31168-31170 |
NN |
denotes |
wk |
| T6713 |
31167-31168 |
HYPH |
denotes |
- |
| T6714 |
31171-31174 |
JJ |
denotes |
old |
| T6715 |
31170-31171 |
HYPH |
denotes |
- |
| T6716 |
31174-31176 |
, |
denotes |
, |
| T6717 |
31176-31179 |
CC |
denotes |
and |
| T6718 |
31180-31181 |
CD |
denotes |
9 |
| T6719 |
31182-31184 |
NN |
denotes |
mo |
| T6720 |
31181-31182 |
HYPH |
denotes |
- |
| T6721 |
31185-31188 |
JJ |
denotes |
old |
| T6722 |
31184-31185 |
HYPH |
denotes |
- |
| T6723 |
31194-31195 |
-LRB- |
denotes |
( |
| T6724 |
31195-31201 |
NN |
denotes |
Figure |
| T6725 |
31202-31204 |
CD |
denotes |
5N |
| T6726 |
31205-31208 |
CC |
denotes |
and |
| T6727 |
31209-31211 |
CD |
denotes |
5S |
| T6728 |
31211-31212 |
-RRB- |
denotes |
) |
| T6729 |
31213-31214 |
-LRB- |
denotes |
( |
| T6730 |
31226-31230 |
NNS |
denotes |
data |
| T6731 |
31214-31225 |
JJ |
denotes |
unpublished |
| T6732 |
31230-31231 |
-RRB- |
denotes |
) |
| T6733 |
31231-31232 |
. |
denotes |
. |
| T6897 |
31234-31242 |
JJ |
denotes |
Synovial |
| T6898 |
31243-31254 |
NN |
denotes |
Hypertrophy |
| T6899 |
31254-31256 |
, |
denotes |
, |
| T6900 |
31256-31265 |
NN |
denotes |
Cartilage |
| T6901 |
31266-31273 |
NN |
denotes |
Erosion |
| T6902 |
31273-31275 |
, |
denotes |
, |
| T6903 |
31275-31278 |
CC |
denotes |
and |
| T6904 |
31279-31290 |
VBN |
denotes |
Accelerated |
| T6905 |
31301-31311 |
NN |
denotes |
Maturation |
| T6906 |
31291-31300 |
NN |
denotes |
Cartilage |
| T6907 |
31311-31460 |
sentence |
denotes |
Conditional loss of Bmpr1a led to marked hypertrophy of the synovial membrane in the joint capsule of some joints, particularly in the ankle region. |
| T6908 |
31312-31323 |
JJ |
denotes |
Conditional |
| T6909 |
31324-31328 |
NN |
denotes |
loss |
| T6910 |
31339-31342 |
VBD |
denotes |
led |
| T6911 |
31329-31331 |
IN |
denotes |
of |
| T6912 |
31332-31338 |
NN |
denotes |
Bmpr1a |
| T6913 |
31343-31345 |
IN |
denotes |
to |
| T6914 |
31346-31352 |
VBN |
denotes |
marked |
| T6915 |
31353-31364 |
NN |
denotes |
hypertrophy |
| T6916 |
31365-31367 |
IN |
denotes |
of |
| T6917 |
31368-31371 |
DT |
denotes |
the |
| T6918 |
31381-31389 |
NN |
denotes |
membrane |
| T6919 |
31372-31380 |
JJ |
denotes |
synovial |
| T6920 |
31390-31392 |
IN |
denotes |
in |
| T6921 |
31393-31396 |
DT |
denotes |
the |
| T6922 |
31403-31410 |
NN |
denotes |
capsule |
| T6923 |
31397-31402 |
NN |
denotes |
joint |
| T6924 |
31411-31413 |
IN |
denotes |
of |
| T6925 |
31414-31418 |
DT |
denotes |
some |
| T6926 |
31419-31425 |
NNS |
denotes |
joints |
| T6927 |
31425-31427 |
, |
denotes |
, |
| T6928 |
31427-31439 |
RB |
denotes |
particularly |
| T6929 |
31440-31442 |
IN |
denotes |
in |
| T6930 |
31443-31446 |
DT |
denotes |
the |
| T6931 |
31453-31459 |
NN |
denotes |
region |
| T6932 |
31447-31452 |
NN |
denotes |
ankle |
| T6933 |
31459-31460 |
. |
denotes |
. |
| T6934 |
31460-31669 |
sentence |
denotes |
In the most severely affected joints, the expanded synovial membrane grew into the joint space and was associated with obvious loss or erosion of the articular cartilage (Figure 6A and 6B, asterisks, arrows). |
| T6935 |
31461-31463 |
IN |
denotes |
In |
| T6936 |
31530-31534 |
VBD |
denotes |
grew |
| T6937 |
31464-31467 |
DT |
denotes |
the |
| T6938 |
31491-31497 |
NNS |
denotes |
joints |
| T6939 |
31468-31472 |
RBS |
denotes |
most |
| T6940 |
31473-31481 |
RB |
denotes |
severely |
| T6941 |
31482-31490 |
VBN |
denotes |
affected |
| T6942 |
31497-31499 |
, |
denotes |
, |
| T6943 |
31499-31502 |
DT |
denotes |
the |
| T6944 |
31521-31529 |
NN |
denotes |
membrane |
| T6945 |
31503-31511 |
VBN |
denotes |
expanded |
| T6946 |
31512-31520 |
JJ |
denotes |
synovial |
| T6947 |
31535-31539 |
IN |
denotes |
into |
| T6948 |
31540-31543 |
DT |
denotes |
the |
| T6949 |
31550-31555 |
NN |
denotes |
space |
| T6950 |
31544-31549 |
NN |
denotes |
joint |
| T6951 |
31556-31559 |
CC |
denotes |
and |
| T6952 |
31560-31563 |
VBD |
denotes |
was |
| T6953 |
31564-31574 |
VBN |
denotes |
associated |
| T6954 |
31575-31579 |
IN |
denotes |
with |
| T6955 |
31580-31587 |
JJ |
denotes |
obvious |
| T6956 |
31588-31592 |
NN |
denotes |
loss |
| T6957 |
31593-31595 |
CC |
denotes |
or |
| T6958 |
31596-31603 |
NN |
denotes |
erosion |
| T6959 |
31604-31606 |
IN |
denotes |
of |
| T6960 |
31607-31610 |
DT |
denotes |
the |
| T6961 |
31621-31630 |
NN |
denotes |
cartilage |
| T6962 |
31611-31620 |
JJ |
denotes |
articular |
| T6963 |
31631-31632 |
-LRB- |
denotes |
( |
| T6964 |
31661-31667 |
NNS |
denotes |
arrows |
| T6965 |
31632-31638 |
NN |
denotes |
Figure |
| T6966 |
31639-31641 |
CD |
denotes |
6A |
| T6967 |
31642-31645 |
CC |
denotes |
and |
| T6968 |
31646-31648 |
CD |
denotes |
6B |
| T6969 |
31648-31650 |
, |
denotes |
, |
| T6970 |
31650-31659 |
NNS |
denotes |
asterisks |
| T6971 |
31659-31661 |
, |
denotes |
, |
| T6972 |
31667-31668 |
-RRB- |
denotes |
) |
| T6973 |
31668-31669 |
. |
denotes |
. |
| T6974 |
31669-31861 |
sentence |
denotes |
Accelerated cartilage maturation and increased expression of Col10a1 was frequently seen in the chondrocytes underlying the articular erosions (Figure 6C and 6D, brackets) (unpublished data). |
| T6975 |
31670-31681 |
VBN |
denotes |
Accelerated |
| T6976 |
31692-31702 |
NN |
denotes |
maturation |
| T6977 |
31682-31691 |
NN |
denotes |
cartilage |
| T6978 |
31754-31758 |
VBN |
denotes |
seen |
| T6979 |
31703-31706 |
CC |
denotes |
and |
| T6980 |
31707-31716 |
VBN |
denotes |
increased |
| T6981 |
31717-31727 |
NN |
denotes |
expression |
| T6982 |
31728-31730 |
IN |
denotes |
of |
| T6983 |
31731-31738 |
NN |
denotes |
Col10a1 |
| T6984 |
31739-31742 |
VBD |
denotes |
was |
| T6985 |
31743-31753 |
RB |
denotes |
frequently |
| T6986 |
31759-31761 |
IN |
denotes |
in |
| T6987 |
31762-31765 |
DT |
denotes |
the |
| T6988 |
31766-31778 |
NNS |
denotes |
chondrocytes |
| T6989 |
31779-31789 |
VBG |
denotes |
underlying |
| T6990 |
31790-31793 |
DT |
denotes |
the |
| T6991 |
31804-31812 |
NNS |
denotes |
erosions |
| T6992 |
31794-31803 |
JJ |
denotes |
articular |
| T6993 |
31813-31814 |
-LRB- |
denotes |
( |
| T6994 |
31832-31840 |
NNS |
denotes |
brackets |
| T6995 |
31814-31820 |
NN |
denotes |
Figure |
| T6996 |
31821-31823 |
CD |
denotes |
6C |
| T6997 |
31824-31827 |
CC |
denotes |
and |
| T6998 |
31828-31830 |
CD |
denotes |
6D |
| T6999 |
31830-31832 |
, |
denotes |
, |
| T7000 |
31840-31841 |
-RRB- |
denotes |
) |
| T7001 |
31842-31843 |
-LRB- |
denotes |
( |
| T7002 |
31855-31859 |
NNS |
denotes |
data |
| T7003 |
31843-31854 |
JJ |
denotes |
unpublished |
| T7004 |
31859-31860 |
-RRB- |
denotes |
) |
| T7005 |
31860-31861 |
. |
denotes |
. |
| T7006 |
31861-32001 |
sentence |
denotes |
Interestingly, the regions of increased Col10a1 expression did not correspond to the regions that had undergone Cre-mediated recombination. |
| T7007 |
31862-31875 |
RB |
denotes |
Interestingly |
| T7008 |
31929-31939 |
VB |
denotes |
correspond |
| T7009 |
31875-31877 |
, |
denotes |
, |
| T7010 |
31877-31880 |
DT |
denotes |
the |
| T7011 |
31881-31888 |
NNS |
denotes |
regions |
| T7012 |
31889-31891 |
IN |
denotes |
of |
| T7013 |
31892-31901 |
VBN |
denotes |
increased |
| T7014 |
31910-31920 |
NN |
denotes |
expression |
| T7015 |
31902-31909 |
NN |
denotes |
Col10a1 |
| T7016 |
31921-31924 |
VBD |
denotes |
did |
| T7017 |
31925-31928 |
RB |
denotes |
not |
| T7018 |
31940-31942 |
IN |
denotes |
to |
| T7019 |
31943-31946 |
DT |
denotes |
the |
| T7020 |
31947-31954 |
NNS |
denotes |
regions |
| T7021 |
31955-31959 |
WDT |
denotes |
that |
| T7022 |
31964-31973 |
VBN |
denotes |
undergone |
| T7023 |
31960-31963 |
VBD |
denotes |
had |
| T7024 |
31974-31977 |
NN |
denotes |
Cre |
| T7025 |
31978-31986 |
VBN |
denotes |
mediated |
| T7026 |
31977-31978 |
HYPH |
denotes |
- |
| T7027 |
31987-32000 |
NN |
denotes |
recombination |
| T7028 |
32000-32001 |
. |
denotes |
. |
| T7029 |
32001-32340 |
sentence |
denotes |
Instead, increased expression of Col10a1 was seen in a zone of largely LACZ-negative cells stretching from the cartilage adjacent to the ossification front (where Col10a1 is normally expressed in maturing cartilage cells), toward the regions where surface articular cartilage was severely eroded or missing (Figure 6A and 6B, arrowheads). |
| T7030 |
32002-32009 |
RB |
denotes |
Instead |
| T7031 |
32047-32051 |
VBN |
denotes |
seen |
| T7032 |
32009-32011 |
, |
denotes |
, |
| T7033 |
32011-32020 |
VBN |
denotes |
increased |
| T7034 |
32021-32031 |
NN |
denotes |
expression |
| T7035 |
32032-32034 |
IN |
denotes |
of |
| T7036 |
32035-32042 |
NN |
denotes |
Col10a1 |
| T7037 |
32043-32046 |
VBD |
denotes |
was |
| T7038 |
32052-32054 |
IN |
denotes |
in |
| T7039 |
32055-32056 |
DT |
denotes |
a |
| T7040 |
32057-32061 |
NN |
denotes |
zone |
| T7041 |
32062-32064 |
IN |
denotes |
of |
| T7042 |
32065-32072 |
RB |
denotes |
largely |
| T7043 |
32087-32092 |
NNS |
denotes |
cells |
| T7044 |
32073-32077 |
NN |
denotes |
LACZ |
| T7045 |
32078-32086 |
JJ |
denotes |
negative |
| T7046 |
32077-32078 |
HYPH |
denotes |
- |
| T7047 |
32093-32103 |
VBG |
denotes |
stretching |
| T7048 |
32104-32108 |
IN |
denotes |
from |
| T7049 |
32109-32112 |
DT |
denotes |
the |
| T7050 |
32113-32122 |
NN |
denotes |
cartilage |
| T7051 |
32123-32131 |
JJ |
denotes |
adjacent |
| T7052 |
32132-32134 |
IN |
denotes |
to |
| T7053 |
32135-32138 |
DT |
denotes |
the |
| T7054 |
32152-32157 |
NN |
denotes |
front |
| T7055 |
32139-32151 |
NN |
denotes |
ossification |
| T7056 |
32158-32159 |
-LRB- |
denotes |
( |
| T7057 |
32159-32164 |
WRB |
denotes |
where |
| T7058 |
32185-32194 |
VBN |
denotes |
expressed |
| T7059 |
32165-32172 |
NN |
denotes |
Col10a1 |
| T7060 |
32173-32175 |
VBZ |
denotes |
is |
| T7061 |
32176-32184 |
RB |
denotes |
normally |
| T7062 |
32195-32197 |
IN |
denotes |
in |
| T7063 |
32198-32206 |
VBG |
denotes |
maturing |
| T7064 |
32217-32222 |
NNS |
denotes |
cells |
| T7065 |
32207-32216 |
NN |
denotes |
cartilage |
| T7066 |
32222-32223 |
-RRB- |
denotes |
) |
| T7067 |
32223-32225 |
, |
denotes |
, |
| T7068 |
32225-32231 |
IN |
denotes |
toward |
| T7069 |
32232-32235 |
DT |
denotes |
the |
| T7070 |
32236-32243 |
NNS |
denotes |
regions |
| T7071 |
32244-32249 |
WRB |
denotes |
where |
| T7072 |
32278-32281 |
VBD |
denotes |
was |
| T7073 |
32250-32257 |
NN |
denotes |
surface |
| T7074 |
32268-32277 |
NN |
denotes |
cartilage |
| T7075 |
32258-32267 |
JJ |
denotes |
articular |
| T7076 |
32282-32290 |
RB |
denotes |
severely |
| T7077 |
32291-32297 |
VBN |
denotes |
eroded |
| T7078 |
32298-32300 |
CC |
denotes |
or |
| T7079 |
32301-32308 |
VBG |
denotes |
missing |
| T7080 |
32309-32310 |
-LRB- |
denotes |
( |
| T7081 |
32328-32338 |
NNS |
denotes |
arrowheads |
| T7082 |
32310-32316 |
NN |
denotes |
Figure |
| T7083 |
32317-32319 |
CD |
denotes |
6A |
| T7084 |
32320-32323 |
CC |
denotes |
and |
| T7085 |
32324-32326 |
CD |
denotes |
6B |
| T7086 |
32326-32328 |
, |
denotes |
, |
| T7087 |
32338-32339 |
-RRB- |
denotes |
) |
| T7088 |
32339-32340 |
. |
denotes |
. |
| T7089 |
32340-32556 |
sentence |
denotes |
Previous studies suggest that parathyroid hormone-related protein, a diffusible signal made in the articular surface, may normally inhibit maturation of underlying cartilage (Vortkamp et al. 1996; Weir et al. 1996). |
| T7090 |
32341-32349 |
JJ |
denotes |
Previous |
| T7091 |
32350-32357 |
NNS |
denotes |
studies |
| T7092 |
32358-32365 |
VBP |
denotes |
suggest |
| T7093 |
32366-32370 |
IN |
denotes |
that |
| T7094 |
32472-32479 |
VB |
denotes |
inhibit |
| T7095 |
32371-32382 |
NN |
denotes |
parathyroid |
| T7096 |
32383-32390 |
NN |
denotes |
hormone |
| T7097 |
32391-32398 |
VBN |
denotes |
related |
| T7098 |
32390-32391 |
HYPH |
denotes |
- |
| T7099 |
32399-32406 |
NN |
denotes |
protein |
| T7100 |
32406-32408 |
, |
denotes |
, |
| T7101 |
32408-32409 |
DT |
denotes |
a |
| T7102 |
32421-32427 |
NN |
denotes |
signal |
| T7103 |
32410-32420 |
JJ |
denotes |
diffusible |
| T7104 |
32428-32432 |
VBN |
denotes |
made |
| T7105 |
32433-32435 |
IN |
denotes |
in |
| T7106 |
32436-32439 |
DT |
denotes |
the |
| T7107 |
32450-32457 |
NN |
denotes |
surface |
| T7108 |
32440-32449 |
JJ |
denotes |
articular |
| T7109 |
32457-32459 |
, |
denotes |
, |
| T7110 |
32459-32462 |
MD |
denotes |
may |
| T7111 |
32463-32471 |
RB |
denotes |
normally |
| T7112 |
32480-32490 |
NN |
denotes |
maturation |
| T7113 |
32491-32493 |
IN |
denotes |
of |
| T7114 |
32494-32504 |
VBG |
denotes |
underlying |
| T7115 |
32505-32514 |
NN |
denotes |
cartilage |
| T7116 |
32515-32516 |
-LRB- |
denotes |
( |
| T7117 |
32516-32524 |
NNP |
denotes |
Vortkamp |
| T7118 |
32525-32527 |
FW |
denotes |
et |
| T7119 |
32528-32531 |
FW |
denotes |
al. |
| T7120 |
32532-32536 |
CD |
denotes |
1996 |
| T7121 |
32536-32537 |
: |
denotes |
; |
| T7122 |
32538-32542 |
NNP |
denotes |
Weir |
| T7123 |
32543-32545 |
FW |
denotes |
et |
| T7124 |
32546-32549 |
FW |
denotes |
al. |
| T7125 |
32550-32554 |
CD |
denotes |
1996 |
| T7126 |
32554-32555 |
-RRB- |
denotes |
) |
| T7127 |
32555-32556 |
. |
denotes |
. |
| T7128 |
32556-32737 |
sentence |
denotes |
Local loss of the articular surface could remove this inhibition and lead to a cell-nonautonomous acceleration of maturation in chondrocytes underlying points of articular erosion. |
| T7129 |
32557-32562 |
JJ |
denotes |
Local |
| T7130 |
32563-32567 |
NN |
denotes |
loss |
| T7131 |
32599-32605 |
VB |
denotes |
remove |
| T7132 |
32568-32570 |
IN |
denotes |
of |
| T7133 |
32571-32574 |
DT |
denotes |
the |
| T7134 |
32585-32592 |
NN |
denotes |
surface |
| T7135 |
32575-32584 |
JJ |
denotes |
articular |
| T7136 |
32593-32598 |
MD |
denotes |
could |
| T7137 |
32606-32610 |
DT |
denotes |
this |
| T7138 |
32611-32621 |
NN |
denotes |
inhibition |
| T7139 |
32622-32625 |
CC |
denotes |
and |
| T7140 |
32626-32630 |
VBP |
denotes |
lead |
| T7141 |
32631-32633 |
IN |
denotes |
to |
| T7142 |
32634-32635 |
DT |
denotes |
a |
| T7143 |
32655-32667 |
NN |
denotes |
acceleration |
| T7144 |
32636-32640 |
NN |
denotes |
cell |
| T7145 |
32641-32654 |
JJ |
denotes |
nonautonomous |
| T7146 |
32640-32641 |
HYPH |
denotes |
- |
| T7147 |
32668-32670 |
IN |
denotes |
of |
| T7148 |
32671-32681 |
NN |
denotes |
maturation |
| T7149 |
32682-32684 |
IN |
denotes |
in |
| T7150 |
32685-32697 |
NNS |
denotes |
chondrocytes |
| T7151 |
32698-32708 |
VBG |
denotes |
underlying |
| T7152 |
32709-32715 |
NNS |
denotes |
points |
| T7153 |
32716-32718 |
IN |
denotes |
of |
| T7154 |
32719-32728 |
JJ |
denotes |
articular |
| T7155 |
32729-32736 |
NN |
denotes |
erosion |
| T7156 |
32736-32737 |
. |
denotes |
. |
| T7157 |
32737-34030 |
sentence |
denotes |
Figure 6 Synovial Membrane Expansion, Articular Surface Erosion, and Accelerated Maturation of Underlying Cartilage in Ankles of Bmpr1a Mutant Mice
Near adjacent sections from the tarsal 2-metatarsal II joint of 7-d-old mice. (A and B) LACZ staining (blue) shows Cre-mediated recombination is largely restricted to articular (arrowheads) and synovial cells (asterisks) in both controls and mutants. (C and D) In situ hybridization shows Col10 expression expands in mutants toward regions of synovial membrane expansion and articular surface erosion (brackets and arrows). This may be a cell nonautonomous effect of joint damage, since the LACZ expressing cells at the articular surface do not show upregulation of Col10 (arrowheads) and the region of expanded Col10 expression is largely made up of cells that have not undergone Cre-mediated recombination. Note the formation of a cartilaginous bridge along the joint capsule of the mutant where joint formation is disrupted at earlier stages (B, white arrowhead, and Figure 3, white arrowheads). (A) Scale bar = 75 μm. This synovial hypertrophy is associated with increased numbers of mononuclear cells resembling synoviocytes or macrophages, cell types that are difficult to distinguish even with surface markers at early postnatal stages. |
| T7158 |
33809-33813 |
DT |
denotes |
This |
| T7159 |
33823-33834 |
NN |
denotes |
hypertrophy |
| T7160 |
33814-33822 |
JJ |
denotes |
synovial |
| T7161 |
33838-33848 |
VBN |
denotes |
associated |
| T7162 |
33835-33837 |
VBZ |
denotes |
is |
| T7163 |
33849-33853 |
IN |
denotes |
with |
| T7164 |
33854-33863 |
VBN |
denotes |
increased |
| T7165 |
33864-33871 |
NNS |
denotes |
numbers |
| T7166 |
33872-33874 |
IN |
denotes |
of |
| T7167 |
33875-33886 |
JJ |
denotes |
mononuclear |
| T7168 |
33887-33892 |
NNS |
denotes |
cells |
| T7169 |
33893-33903 |
VBG |
denotes |
resembling |
| T7170 |
33904-33916 |
NNS |
denotes |
synoviocytes |
| T7171 |
33917-33919 |
CC |
denotes |
or |
| T7172 |
33920-33931 |
NNS |
denotes |
macrophages |
| T7173 |
33931-33933 |
, |
denotes |
, |
| T7174 |
33933-33937 |
NN |
denotes |
cell |
| T7175 |
33938-33943 |
NNS |
denotes |
types |
| T7176 |
33944-33948 |
WDT |
denotes |
that |
| T7177 |
33949-33952 |
VBP |
denotes |
are |
| T7178 |
33953-33962 |
JJ |
denotes |
difficult |
| T7179 |
33963-33965 |
TO |
denotes |
to |
| T7180 |
33966-33977 |
VB |
denotes |
distinguish |
| T7181 |
33978-33982 |
RB |
denotes |
even |
| T7182 |
33983-33987 |
IN |
denotes |
with |
| T7183 |
33988-33995 |
NN |
denotes |
surface |
| T7184 |
33996-34003 |
NNS |
denotes |
markers |
| T7185 |
34004-34006 |
IN |
denotes |
at |
| T7186 |
34007-34012 |
JJ |
denotes |
early |
| T7187 |
34023-34029 |
NNS |
denotes |
stages |
| T7188 |
34013-34022 |
JJ |
denotes |
postnatal |
| T7189 |
34029-34030 |
. |
denotes |
. |
| T7190 |
34030-34115 |
sentence |
denotes |
However, no neutrophils were observed, suggesting that there is little inflammation. |
| T7191 |
34031-34038 |
RB |
denotes |
However |
| T7192 |
34060-34068 |
VBN |
denotes |
observed |
| T7193 |
34038-34040 |
, |
denotes |
, |
| T7194 |
34040-34042 |
DT |
denotes |
no |
| T7195 |
34043-34054 |
NNS |
denotes |
neutrophils |
| T7196 |
34055-34059 |
VBD |
denotes |
were |
| T7197 |
34068-34070 |
, |
denotes |
, |
| T7198 |
34070-34080 |
VBG |
denotes |
suggesting |
| T7199 |
34081-34085 |
IN |
denotes |
that |
| T7200 |
34092-34094 |
VBZ |
denotes |
is |
| T7201 |
34086-34091 |
EX |
denotes |
there |
| T7202 |
34095-34101 |
JJ |
denotes |
little |
| T7203 |
34102-34114 |
NN |
denotes |
inflammation |
| T7204 |
34114-34115 |
. |
denotes |
. |
| T7205 |
34115-34164 |
sentence |
denotes |
At later stages synovial hypertrophy is reduced. |
| T7206 |
34116-34118 |
IN |
denotes |
At |
| T7207 |
34156-34163 |
VBN |
denotes |
reduced |
| T7208 |
34119-34124 |
JJ |
denotes |
later |
| T7209 |
34125-34131 |
NNS |
denotes |
stages |
| T7210 |
34132-34140 |
JJ |
denotes |
synovial |
| T7211 |
34141-34152 |
NN |
denotes |
hypertrophy |
| T7212 |
34153-34155 |
VBZ |
denotes |
is |
| T7213 |
34163-34164 |
. |
denotes |
. |
| T7214 |
34164-34443 |
sentence |
denotes |
Further work will be needed to determine whether synovial development is regulated by BMP signaling, or whether the synovium becomes enlarged as a response to nearby skeletal malformations (such as fusion of the second and central tarsals or defects in the articular cartilage). |
| T7215 |
34165-34172 |
JJ |
denotes |
Further |
| T7216 |
34173-34177 |
NN |
denotes |
work |
| T7217 |
34186-34192 |
VBN |
denotes |
needed |
| T7218 |
34178-34182 |
MD |
denotes |
will |
| T7219 |
34183-34185 |
VB |
denotes |
be |
| T7220 |
34193-34195 |
TO |
denotes |
to |
| T7221 |
34196-34205 |
VB |
denotes |
determine |
| T7222 |
34206-34213 |
IN |
denotes |
whether |
| T7223 |
34238-34247 |
VBN |
denotes |
regulated |
| T7224 |
34214-34222 |
JJ |
denotes |
synovial |
| T7225 |
34223-34234 |
NN |
denotes |
development |
| T7226 |
34235-34237 |
VBZ |
denotes |
is |
| T7227 |
34248-34250 |
IN |
denotes |
by |
| T7228 |
34251-34254 |
NN |
denotes |
BMP |
| T7229 |
34255-34264 |
NN |
denotes |
signaling |
| T7230 |
34264-34266 |
, |
denotes |
, |
| T7231 |
34266-34268 |
CC |
denotes |
or |
| T7232 |
34269-34276 |
IN |
denotes |
whether |
| T7233 |
34290-34297 |
VBZ |
denotes |
becomes |
| T7234 |
34277-34280 |
DT |
denotes |
the |
| T7235 |
34281-34289 |
NN |
denotes |
synovium |
| T7236 |
34298-34306 |
VBN |
denotes |
enlarged |
| T7237 |
34307-34309 |
IN |
denotes |
as |
| T7238 |
34310-34311 |
DT |
denotes |
a |
| T7239 |
34312-34320 |
NN |
denotes |
response |
| T7240 |
34321-34323 |
IN |
denotes |
to |
| T7241 |
34324-34330 |
JJ |
denotes |
nearby |
| T7242 |
34340-34353 |
NNS |
denotes |
malformations |
| T7243 |
34331-34339 |
JJ |
denotes |
skeletal |
| T7244 |
34354-34355 |
-LRB- |
denotes |
( |
| T7245 |
34355-34359 |
JJ |
denotes |
such |
| T7246 |
34360-34362 |
IN |
denotes |
as |
| T7247 |
34363-34369 |
NN |
denotes |
fusion |
| T7248 |
34370-34372 |
IN |
denotes |
of |
| T7249 |
34373-34376 |
DT |
denotes |
the |
| T7250 |
34396-34403 |
NNS |
denotes |
tarsals |
| T7251 |
34377-34383 |
JJ |
denotes |
second |
| T7252 |
34384-34387 |
CC |
denotes |
and |
| T7253 |
34388-34395 |
JJ |
denotes |
central |
| T7254 |
34404-34406 |
CC |
denotes |
or |
| T7255 |
34407-34414 |
NNS |
denotes |
defects |
| T7256 |
34415-34417 |
IN |
denotes |
in |
| T7257 |
34418-34421 |
DT |
denotes |
the |
| T7258 |
34432-34441 |
NN |
denotes |
cartilage |
| T7259 |
34422-34431 |
JJ |
denotes |
articular |
| T7260 |
34441-34442 |
-RRB- |
denotes |
) |
| T7261 |
34442-34443 |
. |
denotes |
. |
| T7528 |
34445-34460 |
JJ |
denotes |
Noninflammatory |
| T7529 |
34461-34473 |
NN |
denotes |
Degeneration |
| T7530 |
34474-34476 |
IN |
denotes |
of |
| T7531 |
34477-34486 |
JJ |
denotes |
Articular |
| T7532 |
34487-34496 |
NN |
denotes |
Cartilage |
| T7533 |
34497-34499 |
IN |
denotes |
in |
| T7534 |
34500-34505 |
NN |
denotes |
Digit |
| T7535 |
34515-34521 |
NN |
denotes |
Joints |
| T7536 |
34506-34509 |
CC |
denotes |
and |
| T7537 |
34510-34514 |
NN |
denotes |
Knee |
| T7538 |
34521-34621 |
sentence |
denotes |
Outside of the ankle region, little or no evidence was seen for expansion of the synovial membrane. |
| T7539 |
34522-34529 |
IN |
denotes |
Outside |
| T7540 |
34577-34581 |
VBN |
denotes |
seen |
| T7541 |
34530-34532 |
IN |
denotes |
of |
| T7542 |
34533-34536 |
DT |
denotes |
the |
| T7543 |
34543-34549 |
NN |
denotes |
region |
| T7544 |
34537-34542 |
NN |
denotes |
ankle |
| T7545 |
34549-34551 |
, |
denotes |
, |
| T7546 |
34551-34557 |
JJ |
denotes |
little |
| T7547 |
34558-34560 |
CC |
denotes |
or |
| T7548 |
34561-34563 |
DT |
denotes |
no |
| T7549 |
34564-34572 |
NN |
denotes |
evidence |
| T7550 |
34573-34576 |
VBD |
denotes |
was |
| T7551 |
34582-34585 |
IN |
denotes |
for |
| T7552 |
34586-34595 |
NN |
denotes |
expansion |
| T7553 |
34596-34598 |
IN |
denotes |
of |
| T7554 |
34599-34602 |
DT |
denotes |
the |
| T7555 |
34612-34620 |
NN |
denotes |
membrane |
| T7556 |
34603-34611 |
JJ |
denotes |
synovial |
| T7557 |
34620-34621 |
. |
denotes |
. |
| T7558 |
34621-34745 |
sentence |
denotes |
Instead, mutant mice showed histological signs of osteoarthritis, such as fibrillation of the articular surface (Figure 7). |
| T7559 |
34622-34629 |
RB |
denotes |
Instead |
| T7560 |
34643-34649 |
VBD |
denotes |
showed |
| T7561 |
34629-34631 |
, |
denotes |
, |
| T7562 |
34631-34637 |
NN |
denotes |
mutant |
| T7563 |
34638-34642 |
NNS |
denotes |
mice |
| T7564 |
34650-34662 |
JJ |
denotes |
histological |
| T7565 |
34663-34668 |
NNS |
denotes |
signs |
| T7566 |
34669-34671 |
IN |
denotes |
of |
| T7567 |
34672-34686 |
NN |
denotes |
osteoarthritis |
| T7568 |
34686-34688 |
, |
denotes |
, |
| T7569 |
34688-34692 |
JJ |
denotes |
such |
| T7570 |
34693-34695 |
IN |
denotes |
as |
| T7571 |
34696-34708 |
NN |
denotes |
fibrillation |
| T7572 |
34709-34711 |
IN |
denotes |
of |
| T7573 |
34712-34715 |
DT |
denotes |
the |
| T7574 |
34726-34733 |
NN |
denotes |
surface |
| T7575 |
34716-34725 |
JJ |
denotes |
articular |
| T7576 |
34734-34735 |
-LRB- |
denotes |
( |
| T7577 |
34735-34741 |
NN |
denotes |
Figure |
| T7578 |
34742-34743 |
CD |
denotes |
7 |
| T7579 |
34743-34744 |
-RRB- |
denotes |
) |
| T7580 |
34744-34745 |
. |
denotes |
. |
| T7581 |
34745-35007 |
sentence |
denotes |
As previously seen in 1- and 2-wk-old animals, Safranin O staining and Agg and Col10 expression were all reduced in mutant articular regions of the forefeet and hindfeet by 7 wk of age, and the beginning signs of cartilage loss were observed (unpublished data). |
| T7582 |
34746-34748 |
IN |
denotes |
As |
| T7583 |
34760-34764 |
VBN |
denotes |
seen |
| T7584 |
34749-34759 |
RB |
denotes |
previously |
| T7585 |
34851-34858 |
VBN |
denotes |
reduced |
| T7586 |
34765-34767 |
IN |
denotes |
in |
| T7587 |
34768-34769 |
CD |
denotes |
1 |
| T7588 |
34777-34779 |
NN |
denotes |
wk |
| T7589 |
34769-34770 |
HYPH |
denotes |
- |
| T7590 |
34771-34774 |
CC |
denotes |
and |
| T7591 |
34775-34776 |
CD |
denotes |
2 |
| T7592 |
34776-34777 |
HYPH |
denotes |
- |
| T7593 |
34780-34783 |
JJ |
denotes |
old |
| T7594 |
34779-34780 |
HYPH |
denotes |
- |
| T7595 |
34784-34791 |
NNS |
denotes |
animals |
| T7596 |
34791-34793 |
, |
denotes |
, |
| T7597 |
34793-34801 |
NN |
denotes |
Safranin |
| T7598 |
34802-34803 |
NN |
denotes |
O |
| T7599 |
34804-34812 |
NN |
denotes |
staining |
| T7600 |
34813-34816 |
CC |
denotes |
and |
| T7601 |
34817-34820 |
NN |
denotes |
Agg |
| T7602 |
34831-34841 |
NN |
denotes |
expression |
| T7603 |
34821-34824 |
CC |
denotes |
and |
| T7604 |
34825-34830 |
NN |
denotes |
Col10 |
| T7605 |
34842-34846 |
VBD |
denotes |
were |
| T7606 |
34847-34850 |
RB |
denotes |
all |
| T7607 |
34859-34861 |
IN |
denotes |
in |
| T7608 |
34862-34868 |
NN |
denotes |
mutant |
| T7609 |
34879-34886 |
NNS |
denotes |
regions |
| T7610 |
34869-34878 |
JJ |
denotes |
articular |
| T7611 |
34887-34889 |
IN |
denotes |
of |
| T7612 |
34890-34893 |
DT |
denotes |
the |
| T7613 |
34894-34902 |
NNS |
denotes |
forefeet |
| T7614 |
34903-34906 |
CC |
denotes |
and |
| T7615 |
34907-34915 |
NN |
denotes |
hindfeet |
| T7616 |
34916-34918 |
IN |
denotes |
by |
| T7617 |
34919-34920 |
CD |
denotes |
7 |
| T7618 |
34921-34923 |
NN |
denotes |
wk |
| T7619 |
34924-34926 |
IN |
denotes |
of |
| T7620 |
34927-34930 |
NN |
denotes |
age |
| T7621 |
34930-34932 |
, |
denotes |
, |
| T7622 |
34932-34935 |
CC |
denotes |
and |
| T7623 |
34936-34939 |
DT |
denotes |
the |
| T7624 |
34950-34955 |
NNS |
denotes |
signs |
| T7625 |
34940-34949 |
NN |
denotes |
beginning |
| T7626 |
34979-34987 |
VBN |
denotes |
observed |
| T7627 |
34956-34958 |
IN |
denotes |
of |
| T7628 |
34959-34968 |
NN |
denotes |
cartilage |
| T7629 |
34969-34973 |
NN |
denotes |
loss |
| T7630 |
34974-34978 |
VBD |
denotes |
were |
| T7631 |
34988-34989 |
-LRB- |
denotes |
( |
| T7632 |
35001-35005 |
NNS |
denotes |
data |
| T7633 |
34989-35000 |
JJ |
denotes |
unpublished |
| T7634 |
35005-35006 |
-RRB- |
denotes |
) |
| T7635 |
35006-35007 |
. |
denotes |
. |
| T7636 |
35007-35172 |
sentence |
denotes |
By 9 mo of age, many regions of articular cartilage were completely missing or extremely fibrillated, leaving regions of exposed bone on the surface (Figure 7A–7D). |
| T7637 |
35008-35010 |
IN |
denotes |
By |
| T7638 |
35060-35064 |
VBD |
denotes |
were |
| T7639 |
35011-35012 |
CD |
denotes |
9 |
| T7640 |
35013-35015 |
NN |
denotes |
mo |
| T7641 |
35016-35018 |
IN |
denotes |
of |
| T7642 |
35019-35022 |
NN |
denotes |
age |
| T7643 |
35022-35024 |
, |
denotes |
, |
| T7644 |
35024-35028 |
JJ |
denotes |
many |
| T7645 |
35029-35036 |
NNS |
denotes |
regions |
| T7646 |
35037-35039 |
IN |
denotes |
of |
| T7647 |
35040-35049 |
JJ |
denotes |
articular |
| T7648 |
35050-35059 |
NN |
denotes |
cartilage |
| T7649 |
35065-35075 |
RB |
denotes |
completely |
| T7650 |
35076-35083 |
VBG |
denotes |
missing |
| T7651 |
35084-35086 |
CC |
denotes |
or |
| T7652 |
35087-35096 |
RB |
denotes |
extremely |
| T7653 |
35097-35108 |
VBN |
denotes |
fibrillated |
| T7654 |
35108-35110 |
, |
denotes |
, |
| T7655 |
35110-35117 |
VBG |
denotes |
leaving |
| T7656 |
35118-35125 |
NNS |
denotes |
regions |
| T7657 |
35126-35128 |
IN |
denotes |
of |
| T7658 |
35129-35136 |
VBN |
denotes |
exposed |
| T7659 |
35137-35141 |
NN |
denotes |
bone |
| T7660 |
35142-35144 |
IN |
denotes |
on |
| T7661 |
35145-35148 |
DT |
denotes |
the |
| T7662 |
35149-35156 |
NN |
denotes |
surface |
| T7663 |
35157-35158 |
-LRB- |
denotes |
( |
| T7664 |
35165-35167 |
CD |
denotes |
7A |
| T7665 |
35158-35164 |
NN |
denotes |
Figure |
| T7666 |
35167-35168 |
SYM |
denotes |
– |
| T7667 |
35168-35170 |
CD |
denotes |
7D |
| T7668 |
35170-35171 |
-RRB- |
denotes |
) |
| T7669 |
35171-35172 |
. |
denotes |
. |
| T7670 |
35172-35292 |
sentence |
denotes |
No alterations were seen in the expression of Osteocalcin, Col1a1, or matrix metalloprotease-13 at either 7 wk or 9 mo. |
| T7671 |
35173-35175 |
DT |
denotes |
No |
| T7672 |
35176-35187 |
NNS |
denotes |
alterations |
| T7673 |
35193-35197 |
VBN |
denotes |
seen |
| T7674 |
35188-35192 |
VBD |
denotes |
were |
| T7675 |
35198-35200 |
IN |
denotes |
in |
| T7676 |
35201-35204 |
DT |
denotes |
the |
| T7677 |
35205-35215 |
NN |
denotes |
expression |
| T7678 |
35216-35218 |
IN |
denotes |
of |
| T7679 |
35219-35230 |
NN |
denotes |
Osteocalcin |
| T7680 |
35230-35232 |
, |
denotes |
, |
| T7681 |
35232-35238 |
NN |
denotes |
Col1a1 |
| T7682 |
35238-35240 |
, |
denotes |
, |
| T7683 |
35240-35242 |
CC |
denotes |
or |
| T7684 |
35243-35249 |
NN |
denotes |
matrix |
| T7685 |
35250-35265 |
NN |
denotes |
metalloprotease |
| T7686 |
35265-35266 |
HYPH |
denotes |
- |
| T7687 |
35266-35268 |
CD |
denotes |
13 |
| T7688 |
35269-35271 |
IN |
denotes |
at |
| T7689 |
35272-35278 |
CC |
denotes |
either |
| T7690 |
35281-35283 |
NNS |
denotes |
wk |
| T7691 |
35279-35280 |
CD |
denotes |
7 |
| T7692 |
35284-35286 |
CC |
denotes |
or |
| T7693 |
35287-35288 |
CD |
denotes |
9 |
| T7694 |
35289-35291 |
NNS |
denotes |
mo |
| T7695 |
35291-35292 |
. |
denotes |
. |
| T7696 |
35292-37146 |
sentence |
denotes |
Figure 7 Loss of Bmpr1a Signaling Leads to Articular Cartilage Fibrillation and Degeneration in Digits and Knees of Aging Mice
(A–D) Near adjacent sections of metatarsal-phalangeal joints from 9 month old mice. Articular cartilage of controls is complete and stains strongly with Safranin O (A, orange stain). In contrast, articular cells of mutants are severely fibrillated or absent with much reduced staining of Safranin O (C, arrowheads). LACZ expression confirms Cre-mediated recombination has occurred in articular cells (B and D).
(E–P) Sagittal sections through knee joints of 7-wk- (E–J) or 9-mo-old animals (K–P); fe, femur; ti, tibia; gp, growth plate. Seven weeks after birth, the height of the tibial epiphysis is reduced in mutants (E and H, bars), and their articular layer stains poorly with Safranin O, is fibrillated, and is strikingly thinner (F and I, black arrowhead, and brackets). Near adjacent sections with LACZ staining confirm Cre-mediated recombination has occurred in articular cells (G and J). Note that in mutants, LACZ is absent in cells adjacent to those that do stain with Safranin O, suggesting Bmpr1a may act cell autonomously (I and J, white arrowheads). At 9 mo old, the mutant tibial epiphysis is extremely thin (K and N, bars), and the articular layer is completely absent, leaving bone to rub directly on bone (L and O, bracket). LACZ staining shows Cre-mediated recombination occurred in articular cells of controls (M) and in some remaining skeletal tissue of mutants (P). Also note aberrantly formed meniscal cartilage in mutants (E, H, K, and N, arrows), and increased sclerosis in mutant epiphyses (E, H, K, and N, asterisks).
(A and K) Scale bar = 50 μm; (I) scale bar = 300 μm. The major weight-bearing joint of the hindlimb, the knee, showed changes that closely paralleled that seen in the foot joints. |
| T7697 |
37020-37023 |
DT |
denotes |
The |
| T7698 |
37045-37050 |
NN |
denotes |
joint |
| T7699 |
37024-37029 |
JJ |
denotes |
major |
| T7700 |
37030-37036 |
NN |
denotes |
weight |
| T7701 |
37036-37037 |
HYPH |
denotes |
- |
| T7702 |
37037-37044 |
VBG |
denotes |
bearing |
| T7703 |
37078-37084 |
VBD |
denotes |
showed |
| T7704 |
37051-37053 |
IN |
denotes |
of |
| T7705 |
37054-37057 |
DT |
denotes |
the |
| T7706 |
37058-37066 |
NN |
denotes |
hindlimb |
| T7707 |
37066-37068 |
, |
denotes |
, |
| T7708 |
37068-37071 |
DT |
denotes |
the |
| T7709 |
37072-37076 |
NN |
denotes |
knee |
| T7710 |
37076-37078 |
, |
denotes |
, |
| T7711 |
37085-37092 |
NNS |
denotes |
changes |
| T7712 |
37093-37097 |
WDT |
denotes |
that |
| T7713 |
37106-37116 |
VBD |
denotes |
paralleled |
| T7714 |
37098-37105 |
RB |
denotes |
closely |
| T7715 |
37117-37121 |
DT |
denotes |
that |
| T7716 |
37122-37126 |
VBN |
denotes |
seen |
| T7717 |
37127-37129 |
IN |
denotes |
in |
| T7718 |
37130-37133 |
DT |
denotes |
the |
| T7719 |
37139-37145 |
NNS |
denotes |
joints |
| T7720 |
37134-37138 |
NN |
denotes |
foot |
| T7721 |
37145-37146 |
. |
denotes |
. |
| T7722 |
37146-37302 |
sentence |
denotes |
All markers of cartilage matrix looked similar to controls at E16.5, suggesting that early stages of joint formation were not disrupted (unpublished data). |
| T7723 |
37147-37150 |
DT |
denotes |
All |
| T7724 |
37151-37158 |
NNS |
denotes |
markers |
| T7725 |
37179-37185 |
VBD |
denotes |
looked |
| T7726 |
37159-37161 |
IN |
denotes |
of |
| T7727 |
37162-37171 |
NN |
denotes |
cartilage |
| T7728 |
37172-37178 |
NN |
denotes |
matrix |
| T7729 |
37186-37193 |
JJ |
denotes |
similar |
| T7730 |
37194-37196 |
IN |
denotes |
to |
| T7731 |
37197-37205 |
NNS |
denotes |
controls |
| T7732 |
37206-37208 |
IN |
denotes |
at |
| T7733 |
37209-37214 |
NN |
denotes |
E16.5 |
| T7734 |
37214-37216 |
, |
denotes |
, |
| T7735 |
37216-37226 |
VBG |
denotes |
suggesting |
| T7736 |
37227-37231 |
IN |
denotes |
that |
| T7737 |
37273-37282 |
VBN |
denotes |
disrupted |
| T7738 |
37232-37237 |
JJ |
denotes |
early |
| T7739 |
37238-37244 |
NNS |
denotes |
stages |
| T7740 |
37245-37247 |
IN |
denotes |
of |
| T7741 |
37248-37253 |
NN |
denotes |
joint |
| T7742 |
37254-37263 |
NN |
denotes |
formation |
| T7743 |
37264-37268 |
VBD |
denotes |
were |
| T7744 |
37269-37272 |
RB |
denotes |
not |
| T7745 |
37283-37284 |
-LRB- |
denotes |
( |
| T7746 |
37296-37300 |
NNS |
denotes |
data |
| T7747 |
37284-37295 |
JJ |
denotes |
unpublished |
| T7748 |
37300-37301 |
-RRB- |
denotes |
) |
| T7749 |
37301-37302 |
. |
denotes |
. |
| T7750 |
37302-37465 |
sentence |
denotes |
By postnatal day 7, Safranin O staining and Col2a1 and Agg expression were clearly reduced in the mutant, despite continued expression of Sox9 (unpublished data). |
| T7751 |
37303-37305 |
IN |
denotes |
By |
| T7752 |
37386-37393 |
VBN |
denotes |
reduced |
| T7753 |
37306-37315 |
JJ |
denotes |
postnatal |
| T7754 |
37316-37319 |
NN |
denotes |
day |
| T7755 |
37320-37321 |
CD |
denotes |
7 |
| T7756 |
37321-37323 |
, |
denotes |
, |
| T7757 |
37323-37331 |
NN |
denotes |
Safranin |
| T7758 |
37332-37333 |
NN |
denotes |
O |
| T7759 |
37334-37342 |
NN |
denotes |
staining |
| T7760 |
37343-37346 |
CC |
denotes |
and |
| T7761 |
37347-37353 |
NN |
denotes |
Col2a1 |
| T7762 |
37362-37372 |
NN |
denotes |
expression |
| T7763 |
37354-37357 |
CC |
denotes |
and |
| T7764 |
37358-37361 |
NN |
denotes |
Agg |
| T7765 |
37373-37377 |
VBD |
denotes |
were |
| T7766 |
37378-37385 |
RB |
denotes |
clearly |
| T7767 |
37394-37396 |
IN |
denotes |
in |
| T7768 |
37397-37400 |
DT |
denotes |
the |
| T7769 |
37401-37407 |
NN |
denotes |
mutant |
| T7770 |
37407-37409 |
, |
denotes |
, |
| T7771 |
37409-37416 |
IN |
denotes |
despite |
| T7772 |
37417-37426 |
VBN |
denotes |
continued |
| T7773 |
37427-37437 |
NN |
denotes |
expression |
| T7774 |
37438-37440 |
IN |
denotes |
of |
| T7775 |
37441-37445 |
NN |
denotes |
Sox9 |
| T7776 |
37446-37447 |
-LRB- |
denotes |
( |
| T7777 |
37459-37463 |
NNS |
denotes |
data |
| T7778 |
37447-37458 |
JJ |
denotes |
unpublished |
| T7779 |
37463-37464 |
-RRB- |
denotes |
) |
| T7780 |
37464-37465 |
. |
denotes |
. |
| T7781 |
37465-37674 |
sentence |
denotes |
The overall shape of mutant knee skeletal elements appeared similar to controls, although the fibrocartilaginous meniscus that resides between the femur and tibia appeared much less dense in mutants at E16.5. |
| T7782 |
37466-37469 |
DT |
denotes |
The |
| T7783 |
37478-37483 |
NN |
denotes |
shape |
| T7784 |
37470-37477 |
JJ |
denotes |
overall |
| T7785 |
37517-37525 |
VBD |
denotes |
appeared |
| T7786 |
37484-37486 |
IN |
denotes |
of |
| T7787 |
37487-37493 |
NN |
denotes |
mutant |
| T7788 |
37494-37498 |
NN |
denotes |
knee |
| T7789 |
37508-37516 |
NNS |
denotes |
elements |
| T7790 |
37499-37507 |
JJ |
denotes |
skeletal |
| T7791 |
37526-37533 |
JJ |
denotes |
similar |
| T7792 |
37534-37536 |
IN |
denotes |
to |
| T7793 |
37537-37545 |
NNS |
denotes |
controls |
| T7794 |
37545-37547 |
, |
denotes |
, |
| T7795 |
37547-37555 |
IN |
denotes |
although |
| T7796 |
37629-37637 |
VBD |
denotes |
appeared |
| T7797 |
37556-37559 |
DT |
denotes |
the |
| T7798 |
37579-37587 |
NN |
denotes |
meniscus |
| T7799 |
37560-37578 |
NN |
denotes |
fibrocartilaginous |
| T7800 |
37588-37592 |
WDT |
denotes |
that |
| T7801 |
37593-37600 |
VBZ |
denotes |
resides |
| T7802 |
37601-37608 |
IN |
denotes |
between |
| T7803 |
37609-37612 |
DT |
denotes |
the |
| T7804 |
37613-37618 |
NN |
denotes |
femur |
| T7805 |
37619-37622 |
CC |
denotes |
and |
| T7806 |
37623-37628 |
NN |
denotes |
tibia |
| T7807 |
37638-37642 |
RB |
denotes |
much |
| T7808 |
37643-37647 |
RBR |
denotes |
less |
| T7809 |
37648-37653 |
JJ |
denotes |
dense |
| T7810 |
37654-37656 |
IN |
denotes |
in |
| T7811 |
37657-37664 |
NNS |
denotes |
mutants |
| T7812 |
37665-37667 |
IN |
denotes |
at |
| T7813 |
37668-37673 |
NN |
denotes |
E16.5 |
| T7814 |
37673-37674 |
. |
denotes |
. |
| T7815 |
37674-37862 |
sentence |
denotes |
Some cartilage formed in the meniscus region, but the size of these elements was greatly reduced and contained abundant cells with fibrous, noncartilaginous appearance (unpublished data). |
| T7816 |
37675-37679 |
DT |
denotes |
Some |
| T7817 |
37680-37689 |
NN |
denotes |
cartilage |
| T7818 |
37690-37696 |
VBN |
denotes |
formed |
| T7819 |
37697-37699 |
IN |
denotes |
in |
| T7820 |
37700-37703 |
DT |
denotes |
the |
| T7821 |
37713-37719 |
NN |
denotes |
region |
| T7822 |
37704-37712 |
NN |
denotes |
meniscus |
| T7823 |
37719-37721 |
, |
denotes |
, |
| T7824 |
37721-37724 |
CC |
denotes |
but |
| T7825 |
37725-37728 |
DT |
denotes |
the |
| T7826 |
37729-37733 |
NN |
denotes |
size |
| T7827 |
37764-37771 |
VBN |
denotes |
reduced |
| T7828 |
37734-37736 |
IN |
denotes |
of |
| T7829 |
37737-37742 |
DT |
denotes |
these |
| T7830 |
37743-37751 |
NNS |
denotes |
elements |
| T7831 |
37752-37755 |
VBD |
denotes |
was |
| T7832 |
37756-37763 |
RB |
denotes |
greatly |
| T7833 |
37772-37775 |
CC |
denotes |
and |
| T7834 |
37776-37785 |
VBN |
denotes |
contained |
| T7835 |
37786-37794 |
JJ |
denotes |
abundant |
| T7836 |
37795-37800 |
NNS |
denotes |
cells |
| T7837 |
37801-37805 |
IN |
denotes |
with |
| T7838 |
37806-37813 |
JJ |
denotes |
fibrous |
| T7839 |
37832-37842 |
NN |
denotes |
appearance |
| T7840 |
37813-37815 |
, |
denotes |
, |
| T7841 |
37815-37831 |
JJ |
denotes |
noncartilaginous |
| T7842 |
37843-37844 |
-LRB- |
denotes |
( |
| T7843 |
37856-37860 |
NNS |
denotes |
data |
| T7844 |
37844-37855 |
JJ |
denotes |
unpublished |
| T7845 |
37860-37861 |
-RRB- |
denotes |
) |
| T7846 |
37861-37862 |
. |
denotes |
. |
| T7847 |
37862-37991 |
sentence |
denotes |
This reduction of the meniscus can also be seen in sections from 7-wk- and 9-mo-old animals (Figure 7E, 7H, 7K, and 7N, arrows). |
| T7848 |
37863-37867 |
DT |
denotes |
This |
| T7849 |
37868-37877 |
NN |
denotes |
reduction |
| T7850 |
37906-37910 |
VBN |
denotes |
seen |
| T7851 |
37878-37880 |
IN |
denotes |
of |
| T7852 |
37881-37884 |
DT |
denotes |
the |
| T7853 |
37885-37893 |
NN |
denotes |
meniscus |
| T7854 |
37894-37897 |
MD |
denotes |
can |
| T7855 |
37898-37902 |
RB |
denotes |
also |
| T7856 |
37903-37905 |
VB |
denotes |
be |
| T7857 |
37911-37913 |
IN |
denotes |
in |
| T7858 |
37914-37922 |
NNS |
denotes |
sections |
| T7859 |
37923-37927 |
IN |
denotes |
from |
| T7860 |
37928-37929 |
CD |
denotes |
7 |
| T7861 |
37930-37932 |
NN |
denotes |
wk |
| T7862 |
37929-37930 |
HYPH |
denotes |
- |
| T7863 |
37943-37946 |
JJ |
denotes |
old |
| T7864 |
37932-37933 |
HYPH |
denotes |
- |
| T7865 |
37934-37937 |
CC |
denotes |
and |
| T7866 |
37938-37939 |
CD |
denotes |
9 |
| T7867 |
37940-37942 |
NN |
denotes |
mo |
| T7868 |
37939-37940 |
HYPH |
denotes |
- |
| T7869 |
37942-37943 |
HYPH |
denotes |
- |
| T7870 |
37947-37954 |
NNS |
denotes |
animals |
| T7871 |
37955-37956 |
-LRB- |
denotes |
( |
| T7872 |
37983-37989 |
NNS |
denotes |
arrows |
| T7873 |
37956-37962 |
NN |
denotes |
Figure |
| T7874 |
37963-37965 |
CD |
denotes |
7E |
| T7875 |
37965-37967 |
, |
denotes |
, |
| T7876 |
37967-37969 |
CD |
denotes |
7H |
| T7877 |
37969-37971 |
, |
denotes |
, |
| T7878 |
37971-37973 |
CD |
denotes |
7K |
| T7879 |
37973-37975 |
, |
denotes |
, |
| T7880 |
37975-37978 |
CC |
denotes |
and |
| T7881 |
37979-37981 |
CD |
denotes |
7N |
| T7882 |
37981-37983 |
, |
denotes |
, |
| T7883 |
37989-37990 |
-RRB- |
denotes |
) |
| T7884 |
37990-37991 |
. |
denotes |
. |
| T7885 |
37991-38214 |
sentence |
denotes |
At 7 wk of age the normally domed tibial epiphysis was flattened and depressed in the knees of mutant animals, markedly reducing the distance between the growth plate and articular surface (Figure 7E and 7H, vertical bar). |
| T7886 |
37992-37994 |
IN |
denotes |
At |
| T7887 |
38047-38056 |
VBN |
denotes |
flattened |
| T7888 |
37995-37996 |
CD |
denotes |
7 |
| T7889 |
37997-37999 |
NNS |
denotes |
wk |
| T7890 |
38000-38002 |
IN |
denotes |
of |
| T7891 |
38003-38006 |
NN |
denotes |
age |
| T7892 |
38007-38010 |
DT |
denotes |
the |
| T7893 |
38033-38042 |
NN |
denotes |
epiphysis |
| T7894 |
38011-38019 |
RB |
denotes |
normally |
| T7895 |
38020-38025 |
VBN |
denotes |
domed |
| T7896 |
38026-38032 |
JJ |
denotes |
tibial |
| T7897 |
38043-38046 |
VBD |
denotes |
was |
| T7898 |
38057-38060 |
CC |
denotes |
and |
| T7899 |
38061-38070 |
VBN |
denotes |
depressed |
| T7900 |
38071-38073 |
IN |
denotes |
in |
| T7901 |
38074-38077 |
DT |
denotes |
the |
| T7902 |
38078-38083 |
NNS |
denotes |
knees |
| T7903 |
38084-38086 |
IN |
denotes |
of |
| T7904 |
38087-38093 |
NN |
denotes |
mutant |
| T7905 |
38094-38101 |
NNS |
denotes |
animals |
| T7906 |
38101-38103 |
, |
denotes |
, |
| T7907 |
38103-38111 |
RB |
denotes |
markedly |
| T7908 |
38112-38120 |
VBG |
denotes |
reducing |
| T7909 |
38121-38124 |
DT |
denotes |
the |
| T7910 |
38125-38133 |
NN |
denotes |
distance |
| T7911 |
38134-38141 |
IN |
denotes |
between |
| T7912 |
38142-38145 |
DT |
denotes |
the |
| T7913 |
38153-38158 |
NN |
denotes |
plate |
| T7914 |
38146-38152 |
NN |
denotes |
growth |
| T7915 |
38159-38162 |
CC |
denotes |
and |
| T7916 |
38163-38172 |
JJ |
denotes |
articular |
| T7917 |
38173-38180 |
NN |
denotes |
surface |
| T7918 |
38181-38182 |
-LRB- |
denotes |
( |
| T7919 |
38209-38212 |
NN |
denotes |
bar |
| T7920 |
38182-38188 |
NN |
denotes |
Figure |
| T7921 |
38189-38191 |
CD |
denotes |
7E |
| T7922 |
38192-38195 |
CC |
denotes |
and |
| T7923 |
38196-38198 |
CD |
denotes |
7H |
| T7924 |
38198-38200 |
, |
denotes |
, |
| T7925 |
38200-38208 |
JJ |
denotes |
vertical |
| T7926 |
38212-38213 |
-RRB- |
denotes |
) |
| T7927 |
38213-38214 |
. |
denotes |
. |
| T7928 |
38214-38419 |
sentence |
denotes |
Articular cartilage was also thinner than in control animals, showed nearly complete absence of Safranin O staining, and was either acellular or beginning to fibrillate in many regions (Figure 7F and 7I). |
| T7929 |
38215-38224 |
JJ |
denotes |
Articular |
| T7930 |
38225-38234 |
NN |
denotes |
cartilage |
| T7931 |
38235-38238 |
VBD |
denotes |
was |
| T7932 |
38239-38243 |
RB |
denotes |
also |
| T7933 |
38244-38251 |
JJR |
denotes |
thinner |
| T7934 |
38252-38256 |
IN |
denotes |
than |
| T7935 |
38257-38259 |
IN |
denotes |
in |
| T7936 |
38260-38267 |
NN |
denotes |
control |
| T7937 |
38268-38275 |
NNS |
denotes |
animals |
| T7938 |
38275-38277 |
, |
denotes |
, |
| T7939 |
38277-38283 |
VBD |
denotes |
showed |
| T7940 |
38284-38290 |
RB |
denotes |
nearly |
| T7941 |
38291-38299 |
JJ |
denotes |
complete |
| T7942 |
38300-38307 |
NN |
denotes |
absence |
| T7943 |
38308-38310 |
IN |
denotes |
of |
| T7944 |
38311-38319 |
NN |
denotes |
Safranin |
| T7945 |
38320-38321 |
NN |
denotes |
O |
| T7946 |
38322-38330 |
NN |
denotes |
staining |
| T7947 |
38330-38332 |
, |
denotes |
, |
| T7948 |
38332-38335 |
CC |
denotes |
and |
| T7949 |
38336-38339 |
VBD |
denotes |
was |
| T7950 |
38340-38346 |
CC |
denotes |
either |
| T7951 |
38347-38356 |
JJ |
denotes |
acellular |
| T7952 |
38357-38359 |
CC |
denotes |
or |
| T7953 |
38360-38369 |
VBG |
denotes |
beginning |
| T7954 |
38370-38372 |
TO |
denotes |
to |
| T7955 |
38373-38383 |
VB |
denotes |
fibrillate |
| T7956 |
38384-38386 |
IN |
denotes |
in |
| T7957 |
38387-38391 |
JJ |
denotes |
many |
| T7958 |
38392-38399 |
NNS |
denotes |
regions |
| T7959 |
38400-38401 |
-LRB- |
denotes |
( |
| T7960 |
38401-38407 |
NN |
denotes |
Figure |
| T7961 |
38408-38410 |
CD |
denotes |
7F |
| T7962 |
38411-38414 |
CC |
denotes |
and |
| T7963 |
38415-38417 |
CD |
denotes |
7I |
| T7964 |
38417-38418 |
-RRB- |
denotes |
) |
| T7965 |
38418-38419 |
. |
denotes |
. |
| T7966 |
38419-38700 |
sentence |
denotes |
The few large Safranin O-stained cells still apparent in mutant articular regions appeared to correspond in position to rare LACZ-negative cells in adjacent sections, suggesting that Bmpr1a is required cell-autonomously in articular cartilage (Figure 7I and 7J, white arrowheads). |
| T7967 |
38420-38423 |
DT |
denotes |
The |
| T7968 |
38453-38458 |
NNS |
denotes |
cells |
| T7969 |
38424-38427 |
JJ |
denotes |
few |
| T7970 |
38428-38433 |
JJ |
denotes |
large |
| T7971 |
38434-38442 |
NN |
denotes |
Safranin |
| T7972 |
38443-38444 |
NN |
denotes |
O |
| T7973 |
38445-38452 |
VBN |
denotes |
stained |
| T7974 |
38444-38445 |
HYPH |
denotes |
- |
| T7975 |
38502-38510 |
VBD |
denotes |
appeared |
| T7976 |
38459-38464 |
RB |
denotes |
still |
| T7977 |
38465-38473 |
JJ |
denotes |
apparent |
| T7978 |
38474-38476 |
IN |
denotes |
in |
| T7979 |
38477-38483 |
NN |
denotes |
mutant |
| T7980 |
38494-38501 |
NNS |
denotes |
regions |
| T7981 |
38484-38493 |
JJ |
denotes |
articular |
| T7982 |
38511-38513 |
TO |
denotes |
to |
| T7983 |
38514-38524 |
VB |
denotes |
correspond |
| T7984 |
38525-38527 |
IN |
denotes |
in |
| T7985 |
38528-38536 |
NN |
denotes |
position |
| T7986 |
38537-38539 |
IN |
denotes |
to |
| T7987 |
38540-38544 |
JJ |
denotes |
rare |
| T7988 |
38559-38564 |
NNS |
denotes |
cells |
| T7989 |
38545-38549 |
NN |
denotes |
LACZ |
| T7990 |
38550-38558 |
JJ |
denotes |
negative |
| T7991 |
38549-38550 |
HYPH |
denotes |
- |
| T7992 |
38565-38567 |
IN |
denotes |
in |
| T7993 |
38568-38576 |
JJ |
denotes |
adjacent |
| T7994 |
38577-38585 |
NNS |
denotes |
sections |
| T7995 |
38585-38587 |
, |
denotes |
, |
| T7996 |
38587-38597 |
VBG |
denotes |
suggesting |
| T7997 |
38598-38602 |
IN |
denotes |
that |
| T7998 |
38613-38621 |
VBN |
denotes |
required |
| T7999 |
38603-38609 |
NN |
denotes |
Bmpr1a |
| T8000 |
38610-38612 |
VBZ |
denotes |
is |
| T8001 |
38622-38626 |
NN |
denotes |
cell |
| T8002 |
38627-38639 |
RB |
denotes |
autonomously |
| T8003 |
38626-38627 |
HYPH |
denotes |
- |
| T8004 |
38640-38642 |
IN |
denotes |
in |
| T8005 |
38643-38652 |
JJ |
denotes |
articular |
| T8006 |
38653-38662 |
NN |
denotes |
cartilage |
| T8007 |
38663-38664 |
-LRB- |
denotes |
( |
| T8008 |
38688-38698 |
NNS |
denotes |
arrowheads |
| T8009 |
38664-38670 |
NN |
denotes |
Figure |
| T8010 |
38671-38673 |
CD |
denotes |
7I |
| T8011 |
38674-38677 |
CC |
denotes |
and |
| T8012 |
38678-38680 |
CD |
denotes |
7J |
| T8013 |
38680-38682 |
, |
denotes |
, |
| T8014 |
38682-38687 |
JJ |
denotes |
white |
| T8015 |
38698-38699 |
-RRB- |
denotes |
) |
| T8016 |
38699-38700 |
. |
denotes |
. |
| T8017 |
38700-38851 |
sentence |
denotes |
By 9 mo, large areas of mutant knees were devoid of articular cells, and the bones of the femur and tibia appeared to rub directly against each other. |
| T8018 |
38701-38703 |
IN |
denotes |
By |
| T8019 |
38738-38742 |
VBD |
denotes |
were |
| T8020 |
38704-38705 |
CD |
denotes |
9 |
| T8021 |
38706-38708 |
NN |
denotes |
mo |
| T8022 |
38708-38710 |
, |
denotes |
, |
| T8023 |
38710-38715 |
JJ |
denotes |
large |
| T8024 |
38716-38721 |
NNS |
denotes |
areas |
| T8025 |
38722-38724 |
IN |
denotes |
of |
| T8026 |
38725-38731 |
NN |
denotes |
mutant |
| T8027 |
38732-38737 |
NNS |
denotes |
knees |
| T8028 |
38743-38749 |
JJ |
denotes |
devoid |
| T8029 |
38750-38752 |
IN |
denotes |
of |
| T8030 |
38753-38762 |
JJ |
denotes |
articular |
| T8031 |
38763-38768 |
NNS |
denotes |
cells |
| T8032 |
38768-38770 |
, |
denotes |
, |
| T8033 |
38770-38773 |
CC |
denotes |
and |
| T8034 |
38774-38777 |
DT |
denotes |
the |
| T8035 |
38778-38783 |
NNS |
denotes |
bones |
| T8036 |
38807-38815 |
VBD |
denotes |
appeared |
| T8037 |
38784-38786 |
IN |
denotes |
of |
| T8038 |
38787-38790 |
DT |
denotes |
the |
| T8039 |
38791-38796 |
NN |
denotes |
femur |
| T8040 |
38797-38800 |
CC |
denotes |
and |
| T8041 |
38801-38806 |
NN |
denotes |
tibia |
| T8042 |
38816-38818 |
TO |
denotes |
to |
| T8043 |
38819-38822 |
VB |
denotes |
rub |
| T8044 |
38823-38831 |
RB |
denotes |
directly |
| T8045 |
38832-38839 |
IN |
denotes |
against |
| T8046 |
38840-38844 |
DT |
denotes |
each |
| T8047 |
38845-38850 |
JJ |
denotes |
other |
| T8048 |
38850-38851 |
. |
denotes |
. |
| T8049 |
38851-39037 |
sentence |
denotes |
Furthermore, the epiphysis of the tibia was extremely depressed, to the point that growth plate cartilage was almost exposed through the surface of the bone (Figure 7K, 7L, 7N, and 7O). |
| T8050 |
38852-38863 |
RB |
denotes |
Furthermore |
| T8051 |
38892-38895 |
VBD |
denotes |
was |
| T8052 |
38863-38865 |
, |
denotes |
, |
| T8053 |
38865-38868 |
DT |
denotes |
the |
| T8054 |
38869-38878 |
NN |
denotes |
epiphysis |
| T8055 |
38879-38881 |
IN |
denotes |
of |
| T8056 |
38882-38885 |
DT |
denotes |
the |
| T8057 |
38886-38891 |
NN |
denotes |
tibia |
| T8058 |
38896-38905 |
RB |
denotes |
extremely |
| T8059 |
38906-38915 |
JJ |
denotes |
depressed |
| T8060 |
38915-38917 |
, |
denotes |
, |
| T8061 |
38917-38919 |
IN |
denotes |
to |
| T8062 |
38920-38923 |
DT |
denotes |
the |
| T8063 |
38924-38929 |
NN |
denotes |
point |
| T8064 |
38930-38934 |
IN |
denotes |
that |
| T8065 |
38969-38976 |
VBN |
denotes |
exposed |
| T8066 |
38935-38941 |
NN |
denotes |
growth |
| T8067 |
38948-38957 |
NN |
denotes |
cartilage |
| T8068 |
38942-38947 |
NN |
denotes |
plate |
| T8069 |
38958-38961 |
VBD |
denotes |
was |
| T8070 |
38962-38968 |
RB |
denotes |
almost |
| T8071 |
38977-38984 |
IN |
denotes |
through |
| T8072 |
38985-38988 |
DT |
denotes |
the |
| T8073 |
38989-38996 |
NN |
denotes |
surface |
| T8074 |
38997-38999 |
IN |
denotes |
of |
| T8075 |
39000-39003 |
DT |
denotes |
the |
| T8076 |
39004-39008 |
NN |
denotes |
bone |
| T8077 |
39009-39010 |
-LRB- |
denotes |
( |
| T8078 |
39017-39019 |
CD |
denotes |
7K |
| T8079 |
39010-39016 |
NN |
denotes |
Figure |
| T8080 |
39019-39021 |
, |
denotes |
, |
| T8081 |
39021-39023 |
CD |
denotes |
7L |
| T8082 |
39023-39025 |
, |
denotes |
, |
| T8083 |
39025-39027 |
CD |
denotes |
7N |
| T8084 |
39027-39029 |
, |
denotes |
, |
| T8085 |
39029-39032 |
CC |
denotes |
and |
| T8086 |
39033-39035 |
CD |
denotes |
7O |
| T8087 |
39035-39036 |
-RRB- |
denotes |
) |
| T8088 |
39036-39037 |
. |
denotes |
. |
| T8089 |
39037-39186 |
sentence |
denotes |
In addition, mutants at 7 wk and 9 mo showed subchondral sclerosis, especially in the epiphysis of the femur (Figure 7E, 7H, 7K, and 7N, asterisks). |
| T8090 |
39038-39040 |
IN |
denotes |
In |
| T8091 |
39076-39082 |
VBD |
denotes |
showed |
| T8092 |
39041-39049 |
NN |
denotes |
addition |
| T8093 |
39049-39051 |
, |
denotes |
, |
| T8094 |
39051-39058 |
NNS |
denotes |
mutants |
| T8095 |
39059-39061 |
IN |
denotes |
at |
| T8096 |
39062-39063 |
CD |
denotes |
7 |
| T8097 |
39064-39066 |
NNS |
denotes |
wk |
| T8098 |
39067-39070 |
CC |
denotes |
and |
| T8099 |
39071-39072 |
CD |
denotes |
9 |
| T8100 |
39073-39075 |
NNS |
denotes |
mo |
| T8101 |
39083-39094 |
JJ |
denotes |
subchondral |
| T8102 |
39095-39104 |
NN |
denotes |
sclerosis |
| T8103 |
39104-39106 |
, |
denotes |
, |
| T8104 |
39106-39116 |
RB |
denotes |
especially |
| T8105 |
39117-39119 |
IN |
denotes |
in |
| T8106 |
39120-39123 |
DT |
denotes |
the |
| T8107 |
39124-39133 |
NN |
denotes |
epiphysis |
| T8108 |
39134-39136 |
IN |
denotes |
of |
| T8109 |
39137-39140 |
DT |
denotes |
the |
| T8110 |
39141-39146 |
NN |
denotes |
femur |
| T8111 |
39147-39148 |
-LRB- |
denotes |
( |
| T8112 |
39175-39184 |
NNS |
denotes |
asterisks |
| T8113 |
39148-39154 |
NN |
denotes |
Figure |
| T8114 |
39155-39157 |
CD |
denotes |
7E |
| T8115 |
39157-39159 |
, |
denotes |
, |
| T8116 |
39159-39161 |
CD |
denotes |
7H |
| T8117 |
39161-39163 |
, |
denotes |
, |
| T8118 |
39163-39165 |
CD |
denotes |
7K |
| T8119 |
39165-39167 |
, |
denotes |
, |
| T8120 |
39167-39170 |
CC |
denotes |
and |
| T8121 |
39171-39173 |
CD |
denotes |
7N |
| T8122 |
39173-39175 |
, |
denotes |
, |
| T8123 |
39184-39185 |
-RRB- |
denotes |
) |
| T8124 |
39185-39186 |
. |
denotes |
. |
| T8125 |
39186-39540 |
sentence |
denotes |
While subchondral sclerosis is commonly seen in cases of osteoarthritis, it is unclear in this case whether the sclerosis is mainly a response of bone formation to compensate for decreased articular cartilage, or whether it is the effect of loss of Bmpr1a signaling in some LACZ-positive cells that are also observed in these regions (unpublished data). |
| T8126 |
39187-39192 |
IN |
denotes |
While |
| T8127 |
39227-39231 |
VBN |
denotes |
seen |
| T8128 |
39193-39204 |
JJ |
denotes |
subchondral |
| T8129 |
39205-39214 |
NN |
denotes |
sclerosis |
| T8130 |
39215-39217 |
VBZ |
denotes |
is |
| T8131 |
39218-39226 |
RB |
denotes |
commonly |
| T8132 |
39263-39265 |
VBZ |
denotes |
is |
| T8133 |
39232-39234 |
IN |
denotes |
in |
| T8134 |
39235-39240 |
NNS |
denotes |
cases |
| T8135 |
39241-39243 |
IN |
denotes |
of |
| T8136 |
39244-39258 |
NN |
denotes |
osteoarthritis |
| T8137 |
39258-39260 |
, |
denotes |
, |
| T8138 |
39260-39262 |
PRP |
denotes |
it |
| T8139 |
39266-39273 |
JJ |
denotes |
unclear |
| T8140 |
39274-39276 |
IN |
denotes |
in |
| T8141 |
39277-39281 |
DT |
denotes |
this |
| T8142 |
39282-39286 |
NN |
denotes |
case |
| T8143 |
39287-39294 |
IN |
denotes |
whether |
| T8144 |
39309-39311 |
VBZ |
denotes |
is |
| T8145 |
39295-39298 |
DT |
denotes |
the |
| T8146 |
39299-39308 |
NN |
denotes |
sclerosis |
| T8147 |
39312-39318 |
RB |
denotes |
mainly |
| T8148 |
39319-39320 |
DT |
denotes |
a |
| T8149 |
39321-39329 |
NN |
denotes |
response |
| T8150 |
39330-39332 |
IN |
denotes |
of |
| T8151 |
39333-39337 |
NN |
denotes |
bone |
| T8152 |
39338-39347 |
NN |
denotes |
formation |
| T8153 |
39348-39350 |
TO |
denotes |
to |
| T8154 |
39351-39361 |
VB |
denotes |
compensate |
| T8155 |
39362-39365 |
IN |
denotes |
for |
| T8156 |
39366-39375 |
VBN |
denotes |
decreased |
| T8157 |
39386-39395 |
NN |
denotes |
cartilage |
| T8158 |
39376-39385 |
JJ |
denotes |
articular |
| T8159 |
39395-39397 |
, |
denotes |
, |
| T8160 |
39397-39399 |
CC |
denotes |
or |
| T8161 |
39400-39407 |
IN |
denotes |
whether |
| T8162 |
39411-39413 |
VBZ |
denotes |
is |
| T8163 |
39408-39410 |
PRP |
denotes |
it |
| T8164 |
39414-39417 |
DT |
denotes |
the |
| T8165 |
39418-39424 |
NN |
denotes |
effect |
| T8166 |
39425-39427 |
IN |
denotes |
of |
| T8167 |
39428-39432 |
NN |
denotes |
loss |
| T8168 |
39433-39435 |
IN |
denotes |
of |
| T8169 |
39436-39442 |
NN |
denotes |
Bmpr1a |
| T8170 |
39443-39452 |
NN |
denotes |
signaling |
| T8171 |
39453-39455 |
IN |
denotes |
in |
| T8172 |
39456-39460 |
DT |
denotes |
some |
| T8173 |
39475-39480 |
NNS |
denotes |
cells |
| T8174 |
39461-39465 |
NN |
denotes |
LACZ |
| T8175 |
39466-39474 |
JJ |
denotes |
positive |
| T8176 |
39465-39466 |
HYPH |
denotes |
- |
| T8177 |
39481-39485 |
WDT |
denotes |
that |
| T8178 |
39495-39503 |
VBN |
denotes |
observed |
| T8179 |
39486-39489 |
VBP |
denotes |
are |
| T8180 |
39490-39494 |
RB |
denotes |
also |
| T8181 |
39504-39506 |
IN |
denotes |
in |
| T8182 |
39507-39512 |
DT |
denotes |
these |
| T8183 |
39513-39520 |
NNS |
denotes |
regions |
| T8184 |
39521-39522 |
-LRB- |
denotes |
( |
| T8185 |
39534-39538 |
NNS |
denotes |
data |
| T8186 |
39522-39533 |
JJ |
denotes |
unpublished |
| T8187 |
39538-39539 |
-RRB- |
denotes |
) |
| T8188 |
39539-39540 |
. |
denotes |
. |
| T8189 |
39540-39689 |
sentence |
denotes |
The histological signs of joint arthritis were accompanied by functional impairments in both grasping ability and range of motion in mutant animals. |
| T8190 |
39541-39544 |
DT |
denotes |
The |
| T8191 |
39558-39563 |
NNS |
denotes |
signs |
| T8192 |
39545-39557 |
JJ |
denotes |
histological |
| T8193 |
39588-39599 |
VBN |
denotes |
accompanied |
| T8194 |
39564-39566 |
IN |
denotes |
of |
| T8195 |
39567-39572 |
NN |
denotes |
joint |
| T8196 |
39573-39582 |
NN |
denotes |
arthritis |
| T8197 |
39583-39587 |
VBD |
denotes |
were |
| T8198 |
39600-39602 |
IN |
denotes |
by |
| T8199 |
39603-39613 |
JJ |
denotes |
functional |
| T8200 |
39614-39625 |
NNS |
denotes |
impairments |
| T8201 |
39626-39628 |
IN |
denotes |
in |
| T8202 |
39629-39633 |
CC |
denotes |
both |
| T8203 |
39643-39650 |
NN |
denotes |
ability |
| T8204 |
39634-39642 |
VBG |
denotes |
grasping |
| T8205 |
39651-39654 |
CC |
denotes |
and |
| T8206 |
39655-39660 |
NN |
denotes |
range |
| T8207 |
39661-39663 |
IN |
denotes |
of |
| T8208 |
39664-39670 |
NN |
denotes |
motion |
| T8209 |
39671-39673 |
IN |
denotes |
in |
| T8210 |
39674-39680 |
NN |
denotes |
mutant |
| T8211 |
39681-39688 |
NNS |
denotes |
animals |
| T8212 |
39688-39689 |
. |
denotes |
. |
| T8213 |
39689-39906 |
sentence |
denotes |
Gdf5-Cre/Bmpr1afloxP mutant animals showed a highly significantly reduced ability to grasp and remain suspended on a slender rod (mean suspension time: controls 38 ± 6 s, n = 39; mutants 6 ± 3 s, n = 11; p < 0.0001). |
| T8214 |
39690-39694 |
NN |
denotes |
Gdf5 |
| T8215 |
39695-39698 |
NN |
denotes |
Cre |
| T8216 |
39694-39695 |
HYPH |
denotes |
- |
| T8217 |
39699-39710 |
NN |
denotes |
Bmpr1afloxP |
| T8218 |
39698-39699 |
HYPH |
denotes |
/ |
| T8219 |
39711-39717 |
JJ |
denotes |
mutant |
| T8220 |
39718-39725 |
NNS |
denotes |
animals |
| T8221 |
39726-39732 |
VBD |
denotes |
showed |
| T8222 |
39733-39734 |
DT |
denotes |
a |
| T8223 |
39764-39771 |
NN |
denotes |
ability |
| T8224 |
39735-39741 |
RB |
denotes |
highly |
| T8225 |
39742-39755 |
RB |
denotes |
significantly |
| T8226 |
39756-39763 |
VBN |
denotes |
reduced |
| T8227 |
39772-39774 |
TO |
denotes |
to |
| T8228 |
39775-39780 |
VB |
denotes |
grasp |
| T8229 |
39781-39784 |
CC |
denotes |
and |
| T8230 |
39785-39791 |
VB |
denotes |
remain |
| T8231 |
39792-39801 |
VBN |
denotes |
suspended |
| T8232 |
39802-39804 |
IN |
denotes |
on |
| T8233 |
39805-39806 |
DT |
denotes |
a |
| T8234 |
39815-39818 |
NN |
denotes |
rod |
| T8235 |
39807-39814 |
JJ |
denotes |
slender |
| T8236 |
39819-39820 |
-LRB- |
denotes |
( |
| T8237 |
39836-39840 |
NN |
denotes |
time |
| T8238 |
39820-39824 |
JJ |
denotes |
mean |
| T8239 |
39825-39835 |
NN |
denotes |
suspension |
| T8240 |
39840-39842 |
: |
denotes |
: |
| T8241 |
39842-39850 |
NNS |
denotes |
controls |
| T8242 |
39858-39859 |
NNS |
denotes |
s |
| T8243 |
39851-39853 |
CD |
denotes |
38 |
| T8244 |
39856-39857 |
CD |
denotes |
6 |
| T8245 |
39854-39855 |
SYM |
denotes |
± |
| T8246 |
39883-39884 |
NNS |
denotes |
s |
| T8247 |
39859-39861 |
, |
denotes |
, |
| T8248 |
39861-39862 |
NN |
denotes |
n |
| T8249 |
39865-39867 |
CD |
denotes |
39 |
| T8250 |
39863-39864 |
SYM |
denotes |
= |
| T8251 |
39867-39868 |
: |
denotes |
; |
| T8252 |
39869-39876 |
NNS |
denotes |
mutants |
| T8253 |
39877-39878 |
CD |
denotes |
6 |
| T8254 |
39881-39882 |
CD |
denotes |
3 |
| T8255 |
39879-39880 |
SYM |
denotes |
± |
| T8256 |
39884-39886 |
, |
denotes |
, |
| T8257 |
39886-39887 |
NN |
denotes |
n |
| T8258 |
39890-39892 |
CD |
denotes |
11 |
| T8259 |
39888-39889 |
SYM |
denotes |
= |
| T8260 |
39892-39893 |
: |
denotes |
; |
| T8261 |
39894-39895 |
NN |
denotes |
p |
| T8262 |
39898-39904 |
CD |
denotes |
0.0001 |
| T8263 |
39896-39897 |
SYM |
denotes |
< |
| T8264 |
39904-39905 |
-RRB- |
denotes |
) |
| T8265 |
39905-39906 |
. |
denotes |
. |
| T8266 |
39906-40207 |
sentence |
denotes |
Mutant mice also showed a clear decrease in the maximum range of mobility of two different joints in the digits, as assayed by passive manipulation (MT/P1 joint: controls 100 ± 0°, n = 26; mutants 82 ± 3°, n = 8; p < 0.0003; P1/P2 joint: controls 152 ± 1°, n = 23; mutants 140 ± 5°, n = 6; p < 0.05). |
| T8267 |
39907-39913 |
NN |
denotes |
Mutant |
| T8268 |
39914-39918 |
NNS |
denotes |
mice |
| T8269 |
39924-39930 |
VBD |
denotes |
showed |
| T8270 |
39919-39923 |
RB |
denotes |
also |
| T8271 |
39931-39932 |
DT |
denotes |
a |
| T8272 |
39939-39947 |
NN |
denotes |
decrease |
| T8273 |
39933-39938 |
JJ |
denotes |
clear |
| T8274 |
39948-39950 |
IN |
denotes |
in |
| T8275 |
39951-39954 |
DT |
denotes |
the |
| T8276 |
39963-39968 |
NN |
denotes |
range |
| T8277 |
39955-39962 |
JJ |
denotes |
maximum |
| T8278 |
39969-39971 |
IN |
denotes |
of |
| T8279 |
39972-39980 |
NN |
denotes |
mobility |
| T8280 |
39981-39983 |
IN |
denotes |
of |
| T8281 |
39984-39987 |
CD |
denotes |
two |
| T8282 |
39998-40004 |
NNS |
denotes |
joints |
| T8283 |
39988-39997 |
JJ |
denotes |
different |
| T8284 |
40005-40007 |
IN |
denotes |
in |
| T8285 |
40008-40011 |
DT |
denotes |
the |
| T8286 |
40012-40018 |
NNS |
denotes |
digits |
| T8287 |
40018-40020 |
, |
denotes |
, |
| T8288 |
40020-40022 |
IN |
denotes |
as |
| T8289 |
40023-40030 |
VBN |
denotes |
assayed |
| T8290 |
40031-40033 |
IN |
denotes |
by |
| T8291 |
40034-40041 |
JJ |
denotes |
passive |
| T8292 |
40042-40054 |
NN |
denotes |
manipulation |
| T8293 |
40055-40056 |
-LRB- |
denotes |
( |
| T8294 |
40201-40205 |
CD |
denotes |
0.05 |
| T8295 |
40056-40058 |
NN |
denotes |
MT |
| T8296 |
40059-40061 |
NN |
denotes |
P1 |
| T8297 |
40058-40059 |
HYPH |
denotes |
/ |
| T8298 |
40062-40067 |
NN |
denotes |
joint |
| T8299 |
40124-40130 |
CD |
denotes |
0.0003 |
| T8300 |
40067-40069 |
: |
denotes |
: |
| T8301 |
40069-40077 |
VBZ |
denotes |
controls |
| T8302 |
40092-40094 |
CD |
denotes |
26 |
| T8303 |
40078-40081 |
CD |
denotes |
100 |
| T8304 |
40084-40085 |
CD |
denotes |
0 |
| T8305 |
40082-40083 |
SYM |
denotes |
± |
| T8306 |
40085-40086 |
NNS |
denotes |
° |
| T8307 |
40086-40088 |
, |
denotes |
, |
| T8308 |
40088-40089 |
NN |
denotes |
n |
| T8309 |
40090-40091 |
SYM |
denotes |
= |
| T8310 |
40094-40095 |
: |
denotes |
; |
| T8311 |
40096-40103 |
NNS |
denotes |
mutants |
| T8312 |
40117-40118 |
CD |
denotes |
8 |
| T8313 |
40104-40106 |
CD |
denotes |
82 |
| T8314 |
40109-40110 |
CD |
denotes |
3 |
| T8315 |
40107-40108 |
SYM |
denotes |
± |
| T8316 |
40110-40111 |
NNS |
denotes |
° |
| T8317 |
40111-40113 |
, |
denotes |
, |
| T8318 |
40113-40114 |
NN |
denotes |
n |
| T8319 |
40115-40116 |
SYM |
denotes |
= |
| T8320 |
40118-40119 |
: |
denotes |
; |
| T8321 |
40120-40121 |
NN |
denotes |
p |
| T8322 |
40122-40123 |
SYM |
denotes |
< |
| T8323 |
40130-40131 |
: |
denotes |
; |
| T8324 |
40132-40134 |
NN |
denotes |
P1 |
| T8325 |
40135-40137 |
NN |
denotes |
P2 |
| T8326 |
40134-40135 |
HYPH |
denotes |
/ |
| T8327 |
40138-40143 |
NN |
denotes |
joint |
| T8328 |
40143-40145 |
: |
denotes |
: |
| T8329 |
40145-40153 |
NNS |
denotes |
controls |
| T8330 |
40168-40170 |
CD |
denotes |
23 |
| T8331 |
40154-40157 |
CD |
denotes |
152 |
| T8332 |
40160-40161 |
CD |
denotes |
1 |
| T8333 |
40158-40159 |
SYM |
denotes |
± |
| T8334 |
40161-40162 |
NN |
denotes |
° |
| T8335 |
40162-40164 |
, |
denotes |
, |
| T8336 |
40164-40165 |
NN |
denotes |
n |
| T8337 |
40166-40167 |
SYM |
denotes |
= |
| T8338 |
40170-40171 |
: |
denotes |
; |
| T8339 |
40172-40179 |
NNS |
denotes |
mutants |
| T8340 |
40194-40195 |
CD |
denotes |
6 |
| T8341 |
40180-40183 |
CD |
denotes |
140 |
| T8342 |
40186-40187 |
CD |
denotes |
5 |
| T8343 |
40184-40185 |
SYM |
denotes |
± |
| T8344 |
40187-40188 |
NNS |
denotes |
° |
| T8345 |
40188-40190 |
, |
denotes |
, |
| T8346 |
40190-40191 |
NN |
denotes |
n |
| T8347 |
40192-40193 |
SYM |
denotes |
= |
| T8348 |
40195-40196 |
: |
denotes |
; |
| T8349 |
40197-40198 |
NN |
denotes |
p |
| T8350 |
40199-40200 |
SYM |
denotes |
< |
| T8351 |
40205-40206 |
-RRB- |
denotes |
) |
| T8352 |
40206-40207 |
. |
denotes |
. |
| T8353 |
40207-40392 |
sentence |
denotes |
The structural, histological, marker gene expression, and functional changes in mutant mice demonstrate that BMPR1A is required for normal postnatal maintenance of articular cartilage. |
| T8354 |
40208-40211 |
DT |
denotes |
The |
| T8355 |
40277-40284 |
NNS |
denotes |
changes |
| T8356 |
40212-40222 |
JJ |
denotes |
structural |
| T8357 |
40222-40224 |
, |
denotes |
, |
| T8358 |
40224-40236 |
JJ |
denotes |
histological |
| T8359 |
40236-40238 |
, |
denotes |
, |
| T8360 |
40238-40244 |
NN |
denotes |
marker |
| T8361 |
40245-40249 |
NN |
denotes |
gene |
| T8362 |
40250-40260 |
NN |
denotes |
expression |
| T8363 |
40260-40262 |
, |
denotes |
, |
| T8364 |
40262-40265 |
CC |
denotes |
and |
| T8365 |
40266-40276 |
JJ |
denotes |
functional |
| T8366 |
40300-40311 |
VBP |
denotes |
demonstrate |
| T8367 |
40285-40287 |
IN |
denotes |
in |
| T8368 |
40288-40294 |
NN |
denotes |
mutant |
| T8369 |
40295-40299 |
NNS |
denotes |
mice |
| T8370 |
40312-40316 |
IN |
denotes |
that |
| T8371 |
40327-40335 |
VBN |
denotes |
required |
| T8372 |
40317-40323 |
NN |
denotes |
BMPR1A |
| T8373 |
40324-40326 |
VBZ |
denotes |
is |
| T8374 |
40336-40339 |
IN |
denotes |
for |
| T8375 |
40340-40346 |
JJ |
denotes |
normal |
| T8376 |
40357-40368 |
NN |
denotes |
maintenance |
| T8377 |
40347-40356 |
JJ |
denotes |
postnatal |
| T8378 |
40369-40371 |
IN |
denotes |
of |
| T8379 |
40372-40381 |
JJ |
denotes |
articular |
| T8380 |
40382-40391 |
NN |
denotes |
cartilage |
| T8381 |
40391-40392 |
. |
denotes |
. |
| T9223 |
40405-40413 |
JJ |
denotes |
Previous |
| T9224 |
40414-40421 |
NNS |
denotes |
studies |
| T9225 |
40422-40429 |
VBP |
denotes |
suggest |
| T9226 |
40430-40434 |
IN |
denotes |
that |
| T9227 |
40452-40460 |
VBN |
denotes |
involved |
| T9228 |
40435-40438 |
NN |
denotes |
BMP |
| T9229 |
40439-40448 |
NN |
denotes |
signaling |
| T9230 |
40449-40451 |
VBZ |
denotes |
is |
| T9231 |
40461-40463 |
IN |
denotes |
in |
| T9232 |
40464-40465 |
DT |
denotes |
a |
| T9233 |
40472-40478 |
NN |
denotes |
number |
| T9234 |
40466-40471 |
JJ |
denotes |
large |
| T9235 |
40479-40481 |
IN |
denotes |
of |
| T9236 |
40482-40495 |
JJ |
denotes |
developmental |
| T9237 |
40496-40502 |
NNS |
denotes |
events |
| T9238 |
40502-40503 |
. |
denotes |
. |
| T9239 |
40503-40641 |
sentence |
denotes |
Many of these events occur early in embryogenesis, and complete inactivation of BMP receptors causes death by E9.5 (Mishina et al. 1995). |
| T9240 |
40504-40508 |
JJ |
denotes |
Many |
| T9241 |
40525-40530 |
VBP |
denotes |
occur |
| T9242 |
40509-40511 |
IN |
denotes |
of |
| T9243 |
40512-40517 |
DT |
denotes |
these |
| T9244 |
40518-40524 |
NNS |
denotes |
events |
| T9245 |
40531-40536 |
RB |
denotes |
early |
| T9246 |
40537-40539 |
IN |
denotes |
in |
| T9247 |
40540-40553 |
NN |
denotes |
embryogenesis |
| T9248 |
40553-40555 |
, |
denotes |
, |
| T9249 |
40555-40558 |
CC |
denotes |
and |
| T9250 |
40559-40567 |
JJ |
denotes |
complete |
| T9251 |
40568-40580 |
NN |
denotes |
inactivation |
| T9252 |
40598-40604 |
VBZ |
denotes |
causes |
| T9253 |
40581-40583 |
IN |
denotes |
of |
| T9254 |
40584-40587 |
NN |
denotes |
BMP |
| T9255 |
40588-40597 |
NNS |
denotes |
receptors |
| T9256 |
40605-40610 |
NN |
denotes |
death |
| T9257 |
40611-40613 |
IN |
denotes |
by |
| T9258 |
40614-40618 |
NN |
denotes |
E9.5 |
| T9259 |
40619-40620 |
-LRB- |
denotes |
( |
| T9260 |
40620-40627 |
NNP |
denotes |
Mishina |
| T9261 |
40628-40630 |
FW |
denotes |
et |
| T9262 |
40631-40634 |
FW |
denotes |
al. |
| T9263 |
40635-40639 |
CD |
denotes |
1995 |
| T9264 |
40639-40640 |
-RRB- |
denotes |
) |
| T9265 |
40640-40641 |
. |
denotes |
. |
| T9266 |
40641-40840 |
sentence |
denotes |
The Gdf5-Cre recombination system bypasses the early embryonic lethality of Bmpr1a mutations, and provides important new information about the role of this receptor in limb and skeletal development. |
| T9267 |
40642-40645 |
DT |
denotes |
The |
| T9268 |
40669-40675 |
NN |
denotes |
system |
| T9269 |
40646-40650 |
NN |
denotes |
Gdf5 |
| T9270 |
40651-40654 |
NN |
denotes |
Cre |
| T9271 |
40650-40651 |
HYPH |
denotes |
- |
| T9272 |
40655-40668 |
NN |
denotes |
recombination |
| T9273 |
40676-40684 |
VBZ |
denotes |
bypasses |
| T9274 |
40685-40688 |
DT |
denotes |
the |
| T9275 |
40705-40714 |
NN |
denotes |
lethality |
| T9276 |
40689-40694 |
JJ |
denotes |
early |
| T9277 |
40695-40704 |
JJ |
denotes |
embryonic |
| T9278 |
40715-40717 |
IN |
denotes |
of |
| T9279 |
40718-40724 |
NN |
denotes |
Bmpr1a |
| T9280 |
40725-40734 |
NNS |
denotes |
mutations |
| T9281 |
40734-40736 |
, |
denotes |
, |
| T9282 |
40736-40739 |
CC |
denotes |
and |
| T9283 |
40740-40748 |
VBZ |
denotes |
provides |
| T9284 |
40749-40758 |
JJ |
denotes |
important |
| T9285 |
40763-40774 |
NN |
denotes |
information |
| T9286 |
40759-40762 |
JJ |
denotes |
new |
| T9287 |
40775-40780 |
IN |
denotes |
about |
| T9288 |
40781-40784 |
DT |
denotes |
the |
| T9289 |
40785-40789 |
NN |
denotes |
role |
| T9290 |
40790-40792 |
IN |
denotes |
of |
| T9291 |
40793-40797 |
DT |
denotes |
this |
| T9292 |
40798-40806 |
NN |
denotes |
receptor |
| T9293 |
40807-40809 |
IN |
denotes |
in |
| T9294 |
40810-40814 |
NN |
denotes |
limb |
| T9295 |
40828-40839 |
NN |
denotes |
development |
| T9296 |
40815-40818 |
CC |
denotes |
and |
| T9297 |
40819-40827 |
JJ |
denotes |
skeletal |
| T9298 |
40839-40840 |
. |
denotes |
. |
| T9299 |
40840-41104 |
sentence |
denotes |
The three major limb phenotypes revealed by eliminating Bmpr1a with Gdf5-driven Cre include webbing between digits, lack of joint formation at specific locations in the ankle, and failure to maintain articular cartilage after birth, resulting in severe arthritis. |
| T9300 |
40841-40844 |
DT |
denotes |
The |
| T9301 |
40862-40872 |
NNS |
denotes |
phenotypes |
| T9302 |
40845-40850 |
CD |
denotes |
three |
| T9303 |
40851-40856 |
JJ |
denotes |
major |
| T9304 |
40857-40861 |
NN |
denotes |
limb |
| T9305 |
40925-40932 |
VBP |
denotes |
include |
| T9306 |
40873-40881 |
VBN |
denotes |
revealed |
| T9307 |
40882-40884 |
IN |
denotes |
by |
| T9308 |
40885-40896 |
VBG |
denotes |
eliminating |
| T9309 |
40897-40903 |
NN |
denotes |
Bmpr1a |
| T9310 |
40904-40908 |
IN |
denotes |
with |
| T9311 |
40909-40913 |
NN |
denotes |
Gdf5 |
| T9312 |
40914-40920 |
VBN |
denotes |
driven |
| T9313 |
40913-40914 |
HYPH |
denotes |
- |
| T9314 |
40921-40924 |
NN |
denotes |
Cre |
| T9315 |
40933-40940 |
NN |
denotes |
webbing |
| T9316 |
40941-40948 |
IN |
denotes |
between |
| T9317 |
40949-40955 |
NNS |
denotes |
digits |
| T9318 |
40955-40957 |
, |
denotes |
, |
| T9319 |
40957-40961 |
NN |
denotes |
lack |
| T9320 |
40962-40964 |
IN |
denotes |
of |
| T9321 |
40965-40970 |
NN |
denotes |
joint |
| T9322 |
40971-40980 |
NN |
denotes |
formation |
| T9323 |
40981-40983 |
IN |
denotes |
at |
| T9324 |
40984-40992 |
JJ |
denotes |
specific |
| T9325 |
40993-41002 |
NNS |
denotes |
locations |
| T9326 |
41003-41005 |
IN |
denotes |
in |
| T9327 |
41006-41009 |
DT |
denotes |
the |
| T9328 |
41010-41015 |
NN |
denotes |
ankle |
| T9329 |
41015-41017 |
, |
denotes |
, |
| T9330 |
41017-41020 |
CC |
denotes |
and |
| T9331 |
41021-41028 |
NN |
denotes |
failure |
| T9332 |
41029-41031 |
TO |
denotes |
to |
| T9333 |
41032-41040 |
VB |
denotes |
maintain |
| T9334 |
41041-41050 |
JJ |
denotes |
articular |
| T9335 |
41051-41060 |
NN |
denotes |
cartilage |
| T9336 |
41061-41066 |
IN |
denotes |
after |
| T9337 |
41067-41072 |
NN |
denotes |
birth |
| T9338 |
41072-41074 |
, |
denotes |
, |
| T9339 |
41074-41083 |
VBG |
denotes |
resulting |
| T9340 |
41084-41086 |
IN |
denotes |
in |
| T9341 |
41087-41093 |
JJ |
denotes |
severe |
| T9342 |
41094-41103 |
NN |
denotes |
arthritis |
| T9343 |
41103-41104 |
. |
denotes |
. |
| T9344 |
41104-41426 |
sentence |
denotes |
Previous studies have shown that manipulation of BMP signaling alters interdigital apoptosis during development of the limb, but no experiment has identified a specific member of the BMP signaling pathway that is required for this process (Yokouchi et al. 1996; Zou and Niswander 1996; Zou et al. 1997; Guha et al. 2002). |
| T9345 |
41105-41113 |
JJ |
denotes |
Previous |
| T9346 |
41114-41121 |
NNS |
denotes |
studies |
| T9347 |
41127-41132 |
VBN |
denotes |
shown |
| T9348 |
41122-41126 |
VBP |
denotes |
have |
| T9349 |
41133-41137 |
IN |
denotes |
that |
| T9350 |
41168-41174 |
VBZ |
denotes |
alters |
| T9351 |
41138-41150 |
NN |
denotes |
manipulation |
| T9352 |
41151-41153 |
IN |
denotes |
of |
| T9353 |
41154-41157 |
NN |
denotes |
BMP |
| T9354 |
41158-41167 |
NN |
denotes |
signaling |
| T9355 |
41175-41187 |
JJ |
denotes |
interdigital |
| T9356 |
41188-41197 |
NN |
denotes |
apoptosis |
| T9357 |
41198-41204 |
IN |
denotes |
during |
| T9358 |
41205-41216 |
NN |
denotes |
development |
| T9359 |
41217-41219 |
IN |
denotes |
of |
| T9360 |
41220-41223 |
DT |
denotes |
the |
| T9361 |
41224-41228 |
NN |
denotes |
limb |
| T9362 |
41228-41230 |
, |
denotes |
, |
| T9363 |
41230-41233 |
CC |
denotes |
but |
| T9364 |
41234-41236 |
DT |
denotes |
no |
| T9365 |
41237-41247 |
NN |
denotes |
experiment |
| T9366 |
41252-41262 |
VBN |
denotes |
identified |
| T9367 |
41248-41251 |
VBZ |
denotes |
has |
| T9368 |
41263-41264 |
DT |
denotes |
a |
| T9369 |
41274-41280 |
NN |
denotes |
member |
| T9370 |
41265-41273 |
JJ |
denotes |
specific |
| T9371 |
41281-41283 |
IN |
denotes |
of |
| T9372 |
41284-41287 |
DT |
denotes |
the |
| T9373 |
41302-41309 |
NN |
denotes |
pathway |
| T9374 |
41288-41291 |
NN |
denotes |
BMP |
| T9375 |
41292-41301 |
NN |
denotes |
signaling |
| T9376 |
41310-41314 |
WDT |
denotes |
that |
| T9377 |
41318-41326 |
VBN |
denotes |
required |
| T9378 |
41315-41317 |
VBZ |
denotes |
is |
| T9379 |
41327-41330 |
IN |
denotes |
for |
| T9380 |
41331-41335 |
DT |
denotes |
this |
| T9381 |
41336-41343 |
NN |
denotes |
process |
| T9382 |
41344-41345 |
-LRB- |
denotes |
( |
| T9383 |
41345-41353 |
NNP |
denotes |
Yokouchi |
| T9384 |
41354-41356 |
FW |
denotes |
et |
| T9385 |
41357-41360 |
FW |
denotes |
al. |
| T9386 |
41361-41365 |
CD |
denotes |
1996 |
| T9387 |
41365-41366 |
: |
denotes |
; |
| T9388 |
41367-41370 |
NNP |
denotes |
Zou |
| T9389 |
41371-41374 |
CC |
denotes |
and |
| T9390 |
41375-41384 |
NNP |
denotes |
Niswander |
| T9391 |
41385-41389 |
CD |
denotes |
1996 |
| T9392 |
41389-41390 |
: |
denotes |
; |
| T9393 |
41391-41394 |
NNP |
denotes |
Zou |
| T9394 |
41395-41397 |
FW |
denotes |
et |
| T9395 |
41398-41401 |
FW |
denotes |
al. |
| T9396 |
41402-41406 |
CD |
denotes |
1997 |
| T9397 |
41406-41407 |
: |
denotes |
; |
| T9398 |
41408-41412 |
NNP |
denotes |
Guha |
| T9399 |
41413-41415 |
FW |
denotes |
et |
| T9400 |
41416-41419 |
FW |
denotes |
al. |
| T9401 |
41420-41424 |
CD |
denotes |
2002 |
| T9402 |
41424-41425 |
-RRB- |
denotes |
) |
| T9403 |
41425-41426 |
. |
denotes |
. |
| T9404 |
41426-41598 |
sentence |
denotes |
Our new loss-of-function data confirm that BMP signaling is required for interdigital apoptosis and suggests that Bmpr1a is a critical component for mediating this signal. |
| T9405 |
41427-41430 |
PRP$ |
denotes |
Our |
| T9406 |
41452-41456 |
NNS |
denotes |
data |
| T9407 |
41431-41434 |
JJ |
denotes |
new |
| T9408 |
41435-41439 |
NN |
denotes |
loss |
| T9409 |
41439-41440 |
HYPH |
denotes |
- |
| T9410 |
41440-41442 |
IN |
denotes |
of |
| T9411 |
41442-41443 |
HYPH |
denotes |
- |
| T9412 |
41443-41451 |
NN |
denotes |
function |
| T9413 |
41457-41464 |
VBP |
denotes |
confirm |
| T9414 |
41465-41469 |
IN |
denotes |
that |
| T9415 |
41487-41495 |
VBN |
denotes |
required |
| T9416 |
41470-41473 |
NN |
denotes |
BMP |
| T9417 |
41474-41483 |
NN |
denotes |
signaling |
| T9418 |
41484-41486 |
VBZ |
denotes |
is |
| T9419 |
41496-41499 |
IN |
denotes |
for |
| T9420 |
41500-41512 |
JJ |
denotes |
interdigital |
| T9421 |
41513-41522 |
NN |
denotes |
apoptosis |
| T9422 |
41523-41526 |
CC |
denotes |
and |
| T9423 |
41527-41535 |
VBZ |
denotes |
suggests |
| T9424 |
41536-41540 |
IN |
denotes |
that |
| T9425 |
41548-41550 |
VBZ |
denotes |
is |
| T9426 |
41541-41547 |
NN |
denotes |
Bmpr1a |
| T9427 |
41551-41552 |
DT |
denotes |
a |
| T9428 |
41562-41571 |
NN |
denotes |
component |
| T9429 |
41553-41561 |
JJ |
denotes |
critical |
| T9430 |
41572-41575 |
IN |
denotes |
for |
| T9431 |
41576-41585 |
VBG |
denotes |
mediating |
| T9432 |
41586-41590 |
DT |
denotes |
this |
| T9433 |
41591-41597 |
NN |
denotes |
signal |
| T9434 |
41597-41598 |
. |
denotes |
. |
| T9435 |
41598-41777 |
sentence |
denotes |
At some sites, loss of Bmpr1a function leads to a defect in the early stages of joint formation, resulting in a complete failure to form a joint and fusion of bones in the ankle. |
| T9436 |
41599-41601 |
IN |
denotes |
At |
| T9437 |
41638-41643 |
VBZ |
denotes |
leads |
| T9438 |
41602-41606 |
DT |
denotes |
some |
| T9439 |
41607-41612 |
NNS |
denotes |
sites |
| T9440 |
41612-41614 |
, |
denotes |
, |
| T9441 |
41614-41618 |
NN |
denotes |
loss |
| T9442 |
41619-41621 |
IN |
denotes |
of |
| T9443 |
41622-41628 |
NN |
denotes |
Bmpr1a |
| T9444 |
41629-41637 |
NN |
denotes |
function |
| T9445 |
41644-41646 |
IN |
denotes |
to |
| T9446 |
41647-41648 |
DT |
denotes |
a |
| T9447 |
41649-41655 |
NN |
denotes |
defect |
| T9448 |
41656-41658 |
IN |
denotes |
in |
| T9449 |
41659-41662 |
DT |
denotes |
the |
| T9450 |
41669-41675 |
NNS |
denotes |
stages |
| T9451 |
41663-41668 |
JJ |
denotes |
early |
| T9452 |
41676-41678 |
IN |
denotes |
of |
| T9453 |
41679-41684 |
NN |
denotes |
joint |
| T9454 |
41685-41694 |
NN |
denotes |
formation |
| T9455 |
41694-41696 |
, |
denotes |
, |
| T9456 |
41696-41705 |
VBG |
denotes |
resulting |
| T9457 |
41706-41708 |
IN |
denotes |
in |
| T9458 |
41709-41710 |
DT |
denotes |
a |
| T9459 |
41720-41727 |
NN |
denotes |
failure |
| T9460 |
41711-41719 |
JJ |
denotes |
complete |
| T9461 |
41728-41730 |
TO |
denotes |
to |
| T9462 |
41731-41735 |
VB |
denotes |
form |
| T9463 |
41736-41737 |
DT |
denotes |
a |
| T9464 |
41738-41743 |
NN |
denotes |
joint |
| T9465 |
41744-41747 |
CC |
denotes |
and |
| T9466 |
41748-41754 |
NN |
denotes |
fusion |
| T9467 |
41755-41757 |
IN |
denotes |
of |
| T9468 |
41758-41763 |
NNS |
denotes |
bones |
| T9469 |
41764-41766 |
IN |
denotes |
in |
| T9470 |
41767-41770 |
DT |
denotes |
the |
| T9471 |
41771-41776 |
NN |
denotes |
ankle |
| T9472 |
41776-41777 |
. |
denotes |
. |
| T9473 |
41777-42071 |
sentence |
denotes |
Mutations in two different ligands in the BMP family, Gdf5 and Gdf6, the Bmpr1b receptor, and in the human Noggin locus (Storm and Kingsley 1996; Gong et al. 1999; Baur et al. 2000; Yi et al. 2000; Settle et al. 2003) also produce defects in joint formation at specific locations in the limbs. |
| T9474 |
41778-41787 |
NNS |
denotes |
Mutations |
| T9475 |
42001-42008 |
VBP |
denotes |
produce |
| T9476 |
41788-41790 |
IN |
denotes |
in |
| T9477 |
41791-41794 |
CD |
denotes |
two |
| T9478 |
41805-41812 |
NNS |
denotes |
ligands |
| T9479 |
41795-41804 |
JJ |
denotes |
different |
| T9480 |
41813-41815 |
IN |
denotes |
in |
| T9481 |
41816-41819 |
DT |
denotes |
the |
| T9482 |
41824-41830 |
NN |
denotes |
family |
| T9483 |
41820-41823 |
NN |
denotes |
BMP |
| T9484 |
41830-41832 |
, |
denotes |
, |
| T9485 |
41832-41836 |
NN |
denotes |
Gdf5 |
| T9486 |
41837-41840 |
CC |
denotes |
and |
| T9487 |
41841-41845 |
NN |
denotes |
Gdf6 |
| T9488 |
41845-41847 |
, |
denotes |
, |
| T9489 |
41847-41850 |
DT |
denotes |
the |
| T9490 |
41858-41866 |
NN |
denotes |
receptor |
| T9491 |
41851-41857 |
NN |
denotes |
Bmpr1b |
| T9492 |
41866-41868 |
, |
denotes |
, |
| T9493 |
41868-41871 |
CC |
denotes |
and |
| T9494 |
41872-41874 |
IN |
denotes |
in |
| T9495 |
41875-41878 |
DT |
denotes |
the |
| T9496 |
41892-41897 |
NN |
denotes |
locus |
| T9497 |
41879-41884 |
JJ |
denotes |
human |
| T9498 |
41885-41891 |
NN |
denotes |
Noggin |
| T9499 |
41898-41899 |
-LRB- |
denotes |
( |
| T9500 |
41899-41904 |
NNP |
denotes |
Storm |
| T9501 |
41905-41908 |
CC |
denotes |
and |
| T9502 |
41909-41917 |
NNP |
denotes |
Kingsley |
| T9503 |
41918-41922 |
CD |
denotes |
1996 |
| T9504 |
41922-41923 |
: |
denotes |
; |
| T9505 |
41924-41928 |
NNP |
denotes |
Gong |
| T9506 |
41929-41931 |
FW |
denotes |
et |
| T9507 |
41932-41935 |
FW |
denotes |
al. |
| T9508 |
41936-41940 |
CD |
denotes |
1999 |
| T9509 |
41940-41941 |
: |
denotes |
; |
| T9510 |
41942-41946 |
NNP |
denotes |
Baur |
| T9511 |
41947-41949 |
FW |
denotes |
et |
| T9512 |
41950-41953 |
FW |
denotes |
al. |
| T9513 |
41954-41958 |
CD |
denotes |
2000 |
| T9514 |
41958-41959 |
: |
denotes |
; |
| T9515 |
41960-41962 |
NNP |
denotes |
Yi |
| T9516 |
41963-41965 |
FW |
denotes |
et |
| T9517 |
41966-41969 |
FW |
denotes |
al. |
| T9518 |
41970-41974 |
CD |
denotes |
2000 |
| T9519 |
41974-41975 |
: |
denotes |
; |
| T9520 |
41976-41982 |
NNP |
denotes |
Settle |
| T9521 |
41983-41985 |
FW |
denotes |
et |
| T9522 |
41986-41989 |
FW |
denotes |
al. |
| T9523 |
41990-41994 |
CD |
denotes |
2003 |
| T9524 |
41994-41995 |
-RRB- |
denotes |
) |
| T9525 |
41996-42000 |
RB |
denotes |
also |
| T9526 |
42009-42016 |
NNS |
denotes |
defects |
| T9527 |
42017-42019 |
IN |
denotes |
in |
| T9528 |
42020-42025 |
NN |
denotes |
joint |
| T9529 |
42026-42035 |
NN |
denotes |
formation |
| T9530 |
42036-42038 |
IN |
denotes |
at |
| T9531 |
42039-42047 |
JJ |
denotes |
specific |
| T9532 |
42048-42057 |
NNS |
denotes |
locations |
| T9533 |
42058-42060 |
IN |
denotes |
in |
| T9534 |
42061-42064 |
DT |
denotes |
the |
| T9535 |
42065-42070 |
NNS |
denotes |
limbs |
| T9536 |
42070-42071 |
. |
denotes |
. |
| T9537 |
42071-42265 |
sentence |
denotes |
The joint defects associated with multiple components of the BMP pathway provide strong evidence that BMP signaling is required for early stages of joint formation at some anatomical locations. |
| T9538 |
42072-42075 |
DT |
denotes |
The |
| T9539 |
42082-42089 |
NNS |
denotes |
defects |
| T9540 |
42076-42081 |
NN |
denotes |
joint |
| T9541 |
42145-42152 |
VBP |
denotes |
provide |
| T9542 |
42090-42100 |
VBN |
denotes |
associated |
| T9543 |
42101-42105 |
IN |
denotes |
with |
| T9544 |
42106-42114 |
JJ |
denotes |
multiple |
| T9545 |
42115-42125 |
NNS |
denotes |
components |
| T9546 |
42126-42128 |
IN |
denotes |
of |
| T9547 |
42129-42132 |
DT |
denotes |
the |
| T9548 |
42137-42144 |
NN |
denotes |
pathway |
| T9549 |
42133-42136 |
NN |
denotes |
BMP |
| T9550 |
42153-42159 |
JJ |
denotes |
strong |
| T9551 |
42160-42168 |
NN |
denotes |
evidence |
| T9552 |
42169-42173 |
IN |
denotes |
that |
| T9553 |
42191-42199 |
VBN |
denotes |
required |
| T9554 |
42174-42177 |
NN |
denotes |
BMP |
| T9555 |
42178-42187 |
NN |
denotes |
signaling |
| T9556 |
42188-42190 |
VBZ |
denotes |
is |
| T9557 |
42200-42203 |
IN |
denotes |
for |
| T9558 |
42204-42209 |
JJ |
denotes |
early |
| T9559 |
42210-42216 |
NNS |
denotes |
stages |
| T9560 |
42217-42219 |
IN |
denotes |
of |
| T9561 |
42220-42225 |
NN |
denotes |
joint |
| T9562 |
42226-42235 |
NN |
denotes |
formation |
| T9563 |
42236-42238 |
IN |
denotes |
at |
| T9564 |
42239-42243 |
DT |
denotes |
some |
| T9565 |
42255-42264 |
NNS |
denotes |
locations |
| T9566 |
42244-42254 |
JJ |
denotes |
anatomical |
| T9567 |
42264-42265 |
. |
denotes |
. |
| T9568 |
42265-42352 |
sentence |
denotes |
Most joints still form normally when Bmpr1a is knocked out in Gdf5 expression domains. |
| T9569 |
42266-42270 |
JJS |
denotes |
Most |
| T9570 |
42271-42277 |
NNS |
denotes |
joints |
| T9571 |
42284-42288 |
VBP |
denotes |
form |
| T9572 |
42278-42283 |
RB |
denotes |
still |
| T9573 |
42289-42297 |
RB |
denotes |
normally |
| T9574 |
42298-42302 |
WRB |
denotes |
when |
| T9575 |
42313-42320 |
VBN |
denotes |
knocked |
| T9576 |
42303-42309 |
NN |
denotes |
Bmpr1a |
| T9577 |
42310-42312 |
VBZ |
denotes |
is |
| T9578 |
42321-42324 |
RP |
denotes |
out |
| T9579 |
42325-42327 |
IN |
denotes |
in |
| T9580 |
42328-42332 |
NN |
denotes |
Gdf5 |
| T9581 |
42344-42351 |
NNS |
denotes |
domains |
| T9582 |
42333-42343 |
NN |
denotes |
expression |
| T9583 |
42351-42352 |
. |
denotes |
. |
| T9584 |
42352-42672 |
sentence |
denotes |
The lack of joint fusions outside the ankle region could be due to differences in requirement for BMP signaling in different joints, to compensating expression of other BMP receptors outside the ankles, or to differences in the detailed timing of Gdf5-Cre stimulated gene inactivation in ankles and other joint regions. |
| T9585 |
42353-42356 |
DT |
denotes |
The |
| T9586 |
42357-42361 |
NN |
denotes |
lack |
| T9587 |
42410-42412 |
VB |
denotes |
be |
| T9588 |
42362-42364 |
IN |
denotes |
of |
| T9589 |
42365-42370 |
NN |
denotes |
joint |
| T9590 |
42371-42378 |
NNS |
denotes |
fusions |
| T9591 |
42379-42386 |
IN |
denotes |
outside |
| T9592 |
42387-42390 |
DT |
denotes |
the |
| T9593 |
42397-42403 |
NN |
denotes |
region |
| T9594 |
42391-42396 |
NN |
denotes |
ankle |
| T9595 |
42404-42409 |
MD |
denotes |
could |
| T9596 |
42413-42416 |
IN |
denotes |
due |
| T9597 |
42417-42419 |
IN |
denotes |
to |
| T9598 |
42420-42431 |
NNS |
denotes |
differences |
| T9599 |
42432-42434 |
IN |
denotes |
in |
| T9600 |
42435-42446 |
NN |
denotes |
requirement |
| T9601 |
42447-42450 |
IN |
denotes |
for |
| T9602 |
42451-42454 |
NN |
denotes |
BMP |
| T9603 |
42455-42464 |
NN |
denotes |
signaling |
| T9604 |
42465-42467 |
IN |
denotes |
in |
| T9605 |
42468-42477 |
JJ |
denotes |
different |
| T9606 |
42478-42484 |
NNS |
denotes |
joints |
| T9607 |
42484-42486 |
, |
denotes |
, |
| T9608 |
42486-42488 |
IN |
denotes |
to |
| T9609 |
42489-42501 |
VBG |
denotes |
compensating |
| T9610 |
42502-42512 |
NN |
denotes |
expression |
| T9611 |
42513-42515 |
IN |
denotes |
of |
| T9612 |
42516-42521 |
JJ |
denotes |
other |
| T9613 |
42526-42535 |
NNS |
denotes |
receptors |
| T9614 |
42522-42525 |
NN |
denotes |
BMP |
| T9615 |
42536-42543 |
IN |
denotes |
outside |
| T9616 |
42544-42547 |
DT |
denotes |
the |
| T9617 |
42548-42554 |
NNS |
denotes |
ankles |
| T9618 |
42554-42556 |
, |
denotes |
, |
| T9619 |
42556-42558 |
CC |
denotes |
or |
| T9620 |
42559-42561 |
IN |
denotes |
to |
| T9621 |
42562-42573 |
NNS |
denotes |
differences |
| T9622 |
42574-42576 |
IN |
denotes |
in |
| T9623 |
42577-42580 |
DT |
denotes |
the |
| T9624 |
42590-42596 |
NN |
denotes |
timing |
| T9625 |
42581-42589 |
VBN |
denotes |
detailed |
| T9626 |
42597-42599 |
IN |
denotes |
of |
| T9627 |
42600-42604 |
NN |
denotes |
Gdf5 |
| T9628 |
42605-42608 |
NN |
denotes |
Cre |
| T9629 |
42604-42605 |
HYPH |
denotes |
- |
| T9630 |
42609-42619 |
VBN |
denotes |
stimulated |
| T9631 |
42625-42637 |
NN |
denotes |
inactivation |
| T9632 |
42620-42624 |
NN |
denotes |
gene |
| T9633 |
42638-42640 |
IN |
denotes |
in |
| T9634 |
42641-42647 |
NNS |
denotes |
ankles |
| T9635 |
42648-42651 |
CC |
denotes |
and |
| T9636 |
42652-42657 |
JJ |
denotes |
other |
| T9637 |
42664-42671 |
NNS |
denotes |
regions |
| T9638 |
42658-42663 |
NN |
denotes |
joint |
| T9639 |
42671-42672 |
. |
denotes |
. |
| T9640 |
42672-42966 |
sentence |
denotes |
Comparison of the expression of the HPLAP marker (driven directly by Gdf5 control elements) and the R26R LACZ marker (expressed following Gdf5-Cre recombination) suggests that recombination-stimulated changes in gene expression may be delayed for a 0.5–1 d in the digit region (see Figure 1C). |
| T9641 |
42673-42683 |
NN |
denotes |
Comparison |
| T9642 |
42835-42843 |
VBZ |
denotes |
suggests |
| T9643 |
42684-42686 |
IN |
denotes |
of |
| T9644 |
42687-42690 |
DT |
denotes |
the |
| T9645 |
42691-42701 |
NN |
denotes |
expression |
| T9646 |
42702-42704 |
IN |
denotes |
of |
| T9647 |
42705-42708 |
DT |
denotes |
the |
| T9648 |
42715-42721 |
NN |
denotes |
marker |
| T9649 |
42709-42714 |
NN |
denotes |
HPLAP |
| T9650 |
42722-42723 |
-LRB- |
denotes |
( |
| T9651 |
42723-42729 |
VBN |
denotes |
driven |
| T9652 |
42730-42738 |
RB |
denotes |
directly |
| T9653 |
42739-42741 |
IN |
denotes |
by |
| T9654 |
42742-42746 |
NN |
denotes |
Gdf5 |
| T9655 |
42755-42763 |
NNS |
denotes |
elements |
| T9656 |
42747-42754 |
NN |
denotes |
control |
| T9657 |
42763-42764 |
-RRB- |
denotes |
) |
| T9658 |
42765-42768 |
CC |
denotes |
and |
| T9659 |
42769-42772 |
DT |
denotes |
the |
| T9660 |
42783-42789 |
NN |
denotes |
marker |
| T9661 |
42773-42777 |
NN |
denotes |
R26R |
| T9662 |
42778-42782 |
NN |
denotes |
LACZ |
| T9663 |
42790-42791 |
-LRB- |
denotes |
( |
| T9664 |
42791-42800 |
VBN |
denotes |
expressed |
| T9665 |
42801-42810 |
VBG |
denotes |
following |
| T9666 |
42811-42815 |
NN |
denotes |
Gdf5 |
| T9667 |
42816-42819 |
NN |
denotes |
Cre |
| T9668 |
42815-42816 |
HYPH |
denotes |
- |
| T9669 |
42820-42833 |
NN |
denotes |
recombination |
| T9670 |
42833-42834 |
-RRB- |
denotes |
) |
| T9674 |
42863-42873 |
VBN |
denotes |
stimulated |
| T9675 |
42862-42863 |
HYPH |
denotes |
- |
| T9676 |
42874-42881 |
NNS |
denotes |
changes |
| T9677 |
42882-42884 |
IN |
denotes |
in |
| T9678 |
42885-42889 |
NN |
denotes |
gene |
| T9679 |
42890-42900 |
NN |
denotes |
expression |
| T9680 |
42901-42904 |
MD |
denotes |
may |
| T9681 |
42905-42907 |
VB |
denotes |
be |
| T9682 |
42916-42919 |
IN |
denotes |
for |
| T9683 |
42920-42921 |
DT |
denotes |
a |
| T9684 |
42928-42929 |
NN |
denotes |
d |
| T9685 |
42922-42925 |
CD |
denotes |
0.5 |
| T9686 |
42926-42927 |
CD |
denotes |
1 |
| T9687 |
42925-42926 |
SYM |
denotes |
– |
| T9688 |
42930-42932 |
IN |
denotes |
in |
| T9689 |
42933-42936 |
DT |
denotes |
the |
| T9690 |
42943-42949 |
NN |
denotes |
region |
| T9691 |
42937-42942 |
NN |
denotes |
digit |
| T9692 |
42950-42951 |
-LRB- |
denotes |
( |
| T9693 |
42951-42954 |
VB |
denotes |
see |
| T9694 |
42955-42961 |
NN |
denotes |
Figure |
| T9695 |
42962-42964 |
CD |
denotes |
1C |
| T9696 |
42964-42965 |
-RRB- |
denotes |
) |
| T9697 |
42965-42966 |
. |
denotes |
. |
| T9698 |
42966-43183 |
sentence |
denotes |
In addition, levels of Bmpr1a mRNA and protein may persist for some time following Gdf5-Cre stimulated recombination, making it possible to bypass an early requirement for Bmpr1a in joint formation at some locations. |
| T9699 |
42967-42969 |
IN |
denotes |
In |
| T9700 |
43018-43025 |
VB |
denotes |
persist |
| T9701 |
42970-42978 |
NN |
denotes |
addition |
| T9702 |
42978-42980 |
, |
denotes |
, |
| T9703 |
42980-42986 |
NNS |
denotes |
levels |
| T9704 |
42987-42989 |
IN |
denotes |
of |
| T9705 |
42990-42996 |
NN |
denotes |
Bmpr1a |
| T9706 |
42997-43001 |
NN |
denotes |
mRNA |
| T9707 |
43002-43005 |
CC |
denotes |
and |
| T9708 |
43006-43013 |
NN |
denotes |
protein |
| T9709 |
43014-43017 |
MD |
denotes |
may |
| T9710 |
43026-43029 |
IN |
denotes |
for |
| T9711 |
43030-43034 |
DT |
denotes |
some |
| T9712 |
43035-43039 |
NN |
denotes |
time |
| T9713 |
43040-43049 |
VBG |
denotes |
following |
| T9714 |
43050-43054 |
NN |
denotes |
Gdf5 |
| T9715 |
43055-43058 |
NN |
denotes |
Cre |
| T9716 |
43054-43055 |
HYPH |
denotes |
- |
| T9717 |
43059-43069 |
VBN |
denotes |
stimulated |
| T9718 |
43070-43083 |
NN |
denotes |
recombination |
| T9719 |
43083-43085 |
, |
denotes |
, |
| T9720 |
43085-43091 |
VBG |
denotes |
making |
| T9721 |
43092-43094 |
PRP |
denotes |
it |
| T9722 |
43095-43103 |
JJ |
denotes |
possible |
| T9723 |
43104-43106 |
TO |
denotes |
to |
| T9724 |
43107-43113 |
VB |
denotes |
bypass |
| T9725 |
43114-43116 |
DT |
denotes |
an |
| T9726 |
43123-43134 |
NN |
denotes |
requirement |
| T9727 |
43117-43122 |
JJ |
denotes |
early |
| T9728 |
43135-43138 |
IN |
denotes |
for |
| T9729 |
43139-43145 |
NN |
denotes |
Bmpr1a |
| T9730 |
43146-43148 |
IN |
denotes |
in |
| T9731 |
43149-43154 |
NN |
denotes |
joint |
| T9732 |
43155-43164 |
NN |
denotes |
formation |
| T9733 |
43165-43167 |
IN |
denotes |
at |
| T9734 |
43168-43172 |
DT |
denotes |
some |
| T9735 |
43173-43182 |
NNS |
denotes |
locations |
| T9736 |
43182-43183 |
. |
denotes |
. |
| T9737 |
43183-43333 |
sentence |
denotes |
Following the decay of Bmpr1a mRNA and protein, the Gdf5-Cre strategy should result in permanent inactivation of Bmpr1a function in recombined cells. |
| T9738 |
43184-43193 |
VBG |
denotes |
Following |
| T9739 |
43261-43267 |
VB |
denotes |
result |
| T9740 |
43194-43197 |
DT |
denotes |
the |
| T9741 |
43198-43203 |
NN |
denotes |
decay |
| T9742 |
43204-43206 |
IN |
denotes |
of |
| T9743 |
43207-43213 |
NN |
denotes |
Bmpr1a |
| T9744 |
43214-43218 |
NN |
denotes |
mRNA |
| T9745 |
43219-43222 |
CC |
denotes |
and |
| T9746 |
43223-43230 |
NN |
denotes |
protein |
| T9747 |
43230-43232 |
, |
denotes |
, |
| T9748 |
43232-43235 |
DT |
denotes |
the |
| T9749 |
43245-43253 |
NN |
denotes |
strategy |
| T9750 |
43236-43240 |
NN |
denotes |
Gdf5 |
| T9751 |
43241-43244 |
NN |
denotes |
Cre |
| T9752 |
43240-43241 |
HYPH |
denotes |
- |
| T9753 |
43254-43260 |
MD |
denotes |
should |
| T9754 |
43268-43270 |
IN |
denotes |
in |
| T9755 |
43271-43280 |
JJ |
denotes |
permanent |
| T9756 |
43281-43293 |
NN |
denotes |
inactivation |
| T9757 |
43294-43296 |
IN |
denotes |
of |
| T9758 |
43297-43303 |
NN |
denotes |
Bmpr1a |
| T9759 |
43304-43312 |
NN |
denotes |
function |
| T9760 |
43313-43315 |
IN |
denotes |
in |
| T9761 |
43316-43326 |
VBN |
denotes |
recombined |
| T9762 |
43327-43332 |
NNS |
denotes |
cells |
| T9763 |
43332-43333 |
. |
denotes |
. |
| T9764 |
43333-43454 |
sentence |
denotes |
This system thus provides one of the first strong genetic tests of Bmpr1a function at later stages of joint development. |
| T9765 |
43334-43338 |
DT |
denotes |
This |
| T9766 |
43339-43345 |
NN |
denotes |
system |
| T9767 |
43351-43359 |
VBZ |
denotes |
provides |
| T9768 |
43346-43350 |
RB |
denotes |
thus |
| T9769 |
43360-43363 |
CD |
denotes |
one |
| T9770 |
43364-43366 |
IN |
denotes |
of |
| T9771 |
43367-43370 |
DT |
denotes |
the |
| T9772 |
43392-43397 |
NNS |
denotes |
tests |
| T9773 |
43371-43376 |
JJ |
denotes |
first |
| T9774 |
43377-43383 |
JJ |
denotes |
strong |
| T9775 |
43384-43391 |
JJ |
denotes |
genetic |
| T9776 |
43398-43400 |
IN |
denotes |
of |
| T9777 |
43401-43407 |
NN |
denotes |
Bmpr1a |
| T9778 |
43408-43416 |
NN |
denotes |
function |
| T9779 |
43417-43419 |
IN |
denotes |
at |
| T9780 |
43420-43425 |
JJ |
denotes |
later |
| T9781 |
43426-43432 |
NNS |
denotes |
stages |
| T9782 |
43433-43435 |
IN |
denotes |
of |
| T9783 |
43436-43441 |
NN |
denotes |
joint |
| T9784 |
43442-43453 |
NN |
denotes |
development |
| T9785 |
43453-43454 |
. |
denotes |
. |
| T9786 |
43454-43690 |
sentence |
denotes |
Despite the normal appearance of articular regions and gene expression immediately after birth, Bmpr1a-deficient animals are unable to maintain the normal differentiated state of articular cartilage as they continue to develop and age. |
| T9787 |
43455-43462 |
IN |
denotes |
Despite |
| T9788 |
43576-43579 |
VBP |
denotes |
are |
| T9789 |
43463-43466 |
DT |
denotes |
the |
| T9790 |
43474-43484 |
NN |
denotes |
appearance |
| T9791 |
43467-43473 |
JJ |
denotes |
normal |
| T9792 |
43485-43487 |
IN |
denotes |
of |
| T9793 |
43488-43497 |
JJ |
denotes |
articular |
| T9794 |
43498-43505 |
NNS |
denotes |
regions |
| T9795 |
43506-43509 |
CC |
denotes |
and |
| T9796 |
43510-43514 |
NN |
denotes |
gene |
| T9797 |
43515-43525 |
NN |
denotes |
expression |
| T9798 |
43526-43537 |
RB |
denotes |
immediately |
| T9799 |
43538-43543 |
IN |
denotes |
after |
| T9800 |
43544-43549 |
NN |
denotes |
birth |
| T9801 |
43549-43551 |
, |
denotes |
, |
| T9802 |
43551-43557 |
NN |
denotes |
Bmpr1a |
| T9803 |
43558-43567 |
JJ |
denotes |
deficient |
| T9804 |
43557-43558 |
HYPH |
denotes |
- |
| T9805 |
43568-43575 |
NNS |
denotes |
animals |
| T9806 |
43580-43586 |
JJ |
denotes |
unable |
| T9807 |
43587-43589 |
TO |
denotes |
to |
| T9808 |
43590-43598 |
VB |
denotes |
maintain |
| T9809 |
43599-43602 |
DT |
denotes |
the |
| T9810 |
43625-43630 |
NN |
denotes |
state |
| T9811 |
43603-43609 |
JJ |
denotes |
normal |
| T9812 |
43610-43624 |
VBN |
denotes |
differentiated |
| T9813 |
43631-43633 |
IN |
denotes |
of |
| T9814 |
43634-43643 |
JJ |
denotes |
articular |
| T9815 |
43644-43653 |
NN |
denotes |
cartilage |
| T9816 |
43654-43656 |
IN |
denotes |
as |
| T9817 |
43662-43670 |
VBP |
denotes |
continue |
| T9818 |
43657-43661 |
PRP |
denotes |
they |
| T9819 |
43671-43673 |
TO |
denotes |
to |
| T9820 |
43674-43681 |
VB |
denotes |
develop |
| T9821 |
43682-43685 |
CC |
denotes |
and |
| T9822 |
43686-43689 |
VB |
denotes |
age |
| T9823 |
43689-43690 |
. |
denotes |
. |
| T9824 |
43690-43836 |
sentence |
denotes |
These results suggest that BMP receptor signaling is essential for continued health and integrity of articular cartilage in the postnatal period. |
| T9825 |
43691-43696 |
DT |
denotes |
These |
| T9826 |
43697-43704 |
NNS |
denotes |
results |
| T9827 |
43705-43712 |
VBP |
denotes |
suggest |
| T9828 |
43713-43717 |
IN |
denotes |
that |
| T9829 |
43741-43743 |
VBZ |
denotes |
is |
| T9830 |
43718-43721 |
NN |
denotes |
BMP |
| T9831 |
43722-43730 |
NN |
denotes |
receptor |
| T9832 |
43731-43740 |
NN |
denotes |
signaling |
| T9833 |
43744-43753 |
JJ |
denotes |
essential |
| T9834 |
43754-43757 |
IN |
denotes |
for |
| T9835 |
43758-43767 |
VBN |
denotes |
continued |
| T9836 |
43768-43774 |
NN |
denotes |
health |
| T9837 |
43775-43778 |
CC |
denotes |
and |
| T9838 |
43779-43788 |
NN |
denotes |
integrity |
| T9839 |
43789-43791 |
IN |
denotes |
of |
| T9840 |
43792-43801 |
JJ |
denotes |
articular |
| T9841 |
43802-43811 |
NN |
denotes |
cartilage |
| T9842 |
43812-43814 |
IN |
denotes |
in |
| T9843 |
43815-43818 |
DT |
denotes |
the |
| T9844 |
43829-43835 |
NN |
denotes |
period |
| T9845 |
43819-43828 |
JJ |
denotes |
postnatal |
| T9846 |
43835-43836 |
. |
denotes |
. |
| T9847 |
43836-43986 |
sentence |
denotes |
Articular cartilage is a key component of synovial joints and is one of the few regions in the skeleton where cartilage is maintained into adulthood. |
| T9848 |
43837-43846 |
JJ |
denotes |
Articular |
| T9849 |
43847-43856 |
NN |
denotes |
cartilage |
| T9850 |
43857-43859 |
VBZ |
denotes |
is |
| T9851 |
43860-43861 |
DT |
denotes |
a |
| T9852 |
43866-43875 |
NN |
denotes |
component |
| T9853 |
43862-43865 |
JJ |
denotes |
key |
| T9854 |
43876-43878 |
IN |
denotes |
of |
| T9855 |
43879-43887 |
JJ |
denotes |
synovial |
| T9856 |
43888-43894 |
NNS |
denotes |
joints |
| T9857 |
43895-43898 |
CC |
denotes |
and |
| T9858 |
43899-43901 |
VBZ |
denotes |
is |
| T9859 |
43902-43905 |
CD |
denotes |
one |
| T9860 |
43906-43908 |
IN |
denotes |
of |
| T9861 |
43909-43912 |
DT |
denotes |
the |
| T9862 |
43917-43924 |
NNS |
denotes |
regions |
| T9863 |
43913-43916 |
JJ |
denotes |
few |
| T9864 |
43925-43927 |
IN |
denotes |
in |
| T9865 |
43928-43931 |
DT |
denotes |
the |
| T9866 |
43932-43940 |
NN |
denotes |
skeleton |
| T9867 |
43941-43946 |
WRB |
denotes |
where |
| T9868 |
43960-43970 |
VBN |
denotes |
maintained |
| T9869 |
43947-43956 |
NN |
denotes |
cartilage |
| T9870 |
43957-43959 |
VBZ |
denotes |
is |
| T9871 |
43971-43975 |
IN |
denotes |
into |
| T9872 |
43976-43985 |
NN |
denotes |
adulthood |
| T9873 |
43985-43986 |
. |
denotes |
. |
| T9874 |
43986-44166 |
sentence |
denotes |
Despite the importance of articular cartilage in joint health and mobility, little is known about the factors that create and maintain it in thin layers at the ends of long bones. |
| T9875 |
43987-43994 |
IN |
denotes |
Despite |
| T9876 |
44073-44078 |
VBN |
denotes |
known |
| T9877 |
43995-43998 |
DT |
denotes |
the |
| T9878 |
43999-44009 |
NN |
denotes |
importance |
| T9879 |
44010-44012 |
IN |
denotes |
of |
| T9880 |
44013-44022 |
JJ |
denotes |
articular |
| T9881 |
44023-44032 |
NN |
denotes |
cartilage |
| T9882 |
44033-44035 |
IN |
denotes |
in |
| T9883 |
44036-44041 |
NN |
denotes |
joint |
| T9884 |
44042-44048 |
NN |
denotes |
health |
| T9885 |
44049-44052 |
CC |
denotes |
and |
| T9886 |
44053-44061 |
NN |
denotes |
mobility |
| T9887 |
44061-44063 |
, |
denotes |
, |
| T9888 |
44063-44069 |
JJ |
denotes |
little |
| T9889 |
44070-44072 |
VBZ |
denotes |
is |
| T9890 |
44079-44084 |
IN |
denotes |
about |
| T9891 |
44085-44088 |
DT |
denotes |
the |
| T9892 |
44089-44096 |
NNS |
denotes |
factors |
| T9893 |
44097-44101 |
WDT |
denotes |
that |
| T9894 |
44102-44108 |
VBP |
denotes |
create |
| T9895 |
44109-44112 |
CC |
denotes |
and |
| T9896 |
44113-44121 |
VBP |
denotes |
maintain |
| T9897 |
44122-44124 |
PRP |
denotes |
it |
| T9898 |
44125-44127 |
IN |
denotes |
in |
| T9899 |
44128-44132 |
JJ |
denotes |
thin |
| T9900 |
44133-44139 |
NNS |
denotes |
layers |
| T9901 |
44140-44142 |
IN |
denotes |
at |
| T9902 |
44143-44146 |
DT |
denotes |
the |
| T9903 |
44147-44151 |
NNS |
denotes |
ends |
| T9904 |
44152-44154 |
IN |
denotes |
of |
| T9905 |
44155-44159 |
JJ |
denotes |
long |
| T9906 |
44160-44165 |
NNS |
denotes |
bones |
| T9907 |
44165-44166 |
. |
denotes |
. |
| T9908 |
44166-44463 |
sentence |
denotes |
In our experiments, articular cartilage lacking Bmpr1a retains some normal characteristics, in that it maintains a very low proliferation rate, does not express Col1a1, and continues to express SOX9, a major transcription factor regulating expression of structural components of cartilage matrix. |
| T9909 |
44167-44169 |
IN |
denotes |
In |
| T9910 |
44222-44229 |
VBZ |
denotes |
retains |
| T9911 |
44170-44173 |
PRP$ |
denotes |
our |
| T9912 |
44174-44185 |
NNS |
denotes |
experiments |
| T9913 |
44185-44187 |
, |
denotes |
, |
| T9914 |
44187-44196 |
JJ |
denotes |
articular |
| T9915 |
44197-44206 |
NN |
denotes |
cartilage |
| T9916 |
44207-44214 |
VBG |
denotes |
lacking |
| T9917 |
44215-44221 |
NN |
denotes |
Bmpr1a |
| T9918 |
44230-44234 |
DT |
denotes |
some |
| T9919 |
44242-44257 |
NNS |
denotes |
characteristics |
| T9920 |
44235-44241 |
JJ |
denotes |
normal |
| T9921 |
44257-44259 |
, |
denotes |
, |
| T9922 |
44259-44261 |
IN |
denotes |
in |
| T9923 |
44270-44279 |
VBZ |
denotes |
maintains |
| T9924 |
44262-44266 |
IN |
denotes |
that |
| T9925 |
44267-44269 |
PRP |
denotes |
it |
| T9926 |
44280-44281 |
DT |
denotes |
a |
| T9927 |
44305-44309 |
NN |
denotes |
rate |
| T9928 |
44282-44286 |
RB |
denotes |
very |
| T9929 |
44287-44290 |
JJ |
denotes |
low |
| T9930 |
44291-44304 |
NN |
denotes |
proliferation |
| T9931 |
44309-44311 |
, |
denotes |
, |
| T9932 |
44311-44315 |
VBZ |
denotes |
does |
| T9933 |
44320-44327 |
VB |
denotes |
express |
| T9934 |
44316-44319 |
RB |
denotes |
not |
| T9935 |
44328-44334 |
NN |
denotes |
Col1a1 |
| T9936 |
44334-44336 |
, |
denotes |
, |
| T9937 |
44336-44339 |
CC |
denotes |
and |
| T9938 |
44340-44349 |
VBZ |
denotes |
continues |
| T9939 |
44350-44352 |
TO |
denotes |
to |
| T9940 |
44353-44360 |
VB |
denotes |
express |
| T9941 |
44361-44365 |
NN |
denotes |
SOX9 |
| T9942 |
44365-44367 |
, |
denotes |
, |
| T9943 |
44367-44368 |
DT |
denotes |
a |
| T9944 |
44389-44395 |
NN |
denotes |
factor |
| T9945 |
44369-44374 |
JJ |
denotes |
major |
| T9946 |
44375-44388 |
NN |
denotes |
transcription |
| T9947 |
44396-44406 |
VBG |
denotes |
regulating |
| T9948 |
44407-44417 |
NN |
denotes |
expression |
| T9949 |
44418-44420 |
IN |
denotes |
of |
| T9950 |
44421-44431 |
JJ |
denotes |
structural |
| T9951 |
44432-44442 |
NNS |
denotes |
components |
| T9952 |
44443-44445 |
IN |
denotes |
of |
| T9953 |
44446-44455 |
NN |
denotes |
cartilage |
| T9954 |
44456-44462 |
NN |
denotes |
matrix |
| T9955 |
44462-44463 |
. |
denotes |
. |
| T9956 |
44463-44653 |
sentence |
denotes |
However, several of the most prominent structural components of cartilage matrix fail to be maintained in mutant animals, resulting in decreased synthesis of Col2a1, Agg, and proteoglycans. |
| T9957 |
44464-44471 |
RB |
denotes |
However |
| T9958 |
44545-44549 |
VBP |
denotes |
fail |
| T9959 |
44471-44473 |
, |
denotes |
, |
| T9960 |
44473-44480 |
JJ |
denotes |
several |
| T9961 |
44481-44483 |
IN |
denotes |
of |
| T9962 |
44484-44487 |
DT |
denotes |
the |
| T9963 |
44514-44524 |
NNS |
denotes |
components |
| T9964 |
44488-44492 |
RBS |
denotes |
most |
| T9965 |
44493-44502 |
JJ |
denotes |
prominent |
| T9966 |
44503-44513 |
JJ |
denotes |
structural |
| T9967 |
44525-44527 |
IN |
denotes |
of |
| T9968 |
44528-44537 |
NN |
denotes |
cartilage |
| T9969 |
44538-44544 |
NN |
denotes |
matrix |
| T9970 |
44550-44552 |
TO |
denotes |
to |
| T9971 |
44556-44566 |
VBN |
denotes |
maintained |
| T9972 |
44553-44555 |
VB |
denotes |
be |
| T9973 |
44567-44569 |
IN |
denotes |
in |
| T9974 |
44570-44576 |
NN |
denotes |
mutant |
| T9975 |
44577-44584 |
NNS |
denotes |
animals |
| T9976 |
44584-44586 |
, |
denotes |
, |
| T9977 |
44586-44595 |
VBG |
denotes |
resulting |
| T9978 |
44596-44598 |
IN |
denotes |
in |
| T9979 |
44599-44608 |
VBN |
denotes |
decreased |
| T9980 |
44609-44618 |
NN |
denotes |
synthesis |
| T9981 |
44619-44621 |
IN |
denotes |
of |
| T9982 |
44622-44628 |
NN |
denotes |
Col2a1 |
| T9983 |
44628-44630 |
, |
denotes |
, |
| T9984 |
44630-44633 |
NN |
denotes |
Agg |
| T9985 |
44633-44635 |
, |
denotes |
, |
| T9986 |
44635-44638 |
CC |
denotes |
and |
| T9987 |
44639-44652 |
NNS |
denotes |
proteoglycans |
| T9988 |
44652-44653 |
. |
denotes |
. |
| T9989 |
44653-44772 |
sentence |
denotes |
Therefore, BMPR1A appears to maintain articular cartilage primarily through inducing expression of key ECM components. |
| T9990 |
44654-44663 |
RB |
denotes |
Therefore |
| T9991 |
44672-44679 |
VBZ |
denotes |
appears |
| T9992 |
44663-44665 |
, |
denotes |
, |
| T9993 |
44665-44671 |
NN |
denotes |
BMPR1A |
| T9994 |
44680-44682 |
TO |
denotes |
to |
| T9995 |
44683-44691 |
VB |
denotes |
maintain |
| T9996 |
44692-44701 |
JJ |
denotes |
articular |
| T9997 |
44702-44711 |
NN |
denotes |
cartilage |
| T9998 |
44712-44721 |
RB |
denotes |
primarily |
| T9999 |
44722-44729 |
IN |
denotes |
through |
| T10000 |
44730-44738 |
VBG |
denotes |
inducing |
| T10001 |
44739-44749 |
NN |
denotes |
expression |
| T10002 |
44750-44752 |
IN |
denotes |
of |
| T10003 |
44753-44756 |
JJ |
denotes |
key |
| T10004 |
44761-44771 |
NNS |
denotes |
components |
| T10005 |
44757-44760 |
NN |
denotes |
ECM |
| T10006 |
44771-44772 |
. |
denotes |
. |
| T10007 |
44772-44982 |
sentence |
denotes |
It is interesting that the SOX9 transcription factor continues to be expressed in mutant cartilage despite loss of Col2a1, a direct target of this transcription factor (Bell et al. 1997; Lefebvre et al. 1997). |
| T10008 |
44773-44775 |
PRP |
denotes |
It |
| T10009 |
44776-44778 |
VBZ |
denotes |
is |
| T10010 |
44779-44790 |
JJ |
denotes |
interesting |
| T10011 |
44791-44795 |
IN |
denotes |
that |
| T10012 |
44826-44835 |
VBZ |
denotes |
continues |
| T10013 |
44796-44799 |
DT |
denotes |
the |
| T10014 |
44819-44825 |
NN |
denotes |
factor |
| T10015 |
44800-44804 |
NN |
denotes |
SOX9 |
| T10016 |
44805-44818 |
NN |
denotes |
transcription |
| T10017 |
44836-44838 |
TO |
denotes |
to |
| T10018 |
44842-44851 |
VBN |
denotes |
expressed |
| T10019 |
44839-44841 |
VB |
denotes |
be |
| T10020 |
44852-44854 |
IN |
denotes |
in |
| T10021 |
44855-44861 |
NN |
denotes |
mutant |
| T10022 |
44862-44871 |
NN |
denotes |
cartilage |
| T10023 |
44872-44879 |
IN |
denotes |
despite |
| T10024 |
44880-44884 |
NN |
denotes |
loss |
| T10025 |
44885-44887 |
IN |
denotes |
of |
| T10026 |
44888-44894 |
NN |
denotes |
Col2a1 |
| T10027 |
44894-44896 |
, |
denotes |
, |
| T10028 |
44896-44897 |
DT |
denotes |
a |
| T10029 |
44905-44911 |
NN |
denotes |
target |
| T10030 |
44898-44904 |
JJ |
denotes |
direct |
| T10031 |
44912-44914 |
IN |
denotes |
of |
| T10032 |
44915-44919 |
DT |
denotes |
this |
| T10033 |
44934-44940 |
NN |
denotes |
factor |
| T10034 |
44920-44933 |
NN |
denotes |
transcription |
| T10035 |
44941-44942 |
-LRB- |
denotes |
( |
| T10036 |
44942-44946 |
NNP |
denotes |
Bell |
| T10037 |
44947-44949 |
FW |
denotes |
et |
| T10038 |
44950-44953 |
FW |
denotes |
al. |
| T10039 |
44954-44958 |
CD |
denotes |
1997 |
| T10040 |
44958-44959 |
: |
denotes |
; |
| T10041 |
44960-44968 |
NNP |
denotes |
Lefebvre |
| T10042 |
44969-44971 |
FW |
denotes |
et |
| T10043 |
44972-44975 |
FW |
denotes |
al. |
| T10044 |
44976-44980 |
CD |
denotes |
1997 |
| T10045 |
44980-44981 |
-RRB- |
denotes |
) |
| T10046 |
44981-44982 |
. |
denotes |
. |
| T10047 |
44982-45206 |
sentence |
denotes |
Previous studies suggest that SOX9 activity can be modified by protein kinase A (PKA)-dependent protein phosphorylation, or by coexpression of two related proteins, L-SOX5 and SOX6 (Lefebvre et al. 1998; Huang et al. 2000). |
| T10048 |
44983-44991 |
JJ |
denotes |
Previous |
| T10049 |
44992-44999 |
NNS |
denotes |
studies |
| T10050 |
45000-45007 |
VBP |
denotes |
suggest |
| T10051 |
45008-45012 |
IN |
denotes |
that |
| T10052 |
45034-45042 |
VBN |
denotes |
modified |
| T10053 |
45013-45017 |
NN |
denotes |
SOX9 |
| T10054 |
45018-45026 |
NN |
denotes |
activity |
| T10055 |
45027-45030 |
MD |
denotes |
can |
| T10056 |
45031-45033 |
VB |
denotes |
be |
| T10057 |
45043-45045 |
IN |
denotes |
by |
| T10058 |
45046-45053 |
NN |
denotes |
protein |
| T10059 |
45061-45062 |
NN |
denotes |
A |
| T10060 |
45054-45060 |
NN |
denotes |
kinase |
| T10061 |
45069-45078 |
JJ |
denotes |
dependent |
| T10062 |
45063-45064 |
-LRB- |
denotes |
( |
| T10063 |
45064-45067 |
NN |
denotes |
PKA |
| T10064 |
45067-45068 |
-RRB- |
denotes |
) |
| T10065 |
45068-45069 |
HYPH |
denotes |
- |
| T10066 |
45087-45102 |
NN |
denotes |
phosphorylation |
| T10067 |
45079-45086 |
NN |
denotes |
protein |
| T10068 |
45102-45104 |
, |
denotes |
, |
| T10069 |
45104-45106 |
CC |
denotes |
or |
| T10070 |
45107-45109 |
IN |
denotes |
by |
| T10071 |
45110-45122 |
NN |
denotes |
coexpression |
| T10072 |
45123-45125 |
IN |
denotes |
of |
| T10073 |
45126-45129 |
CD |
denotes |
two |
| T10074 |
45138-45146 |
NN |
denotes |
proteins |
| T10075 |
45130-45137 |
VBN |
denotes |
related |
| T10076 |
45146-45148 |
, |
denotes |
, |
| T10077 |
45148-45149 |
NN |
denotes |
L |
| T10078 |
45150-45154 |
NN |
denotes |
SOX5 |
| T10079 |
45149-45150 |
HYPH |
denotes |
- |
| T10080 |
45155-45158 |
CC |
denotes |
and |
| T10081 |
45159-45163 |
NN |
denotes |
SOX6 |
| T10082 |
45164-45165 |
-LRB- |
denotes |
( |
| T10083 |
45165-45173 |
NNP |
denotes |
Lefebvre |
| T10084 |
45174-45176 |
FW |
denotes |
et |
| T10085 |
45177-45180 |
FW |
denotes |
al. |
| T10086 |
45181-45185 |
CD |
denotes |
1998 |
| T10087 |
45185-45186 |
: |
denotes |
; |
| T10088 |
45187-45192 |
NNP |
denotes |
Huang |
| T10089 |
45193-45195 |
FW |
denotes |
et |
| T10090 |
45196-45199 |
FW |
denotes |
al. |
| T10091 |
45200-45204 |
CD |
denotes |
2000 |
| T10092 |
45204-45205 |
-RRB- |
denotes |
) |
| T10093 |
45205-45206 |
. |
denotes |
. |
| T10094 |
45206-45469 |
sentence |
denotes |
In addition, close examination of the order of genes induced during chicken digit formation reveals that Sox9 turns on first, followed by Bmpr1b with L-Sox5, and then Sox6 and the cartilage matrix structural components Col2a1 and Agg (Chimal-Monroy et al. 2003). |
| T10095 |
45207-45209 |
IN |
denotes |
In |
| T10096 |
45299-45306 |
VBZ |
denotes |
reveals |
| T10097 |
45210-45218 |
NN |
denotes |
addition |
| T10098 |
45218-45220 |
, |
denotes |
, |
| T10099 |
45220-45225 |
JJ |
denotes |
close |
| T10100 |
45226-45237 |
NN |
denotes |
examination |
| T10101 |
45238-45240 |
IN |
denotes |
of |
| T10102 |
45241-45244 |
DT |
denotes |
the |
| T10103 |
45245-45250 |
NN |
denotes |
order |
| T10104 |
45251-45253 |
IN |
denotes |
of |
| T10105 |
45254-45259 |
NNS |
denotes |
genes |
| T10106 |
45260-45267 |
VBN |
denotes |
induced |
| T10107 |
45268-45274 |
IN |
denotes |
during |
| T10108 |
45275-45282 |
NN |
denotes |
chicken |
| T10109 |
45289-45298 |
NN |
denotes |
formation |
| T10110 |
45283-45288 |
NN |
denotes |
digit |
| T10111 |
45307-45311 |
IN |
denotes |
that |
| T10112 |
45317-45322 |
VBZ |
denotes |
turns |
| T10113 |
45312-45316 |
NN |
denotes |
Sox9 |
| T10114 |
45323-45325 |
RP |
denotes |
on |
| T10115 |
45326-45331 |
RB |
denotes |
first |
| T10116 |
45331-45333 |
, |
denotes |
, |
| T10117 |
45333-45341 |
VBN |
denotes |
followed |
| T10118 |
45342-45344 |
IN |
denotes |
by |
| T10119 |
45345-45351 |
NN |
denotes |
Bmpr1b |
| T10120 |
45352-45356 |
IN |
denotes |
with |
| T10121 |
45357-45358 |
NN |
denotes |
L |
| T10122 |
45359-45363 |
NN |
denotes |
Sox5 |
| T10123 |
45358-45359 |
HYPH |
denotes |
- |
| T10124 |
45363-45365 |
, |
denotes |
, |
| T10125 |
45365-45368 |
CC |
denotes |
and |
| T10126 |
45369-45373 |
RB |
denotes |
then |
| T10127 |
45374-45378 |
NN |
denotes |
Sox6 |
| T10128 |
45379-45382 |
CC |
denotes |
and |
| T10129 |
45383-45386 |
DT |
denotes |
the |
| T10130 |
45415-45425 |
NNS |
denotes |
components |
| T10131 |
45387-45396 |
NN |
denotes |
cartilage |
| T10132 |
45397-45403 |
NN |
denotes |
matrix |
| T10133 |
45404-45414 |
JJ |
denotes |
structural |
| T10134 |
45426-45432 |
NN |
denotes |
Col2a1 |
| T10135 |
45433-45436 |
CC |
denotes |
and |
| T10136 |
45437-45440 |
NN |
denotes |
Agg |
| T10137 |
45441-45442 |
-LRB- |
denotes |
( |
| T10138 |
45442-45448 |
NNP |
denotes |
Chimal |
| T10139 |
45448-45449 |
HYPH |
denotes |
- |
| T10140 |
45449-45455 |
NNP |
denotes |
Monroy |
| T10141 |
45456-45458 |
FW |
denotes |
et |
| T10142 |
45459-45462 |
FW |
denotes |
al. |
| T10143 |
45463-45467 |
CD |
denotes |
2003 |
| T10144 |
45467-45468 |
-RRB- |
denotes |
) |
| T10145 |
45468-45469 |
. |
denotes |
. |
| T10146 |
45469-45764 |
sentence |
denotes |
These results, together with the altered pattern of gene expression seen in our Bmpr1a-deficient mice, suggest that BMPR1A signaling may normally act to stimulate SOX9 by post-translational protein modification, or to induce L-Sox5 or Sox6 in cartilage to maintain expression of ECM components. |
| T10147 |
45470-45475 |
DT |
denotes |
These |
| T10148 |
45476-45483 |
NNS |
denotes |
results |
| T10149 |
45573-45580 |
VBP |
denotes |
suggest |
| T10150 |
45483-45485 |
, |
denotes |
, |
| T10151 |
45485-45493 |
RB |
denotes |
together |
| T10152 |
45494-45498 |
IN |
denotes |
with |
| T10153 |
45499-45502 |
DT |
denotes |
the |
| T10154 |
45511-45518 |
NN |
denotes |
pattern |
| T10155 |
45503-45510 |
VBN |
denotes |
altered |
| T10156 |
45519-45521 |
IN |
denotes |
of |
| T10157 |
45522-45526 |
NN |
denotes |
gene |
| T10158 |
45527-45537 |
NN |
denotes |
expression |
| T10159 |
45538-45542 |
VBN |
denotes |
seen |
| T10160 |
45543-45545 |
IN |
denotes |
in |
| T10161 |
45546-45549 |
PRP$ |
denotes |
our |
| T10162 |
45567-45571 |
NNS |
denotes |
mice |
| T10163 |
45550-45556 |
NN |
denotes |
Bmpr1a |
| T10164 |
45557-45566 |
JJ |
denotes |
deficient |
| T10165 |
45556-45557 |
HYPH |
denotes |
- |
| T10166 |
45571-45573 |
, |
denotes |
, |
| T10167 |
45581-45585 |
IN |
denotes |
that |
| T10168 |
45616-45619 |
VB |
denotes |
act |
| T10169 |
45586-45592 |
NN |
denotes |
BMPR1A |
| T10170 |
45593-45602 |
NN |
denotes |
signaling |
| T10171 |
45603-45606 |
MD |
denotes |
may |
| T10172 |
45607-45615 |
RB |
denotes |
normally |
| T10173 |
45620-45622 |
TO |
denotes |
to |
| T10174 |
45623-45632 |
VB |
denotes |
stimulate |
| T10175 |
45633-45637 |
NN |
denotes |
SOX9 |
| T10176 |
45638-45640 |
IN |
denotes |
by |
| T10177 |
45641-45659 |
JJ |
denotes |
post-translational |
| T10178 |
45668-45680 |
NN |
denotes |
modification |
| T10179 |
45660-45667 |
NN |
denotes |
protein |
| T10180 |
45680-45682 |
, |
denotes |
, |
| T10181 |
45682-45684 |
CC |
denotes |
or |
| T10182 |
45685-45687 |
TO |
denotes |
to |
| T10183 |
45688-45694 |
VB |
denotes |
induce |
| T10184 |
45695-45696 |
NN |
denotes |
L |
| T10185 |
45697-45701 |
NN |
denotes |
Sox5 |
| T10186 |
45696-45697 |
HYPH |
denotes |
- |
| T10187 |
45702-45704 |
CC |
denotes |
or |
| T10188 |
45705-45709 |
NN |
denotes |
Sox6 |
| T10189 |
45710-45712 |
IN |
denotes |
in |
| T10190 |
45713-45722 |
NN |
denotes |
cartilage |
| T10191 |
45723-45725 |
TO |
denotes |
to |
| T10192 |
45726-45734 |
VB |
denotes |
maintain |
| T10193 |
45735-45745 |
NN |
denotes |
expression |
| T10194 |
45746-45748 |
IN |
denotes |
of |
| T10195 |
45749-45752 |
NN |
denotes |
ECM |
| T10196 |
45753-45763 |
NNS |
denotes |
components |
| T10197 |
45763-45764 |
. |
denotes |
. |
| T10198 |
45764-45954 |
sentence |
denotes |
These models are consistent with the ability of BMP2 to both increase PKA activity and induce expression of Sox6 in tissue culture cells (Lee and Chuong 1997; Fernandez-Lloris et al. 2003). |
| T10199 |
45765-45770 |
DT |
denotes |
These |
| T10200 |
45771-45777 |
NNS |
denotes |
models |
| T10201 |
45778-45781 |
VBP |
denotes |
are |
| T10202 |
45782-45792 |
JJ |
denotes |
consistent |
| T10203 |
45793-45797 |
IN |
denotes |
with |
| T10204 |
45798-45801 |
DT |
denotes |
the |
| T10205 |
45802-45809 |
NN |
denotes |
ability |
| T10206 |
45810-45812 |
IN |
denotes |
of |
| T10207 |
45813-45817 |
NN |
denotes |
BMP2 |
| T10208 |
45818-45820 |
TO |
denotes |
to |
| T10209 |
45826-45834 |
VB |
denotes |
increase |
| T10210 |
45821-45825 |
CC |
denotes |
both |
| T10211 |
45835-45838 |
NN |
denotes |
PKA |
| T10212 |
45839-45847 |
NN |
denotes |
activity |
| T10213 |
45848-45851 |
CC |
denotes |
and |
| T10214 |
45852-45858 |
VB |
denotes |
induce |
| T10215 |
45859-45869 |
NN |
denotes |
expression |
| T10216 |
45870-45872 |
IN |
denotes |
of |
| T10217 |
45873-45877 |
NN |
denotes |
Sox6 |
| T10218 |
45878-45880 |
IN |
denotes |
in |
| T10219 |
45881-45887 |
NN |
denotes |
tissue |
| T10220 |
45896-45901 |
NNS |
denotes |
cells |
| T10221 |
45888-45895 |
NN |
denotes |
culture |
| T10222 |
45902-45903 |
-LRB- |
denotes |
( |
| T10223 |
45903-45906 |
NNP |
denotes |
Lee |
| T10224 |
45907-45910 |
CC |
denotes |
and |
| T10225 |
45911-45917 |
NNP |
denotes |
Chuong |
| T10226 |
45918-45922 |
CD |
denotes |
1997 |
| T10227 |
45922-45923 |
: |
denotes |
; |
| T10228 |
45924-45933 |
NNP |
denotes |
Fernandez |
| T10229 |
45933-45934 |
HYPH |
denotes |
- |
| T10230 |
45934-45940 |
NNP |
denotes |
Lloris |
| T10231 |
45941-45943 |
FW |
denotes |
et |
| T10232 |
45944-45947 |
FW |
denotes |
al. |
| T10233 |
45948-45952 |
CD |
denotes |
2003 |
| T10234 |
45952-45953 |
-RRB- |
denotes |
) |
| T10235 |
45953-45954 |
. |
denotes |
. |
| T10236 |
45954-46281 |
sentence |
denotes |
Although we have tried to monitor the expression of L-Sox5 or Sox6 in postnatal articular cartilage, and test the phosphorylation state of SOX9 using previously described reagents (Lefebvre et al. 1998; Huang et al. 2000), we have been unable to obtain specific signal at the late postnatal stages required (unpublished data). |
| T10237 |
45955-45963 |
IN |
denotes |
Although |
| T10238 |
45972-45977 |
VBN |
denotes |
tried |
| T10239 |
45964-45966 |
PRP |
denotes |
we |
| T10240 |
45967-45971 |
VBP |
denotes |
have |
| T10241 |
46186-46190 |
VBN |
denotes |
been |
| T10242 |
45978-45980 |
TO |
denotes |
to |
| T10243 |
45981-45988 |
VB |
denotes |
monitor |
| T10244 |
45989-45992 |
DT |
denotes |
the |
| T10245 |
45993-46003 |
NN |
denotes |
expression |
| T10246 |
46004-46006 |
IN |
denotes |
of |
| T10247 |
46007-46008 |
NN |
denotes |
L |
| T10248 |
46009-46013 |
NN |
denotes |
Sox5 |
| T10249 |
46008-46009 |
HYPH |
denotes |
- |
| T10250 |
46014-46016 |
CC |
denotes |
or |
| T10251 |
46017-46021 |
NN |
denotes |
Sox6 |
| T10252 |
46022-46024 |
IN |
denotes |
in |
| T10253 |
46025-46034 |
JJ |
denotes |
postnatal |
| T10254 |
46045-46054 |
NN |
denotes |
cartilage |
| T10255 |
46035-46044 |
JJ |
denotes |
articular |
| T10256 |
46054-46056 |
, |
denotes |
, |
| T10257 |
46056-46059 |
CC |
denotes |
and |
| T10258 |
46060-46064 |
VB |
denotes |
test |
| T10259 |
46065-46068 |
DT |
denotes |
the |
| T10260 |
46085-46090 |
NN |
denotes |
state |
| T10261 |
46069-46084 |
NN |
denotes |
phosphorylation |
| T10262 |
46091-46093 |
IN |
denotes |
of |
| T10263 |
46094-46098 |
NN |
denotes |
SOX9 |
| T10264 |
46099-46104 |
VBG |
denotes |
using |
| T10265 |
46105-46115 |
RB |
denotes |
previously |
| T10266 |
46116-46125 |
VBN |
denotes |
described |
| T10267 |
46126-46134 |
NNS |
denotes |
reagents |
| T10268 |
46135-46136 |
-LRB- |
denotes |
( |
| T10269 |
46136-46144 |
NNP |
denotes |
Lefebvre |
| T10270 |
46145-46147 |
FW |
denotes |
et |
| T10271 |
46148-46151 |
FW |
denotes |
al. |
| T10272 |
46152-46156 |
CD |
denotes |
1998 |
| T10273 |
46156-46157 |
: |
denotes |
; |
| T10274 |
46158-46163 |
NNP |
denotes |
Huang |
| T10275 |
46164-46166 |
FW |
denotes |
et |
| T10276 |
46167-46170 |
FW |
denotes |
al. |
| T10277 |
46171-46175 |
CD |
denotes |
2000 |
| T10278 |
46175-46176 |
-RRB- |
denotes |
) |
| T10279 |
46176-46178 |
, |
denotes |
, |
| T10280 |
46178-46180 |
PRP |
denotes |
we |
| T10281 |
46181-46185 |
VBP |
denotes |
have |
| T10282 |
46191-46197 |
JJ |
denotes |
unable |
| T10283 |
46198-46200 |
TO |
denotes |
to |
| T10284 |
46201-46207 |
VB |
denotes |
obtain |
| T10285 |
46208-46216 |
JJ |
denotes |
specific |
| T10286 |
46217-46223 |
NN |
denotes |
signal |
| T10287 |
46224-46226 |
IN |
denotes |
at |
| T10288 |
46227-46230 |
DT |
denotes |
the |
| T10289 |
46246-46252 |
NNS |
denotes |
stages |
| T10290 |
46231-46235 |
JJ |
denotes |
late |
| T10291 |
46236-46245 |
JJ |
denotes |
postnatal |
| T10292 |
46253-46261 |
VBN |
denotes |
required |
| T10293 |
46262-46263 |
-LRB- |
denotes |
( |
| T10294 |
46275-46279 |
NNS |
denotes |
data |
| T10295 |
46263-46274 |
JJ |
denotes |
unpublished |
| T10296 |
46279-46280 |
-RRB- |
denotes |
) |
| T10297 |
46280-46281 |
. |
denotes |
. |
| T10298 |
46281-46446 |
sentence |
denotes |
Furthermore, null mutations in L-Sox5 or Sox-6 cause lethality at or soon after birth, and no effect on cartilage maintenance has been reported (Smits et al. 2001). |
| T10299 |
46282-46293 |
RB |
denotes |
Furthermore |
| T10300 |
46329-46334 |
VBP |
denotes |
cause |
| T10301 |
46293-46295 |
, |
denotes |
, |
| T10302 |
46295-46299 |
JJ |
denotes |
null |
| T10303 |
46300-46309 |
NNS |
denotes |
mutations |
| T10304 |
46310-46312 |
IN |
denotes |
in |
| T10305 |
46313-46314 |
NN |
denotes |
L |
| T10306 |
46315-46319 |
NN |
denotes |
Sox5 |
| T10307 |
46314-46315 |
HYPH |
denotes |
- |
| T10308 |
46320-46322 |
CC |
denotes |
or |
| T10309 |
46323-46326 |
NN |
denotes |
Sox |
| T10310 |
46326-46327 |
HYPH |
denotes |
- |
| T10311 |
46327-46328 |
CD |
denotes |
6 |
| T10312 |
46335-46344 |
NN |
denotes |
lethality |
| T10313 |
46345-46347 |
IN |
denotes |
at |
| T10314 |
46348-46350 |
CC |
denotes |
or |
| T10315 |
46351-46355 |
RB |
denotes |
soon |
| T10316 |
46356-46361 |
IN |
denotes |
after |
| T10317 |
46362-46367 |
NN |
denotes |
birth |
| T10318 |
46367-46369 |
, |
denotes |
, |
| T10319 |
46369-46372 |
CC |
denotes |
and |
| T10320 |
46373-46375 |
DT |
denotes |
no |
| T10321 |
46376-46382 |
NN |
denotes |
effect |
| T10322 |
46417-46425 |
VBN |
denotes |
reported |
| T10323 |
46383-46385 |
IN |
denotes |
on |
| T10324 |
46386-46395 |
NN |
denotes |
cartilage |
| T10325 |
46396-46407 |
NN |
denotes |
maintenance |
| T10326 |
46408-46411 |
VBZ |
denotes |
has |
| T10327 |
46412-46416 |
VBN |
denotes |
been |
| T10328 |
46426-46427 |
-LRB- |
denotes |
( |
| T10329 |
46427-46432 |
NNP |
denotes |
Smits |
| T10330 |
46433-46435 |
FW |
denotes |
et |
| T10331 |
46436-46439 |
FW |
denotes |
al. |
| T10332 |
46440-46444 |
CD |
denotes |
2001 |
| T10333 |
46444-46445 |
-RRB- |
denotes |
) |
| T10334 |
46445-46446 |
. |
denotes |
. |
| T10335 |
46446-46595 |
sentence |
denotes |
However, it seems likely that these or other processes regulated by BMP signaling cooperate with SOX9 to induce target genes in articular cartilage. |
| T10336 |
46447-46454 |
RB |
denotes |
However |
| T10337 |
46459-46464 |
VBZ |
denotes |
seems |
| T10338 |
46454-46456 |
, |
denotes |
, |
| T10339 |
46456-46458 |
PRP |
denotes |
it |
| T10340 |
46465-46471 |
JJ |
denotes |
likely |
| T10341 |
46472-46476 |
IN |
denotes |
that |
| T10342 |
46529-46538 |
VBP |
denotes |
cooperate |
| T10343 |
46477-46482 |
DT |
denotes |
these |
| T10344 |
46483-46485 |
CC |
denotes |
or |
| T10345 |
46486-46491 |
JJ |
denotes |
other |
| T10346 |
46492-46501 |
NNS |
denotes |
processes |
| T10347 |
46502-46511 |
VBN |
denotes |
regulated |
| T10348 |
46512-46514 |
IN |
denotes |
by |
| T10349 |
46515-46518 |
NN |
denotes |
BMP |
| T10350 |
46519-46528 |
NN |
denotes |
signaling |
| T10351 |
46539-46543 |
IN |
denotes |
with |
| T10352 |
46544-46548 |
NN |
denotes |
SOX9 |
| T10353 |
46549-46551 |
TO |
denotes |
to |
| T10354 |
46552-46558 |
VB |
denotes |
induce |
| T10355 |
46559-46565 |
JJ |
denotes |
target |
| T10356 |
46566-46571 |
NNS |
denotes |
genes |
| T10357 |
46572-46574 |
IN |
denotes |
in |
| T10358 |
46575-46584 |
JJ |
denotes |
articular |
| T10359 |
46585-46594 |
NN |
denotes |
cartilage |
| T10360 |
46594-46595 |
. |
denotes |
. |
| T10361 |
46595-46794 |
sentence |
denotes |
Mutation of Smad3 or expression of dominant negative transforming growth factor β (TGF-β) type II receptor also disrupts normal articular cartilage maintenance (Serra et al. 1997; Yang et al. 2001). |
| T10362 |
46596-46604 |
NN |
denotes |
Mutation |
| T10363 |
46708-46716 |
VBZ |
denotes |
disrupts |
| T10364 |
46605-46607 |
IN |
denotes |
of |
| T10365 |
46608-46613 |
NN |
denotes |
Smad3 |
| T10366 |
46614-46616 |
CC |
denotes |
or |
| T10367 |
46617-46627 |
NN |
denotes |
expression |
| T10368 |
46628-46630 |
IN |
denotes |
of |
| T10369 |
46631-46639 |
JJ |
denotes |
dominant |
| T10370 |
46694-46702 |
NN |
denotes |
receptor |
| T10371 |
46640-46648 |
JJ |
denotes |
negative |
| T10372 |
46649-46661 |
VBG |
denotes |
transforming |
| T10373 |
46676-46677 |
NN |
denotes |
β |
| T10374 |
46662-46668 |
NN |
denotes |
growth |
| T10375 |
46669-46675 |
NN |
denotes |
factor |
| T10376 |
46678-46679 |
-LRB- |
denotes |
( |
| T10377 |
46679-46682 |
NN |
denotes |
TGF |
| T10378 |
46683-46684 |
NN |
denotes |
β |
| T10379 |
46682-46683 |
HYPH |
denotes |
- |
| T10380 |
46684-46685 |
-RRB- |
denotes |
) |
| T10381 |
46686-46690 |
NN |
denotes |
type |
| T10382 |
46691-46693 |
CD |
denotes |
II |
| T10383 |
46703-46707 |
RB |
denotes |
also |
| T10384 |
46717-46723 |
JJ |
denotes |
normal |
| T10385 |
46744-46755 |
NN |
denotes |
maintenance |
| T10386 |
46724-46733 |
JJ |
denotes |
articular |
| T10387 |
46734-46743 |
NN |
denotes |
cartilage |
| T10388 |
46756-46757 |
-LRB- |
denotes |
( |
| T10389 |
46757-46762 |
NNP |
denotes |
Serra |
| T10390 |
46763-46765 |
FW |
denotes |
et |
| T10391 |
46766-46769 |
FW |
denotes |
al. |
| T10392 |
46770-46774 |
CD |
denotes |
1997 |
| T10393 |
46774-46775 |
: |
denotes |
; |
| T10394 |
46776-46780 |
NNP |
denotes |
Yang |
| T10395 |
46781-46783 |
FW |
denotes |
et |
| T10396 |
46784-46787 |
FW |
denotes |
al. |
| T10397 |
46788-46792 |
CD |
denotes |
2001 |
| T10398 |
46792-46793 |
-RRB- |
denotes |
) |
| T10399 |
46793-46794 |
. |
denotes |
. |
| T10400 |
46794-46949 |
sentence |
denotes |
Both manipulations should disrupt TGFβ rather than BMP signaling, and both manipulations cause articular cartilage to hypertrophy and be replaced by bone. |
| T10401 |
46795-46799 |
DT |
denotes |
Both |
| T10402 |
46800-46813 |
NNS |
denotes |
manipulations |
| T10403 |
46821-46828 |
VB |
denotes |
disrupt |
| T10404 |
46814-46820 |
MD |
denotes |
should |
| T10405 |
46829-46833 |
NN |
denotes |
TGFβ |
| T10406 |
46834-46840 |
JJ |
denotes |
rather |
| T10407 |
46841-46845 |
IN |
denotes |
than |
| T10408 |
46846-46849 |
NN |
denotes |
BMP |
| T10409 |
46850-46859 |
NN |
denotes |
signaling |
| T10410 |
46859-46861 |
, |
denotes |
, |
| T10411 |
46861-46864 |
CC |
denotes |
and |
| T10412 |
46865-46869 |
DT |
denotes |
both |
| T10413 |
46870-46883 |
NNS |
denotes |
manipulations |
| T10414 |
46884-46889 |
VBP |
denotes |
cause |
| T10415 |
46890-46899 |
JJ |
denotes |
articular |
| T10416 |
46900-46909 |
NN |
denotes |
cartilage |
| T10417 |
46913-46924 |
VB |
denotes |
hypertrophy |
| T10418 |
46910-46912 |
TO |
denotes |
to |
| T10419 |
46925-46928 |
CC |
denotes |
and |
| T10420 |
46929-46931 |
VB |
denotes |
be |
| T10421 |
46932-46940 |
VBN |
denotes |
replaced |
| T10422 |
46941-46943 |
IN |
denotes |
by |
| T10423 |
46944-46948 |
NN |
denotes |
bone |
| T10424 |
46948-46949 |
. |
denotes |
. |
| T10425 |
46949-47094 |
sentence |
denotes |
In contrast, our analysis of Bmpr1a mutant articular cartilage showed a loss of ECM components, but no signs of hypertrophy or bone replacement. |
| T10426 |
46950-46952 |
IN |
denotes |
In |
| T10427 |
47013-47019 |
VBD |
denotes |
showed |
| T10428 |
46953-46961 |
NN |
denotes |
contrast |
| T10429 |
46961-46963 |
, |
denotes |
, |
| T10430 |
46963-46966 |
PRP$ |
denotes |
our |
| T10431 |
46967-46975 |
NN |
denotes |
analysis |
| T10432 |
46976-46978 |
IN |
denotes |
of |
| T10433 |
46979-46985 |
NN |
denotes |
Bmpr1a |
| T10434 |
46986-46992 |
NN |
denotes |
mutant |
| T10435 |
47003-47012 |
NN |
denotes |
cartilage |
| T10436 |
46993-47002 |
JJ |
denotes |
articular |
| T10437 |
47020-47021 |
DT |
denotes |
a |
| T10438 |
47022-47026 |
NN |
denotes |
loss |
| T10439 |
47027-47029 |
IN |
denotes |
of |
| T10440 |
47030-47033 |
NN |
denotes |
ECM |
| T10441 |
47034-47044 |
NNS |
denotes |
components |
| T10442 |
47044-47046 |
, |
denotes |
, |
| T10443 |
47046-47049 |
CC |
denotes |
but |
| T10444 |
47050-47052 |
DT |
denotes |
no |
| T10445 |
47053-47058 |
NNS |
denotes |
signs |
| T10446 |
47059-47061 |
IN |
denotes |
of |
| T10447 |
47062-47073 |
NN |
denotes |
hypertrophy |
| T10448 |
47074-47076 |
CC |
denotes |
or |
| T10449 |
47077-47081 |
NN |
denotes |
bone |
| T10450 |
47082-47093 |
NN |
denotes |
replacement |
| T10451 |
47093-47094 |
. |
denotes |
. |
| T10452 |
47094-47202 |
sentence |
denotes |
Therefore, TGFβ and BMP signaling are playing distinct but necessary roles to maintain articular cartilage. |
| T10453 |
47095-47104 |
RB |
denotes |
Therefore |
| T10454 |
47133-47140 |
VBG |
denotes |
playing |
| T10455 |
47104-47106 |
, |
denotes |
, |
| T10456 |
47106-47110 |
NN |
denotes |
TGFβ |
| T10457 |
47119-47128 |
NN |
denotes |
signaling |
| T10458 |
47111-47114 |
CC |
denotes |
and |
| T10459 |
47115-47118 |
NN |
denotes |
BMP |
| T10460 |
47129-47132 |
VBP |
denotes |
are |
| T10461 |
47141-47149 |
JJ |
denotes |
distinct |
| T10462 |
47164-47169 |
NNS |
denotes |
roles |
| T10463 |
47150-47153 |
CC |
denotes |
but |
| T10464 |
47154-47163 |
JJ |
denotes |
necessary |
| T10465 |
47170-47172 |
TO |
denotes |
to |
| T10466 |
47173-47181 |
VB |
denotes |
maintain |
| T10467 |
47182-47191 |
JJ |
denotes |
articular |
| T10468 |
47192-47201 |
NN |
denotes |
cartilage |
| T10469 |
47201-47202 |
. |
denotes |
. |
| T10470 |
47202-47586 |
sentence |
denotes |
Although BMPs were originally isolated on the basis of their ability to induce ectopic bone formation, their presence in articular cartilage and strong effect on cartilage formation has stimulated interest in using them to repair or regenerate cartilage defects in adult animals (Chang et al. 1994; Erlacher et al. 1998; Edwards and Francis-West 2001; Chubinskaya and Kuettner 2003). |
| T10471 |
47203-47211 |
IN |
denotes |
Although |
| T10472 |
47233-47241 |
VBN |
denotes |
isolated |
| T10473 |
47212-47216 |
NNS |
denotes |
BMPs |
| T10474 |
47217-47221 |
VBD |
denotes |
were |
| T10475 |
47222-47232 |
RB |
denotes |
originally |
| T10476 |
47389-47399 |
VBN |
denotes |
stimulated |
| T10477 |
47242-47244 |
IN |
denotes |
on |
| T10478 |
47245-47248 |
DT |
denotes |
the |
| T10479 |
47249-47254 |
NN |
denotes |
basis |
| T10480 |
47255-47257 |
IN |
denotes |
of |
| T10481 |
47258-47263 |
PRP$ |
denotes |
their |
| T10482 |
47264-47271 |
NN |
denotes |
ability |
| T10483 |
47272-47274 |
TO |
denotes |
to |
| T10484 |
47275-47281 |
VB |
denotes |
induce |
| T10485 |
47282-47289 |
JJ |
denotes |
ectopic |
| T10486 |
47295-47304 |
NN |
denotes |
formation |
| T10487 |
47290-47294 |
NN |
denotes |
bone |
| T10488 |
47304-47306 |
, |
denotes |
, |
| T10489 |
47306-47311 |
PRP$ |
denotes |
their |
| T10490 |
47312-47320 |
NN |
denotes |
presence |
| T10491 |
47321-47323 |
IN |
denotes |
in |
| T10492 |
47324-47333 |
JJ |
denotes |
articular |
| T10493 |
47334-47343 |
NN |
denotes |
cartilage |
| T10494 |
47344-47347 |
CC |
denotes |
and |
| T10495 |
47348-47354 |
JJ |
denotes |
strong |
| T10496 |
47355-47361 |
NN |
denotes |
effect |
| T10497 |
47362-47364 |
IN |
denotes |
on |
| T10498 |
47365-47374 |
NN |
denotes |
cartilage |
| T10499 |
47375-47384 |
NN |
denotes |
formation |
| T10500 |
47385-47388 |
VBZ |
denotes |
has |
| T10501 |
47400-47408 |
NN |
denotes |
interest |
| T10502 |
47409-47411 |
IN |
denotes |
in |
| T10503 |
47412-47417 |
VBG |
denotes |
using |
| T10504 |
47418-47422 |
PRP |
denotes |
them |
| T10505 |
47423-47425 |
TO |
denotes |
to |
| T10506 |
47426-47432 |
VB |
denotes |
repair |
| T10507 |
47433-47435 |
CC |
denotes |
or |
| T10508 |
47436-47446 |
VB |
denotes |
regenerate |
| T10509 |
47447-47456 |
NN |
denotes |
cartilage |
| T10510 |
47457-47464 |
NNS |
denotes |
defects |
| T10511 |
47465-47467 |
IN |
denotes |
in |
| T10512 |
47468-47473 |
NN |
denotes |
adult |
| T10513 |
47474-47481 |
NNS |
denotes |
animals |
| T10514 |
47482-47483 |
-LRB- |
denotes |
( |
| T10515 |
47483-47488 |
NNP |
denotes |
Chang |
| T10516 |
47489-47491 |
FW |
denotes |
et |
| T10517 |
47492-47495 |
FW |
denotes |
al. |
| T10518 |
47496-47500 |
CD |
denotes |
1994 |
| T10519 |
47500-47501 |
: |
denotes |
; |
| T10520 |
47502-47510 |
NNP |
denotes |
Erlacher |
| T10521 |
47511-47513 |
FW |
denotes |
et |
| T10522 |
47514-47517 |
FW |
denotes |
al. |
| T10523 |
47518-47522 |
CD |
denotes |
1998 |
| T10524 |
47522-47523 |
: |
denotes |
; |
| T10525 |
47524-47531 |
NNP |
denotes |
Edwards |
| T10526 |
47532-47535 |
CC |
denotes |
and |
| T10527 |
47536-47543 |
NNP |
denotes |
Francis |
| T10528 |
47543-47544 |
HYPH |
denotes |
- |
| T10529 |
47544-47548 |
NNP |
denotes |
West |
| T10530 |
47549-47553 |
CD |
denotes |
2001 |
| T10531 |
47553-47554 |
: |
denotes |
; |
| T10532 |
47555-47566 |
NNP |
denotes |
Chubinskaya |
| T10533 |
47567-47570 |
CC |
denotes |
and |
| T10534 |
47571-47579 |
NNP |
denotes |
Kuettner |
| T10535 |
47580-47584 |
CD |
denotes |
2003 |
| T10536 |
47584-47585 |
-RRB- |
denotes |
) |
| T10537 |
47585-47586 |
. |
denotes |
. |
| T10538 |
47586-47900 |
sentence |
denotes |
The failure to maintain articular cartilage in the absence of normal BMPR1A function suggests that ligands or small molecule agonists that interact specifically with this receptor subtype may be particularly good candidates for designing new approaches to maintain or heal articular cartilage at postnatal stages. |
| T10539 |
47587-47590 |
DT |
denotes |
The |
| T10540 |
47591-47598 |
NN |
denotes |
failure |
| T10541 |
47672-47680 |
VBZ |
denotes |
suggests |
| T10542 |
47599-47601 |
TO |
denotes |
to |
| T10543 |
47602-47610 |
VB |
denotes |
maintain |
| T10544 |
47611-47620 |
JJ |
denotes |
articular |
| T10545 |
47621-47630 |
NN |
denotes |
cartilage |
| T10546 |
47631-47633 |
IN |
denotes |
in |
| T10547 |
47634-47637 |
DT |
denotes |
the |
| T10548 |
47638-47645 |
NN |
denotes |
absence |
| T10549 |
47646-47648 |
IN |
denotes |
of |
| T10550 |
47649-47655 |
JJ |
denotes |
normal |
| T10551 |
47663-47671 |
NN |
denotes |
function |
| T10552 |
47656-47662 |
NN |
denotes |
BMPR1A |
| T10553 |
47681-47685 |
IN |
denotes |
that |
| T10554 |
47779-47781 |
VB |
denotes |
be |
| T10555 |
47686-47693 |
NNS |
denotes |
ligands |
| T10556 |
47694-47696 |
CC |
denotes |
or |
| T10557 |
47697-47702 |
JJ |
denotes |
small |
| T10558 |
47712-47720 |
NNS |
denotes |
agonists |
| T10559 |
47703-47711 |
NN |
denotes |
molecule |
| T10560 |
47721-47725 |
WDT |
denotes |
that |
| T10561 |
47726-47734 |
VBP |
denotes |
interact |
| T10562 |
47735-47747 |
RB |
denotes |
specifically |
| T10563 |
47748-47752 |
IN |
denotes |
with |
| T10564 |
47753-47757 |
DT |
denotes |
this |
| T10565 |
47767-47774 |
NN |
denotes |
subtype |
| T10566 |
47758-47766 |
NN |
denotes |
receptor |
| T10567 |
47775-47778 |
MD |
denotes |
may |
| T10568 |
47782-47794 |
RB |
denotes |
particularly |
| T10569 |
47795-47799 |
JJ |
denotes |
good |
| T10570 |
47800-47810 |
NNS |
denotes |
candidates |
| T10571 |
47811-47814 |
IN |
denotes |
for |
| T10572 |
47815-47824 |
VBG |
denotes |
designing |
| T10573 |
47825-47828 |
JJ |
denotes |
new |
| T10574 |
47829-47839 |
NNS |
denotes |
approaches |
| T10575 |
47840-47842 |
TO |
denotes |
to |
| T10576 |
47843-47851 |
VB |
denotes |
maintain |
| T10577 |
47852-47854 |
CC |
denotes |
or |
| T10578 |
47855-47859 |
VB |
denotes |
heal |
| T10579 |
47860-47869 |
JJ |
denotes |
articular |
| T10580 |
47870-47879 |
NN |
denotes |
cartilage |
| T10581 |
47880-47882 |
IN |
denotes |
at |
| T10582 |
47883-47892 |
JJ |
denotes |
postnatal |
| T10583 |
47893-47899 |
NNS |
denotes |
stages |
| T10584 |
47899-47900 |
. |
denotes |
. |
| T10585 |
47900-48031 |
sentence |
denotes |
Lack of Bmpr1a function in articular cartilage results in severe fibrillation of the articular surface and loss of joint mobility. |
| T10586 |
47901-47905 |
NN |
denotes |
Lack |
| T10587 |
47948-47955 |
VBZ |
denotes |
results |
| T10588 |
47906-47908 |
IN |
denotes |
of |
| T10589 |
47909-47915 |
NN |
denotes |
Bmpr1a |
| T10590 |
47916-47924 |
NN |
denotes |
function |
| T10591 |
47925-47927 |
IN |
denotes |
in |
| T10592 |
47928-47937 |
JJ |
denotes |
articular |
| T10593 |
47938-47947 |
NN |
denotes |
cartilage |
| T10594 |
47956-47958 |
IN |
denotes |
in |
| T10595 |
47959-47965 |
JJ |
denotes |
severe |
| T10596 |
47966-47978 |
NN |
denotes |
fibrillation |
| T10597 |
47979-47981 |
IN |
denotes |
of |
| T10598 |
47982-47985 |
DT |
denotes |
the |
| T10599 |
47996-48003 |
NN |
denotes |
surface |
| T10600 |
47986-47995 |
JJ |
denotes |
articular |
| T10601 |
48004-48007 |
CC |
denotes |
and |
| T10602 |
48008-48012 |
NN |
denotes |
loss |
| T10603 |
48013-48015 |
IN |
denotes |
of |
| T10604 |
48016-48021 |
NN |
denotes |
joint |
| T10605 |
48022-48030 |
NN |
denotes |
mobility |
| T10606 |
48030-48031 |
. |
denotes |
. |
| T10607 |
48031-48194 |
sentence |
denotes |
The development of severe arthritis symptoms in Bmpr1a-deficient mice raises the possibility that defects in BMP signaling also contribute to human joint disease. |
| T10608 |
48032-48035 |
DT |
denotes |
The |
| T10609 |
48036-48047 |
NN |
denotes |
development |
| T10610 |
48102-48108 |
VBZ |
denotes |
raises |
| T10611 |
48048-48050 |
IN |
denotes |
of |
| T10612 |
48051-48057 |
JJ |
denotes |
severe |
| T10613 |
48068-48076 |
NNS |
denotes |
symptoms |
| T10614 |
48058-48067 |
NN |
denotes |
arthritis |
| T10615 |
48077-48079 |
IN |
denotes |
in |
| T10616 |
48080-48086 |
NN |
denotes |
Bmpr1a |
| T10617 |
48087-48096 |
JJ |
denotes |
deficient |
| T10618 |
48086-48087 |
HYPH |
denotes |
- |
| T10619 |
48097-48101 |
NNS |
denotes |
mice |
| T10620 |
48109-48112 |
DT |
denotes |
the |
| T10621 |
48113-48124 |
NN |
denotes |
possibility |
| T10622 |
48125-48129 |
IN |
denotes |
that |
| T10623 |
48160-48170 |
VBP |
denotes |
contribute |
| T10624 |
48130-48137 |
NNS |
denotes |
defects |
| T10625 |
48138-48140 |
IN |
denotes |
in |
| T10626 |
48141-48144 |
NN |
denotes |
BMP |
| T10627 |
48145-48154 |
NN |
denotes |
signaling |
| T10628 |
48155-48159 |
RB |
denotes |
also |
| T10629 |
48171-48173 |
IN |
denotes |
to |
| T10630 |
48174-48179 |
JJ |
denotes |
human |
| T10631 |
48186-48193 |
NN |
denotes |
disease |
| T10632 |
48180-48185 |
NN |
denotes |
joint |
| T10633 |
48193-48194 |
. |
denotes |
. |
| T10634 |
48194-48407 |
sentence |
denotes |
Osteoarthritis is known to have a significant genetic component, but it likely involves multiple genetic factors that have been difficult to identify (Spector et al. 1996; Felson et al. 1998; Hirsch et al. 1998). |
| T10635 |
48195-48209 |
NN |
denotes |
Osteoarthritis |
| T10636 |
48213-48218 |
VBN |
denotes |
known |
| T10637 |
48210-48212 |
VBZ |
denotes |
is |
| T10638 |
48219-48221 |
TO |
denotes |
to |
| T10639 |
48222-48226 |
VB |
denotes |
have |
| T10640 |
48227-48228 |
DT |
denotes |
a |
| T10641 |
48249-48258 |
NN |
denotes |
component |
| T10642 |
48229-48240 |
JJ |
denotes |
significant |
| T10643 |
48241-48248 |
JJ |
denotes |
genetic |
| T10644 |
48258-48260 |
, |
denotes |
, |
| T10645 |
48260-48263 |
CC |
denotes |
but |
| T10646 |
48264-48266 |
PRP |
denotes |
it |
| T10647 |
48274-48282 |
VBZ |
denotes |
involves |
| T10648 |
48267-48273 |
RB |
denotes |
likely |
| T10649 |
48283-48291 |
JJ |
denotes |
multiple |
| T10650 |
48300-48307 |
NNS |
denotes |
factors |
| T10651 |
48292-48299 |
JJ |
denotes |
genetic |
| T10652 |
48308-48312 |
WDT |
denotes |
that |
| T10653 |
48318-48322 |
VBN |
denotes |
been |
| T10654 |
48313-48317 |
VBP |
denotes |
have |
| T10655 |
48323-48332 |
JJ |
denotes |
difficult |
| T10656 |
48333-48335 |
TO |
denotes |
to |
| T10657 |
48336-48344 |
VB |
denotes |
identify |
| T10658 |
48345-48346 |
-LRB- |
denotes |
( |
| T10659 |
48346-48353 |
NNP |
denotes |
Spector |
| T10660 |
48354-48356 |
FW |
denotes |
et |
| T10661 |
48357-48360 |
FW |
denotes |
al. |
| T10662 |
48361-48365 |
CD |
denotes |
1996 |
| T10663 |
48365-48366 |
: |
denotes |
; |
| T10664 |
48367-48373 |
NNP |
denotes |
Felson |
| T10665 |
48374-48376 |
FW |
denotes |
et |
| T10666 |
48377-48380 |
FW |
denotes |
al. |
| T10667 |
48381-48385 |
CD |
denotes |
1998 |
| T10668 |
48385-48386 |
: |
denotes |
; |
| T10669 |
48387-48393 |
NNP |
denotes |
Hirsch |
| T10670 |
48394-48396 |
FW |
denotes |
et |
| T10671 |
48397-48400 |
FW |
denotes |
al. |
| T10672 |
48401-48405 |
CD |
denotes |
1998 |
| T10673 |
48405-48406 |
-RRB- |
denotes |
) |
| T10674 |
48406-48407 |
. |
denotes |
. |
| T10675 |
48407-48633 |
sentence |
denotes |
Humans that are heterozygous for loss-of-function mutations in BMPR1A are known to be at risk for juvenile polyposis (Howe et al. 2001; Zhou et al. 2001), but the risk of osteoarthritis for these people has not been reported. |
| T10676 |
48408-48414 |
NNS |
denotes |
Humans |
| T10677 |
48482-48487 |
VBN |
denotes |
known |
| T10678 |
48415-48419 |
WDT |
denotes |
that |
| T10679 |
48420-48423 |
VBP |
denotes |
are |
| T10680 |
48424-48436 |
JJ |
denotes |
heterozygous |
| T10681 |
48437-48440 |
IN |
denotes |
for |
| T10682 |
48441-48445 |
NN |
denotes |
loss |
| T10683 |
48458-48467 |
NNS |
denotes |
mutations |
| T10684 |
48445-48446 |
HYPH |
denotes |
- |
| T10685 |
48446-48448 |
IN |
denotes |
of |
| T10686 |
48448-48449 |
HYPH |
denotes |
- |
| T10687 |
48449-48457 |
NN |
denotes |
function |
| T10688 |
48468-48470 |
IN |
denotes |
in |
| T10689 |
48471-48477 |
NN |
denotes |
BMPR1A |
| T10690 |
48478-48481 |
VBP |
denotes |
are |
| T10691 |
48488-48490 |
TO |
denotes |
to |
| T10692 |
48491-48493 |
VB |
denotes |
be |
| T10693 |
48494-48496 |
IN |
denotes |
at |
| T10694 |
48497-48501 |
NN |
denotes |
risk |
| T10695 |
48502-48505 |
IN |
denotes |
for |
| T10696 |
48506-48514 |
JJ |
denotes |
juvenile |
| T10697 |
48515-48524 |
NN |
denotes |
polyposis |
| T10698 |
48525-48526 |
-LRB- |
denotes |
( |
| T10699 |
48526-48530 |
NNP |
denotes |
Howe |
| T10700 |
48531-48533 |
FW |
denotes |
et |
| T10701 |
48534-48537 |
FW |
denotes |
al. |
| T10702 |
48538-48542 |
CD |
denotes |
2001 |
| T10703 |
48542-48543 |
: |
denotes |
; |
| T10704 |
48544-48548 |
NNP |
denotes |
Zhou |
| T10705 |
48549-48551 |
FW |
denotes |
et |
| T10706 |
48552-48555 |
FW |
denotes |
al. |
| T10707 |
48556-48560 |
CD |
denotes |
2001 |
| T10708 |
48560-48561 |
-RRB- |
denotes |
) |
| T10709 |
48561-48563 |
, |
denotes |
, |
| T10710 |
48563-48566 |
CC |
denotes |
but |
| T10711 |
48567-48570 |
DT |
denotes |
the |
| T10712 |
48571-48575 |
NN |
denotes |
risk |
| T10713 |
48624-48632 |
VBN |
denotes |
reported |
| T10714 |
48576-48578 |
IN |
denotes |
of |
| T10715 |
48579-48593 |
NN |
denotes |
osteoarthritis |
| T10716 |
48594-48597 |
IN |
denotes |
for |
| T10717 |
48598-48603 |
DT |
denotes |
these |
| T10718 |
48604-48610 |
NNS |
denotes |
people |
| T10719 |
48611-48614 |
VBZ |
denotes |
has |
| T10720 |
48615-48618 |
RB |
denotes |
not |
| T10721 |
48619-48623 |
VBN |
denotes |
been |
| T10722 |
48632-48633 |
. |
denotes |
. |
| T10723 |
48633-48790 |
sentence |
denotes |
However, the control mice used in this study were heterozygous for a null allele of Bmpr1a, and they showed little sign of osteoarthritis even late in life. |
| T10724 |
48634-48641 |
RB |
denotes |
However |
| T10725 |
48679-48683 |
VBD |
denotes |
were |
| T10726 |
48641-48643 |
, |
denotes |
, |
| T10727 |
48643-48646 |
DT |
denotes |
the |
| T10728 |
48655-48659 |
NNS |
denotes |
mice |
| T10729 |
48647-48654 |
NN |
denotes |
control |
| T10730 |
48660-48664 |
VBN |
denotes |
used |
| T10731 |
48665-48667 |
IN |
denotes |
in |
| T10732 |
48668-48672 |
DT |
denotes |
this |
| T10733 |
48673-48678 |
NN |
denotes |
study |
| T10734 |
48684-48696 |
JJ |
denotes |
heterozygous |
| T10735 |
48697-48700 |
IN |
denotes |
for |
| T10736 |
48701-48702 |
DT |
denotes |
a |
| T10737 |
48708-48714 |
NN |
denotes |
allele |
| T10738 |
48703-48707 |
JJ |
denotes |
null |
| T10739 |
48715-48717 |
IN |
denotes |
of |
| T10740 |
48718-48724 |
NN |
denotes |
Bmpr1a |
| T10741 |
48724-48726 |
, |
denotes |
, |
| T10742 |
48726-48729 |
CC |
denotes |
and |
| T10743 |
48730-48734 |
PRP |
denotes |
they |
| T10744 |
48735-48741 |
VBD |
denotes |
showed |
| T10745 |
48742-48748 |
JJ |
denotes |
little |
| T10746 |
48749-48753 |
NN |
denotes |
sign |
| T10747 |
48754-48756 |
IN |
denotes |
of |
| T10748 |
48757-48771 |
NN |
denotes |
osteoarthritis |
| T10749 |
48772-48776 |
RB |
denotes |
even |
| T10750 |
48777-48781 |
RB |
denotes |
late |
| T10751 |
48782-48784 |
IN |
denotes |
in |
| T10752 |
48785-48789 |
NN |
denotes |
life |
| T10753 |
48789-48790 |
. |
denotes |
. |
| T10754 |
48790-48959 |
sentence |
denotes |
Several chromosome regions have been previously linked to arthritis phenotypes in humans using either association studies in populations or linkage studies in families. |
| T10755 |
48791-48798 |
JJ |
denotes |
Several |
| T10756 |
48810-48817 |
NNS |
denotes |
regions |
| T10757 |
48799-48809 |
NN |
denotes |
chromosome |
| T10758 |
48839-48845 |
VBN |
denotes |
linked |
| T10759 |
48818-48822 |
VBP |
denotes |
have |
| T10760 |
48823-48827 |
VBN |
denotes |
been |
| T10761 |
48828-48838 |
RB |
denotes |
previously |
| T10762 |
48846-48848 |
IN |
denotes |
to |
| T10763 |
48849-48858 |
NN |
denotes |
arthritis |
| T10764 |
48859-48869 |
NNS |
denotes |
phenotypes |
| T10765 |
48870-48872 |
IN |
denotes |
in |
| T10766 |
48873-48879 |
NNS |
denotes |
humans |
| T10767 |
48880-48885 |
VBG |
denotes |
using |
| T10768 |
48886-48892 |
CC |
denotes |
either |
| T10769 |
48905-48912 |
NNS |
denotes |
studies |
| T10770 |
48893-48904 |
NN |
denotes |
association |
| T10771 |
48913-48915 |
IN |
denotes |
in |
| T10772 |
48916-48927 |
NNS |
denotes |
populations |
| T10773 |
48928-48930 |
CC |
denotes |
or |
| T10774 |
48931-48938 |
NN |
denotes |
linkage |
| T10775 |
48939-48946 |
NNS |
denotes |
studies |
| T10776 |
48947-48949 |
IN |
denotes |
in |
| T10777 |
48950-48958 |
NNS |
denotes |
families |
| T10778 |
48958-48959 |
. |
denotes |
. |
| T10779 |
48959-49329 |
sentence |
denotes |
It is interesting to note that several of these chromosome regions contain genes encoding different members of the BMP signaling pathway, including the BMP5 gene on human chromosome 6p12 (Loughlin et al. 2002), the MADH1 gene on human chromosome 4q26–4q31 (Leppavuori et al. 1999; Kent et al. 2002), and the BMPR2 receptor on human chromosome 2q33 (Wright et al. 1996). |
| T10780 |
48960-48962 |
PRP |
denotes |
It |
| T10781 |
48963-48965 |
VBZ |
denotes |
is |
| T10782 |
48966-48977 |
JJ |
denotes |
interesting |
| T10783 |
48978-48980 |
TO |
denotes |
to |
| T10784 |
48981-48985 |
VB |
denotes |
note |
| T10785 |
48986-48990 |
IN |
denotes |
that |
| T10786 |
49027-49034 |
VBP |
denotes |
contain |
| T10787 |
48991-48998 |
JJ |
denotes |
several |
| T10788 |
48999-49001 |
IN |
denotes |
of |
| T10789 |
49002-49007 |
DT |
denotes |
these |
| T10790 |
49019-49026 |
NNS |
denotes |
regions |
| T10791 |
49008-49018 |
NN |
denotes |
chromosome |
| T10792 |
49035-49040 |
NNS |
denotes |
genes |
| T10793 |
49041-49049 |
VBG |
denotes |
encoding |
| T10794 |
49050-49059 |
JJ |
denotes |
different |
| T10795 |
49060-49067 |
NNS |
denotes |
members |
| T10796 |
49068-49070 |
IN |
denotes |
of |
| T10797 |
49071-49074 |
DT |
denotes |
the |
| T10798 |
49089-49096 |
NN |
denotes |
pathway |
| T10799 |
49075-49078 |
NN |
denotes |
BMP |
| T10800 |
49079-49088 |
NN |
denotes |
signaling |
| T10801 |
49096-49098 |
, |
denotes |
, |
| T10802 |
49098-49107 |
VBG |
denotes |
including |
| T10803 |
49108-49111 |
DT |
denotes |
the |
| T10804 |
49117-49121 |
NN |
denotes |
gene |
| T10805 |
49112-49116 |
NN |
denotes |
BMP5 |
| T10806 |
49122-49124 |
IN |
denotes |
on |
| T10807 |
49125-49130 |
JJ |
denotes |
human |
| T10808 |
49142-49146 |
NN |
denotes |
6p12 |
| T10809 |
49131-49141 |
NN |
denotes |
chromosome |
| T10810 |
49147-49148 |
-LRB- |
denotes |
( |
| T10811 |
49148-49156 |
NNP |
denotes |
Loughlin |
| T10812 |
49157-49159 |
FW |
denotes |
et |
| T10813 |
49160-49163 |
FW |
denotes |
al. |
| T10814 |
49164-49168 |
CD |
denotes |
2002 |
| T10815 |
49168-49169 |
-RRB- |
denotes |
) |
| T10816 |
49169-49171 |
, |
denotes |
, |
| T10817 |
49171-49174 |
DT |
denotes |
the |
| T10818 |
49181-49185 |
NN |
denotes |
gene |
| T10819 |
49175-49180 |
NN |
denotes |
MADH1 |
| T10820 |
49186-49188 |
IN |
denotes |
on |
| T10821 |
49189-49194 |
JJ |
denotes |
human |
| T10822 |
49206-49210 |
NN |
denotes |
4q26 |
| T10823 |
49195-49205 |
NN |
denotes |
chromosome |
| T10824 |
49210-49211 |
SYM |
denotes |
– |
| T10825 |
49211-49215 |
NN |
denotes |
4q31 |
| T10826 |
49216-49217 |
-LRB- |
denotes |
( |
| T10827 |
49217-49227 |
NNP |
denotes |
Leppavuori |
| T10828 |
49228-49230 |
FW |
denotes |
et |
| T10829 |
49231-49234 |
FW |
denotes |
al. |
| T10830 |
49235-49239 |
CD |
denotes |
1999 |
| T10831 |
49239-49240 |
: |
denotes |
; |
| T10832 |
49241-49245 |
NNP |
denotes |
Kent |
| T10833 |
49246-49248 |
FW |
denotes |
et |
| T10834 |
49249-49252 |
FW |
denotes |
al. |
| T10835 |
49253-49257 |
CD |
denotes |
2002 |
| T10836 |
49257-49258 |
-RRB- |
denotes |
) |
| T10837 |
49258-49260 |
, |
denotes |
, |
| T10838 |
49260-49263 |
CC |
denotes |
and |
| T10839 |
49264-49267 |
DT |
denotes |
the |
| T10840 |
49274-49282 |
NN |
denotes |
receptor |
| T10841 |
49268-49273 |
NN |
denotes |
BMPR2 |
| T10842 |
49283-49285 |
IN |
denotes |
on |
| T10843 |
49286-49291 |
JJ |
denotes |
human |
| T10844 |
49303-49307 |
NN |
denotes |
2q33 |
| T10845 |
49292-49302 |
NN |
denotes |
chromosome |
| T10846 |
49308-49309 |
-LRB- |
denotes |
( |
| T10847 |
49309-49315 |
NNP |
denotes |
Wright |
| T10848 |
49316-49318 |
FW |
denotes |
et |
| T10849 |
49319-49322 |
FW |
denotes |
al. |
| T10850 |
49323-49327 |
CD |
denotes |
1996 |
| T10851 |
49327-49328 |
-RRB- |
denotes |
) |
| T10852 |
49328-49329 |
. |
denotes |
. |
| T10853 |
49329-49482 |
sentence |
denotes |
The complex nature of human osteoarthritis suggests that interactions between multiple genes may be involved in modifying susceptibility to the disease. |
| T10854 |
49330-49333 |
DT |
denotes |
The |
| T10855 |
49342-49348 |
NN |
denotes |
nature |
| T10856 |
49334-49341 |
JJ |
denotes |
complex |
| T10857 |
49373-49381 |
VBZ |
denotes |
suggests |
| T10858 |
49349-49351 |
IN |
denotes |
of |
| T10859 |
49352-49357 |
JJ |
denotes |
human |
| T10860 |
49358-49372 |
NN |
denotes |
osteoarthritis |
| T10861 |
49382-49386 |
IN |
denotes |
that |
| T10862 |
49430-49438 |
VBN |
denotes |
involved |
| T10863 |
49387-49399 |
NNS |
denotes |
interactions |
| T10864 |
49400-49407 |
IN |
denotes |
between |
| T10865 |
49408-49416 |
JJ |
denotes |
multiple |
| T10866 |
49417-49422 |
NNS |
denotes |
genes |
| T10867 |
49423-49426 |
MD |
denotes |
may |
| T10868 |
49427-49429 |
VB |
denotes |
be |
| T10869 |
49439-49441 |
IN |
denotes |
in |
| T10870 |
49442-49451 |
VBG |
denotes |
modifying |
| T10871 |
49452-49466 |
NN |
denotes |
susceptibility |
| T10872 |
49467-49469 |
IN |
denotes |
to |
| T10873 |
49470-49473 |
DT |
denotes |
the |
| T10874 |
49474-49481 |
NN |
denotes |
disease |
| T10875 |
49481-49482 |
. |
denotes |
. |
| T10876 |
49482-49660 |
sentence |
denotes |
The inclusion of genetic markers near BMP signaling components may help identify additional osteoarthritis susceptibility loci and facilitate the search for causative mutations. |
| T10877 |
49483-49486 |
DT |
denotes |
The |
| T10878 |
49487-49496 |
NN |
denotes |
inclusion |
| T10879 |
49550-49554 |
VB |
denotes |
help |
| T10880 |
49497-49499 |
IN |
denotes |
of |
| T10881 |
49500-49507 |
JJ |
denotes |
genetic |
| T10882 |
49508-49515 |
NNS |
denotes |
markers |
| T10883 |
49516-49520 |
IN |
denotes |
near |
| T10884 |
49521-49524 |
NN |
denotes |
BMP |
| T10885 |
49535-49545 |
NNS |
denotes |
components |
| T10886 |
49525-49534 |
NN |
denotes |
signaling |
| T10887 |
49546-49549 |
MD |
denotes |
may |
| T10888 |
49555-49563 |
VB |
denotes |
identify |
| T10889 |
49564-49574 |
JJ |
denotes |
additional |
| T10890 |
49605-49609 |
NNS |
denotes |
loci |
| T10891 |
49575-49589 |
NN |
denotes |
osteoarthritis |
| T10892 |
49590-49604 |
NN |
denotes |
susceptibility |
| T10893 |
49610-49613 |
CC |
denotes |
and |
| T10894 |
49614-49624 |
VB |
denotes |
facilitate |
| T10895 |
49625-49628 |
DT |
denotes |
the |
| T10896 |
49629-49635 |
NN |
denotes |
search |
| T10897 |
49636-49639 |
IN |
denotes |
for |
| T10898 |
49640-49649 |
JJ |
denotes |
causative |
| T10899 |
49650-49659 |
NNS |
denotes |
mutations |
| T10900 |
49659-49660 |
. |
denotes |
. |
| T10901 |
49660-49859 |
sentence |
denotes |
Development and disease processes in synovial joints have been difficult to study genetically, because synovial joints are generated and function at relatively late stages of vertebrate development. |
| T10902 |
49661-49672 |
NN |
denotes |
Development |
| T10903 |
49685-49694 |
NNS |
denotes |
processes |
| T10904 |
49673-49676 |
CC |
denotes |
and |
| T10905 |
49677-49684 |
NN |
denotes |
disease |
| T10906 |
49719-49723 |
VBN |
denotes |
been |
| T10907 |
49695-49697 |
IN |
denotes |
in |
| T10908 |
49698-49706 |
JJ |
denotes |
synovial |
| T10909 |
49707-49713 |
NNS |
denotes |
joints |
| T10910 |
49714-49718 |
VBP |
denotes |
have |
| T10911 |
49724-49733 |
JJ |
denotes |
difficult |
| T10912 |
49734-49736 |
TO |
denotes |
to |
| T10913 |
49737-49742 |
VB |
denotes |
study |
| T10914 |
49743-49754 |
RB |
denotes |
genetically |
| T10915 |
49754-49756 |
, |
denotes |
, |
| T10916 |
49756-49763 |
IN |
denotes |
because |
| T10917 |
49784-49793 |
VBN |
denotes |
generated |
| T10918 |
49764-49772 |
JJ |
denotes |
synovial |
| T10919 |
49773-49779 |
NNS |
denotes |
joints |
| T10920 |
49780-49783 |
VBP |
denotes |
are |
| T10921 |
49794-49797 |
CC |
denotes |
and |
| T10922 |
49798-49806 |
VBP |
denotes |
function |
| T10923 |
49807-49809 |
IN |
denotes |
at |
| T10924 |
49810-49820 |
RB |
denotes |
relatively |
| T10925 |
49821-49825 |
JJ |
denotes |
late |
| T10926 |
49826-49832 |
NNS |
denotes |
stages |
| T10927 |
49833-49835 |
IN |
denotes |
of |
| T10928 |
49836-49846 |
NN |
denotes |
vertebrate |
| T10929 |
49847-49858 |
NN |
denotes |
development |
| T10930 |
49858-49859 |
. |
denotes |
. |
| T10931 |
49859-50053 |
sentence |
denotes |
The Gdf5-Cre system provides a new method for restricting gene expression or inactivation primarily to articular regions, thus avoiding the pleiotropic functions of many genes in other tissues. |
| T10932 |
49860-49863 |
DT |
denotes |
The |
| T10933 |
49873-49879 |
NN |
denotes |
system |
| T10934 |
49864-49868 |
NN |
denotes |
Gdf5 |
| T10935 |
49869-49872 |
NN |
denotes |
Cre |
| T10936 |
49868-49869 |
HYPH |
denotes |
- |
| T10937 |
49880-49888 |
VBZ |
denotes |
provides |
| T10938 |
49889-49890 |
DT |
denotes |
a |
| T10939 |
49895-49901 |
NN |
denotes |
method |
| T10940 |
49891-49894 |
JJ |
denotes |
new |
| T10941 |
49902-49905 |
IN |
denotes |
for |
| T10942 |
49906-49917 |
VBG |
denotes |
restricting |
| T10943 |
49918-49922 |
NN |
denotes |
gene |
| T10944 |
49923-49933 |
NN |
denotes |
expression |
| T10945 |
49934-49936 |
CC |
denotes |
or |
| T10946 |
49937-49949 |
NN |
denotes |
inactivation |
| T10947 |
49950-49959 |
RB |
denotes |
primarily |
| T10948 |
49960-49962 |
IN |
denotes |
to |
| T10949 |
49963-49972 |
JJ |
denotes |
articular |
| T10950 |
49973-49980 |
NNS |
denotes |
regions |
| T10951 |
49980-49982 |
, |
denotes |
, |
| T10952 |
49982-49986 |
RB |
denotes |
thus |
| T10953 |
49987-49995 |
VBG |
denotes |
avoiding |
| T10954 |
49996-49999 |
DT |
denotes |
the |
| T10955 |
50012-50021 |
NNS |
denotes |
functions |
| T10956 |
50000-50011 |
JJ |
denotes |
pleiotropic |
| T10957 |
50022-50024 |
IN |
denotes |
of |
| T10958 |
50025-50029 |
JJ |
denotes |
many |
| T10959 |
50030-50035 |
NNS |
denotes |
genes |
| T10960 |
50036-50038 |
IN |
denotes |
in |
| T10961 |
50039-50044 |
JJ |
denotes |
other |
| T10962 |
50045-50052 |
NNS |
denotes |
tissues |
| T10963 |
50052-50053 |
. |
denotes |
. |
| T10964 |
50053-50299 |
sentence |
denotes |
Depending on the configuration of the floxed target gene, this system can be used to either activate the expression of a gene primarily in developing joints (ssee Figure 1B–1D), or to inactivate gene function in articular regions (see Figure 3). |
| T10965 |
50054-50063 |
VBG |
denotes |
Depending |
| T10966 |
50131-50135 |
VBN |
denotes |
used |
| T10967 |
50064-50066 |
IN |
denotes |
on |
| T10968 |
50067-50070 |
DT |
denotes |
the |
| T10969 |
50071-50084 |
NN |
denotes |
configuration |
| T10970 |
50085-50087 |
IN |
denotes |
of |
| T10971 |
50088-50091 |
DT |
denotes |
the |
| T10972 |
50106-50110 |
NN |
denotes |
gene |
| T10973 |
50092-50098 |
VBN |
denotes |
floxed |
| T10974 |
50099-50105 |
NN |
denotes |
target |
| T10975 |
50110-50112 |
, |
denotes |
, |
| T10976 |
50112-50116 |
DT |
denotes |
this |
| T10977 |
50117-50123 |
NN |
denotes |
system |
| T10978 |
50124-50127 |
MD |
denotes |
can |
| T10979 |
50128-50130 |
VB |
denotes |
be |
| T10980 |
50136-50138 |
TO |
denotes |
to |
| T10981 |
50146-50154 |
VB |
denotes |
activate |
| T10982 |
50139-50145 |
CC |
denotes |
either |
| T10983 |
50155-50158 |
DT |
denotes |
the |
| T10984 |
50159-50169 |
NN |
denotes |
expression |
| T10985 |
50170-50172 |
IN |
denotes |
of |
| T10986 |
50173-50174 |
DT |
denotes |
a |
| T10987 |
50175-50179 |
NN |
denotes |
gene |
| T10988 |
50180-50189 |
RB |
denotes |
primarily |
| T10989 |
50190-50192 |
IN |
denotes |
in |
| T10990 |
50193-50203 |
VBG |
denotes |
developing |
| T10991 |
50204-50210 |
NNS |
denotes |
joints |
| T10992 |
50211-50212 |
-LRB- |
denotes |
( |
| T10993 |
50212-50216 |
VB |
denotes |
ssee |
| T10994 |
50217-50223 |
NN |
denotes |
Figure |
| T10995 |
50224-50226 |
CD |
denotes |
1B |
| T10996 |
50226-50227 |
SYM |
denotes |
– |
| T10997 |
50227-50229 |
CD |
denotes |
1D |
| T10998 |
50229-50230 |
-RRB- |
denotes |
) |
| T10999 |
50230-50232 |
, |
denotes |
, |
| T11000 |
50232-50234 |
CC |
denotes |
or |
| T11001 |
50235-50237 |
TO |
denotes |
to |
| T11002 |
50238-50248 |
VB |
denotes |
inactivate |
| T11003 |
50249-50253 |
NN |
denotes |
gene |
| T11004 |
50254-50262 |
NN |
denotes |
function |
| T11005 |
50263-50265 |
IN |
denotes |
in |
| T11006 |
50266-50275 |
JJ |
denotes |
articular |
| T11007 |
50276-50283 |
NNS |
denotes |
regions |
| T11008 |
50284-50285 |
-LRB- |
denotes |
( |
| T11009 |
50285-50288 |
VB |
denotes |
see |
| T11010 |
50289-50295 |
NN |
denotes |
Figure |
| T11011 |
50296-50297 |
CD |
denotes |
3 |
| T11012 |
50297-50298 |
-RRB- |
denotes |
) |
| T11013 |
50298-50299 |
. |
denotes |
. |
| T11014 |
50299-50514 |
sentence |
denotes |
Additional studies with this system should greatly enhance our knowledge of the development, function, and disease mechanisms of joints, and may bring us closer to better prevention and treatment of joint diseases. |
| T11015 |
50300-50310 |
JJ |
denotes |
Additional |
| T11016 |
50311-50318 |
NNS |
denotes |
studies |
| T11017 |
50351-50358 |
VB |
denotes |
enhance |
| T11018 |
50319-50323 |
IN |
denotes |
with |
| T11019 |
50324-50328 |
DT |
denotes |
this |
| T11020 |
50329-50335 |
NN |
denotes |
system |
| T11021 |
50336-50342 |
MD |
denotes |
should |
| T11022 |
50343-50350 |
RB |
denotes |
greatly |
| T11023 |
50359-50362 |
PRP$ |
denotes |
our |
| T11024 |
50363-50372 |
NN |
denotes |
knowledge |
| T11025 |
50373-50375 |
IN |
denotes |
of |
| T11026 |
50376-50379 |
DT |
denotes |
the |
| T11027 |
50415-50425 |
NNS |
denotes |
mechanisms |
| T11028 |
50380-50391 |
NN |
denotes |
development |
| T11029 |
50391-50393 |
, |
denotes |
, |
| T11030 |
50393-50401 |
NN |
denotes |
function |
| T11031 |
50401-50403 |
, |
denotes |
, |
| T11032 |
50403-50406 |
CC |
denotes |
and |
| T11033 |
50407-50414 |
NN |
denotes |
disease |
| T11034 |
50426-50428 |
IN |
denotes |
of |
| T11035 |
50429-50435 |
NNS |
denotes |
joints |
| T11036 |
50435-50437 |
, |
denotes |
, |
| T11037 |
50437-50440 |
CC |
denotes |
and |
| T11038 |
50441-50444 |
MD |
denotes |
may |
| T11039 |
50445-50450 |
VB |
denotes |
bring |
| T11040 |
50451-50453 |
PRP |
denotes |
us |
| T11041 |
50454-50460 |
JJR |
denotes |
closer |
| T11042 |
50461-50463 |
IN |
denotes |
to |
| T11043 |
50464-50470 |
JJR |
denotes |
better |
| T11044 |
50471-50481 |
NN |
denotes |
prevention |
| T11045 |
50482-50485 |
CC |
denotes |
and |
| T11046 |
50486-50495 |
NN |
denotes |
treatment |
| T11047 |
50496-50498 |
IN |
denotes |
of |
| T11048 |
50499-50504 |
NN |
denotes |
joint |
| T11049 |
50505-50513 |
NNS |
denotes |
diseases |
| T11050 |
50513-50514 |
. |
denotes |
. |
| T11313 |
50539-50549 |
NN |
denotes |
Generation |
| T11314 |
50550-50552 |
IN |
denotes |
of |
| T11315 |
50553-50557 |
NN |
denotes |
Gdf5 |
| T11316 |
50558-50561 |
NN |
denotes |
Cre |
| T11317 |
50557-50558 |
HYPH |
denotes |
- |
| T11318 |
50562-50572 |
JJ |
denotes |
transgenic |
| T11319 |
50573-50577 |
NNS |
denotes |
mice |
| T11320 |
50577-50679 |
sentence |
denotes |
A mouse 129x1/SvJ BAC library (Invitrogen) was screened to identify a 140-kb BAC from the Gdf5 locus. |
| T11321 |
50578-50579 |
DT |
denotes |
A |
| T11322 |
50600-50607 |
NN |
denotes |
library |
| T11323 |
50580-50585 |
NN |
denotes |
mouse |
| T11324 |
50596-50599 |
NN |
denotes |
BAC |
| T11325 |
50586-50591 |
NN |
denotes |
129x1 |
| T11326 |
50592-50595 |
NN |
denotes |
SvJ |
| T11327 |
50591-50592 |
HYPH |
denotes |
/ |
| T11328 |
50625-50633 |
VBN |
denotes |
screened |
| T11329 |
50608-50609 |
-LRB- |
denotes |
( |
| T11330 |
50609-50619 |
NNP |
denotes |
Invitrogen |
| T11331 |
50619-50620 |
-RRB- |
denotes |
) |
| T11332 |
50621-50624 |
VBD |
denotes |
was |
| T11333 |
50634-50636 |
TO |
denotes |
to |
| T11334 |
50637-50645 |
VB |
denotes |
identify |
| T11335 |
50646-50647 |
DT |
denotes |
a |
| T11336 |
50655-50658 |
NN |
denotes |
BAC |
| T11337 |
50648-50651 |
CD |
denotes |
140 |
| T11338 |
50652-50654 |
NN |
denotes |
kb |
| T11339 |
50651-50652 |
HYPH |
denotes |
- |
| T11340 |
50659-50663 |
IN |
denotes |
from |
| T11341 |
50664-50667 |
DT |
denotes |
the |
| T11342 |
50673-50678 |
NN |
denotes |
locus |
| T11343 |
50668-50672 |
NN |
denotes |
Gdf5 |
| T11344 |
50678-50679 |
. |
denotes |
. |
| T11345 |
50679-50966 |
sentence |
denotes |
This BAC was modified using a homologous recombination system in E. coli (Yang et al. 1997) to place nuclear-localized Cre recombinase (from plasmid pML78, gift of Gail Martin) followed by IRES-hPLAP (from plasmid 1726, gift of Oliver Bogler) directly behind the ATG start site of Gdf5. |
| T11346 |
50680-50684 |
DT |
denotes |
This |
| T11347 |
50685-50688 |
NN |
denotes |
BAC |
| T11348 |
50693-50701 |
VBN |
denotes |
modified |
| T11349 |
50689-50692 |
VBD |
denotes |
was |
| T11350 |
50702-50707 |
VBG |
denotes |
using |
| T11351 |
50708-50709 |
DT |
denotes |
a |
| T11352 |
50735-50741 |
NN |
denotes |
system |
| T11353 |
50710-50720 |
JJ |
denotes |
homologous |
| T11354 |
50721-50734 |
NN |
denotes |
recombination |
| T11355 |
50742-50744 |
IN |
denotes |
in |
| T11356 |
50745-50747 |
NNP |
denotes |
E. |
| T11357 |
50748-50752 |
NNP |
denotes |
coli |
| T11358 |
50753-50754 |
-LRB- |
denotes |
( |
| T11359 |
50754-50758 |
NNP |
denotes |
Yang |
| T11360 |
50759-50761 |
FW |
denotes |
et |
| T11361 |
50762-50765 |
FW |
denotes |
al. |
| T11362 |
50766-50770 |
CD |
denotes |
1997 |
| T11363 |
50770-50771 |
-RRB- |
denotes |
) |
| T11364 |
50772-50774 |
TO |
denotes |
to |
| T11365 |
50775-50780 |
VB |
denotes |
place |
| T11366 |
50781-50788 |
JJ |
denotes |
nuclear |
| T11367 |
50789-50798 |
VBN |
denotes |
localized |
| T11368 |
50788-50789 |
HYPH |
denotes |
- |
| T11369 |
50803-50814 |
NN |
denotes |
recombinase |
| T11370 |
50799-50802 |
NN |
denotes |
Cre |
| T11371 |
50815-50816 |
-LRB- |
denotes |
( |
| T11372 |
50816-50820 |
IN |
denotes |
from |
| T11373 |
50821-50828 |
NN |
denotes |
plasmid |
| T11374 |
50829-50834 |
NN |
denotes |
pML78 |
| T11375 |
50834-50836 |
, |
denotes |
, |
| T11376 |
50836-50840 |
NN |
denotes |
gift |
| T11377 |
50841-50843 |
IN |
denotes |
of |
| T11378 |
50844-50848 |
NNP |
denotes |
Gail |
| T11379 |
50849-50855 |
NNP |
denotes |
Martin |
| T11380 |
50855-50856 |
-RRB- |
denotes |
) |
| T11381 |
50857-50865 |
VBN |
denotes |
followed |
| T11382 |
50866-50868 |
IN |
denotes |
by |
| T11383 |
50869-50873 |
NN |
denotes |
IRES |
| T11384 |
50874-50879 |
NN |
denotes |
hPLAP |
| T11385 |
50873-50874 |
HYPH |
denotes |
- |
| T11386 |
50880-50881 |
-LRB- |
denotes |
( |
| T11387 |
50881-50885 |
IN |
denotes |
from |
| T11388 |
50886-50893 |
NN |
denotes |
plasmid |
| T11389 |
50894-50898 |
CD |
denotes |
1726 |
| T11390 |
50898-50900 |
, |
denotes |
, |
| T11391 |
50900-50904 |
NN |
denotes |
gift |
| T11392 |
50905-50907 |
IN |
denotes |
of |
| T11393 |
50908-50914 |
NNP |
denotes |
Oliver |
| T11394 |
50915-50921 |
NNP |
denotes |
Bogler |
| T11395 |
50921-50922 |
-RRB- |
denotes |
) |
| T11396 |
50923-50931 |
RB |
denotes |
directly |
| T11397 |
50932-50938 |
IN |
denotes |
behind |
| T11398 |
50939-50942 |
DT |
denotes |
the |
| T11399 |
50953-50957 |
NN |
denotes |
site |
| T11400 |
50943-50946 |
NN |
denotes |
ATG |
| T11401 |
50947-50952 |
NN |
denotes |
start |
| T11402 |
50958-50960 |
IN |
denotes |
of |
| T11403 |
50961-50965 |
NN |
denotes |
Gdf5 |
| T11404 |
50965-50966 |
. |
denotes |
. |
| T11405 |
50966-51087 |
sentence |
denotes |
In the process, 583 bp of the first exon of Gdf5 was removed and no functional GDF5 protein is predicted to be produced. |
| T11406 |
50967-50969 |
IN |
denotes |
In |
| T11407 |
51020-51027 |
VBN |
denotes |
removed |
| T11408 |
50970-50973 |
DT |
denotes |
the |
| T11409 |
50974-50981 |
NN |
denotes |
process |
| T11410 |
50981-50983 |
, |
denotes |
, |
| T11411 |
50983-50986 |
CD |
denotes |
583 |
| T11412 |
50987-50989 |
NNS |
denotes |
bp |
| T11413 |
50990-50992 |
IN |
denotes |
of |
| T11414 |
50993-50996 |
DT |
denotes |
the |
| T11415 |
51003-51007 |
NN |
denotes |
exon |
| T11416 |
50997-51002 |
JJ |
denotes |
first |
| T11417 |
51008-51010 |
IN |
denotes |
of |
| T11418 |
51011-51015 |
NN |
denotes |
Gdf5 |
| T11419 |
51016-51019 |
VBD |
denotes |
was |
| T11420 |
51028-51031 |
CC |
denotes |
and |
| T11421 |
51032-51034 |
DT |
denotes |
no |
| T11422 |
51051-51058 |
NN |
denotes |
protein |
| T11423 |
51035-51045 |
JJ |
denotes |
functional |
| T11424 |
51046-51050 |
NN |
denotes |
GDF5 |
| T11425 |
51062-51071 |
VBN |
denotes |
predicted |
| T11426 |
51059-51061 |
VBZ |
denotes |
is |
| T11427 |
51072-51074 |
TO |
denotes |
to |
| T11428 |
51078-51086 |
VBN |
denotes |
produced |
| T11429 |
51075-51077 |
VB |
denotes |
be |
| T11430 |
51086-51087 |
. |
denotes |
. |
| T11431 |
51087-51379 |
sentence |
denotes |
The 5′ homology arm was subcloned from a PCR product tailed with XhoI and Bsp120I restriction sites that contains 781 bp of 5′ genomic Gdf5 sequence ending at the ATG translation start site (forward primer 5′-CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC-3′; reverse 5′-GTTTGGGCCCATCCTCTGGCCAGCCGCTG-3′). |
| T11432 |
51088-51091 |
DT |
denotes |
The |
| T11433 |
51104-51107 |
NN |
denotes |
arm |
| T11434 |
51092-51093 |
CD |
denotes |
5 |
| T11435 |
51093-51094 |
SYM |
denotes |
′ |
| T11436 |
51095-51103 |
NN |
denotes |
homology |
| T11437 |
51112-51121 |
VBN |
denotes |
subcloned |
| T11438 |
51108-51111 |
VBD |
denotes |
was |
| T11439 |
51122-51126 |
IN |
denotes |
from |
| T11440 |
51127-51128 |
DT |
denotes |
a |
| T11441 |
51133-51140 |
NN |
denotes |
product |
| T11442 |
51129-51132 |
NN |
denotes |
PCR |
| T11443 |
51141-51147 |
VBN |
denotes |
tailed |
| T11444 |
51148-51152 |
IN |
denotes |
with |
| T11445 |
51153-51157 |
NN |
denotes |
XhoI |
| T11446 |
51182-51187 |
NNS |
denotes |
sites |
| T11447 |
51158-51161 |
CC |
denotes |
and |
| T11448 |
51162-51169 |
NN |
denotes |
Bsp120I |
| T11449 |
51170-51181 |
NN |
denotes |
restriction |
| T11450 |
51188-51192 |
WDT |
denotes |
that |
| T11451 |
51193-51201 |
VBZ |
denotes |
contains |
| T11452 |
51202-51205 |
CD |
denotes |
781 |
| T11453 |
51206-51208 |
NNS |
denotes |
bp |
| T11454 |
51209-51211 |
IN |
denotes |
of |
| T11455 |
51212-51213 |
CD |
denotes |
5 |
| T11456 |
51228-51236 |
NN |
denotes |
sequence |
| T11457 |
51213-51214 |
SYM |
denotes |
′ |
| T11458 |
51215-51222 |
JJ |
denotes |
genomic |
| T11459 |
51223-51227 |
NN |
denotes |
Gdf5 |
| T11460 |
51237-51243 |
VBG |
denotes |
ending |
| T11461 |
51244-51246 |
IN |
denotes |
at |
| T11462 |
51247-51250 |
DT |
denotes |
the |
| T11463 |
51273-51277 |
NN |
denotes |
site |
| T11464 |
51251-51254 |
NN |
denotes |
ATG |
| T11465 |
51255-51266 |
NN |
denotes |
translation |
| T11466 |
51267-51272 |
NN |
denotes |
start |
| T11467 |
51278-51279 |
-LRB- |
denotes |
( |
| T11468 |
51345-51374 |
NN |
denotes |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| T11469 |
51279-51286 |
JJ |
denotes |
forward |
| T11470 |
51287-51293 |
NN |
denotes |
primer |
| T11471 |
51297-51329 |
NN |
denotes |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| T11472 |
51294-51295 |
CD |
denotes |
5 |
| T11473 |
51295-51296 |
SYM |
denotes |
′ |
| T11474 |
51296-51297 |
HYPH |
denotes |
- |
| T11475 |
51329-51330 |
HYPH |
denotes |
- |
| T11476 |
51330-51331 |
CD |
denotes |
3 |
| T11477 |
51331-51332 |
SYM |
denotes |
′ |
| T11478 |
51332-51333 |
: |
denotes |
; |
| T11479 |
51334-51341 |
JJ |
denotes |
reverse |
| T11480 |
51342-51343 |
CD |
denotes |
5 |
| T11481 |
51343-51344 |
SYM |
denotes |
′ |
| T11482 |
51344-51345 |
HYPH |
denotes |
- |
| T11483 |
51374-51375 |
HYPH |
denotes |
- |
| T11484 |
51375-51376 |
CD |
denotes |
3 |
| T11485 |
51376-51377 |
SYM |
denotes |
′ |
| T11486 |
51377-51378 |
-RRB- |
denotes |
) |
| T11487 |
51378-51379 |
. |
denotes |
. |
| T11488 |
51379-51444 |
sentence |
denotes |
Cre was subcloned from a 1.1-kb Bsp120I/EcoRI fragment of pML78. |
| T11489 |
51380-51383 |
NN |
denotes |
Cre |
| T11490 |
51388-51397 |
VBN |
denotes |
subcloned |
| T11491 |
51384-51387 |
VBD |
denotes |
was |
| T11492 |
51398-51402 |
IN |
denotes |
from |
| T11493 |
51403-51404 |
DT |
denotes |
a |
| T11494 |
51426-51434 |
NN |
denotes |
fragment |
| T11495 |
51405-51408 |
CD |
denotes |
1.1 |
| T11496 |
51409-51411 |
NN |
denotes |
kb |
| T11497 |
51408-51409 |
HYPH |
denotes |
- |
| T11498 |
51412-51419 |
NN |
denotes |
Bsp120I |
| T11499 |
51420-51425 |
NN |
denotes |
EcoRI |
| T11500 |
51419-51420 |
HYPH |
denotes |
/ |
| T11501 |
51435-51437 |
IN |
denotes |
of |
| T11502 |
51438-51443 |
NN |
denotes |
pML78 |
| T11503 |
51443-51444 |
. |
denotes |
. |
| T11504 |
51444-51691 |
sentence |
denotes |
IRES hPLAP was subcloned from a 2.1-kb PCR product tailed with EcoRI and SpeI sites that contains the hPLAP translation stop site (forward primer 5′-ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG-3′; reverse 5′-AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG-3′). |
| T11505 |
51445-51449 |
NN |
denotes |
IRES |
| T11506 |
51450-51455 |
NN |
denotes |
hPLAP |
| T11507 |
51460-51469 |
VBN |
denotes |
subcloned |
| T11508 |
51456-51459 |
VBD |
denotes |
was |
| T11509 |
51470-51474 |
IN |
denotes |
from |
| T11510 |
51475-51476 |
DT |
denotes |
a |
| T11511 |
51488-51495 |
NN |
denotes |
product |
| T11512 |
51477-51480 |
CD |
denotes |
2.1 |
| T11513 |
51481-51483 |
NN |
denotes |
kb |
| T11514 |
51480-51481 |
HYPH |
denotes |
- |
| T11515 |
51484-51487 |
NN |
denotes |
PCR |
| T11516 |
51496-51502 |
VBN |
denotes |
tailed |
| T11517 |
51503-51507 |
IN |
denotes |
with |
| T11518 |
51508-51513 |
NN |
denotes |
EcoRI |
| T11519 |
51523-51528 |
NNS |
denotes |
sites |
| T11520 |
51514-51517 |
CC |
denotes |
and |
| T11521 |
51518-51522 |
NN |
denotes |
SpeI |
| T11522 |
51529-51533 |
WDT |
denotes |
that |
| T11523 |
51534-51542 |
VBZ |
denotes |
contains |
| T11524 |
51543-51546 |
DT |
denotes |
the |
| T11525 |
51570-51574 |
NN |
denotes |
site |
| T11526 |
51547-51552 |
NN |
denotes |
hPLAP |
| T11527 |
51553-51564 |
NN |
denotes |
translation |
| T11528 |
51565-51569 |
NN |
denotes |
stop |
| T11529 |
51575-51576 |
-LRB- |
denotes |
( |
| T11530 |
51648-51686 |
NN |
denotes |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| T11531 |
51576-51583 |
JJ |
denotes |
forward |
| T11532 |
51584-51590 |
NN |
denotes |
primer |
| T11533 |
51594-51632 |
NN |
denotes |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| T11534 |
51591-51592 |
CD |
denotes |
5 |
| T11535 |
51592-51593 |
SYM |
denotes |
′ |
| T11536 |
51593-51594 |
HYPH |
denotes |
- |
| T11537 |
51632-51633 |
HYPH |
denotes |
- |
| T11538 |
51633-51634 |
CD |
denotes |
3 |
| T11539 |
51634-51635 |
SYM |
denotes |
′ |
| T11540 |
51635-51636 |
: |
denotes |
; |
| T11541 |
51637-51644 |
JJ |
denotes |
reverse |
| T11542 |
51645-51646 |
CD |
denotes |
5 |
| T11543 |
51646-51647 |
SYM |
denotes |
′ |
| T11544 |
51647-51648 |
HYPH |
denotes |
- |
| T11545 |
51686-51687 |
HYPH |
denotes |
- |
| T11546 |
51687-51688 |
CD |
denotes |
3 |
| T11547 |
51688-51689 |
SYM |
denotes |
′ |
| T11548 |
51689-51690 |
-RRB- |
denotes |
) |
| T11549 |
51690-51691 |
. |
denotes |
. |
| T11550 |
51691-51859 |
sentence |
denotes |
The 3′ homology arm was subcloned from a 0.8-kb PCR product amplified from a 0.9-kb XhoI Gdf5 genomic subclone containing part of the first exon and downstream intron. |
| T11551 |
51692-51695 |
DT |
denotes |
The |
| T11552 |
51708-51711 |
NN |
denotes |
arm |
| T11553 |
51696-51697 |
CD |
denotes |
3 |
| T11554 |
51697-51698 |
SYM |
denotes |
′ |
| T11555 |
51699-51707 |
NN |
denotes |
homology |
| T11556 |
51716-51725 |
VBN |
denotes |
subcloned |
| T11557 |
51712-51715 |
VBD |
denotes |
was |
| T11558 |
51726-51730 |
IN |
denotes |
from |
| T11559 |
51731-51732 |
DT |
denotes |
a |
| T11560 |
51744-51751 |
NN |
denotes |
product |
| T11561 |
51733-51736 |
CD |
denotes |
0.8 |
| T11562 |
51737-51739 |
NN |
denotes |
kb |
| T11563 |
51736-51737 |
HYPH |
denotes |
- |
| T11564 |
51740-51743 |
NN |
denotes |
PCR |
| T11565 |
51752-51761 |
VBN |
denotes |
amplified |
| T11566 |
51762-51766 |
IN |
denotes |
from |
| T11567 |
51767-51768 |
DT |
denotes |
a |
| T11568 |
51794-51802 |
NN |
denotes |
subclone |
| T11569 |
51769-51772 |
CD |
denotes |
0.9 |
| T11570 |
51773-51775 |
NN |
denotes |
kb |
| T11571 |
51772-51773 |
HYPH |
denotes |
- |
| T11572 |
51776-51780 |
NN |
denotes |
XhoI |
| T11573 |
51781-51785 |
NN |
denotes |
Gdf5 |
| T11574 |
51786-51793 |
JJ |
denotes |
genomic |
| T11575 |
51803-51813 |
VBG |
denotes |
containing |
| T11576 |
51814-51818 |
NN |
denotes |
part |
| T11577 |
51819-51821 |
IN |
denotes |
of |
| T11578 |
51822-51825 |
DT |
denotes |
the |
| T11579 |
51832-51836 |
NN |
denotes |
exon |
| T11580 |
51826-51831 |
JJ |
denotes |
first |
| T11581 |
51837-51840 |
CC |
denotes |
and |
| T11582 |
51841-51851 |
JJ |
denotes |
downstream |
| T11583 |
51852-51858 |
NN |
denotes |
intron |
| T11584 |
51858-51859 |
. |
denotes |
. |
| T11585 |
51859-52174 |
sentence |
denotes |
The forward primer contains the 3′ end of the first exon and is tailed with a SpeI site; the reverse primer is from the T7 promoter of the vector containing the 0.9-kb subclone and flanks the intronic XhoI site (forward primer 5′-CTAAACTAGTCACCAGCTTTATTGACAAAGG-3′; reverse 5′-GATTTCTAGAGTAATACGACTCACTATAGGGC-3′). |
| T11586 |
51860-51863 |
DT |
denotes |
The |
| T11587 |
51872-51878 |
NN |
denotes |
primer |
| T11588 |
51864-51871 |
JJ |
denotes |
forward |
| T11589 |
51879-51887 |
VBZ |
denotes |
contains |
| T11590 |
51968-51970 |
VBZ |
denotes |
is |
| T11591 |
51888-51891 |
DT |
denotes |
the |
| T11592 |
51895-51898 |
NN |
denotes |
end |
| T11593 |
51892-51893 |
CD |
denotes |
3 |
| T11594 |
51893-51894 |
SYM |
denotes |
′ |
| T11595 |
51899-51901 |
IN |
denotes |
of |
| T11596 |
51902-51905 |
DT |
denotes |
the |
| T11597 |
51912-51916 |
NN |
denotes |
exon |
| T11598 |
51906-51911 |
JJ |
denotes |
first |
| T11599 |
51917-51920 |
CC |
denotes |
and |
| T11600 |
51921-51923 |
VBZ |
denotes |
is |
| T11601 |
51924-51930 |
VBN |
denotes |
tailed |
| T11602 |
51931-51935 |
IN |
denotes |
with |
| T11603 |
51936-51937 |
DT |
denotes |
a |
| T11604 |
51943-51947 |
NN |
denotes |
site |
| T11605 |
51938-51942 |
NN |
denotes |
SpeI |
| T11606 |
51947-51948 |
: |
denotes |
; |
| T11607 |
51949-51952 |
DT |
denotes |
the |
| T11608 |
51961-51967 |
NN |
denotes |
primer |
| T11609 |
51953-51960 |
JJ |
denotes |
reverse |
| T11610 |
51971-51975 |
IN |
denotes |
from |
| T11611 |
51976-51979 |
DT |
denotes |
the |
| T11612 |
51983-51991 |
NN |
denotes |
promoter |
| T11613 |
51980-51982 |
NN |
denotes |
T7 |
| T11614 |
51992-51994 |
IN |
denotes |
of |
| T11615 |
51995-51998 |
DT |
denotes |
the |
| T11616 |
51999-52005 |
NN |
denotes |
vector |
| T11617 |
52006-52016 |
VBG |
denotes |
containing |
| T11618 |
52017-52020 |
DT |
denotes |
the |
| T11619 |
52028-52036 |
NN |
denotes |
subclone |
| T11620 |
52021-52024 |
CD |
denotes |
0.9 |
| T11621 |
52025-52027 |
NN |
denotes |
kb |
| T11622 |
52024-52025 |
HYPH |
denotes |
- |
| T11623 |
52037-52040 |
CC |
denotes |
and |
| T11624 |
52041-52047 |
VBZ |
denotes |
flanks |
| T11625 |
52048-52051 |
DT |
denotes |
the |
| T11626 |
52066-52070 |
NN |
denotes |
site |
| T11627 |
52052-52060 |
JJ |
denotes |
intronic |
| T11628 |
52061-52065 |
NN |
denotes |
XhoI |
| T11629 |
52071-52072 |
-LRB- |
denotes |
( |
| T11630 |
52137-52169 |
NN |
denotes |
GATTTCTAGAGTAATACGACTCACTATAGGGC |
| T11631 |
52072-52079 |
JJ |
denotes |
forward |
| T11632 |
52080-52086 |
NN |
denotes |
primer |
| T11633 |
52090-52121 |
NN |
denotes |
CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| T11634 |
52087-52088 |
CD |
denotes |
5 |
| T11635 |
52088-52089 |
SYM |
denotes |
′ |
| T11636 |
52089-52090 |
HYPH |
denotes |
- |
| T11637 |
52121-52122 |
HYPH |
denotes |
- |
| T11638 |
52122-52123 |
CD |
denotes |
3 |
| T11639 |
52123-52124 |
SYM |
denotes |
′ |
| T11640 |
52124-52125 |
: |
denotes |
; |
| T11641 |
52126-52133 |
JJ |
denotes |
reverse |
| T11642 |
52134-52135 |
CD |
denotes |
5 |
| T11643 |
52135-52136 |
SYM |
denotes |
′ |
| T11644 |
52136-52137 |
HYPH |
denotes |
- |
| T11645 |
52169-52170 |
HYPH |
denotes |
- |
| T11646 |
52170-52171 |
CD |
denotes |
3 |
| T11647 |
52171-52172 |
SYM |
denotes |
′ |
| T11648 |
52172-52173 |
-RRB- |
denotes |
) |
| T11649 |
52173-52174 |
. |
denotes |
. |
| T11650 |
52174-52395 |
sentence |
denotes |
The targeting construct was built and verified in pBSSK (Stratagene, La Jolla, California, United States), then digested with XhoI and subcloned into pSV1, the vector used for homologous recombination (Yang et al. 1997). |
| T11651 |
52175-52178 |
DT |
denotes |
The |
| T11652 |
52189-52198 |
NN |
denotes |
construct |
| T11653 |
52179-52188 |
NN |
denotes |
targeting |
| T11654 |
52203-52208 |
VBN |
denotes |
built |
| T11655 |
52199-52202 |
VBD |
denotes |
was |
| T11656 |
52209-52212 |
CC |
denotes |
and |
| T11657 |
52213-52221 |
VBN |
denotes |
verified |
| T11658 |
52222-52224 |
IN |
denotes |
in |
| T11659 |
52225-52230 |
NN |
denotes |
pBSSK |
| T11660 |
52231-52232 |
-LRB- |
denotes |
( |
| T11661 |
52232-52242 |
NNP |
denotes |
Stratagene |
| T11662 |
52242-52244 |
, |
denotes |
, |
| T11663 |
52244-52246 |
NNP |
denotes |
La |
| T11664 |
52247-52252 |
NNP |
denotes |
Jolla |
| T11665 |
52252-52254 |
, |
denotes |
, |
| T11666 |
52254-52264 |
NNP |
denotes |
California |
| T11667 |
52264-52266 |
, |
denotes |
, |
| T11668 |
52266-52272 |
NNP |
denotes |
United |
| T11669 |
52273-52279 |
NNP |
denotes |
States |
| T11670 |
52279-52280 |
-RRB- |
denotes |
) |
| T11671 |
52280-52282 |
, |
denotes |
, |
| T11672 |
52282-52286 |
RB |
denotes |
then |
| T11673 |
52287-52295 |
VBN |
denotes |
digested |
| T11674 |
52296-52300 |
IN |
denotes |
with |
| T11675 |
52301-52305 |
NN |
denotes |
XhoI |
| T11676 |
52306-52309 |
CC |
denotes |
and |
| T11677 |
52310-52319 |
VBN |
denotes |
subcloned |
| T11678 |
52320-52324 |
IN |
denotes |
into |
| T11679 |
52325-52329 |
NN |
denotes |
pSV1 |
| T11680 |
52329-52331 |
, |
denotes |
, |
| T11681 |
52331-52334 |
DT |
denotes |
the |
| T11682 |
52335-52341 |
NN |
denotes |
vector |
| T11683 |
52342-52346 |
VBN |
denotes |
used |
| T11684 |
52347-52350 |
IN |
denotes |
for |
| T11685 |
52351-52361 |
JJ |
denotes |
homologous |
| T11686 |
52362-52375 |
NN |
denotes |
recombination |
| T11687 |
52376-52377 |
-LRB- |
denotes |
( |
| T11688 |
52377-52381 |
NNP |
denotes |
Yang |
| T11689 |
52382-52384 |
FW |
denotes |
et |
| T11690 |
52385-52388 |
FW |
denotes |
al. |
| T11691 |
52389-52393 |
CD |
denotes |
1997 |
| T11692 |
52393-52394 |
-RRB- |
denotes |
) |
| T11693 |
52394-52395 |
. |
denotes |
. |
| T11694 |
52395-52543 |
sentence |
denotes |
Southern blotting, PCR, and DNA sequence analysis confirmed the appropriate targeting construct and BAC modifications were made (unpublished data). |
| T11695 |
52396-52404 |
NNP |
denotes |
Southern |
| T11696 |
52405-52413 |
NN |
denotes |
blotting |
| T11697 |
52437-52445 |
NN |
denotes |
analysis |
| T11698 |
52413-52415 |
, |
denotes |
, |
| T11699 |
52415-52418 |
NN |
denotes |
PCR |
| T11700 |
52418-52420 |
, |
denotes |
, |
| T11701 |
52420-52423 |
CC |
denotes |
and |
| T11702 |
52424-52427 |
NN |
denotes |
DNA |
| T11703 |
52428-52436 |
NN |
denotes |
sequence |
| T11704 |
52446-52455 |
VBD |
denotes |
confirmed |
| T11705 |
52456-52459 |
DT |
denotes |
the |
| T11706 |
52482-52491 |
NN |
denotes |
construct |
| T11707 |
52460-52471 |
JJ |
denotes |
appropriate |
| T11708 |
52472-52481 |
NN |
denotes |
targeting |
| T11709 |
52519-52523 |
VBN |
denotes |
made |
| T11710 |
52492-52495 |
CC |
denotes |
and |
| T11711 |
52496-52499 |
NN |
denotes |
BAC |
| T11712 |
52500-52513 |
NNS |
denotes |
modifications |
| T11713 |
52514-52518 |
VBD |
denotes |
were |
| T11714 |
52524-52525 |
-LRB- |
denotes |
( |
| T11715 |
52537-52541 |
NNS |
denotes |
data |
| T11716 |
52525-52536 |
JJ |
denotes |
unpublished |
| T11717 |
52541-52542 |
-RRB- |
denotes |
) |
| T11718 |
52542-52543 |
. |
denotes |
. |
| T11719 |
52543-52745 |
sentence |
denotes |
Before the modified BAC was injected to produce transgenic animals, a loxP site present in the BAC vector, pBeloBAC11, was removed to prevent the addition of undesired Cre target sites into the genome. |
| T11720 |
52544-52550 |
IN |
denotes |
Before |
| T11721 |
52572-52580 |
VBN |
denotes |
injected |
| T11722 |
52551-52554 |
DT |
denotes |
the |
| T11723 |
52564-52567 |
NN |
denotes |
BAC |
| T11724 |
52555-52563 |
VBN |
denotes |
modified |
| T11725 |
52568-52571 |
VBD |
denotes |
was |
| T11726 |
52667-52674 |
VBN |
denotes |
removed |
| T11727 |
52581-52583 |
TO |
denotes |
to |
| T11728 |
52584-52591 |
VB |
denotes |
produce |
| T11729 |
52592-52602 |
JJ |
denotes |
transgenic |
| T11730 |
52603-52610 |
NNS |
denotes |
animals |
| T11731 |
52610-52612 |
, |
denotes |
, |
| T11732 |
52612-52613 |
DT |
denotes |
a |
| T11733 |
52619-52623 |
NN |
denotes |
site |
| T11734 |
52614-52618 |
NN |
denotes |
loxP |
| T11735 |
52624-52631 |
JJ |
denotes |
present |
| T11736 |
52632-52634 |
IN |
denotes |
in |
| T11737 |
52635-52638 |
DT |
denotes |
the |
| T11738 |
52643-52649 |
NN |
denotes |
vector |
| T11739 |
52639-52642 |
NN |
denotes |
BAC |
| T11740 |
52649-52651 |
, |
denotes |
, |
| T11741 |
52651-52661 |
NN |
denotes |
pBeloBAC11 |
| T11742 |
52661-52663 |
, |
denotes |
, |
| T11743 |
52663-52666 |
VBD |
denotes |
was |
| T11744 |
52675-52677 |
TO |
denotes |
to |
| T11745 |
52678-52685 |
VB |
denotes |
prevent |
| T11746 |
52686-52689 |
DT |
denotes |
the |
| T11747 |
52690-52698 |
NN |
denotes |
addition |
| T11748 |
52699-52701 |
IN |
denotes |
of |
| T11749 |
52702-52711 |
JJ |
denotes |
undesired |
| T11750 |
52723-52728 |
NNS |
denotes |
sites |
| T11751 |
52712-52715 |
NN |
denotes |
Cre |
| T11752 |
52716-52722 |
NN |
denotes |
target |
| T11753 |
52729-52733 |
IN |
denotes |
into |
| T11754 |
52734-52737 |
DT |
denotes |
the |
| T11755 |
52738-52744 |
NN |
denotes |
genome |
| T11756 |
52744-52745 |
. |
denotes |
. |
| T11757 |
52745-52900 |
sentence |
denotes |
To do this, BAC DNA was prepared by CsCl separation, digested with NotI to free the insert from the vector, and size-fractionated over a sucrose gradient. |
| T11758 |
52746-52748 |
TO |
denotes |
To |
| T11759 |
52749-52751 |
VB |
denotes |
do |
| T11760 |
52770-52778 |
VBN |
denotes |
prepared |
| T11761 |
52752-52756 |
DT |
denotes |
this |
| T11762 |
52756-52758 |
, |
denotes |
, |
| T11763 |
52758-52761 |
NN |
denotes |
BAC |
| T11764 |
52762-52765 |
NN |
denotes |
DNA |
| T11765 |
52766-52769 |
VBD |
denotes |
was |
| T11766 |
52779-52781 |
IN |
denotes |
by |
| T11767 |
52782-52786 |
NN |
denotes |
CsCl |
| T11768 |
52787-52797 |
NN |
denotes |
separation |
| T11769 |
52797-52799 |
, |
denotes |
, |
| T11770 |
52799-52807 |
VBN |
denotes |
digested |
| T11771 |
52808-52812 |
IN |
denotes |
with |
| T11772 |
52813-52817 |
NN |
denotes |
NotI |
| T11773 |
52818-52820 |
TO |
denotes |
to |
| T11774 |
52821-52825 |
VB |
denotes |
free |
| T11775 |
52826-52829 |
DT |
denotes |
the |
| T11776 |
52830-52836 |
NN |
denotes |
insert |
| T11777 |
52837-52841 |
IN |
denotes |
from |
| T11778 |
52842-52845 |
DT |
denotes |
the |
| T11779 |
52846-52852 |
NN |
denotes |
vector |
| T11780 |
52852-52854 |
, |
denotes |
, |
| T11781 |
52854-52857 |
CC |
denotes |
and |
| T11782 |
52858-52862 |
NN |
denotes |
size |
| T11783 |
52863-52875 |
VBN |
denotes |
fractionated |
| T11784 |
52862-52863 |
HYPH |
denotes |
- |
| T11785 |
52876-52880 |
IN |
denotes |
over |
| T11786 |
52881-52882 |
DT |
denotes |
a |
| T11787 |
52891-52899 |
NN |
denotes |
gradient |
| T11788 |
52883-52890 |
NN |
denotes |
sucrose |
| T11789 |
52899-52900 |
. |
denotes |
. |
| T11790 |
52900-53011 |
sentence |
denotes |
Aliquots of fractions were run on a pulse-field gel and Southern blotted using vector-specific DNA as a probe. |
| T11791 |
52901-52909 |
NNS |
denotes |
Aliquots |
| T11792 |
52928-52931 |
VBN |
denotes |
run |
| T11793 |
52910-52912 |
IN |
denotes |
of |
| T11794 |
52913-52922 |
NNS |
denotes |
fractions |
| T11795 |
52923-52927 |
VBD |
denotes |
were |
| T11796 |
52932-52934 |
IN |
denotes |
on |
| T11797 |
52935-52936 |
DT |
denotes |
a |
| T11798 |
52949-52952 |
NN |
denotes |
gel |
| T11799 |
52937-52942 |
NN |
denotes |
pulse |
| T11800 |
52943-52948 |
NN |
denotes |
field |
| T11801 |
52942-52943 |
HYPH |
denotes |
- |
| T11802 |
52953-52956 |
CC |
denotes |
and |
| T11803 |
52957-52965 |
NNP |
denotes |
Southern |
| T11804 |
52966-52973 |
VBN |
denotes |
blotted |
| T11805 |
52974-52979 |
VBG |
denotes |
using |
| T11806 |
52980-52986 |
NN |
denotes |
vector |
| T11807 |
52996-52999 |
NN |
denotes |
DNA |
| T11808 |
52986-52987 |
HYPH |
denotes |
- |
| T11809 |
52987-52995 |
JJ |
denotes |
specific |
| T11810 |
53000-53002 |
IN |
denotes |
as |
| T11811 |
53003-53004 |
DT |
denotes |
a |
| T11812 |
53005-53010 |
NN |
denotes |
probe |
| T11813 |
53010-53011 |
. |
denotes |
. |
| T11814 |
53011-53261 |
sentence |
denotes |
Fractions containing unsheared insert and almost no detectable vector DNA were dialyzed in microinjection buffer (10 mM Tris [pH 7.4] with 0.15 mM EDTA [pH 8.0]) using Centriprep-30 concentrators (Millipore, Billerica, Massachusetts, United States). |
| T11815 |
53012-53021 |
NNS |
denotes |
Fractions |
| T11816 |
53091-53099 |
VBN |
denotes |
dialyzed |
| T11817 |
53022-53032 |
VBG |
denotes |
containing |
| T11818 |
53033-53042 |
JJ |
denotes |
unsheared |
| T11819 |
53043-53049 |
NN |
denotes |
insert |
| T11820 |
53050-53053 |
CC |
denotes |
and |
| T11821 |
53054-53060 |
RB |
denotes |
almost |
| T11822 |
53082-53085 |
NN |
denotes |
DNA |
| T11823 |
53061-53063 |
DT |
denotes |
no |
| T11824 |
53064-53074 |
JJ |
denotes |
detectable |
| T11825 |
53075-53081 |
NN |
denotes |
vector |
| T11826 |
53086-53090 |
VBD |
denotes |
were |
| T11827 |
53100-53102 |
IN |
denotes |
in |
| T11828 |
53103-53117 |
NN |
denotes |
microinjection |
| T11829 |
53118-53124 |
NN |
denotes |
buffer |
| T11830 |
53125-53126 |
-LRB- |
denotes |
( |
| T11831 |
53132-53136 |
NN |
denotes |
Tris |
| T11832 |
53126-53128 |
CD |
denotes |
10 |
| T11833 |
53129-53131 |
NN |
denotes |
mM |
| T11834 |
53137-53138 |
-LRB- |
denotes |
[ |
| T11835 |
53138-53140 |
NN |
denotes |
pH |
| T11836 |
53141-53144 |
CD |
denotes |
7.4 |
| T11837 |
53144-53145 |
-RRB- |
denotes |
] |
| T11838 |
53146-53150 |
IN |
denotes |
with |
| T11839 |
53151-53155 |
CD |
denotes |
0.15 |
| T11840 |
53156-53158 |
NN |
denotes |
mM |
| T11841 |
53159-53163 |
NN |
denotes |
EDTA |
| T11842 |
53164-53165 |
-LRB- |
denotes |
[ |
| T11843 |
53165-53167 |
NN |
denotes |
pH |
| T11844 |
53168-53171 |
CD |
denotes |
8.0 |
| T11845 |
53171-53172 |
-RRB- |
denotes |
] |
| T11846 |
53172-53173 |
-RRB- |
denotes |
) |
| T11847 |
53174-53179 |
VBG |
denotes |
using |
| T11848 |
53180-53190 |
NN |
denotes |
Centriprep |
| T11849 |
53194-53207 |
NNS |
denotes |
concentrators |
| T11850 |
53190-53191 |
HYPH |
denotes |
- |
| T11851 |
53191-53193 |
CD |
denotes |
30 |
| T11852 |
53208-53209 |
-LRB- |
denotes |
( |
| T11853 |
53209-53218 |
NNP |
denotes |
Millipore |
| T11854 |
53218-53220 |
, |
denotes |
, |
| T11855 |
53220-53229 |
NNP |
denotes |
Billerica |
| T11856 |
53229-53231 |
, |
denotes |
, |
| T11857 |
53231-53244 |
NNP |
denotes |
Massachusetts |
| T11858 |
53244-53246 |
, |
denotes |
, |
| T11859 |
53246-53252 |
NNP |
denotes |
United |
| T11860 |
53253-53259 |
NNP |
denotes |
States |
| T11861 |
53259-53260 |
-RRB- |
denotes |
) |
| T11862 |
53260-53261 |
. |
denotes |
. |
| T11863 |
53261-53415 |
sentence |
denotes |
This purified insert DNA was adjusted to 1 ng/μl and injected into the pronucleus of fertilized eggs from FVB/N mice by the Stanford Transgenic Facility. |
| T11864 |
53262-53266 |
DT |
denotes |
This |
| T11865 |
53283-53286 |
NN |
denotes |
DNA |
| T11866 |
53267-53275 |
VBN |
denotes |
purified |
| T11867 |
53276-53282 |
NN |
denotes |
insert |
| T11868 |
53291-53299 |
VBN |
denotes |
adjusted |
| T11869 |
53287-53290 |
VBD |
denotes |
was |
| T11870 |
53300-53302 |
IN |
denotes |
to |
| T11871 |
53303-53304 |
CD |
denotes |
1 |
| T11872 |
53305-53307 |
NN |
denotes |
ng |
| T11873 |
53307-53308 |
SYM |
denotes |
/ |
| T11874 |
53308-53310 |
NN |
denotes |
μl |
| T11875 |
53311-53314 |
CC |
denotes |
and |
| T11876 |
53315-53323 |
VBN |
denotes |
injected |
| T11877 |
53324-53328 |
IN |
denotes |
into |
| T11878 |
53329-53332 |
DT |
denotes |
the |
| T11879 |
53333-53343 |
NN |
denotes |
pronucleus |
| T11880 |
53344-53346 |
IN |
denotes |
of |
| T11881 |
53347-53357 |
VBN |
denotes |
fertilized |
| T11882 |
53358-53362 |
NNS |
denotes |
eggs |
| T11883 |
53363-53367 |
IN |
denotes |
from |
| T11884 |
53368-53371 |
NN |
denotes |
FVB |
| T11885 |
53372-53373 |
NN |
denotes |
N |
| T11886 |
53371-53372 |
HYPH |
denotes |
/ |
| T11887 |
53374-53378 |
NNS |
denotes |
mice |
| T11888 |
53379-53381 |
IN |
denotes |
by |
| T11889 |
53382-53385 |
DT |
denotes |
the |
| T11890 |
53406-53414 |
NNP |
denotes |
Facility |
| T11891 |
53386-53394 |
NNP |
denotes |
Stanford |
| T11892 |
53395-53405 |
NNP |
denotes |
Transgenic |
| T11893 |
53414-53415 |
. |
denotes |
. |
| T11894 |
53415-53764 |
sentence |
denotes |
Transgenic founder mice were identified by PCR using Cre-specific primers 5′-GCCTGCATTACCGGTCGATGCAACGA-3′ and 5′-GTGGCAGATGGCGCGGCAACACCATT-3′, which amplify a 725-bp product, and were assessed for absence of BAC vector using vector-specific primers 5′-CGGAGTCTGATGCGGTTGCGATG-3′ and 5′-AGTGCTGTTCCCTGGTGCTTCCTC-3′, which amplify a 465-bp product. |
| T11895 |
53416-53426 |
JJ |
denotes |
Transgenic |
| T11896 |
53435-53439 |
NNS |
denotes |
mice |
| T11897 |
53427-53434 |
NN |
denotes |
founder |
| T11898 |
53445-53455 |
VBN |
denotes |
identified |
| T11899 |
53440-53444 |
VBD |
denotes |
were |
| T11900 |
53456-53458 |
IN |
denotes |
by |
| T11901 |
53459-53462 |
NN |
denotes |
PCR |
| T11902 |
53463-53468 |
VBG |
denotes |
using |
| T11903 |
53469-53472 |
NN |
denotes |
Cre |
| T11904 |
53473-53481 |
JJ |
denotes |
specific |
| T11905 |
53472-53473 |
HYPH |
denotes |
- |
| T11906 |
53493-53519 |
NN |
denotes |
GCCTGCATTACCGGTCGATGCAACGA |
| T11907 |
53482-53489 |
NNS |
denotes |
primers |
| T11908 |
53490-53491 |
CD |
denotes |
5 |
| T11909 |
53491-53492 |
SYM |
denotes |
′ |
| T11910 |
53492-53493 |
HYPH |
denotes |
- |
| T11911 |
53519-53520 |
HYPH |
denotes |
- |
| T11912 |
53520-53521 |
CD |
denotes |
3 |
| T11913 |
53521-53522 |
SYM |
denotes |
′ |
| T11914 |
53523-53526 |
CC |
denotes |
and |
| T11915 |
53527-53528 |
CD |
denotes |
5 |
| T11916 |
53530-53556 |
NN |
denotes |
GTGGCAGATGGCGCGGCAACACCATT |
| T11917 |
53528-53529 |
SYM |
denotes |
′ |
| T11918 |
53529-53530 |
HYPH |
denotes |
- |
| T11919 |
53556-53557 |
HYPH |
denotes |
- |
| T11920 |
53557-53558 |
CD |
denotes |
3 |
| T11921 |
53558-53559 |
SYM |
denotes |
′ |
| T11922 |
53559-53561 |
, |
denotes |
, |
| T11923 |
53561-53566 |
WDT |
denotes |
which |
| T11924 |
53567-53574 |
VBP |
denotes |
amplify |
| T11925 |
53575-53576 |
DT |
denotes |
a |
| T11926 |
53584-53591 |
NN |
denotes |
product |
| T11927 |
53577-53580 |
CD |
denotes |
725 |
| T11928 |
53581-53583 |
NN |
denotes |
bp |
| T11929 |
53580-53581 |
HYPH |
denotes |
- |
| T11930 |
53591-53593 |
, |
denotes |
, |
| T11931 |
53593-53596 |
CC |
denotes |
and |
| T11932 |
53597-53601 |
VBD |
denotes |
were |
| T11933 |
53602-53610 |
VBN |
denotes |
assessed |
| T11934 |
53611-53614 |
IN |
denotes |
for |
| T11935 |
53615-53622 |
NN |
denotes |
absence |
| T11936 |
53623-53625 |
IN |
denotes |
of |
| T11937 |
53626-53629 |
NN |
denotes |
BAC |
| T11938 |
53630-53636 |
NN |
denotes |
vector |
| T11939 |
53637-53642 |
VBG |
denotes |
using |
| T11940 |
53643-53649 |
NN |
denotes |
vector |
| T11941 |
53659-53666 |
NNS |
denotes |
primers |
| T11942 |
53649-53650 |
HYPH |
denotes |
- |
| T11943 |
53650-53658 |
JJ |
denotes |
specific |
| T11944 |
53667-53668 |
CD |
denotes |
5 |
| T11945 |
53670-53693 |
NN |
denotes |
CGGAGTCTGATGCGGTTGCGATG |
| T11946 |
53668-53669 |
SYM |
denotes |
′ |
| T11947 |
53669-53670 |
HYPH |
denotes |
- |
| T11948 |
53693-53694 |
HYPH |
denotes |
- |
| T11949 |
53694-53695 |
CD |
denotes |
3 |
| T11950 |
53695-53696 |
SYM |
denotes |
′ |
| T11951 |
53697-53700 |
CC |
denotes |
and |
| T11952 |
53701-53702 |
CD |
denotes |
5 |
| T11953 |
53704-53728 |
NN |
denotes |
AGTGCTGTTCCCTGGTGCTTCCTC |
| T11954 |
53702-53703 |
SYM |
denotes |
′ |
| T11955 |
53703-53704 |
HYPH |
denotes |
- |
| T11956 |
53728-53729 |
HYPH |
denotes |
- |
| T11957 |
53729-53730 |
CD |
denotes |
3 |
| T11958 |
53730-53731 |
SYM |
denotes |
′ |
| T11959 |
53731-53733 |
, |
denotes |
, |
| T11960 |
53733-53738 |
WDT |
denotes |
which |
| T11961 |
53739-53746 |
VBP |
denotes |
amplify |
| T11962 |
53747-53748 |
DT |
denotes |
a |
| T11963 |
53756-53763 |
NN |
denotes |
product |
| T11964 |
53749-53752 |
CD |
denotes |
465 |
| T11965 |
53753-53755 |
NN |
denotes |
bp |
| T11966 |
53752-53753 |
HYPH |
denotes |
- |
| T11967 |
53763-53764 |
. |
denotes |
. |
| T11968 |
53764-53848 |
sentence |
denotes |
Three lines of Gdf5-Cre mice were established and maintained on the FVB background. |
| T11969 |
53765-53770 |
CD |
denotes |
Three |
| T11970 |
53771-53776 |
NNS |
denotes |
lines |
| T11971 |
53799-53810 |
VBN |
denotes |
established |
| T11972 |
53777-53779 |
IN |
denotes |
of |
| T11973 |
53780-53784 |
NN |
denotes |
Gdf5 |
| T11974 |
53785-53788 |
NN |
denotes |
Cre |
| T11975 |
53784-53785 |
HYPH |
denotes |
- |
| T11976 |
53789-53793 |
NNS |
denotes |
mice |
| T11977 |
53794-53798 |
VBD |
denotes |
were |
| T11978 |
53811-53814 |
CC |
denotes |
and |
| T11979 |
53815-53825 |
VBN |
denotes |
maintained |
| T11980 |
53826-53828 |
IN |
denotes |
on |
| T11981 |
53829-53832 |
DT |
denotes |
the |
| T11982 |
53837-53847 |
NN |
denotes |
background |
| T11983 |
53833-53836 |
NN |
denotes |
FVB |
| T11984 |
53847-53848 |
. |
denotes |
. |
| T11985 |
53848-53950 |
sentence |
denotes |
Matings with R26R Cre-inducible LACZ reporter mice (Soriano 1999) were used to test for Cre activity. |
| T11986 |
53849-53856 |
NNS |
denotes |
Matings |
| T11987 |
53920-53924 |
VBN |
denotes |
used |
| T11988 |
53857-53861 |
IN |
denotes |
with |
| T11989 |
53862-53866 |
NN |
denotes |
R26R |
| T11990 |
53867-53870 |
NN |
denotes |
Cre |
| T11991 |
53871-53880 |
JJ |
denotes |
inducible |
| T11992 |
53870-53871 |
HYPH |
denotes |
- |
| T11993 |
53895-53899 |
NNS |
denotes |
mice |
| T11994 |
53881-53885 |
NN |
denotes |
LACZ |
| T11995 |
53886-53894 |
NN |
denotes |
reporter |
| T11996 |
53900-53901 |
-LRB- |
denotes |
( |
| T11997 |
53901-53908 |
NNP |
denotes |
Soriano |
| T11998 |
53909-53913 |
CD |
denotes |
1999 |
| T11999 |
53913-53914 |
-RRB- |
denotes |
) |
| T12000 |
53915-53919 |
VBD |
denotes |
were |
| T12001 |
53925-53927 |
TO |
denotes |
to |
| T12002 |
53928-53932 |
VB |
denotes |
test |
| T12003 |
53933-53936 |
IN |
denotes |
for |
| T12004 |
53937-53940 |
NN |
denotes |
Cre |
| T12005 |
53941-53949 |
NN |
denotes |
activity |
| T12006 |
53949-53950 |
. |
denotes |
. |
| T12007 |
53950-54087 |
sentence |
denotes |
Staining for LACZ and HPLAP on whole embryos or sections of embryos was accomplished following established protocols (Lobe et al. 1999). |
| T12008 |
53951-53959 |
VBG |
denotes |
Staining |
| T12009 |
54023-54035 |
VBN |
denotes |
accomplished |
| T12010 |
53960-53963 |
IN |
denotes |
for |
| T12011 |
53964-53968 |
NN |
denotes |
LACZ |
| T12012 |
53969-53972 |
CC |
denotes |
and |
| T12013 |
53973-53978 |
NN |
denotes |
HPLAP |
| T12014 |
53979-53981 |
IN |
denotes |
on |
| T12015 |
53982-53987 |
JJ |
denotes |
whole |
| T12016 |
53988-53995 |
NNS |
denotes |
embryos |
| T12017 |
53996-53998 |
CC |
denotes |
or |
| T12018 |
53999-54007 |
NNS |
denotes |
sections |
| T12019 |
54008-54010 |
IN |
denotes |
of |
| T12020 |
54011-54018 |
NNS |
denotes |
embryos |
| T12021 |
54019-54022 |
VBD |
denotes |
was |
| T12022 |
54036-54045 |
VBG |
denotes |
following |
| T12023 |
54046-54057 |
VBN |
denotes |
established |
| T12024 |
54058-54067 |
NNS |
denotes |
protocols |
| T12025 |
54068-54069 |
-LRB- |
denotes |
( |
| T12026 |
54069-54073 |
NNP |
denotes |
Lobe |
| T12027 |
54074-54076 |
FW |
denotes |
et |
| T12028 |
54077-54080 |
FW |
denotes |
al. |
| T12029 |
54081-54085 |
CD |
denotes |
1999 |
| T12030 |
54085-54086 |
-RRB- |
denotes |
) |
| T12031 |
54086-54087 |
. |
denotes |
. |
| T12032 |
54087-54236 |
sentence |
denotes |
The red LACZ substrate (see Figure 1E) is 6-chloro-3-indoxyl-beta-D-galactopyranoside (Biosynth International, Naperville, Illinois, United States). |
| T12033 |
54088-54091 |
DT |
denotes |
The |
| T12034 |
54101-54110 |
NN |
denotes |
substrate |
| T12035 |
54092-54095 |
JJ |
denotes |
red |
| T12036 |
54096-54100 |
NN |
denotes |
LACZ |
| T12037 |
54127-54129 |
VBZ |
denotes |
is |
| T12038 |
54111-54112 |
-LRB- |
denotes |
( |
| T12039 |
54112-54115 |
VB |
denotes |
see |
| T12040 |
54116-54122 |
NN |
denotes |
Figure |
| T12041 |
54123-54125 |
CD |
denotes |
1E |
| T12042 |
54125-54126 |
-RRB- |
denotes |
) |
| T12043 |
54130-54131 |
CD |
denotes |
6 |
| T12044 |
54156-54173 |
NN |
denotes |
galactopyranoside |
| T12045 |
54131-54132 |
HYPH |
denotes |
- |
| T12046 |
54132-54138 |
NN |
denotes |
chloro |
| T12047 |
54138-54139 |
HYPH |
denotes |
- |
| T12048 |
54139-54140 |
CD |
denotes |
3 |
| T12049 |
54140-54141 |
HYPH |
denotes |
- |
| T12050 |
54141-54148 |
NN |
denotes |
indoxyl |
| T12051 |
54148-54149 |
HYPH |
denotes |
- |
| T12052 |
54149-54153 |
NN |
denotes |
beta |
| T12053 |
54153-54154 |
HYPH |
denotes |
- |
| T12054 |
54154-54155 |
NN |
denotes |
D |
| T12055 |
54155-54156 |
HYPH |
denotes |
- |
| T12056 |
54174-54175 |
-LRB- |
denotes |
( |
| T12057 |
54184-54197 |
NNP |
denotes |
International |
| T12058 |
54175-54183 |
NNP |
denotes |
Biosynth |
| T12059 |
54197-54199 |
, |
denotes |
, |
| T12060 |
54199-54209 |
NNP |
denotes |
Naperville |
| T12061 |
54209-54211 |
, |
denotes |
, |
| T12062 |
54211-54219 |
NNP |
denotes |
Illinois |
| T12063 |
54219-54221 |
, |
denotes |
, |
| T12064 |
54221-54227 |
NNP |
denotes |
United |
| T12065 |
54228-54234 |
NNP |
denotes |
States |
| T12066 |
54234-54235 |
-RRB- |
denotes |
) |
| T12067 |
54235-54236 |
. |
denotes |
. |
| T12177 |
54238-54245 |
JJ |
denotes |
General |
| T12178 |
54246-54262 |
NN |
denotes |
characterization |
| T12179 |
54263-54265 |
IN |
denotes |
of |
| T12180 |
54266-54272 |
NN |
denotes |
Bmpr1a |
| T12181 |
54273-54279 |
JJ |
denotes |
mutant |
| T12182 |
54280-54284 |
NNS |
denotes |
mice |
| T12183 |
54284-54441 |
sentence |
denotes |
Bmpr1a null and floxed alleles (Ahn et al. 2001; Mishina et al. 2002) were obtained on a mixed 129 and C57BL/6 background and maintained by random breeding. |
| T12184 |
54285-54291 |
NN |
denotes |
Bmpr1a |
| T12185 |
54292-54296 |
JJ |
denotes |
null |
| T12186 |
54308-54315 |
NNS |
denotes |
alleles |
| T12187 |
54297-54300 |
CC |
denotes |
and |
| T12188 |
54301-54307 |
VBN |
denotes |
floxed |
| T12189 |
54360-54368 |
VBN |
denotes |
obtained |
| T12190 |
54316-54317 |
-LRB- |
denotes |
( |
| T12191 |
54317-54320 |
NNP |
denotes |
Ahn |
| T12192 |
54321-54323 |
FW |
denotes |
et |
| T12193 |
54324-54327 |
FW |
denotes |
al. |
| T12194 |
54328-54332 |
CD |
denotes |
2001 |
| T12195 |
54332-54333 |
: |
denotes |
; |
| T12196 |
54334-54341 |
NNP |
denotes |
Mishina |
| T12197 |
54342-54344 |
FW |
denotes |
et |
| T12198 |
54345-54348 |
FW |
denotes |
al. |
| T12199 |
54349-54353 |
CD |
denotes |
2002 |
| T12200 |
54353-54354 |
-RRB- |
denotes |
) |
| T12201 |
54355-54359 |
VBD |
denotes |
were |
| T12202 |
54369-54371 |
IN |
denotes |
on |
| T12203 |
54372-54373 |
DT |
denotes |
a |
| T12204 |
54396-54406 |
NN |
denotes |
background |
| T12205 |
54374-54379 |
VBN |
denotes |
mixed |
| T12206 |
54380-54383 |
CD |
denotes |
129 |
| T12207 |
54384-54387 |
CC |
denotes |
and |
| T12208 |
54388-54393 |
NN |
denotes |
C57BL |
| T12209 |
54393-54394 |
HYPH |
denotes |
/ |
| T12210 |
54394-54395 |
CD |
denotes |
6 |
| T12211 |
54407-54410 |
CC |
denotes |
and |
| T12212 |
54411-54421 |
VBN |
denotes |
maintained |
| T12213 |
54422-54424 |
IN |
denotes |
by |
| T12214 |
54425-54431 |
JJ |
denotes |
random |
| T12215 |
54432-54440 |
NN |
denotes |
breeding |
| T12216 |
54440-54441 |
. |
denotes |
. |
| T12217 |
54441-54543 |
sentence |
denotes |
Mice carrying the null and floxed alleles were typically mated to Gdf5-Cre mice as shown in Figure 3. |
| T12218 |
54442-54446 |
NNS |
denotes |
Mice |
| T12219 |
54499-54504 |
VBN |
denotes |
mated |
| T12220 |
54447-54455 |
VBG |
denotes |
carrying |
| T12221 |
54456-54459 |
DT |
denotes |
the |
| T12222 |
54476-54483 |
NNS |
denotes |
alleles |
| T12223 |
54460-54464 |
JJ |
denotes |
null |
| T12224 |
54465-54468 |
CC |
denotes |
and |
| T12225 |
54469-54475 |
VBN |
denotes |
floxed |
| T12226 |
54484-54488 |
VBD |
denotes |
were |
| T12227 |
54489-54498 |
RB |
denotes |
typically |
| T12228 |
54505-54507 |
IN |
denotes |
to |
| T12229 |
54508-54512 |
NN |
denotes |
Gdf5 |
| T12230 |
54513-54516 |
NN |
denotes |
Cre |
| T12231 |
54512-54513 |
HYPH |
denotes |
- |
| T12232 |
54517-54521 |
NNS |
denotes |
mice |
| T12233 |
54522-54524 |
IN |
denotes |
as |
| T12234 |
54525-54530 |
VBN |
denotes |
shown |
| T12235 |
54531-54533 |
IN |
denotes |
in |
| T12236 |
54534-54540 |
NN |
denotes |
Figure |
| T12237 |
54541-54542 |
CD |
denotes |
3 |
| T12238 |
54542-54543 |
. |
denotes |
. |
| T12239 |
54543-54695 |
sentence |
denotes |
The resulting mice are on a mixed 129; C57Bl/6; FVB/N background, with both controls and mutant animals generated as littermates from the same matings. |
| T12240 |
54544-54547 |
DT |
denotes |
The |
| T12241 |
54558-54562 |
NNS |
denotes |
mice |
| T12242 |
54548-54557 |
VBG |
denotes |
resulting |
| T12243 |
54563-54566 |
VBP |
denotes |
are |
| T12244 |
54567-54569 |
IN |
denotes |
on |
| T12245 |
54570-54571 |
DT |
denotes |
a |
| T12246 |
54598-54608 |
NN |
denotes |
background |
| T12247 |
54572-54577 |
VBN |
denotes |
mixed |
| T12248 |
54578-54581 |
CD |
denotes |
129 |
| T12249 |
54581-54582 |
: |
denotes |
; |
| T12250 |
54583-54588 |
NN |
denotes |
C57Bl |
| T12251 |
54588-54589 |
HYPH |
denotes |
/ |
| T12252 |
54589-54590 |
CD |
denotes |
6 |
| T12253 |
54590-54591 |
: |
denotes |
; |
| T12254 |
54592-54595 |
NN |
denotes |
FVB |
| T12255 |
54596-54597 |
NN |
denotes |
N |
| T12256 |
54595-54596 |
HYPH |
denotes |
/ |
| T12257 |
54608-54610 |
, |
denotes |
, |
| T12258 |
54610-54614 |
IN |
denotes |
with |
| T12259 |
54648-54657 |
VBN |
denotes |
generated |
| T12260 |
54615-54619 |
CC |
denotes |
both |
| T12261 |
54620-54628 |
NNS |
denotes |
controls |
| T12262 |
54629-54632 |
CC |
denotes |
and |
| T12263 |
54633-54639 |
NN |
denotes |
mutant |
| T12264 |
54640-54647 |
NNS |
denotes |
animals |
| T12265 |
54658-54660 |
IN |
denotes |
as |
| T12266 |
54661-54672 |
NNS |
denotes |
littermates |
| T12267 |
54673-54677 |
IN |
denotes |
from |
| T12268 |
54678-54681 |
DT |
denotes |
the |
| T12269 |
54687-54694 |
NNS |
denotes |
matings |
| T12270 |
54682-54686 |
JJ |
denotes |
same |
| T12271 |
54694-54695 |
. |
denotes |
. |
| T12272 |
54695-54787 |
sentence |
denotes |
Whole-mount skeletal preparations were made from 34- to 36-d-old mice (Lufkin et al. 1992). |
| T12273 |
54696-54701 |
JJ |
denotes |
Whole |
| T12274 |
54702-54707 |
NN |
denotes |
mount |
| T12275 |
54701-54702 |
HYPH |
denotes |
- |
| T12276 |
54717-54729 |
NNS |
denotes |
preparations |
| T12277 |
54708-54716 |
JJ |
denotes |
skeletal |
| T12278 |
54735-54739 |
VBN |
denotes |
made |
| T12279 |
54730-54734 |
VBD |
denotes |
were |
| T12280 |
54740-54744 |
IN |
denotes |
from |
| T12281 |
54745-54747 |
CD |
denotes |
34 |
| T12282 |
54752-54754 |
CD |
denotes |
36 |
| T12283 |
54747-54748 |
HYPH |
denotes |
- |
| T12284 |
54749-54751 |
IN |
denotes |
to |
| T12285 |
54755-54756 |
NN |
denotes |
d |
| T12286 |
54754-54755 |
HYPH |
denotes |
- |
| T12287 |
54757-54760 |
JJ |
denotes |
old |
| T12288 |
54756-54757 |
HYPH |
denotes |
- |
| T12289 |
54761-54765 |
NNS |
denotes |
mice |
| T12290 |
54766-54767 |
-LRB- |
denotes |
( |
| T12291 |
54767-54773 |
NNP |
denotes |
Lufkin |
| T12292 |
54774-54776 |
FW |
denotes |
et |
| T12293 |
54777-54780 |
FW |
denotes |
al. |
| T12294 |
54781-54785 |
CD |
denotes |
1992 |
| T12295 |
54785-54786 |
-RRB- |
denotes |
) |
| T12296 |
54786-54787 |
. |
denotes |
. |
| T12297 |
54787-55011 |
sentence |
denotes |
Pairs of ears from euthanized 6-mo-old animals were removed, pinned, photographed, projected, and measured from the base of the curve formed between the tragus and antitragus to the farthest point at the edge of the pinnae. |
| T12298 |
54788-54793 |
NNS |
denotes |
Pairs |
| T12299 |
54840-54847 |
VBN |
denotes |
removed |
| T12300 |
54794-54796 |
IN |
denotes |
of |
| T12301 |
54797-54801 |
NNS |
denotes |
ears |
| T12302 |
54802-54806 |
IN |
denotes |
from |
| T12303 |
54807-54817 |
VBN |
denotes |
euthanized |
| T12304 |
54827-54834 |
NNS |
denotes |
animals |
| T12305 |
54818-54819 |
CD |
denotes |
6 |
| T12306 |
54820-54822 |
NN |
denotes |
mo |
| T12307 |
54819-54820 |
HYPH |
denotes |
- |
| T12308 |
54823-54826 |
JJ |
denotes |
old |
| T12309 |
54822-54823 |
HYPH |
denotes |
- |
| T12310 |
54835-54839 |
VBD |
denotes |
were |
| T12311 |
54847-54849 |
, |
denotes |
, |
| T12312 |
54849-54855 |
VBN |
denotes |
pinned |
| T12313 |
54855-54857 |
, |
denotes |
, |
| T12314 |
54857-54869 |
VBN |
denotes |
photographed |
| T12315 |
54869-54871 |
, |
denotes |
, |
| T12316 |
54871-54880 |
VBN |
denotes |
projected |
| T12317 |
54880-54882 |
, |
denotes |
, |
| T12318 |
54882-54885 |
CC |
denotes |
and |
| T12319 |
54886-54894 |
VBN |
denotes |
measured |
| T12320 |
54895-54899 |
IN |
denotes |
from |
| T12321 |
54900-54903 |
DT |
denotes |
the |
| T12322 |
54904-54908 |
NN |
denotes |
base |
| T12323 |
54909-54911 |
IN |
denotes |
of |
| T12324 |
54912-54915 |
DT |
denotes |
the |
| T12325 |
54916-54921 |
NN |
denotes |
curve |
| T12326 |
54922-54928 |
VBN |
denotes |
formed |
| T12327 |
54929-54936 |
IN |
denotes |
between |
| T12328 |
54937-54940 |
DT |
denotes |
the |
| T12329 |
54941-54947 |
NN |
denotes |
tragus |
| T12330 |
54948-54951 |
CC |
denotes |
and |
| T12331 |
54952-54962 |
NN |
denotes |
antitragus |
| T12332 |
54963-54965 |
IN |
denotes |
to |
| T12333 |
54966-54969 |
DT |
denotes |
the |
| T12334 |
54979-54984 |
NN |
denotes |
point |
| T12335 |
54970-54978 |
JJS |
denotes |
farthest |
| T12336 |
54985-54987 |
IN |
denotes |
at |
| T12337 |
54988-54991 |
DT |
denotes |
the |
| T12338 |
54992-54996 |
NN |
denotes |
edge |
| T12339 |
54997-54999 |
IN |
denotes |
of |
| T12340 |
55000-55003 |
DT |
denotes |
the |
| T12341 |
55004-55010 |
NNS |
denotes |
pinnae |
| T12342 |
55010-55011 |
. |
denotes |
. |
| T12343 |
55011-55190 |
sentence |
denotes |
Grasping ability in 6-mo-old mice was measured by placing animals on a slender rod and timing how long they could remain suspended on the rod, to a maximum time allowed of 2 min. |
| T12344 |
55012-55020 |
NN |
denotes |
Grasping |
| T12345 |
55021-55028 |
NN |
denotes |
ability |
| T12346 |
55050-55058 |
VBN |
denotes |
measured |
| T12347 |
55029-55031 |
IN |
denotes |
in |
| T12348 |
55032-55033 |
CD |
denotes |
6 |
| T12349 |
55034-55036 |
NN |
denotes |
mo |
| T12350 |
55033-55034 |
HYPH |
denotes |
- |
| T12351 |
55037-55040 |
JJ |
denotes |
old |
| T12352 |
55036-55037 |
HYPH |
denotes |
- |
| T12353 |
55041-55045 |
NNS |
denotes |
mice |
| T12354 |
55046-55049 |
VBD |
denotes |
was |
| T12355 |
55059-55061 |
IN |
denotes |
by |
| T12356 |
55062-55069 |
VBG |
denotes |
placing |
| T12357 |
55070-55077 |
NNS |
denotes |
animals |
| T12358 |
55078-55080 |
IN |
denotes |
on |
| T12359 |
55081-55082 |
DT |
denotes |
a |
| T12360 |
55091-55094 |
NN |
denotes |
rod |
| T12361 |
55083-55090 |
JJ |
denotes |
slender |
| T12362 |
55095-55098 |
CC |
denotes |
and |
| T12363 |
55099-55105 |
VBG |
denotes |
timing |
| T12364 |
55106-55109 |
WRB |
denotes |
how |
| T12365 |
55110-55114 |
RB |
denotes |
long |
| T12366 |
55126-55132 |
VB |
denotes |
remain |
| T12367 |
55115-55119 |
PRP |
denotes |
they |
| T12368 |
55120-55125 |
MD |
denotes |
could |
| T12369 |
55133-55142 |
JJ |
denotes |
suspended |
| T12370 |
55143-55145 |
IN |
denotes |
on |
| T12371 |
55146-55149 |
DT |
denotes |
the |
| T12372 |
55150-55153 |
NN |
denotes |
rod |
| T12373 |
55153-55155 |
, |
denotes |
, |
| T12374 |
55155-55157 |
IN |
denotes |
to |
| T12375 |
55158-55159 |
DT |
denotes |
a |
| T12376 |
55168-55172 |
NN |
denotes |
time |
| T12377 |
55160-55167 |
JJ |
denotes |
maximum |
| T12378 |
55173-55180 |
VBN |
denotes |
allowed |
| T12379 |
55181-55183 |
IN |
denotes |
of |
| T12380 |
55184-55185 |
CD |
denotes |
2 |
| T12381 |
55186-55189 |
NN |
denotes |
min |
| T12382 |
55189-55190 |
. |
denotes |
. |
| T12383 |
55190-55254 |
sentence |
denotes |
Data from five consecutive trials for each mouse were averaged. |
| T12384 |
55191-55195 |
NNS |
denotes |
Data |
| T12385 |
55245-55253 |
VBN |
denotes |
averaged |
| T12386 |
55196-55200 |
IN |
denotes |
from |
| T12387 |
55201-55205 |
CD |
denotes |
five |
| T12388 |
55218-55224 |
NNS |
denotes |
trials |
| T12389 |
55206-55217 |
JJ |
denotes |
consecutive |
| T12390 |
55225-55228 |
IN |
denotes |
for |
| T12391 |
55229-55233 |
DT |
denotes |
each |
| T12392 |
55234-55239 |
NN |
denotes |
mouse |
| T12393 |
55240-55244 |
VBD |
denotes |
were |
| T12394 |
55253-55254 |
. |
denotes |
. |
| T12395 |
55254-55386 |
sentence |
denotes |
Range of motion assays were conducted on the MT/P1 and P1/P2 joints of the second hindlimb digit from euthanized 18-wk-old animals. |
| T12396 |
55255-55260 |
NN |
denotes |
Range |
| T12397 |
55271-55277 |
NNS |
denotes |
assays |
| T12398 |
55261-55263 |
IN |
denotes |
of |
| T12399 |
55264-55270 |
NN |
denotes |
motion |
| T12400 |
55283-55292 |
VBN |
denotes |
conducted |
| T12401 |
55278-55282 |
VBD |
denotes |
were |
| T12402 |
55293-55295 |
IN |
denotes |
on |
| T12403 |
55296-55299 |
DT |
denotes |
the |
| T12404 |
55316-55322 |
NNS |
denotes |
joints |
| T12405 |
55300-55302 |
NN |
denotes |
MT |
| T12406 |
55303-55305 |
NN |
denotes |
P1 |
| T12407 |
55302-55303 |
HYPH |
denotes |
/ |
| T12408 |
55306-55309 |
CC |
denotes |
and |
| T12409 |
55310-55312 |
NN |
denotes |
P1 |
| T12410 |
55313-55315 |
NN |
denotes |
P2 |
| T12411 |
55312-55313 |
HYPH |
denotes |
/ |
| T12412 |
55323-55325 |
IN |
denotes |
of |
| T12413 |
55326-55329 |
DT |
denotes |
the |
| T12414 |
55346-55351 |
NN |
denotes |
digit |
| T12415 |
55330-55336 |
JJ |
denotes |
second |
| T12416 |
55337-55345 |
NN |
denotes |
hindlimb |
| T12417 |
55352-55356 |
IN |
denotes |
from |
| T12418 |
55357-55367 |
VBN |
denotes |
euthanized |
| T12419 |
55378-55385 |
NNS |
denotes |
animals |
| T12420 |
55368-55370 |
CD |
denotes |
18 |
| T12421 |
55371-55373 |
NN |
denotes |
wk |
| T12422 |
55370-55371 |
HYPH |
denotes |
- |
| T12423 |
55374-55377 |
JJ |
denotes |
old |
| T12424 |
55373-55374 |
HYPH |
denotes |
- |
| T12425 |
55385-55386 |
. |
denotes |
. |
| T12426 |
55386-55561 |
sentence |
denotes |
Forceps were used to bend the joint to its natural stopping position, and the resulting angle was measured to the nearest 10° under 12.5× magnification using a 360° reticule. |
| T12427 |
55387-55394 |
NNS |
denotes |
Forceps |
| T12428 |
55400-55404 |
VBN |
denotes |
used |
| T12429 |
55395-55399 |
VBD |
denotes |
were |
| T12430 |
55405-55407 |
TO |
denotes |
to |
| T12431 |
55408-55412 |
VB |
denotes |
bend |
| T12432 |
55413-55416 |
DT |
denotes |
the |
| T12433 |
55417-55422 |
NN |
denotes |
joint |
| T12434 |
55423-55425 |
IN |
denotes |
to |
| T12435 |
55426-55429 |
PRP$ |
denotes |
its |
| T12436 |
55447-55455 |
NN |
denotes |
position |
| T12437 |
55430-55437 |
JJ |
denotes |
natural |
| T12438 |
55438-55446 |
NN |
denotes |
stopping |
| T12439 |
55455-55457 |
, |
denotes |
, |
| T12440 |
55457-55460 |
CC |
denotes |
and |
| T12441 |
55461-55464 |
DT |
denotes |
the |
| T12442 |
55475-55480 |
NN |
denotes |
angle |
| T12443 |
55465-55474 |
VBG |
denotes |
resulting |
| T12444 |
55485-55493 |
VBN |
denotes |
measured |
| T12445 |
55481-55484 |
VBD |
denotes |
was |
| T12446 |
55494-55496 |
IN |
denotes |
to |
| T12447 |
55497-55500 |
DT |
denotes |
the |
| T12448 |
55511-55512 |
NNS |
denotes |
° |
| T12449 |
55501-55508 |
JJS |
denotes |
nearest |
| T12450 |
55509-55511 |
CD |
denotes |
10 |
| T12451 |
55513-55518 |
IN |
denotes |
under |
| T12452 |
55519-55523 |
CD |
denotes |
12.5 |
| T12453 |
55525-55538 |
NN |
denotes |
magnification |
| T12454 |
55523-55524 |
SYM |
denotes |
× |
| T12455 |
55539-55544 |
VBG |
denotes |
using |
| T12456 |
55545-55546 |
DT |
denotes |
a |
| T12457 |
55552-55560 |
NN |
denotes |
reticule |
| T12458 |
55547-55550 |
CD |
denotes |
360 |
| T12459 |
55550-55551 |
NN |
denotes |
° |
| T12460 |
55560-55561 |
. |
denotes |
. |
| T12461 |
55561-55630 |
sentence |
denotes |
Analysis described in this section occurred on animals lacking R26R. |
| T12462 |
55562-55570 |
NN |
denotes |
Analysis |
| T12463 |
55597-55605 |
VBD |
denotes |
occurred |
| T12464 |
55571-55580 |
VBN |
denotes |
described |
| T12465 |
55581-55583 |
IN |
denotes |
in |
| T12466 |
55584-55588 |
DT |
denotes |
this |
| T12467 |
55589-55596 |
NN |
denotes |
section |
| T12468 |
55606-55608 |
IN |
denotes |
on |
| T12469 |
55609-55616 |
NNS |
denotes |
animals |
| T12470 |
55617-55624 |
VBG |
denotes |
lacking |
| T12471 |
55625-55629 |
NN |
denotes |
R26R |
| T12472 |
55629-55630 |
. |
denotes |
. |
| T12473 |
55630-55809 |
sentence |
denotes |
Control mice included all nonmutant genotypes generated by Parent 1 being heterozygous for Gdf5-Cre and Bmpr1anull and Parent 2 being heterozygous for Bmpr1afloxP (see Figure 3). |
| T12474 |
55631-55638 |
NN |
denotes |
Control |
| T12475 |
55639-55643 |
NNS |
denotes |
mice |
| T12476 |
55644-55652 |
VBD |
denotes |
included |
| T12477 |
55653-55656 |
DT |
denotes |
all |
| T12478 |
55667-55676 |
NNS |
denotes |
genotypes |
| T12479 |
55657-55666 |
JJ |
denotes |
nonmutant |
| T12480 |
55677-55686 |
VBN |
denotes |
generated |
| T12481 |
55687-55689 |
IN |
denotes |
by |
| T12482 |
55690-55696 |
NN |
denotes |
Parent |
| T12483 |
55699-55704 |
VBG |
denotes |
being |
| T12484 |
55697-55698 |
CD |
denotes |
1 |
| T12485 |
55705-55717 |
JJ |
denotes |
heterozygous |
| T12486 |
55718-55721 |
IN |
denotes |
for |
| T12487 |
55722-55726 |
NN |
denotes |
Gdf5 |
| T12488 |
55727-55730 |
NN |
denotes |
Cre |
| T12489 |
55726-55727 |
HYPH |
denotes |
- |
| T12490 |
55731-55734 |
CC |
denotes |
and |
| T12491 |
55735-55745 |
NN |
denotes |
Bmpr1anull |
| T12492 |
55746-55749 |
CC |
denotes |
and |
| T12493 |
55750-55756 |
NN |
denotes |
Parent |
| T12494 |
55759-55764 |
VBG |
denotes |
being |
| T12495 |
55757-55758 |
CD |
denotes |
2 |
| T12496 |
55765-55777 |
JJ |
denotes |
heterozygous |
| T12497 |
55778-55781 |
IN |
denotes |
for |
| T12498 |
55782-55793 |
NN |
denotes |
Bmpr1afloxP |
| T12499 |
55794-55795 |
-LRB- |
denotes |
( |
| T12500 |
55795-55798 |
VB |
denotes |
see |
| T12501 |
55799-55805 |
NN |
denotes |
Figure |
| T12502 |
55806-55807 |
CD |
denotes |
3 |
| T12503 |
55807-55808 |
-RRB- |
denotes |
) |
| T12504 |
55808-55809 |
. |
denotes |
. |
| T12505 |
55809-55936 |
sentence |
denotes |
All statistical analysis used the Student's t-test or Welch's t-test, and values listed are mean ± standard error of the mean. |
| T12506 |
55810-55813 |
DT |
denotes |
All |
| T12507 |
55826-55834 |
NN |
denotes |
analysis |
| T12508 |
55814-55825 |
JJ |
denotes |
statistical |
| T12509 |
55835-55839 |
VBD |
denotes |
used |
| T12510 |
55840-55843 |
DT |
denotes |
the |
| T12511 |
55844-55851 |
NNP |
denotes |
Student |
| T12512 |
55856-55860 |
NN |
denotes |
test |
| T12513 |
55851-55853 |
POS |
denotes |
's |
| T12514 |
55854-55855 |
NN |
denotes |
t |
| T12515 |
55855-55856 |
HYPH |
denotes |
- |
| T12516 |
55861-55863 |
CC |
denotes |
or |
| T12517 |
55864-55869 |
NNP |
denotes |
Welch |
| T12518 |
55874-55878 |
NN |
denotes |
test |
| T12519 |
55869-55871 |
POS |
denotes |
's |
| T12520 |
55872-55873 |
NN |
denotes |
t |
| T12521 |
55873-55874 |
HYPH |
denotes |
- |
| T12522 |
55878-55880 |
, |
denotes |
, |
| T12523 |
55880-55883 |
CC |
denotes |
and |
| T12524 |
55884-55890 |
NNS |
denotes |
values |
| T12525 |
55898-55901 |
VBP |
denotes |
are |
| T12526 |
55891-55897 |
VBN |
denotes |
listed |
| T12527 |
55902-55906 |
JJ |
denotes |
mean |
| T12528 |
55907-55908 |
SYM |
denotes |
± |
| T12529 |
55909-55917 |
JJ |
denotes |
standard |
| T12530 |
55918-55923 |
NN |
denotes |
error |
| T12531 |
55924-55926 |
IN |
denotes |
of |
| T12532 |
55927-55930 |
DT |
denotes |
the |
| T12533 |
55931-55935 |
NN |
denotes |
mean |
| T12534 |
55935-55936 |
. |
denotes |
. |
| T12726 |
56307-56308 |
NN |
denotes |
% |
| T12651 |
55938-55942 |
NN |
denotes |
Cell |
| T12652 |
55943-55948 |
NN |
denotes |
death |
| T12653 |
55949-55952 |
CC |
denotes |
and |
| T12654 |
55953-55966 |
NN |
denotes |
proliferation |
| T12655 |
55967-55973 |
NNS |
denotes |
assays |
| T12656 |
55973-56109 |
sentence |
denotes |
Limbs from mutant and control animals at E13.5 and E14.5 were dissected and frozen in OCT (Sakura Finetek,Torrence, CA, United States). |
| T12657 |
55974-55979 |
NNS |
denotes |
Limbs |
| T12658 |
56036-56045 |
VBN |
denotes |
dissected |
| T12659 |
55980-55984 |
IN |
denotes |
from |
| T12660 |
55985-55991 |
JJ |
denotes |
mutant |
| T12661 |
56004-56011 |
NNS |
denotes |
animals |
| T12662 |
55992-55995 |
CC |
denotes |
and |
| T12663 |
55996-56003 |
NN |
denotes |
control |
| T12664 |
56012-56014 |
IN |
denotes |
at |
| T12665 |
56015-56020 |
NN |
denotes |
E13.5 |
| T12666 |
56021-56024 |
CC |
denotes |
and |
| T12667 |
56025-56030 |
NN |
denotes |
E14.5 |
| T12668 |
56031-56035 |
VBD |
denotes |
were |
| T12669 |
56046-56049 |
CC |
denotes |
and |
| T12670 |
56050-56056 |
VBN |
denotes |
frozen |
| T12671 |
56057-56059 |
IN |
denotes |
in |
| T12672 |
56060-56063 |
NN |
denotes |
OCT |
| T12673 |
56064-56065 |
-LRB- |
denotes |
( |
| T12674 |
56072-56079 |
NNP |
denotes |
Finetek |
| T12675 |
56065-56071 |
NNP |
denotes |
Sakura |
| T12676 |
56079-56080 |
, |
denotes |
, |
| T12677 |
56080-56088 |
NNP |
denotes |
Torrence |
| T12678 |
56088-56090 |
, |
denotes |
, |
| T12679 |
56090-56092 |
NNP |
denotes |
CA |
| T12680 |
56092-56094 |
, |
denotes |
, |
| T12681 |
56094-56100 |
NNP |
denotes |
United |
| T12682 |
56101-56107 |
NNP |
denotes |
States |
| T12683 |
56107-56108 |
-RRB- |
denotes |
) |
| T12684 |
56108-56109 |
. |
denotes |
. |
| T12685 |
56109-56239 |
sentence |
denotes |
Cryosections of tissue were assayed by TUNEL using the In Situ Cell Death Detection Kit, Fluorescein (Roche, Basel, Switzerland). |
| T12686 |
56110-56122 |
NNS |
denotes |
Cryosections |
| T12687 |
56138-56145 |
VBN |
denotes |
assayed |
| T12688 |
56123-56125 |
IN |
denotes |
of |
| T12689 |
56126-56132 |
NN |
denotes |
tissue |
| T12690 |
56133-56137 |
VBD |
denotes |
were |
| T12691 |
56146-56148 |
IN |
denotes |
by |
| T12692 |
56149-56154 |
NN |
denotes |
TUNEL |
| T12693 |
56155-56160 |
VBG |
denotes |
using |
| T12694 |
56161-56164 |
DT |
denotes |
the |
| T12695 |
56194-56197 |
NN |
denotes |
Kit |
| T12696 |
56165-56167 |
FW |
denotes |
In |
| T12697 |
56168-56172 |
FW |
denotes |
Situ |
| T12698 |
56184-56193 |
NN |
denotes |
Detection |
| T12699 |
56173-56177 |
NN |
denotes |
Cell |
| T12700 |
56178-56183 |
NN |
denotes |
Death |
| T12701 |
56197-56199 |
, |
denotes |
, |
| T12702 |
56199-56210 |
NNP |
denotes |
Fluorescein |
| T12703 |
56211-56212 |
-LRB- |
denotes |
( |
| T12704 |
56212-56217 |
NNP |
denotes |
Roche |
| T12705 |
56217-56219 |
, |
denotes |
, |
| T12706 |
56219-56224 |
NNP |
denotes |
Basel |
| T12707 |
56224-56226 |
, |
denotes |
, |
| T12708 |
56226-56237 |
NNP |
denotes |
Switzerland |
| T12709 |
56237-56238 |
-RRB- |
denotes |
) |
| T12710 |
56238-56239 |
. |
denotes |
. |
| T12711 |
56239-56543 |
sentence |
denotes |
Following TUNEL, slides were washed in PBS, blocked with PBS + 0.05% Tween-20 + 5% goat serum, washed again, and incubated with a 1:200 dilution of a rabbit anti-phospho-histone-H3 antibody called Mitosis Marker (Upstate Biotechnology, Lake Placid, New York, United States) to identify cells in mitosis. |
| T12712 |
56240-56249 |
VBG |
denotes |
Following |
| T12713 |
56269-56275 |
VBN |
denotes |
washed |
| T12714 |
56250-56255 |
NN |
denotes |
TUNEL |
| T12715 |
56255-56257 |
, |
denotes |
, |
| T12716 |
56257-56263 |
NNS |
denotes |
slides |
| T12717 |
56264-56268 |
VBD |
denotes |
were |
| T12718 |
56276-56278 |
IN |
denotes |
in |
| T12719 |
56279-56282 |
NN |
denotes |
PBS |
| T12720 |
56282-56284 |
, |
denotes |
, |
| T12721 |
56284-56291 |
VBN |
denotes |
blocked |
| T12722 |
56292-56296 |
IN |
denotes |
with |
| T12723 |
56297-56300 |
NN |
denotes |
PBS |
| T12724 |
56301-56302 |
SYM |
denotes |
+ |
| T12725 |
56303-56307 |
CD |
denotes |
0.05 |
| T12727 |
56309-56314 |
NN |
denotes |
Tween |
| T12728 |
56314-56315 |
HYPH |
denotes |
- |
| T12729 |
56315-56317 |
CD |
denotes |
20 |
| T12730 |
56318-56319 |
SYM |
denotes |
+ |
| T12731 |
56320-56321 |
CD |
denotes |
5 |
| T12732 |
56321-56322 |
NN |
denotes |
% |
| T12733 |
56328-56333 |
NN |
denotes |
serum |
| T12734 |
56323-56327 |
NN |
denotes |
goat |
| T12735 |
56333-56335 |
, |
denotes |
, |
| T12736 |
56335-56341 |
VBD |
denotes |
washed |
| T12737 |
56342-56347 |
RB |
denotes |
again |
| T12738 |
56347-56349 |
, |
denotes |
, |
| T12739 |
56349-56352 |
CC |
denotes |
and |
| T12740 |
56353-56362 |
VBN |
denotes |
incubated |
| T12741 |
56363-56367 |
IN |
denotes |
with |
| T12742 |
56368-56369 |
DT |
denotes |
a |
| T12743 |
56376-56384 |
NN |
denotes |
dilution |
| T12744 |
56370-56371 |
CD |
denotes |
1 |
| T12745 |
56371-56372 |
SYM |
denotes |
: |
| T12746 |
56372-56375 |
CD |
denotes |
200 |
| T12747 |
56385-56387 |
IN |
denotes |
of |
| T12748 |
56388-56389 |
DT |
denotes |
a |
| T12749 |
56421-56429 |
NN |
denotes |
antibody |
| T12750 |
56390-56396 |
NN |
denotes |
rabbit |
| T12751 |
56397-56417 |
JJ |
denotes |
anti-phospho-histone |
| T12752 |
56418-56420 |
NN |
denotes |
H3 |
| T12753 |
56417-56418 |
HYPH |
denotes |
- |
| T12754 |
56430-56436 |
VBN |
denotes |
called |
| T12755 |
56437-56444 |
NN |
denotes |
Mitosis |
| T12756 |
56445-56451 |
NN |
denotes |
Marker |
| T12757 |
56452-56453 |
-LRB- |
denotes |
( |
| T12758 |
56461-56474 |
NNP |
denotes |
Biotechnology |
| T12759 |
56453-56460 |
NNP |
denotes |
Upstate |
| T12760 |
56474-56476 |
, |
denotes |
, |
| T12761 |
56476-56480 |
NNP |
denotes |
Lake |
| T12762 |
56481-56487 |
NNP |
denotes |
Placid |
| T12763 |
56487-56489 |
, |
denotes |
, |
| T12764 |
56489-56492 |
NNP |
denotes |
New |
| T12765 |
56493-56497 |
NNP |
denotes |
York |
| T12766 |
56497-56499 |
, |
denotes |
, |
| T12767 |
56499-56505 |
NNP |
denotes |
United |
| T12768 |
56506-56512 |
NNP |
denotes |
States |
| T12769 |
56512-56513 |
-RRB- |
denotes |
) |
| T12770 |
56514-56516 |
TO |
denotes |
to |
| T12771 |
56517-56525 |
VB |
denotes |
identify |
| T12772 |
56526-56531 |
NNS |
denotes |
cells |
| T12773 |
56532-56534 |
IN |
denotes |
in |
| T12774 |
56535-56542 |
NN |
denotes |
mitosis |
| T12775 |
56542-56543 |
. |
denotes |
. |
| T12776 |
56543-56619 |
sentence |
denotes |
Cy3-labeled anti-rabbit secondary antibody was used to detect the antibody. |
| T12777 |
56544-56547 |
NN |
denotes |
Cy3 |
| T12778 |
56548-56555 |
VBN |
denotes |
labeled |
| T12779 |
56547-56548 |
HYPH |
denotes |
- |
| T12780 |
56578-56586 |
NN |
denotes |
antibody |
| T12781 |
56556-56567 |
JJ |
denotes |
anti-rabbit |
| T12782 |
56568-56577 |
JJ |
denotes |
secondary |
| T12783 |
56591-56595 |
VBN |
denotes |
used |
| T12784 |
56587-56590 |
VBD |
denotes |
was |
| T12785 |
56596-56598 |
TO |
denotes |
to |
| T12786 |
56599-56605 |
VB |
denotes |
detect |
| T12787 |
56606-56609 |
DT |
denotes |
the |
| T12788 |
56610-56618 |
NN |
denotes |
antibody |
| T12789 |
56618-56619 |
. |
denotes |
. |
| T12790 |
56619-56792 |
sentence |
denotes |
Cell nuclei were labeled with DAPI, and slides were mounted in Vectamount (Vector Laboratories, Burlingame, California, United States) and visualized at 100× magnification. |
| T12791 |
56620-56624 |
NN |
denotes |
Cell |
| T12792 |
56625-56631 |
NNS |
denotes |
nuclei |
| T12793 |
56637-56644 |
VBN |
denotes |
labeled |
| T12794 |
56632-56636 |
VBD |
denotes |
were |
| T12795 |
56645-56649 |
IN |
denotes |
with |
| T12796 |
56650-56654 |
NN |
denotes |
DAPI |
| T12797 |
56654-56656 |
, |
denotes |
, |
| T12798 |
56656-56659 |
CC |
denotes |
and |
| T12799 |
56660-56666 |
NNS |
denotes |
slides |
| T12800 |
56672-56679 |
VBN |
denotes |
mounted |
| T12801 |
56667-56671 |
VBD |
denotes |
were |
| T12802 |
56680-56682 |
IN |
denotes |
in |
| T12803 |
56683-56693 |
NNP |
denotes |
Vectamount |
| T12804 |
56694-56695 |
-LRB- |
denotes |
( |
| T12805 |
56702-56714 |
NNP |
denotes |
Laboratories |
| T12806 |
56695-56701 |
NNP |
denotes |
Vector |
| T12807 |
56714-56716 |
, |
denotes |
, |
| T12808 |
56716-56726 |
NNP |
denotes |
Burlingame |
| T12809 |
56726-56728 |
, |
denotes |
, |
| T12810 |
56728-56738 |
NNP |
denotes |
California |
| T12811 |
56738-56740 |
, |
denotes |
, |
| T12812 |
56740-56746 |
NNP |
denotes |
United |
| T12813 |
56747-56753 |
NNP |
denotes |
States |
| T12814 |
56753-56754 |
-RRB- |
denotes |
) |
| T12815 |
56755-56758 |
CC |
denotes |
and |
| T12816 |
56759-56769 |
VBN |
denotes |
visualized |
| T12817 |
56770-56772 |
IN |
denotes |
at |
| T12818 |
56773-56776 |
CD |
denotes |
100 |
| T12819 |
56778-56791 |
NN |
denotes |
magnification |
| T12820 |
56776-56777 |
SYM |
denotes |
× |
| T12821 |
56791-56792 |
. |
denotes |
. |
| T12822 |
56792-57032 |
sentence |
denotes |
The area of selected anatomical sites were measured, and the number of TUNEL-labeled nuclear fragments and the number of Cy3-labeled nuclei were counted from three 10-μm sections spanning 50 μm, from three control and three mutant animals. |
| T12823 |
56793-56796 |
DT |
denotes |
The |
| T12824 |
56797-56801 |
NN |
denotes |
area |
| T12825 |
56836-56844 |
VBN |
denotes |
measured |
| T12826 |
56802-56804 |
IN |
denotes |
of |
| T12827 |
56805-56813 |
VBN |
denotes |
selected |
| T12828 |
56825-56830 |
NNS |
denotes |
sites |
| T12829 |
56814-56824 |
JJ |
denotes |
anatomical |
| T12830 |
56831-56835 |
VBD |
denotes |
were |
| T12831 |
56844-56846 |
, |
denotes |
, |
| T12832 |
56846-56849 |
CC |
denotes |
and |
| T12833 |
56850-56853 |
DT |
denotes |
the |
| T12834 |
56854-56860 |
NN |
denotes |
number |
| T12835 |
56938-56945 |
VBN |
denotes |
counted |
| T12836 |
56861-56863 |
IN |
denotes |
of |
| T12837 |
56864-56869 |
NN |
denotes |
TUNEL |
| T12838 |
56870-56877 |
VBN |
denotes |
labeled |
| T12839 |
56869-56870 |
HYPH |
denotes |
- |
| T12840 |
56886-56895 |
NNS |
denotes |
fragments |
| T12841 |
56878-56885 |
JJ |
denotes |
nuclear |
| T12842 |
56896-56899 |
CC |
denotes |
and |
| T12843 |
56900-56903 |
DT |
denotes |
the |
| T12844 |
56904-56910 |
NN |
denotes |
number |
| T12845 |
56911-56913 |
IN |
denotes |
of |
| T12846 |
56914-56917 |
NN |
denotes |
Cy3 |
| T12847 |
56918-56925 |
VBN |
denotes |
labeled |
| T12848 |
56917-56918 |
HYPH |
denotes |
- |
| T12849 |
56926-56932 |
NNS |
denotes |
nuclei |
| T12850 |
56933-56937 |
VBD |
denotes |
were |
| T12851 |
56946-56950 |
IN |
denotes |
from |
| T12852 |
56951-56956 |
CD |
denotes |
three |
| T12853 |
56963-56971 |
NNS |
denotes |
sections |
| T12854 |
56957-56959 |
CD |
denotes |
10 |
| T12855 |
56960-56962 |
NN |
denotes |
μm |
| T12856 |
56959-56960 |
HYPH |
denotes |
- |
| T12857 |
56972-56980 |
VBG |
denotes |
spanning |
| T12858 |
56981-56983 |
CD |
denotes |
50 |
| T12859 |
56984-56986 |
NN |
denotes |
μm |
| T12860 |
56986-56988 |
, |
denotes |
, |
| T12861 |
56988-56992 |
IN |
denotes |
from |
| T12862 |
56993-56998 |
CD |
denotes |
three |
| T12863 |
56999-57006 |
NN |
denotes |
control |
| T12864 |
57007-57010 |
CC |
denotes |
and |
| T12865 |
57011-57016 |
CD |
denotes |
three |
| T12866 |
57017-57023 |
NN |
denotes |
mutant |
| T12867 |
57024-57031 |
NNS |
denotes |
animals |
| T12868 |
57031-57032 |
. |
denotes |
. |
| T12869 |
57032-57204 |
sentence |
denotes |
The number of labeled cells in the metacarpal-phalangeal and metatarsal-phalangeal joints was counted in a 290 μm × 365 μm rectangle placed around the center of the joint. |
| T12870 |
57033-57036 |
DT |
denotes |
The |
| T12871 |
57037-57043 |
NN |
denotes |
number |
| T12872 |
57127-57134 |
VBN |
denotes |
counted |
| T12873 |
57044-57046 |
IN |
denotes |
of |
| T12874 |
57047-57054 |
VBN |
denotes |
labeled |
| T12875 |
57055-57060 |
NNS |
denotes |
cells |
| T12876 |
57061-57063 |
IN |
denotes |
in |
| T12877 |
57064-57067 |
DT |
denotes |
the |
| T12878 |
57116-57122 |
NNS |
denotes |
joints |
| T12879 |
57068-57078 |
JJ |
denotes |
metacarpal |
| T12880 |
57079-57089 |
JJ |
denotes |
phalangeal |
| T12881 |
57078-57079 |
HYPH |
denotes |
- |
| T12882 |
57090-57093 |
CC |
denotes |
and |
| T12883 |
57094-57104 |
JJ |
denotes |
metatarsal |
| T12884 |
57105-57115 |
JJ |
denotes |
phalangeal |
| T12885 |
57104-57105 |
HYPH |
denotes |
- |
| T12886 |
57123-57126 |
VBD |
denotes |
was |
| T12887 |
57135-57137 |
IN |
denotes |
in |
| T12888 |
57138-57139 |
DT |
denotes |
a |
| T12889 |
57156-57165 |
NN |
denotes |
rectangle |
| T12890 |
57140-57143 |
CD |
denotes |
290 |
| T12891 |
57144-57146 |
NN |
denotes |
μm |
| T12892 |
57147-57148 |
SYM |
denotes |
× |
| T12893 |
57153-57155 |
NN |
denotes |
μm |
| T12894 |
57149-57152 |
CD |
denotes |
365 |
| T12895 |
57166-57172 |
VBN |
denotes |
placed |
| T12896 |
57173-57179 |
IN |
denotes |
around |
| T12897 |
57180-57183 |
DT |
denotes |
the |
| T12898 |
57184-57190 |
NN |
denotes |
center |
| T12899 |
57191-57193 |
IN |
denotes |
of |
| T12900 |
57194-57197 |
DT |
denotes |
the |
| T12901 |
57198-57203 |
NN |
denotes |
joint |
| T12902 |
57203-57204 |
. |
denotes |
. |
| T12903 |
57204-57359 |
sentence |
denotes |
The posterior region of the fifth digit was defined by drawing a line from the tip of the digit down 2.15 mm and across to the lateral edge of the tissue. |
| T12904 |
57205-57208 |
DT |
denotes |
The |
| T12905 |
57219-57225 |
NN |
denotes |
region |
| T12906 |
57209-57218 |
JJ |
denotes |
posterior |
| T12907 |
57249-57256 |
VBN |
denotes |
defined |
| T12908 |
57226-57228 |
IN |
denotes |
of |
| T12909 |
57229-57232 |
DT |
denotes |
the |
| T12910 |
57239-57244 |
NN |
denotes |
digit |
| T12911 |
57233-57238 |
JJ |
denotes |
fifth |
| T12912 |
57245-57248 |
VBD |
denotes |
was |
| T12913 |
57257-57259 |
IN |
denotes |
by |
| T12914 |
57260-57267 |
VBG |
denotes |
drawing |
| T12915 |
57268-57269 |
DT |
denotes |
a |
| T12916 |
57270-57274 |
NN |
denotes |
line |
| T12917 |
57275-57279 |
IN |
denotes |
from |
| T12918 |
57280-57283 |
DT |
denotes |
the |
| T12919 |
57284-57287 |
NN |
denotes |
tip |
| T12920 |
57288-57290 |
IN |
denotes |
of |
| T12921 |
57291-57294 |
DT |
denotes |
the |
| T12922 |
57295-57300 |
NN |
denotes |
digit |
| T12923 |
57301-57305 |
IN |
denotes |
down |
| T12924 |
57306-57310 |
CD |
denotes |
2.15 |
| T12925 |
57311-57313 |
NN |
denotes |
mm |
| T12926 |
57314-57317 |
CC |
denotes |
and |
| T12927 |
57318-57324 |
IN |
denotes |
across |
| T12928 |
57325-57327 |
IN |
denotes |
to |
| T12929 |
57328-57331 |
DT |
denotes |
the |
| T12930 |
57340-57344 |
NN |
denotes |
edge |
| T12931 |
57332-57339 |
JJ |
denotes |
lateral |
| T12932 |
57345-57347 |
IN |
denotes |
of |
| T12933 |
57348-57351 |
DT |
denotes |
the |
| T12934 |
57352-57358 |
NN |
denotes |
tissue |
| T12935 |
57358-57359 |
. |
denotes |
. |
| T12936 |
57359-57417 |
sentence |
denotes |
For this analysis, the R26R Cre reporter was not present. |
| T12937 |
57360-57363 |
IN |
denotes |
For |
| T12938 |
57401-57404 |
VBD |
denotes |
was |
| T12939 |
57364-57368 |
DT |
denotes |
this |
| T12940 |
57369-57377 |
NN |
denotes |
analysis |
| T12941 |
57377-57379 |
, |
denotes |
, |
| T12942 |
57379-57382 |
DT |
denotes |
the |
| T12943 |
57392-57400 |
NN |
denotes |
reporter |
| T12944 |
57383-57387 |
NN |
denotes |
R26R |
| T12945 |
57388-57391 |
NN |
denotes |
Cre |
| T12946 |
57405-57408 |
RB |
denotes |
not |
| T12947 |
57409-57416 |
JJ |
denotes |
present |
| T12948 |
57416-57417 |
. |
denotes |
. |
| T13137 |
57419-57428 |
NN |
denotes |
Histology |
| T13138 |
57429-57432 |
CC |
denotes |
and |
| T13139 |
57433-57447 |
NN |
denotes |
histochemistry |
| T13140 |
57447-57778 |
sentence |
denotes |
Tissue from animals ranging from stages E14.5 to P14 was prepared for analysis by fixing in 4% paraformaldehyde (PFA) in PBS for 45 min to 4 h depending on the stage; washing three times in PBS, once in PBS + 15% sucrose for 1 h, and once in PBS + 30% sucrose for 2 h to overnight depending on the stage; and then freezing in OCT. |
| T13141 |
57448-57454 |
NN |
denotes |
Tissue |
| T13142 |
57505-57513 |
VBN |
denotes |
prepared |
| T13143 |
57455-57459 |
IN |
denotes |
from |
| T13144 |
57460-57467 |
NNS |
denotes |
animals |
| T13145 |
57468-57475 |
VBG |
denotes |
ranging |
| T13146 |
57476-57480 |
IN |
denotes |
from |
| T13147 |
57481-57487 |
NNS |
denotes |
stages |
| T13148 |
57488-57493 |
NN |
denotes |
E14.5 |
| T13149 |
57494-57496 |
IN |
denotes |
to |
| T13150 |
57497-57500 |
NN |
denotes |
P14 |
| T13151 |
57501-57504 |
VBD |
denotes |
was |
| T13152 |
57514-57517 |
IN |
denotes |
for |
| T13153 |
57518-57526 |
NN |
denotes |
analysis |
| T13154 |
57527-57529 |
IN |
denotes |
by |
| T13155 |
57530-57536 |
VBG |
denotes |
fixing |
| T13156 |
57537-57539 |
IN |
denotes |
in |
| T13157 |
57540-57541 |
CD |
denotes |
4 |
| T13158 |
57541-57542 |
NN |
denotes |
% |
| T13159 |
57543-57559 |
NN |
denotes |
paraformaldehyde |
| T13160 |
57560-57561 |
-LRB- |
denotes |
( |
| T13161 |
57561-57564 |
NN |
denotes |
PFA |
| T13162 |
57564-57565 |
-RRB- |
denotes |
) |
| T13163 |
57566-57568 |
IN |
denotes |
in |
| T13164 |
57569-57572 |
NN |
denotes |
PBS |
| T13165 |
57573-57576 |
IN |
denotes |
for |
| T13166 |
57577-57579 |
CD |
denotes |
45 |
| T13167 |
57580-57583 |
NN |
denotes |
min |
| T13168 |
57584-57586 |
IN |
denotes |
to |
| T13169 |
57587-57588 |
CD |
denotes |
4 |
| T13170 |
57589-57590 |
NN |
denotes |
h |
| T13171 |
57591-57600 |
VBG |
denotes |
depending |
| T13172 |
57601-57603 |
IN |
denotes |
on |
| T13173 |
57604-57607 |
DT |
denotes |
the |
| T13174 |
57608-57613 |
NN |
denotes |
stage |
| T13175 |
57613-57614 |
: |
denotes |
; |
| T13176 |
57615-57622 |
VBG |
denotes |
washing |
| T13177 |
57623-57628 |
CD |
denotes |
three |
| T13178 |
57629-57634 |
NNS |
denotes |
times |
| T13179 |
57635-57637 |
IN |
denotes |
in |
| T13180 |
57638-57641 |
NN |
denotes |
PBS |
| T13181 |
57641-57643 |
, |
denotes |
, |
| T13182 |
57643-57647 |
RB |
denotes |
once |
| T13183 |
57648-57650 |
IN |
denotes |
in |
| T13184 |
57651-57654 |
NN |
denotes |
PBS |
| T13185 |
57655-57656 |
SYM |
denotes |
+ |
| T13186 |
57657-57659 |
CD |
denotes |
15 |
| T13187 |
57659-57660 |
NN |
denotes |
% |
| T13188 |
57661-57668 |
NN |
denotes |
sucrose |
| T13189 |
57669-57672 |
IN |
denotes |
for |
| T13190 |
57673-57674 |
CD |
denotes |
1 |
| T13191 |
57675-57676 |
NN |
denotes |
h |
| T13192 |
57676-57678 |
, |
denotes |
, |
| T13193 |
57678-57681 |
CC |
denotes |
and |
| T13194 |
57682-57686 |
RB |
denotes |
once |
| T13195 |
57687-57689 |
IN |
denotes |
in |
| T13196 |
57690-57693 |
NN |
denotes |
PBS |
| T13197 |
57694-57695 |
SYM |
denotes |
+ |
| T13198 |
57696-57698 |
CD |
denotes |
30 |
| T13199 |
57698-57699 |
NN |
denotes |
% |
| T13200 |
57700-57707 |
NN |
denotes |
sucrose |
| T13201 |
57708-57711 |
IN |
denotes |
for |
| T13202 |
57712-57713 |
CD |
denotes |
2 |
| T13203 |
57714-57715 |
NN |
denotes |
h |
| T13204 |
57716-57718 |
IN |
denotes |
to |
| T13205 |
57719-57728 |
NN |
denotes |
overnight |
| T13206 |
57729-57738 |
VBG |
denotes |
depending |
| T13207 |
57739-57741 |
IN |
denotes |
on |
| T13208 |
57742-57745 |
DT |
denotes |
the |
| T13209 |
57746-57751 |
NN |
denotes |
stage |
| T13210 |
57751-57752 |
: |
denotes |
; |
| T13211 |
57753-57756 |
CC |
denotes |
and |
| T13212 |
57757-57761 |
RB |
denotes |
then |
| T13213 |
57762-57770 |
VBG |
denotes |
freezing |
| T13214 |
57771-57773 |
IN |
denotes |
in |
| T13215 |
57774-57777 |
NN |
denotes |
OCT |
| T13216 |
57777-57778 |
. |
denotes |
. |
| T13217 |
57778-57952 |
sentence |
denotes |
Tissue from animals aged 7 wk to 9 mo was processed similarly to earlier stages except that it was decalcified in 0.5 M EDTA (pH 7.4) for 4 d prior to incubating in sucrose. |
| T13218 |
57779-57785 |
NN |
denotes |
Tissue |
| T13219 |
57821-57830 |
VBN |
denotes |
processed |
| T13220 |
57786-57790 |
IN |
denotes |
from |
| T13221 |
57791-57798 |
NNS |
denotes |
animals |
| T13222 |
57799-57803 |
VBN |
denotes |
aged |
| T13223 |
57804-57805 |
CD |
denotes |
7 |
| T13224 |
57806-57808 |
NNS |
denotes |
wk |
| T13225 |
57809-57811 |
IN |
denotes |
to |
| T13226 |
57812-57813 |
CD |
denotes |
9 |
| T13227 |
57814-57816 |
NNS |
denotes |
mo |
| T13228 |
57817-57820 |
VBD |
denotes |
was |
| T13229 |
57831-57840 |
RB |
denotes |
similarly |
| T13230 |
57841-57843 |
IN |
denotes |
to |
| T13231 |
57844-57851 |
JJR |
denotes |
earlier |
| T13232 |
57852-57858 |
NNS |
denotes |
stages |
| T13233 |
57859-57865 |
IN |
denotes |
except |
| T13234 |
57866-57870 |
IN |
denotes |
that |
| T13235 |
57878-57889 |
VBN |
denotes |
decalcified |
| T13236 |
57871-57873 |
PRP |
denotes |
it |
| T13237 |
57874-57877 |
VBD |
denotes |
was |
| T13238 |
57890-57892 |
IN |
denotes |
in |
| T13239 |
57893-57896 |
CD |
denotes |
0.5 |
| T13240 |
57897-57898 |
NN |
denotes |
M |
| T13241 |
57899-57903 |
NN |
denotes |
EDTA |
| T13242 |
57904-57905 |
-LRB- |
denotes |
( |
| T13243 |
57905-57907 |
NN |
denotes |
pH |
| T13244 |
57908-57911 |
CD |
denotes |
7.4 |
| T13245 |
57911-57912 |
-RRB- |
denotes |
) |
| T13246 |
57913-57916 |
IN |
denotes |
for |
| T13247 |
57917-57918 |
CD |
denotes |
4 |
| T13248 |
57919-57920 |
NN |
denotes |
d |
| T13249 |
57921-57926 |
JJ |
denotes |
prior |
| T13250 |
57927-57929 |
IN |
denotes |
to |
| T13251 |
57930-57940 |
VBG |
denotes |
incubating |
| T13252 |
57941-57943 |
IN |
denotes |
in |
| T13253 |
57944-57951 |
NN |
denotes |
sucrose |
| T13254 |
57951-57952 |
. |
denotes |
. |
| T13255 |
57952-58103 |
sentence |
denotes |
All solutions were prechilled and used at 4 °C with agitation, and skin from tissues of P0 or older mice was lacerated or removed prior to processing. |
| T13256 |
57953-57956 |
DT |
denotes |
All |
| T13257 |
57957-57966 |
NNS |
denotes |
solutions |
| T13258 |
57972-57982 |
VBN |
denotes |
prechilled |
| T13259 |
57967-57971 |
VBD |
denotes |
were |
| T13260 |
57983-57986 |
CC |
denotes |
and |
| T13261 |
57987-57991 |
VBN |
denotes |
used |
| T13262 |
57992-57994 |
IN |
denotes |
at |
| T13263 |
57995-57996 |
CD |
denotes |
4 |
| T13264 |
57997-57999 |
NN |
denotes |
°C |
| T13265 |
58000-58004 |
IN |
denotes |
with |
| T13266 |
58005-58014 |
NN |
denotes |
agitation |
| T13267 |
58014-58016 |
, |
denotes |
, |
| T13268 |
58016-58019 |
CC |
denotes |
and |
| T13269 |
58020-58024 |
NN |
denotes |
skin |
| T13270 |
58062-58071 |
VBN |
denotes |
lacerated |
| T13271 |
58025-58029 |
IN |
denotes |
from |
| T13272 |
58030-58037 |
NNS |
denotes |
tissues |
| T13273 |
58038-58040 |
IN |
denotes |
of |
| T13274 |
58041-58043 |
NN |
denotes |
P0 |
| T13275 |
58053-58057 |
NNS |
denotes |
mice |
| T13276 |
58044-58046 |
CC |
denotes |
or |
| T13277 |
58047-58052 |
JJR |
denotes |
older |
| T13278 |
58058-58061 |
VBD |
denotes |
was |
| T13279 |
58072-58074 |
CC |
denotes |
or |
| T13280 |
58075-58082 |
VBN |
denotes |
removed |
| T13281 |
58083-58088 |
JJ |
denotes |
prior |
| T13282 |
58089-58091 |
IN |
denotes |
to |
| T13283 |
58092-58102 |
NN |
denotes |
processing |
| T13284 |
58102-58103 |
. |
denotes |
. |
| T13285 |
58103-58157 |
sentence |
denotes |
Tissue was then cryosectioned at 12 μm and processed. |
| T13286 |
58104-58110 |
NN |
denotes |
Tissue |
| T13287 |
58120-58133 |
VBN |
denotes |
cryosectioned |
| T13288 |
58111-58114 |
VBD |
denotes |
was |
| T13289 |
58115-58119 |
RB |
denotes |
then |
| T13290 |
58134-58136 |
IN |
denotes |
at |
| T13291 |
58137-58139 |
CD |
denotes |
12 |
| T13292 |
58140-58142 |
NN |
denotes |
μm |
| T13293 |
58143-58146 |
CC |
denotes |
and |
| T13294 |
58147-58156 |
VBN |
denotes |
processed |
| T13295 |
58156-58157 |
. |
denotes |
. |
| T13296 |
58157-58287 |
sentence |
denotes |
Staining of sections with Safranin O, Fast Green, and Harris' hematoxylin was carried out using standard histological procedures. |
| T13297 |
58158-58166 |
NN |
denotes |
Staining |
| T13298 |
58236-58243 |
VBN |
denotes |
carried |
| T13299 |
58167-58169 |
IN |
denotes |
of |
| T13300 |
58170-58178 |
NNS |
denotes |
sections |
| T13301 |
58179-58183 |
IN |
denotes |
with |
| T13302 |
58184-58192 |
NN |
denotes |
Safranin |
| T13303 |
58193-58194 |
NN |
denotes |
O |
| T13304 |
58194-58196 |
, |
denotes |
, |
| T13305 |
58196-58200 |
JJ |
denotes |
Fast |
| T13306 |
58201-58206 |
NN |
denotes |
Green |
| T13307 |
58206-58208 |
, |
denotes |
, |
| T13308 |
58208-58211 |
CC |
denotes |
and |
| T13309 |
58212-58218 |
NNP |
denotes |
Harris |
| T13310 |
58220-58231 |
NN |
denotes |
hematoxylin |
| T13311 |
58218-58219 |
POS |
denotes |
' |
| T13312 |
58232-58235 |
VBD |
denotes |
was |
| T13313 |
58244-58247 |
RP |
denotes |
out |
| T13314 |
58248-58253 |
VBG |
denotes |
using |
| T13315 |
58254-58262 |
JJ |
denotes |
standard |
| T13316 |
58276-58286 |
NNS |
denotes |
procedures |
| T13317 |
58263-58275 |
JJ |
denotes |
histological |
| T13318 |
58286-58287 |
. |
denotes |
. |
| T13319 |
58287-58607 |
sentence |
denotes |
Detection of LACZ activity with X-Gal was performed as described (Lobe et al. 1999) and was followed by refixing in 4% PFA, rinsing with deionized water, counterstaining with Nuclear Fast Red (Vector Labs), rinsing with water again, and then mounting in Aquamount (Lerner Labs, Pittsburgh, Pennsylvania, United States). |
| T13320 |
58288-58297 |
NN |
denotes |
Detection |
| T13321 |
58330-58339 |
VBN |
denotes |
performed |
| T13322 |
58298-58300 |
IN |
denotes |
of |
| T13323 |
58301-58305 |
NN |
denotes |
LACZ |
| T13324 |
58306-58314 |
NN |
denotes |
activity |
| T13325 |
58315-58319 |
IN |
denotes |
with |
| T13326 |
58320-58321 |
NN |
denotes |
X |
| T13327 |
58322-58325 |
NN |
denotes |
Gal |
| T13328 |
58321-58322 |
HYPH |
denotes |
- |
| T13329 |
58326-58329 |
VBD |
denotes |
was |
| T13330 |
58340-58342 |
IN |
denotes |
as |
| T13331 |
58343-58352 |
VBN |
denotes |
described |
| T13332 |
58353-58354 |
-LRB- |
denotes |
( |
| T13333 |
58354-58358 |
NNP |
denotes |
Lobe |
| T13334 |
58359-58361 |
FW |
denotes |
et |
| T13335 |
58362-58365 |
FW |
denotes |
al. |
| T13336 |
58366-58370 |
CD |
denotes |
1999 |
| T13337 |
58370-58371 |
-RRB- |
denotes |
) |
| T13338 |
58372-58375 |
CC |
denotes |
and |
| T13339 |
58376-58379 |
VBD |
denotes |
was |
| T13340 |
58380-58388 |
VBN |
denotes |
followed |
| T13341 |
58389-58391 |
IN |
denotes |
by |
| T13342 |
58392-58400 |
VBG |
denotes |
refixing |
| T13343 |
58401-58403 |
IN |
denotes |
in |
| T13344 |
58404-58405 |
CD |
denotes |
4 |
| T13345 |
58405-58406 |
NN |
denotes |
% |
| T13346 |
58407-58410 |
NN |
denotes |
PFA |
| T13347 |
58410-58412 |
, |
denotes |
, |
| T13348 |
58412-58419 |
VBG |
denotes |
rinsing |
| T13349 |
58420-58424 |
IN |
denotes |
with |
| T13350 |
58425-58434 |
VBN |
denotes |
deionized |
| T13351 |
58435-58440 |
NN |
denotes |
water |
| T13352 |
58440-58442 |
, |
denotes |
, |
| T13353 |
58442-58457 |
VBG |
denotes |
counterstaining |
| T13354 |
58458-58462 |
IN |
denotes |
with |
| T13355 |
58463-58470 |
JJ |
denotes |
Nuclear |
| T13356 |
58476-58479 |
NN |
denotes |
Red |
| T13357 |
58471-58475 |
JJ |
denotes |
Fast |
| T13358 |
58480-58481 |
-LRB- |
denotes |
( |
| T13359 |
58481-58487 |
NNP |
denotes |
Vector |
| T13360 |
58488-58492 |
NNP |
denotes |
Labs |
| T13361 |
58492-58493 |
-RRB- |
denotes |
) |
| T13362 |
58493-58495 |
, |
denotes |
, |
| T13363 |
58495-58502 |
VBG |
denotes |
rinsing |
| T13364 |
58503-58507 |
IN |
denotes |
with |
| T13365 |
58508-58513 |
NN |
denotes |
water |
| T13366 |
58514-58519 |
RB |
denotes |
again |
| T13367 |
58519-58521 |
, |
denotes |
, |
| T13368 |
58521-58524 |
CC |
denotes |
and |
| T13369 |
58525-58529 |
RB |
denotes |
then |
| T13370 |
58530-58538 |
VBG |
denotes |
mounting |
| T13371 |
58539-58541 |
IN |
denotes |
in |
| T13372 |
58542-58551 |
NN |
denotes |
Aquamount |
| T13373 |
58552-58553 |
-LRB- |
denotes |
( |
| T13374 |
58560-58564 |
NNP |
denotes |
Labs |
| T13375 |
58553-58559 |
NNP |
denotes |
Lerner |
| T13376 |
58564-58566 |
, |
denotes |
, |
| T13377 |
58566-58576 |
NNP |
denotes |
Pittsburgh |
| T13378 |
58576-58578 |
, |
denotes |
, |
| T13379 |
58578-58590 |
NNP |
denotes |
Pennsylvania |
| T13380 |
58590-58592 |
, |
denotes |
, |
| T13381 |
58592-58598 |
NNP |
denotes |
United |
| T13382 |
58599-58605 |
NNP |
denotes |
States |
| T13383 |
58605-58606 |
-RRB- |
denotes |
) |
| T13384 |
58606-58607 |
. |
denotes |
. |
| T13385 |
58607-59083 |
sentence |
denotes |
RNA in situ hybridization was performed as described (Storm and Kingsley 1996), with the following modifications: (1) Prior to the acetylation step, sections were incubated with 10–20 μg/ml proteinase K for 30 s to 7 min at room temperature (depending on the developmental stage), followed by refixing in 4% PFA and washing three times in PBS; (2) prehybridization step was skipped, and (3) embryonic tissue sections used a different color development mix (Thut et al. 2001). |
| T13386 |
58608-58611 |
NN |
denotes |
RNA |
| T13387 |
58620-58633 |
NN |
denotes |
hybridization |
| T13388 |
58612-58614 |
FW |
denotes |
in |
| T13389 |
58615-58619 |
FW |
denotes |
situ |
| T13390 |
58638-58647 |
VBN |
denotes |
performed |
| T13391 |
58634-58637 |
VBD |
denotes |
was |
| T13392 |
58648-58650 |
IN |
denotes |
as |
| T13393 |
58651-58660 |
VBN |
denotes |
described |
| T13394 |
58661-58662 |
-LRB- |
denotes |
( |
| T13395 |
58662-58667 |
NNP |
denotes |
Storm |
| T13396 |
58668-58671 |
CC |
denotes |
and |
| T13397 |
58672-58680 |
NNP |
denotes |
Kingsley |
| T13398 |
58681-58685 |
CD |
denotes |
1996 |
| T13399 |
58685-58686 |
-RRB- |
denotes |
) |
| T13400 |
58686-58688 |
, |
denotes |
, |
| T13401 |
58688-58692 |
IN |
denotes |
with |
| T13402 |
58693-58696 |
DT |
denotes |
the |
| T13403 |
58707-58720 |
NNS |
denotes |
modifications |
| T13404 |
58697-58706 |
VBG |
denotes |
following |
| T13405 |
58720-58722 |
: |
denotes |
: |
| T13406 |
58722-58723 |
-LRB- |
denotes |
( |
| T13407 |
58723-58724 |
LS |
denotes |
1 |
| T13408 |
58771-58780 |
VBN |
denotes |
incubated |
| T13409 |
58724-58725 |
-RRB- |
denotes |
) |
| T13410 |
58726-58731 |
JJ |
denotes |
Prior |
| T13411 |
58732-58734 |
IN |
denotes |
to |
| T13412 |
58735-58738 |
DT |
denotes |
the |
| T13413 |
58751-58755 |
NN |
denotes |
step |
| T13414 |
58739-58750 |
NN |
denotes |
acetylation |
| T13415 |
58755-58757 |
, |
denotes |
, |
| T13416 |
58757-58765 |
NNS |
denotes |
sections |
| T13417 |
58766-58770 |
VBD |
denotes |
were |
| T13418 |
58781-58785 |
IN |
denotes |
with |
| T13419 |
58786-58788 |
CD |
denotes |
10 |
| T13420 |
58789-58791 |
CD |
denotes |
20 |
| T13421 |
58788-58789 |
HYPH |
denotes |
– |
| T13422 |
58792-58794 |
NNS |
denotes |
μg |
| T13423 |
58809-58810 |
NN |
denotes |
K |
| T13424 |
58794-58795 |
SYM |
denotes |
/ |
| T13425 |
58795-58797 |
NN |
denotes |
ml |
| T13426 |
58798-58808 |
NN |
denotes |
proteinase |
| T13427 |
58811-58814 |
IN |
denotes |
for |
| T13428 |
58815-58817 |
CD |
denotes |
30 |
| T13429 |
58818-58819 |
NN |
denotes |
s |
| T13430 |
58820-58822 |
IN |
denotes |
to |
| T13431 |
58823-58824 |
CD |
denotes |
7 |
| T13432 |
58825-58828 |
NN |
denotes |
min |
| T13433 |
58829-58831 |
IN |
denotes |
at |
| T13434 |
58832-58836 |
NN |
denotes |
room |
| T13435 |
58837-58848 |
NN |
denotes |
temperature |
| T13436 |
58849-58850 |
-LRB- |
denotes |
( |
| T13437 |
58850-58859 |
VBG |
denotes |
depending |
| T13438 |
58860-58862 |
IN |
denotes |
on |
| T13439 |
58863-58866 |
DT |
denotes |
the |
| T13440 |
58881-58886 |
NN |
denotes |
stage |
| T13441 |
58867-58880 |
JJ |
denotes |
developmental |
| T13442 |
58886-58887 |
-RRB- |
denotes |
) |
| T13443 |
58887-58889 |
, |
denotes |
, |
| T13444 |
58889-58897 |
VBN |
denotes |
followed |
| T13445 |
58898-58900 |
IN |
denotes |
by |
| T13446 |
58901-58909 |
VBG |
denotes |
refixing |
| T13447 |
58910-58912 |
IN |
denotes |
in |
| T13448 |
58913-58914 |
CD |
denotes |
4 |
| T13449 |
58914-58915 |
NN |
denotes |
% |
| T13450 |
58916-58919 |
NN |
denotes |
PFA |
| T13451 |
58920-58923 |
CC |
denotes |
and |
| T13452 |
58924-58931 |
VBG |
denotes |
washing |
| T13453 |
58932-58937 |
CD |
denotes |
three |
| T13454 |
58938-58943 |
NNS |
denotes |
times |
| T13455 |
58944-58946 |
IN |
denotes |
in |
| T13456 |
58947-58950 |
NN |
denotes |
PBS |
| T13457 |
58950-58951 |
: |
denotes |
; |
| T13458 |
58952-58953 |
-LRB- |
denotes |
( |
| T13459 |
58953-58954 |
LS |
denotes |
2 |
| T13460 |
58982-58989 |
VBN |
denotes |
skipped |
| T13461 |
58954-58955 |
-RRB- |
denotes |
) |
| T13462 |
58956-58972 |
NN |
denotes |
prehybridization |
| T13463 |
58973-58977 |
NN |
denotes |
step |
| T13464 |
58978-58981 |
VBD |
denotes |
was |
| T13465 |
58989-58991 |
, |
denotes |
, |
| T13466 |
58991-58994 |
CC |
denotes |
and |
| T13467 |
58995-58996 |
-LRB- |
denotes |
( |
| T13468 |
58996-58997 |
LS |
denotes |
3 |
| T13469 |
59025-59029 |
VBD |
denotes |
used |
| T13470 |
58997-58998 |
-RRB- |
denotes |
) |
| T13471 |
58999-59008 |
JJ |
denotes |
embryonic |
| T13472 |
59009-59015 |
NN |
denotes |
tissue |
| T13473 |
59016-59024 |
NNS |
denotes |
sections |
| T13474 |
59030-59031 |
DT |
denotes |
a |
| T13475 |
59060-59063 |
NN |
denotes |
mix |
| T13476 |
59032-59041 |
JJ |
denotes |
different |
| T13477 |
59042-59047 |
NN |
denotes |
color |
| T13478 |
59048-59059 |
NN |
denotes |
development |
| T13479 |
59064-59065 |
-LRB- |
denotes |
( |
| T13480 |
59065-59069 |
NNP |
denotes |
Thut |
| T13481 |
59070-59072 |
FW |
denotes |
et |
| T13482 |
59073-59076 |
FW |
denotes |
al. |
| T13483 |
59077-59081 |
CD |
denotes |
2001 |
| T13484 |
59081-59082 |
-RRB- |
denotes |
) |
| T13485 |
59082-59083 |
. |
denotes |
. |
| T13486 |
59083-59346 |
sentence |
denotes |
Probes for the following genes have been published previously: Bmpr1a (Mishina et al. 1995), Col2a1 (Metsaranta et al. 1991), Col10a1 (Apte et al. 1992), Gdf5 (Storm and Kingsley 1996), Osteocalcin (Celeste et al. 1986), and Sox5 and Sox6 (Lefebvre et al. 1998). |
| T13487 |
59084-59090 |
NNS |
denotes |
Probes |
| T13488 |
59125-59134 |
VBN |
denotes |
published |
| T13489 |
59091-59094 |
IN |
denotes |
for |
| T13490 |
59095-59098 |
DT |
denotes |
the |
| T13491 |
59109-59114 |
NNS |
denotes |
genes |
| T13492 |
59099-59108 |
VBG |
denotes |
following |
| T13493 |
59115-59119 |
VBP |
denotes |
have |
| T13494 |
59120-59124 |
VBN |
denotes |
been |
| T13495 |
59135-59145 |
RB |
denotes |
previously |
| T13496 |
59145-59147 |
: |
denotes |
: |
| T13497 |
59147-59153 |
NN |
denotes |
Bmpr1a |
| T13498 |
59154-59155 |
-LRB- |
denotes |
( |
| T13499 |
59155-59162 |
NNP |
denotes |
Mishina |
| T13500 |
59163-59165 |
FW |
denotes |
et |
| T13501 |
59166-59169 |
FW |
denotes |
al. |
| T13502 |
59170-59174 |
CD |
denotes |
1995 |
| T13503 |
59174-59175 |
-RRB- |
denotes |
) |
| T13504 |
59175-59177 |
, |
denotes |
, |
| T13505 |
59177-59183 |
NN |
denotes |
Col2a1 |
| T13506 |
59184-59185 |
-LRB- |
denotes |
( |
| T13507 |
59185-59195 |
NNP |
denotes |
Metsaranta |
| T13508 |
59196-59198 |
FW |
denotes |
et |
| T13509 |
59199-59202 |
FW |
denotes |
al. |
| T13510 |
59203-59207 |
CD |
denotes |
1991 |
| T13511 |
59207-59208 |
-RRB- |
denotes |
) |
| T13512 |
59208-59210 |
, |
denotes |
, |
| T13513 |
59210-59217 |
NN |
denotes |
Col10a1 |
| T13514 |
59218-59219 |
-LRB- |
denotes |
( |
| T13515 |
59219-59223 |
NNP |
denotes |
Apte |
| T13516 |
59224-59226 |
FW |
denotes |
et |
| T13517 |
59227-59230 |
FW |
denotes |
al. |
| T13518 |
59231-59235 |
CD |
denotes |
1992 |
| T13519 |
59235-59236 |
-RRB- |
denotes |
) |
| T13520 |
59236-59238 |
, |
denotes |
, |
| T13521 |
59238-59242 |
NN |
denotes |
Gdf5 |
| T13522 |
59243-59244 |
-LRB- |
denotes |
( |
| T13523 |
59244-59249 |
NNP |
denotes |
Storm |
| T13524 |
59250-59253 |
CC |
denotes |
and |
| T13525 |
59254-59262 |
NNP |
denotes |
Kingsley |
| T13526 |
59263-59267 |
CD |
denotes |
1996 |
| T13527 |
59267-59268 |
-RRB- |
denotes |
) |
| T13528 |
59268-59270 |
, |
denotes |
, |
| T13529 |
59270-59281 |
NN |
denotes |
Osteocalcin |
| T13530 |
59282-59283 |
-LRB- |
denotes |
( |
| T13531 |
59283-59290 |
NNP |
denotes |
Celeste |
| T13532 |
59291-59293 |
FW |
denotes |
et |
| T13533 |
59294-59297 |
FW |
denotes |
al. |
| T13534 |
59298-59302 |
CD |
denotes |
1986 |
| T13535 |
59302-59303 |
-RRB- |
denotes |
) |
| T13536 |
59303-59305 |
, |
denotes |
, |
| T13537 |
59305-59308 |
CC |
denotes |
and |
| T13538 |
59309-59313 |
NN |
denotes |
Sox5 |
| T13539 |
59314-59317 |
CC |
denotes |
and |
| T13540 |
59318-59322 |
NN |
denotes |
Sox6 |
| T13541 |
59323-59324 |
-LRB- |
denotes |
( |
| T13542 |
59324-59332 |
NNP |
denotes |
Lefebvre |
| T13543 |
59333-59335 |
FW |
denotes |
et |
| T13544 |
59336-59339 |
FW |
denotes |
al. |
| T13545 |
59340-59344 |
CD |
denotes |
1998 |
| T13546 |
59344-59345 |
-RRB- |
denotes |
) |
| T13547 |
59345-59346 |
. |
denotes |
. |
| T13548 |
59346-59694 |
sentence |
denotes |
The following probe templates were gifts: Agg, Dr. Vicki Rosen, Genetics Institute; Bmp2 and Bmp4, Arend Sidow, Stanford University; Col1a1, Bjorn Olsen, Harvard Medical School; Bmpr1b, Col3a1, and Mat4 probes were made from ESTs with IMAGE clone numbers 5056341, 478480, and 406027, respectively (Invitrogen, Carlsbad, California, United States). |
| T13549 |
59347-59350 |
DT |
denotes |
The |
| T13550 |
59367-59376 |
NNS |
denotes |
templates |
| T13551 |
59351-59360 |
VBG |
denotes |
following |
| T13552 |
59361-59366 |
NN |
denotes |
probe |
| T13553 |
59377-59381 |
VBD |
denotes |
were |
| T13554 |
59562-59566 |
VBN |
denotes |
made |
| T13555 |
59382-59387 |
NNS |
denotes |
gifts |
| T13556 |
59387-59389 |
: |
denotes |
: |
| T13557 |
59389-59392 |
NN |
denotes |
Agg |
| T13558 |
59392-59394 |
, |
denotes |
, |
| T13559 |
59394-59397 |
NNP |
denotes |
Dr. |
| T13560 |
59404-59409 |
NNP |
denotes |
Rosen |
| T13561 |
59398-59403 |
NNP |
denotes |
Vicki |
| T13562 |
59409-59411 |
, |
denotes |
, |
| T13563 |
59411-59419 |
NNP |
denotes |
Genetics |
| T13564 |
59420-59429 |
NNP |
denotes |
Institute |
| T13565 |
59429-59430 |
: |
denotes |
; |
| T13566 |
59431-59435 |
NN |
denotes |
Bmp2 |
| T13567 |
59436-59439 |
CC |
denotes |
and |
| T13568 |
59440-59444 |
NN |
denotes |
Bmp4 |
| T13569 |
59444-59446 |
, |
denotes |
, |
| T13570 |
59446-59451 |
NNP |
denotes |
Arend |
| T13571 |
59452-59457 |
NNP |
denotes |
Sidow |
| T13572 |
59457-59459 |
, |
denotes |
, |
| T13573 |
59459-59467 |
NNP |
denotes |
Stanford |
| T13574 |
59468-59478 |
NNP |
denotes |
University |
| T13575 |
59478-59479 |
: |
denotes |
; |
| T13576 |
59480-59486 |
NN |
denotes |
Col1a1 |
| T13577 |
59486-59488 |
, |
denotes |
, |
| T13578 |
59488-59493 |
NNP |
denotes |
Bjorn |
| T13579 |
59494-59499 |
NNP |
denotes |
Olsen |
| T13580 |
59499-59501 |
, |
denotes |
, |
| T13581 |
59501-59508 |
NNP |
denotes |
Harvard |
| T13582 |
59517-59523 |
NNP |
denotes |
School |
| T13583 |
59509-59516 |
NNP |
denotes |
Medical |
| T13584 |
59523-59524 |
: |
denotes |
; |
| T13585 |
59525-59531 |
NN |
denotes |
Bmpr1b |
| T13586 |
59550-59556 |
NNS |
denotes |
probes |
| T13587 |
59531-59533 |
, |
denotes |
, |
| T13588 |
59533-59539 |
NN |
denotes |
Col3a1 |
| T13589 |
59539-59541 |
, |
denotes |
, |
| T13590 |
59541-59544 |
CC |
denotes |
and |
| T13591 |
59545-59549 |
NN |
denotes |
Mat4 |
| T13592 |
59557-59561 |
VBD |
denotes |
were |
| T13593 |
59567-59571 |
IN |
denotes |
from |
| T13594 |
59572-59576 |
NNS |
denotes |
ESTs |
| T13595 |
59577-59581 |
IN |
denotes |
with |
| T13596 |
59582-59587 |
NN |
denotes |
IMAGE |
| T13597 |
59594-59601 |
NNS |
denotes |
numbers |
| T13598 |
59588-59593 |
NN |
denotes |
clone |
| T13599 |
59602-59609 |
CD |
denotes |
5056341 |
| T13600 |
59609-59611 |
, |
denotes |
, |
| T13601 |
59611-59617 |
CD |
denotes |
478480 |
| T13602 |
59617-59619 |
, |
denotes |
, |
| T13603 |
59619-59622 |
CC |
denotes |
and |
| T13604 |
59623-59629 |
CD |
denotes |
406027 |
| T13605 |
59629-59631 |
, |
denotes |
, |
| T13606 |
59631-59643 |
RB |
denotes |
respectively |
| T13607 |
59644-59645 |
-LRB- |
denotes |
( |
| T13608 |
59645-59655 |
NNP |
denotes |
Invitrogen |
| T13609 |
59655-59657 |
, |
denotes |
, |
| T13610 |
59657-59665 |
NNP |
denotes |
Carlsbad |
| T13611 |
59665-59667 |
, |
denotes |
, |
| T13612 |
59667-59677 |
NNP |
denotes |
California |
| T13613 |
59677-59679 |
, |
denotes |
, |
| T13614 |
59679-59685 |
NNP |
denotes |
United |
| T13615 |
59686-59692 |
NNP |
denotes |
States |
| T13616 |
59692-59693 |
-RRB- |
denotes |
) |
| T13617 |
59693-59694 |
. |
denotes |
. |
| T13618 |
59694-59925 |
sentence |
denotes |
Sections for immunohistochemistry were fixed in 4% PFA, then digested with 942–2,000 U/ml type IV-S bovine hyaluronindase (Sigma, St. Louis, Missouri, United States) in PBS (pH 5) at 37 °C for 30 min to 2 h depending on the stage. |
| T13619 |
59695-59703 |
NNS |
denotes |
Sections |
| T13620 |
59734-59739 |
VBN |
denotes |
fixed |
| T13621 |
59704-59707 |
IN |
denotes |
for |
| T13622 |
59708-59728 |
NN |
denotes |
immunohistochemistry |
| T13623 |
59729-59733 |
VBD |
denotes |
were |
| T13624 |
59740-59742 |
IN |
denotes |
in |
| T13625 |
59743-59744 |
CD |
denotes |
4 |
| T13626 |
59744-59745 |
NN |
denotes |
% |
| T13627 |
59746-59749 |
NN |
denotes |
PFA |
| T13628 |
59749-59751 |
, |
denotes |
, |
| T13629 |
59751-59755 |
RB |
denotes |
then |
| T13630 |
59756-59764 |
VBN |
denotes |
digested |
| T13631 |
59765-59769 |
IN |
denotes |
with |
| T13632 |
59770-59773 |
CD |
denotes |
942 |
| T13633 |
59774-59779 |
CD |
denotes |
2,000 |
| T13634 |
59773-59774 |
SYM |
denotes |
– |
| T13635 |
59780-59781 |
NNS |
denotes |
U |
| T13636 |
59802-59816 |
NN |
denotes |
hyaluronindase |
| T13637 |
59781-59782 |
SYM |
denotes |
/ |
| T13638 |
59782-59784 |
NN |
denotes |
ml |
| T13639 |
59785-59789 |
NN |
denotes |
type |
| T13640 |
59793-59794 |
NN |
denotes |
S |
| T13641 |
59790-59792 |
CD |
denotes |
IV |
| T13642 |
59792-59793 |
HYPH |
denotes |
- |
| T13643 |
59795-59801 |
JJ |
denotes |
bovine |
| T13644 |
59817-59818 |
-LRB- |
denotes |
( |
| T13645 |
59818-59823 |
NNP |
denotes |
Sigma |
| T13646 |
59823-59825 |
, |
denotes |
, |
| T13647 |
59825-59828 |
NNP |
denotes |
St. |
| T13648 |
59829-59834 |
NNP |
denotes |
Louis |
| T13649 |
59834-59836 |
, |
denotes |
, |
| T13650 |
59836-59844 |
NNP |
denotes |
Missouri |
| T13651 |
59844-59846 |
, |
denotes |
, |
| T13652 |
59846-59852 |
NNP |
denotes |
United |
| T13653 |
59853-59859 |
NNP |
denotes |
States |
| T13654 |
59859-59860 |
-RRB- |
denotes |
) |
| T13655 |
59861-59863 |
IN |
denotes |
in |
| T13656 |
59864-59867 |
NNS |
denotes |
PBS |
| T13657 |
59868-59869 |
-LRB- |
denotes |
( |
| T13658 |
59869-59871 |
NN |
denotes |
pH |
| T13659 |
59872-59873 |
CD |
denotes |
5 |
| T13660 |
59873-59874 |
-RRB- |
denotes |
) |
| T13661 |
59875-59877 |
IN |
denotes |
at |
| T13662 |
59878-59880 |
CD |
denotes |
37 |
| T13663 |
59881-59883 |
NN |
denotes |
°C |
| T13664 |
59884-59887 |
IN |
denotes |
for |
| T13665 |
59888-59890 |
CD |
denotes |
30 |
| T13666 |
59891-59894 |
NN |
denotes |
min |
| T13667 |
59895-59897 |
IN |
denotes |
to |
| T13668 |
59898-59899 |
CD |
denotes |
2 |
| T13669 |
59900-59901 |
NN |
denotes |
h |
| T13670 |
59902-59911 |
VBG |
denotes |
depending |
| T13671 |
59912-59914 |
IN |
denotes |
on |
| T13672 |
59915-59918 |
DT |
denotes |
the |
| T13673 |
59919-59924 |
NN |
denotes |
stage |
| T13674 |
59924-59925 |
. |
denotes |
. |
| T13675 |
59925-60223 |
sentence |
denotes |
Slides were then washed in PBS, treated with 0.3% hydrogen peroxide in 100% methanol for 30 min, washed, blocked with PBS + 0.05% Tween20 + 5% goat or fetal bovine serum, washed again, and incubated with primary antibodies in PBS + 0.05% Tween 20 + 1% goat or fetal bovine serum overnight at 4 °C. |
| T13676 |
59926-59932 |
NNS |
denotes |
Slides |
| T13677 |
59943-59949 |
VBN |
denotes |
washed |
| T13678 |
59933-59937 |
VBD |
denotes |
were |
| T13679 |
59938-59942 |
RB |
denotes |
then |
| T13680 |
59950-59952 |
IN |
denotes |
in |
| T13681 |
59953-59956 |
NN |
denotes |
PBS |
| T13682 |
59956-59958 |
, |
denotes |
, |
| T13683 |
59958-59965 |
VBN |
denotes |
treated |
| T13684 |
59966-59970 |
IN |
denotes |
with |
| T13685 |
59971-59974 |
CD |
denotes |
0.3 |
| T13686 |
59974-59975 |
NN |
denotes |
% |
| T13687 |
59985-59993 |
NN |
denotes |
peroxide |
| T13688 |
59976-59984 |
NN |
denotes |
hydrogen |
| T13689 |
59994-59996 |
IN |
denotes |
in |
| T13690 |
59997-60000 |
CD |
denotes |
100 |
| T13691 |
60000-60001 |
NN |
denotes |
% |
| T13692 |
60002-60010 |
NN |
denotes |
methanol |
| T13693 |
60011-60014 |
IN |
denotes |
for |
| T13694 |
60015-60017 |
CD |
denotes |
30 |
| T13695 |
60018-60021 |
NN |
denotes |
min |
| T13696 |
60021-60023 |
, |
denotes |
, |
| T13697 |
60023-60029 |
VBN |
denotes |
washed |
| T13698 |
60029-60031 |
, |
denotes |
, |
| T13699 |
60031-60038 |
VBN |
denotes |
blocked |
| T13700 |
60039-60043 |
IN |
denotes |
with |
| T13701 |
60044-60047 |
NN |
denotes |
PBS |
| T13702 |
60048-60049 |
SYM |
denotes |
+ |
| T13703 |
60050-60054 |
CD |
denotes |
0.05 |
| T13704 |
60054-60055 |
NN |
denotes |
% |
| T13705 |
60056-60063 |
NN |
denotes |
Tween20 |
| T13706 |
60064-60065 |
SYM |
denotes |
+ |
| T13707 |
60066-60067 |
CD |
denotes |
5 |
| T13708 |
60067-60068 |
NN |
denotes |
% |
| T13709 |
60090-60095 |
NN |
denotes |
serum |
| T13710 |
60069-60073 |
NN |
denotes |
goat |
| T13711 |
60074-60076 |
CC |
denotes |
or |
| T13712 |
60077-60082 |
JJ |
denotes |
fetal |
| T13713 |
60083-60089 |
JJ |
denotes |
bovine |
| T13714 |
60095-60097 |
, |
denotes |
, |
| T13715 |
60097-60103 |
VBD |
denotes |
washed |
| T13716 |
60104-60109 |
RB |
denotes |
again |
| T13717 |
60109-60111 |
, |
denotes |
, |
| T13718 |
60111-60114 |
CC |
denotes |
and |
| T13719 |
60115-60124 |
VBN |
denotes |
incubated |
| T13720 |
60125-60129 |
IN |
denotes |
with |
| T13721 |
60130-60137 |
JJ |
denotes |
primary |
| T13722 |
60138-60148 |
NNS |
denotes |
antibodies |
| T13723 |
60149-60151 |
IN |
denotes |
in |
| T13724 |
60152-60155 |
NN |
denotes |
PBS |
| T13725 |
60156-60157 |
SYM |
denotes |
+ |
| T13726 |
60158-60162 |
CD |
denotes |
0.05 |
| T13727 |
60162-60163 |
NN |
denotes |
% |
| T13728 |
60164-60169 |
NN |
denotes |
Tween |
| T13729 |
60170-60172 |
CD |
denotes |
20 |
| T13730 |
60173-60174 |
SYM |
denotes |
+ |
| T13731 |
60175-60176 |
CD |
denotes |
1 |
| T13732 |
60176-60177 |
NN |
denotes |
% |
| T13733 |
60199-60204 |
NN |
denotes |
serum |
| T13734 |
60178-60182 |
NN |
denotes |
goat |
| T13735 |
60183-60185 |
CC |
denotes |
or |
| T13736 |
60186-60191 |
JJ |
denotes |
fetal |
| T13737 |
60192-60198 |
JJ |
denotes |
bovine |
| T13738 |
60205-60214 |
RB |
denotes |
overnight |
| T13739 |
60215-60217 |
IN |
denotes |
at |
| T13740 |
60218-60219 |
CD |
denotes |
4 |
| T13741 |
60220-60222 |
NN |
denotes |
°C |
| T13742 |
60222-60223 |
. |
denotes |
. |
| T13743 |
60223-60389 |
sentence |
denotes |
Biotin-labeled secondary antibodies (Vector Labs) were tagged with HRP using the Vectastain Elite ABC kit (Vector Labs) followed by detection with DAB (Vector Labs). |
| T13744 |
60224-60230 |
NN |
denotes |
Biotin |
| T13745 |
60231-60238 |
VBN |
denotes |
labeled |
| T13746 |
60230-60231 |
HYPH |
denotes |
- |
| T13747 |
60249-60259 |
NNS |
denotes |
antibodies |
| T13748 |
60239-60248 |
JJ |
denotes |
secondary |
| T13749 |
60279-60285 |
VBN |
denotes |
tagged |
| T13750 |
60260-60261 |
-LRB- |
denotes |
( |
| T13751 |
60268-60272 |
NNS |
denotes |
Labs |
| T13752 |
60261-60267 |
NN |
denotes |
Vector |
| T13753 |
60272-60273 |
-RRB- |
denotes |
) |
| T13754 |
60274-60278 |
VBD |
denotes |
were |
| T13755 |
60286-60290 |
IN |
denotes |
with |
| T13756 |
60291-60294 |
NN |
denotes |
HRP |
| T13757 |
60295-60300 |
VBG |
denotes |
using |
| T13758 |
60301-60304 |
DT |
denotes |
the |
| T13759 |
60326-60329 |
NN |
denotes |
kit |
| T13760 |
60305-60315 |
NNP |
denotes |
Vectastain |
| T13761 |
60316-60321 |
NNP |
denotes |
Elite |
| T13762 |
60322-60325 |
NNP |
denotes |
ABC |
| T13763 |
60330-60331 |
-LRB- |
denotes |
( |
| T13764 |
60338-60342 |
NNPS |
denotes |
Labs |
| T13765 |
60331-60337 |
NNP |
denotes |
Vector |
| T13766 |
60342-60343 |
-RRB- |
denotes |
) |
| T13767 |
60344-60352 |
VBN |
denotes |
followed |
| T13768 |
60353-60355 |
IN |
denotes |
by |
| T13769 |
60356-60365 |
NN |
denotes |
detection |
| T13770 |
60366-60370 |
IN |
denotes |
with |
| T13771 |
60371-60374 |
NN |
denotes |
DAB |
| T13772 |
60375-60376 |
-LRB- |
denotes |
( |
| T13773 |
60383-60387 |
NNPS |
denotes |
Labs |
| T13774 |
60376-60382 |
NNP |
denotes |
Vector |
| T13775 |
60387-60388 |
-RRB- |
denotes |
) |
| T13776 |
60388-60389 |
. |
denotes |
. |
| T13777 |
60389-60660 |
sentence |
denotes |
Primary antibodies and dilutions used were: goat anti-mouse MMP13, 1:100 (Chemicon International, Temecula, California, United States); rabbit anti-human SOX9, 1:500 (Morais da Silva et al. 1996); rabbit anti-phosphorylated-SOX9 (SOX9.P), 1:10–1:250 (Huang et al. 2000). |
| T13778 |
60390-60397 |
JJ |
denotes |
Primary |
| T13779 |
60398-60408 |
NNS |
denotes |
antibodies |
| T13780 |
60428-60432 |
VBD |
denotes |
were |
| T13781 |
60409-60412 |
CC |
denotes |
and |
| T13782 |
60413-60422 |
NNS |
denotes |
dilutions |
| T13783 |
60423-60427 |
VBN |
denotes |
used |
| T13784 |
60432-60434 |
: |
denotes |
: |
| T13785 |
60434-60438 |
NN |
denotes |
goat |
| T13786 |
60450-60455 |
NN |
denotes |
MMP13 |
| T13787 |
60439-60449 |
JJ |
denotes |
anti-mouse |
| T13788 |
60455-60457 |
, |
denotes |
, |
| T13789 |
60457-60458 |
CD |
denotes |
1 |
| T13790 |
60458-60459 |
SYM |
denotes |
: |
| T13791 |
60459-60462 |
CD |
denotes |
100 |
| T13792 |
60463-60464 |
-LRB- |
denotes |
( |
| T13793 |
60473-60486 |
NNP |
denotes |
International |
| T13794 |
60464-60472 |
NNP |
denotes |
Chemicon |
| T13795 |
60486-60488 |
, |
denotes |
, |
| T13796 |
60488-60496 |
NNP |
denotes |
Temecula |
| T13797 |
60496-60498 |
, |
denotes |
, |
| T13798 |
60498-60508 |
NNP |
denotes |
California |
| T13799 |
60508-60510 |
, |
denotes |
, |
| T13800 |
60510-60516 |
NNP |
denotes |
United |
| T13801 |
60517-60523 |
NNP |
denotes |
States |
| T13802 |
60523-60524 |
-RRB- |
denotes |
) |
| T13803 |
60524-60525 |
: |
denotes |
; |
| T13804 |
60526-60532 |
NN |
denotes |
rabbit |
| T13805 |
60544-60548 |
NN |
denotes |
SOX9 |
| T13806 |
60533-60543 |
JJ |
denotes |
anti-human |
| T13807 |
60548-60550 |
, |
denotes |
, |
| T13808 |
60550-60551 |
CD |
denotes |
1 |
| T13809 |
60551-60552 |
SYM |
denotes |
: |
| T13810 |
60552-60555 |
CD |
denotes |
500 |
| T13811 |
60556-60557 |
-LRB- |
denotes |
( |
| T13812 |
60557-60563 |
NNP |
denotes |
Morais |
| T13813 |
60564-60566 |
NNP |
denotes |
da |
| T13814 |
60567-60572 |
NNP |
denotes |
Silva |
| T13815 |
60573-60575 |
FW |
denotes |
et |
| T13816 |
60576-60579 |
FW |
denotes |
al. |
| T13817 |
60580-60584 |
CD |
denotes |
1996 |
| T13818 |
60584-60585 |
-RRB- |
denotes |
) |
| T13819 |
60585-60586 |
: |
denotes |
; |
| T13820 |
60587-60593 |
NN |
denotes |
rabbit |
| T13821 |
60614-60618 |
NN |
denotes |
SOX9 |
| T13822 |
60594-60613 |
VBN |
denotes |
anti-phosphorylated |
| T13823 |
60613-60614 |
HYPH |
denotes |
- |
| T13824 |
60619-60620 |
-LRB- |
denotes |
( |
| T13825 |
60620-60624 |
NN |
denotes |
SOX9 |
| T13826 |
60625-60626 |
NN |
denotes |
P |
| T13827 |
60624-60625 |
, |
denotes |
. |
| T13828 |
60626-60627 |
-RRB- |
denotes |
) |
| T13829 |
60627-60629 |
, |
denotes |
, |
| T13830 |
60629-60630 |
CD |
denotes |
1 |
| T13831 |
60630-60631 |
SYM |
denotes |
: |
| T13832 |
60631-60633 |
CD |
denotes |
10 |
| T13833 |
60633-60634 |
SYM |
denotes |
– |
| T13834 |
60634-60635 |
CD |
denotes |
1 |
| T13835 |
60635-60636 |
SYM |
denotes |
: |
| T13836 |
60636-60639 |
CD |
denotes |
250 |
| T13837 |
60640-60641 |
-LRB- |
denotes |
( |
| T13838 |
60641-60646 |
NNP |
denotes |
Huang |
| T13839 |
60647-60649 |
FW |
denotes |
et |
| T13840 |
60650-60653 |
FW |
denotes |
al. |
| T13841 |
60654-60658 |
CD |
denotes |
2000 |
| T13842 |
60658-60659 |
-RRB- |
denotes |
) |
| T13843 |
60659-60660 |
. |
denotes |
. |
| T5156 |
22493-22500 |
NN |
denotes |
Failure |
| T5157 |
22501-22503 |
IN |
denotes |
of |
| T5158 |
22504-22509 |
JJ |
denotes |
Early |
| T5159 |
22516-22525 |
NN |
denotes |
Formation |
| T5160 |
22510-22515 |
NN |
denotes |
Joint |
| T5161 |
22526-22528 |
IN |
denotes |
in |
| T5162 |
22529-22534 |
NN |
denotes |
Ankle |
| T5163 |
22535-22542 |
NNS |
denotes |
Regions |
| T5164 |
22542-22645 |
sentence |
denotes |
The Bmpr1a gene is expressed in the interzone region of developing joints at E13.5 (Baur et al. 2000). |
| T5165 |
22543-22546 |
DT |
denotes |
The |
| T5166 |
22554-22558 |
NN |
denotes |
gene |
| T5167 |
22547-22553 |
NN |
denotes |
Bmpr1a |
| T5168 |
22562-22571 |
VBN |
denotes |
expressed |
| T5169 |
22559-22561 |
VBZ |
denotes |
is |
| T5170 |
22572-22574 |
IN |
denotes |
in |
| T5171 |
22575-22578 |
DT |
denotes |
the |
| T5172 |
22589-22595 |
NN |
denotes |
region |
| T5173 |
22579-22588 |
NN |
denotes |
interzone |
| T5174 |
22596-22598 |
IN |
denotes |
of |
| T5175 |
22599-22609 |
VBG |
denotes |
developing |
| T5176 |
22610-22616 |
NNS |
denotes |
joints |
| T5177 |
22617-22619 |
IN |
denotes |
at |
| T5178 |
22620-22625 |
NN |
denotes |
E13.5 |
| T5179 |
22626-22627 |
-LRB- |
denotes |
( |
| T5180 |
22627-22631 |
NNP |
denotes |
Baur |
| T5181 |
22632-22634 |
FW |
denotes |
et |
| T5182 |
22635-22638 |
FW |
denotes |
al. |
| T5183 |
22639-22643 |
CD |
denotes |
2000 |
| T5184 |
22643-22644 |
-RRB- |
denotes |
) |
| T249 |
83-84 |
sentence |
denotes |
|
| R17 |
T247 |
T248 |
amod |
Articular,Cartilage |
| R18 |
T248 |
T246 |
pobj |
Cartilage,of |
| R19 |
T251 |
T252 |
amod |
Articular,cartilage |
| R20 |
T252 |
T253 |
nsubj |
cartilage,plays |
| R21 |
T254 |
T255 |
det |
an,role |
| R84 |
T320 |
T321 |
advmod |
Here,use |
| R85 |
T322 |
T321 |
nsubj |
we,use |
| R86 |
T323 |
T324 |
amod |
regulatory,information |
| R145 |
T384 |
T382 |
pobj |
joints,in |
| R146 |
T385 |
T384 |
punct |
", ",joints |
| R147 |
T386 |
T384 |
prep |
including,joints |
| R148 |
T387 |
T388 |
amod |
early,interzones |
| R149 |
T388 |
T386 |
pobj |
interzones,including |
| R150 |
T389 |
T388 |
compound |
joint,interzones |
| R151 |
T390 |
T388 |
punct |
", ",interzones |
| R152 |
T391 |
T392 |
nmod |
adult,cartilage |
| R153 |
T392 |
T388 |
conj |
cartilage,interzones |
| R154 |
T393 |
T392 |
amod |
articular,cartilage |
| R190 |
T433 |
T434 |
amod |
multiple,defects |
| R191 |
T434 |
T432 |
pobj |
defects,with |
| R192 |
T435 |
T420 |
punct |
.,known |
| R193 |
T437 |
T438 |
advmod |
However,bypasses |
| R194 |
T439 |
T438 |
punct |
", ",bypasses |
| R195 |
T440 |
T438 |
csubj |
combining,bypasses |
| R213 |
T458 |
T457 |
pobj |
birth,to |
| R214 |
T459 |
T458 |
cc |
and,birth |
| R223 |
T468 |
T464 |
prep |
in,missing |
| R224 |
T469 |
T470 |
amod |
articular,regions |
| R225 |
T470 |
T468 |
pobj |
regions,in |
| R226 |
T471 |
T438 |
punct |
.,bypasses |
| R227 |
T473 |
T474 |
amod |
Most,joints |
| R228 |
T474 |
T475 |
nsubj |
joints,form |
| R229 |
T476 |
T474 |
prep |
in,joints |
| R230 |
T477 |
T478 |
det |
the,body |
| R293 |
T546 |
T543 |
pobj |
development,for |
| R294 |
T547 |
T546 |
cc |
and,development |
| R295 |
T548 |
T546 |
conj |
creation,development |
| R296 |
T549 |
T546 |
prep |
of,development |
| R297 |
T550 |
T551 |
amod |
multiple,tissues |
| R298 |
T551 |
T549 |
pobj |
tissues,of |
| R299 |
T552 |
T543 |
punct |
", ",for |
| R300 |
T553 |
T543 |
cc |
but,for |
| R301 |
T554 |
T553 |
advmod |
also,but |
| R302 |
T555 |
T543 |
conj |
for,for |
| R303 |
T556 |
T557 |
amod |
ongoing,maintenance |
| R304 |
T557 |
T555 |
pobj |
maintenance,for |
| R305 |
T558 |
T557 |
prep |
of,maintenance |
| R306 |
T559 |
T560 |
amod |
articular,cartilage |
| R307 |
T560 |
T558 |
pobj |
cartilage,of |
| R308 |
T561 |
T557 |
prep |
after,maintenance |
| R309 |
T562 |
T561 |
pobj |
birth,after |
| R9 |
T237 |
T238 |
compound |
BMP,Receptor |
| R10 |
T238 |
T240 |
compound |
Receptor,Signaling |
| R11 |
T240 |
T241 |
nsubjpass |
Signaling,Required |
| R12 |
T242 |
T241 |
auxpass |
Is,Required |
| R13 |
T243 |
T241 |
prep |
for,Required |
| R14 |
T244 |
T245 |
amod |
Postnatal,Maintenance |
| R15 |
T245 |
T243 |
pobj |
Maintenance,for |
| R16 |
T246 |
T245 |
prep |
of,Maintenance |
| R22 |
T255 |
T253 |
dobj |
role,plays |
| R23 |
T256 |
T255 |
amod |
essential,role |
| R24 |
T257 |
T253 |
prep |
in,plays |
| R25 |
T258 |
T257 |
pobj |
health,in |
| R26 |
T259 |
T258 |
cc |
and,health |
| R27 |
T260 |
T258 |
conj |
mobility,health |
| R28 |
T261 |
T253 |
punct |
", ",plays |
| R29 |
T262 |
T253 |
cc |
but,plays |
| R30 |
T263 |
T264 |
auxpass |
is,damaged |
| R31 |
T264 |
T253 |
conj |
damaged,plays |
| R32 |
T265 |
T264 |
advmod |
frequently,damaged |
| R33 |
T266 |
T264 |
cc |
or,damaged |
| R34 |
T267 |
T264 |
conj |
lost,damaged |
| R35 |
T268 |
T267 |
prep |
in,lost |
| R36 |
T269 |
T268 |
pobj |
millions,in |
| R37 |
T270 |
T269 |
prep |
of,millions |
| R38 |
T271 |
T270 |
pobj |
people,of |
| R39 |
T272 |
T273 |
dep |
that,develop |
| R40 |
T273 |
T271 |
relcl |
develop,people |
| R41 |
T274 |
T273 |
dobj |
arthritis,develop |
| R42 |
T275 |
T253 |
punct |
.,plays |
| R43 |
T277 |
T278 |
det |
The,mechanisms |
| R44 |
T278 |
T280 |
nsubjpass |
mechanisms,understood |
| R45 |
T279 |
T278 |
amod |
molecular,mechanisms |
| R46 |
T281 |
T282 |
dep |
that,create |
| R47 |
T282 |
T278 |
relcl |
create,mechanisms |
| R48 |
T283 |
T282 |
cc |
and,create |
| R49 |
T284 |
T282 |
conj |
maintain,create |
| R50 |
T285 |
T286 |
det |
this,layer |
| R51 |
T286 |
T284 |
dobj |
layer,maintain |
| R52 |
T287 |
T286 |
amod |
thin,layer |
| R53 |
T288 |
T286 |
prep |
of,layer |
| R54 |
T289 |
T288 |
pobj |
cartilage,of |
| R55 |
T290 |
T291 |
dep |
that,covers |
| R56 |
T291 |
T286 |
relcl |
covers,layer |
| R57 |
T292 |
T293 |
det |
the,surface |
| R58 |
T293 |
T291 |
dobj |
surface,covers |
| R59 |
T294 |
T293 |
prep |
of,surface |
| R60 |
T295 |
T294 |
pobj |
bones,of |
| R61 |
T296 |
T291 |
prep |
in,covers |
| R62 |
T297 |
T298 |
compound |
joint,regions |
| R63 |
T298 |
T296 |
pobj |
regions,in |
| R64 |
T299 |
T280 |
auxpass |
are,understood |
| R65 |
T300 |
T280 |
advmod |
poorly,understood |
| R66 |
T301 |
T280 |
punct |
", ",understood |
| R67 |
T302 |
T303 |
prep |
in,been |
| R68 |
T303 |
T280 |
advcl |
been,understood |
| R69 |
T304 |
T302 |
amod |
part,in |
| R70 |
T305 |
T303 |
mark |
because,been |
| R71 |
T306 |
T303 |
nsubj |
tools,been |
| R72 |
T307 |
T308 |
aux |
to,manipulate |
| R73 |
T308 |
T306 |
advcl |
manipulate,tools |
| R74 |
T309 |
T310 |
compound |
gene,expression |
| R75 |
T310 |
T308 |
dobj |
expression,manipulate |
| R76 |
T311 |
T312 |
advmod |
specifically,in |
| R77 |
T312 |
T308 |
prep |
in,manipulate |
| R78 |
T313 |
T314 |
det |
this,tissue |
| R79 |
T314 |
T312 |
pobj |
tissue,in |
| R80 |
T315 |
T303 |
aux |
have,been |
| R81 |
T316 |
T303 |
neg |
not,been |
| R82 |
T317 |
T303 |
acomp |
available,been |
| R83 |
T318 |
T280 |
punct |
.,understood |
| R87 |
T324 |
T321 |
dobj |
information,use |
| R88 |
T325 |
T324 |
prep |
from,information |
| R89 |
T326 |
T327 |
det |
the,gene |
| R90 |
T327 |
T325 |
pobj |
gene,from |
| R91 |
T328 |
T327 |
compound |
mouse,gene |
| R92 |
T329 |
T327 |
compound |
Gdf5,gene |
| R93 |
T330 |
T331 |
punct |
(,member |
| R95 |
T332 |
T331 |
det |
a,member |
| R96 |
T333 |
T334 |
nmod |
bone,protein |
| R97 |
T334 |
T331 |
nmod |
protein,member |
| R98 |
T335 |
T334 |
amod |
morphogenetic,protein |
| R99 |
T336 |
T337 |
punct |
[,BMP |
| R100 |
T337 |
T334 |
appos |
BMP,protein |
| R101 |
T338 |
T337 |
punct |
],BMP |
| R102 |
T339 |
T331 |
compound |
family,member |
| R103 |
T340 |
T331 |
punct |
),member |
| R104 |
T341 |
T342 |
aux |
to,develop |
| R105 |
T342 |
T321 |
advcl |
develop,use |
| R106 |
T343 |
T344 |
amod |
new,lines |
| R107 |
T344 |
T342 |
dobj |
lines,develop |
| R108 |
T345 |
T344 |
compound |
mouse,lines |
| R109 |
T346 |
T347 |
dep |
that,used |
| R110 |
T347 |
T344 |
relcl |
used,lines |
| R111 |
T348 |
T347 |
aux |
can,used |
| R112 |
T349 |
T347 |
auxpass |
be,used |
| R113 |
T350 |
T351 |
aux |
to,activate |
| R114 |
T351 |
T347 |
advcl |
activate,used |
| R115 |
T352 |
T351 |
preconj |
either,activate |
| R116 |
T353 |
T351 |
cc |
or,activate |
| R117 |
T354 |
T351 |
conj |
inactivate,activate |
| R118 |
T355 |
T354 |
dobj |
genes,inactivate |
| R119 |
T356 |
T354 |
advmod |
specifically,inactivate |
| R120 |
T357 |
T354 |
prep |
in,inactivate |
| R121 |
T358 |
T359 |
amod |
developing,joints |
| R122 |
T359 |
T357 |
pobj |
joints,in |
| R123 |
T360 |
T321 |
punct |
.,use |
| R124 |
T362 |
T363 |
nsubj |
Expression,leads |
| R125 |
T364 |
T362 |
prep |
of,Expression |
| R126 |
T365 |
T366 |
compound |
Cre,recombinase |
| R127 |
T366 |
T364 |
pobj |
recombinase,of |
| R128 |
T367 |
T366 |
prep |
from,recombinase |
| R129 |
T368 |
T369 |
nmod |
Gdf5,chromosome |
| R130 |
T369 |
T372 |
compound |
chromosome,clones |
| R131 |
T370 |
T371 |
amod |
bacterial,artificial |
| R132 |
T371 |
T369 |
amod |
artificial,chromosome |
| R133 |
T372 |
T367 |
pobj |
clones,from |
| R134 |
T373 |
T363 |
prep |
to,leads |
| R135 |
T374 |
T375 |
amod |
specific,activation |
| R136 |
T375 |
T373 |
pobj |
activation,to |
| R137 |
T376 |
T375 |
cc |
or,activation |
| R138 |
T377 |
T375 |
conj |
inactivation,activation |
| R139 |
T378 |
T375 |
prep |
of,activation |
| R140 |
T379 |
T380 |
amod |
floxed,genes |
| R141 |
T380 |
T378 |
pobj |
genes,of |
| R142 |
T381 |
T380 |
compound |
target,genes |
| R143 |
T382 |
T363 |
prep |
in,leads |
| R144 |
T383 |
T384 |
amod |
developing,joints |
| R155 |
T394 |
T392 |
punct |
", ",cartilage |
| R156 |
T395 |
T392 |
cc |
and,cartilage |
| R157 |
T396 |
T397 |
det |
the,capsule |
| R158 |
T397 |
T392 |
conj |
capsule,cartilage |
| R159 |
T398 |
T397 |
compound |
joint,capsule |
| R160 |
T399 |
T363 |
punct |
.,leads |
| R161 |
T401 |
T402 |
nsubj |
We,used |
| R162 |
T403 |
T402 |
aux |
have,used |
| R163 |
T404 |
T405 |
det |
this,system |
| R164 |
T405 |
T402 |
dobj |
system,used |
| R165 |
T406 |
T407 |
aux |
to,test |
| R166 |
T407 |
T402 |
advcl |
test,used |
| R167 |
T408 |
T409 |
det |
the,role |
| R168 |
T409 |
T407 |
dobj |
role,test |
| R169 |
T410 |
T409 |
prep |
of,role |
| R170 |
T411 |
T412 |
compound |
BMP,signaling |
| R171 |
T412 |
T410 |
pobj |
signaling,of |
| R172 |
T413 |
T412 |
compound |
receptor,signaling |
| R173 |
T414 |
T409 |
prep |
in,role |
| R174 |
T415 |
T416 |
compound |
joint,development |
| R175 |
T416 |
T414 |
pobj |
development,in |
| R176 |
T417 |
T402 |
punct |
.,used |
| R177 |
T419 |
T420 |
nsubjpass |
Mice,known |
| R178 |
T421 |
T419 |
prep |
with,Mice |
| R179 |
T422 |
T423 |
amod |
null,mutations |
| R180 |
T423 |
T421 |
pobj |
mutations,with |
| R181 |
T424 |
T423 |
prep |
in,mutations |
| R182 |
T425 |
T424 |
pobj |
Bmpr1a,in |
| R183 |
T426 |
T420 |
auxpass |
are,known |
| R184 |
T427 |
T428 |
aux |
to,die |
| R185 |
T428 |
T420 |
xcomp |
die,known |
| R186 |
T429 |
T428 |
advmod |
early,die |
| R187 |
T430 |
T429 |
prep |
in,early |
| R188 |
T431 |
T430 |
pobj |
embryogenesis,in |
| R189 |
T432 |
T428 |
prep |
with,die |
| R196 |
T441 |
T442 |
det |
a,allele |
| R197 |
T442 |
T440 |
dobj |
allele,combining |
| R198 |
T443 |
T442 |
amod |
floxed,allele |
| R199 |
T444 |
T442 |
compound |
Bmpr1a,allele |
| R200 |
T445 |
T440 |
prep |
with,combining |
| R201 |
T446 |
T447 |
det |
the,driver |
| R202 |
T447 |
T445 |
pobj |
driver,with |
| R203 |
T448 |
T449 |
compound |
Gdf5,Cre |
| R204 |
T449 |
T447 |
compound |
Cre,driver |
| R205 |
T450 |
T449 |
punct |
-,Cre |
| R206 |
T451 |
T452 |
det |
this,lethality |
| R207 |
T452 |
T438 |
dobj |
lethality,bypasses |
| R208 |
T453 |
T452 |
amod |
embryonic,lethality |
| R209 |
T454 |
T438 |
punct |
", ",bypasses |
| R210 |
T455 |
T438 |
cc |
and,bypasses |
| R211 |
T456 |
T438 |
conj |
leads,bypasses |
| R212 |
T457 |
T456 |
prep |
to,leads |
| R215 |
T460 |
T461 |
amod |
postnatal,development |
| R216 |
T461 |
T458 |
conj |
development,birth |
| R217 |
T462 |
T458 |
prep |
of,birth |
| R218 |
T463 |
T462 |
pobj |
mice,of |
| R219 |
T464 |
T463 |
acl |
missing,mice |
| R220 |
T465 |
T466 |
det |
the,gene |
| R221 |
T466 |
T464 |
dobj |
gene,missing |
| R222 |
T467 |
T466 |
compound |
Bmpr1a,gene |
| R231 |
T478 |
T476 |
pobj |
body,in |
| R232 |
T479 |
T475 |
advmod |
normally,form |
| R233 |
T480 |
T475 |
prep |
in,form |
| R234 |
T481 |
T482 |
det |
the,absence |
| R235 |
T482 |
T480 |
pobj |
absence,in |
| R236 |
T483 |
T482 |
prep |
of,absence |
| R237 |
T484 |
T485 |
compound |
Bmpr1a,receptor |
| R238 |
T485 |
T486 |
compound |
receptor,function |
| R239 |
T486 |
T483 |
pobj |
function,of |
| R240 |
T487 |
T475 |
punct |
.,form |
| R241 |
T489 |
T490 |
advmod |
However,wears |
| R242 |
T491 |
T490 |
punct |
", ",wears |
| R243 |
T492 |
T493 |
amod |
articular,cartilage |
| R244 |
T493 |
T490 |
nsubj |
cartilage,wears |
| R245 |
T494 |
T493 |
prep |
within,cartilage |
| R246 |
T495 |
T496 |
det |
the,joints |
| R247 |
T496 |
T494 |
pobj |
joints,within |
| R248 |
T497 |
T490 |
advmod |
gradually,wears |
| R249 |
T498 |
T490 |
prt |
away,wears |
| R250 |
T499 |
T490 |
prep |
in,wears |
| R251 |
T500 |
T501 |
nmod |
receptor,mice |
| R252 |
T501 |
T499 |
pobj |
mice,in |
| R253 |
T502 |
T500 |
punct |
-,receptor |
| R254 |
T503 |
T500 |
amod |
deficient,receptor |
| R255 |
T504 |
T490 |
prep |
after,wears |
| R256 |
T505 |
T504 |
pobj |
birth,after |
| R257 |
T506 |
T490 |
prep |
in,wears |
| R258 |
T507 |
T508 |
det |
a,process |
| R259 |
T508 |
T506 |
pobj |
process,in |
| R260 |
T509 |
T508 |
acl |
resembling,process |
| R261 |
T510 |
T511 |
amod |
human,osteoarthritis |
| R262 |
T511 |
T509 |
dobj |
osteoarthritis,resembling |
| R263 |
T512 |
T490 |
punct |
.,wears |
| R264 |
T514 |
T515 |
compound |
Gdf5,Cre |
| R265 |
T515 |
T517 |
compound |
Cre,mice |
| R266 |
T516 |
T515 |
punct |
-,Cre |
| R267 |
T517 |
T518 |
nsubj |
mice,provide |
| R268 |
T519 |
T520 |
det |
a,system |
| R269 |
T520 |
T518 |
dobj |
system,provide |
| R270 |
T521 |
T520 |
amod |
general,system |
| R271 |
T522 |
T523 |
dep |
that,used |
| R272 |
T523 |
T520 |
relcl |
used,system |
| R273 |
T524 |
T523 |
aux |
can,used |
| R274 |
T525 |
T523 |
auxpass |
be,used |
| R275 |
T526 |
T527 |
aux |
to,test |
| R276 |
T527 |
T523 |
advcl |
test,used |
| R277 |
T528 |
T529 |
det |
the,role |
| R278 |
T529 |
T527 |
dobj |
role,test |
| R279 |
T530 |
T529 |
prep |
of,role |
| R280 |
T531 |
T530 |
pobj |
genes,of |
| R281 |
T532 |
T529 |
prep |
in,role |
| R282 |
T533 |
T534 |
amod |
articular,regions |
| R283 |
T534 |
T532 |
pobj |
regions,in |
| R284 |
T535 |
T518 |
punct |
.,provide |
| R285 |
T537 |
T538 |
compound |
BMP,receptor |
| R286 |
T538 |
T539 |
compound |
receptor,signaling |
| R287 |
T539 |
T540 |
nsubjpass |
signaling,required |
| R288 |
T541 |
T540 |
auxpass |
is,required |
| R289 |
T542 |
T543 |
preconj |
not,for |
| R290 |
T543 |
T540 |
prep |
for,required |
| R291 |
T544 |
T542 |
advmod |
only,not |
| R292 |
T545 |
T546 |
amod |
early,development |
| R310 |
T563 |
T540 |
punct |
.,required |
| R311 |
T565 |
T566 |
amod |
Genetic,variation |
| R312 |
T566 |
T567 |
nsubj |
variation,be |
| R313 |
T568 |
T566 |
prep |
in,variation |
| R314 |
T569 |
T570 |
det |
the,strength |
| R315 |
T570 |
T568 |
pobj |
strength,in |
| R316 |
T571 |
T570 |
prep |
of,strength |
| R317 |
T572 |
T573 |
compound |
BMP,receptor |
| R318 |
T573 |
T574 |
compound |
receptor,signaling |
| R319 |
T574 |
T571 |
pobj |
signaling,of |
| R320 |
T575 |
T567 |
aux |
may,be |
| R321 |
T576 |
T577 |
det |
an,factor |
| R322 |
T577 |
T567 |
attr |
factor,be |
| R323 |
T578 |
T577 |
amod |
important,factor |
| R324 |
T579 |
T577 |
compound |
risk,factor |
| R325 |
T580 |
T567 |
prep |
in,be |
| R326 |
T581 |
T582 |
amod |
human,osteoarthritis |
| R327 |
T582 |
T580 |
pobj |
osteoarthritis,in |
| R328 |
T583 |
T567 |
punct |
", ",be |
| R329 |
T584 |
T567 |
cc |
and,be |
| R330 |
T585 |
T586 |
nsubjpass |
treatments,investigated |
| R331 |
T586 |
T567 |
conj |
investigated,be |
| R332 |
T587 |
T588 |
dep |
that,mimic |
| R333 |
T588 |
T585 |
relcl |
mimic,treatments |
| R334 |
T589 |
T588 |
cc |
or,mimic |
| R335 |
T590 |
T588 |
conj |
augment,mimic |
| R336 |
T591 |
T592 |
compound |
BMP,receptor |
| R337 |
T592 |
T593 |
compound |
receptor,signaling |
| R338 |
T593 |
T590 |
dobj |
signaling,augment |
| R339 |
T594 |
T586 |
aux |
should,investigated |
| R340 |
T595 |
T586 |
auxpass |
be,investigated |
| R341 |
T596 |
T586 |
prep |
as,investigated |
| R342 |
T597 |
T598 |
det |
a,strategy |
| R343 |
T598 |
T596 |
pobj |
strategy,as |
| R344 |
T599 |
T598 |
amod |
possible,strategy |
| R345 |
T600 |
T598 |
amod |
therapeutic,strategy |
| R346 |
T601 |
T598 |
prep |
for,strategy |
| R347 |
T602 |
T601 |
pcomp |
maintaining,for |
| R348 |
T603 |
T604 |
det |
the,health |
| R349 |
T604 |
T602 |
dobj |
health,maintaining |
| R350 |
T605 |
T604 |
prep |
of,health |
| R351 |
T606 |
T607 |
compound |
joint,linings |
| R352 |
T607 |
T605 |
pobj |
linings,of |
| R353 |
T608 |
T586 |
punct |
.,investigated |
| R360 |
T1083 |
T1084 |
amod |
Thin,layers |
| R361 |
T1084 |
T1085 |
nsubj |
layers,line |
| R362 |
T1086 |
T1084 |
prep |
of,layers |
| R363 |
T1087 |
T1088 |
amod |
articular,cartilage |
| R364 |
T1088 |
T1086 |
pobj |
cartilage,of |
| R365 |
T1089 |
T1090 |
det |
the,bones |
| R366 |
T1090 |
T1085 |
dobj |
bones,line |
| R367 |
T1091 |
T1090 |
prep |
of,bones |
| R368 |
T1092 |
T1093 |
amod |
synovial,joints |
| R369 |
T1093 |
T1091 |
pobj |
joints,of |
| R370 |
T1094 |
T1085 |
cc |
and,line |
| R371 |
T1095 |
T1085 |
conj |
provide,line |
| R372 |
T1096 |
T1097 |
det |
a,structure |
| R373 |
T1097 |
T1095 |
dobj |
structure,provide |
| R374 |
T1098 |
T1097 |
amod |
smooth,structure |
| R375 |
T1099 |
T1097 |
punct |
", ",structure |
| R376 |
T1100 |
T1101 |
npadvmod |
wear,resistant |
| R377 |
T1101 |
T1097 |
amod |
resistant,structure |
| R378 |
T1102 |
T1101 |
punct |
-,resistant |
| R379 |
T1103 |
T1104 |
dep |
that,reduces |
| R380 |
T1104 |
T1097 |
relcl |
reduces,structure |
| R381 |
T1105 |
T1104 |
dobj |
friction,reduces |
| R382 |
T1106 |
T1104 |
cc |
and,reduces |
| R383 |
T1107 |
T1104 |
conj |
absorbs,reduces |
| R384 |
T1108 |
T1109 |
compound |
impact,forces |
| R385 |
T1109 |
T1107 |
dobj |
forces,absorbs |
| R386 |
T1110 |
T1111 |
punct |
(,Brandt |
| R387 |
T1111 |
T1095 |
meta |
Brandt,provide |
| R388 |
T1112 |
T1111 |
nmod |
et,Brandt |
| R389 |
T1113 |
T1111 |
nmod |
al.,Brandt |
| R390 |
T1114 |
T1111 |
nummod |
1998,Brandt |
| R391 |
T1115 |
T1111 |
punct |
),Brandt |
| R392 |
T1116 |
T1085 |
punct |
.,line |
| R393 |
T1118 |
T1119 |
nsubj |
Loss,is |
| R394 |
T1120 |
T1118 |
cc |
or,Loss |
| R395 |
T1121 |
T1118 |
conj |
damage,Loss |
| R396 |
T1122 |
T1121 |
prep |
to,damage |
| R397 |
T1123 |
T1124 |
amod |
articular,cartilage |
| R398 |
T1124 |
T1122 |
pobj |
cartilage,to |
| R399 |
T1125 |
T1126 |
det |
a,hallmark |
| R400 |
T1126 |
T1119 |
attr |
hallmark,is |
| R401 |
T1127 |
T1126 |
prep |
of,hallmark |
| R402 |
T1128 |
T1129 |
amod |
arthritic,diseases |
| R403 |
T1129 |
T1127 |
pobj |
diseases,of |
| R404 |
T1130 |
T1119 |
cc |
and,is |
| R405 |
T1131 |
T1119 |
conj |
is,is |
| R406 |
T1132 |
T1131 |
attr |
one,is |
| R407 |
T1133 |
T1132 |
prep |
of,one |
| R408 |
T1134 |
T1135 |
det |
the,reasons |
| R409 |
T1135 |
T1133 |
pobj |
reasons,of |
| R410 |
T1136 |
T1137 |
advmod |
most,common |
| R411 |
T1137 |
T1135 |
amod |
common,reasons |
| R412 |
T1138 |
T1139 |
mark |
that,seek |
| R413 |
T1139 |
T1135 |
acl |
seek,reasons |
| R414 |
T1140 |
T1141 |
preconj |
both,young |
| R415 |
T1141 |
T1142 |
amod |
young,adults |
| R416 |
T1142 |
T1139 |
nsubj |
adults,seek |
| R417 |
T1143 |
T1141 |
cc |
and,young |
| R418 |
T1144 |
T1141 |
conj |
old,young |
| R419 |
T1145 |
T1146 |
amod |
medical,care |
| R420 |
T1146 |
T1139 |
dobj |
care,seek |
| R421 |
T1147 |
T1119 |
punct |
.,is |
| R422 |
T1149 |
T1150 |
nsubj |
Millions,are |
| R423 |
T1151 |
T1149 |
prep |
of,Millions |
| R424 |
T1152 |
T1151 |
pobj |
people,of |
| R425 |
T1153 |
T1150 |
acomp |
afflicted,are |
| R426 |
T1154 |
T1153 |
prep |
with,afflicted |
| R427 |
T1155 |
T1154 |
pobj |
arthritis,with |
| R428 |
T1156 |
T1150 |
punct |
", ",are |
| R429 |
T1157 |
T1150 |
cc |
and,are |
| R430 |
T1158 |
T1159 |
nsubj |
it,affects |
| R431 |
T1159 |
T1150 |
conj |
affects,are |
| R432 |
T1160 |
T1159 |
advmod |
ultimately,affects |
| R433 |
T1161 |
T1162 |
amod |
more,half |
| R434 |
T1162 |
T1159 |
dobj |
half,affects |
| R435 |
T1163 |
T1162 |
quantmod |
than,half |
| R436 |
T1164 |
T1162 |
prep |
of,half |
| R437 |
T1165 |
T1164 |
pobj |
people,of |
| R438 |
T1166 |
T1165 |
prep |
over,people |
| R439 |
T1167 |
T1168 |
det |
the,age |
| R440 |
T1168 |
T1166 |
pobj |
age,over |
| R441 |
T1169 |
T1168 |
prep |
of,age |
| R442 |
T1170 |
T1169 |
pobj |
65,of |
| R443 |
T1171 |
T1172 |
punct |
(,Badley |
| R444 |
T1172 |
T1159 |
parataxis |
Badley,affects |
| R445 |
T1173 |
T1172 |
nummod |
1995,Badley |
| R446 |
T1174 |
T1172 |
punct |
;,Badley |
| R447 |
T1175 |
T1172 |
conj |
Yelin,Badley |
| R448 |
T1176 |
T1175 |
cc |
and,Yelin |
| R449 |
T1177 |
T1175 |
conj |
Callahan,Yelin |
| R450 |
T1178 |
T1177 |
nummod |
1995,Callahan |
| R451 |
T1179 |
T1172 |
punct |
),Badley |
| R452 |
T1180 |
T1159 |
punct |
.,affects |
| R453 |
T1182 |
T1183 |
det |
A,understanding |
| R454 |
T1183 |
T1185 |
nsubj |
understanding,is |
| R455 |
T1184 |
T1183 |
amod |
better,understanding |
| R456 |
T1186 |
T1183 |
prep |
of,understanding |
| R457 |
T1187 |
T1188 |
det |
the,mechanisms |
| R458 |
T1188 |
T1186 |
pobj |
mechanisms,of |
| R459 |
T1189 |
T1188 |
amod |
molecular,mechanisms |
| R460 |
T1190 |
T1191 |
dep |
that,create |
| R461 |
T1191 |
T1188 |
relcl |
create,mechanisms |
| R462 |
T1192 |
T1191 |
cc |
and,create |
| R463 |
T1193 |
T1191 |
conj |
maintain,create |
| R464 |
T1194 |
T1195 |
amod |
articular,cartilage |
| R465 |
T1195 |
T1193 |
dobj |
cartilage,maintain |
| R466 |
T1196 |
T1185 |
acomp |
crucial,is |
| R467 |
T1197 |
T1196 |
prep |
for,crucial |
| R468 |
T1198 |
T1197 |
pcomp |
discovering,for |
| R469 |
T1199 |
T1200 |
det |
the,causes |
| R470 |
T1200 |
T1198 |
dobj |
causes,discovering |
| R471 |
T1201 |
T1200 |
prep |
of,causes |
| R472 |
T1202 |
T1203 |
compound |
joint,disorders |
| R473 |
T1203 |
T1201 |
pobj |
disorders,of |
| R474 |
T1204 |
T1198 |
cc |
and,discovering |
| R475 |
T1205 |
T1198 |
conj |
providing,discovering |
| R476 |
T1206 |
T1207 |
amod |
useful,treatments |
| R477 |
T1207 |
T1205 |
dobj |
treatments,providing |
| R478 |
T1208 |
T1207 |
amod |
medical,treatments |
| R479 |
T1209 |
T1185 |
punct |
.,is |
| R480 |
T1211 |
T1212 |
compound |
Joint,formation |
| R481 |
T1212 |
T1213 |
nsubj |
formation,begins |
| R482 |
T1214 |
T1213 |
prep |
during,begins |
| R483 |
T1215 |
T1214 |
pobj |
embryogenesis,during |
| R484 |
T1216 |
T1215 |
punct |
", ",embryogenesis |
| R485 |
T1217 |
T1218 |
advmod |
when,form |
| R486 |
T1218 |
T1215 |
relcl |
form,embryogenesis |
| R487 |
T1219 |
T1218 |
nsubj |
stripes,form |
| R488 |
T1220 |
T1219 |
prep |
of,stripes |
| R489 |
T1221 |
T1222 |
amod |
high,density |
| R490 |
T1222 |
T1220 |
pobj |
density,of |
| R491 |
T1223 |
T1222 |
compound |
cell,density |
| R492 |
T1224 |
T1219 |
acl |
called,stripes |
| R493 |
T1225 |
T1224 |
oprd |
interzones,called |
| R494 |
T1226 |
T1218 |
prep |
across,form |
| R495 |
T1227 |
T1228 |
amod |
developing,precursors |
| R496 |
T1228 |
T1226 |
pobj |
precursors,across |
| R497 |
T1229 |
T1228 |
amod |
skeletal,precursors |
| R498 |
T1230 |
T1231 |
punct |
(,Haines |
| R499 |
T1231 |
T1213 |
meta |
Haines,begins |
| R500 |
T1232 |
T1231 |
nummod |
1947,Haines |
| R501 |
T1233 |
T1231 |
punct |
),Haines |
| R502 |
T1234 |
T1213 |
punct |
.,begins |
| R503 |
T1236 |
T1237 |
amod |
Programmed,death |
| R504 |
T1237 |
T1239 |
nsubj |
death,occurs |
| R505 |
T1238 |
T1237 |
compound |
cell,death |
| R506 |
T1240 |
T1239 |
prep |
within,occurs |
| R507 |
T1241 |
T1242 |
det |
the,interzone |
| R508 |
T1242 |
T1240 |
pobj |
interzone,within |
| R509 |
T1243 |
T1239 |
punct |
", ",occurs |
| R510 |
T1244 |
T1239 |
cc |
and,occurs |
| R511 |
T1245 |
T1246 |
det |
a,interzone |
| R512 |
T1246 |
T1250 |
nsubj |
interzone,forms |
| R513 |
T1247 |
T1248 |
advmod |
three,layered |
| R514 |
T1248 |
T1246 |
amod |
layered,interzone |
| R515 |
T1249 |
T1248 |
punct |
-,layered |
| R516 |
T1250 |
T1239 |
conj |
forms,occurs |
| R517 |
T1251 |
T1252 |
dep |
that,has |
| R518 |
T1252 |
T1250 |
ccomp |
has,forms |
| R519 |
T1253 |
T1254 |
nummod |
two,layers |
| R520 |
T1254 |
T1252 |
dobj |
layers,has |
| R521 |
T1255 |
T1254 |
prep |
of,layers |
| R522 |
T1256 |
T1257 |
amod |
higher,density |
| R523 |
T1257 |
T1255 |
pobj |
density,of |
| R524 |
T1258 |
T1257 |
compound |
cell,density |
| R525 |
T1259 |
T1254 |
acl |
flanking,layers |
| R526 |
T1260 |
T1261 |
det |
a,region |
| R527 |
T1261 |
T1259 |
dobj |
region,flanking |
| R528 |
T1262 |
T1261 |
prep |
of,region |
| R529 |
T1263 |
T1264 |
amod |
lower,density |
| R530 |
T1264 |
T1262 |
pobj |
density,of |
| R531 |
T1265 |
T1264 |
compound |
cell,density |
| R532 |
T1266 |
T1250 |
punct |
.,forms |
| R533 |
T1268 |
T1269 |
compound |
Non-joint,precursors |
| R534 |
T1269 |
T1270 |
nsubj |
precursors,develop |
| R535 |
T1271 |
T1269 |
prep |
of,precursors |
| R536 |
T1272 |
T1273 |
det |
the,skeleton |
| R537 |
T1273 |
T1271 |
pobj |
skeleton,of |
| R538 |
T1274 |
T1270 |
advmod |
typically,develop |
| R539 |
T1275 |
T1270 |
prep |
into,develop |
| R540 |
T1276 |
T1275 |
pobj |
cartilage,into |
| R541 |
T1277 |
T1276 |
punct |
", ",cartilage |
| R542 |
T1278 |
T1279 |
dep |
which,hypertrophies |
| R543 |
T1279 |
T1276 |
relcl |
hypertrophies,cartilage |
| R544 |
T1280 |
T1279 |
cc |
and,hypertrophies |
| R545 |
T1281 |
T1282 |
auxpass |
is,replaced |
| R546 |
T1282 |
T1279 |
conj |
replaced,hypertrophies |
| R547 |
T1283 |
T1282 |
agent |
by,replaced |
| R548 |
T1284 |
T1283 |
pobj |
bone,by |
| R549 |
T1285 |
T1270 |
punct |
.,develop |
| R550 |
T1287 |
T1288 |
advmod |
However,excluded |
| R551 |
T1289 |
T1288 |
punct |
", ",excluded |
| R552 |
T1290 |
T1288 |
nsubjpass |
cells,excluded |
| R553 |
T1291 |
T1290 |
prep |
within,cells |
| R554 |
T1292 |
T1293 |
det |
the,layers |
| R555 |
T1293 |
T1291 |
pobj |
layers,within |
| R556 |
T1294 |
T1295 |
amod |
high,density |
| R557 |
T1295 |
T1293 |
compound |
density,layers |
| R558 |
T1296 |
T1295 |
punct |
-,density |
| R559 |
T1297 |
T1293 |
prep |
of,layers |
| R560 |
T1298 |
T1299 |
det |
the,interzone |
| R561 |
T1299 |
T1297 |
pobj |
interzone,of |
| R562 |
T1300 |
T1288 |
auxpass |
are,excluded |
| R563 |
T1301 |
T1288 |
prep |
from,excluded |
| R564 |
T1302 |
T1303 |
det |
this,process |
| R565 |
T1303 |
T1301 |
pobj |
process,from |
| R566 |
T1304 |
T1288 |
cc |
and,excluded |
| R567 |
T1305 |
T1288 |
conj |
develop,excluded |
| R568 |
T1306 |
T1305 |
prep |
into,develop |
| R569 |
T1307 |
T1308 |
det |
the,layers |
| R570 |
T1308 |
T1306 |
pobj |
layers,into |
| R571 |
T1309 |
T1308 |
amod |
permanent,layers |
| R572 |
T1310 |
T1308 |
prep |
of,layers |
| R573 |
T1311 |
T1312 |
amod |
articular,cartilage |
| R574 |
T1312 |
T1310 |
pobj |
cartilage,of |
| R575 |
T1313 |
T1308 |
acl |
found,layers |
| R576 |
T1314 |
T1313 |
prep |
in,found |
| R577 |
T1315 |
T1316 |
det |
the,joint |
| R578 |
T1316 |
T1314 |
pobj |
joint,in |
| R579 |
T1317 |
T1316 |
amod |
mature,joint |
| R580 |
T1318 |
T1319 |
punct |
(,Mitrovic |
| R581 |
T1319 |
T1305 |
meta |
Mitrovic,develop |
| R582 |
T1320 |
T1319 |
nummod |
1978,Mitrovic |
| R583 |
T1321 |
T1319 |
punct |
),Mitrovic |
| R584 |
T1322 |
T1288 |
punct |
.,excluded |
| R585 |
T1324 |
T1325 |
nsubj |
Studies,begun |
| R586 |
T1326 |
T1324 |
prep |
over,Studies |
| R587 |
T1327 |
T1328 |
det |
the,y |
| R588 |
T1328 |
T1326 |
pobj |
y,over |
| R589 |
T1329 |
T1328 |
amod |
last,y |
| R590 |
T1330 |
T1328 |
nummod |
10,y |
| R591 |
T1331 |
T1325 |
aux |
have,begun |
| R592 |
T1332 |
T1333 |
aux |
to,elucidate |
| R593 |
T1333 |
T1325 |
xcomp |
elucidate,begun |
| R594 |
T1334 |
T1333 |
dobj |
some,elucidate |
| R595 |
T1335 |
T1334 |
prep |
of,some |
| R596 |
T1336 |
T1337 |
det |
the,pathways |
| R597 |
T1337 |
T1335 |
pobj |
pathways,of |
| R598 |
T1338 |
T1337 |
compound |
signaling,pathways |
| R599 |
T1339 |
T1340 |
dep |
that,contribute |
| R600 |
T1340 |
T1337 |
relcl |
contribute,pathways |
| R601 |
T1341 |
T1340 |
prep |
to,contribute |
| R602 |
T1342 |
T1343 |
det |
the,stages |
| R603 |
T1343 |
T1341 |
pobj |
stages,to |
| R604 |
T1344 |
T1343 |
amod |
early,stages |
| R605 |
T1345 |
T1343 |
prep |
of,stages |
| R606 |
T1346 |
T1347 |
compound |
joint,formation |
| R607 |
T1347 |
T1345 |
pobj |
formation,of |
| R608 |
T1348 |
T1325 |
punct |
.,begun |
| R609 |
T1350 |
T1351 |
nsubjpass |
Wnt14,expressed |
| R610 |
T1352 |
T1351 |
auxpass |
is,expressed |
| R611 |
T1353 |
T1351 |
prep |
in,expressed |
| R612 |
T1354 |
T1353 |
pobj |
stripes,in |
| R613 |
T1355 |
T1351 |
prep |
at,expressed |
| R614 |
T1356 |
T1357 |
det |
the,sites |
| R615 |
T1357 |
T1355 |
pobj |
sites,at |
| R616 |
T1358 |
T1359 |
advmod |
where,form |
| R617 |
T1359 |
T1357 |
relcl |
form,sites |
| R618 |
T1360 |
T1359 |
nsubj |
joints,form |
| R619 |
T1361 |
T1359 |
aux |
will,form |
| R620 |
T1362 |
T1351 |
punct |
", ",expressed |
| R621 |
T1363 |
T1351 |
cc |
and,expressed |
| R622 |
T1364 |
T1365 |
nsubj |
it,is |
| R623 |
T1365 |
T1351 |
conj |
is,expressed |
| R624 |
T1366 |
T1365 |
acomp |
capable,is |
| R625 |
T1367 |
T1366 |
prep |
of,capable |
| R626 |
T1368 |
T1367 |
pcomp |
inducing,of |
| R627 |
T1369 |
T1368 |
dobj |
expression,inducing |
| R628 |
T1370 |
T1369 |
prep |
of,expression |
| R629 |
T1371 |
T1372 |
amod |
other,markers |
| R630 |
T1372 |
T1370 |
pobj |
markers,of |
| R631 |
T1373 |
T1372 |
compound |
joint,markers |
| R632 |
T1374 |
T1375 |
advmod |
when,misexpressed |
| R633 |
T1375 |
T1365 |
advcl |
misexpressed,is |
| R634 |
T1376 |
T1375 |
prep |
at,misexpressed |
| R635 |
T1377 |
T1378 |
amod |
new,locations |
| R636 |
T1378 |
T1376 |
pobj |
locations,at |
| R637 |
T1379 |
T1378 |
prep |
in,locations |
| R638 |
T1380 |
T1381 |
det |
the,limb |
| R639 |
T1381 |
T1379 |
pobj |
limb,in |
| R640 |
T1382 |
T1383 |
punct |
(,Hartmann |
| R641 |
T1383 |
T1365 |
meta |
Hartmann,is |
| R642 |
T1384 |
T1383 |
cc |
and,Hartmann |
| R643 |
T1385 |
T1383 |
conj |
Tabin,Hartmann |
| R644 |
T1386 |
T1385 |
nummod |
2001,Tabin |
| R645 |
T1387 |
T1385 |
punct |
),Tabin |
| R646 |
T1388 |
T1365 |
punct |
.,is |
| R647 |
T1390 |
T1391 |
amod |
Several,members |
| R648 |
T1391 |
T1392 |
nsubjpass |
members,expressed |
| R649 |
T1393 |
T1391 |
prep |
of,members |
| R650 |
T1394 |
T1395 |
det |
the,family |
| R651 |
T1395 |
T1393 |
pobj |
family,of |
| R652 |
T1396 |
T1397 |
nmod |
bone,protein |
| R653 |
T1397 |
T1395 |
nmod |
protein,family |
| R654 |
T1398 |
T1397 |
amod |
morphogenetic,protein |
| R655 |
T1399 |
T1400 |
punct |
(,BMP |
| R656 |
T1400 |
T1397 |
appos |
BMP,protein |
| R657 |
T1401 |
T1400 |
punct |
),BMP |
| R658 |
T1402 |
T1395 |
prep |
of,family |
| R659 |
T1403 |
T1404 |
amod |
secreted,molecules |
| R660 |
T1404 |
T1402 |
pobj |
molecules,of |
| R661 |
T1405 |
T1404 |
compound |
signaling,molecules |
| R662 |
T1406 |
T1392 |
auxpass |
are,expressed |
| R663 |
T1407 |
T1392 |
advmod |
also,expressed |
| R664 |
T1408 |
T1392 |
prep |
in,expressed |
| R665 |
T1409 |
T1408 |
pobj |
stripes,in |
| R666 |
T1410 |
T1392 |
prep |
at,expressed |
| R667 |
T1411 |
T1410 |
pobj |
sites,at |
| R668 |
T1412 |
T1413 |
advmod |
where,form |
| R669 |
T1413 |
T1411 |
relcl |
form,sites |
| R670 |
T1414 |
T1413 |
nsubj |
joints,form |
| R671 |
T1415 |
T1413 |
aux |
will,form |
| R672 |
T1416 |
T1411 |
punct |
", ",sites |
| R673 |
T1417 |
T1411 |
prep |
including,sites |
| R674 |
T1418 |
T1417 |
pobj |
those,including |
| R675 |
T1419 |
T1418 |
acl |
encoded,those |
| R676 |
T1420 |
T1419 |
agent |
by,encoded |
| R677 |
T1421 |
T1422 |
det |
the,genes |
| R678 |
T1422 |
T1420 |
pobj |
genes,by |
| R679 |
T1423 |
T1422 |
appos |
Gdf5,genes |
| R680 |
T1424 |
T1423 |
punct |
", ",Gdf5 |
| R681 |
T1425 |
T1423 |
conj |
Gdf6,Gdf5 |
| R682 |
T1426 |
T1425 |
punct |
", ",Gdf6 |
| R683 |
T1427 |
T1425 |
conj |
Gdf7,Gdf6 |
| R684 |
T1428 |
T1427 |
punct |
", ",Gdf7 |
| R685 |
T1429 |
T1427 |
conj |
Bmp2,Gdf7 |
| R686 |
T1430 |
T1429 |
punct |
", ",Bmp2 |
| R687 |
T1431 |
T1429 |
cc |
and,Bmp2 |
| R688 |
T1432 |
T1429 |
conj |
Bmp4,Bmp2 |
| R689 |
T1433 |
T1434 |
punct |
(,Storm |
| R690 |
T1434 |
T1392 |
meta |
Storm,expressed |
| R691 |
T1435 |
T1434 |
cc |
and,Storm |
| R692 |
T1436 |
T1434 |
conj |
Kingsley,Storm |
| R693 |
T1437 |
T1436 |
nummod |
1996,Kingsley |
| R694 |
T1438 |
T1436 |
punct |
;,Kingsley |
| R695 |
T1439 |
T1436 |
conj |
Wolfman,Kingsley |
| R696 |
T1440 |
T1439 |
nmod |
et,Wolfman |
| R697 |
T1441 |
T1439 |
nmod |
al.,Wolfman |
| R698 |
T1442 |
T1439 |
nummod |
1997,Wolfman |
| R699 |
T1443 |
T1439 |
punct |
;,Wolfman |
| R700 |
T1444 |
T1439 |
conj |
Francis,Wolfman |
| R701 |
T1445 |
T1444 |
punct |
-,Francis |
| R702 |
T1446 |
T1444 |
nmod |
West,Francis |
| R703 |
T1447 |
T1444 |
nmod |
et,Francis |
| R704 |
T1448 |
T1444 |
nmod |
al.,Francis |
| R705 |
T1449 |
T1444 |
nummod |
1999,Francis |
| R706 |
T1450 |
T1444 |
punct |
;,Francis |
| R707 |
T1451 |
T1444 |
conj |
Settle,Francis |
| R708 |
T1452 |
T1451 |
nmod |
et,Settle |
| R709 |
T1453 |
T1451 |
nmod |
al.,Settle |
| R710 |
T1454 |
T1451 |
nummod |
2003,Settle |
| R711 |
T1455 |
T1451 |
punct |
),Settle |
| R712 |
T1456 |
T1392 |
punct |
.,expressed |
| R713 |
T1458 |
T1459 |
prep |
Of,is |
| R714 |
T1460 |
T1458 |
pobj |
these,Of |
| R715 |
T1461 |
T1459 |
punct |
", ",is |
| R716 |
T1462 |
T1463 |
compound |
Gdf5,expression |
| R717 |
T1463 |
T1459 |
nsubj |
expression,is |
| R718 |
T1464 |
T1465 |
advmod |
most,strikingly |
| R719 |
T1465 |
T1466 |
advmod |
strikingly,limited |
| R720 |
T1466 |
T1459 |
acomp |
limited,is |
| R721 |
T1467 |
T1466 |
prep |
to,limited |
| R722 |
T1468 |
T1467 |
pobj |
regions,to |
| R723 |
T1469 |
T1470 |
advmod |
where,develop |
| R724 |
T1470 |
T1468 |
relcl |
develop,regions |
| R725 |
T1471 |
T1470 |
nsubj |
joints,develop |
| R726 |
T1472 |
T1470 |
aux |
will,develop |
| R727 |
T1473 |
T1459 |
cc |
and,is |
| R728 |
T1474 |
T1459 |
conj |
is,is |
| R729 |
T1475 |
T1474 |
attr |
one,is |
| R730 |
T1476 |
T1475 |
prep |
of,one |
| R731 |
T1477 |
T1478 |
det |
the,markers |
| R732 |
T1478 |
T1476 |
pobj |
markers,of |
| R733 |
T1479 |
T1480 |
amod |
earliest,known |
| R734 |
T1480 |
T1478 |
amod |
known,markers |
| R735 |
T1481 |
T1478 |
prep |
of,markers |
| R736 |
T1482 |
T1483 |
compound |
joint,formation |
| R737 |
T1483 |
T1481 |
pobj |
formation,of |
| R738 |
T1484 |
T1459 |
punct |
.,is |
| R739 |
T1486 |
T1487 |
nsubj |
Mutations,block |
| R740 |
T1488 |
T1486 |
prep |
in,Mutations |
| R741 |
T1489 |
T1490 |
preconj |
either,Gdf5 |
| R742 |
T1490 |
T1488 |
pobj |
Gdf5,in |
| R743 |
T1491 |
T1490 |
cc |
or,Gdf5 |
| R744 |
T1492 |
T1493 |
det |
the,gene |
| R745 |
T1493 |
T1490 |
conj |
gene,Gdf5 |
| R746 |
T1494 |
T1495 |
advmod |
closely,related |
| R747 |
T1495 |
T1493 |
amod |
related,gene |
| R748 |
T1496 |
T1493 |
compound |
Gdf6,gene |
| R749 |
T1497 |
T1487 |
advmod |
also,block |
| R750 |
T1498 |
T1487 |
dobj |
formation,block |
| R751 |
T1499 |
T1498 |
prep |
of,formation |
| R752 |
T1500 |
T1499 |
pobj |
joints,of |
| R753 |
T1501 |
T1498 |
prep |
at,formation |
| R754 |
T1502 |
T1503 |
amod |
specific,locations |
| R755 |
T1503 |
T1501 |
pobj |
locations,at |
| R756 |
T1504 |
T1487 |
punct |
", ",block |
| R757 |
T1505 |
T1487 |
advcl |
providing,block |
| R758 |
T1506 |
T1507 |
amod |
strong,evidence |
| R759 |
T1507 |
T1505 |
dobj |
evidence,providing |
| R760 |
T1508 |
T1509 |
mark |
that,are |
| R761 |
T1509 |
T1507 |
acl |
are,evidence |
| R762 |
T1510 |
T1511 |
det |
these,molecules |
| R763 |
T1511 |
T1509 |
nsubj |
molecules,are |
| R764 |
T1512 |
T1509 |
acomp |
essential,are |
| R765 |
T1513 |
T1512 |
prep |
for,essential |
| R766 |
T1514 |
T1515 |
det |
the,process |
| R767 |
T1515 |
T1513 |
pobj |
process,for |
| R768 |
T1516 |
T1517 |
compound |
joint,formation |
| R769 |
T1517 |
T1515 |
compound |
formation,process |
| R770 |
T1518 |
T1519 |
punct |
(,Storm |
| R771 |
T1519 |
T1487 |
meta |
Storm,block |
| R772 |
T1520 |
T1519 |
nmod |
et,Storm |
| R773 |
T1521 |
T1519 |
nmod |
al.,Storm |
| R774 |
T1522 |
T1519 |
nummod |
1994,Storm |
| R775 |
T1523 |
T1519 |
punct |
;,Storm |
| R776 |
T1524 |
T1519 |
nmod |
Settle,Storm |
| R777 |
T1525 |
T1519 |
nmod |
et,Storm |
| R778 |
T1526 |
T1519 |
nmod |
al.,Storm |
| R779 |
T1527 |
T1519 |
nummod |
2003,Storm |
| R780 |
T1528 |
T1519 |
punct |
),Storm |
| R781 |
T1529 |
T1487 |
punct |
.,block |
| R782 |
T1531 |
T1532 |
advmod |
However,cause |
| R783 |
T1533 |
T1532 |
punct |
", ",cause |
| R784 |
T1534 |
T1532 |
nsubj |
mutations,cause |
| R785 |
T1535 |
T1534 |
prep |
in,mutations |
| R786 |
T1536 |
T1535 |
pobj |
Bmp2,in |
| R787 |
T1537 |
T1536 |
cc |
or,Bmp2 |
| R788 |
T1538 |
T1536 |
conj |
Bmp4,Bmp2 |
| R789 |
T1539 |
T1540 |
amod |
early,lethality |
| R790 |
T1540 |
T1532 |
dobj |
lethality,cause |
| R791 |
T1541 |
T1540 |
amod |
embryonic,lethality |
| R792 |
T1542 |
T1532 |
punct |
", ",cause |
| R793 |
T1543 |
T1532 |
advcl |
making,cause |
| R794 |
T1544 |
T1545 |
nsubj |
it,difficult |
| R795 |
T1545 |
T1543 |
ccomp |
difficult,making |
| R796 |
T1546 |
T1547 |
aux |
to,test |
| R797 |
T1547 |
T1545 |
advcl |
test,difficult |
| R798 |
T1548 |
T1549 |
poss |
their,role |
| R799 |
T1549 |
T1547 |
dobj |
role,test |
| R800 |
T1550 |
T1549 |
prep |
in,role |
| R801 |
T1551 |
T1552 |
compound |
joint,formation |
| R802 |
T1552 |
T1550 |
pobj |
formation,in |
| R803 |
T1553 |
T1554 |
punct |
(,Winnier |
| R804 |
T1554 |
T1532 |
meta |
Winnier,cause |
| R805 |
T1555 |
T1554 |
nmod |
et,Winnier |
| R806 |
T1556 |
T1554 |
nmod |
al.,Winnier |
| R807 |
T1557 |
T1554 |
nummod |
1995,Winnier |
| R808 |
T1558 |
T1554 |
punct |
;,Winnier |
| R809 |
T1559 |
T1554 |
conj |
Zhang,Winnier |
| R810 |
T1560 |
T1559 |
cc |
and,Zhang |
| R811 |
T1561 |
T1559 |
conj |
Bradley,Zhang |
| R812 |
T1562 |
T1561 |
nummod |
1996,Bradley |
| R813 |
T1563 |
T1561 |
punct |
),Bradley |
| R814 |
T1564 |
T1532 |
punct |
.,cause |
| R815 |
T1566 |
T1567 |
advmod |
Much,less |
| R816 |
T1567 |
T1568 |
nsubjpass |
less,known |
| R817 |
T1569 |
T1568 |
auxpass |
is,known |
| R818 |
T1570 |
T1568 |
prep |
about,known |
| R819 |
T1571 |
T1572 |
advmod |
how,function |
| R820 |
T1572 |
T1570 |
pcomp |
function,about |
| R821 |
T1573 |
T1574 |
compound |
signaling,pathways |
| R822 |
T1574 |
T1572 |
nsubj |
pathways,function |
| R823 |
T1575 |
T1572 |
prep |
during,function |
| R824 |
T1576 |
T1577 |
det |
the,maturation |
| R825 |
T1577 |
T1575 |
pobj |
maturation,during |
| R826 |
T1578 |
T1577 |
amod |
subsequent,maturation |
| R827 |
T1579 |
T1577 |
cc |
and,maturation |
| R828 |
T1580 |
T1577 |
conj |
maintenance,maturation |
| R829 |
T1581 |
T1577 |
prep |
of,maturation |
| R830 |
T1582 |
T1583 |
compound |
adult,structures |
| R831 |
T1583 |
T1581 |
pobj |
structures,of |
| R832 |
T1584 |
T1583 |
compound |
joint,structures |
| R833 |
T1585 |
T1568 |
punct |
.,known |
| R834 |
T1587 |
T1588 |
advmod |
Importantly,are |
| R835 |
T1589 |
T1588 |
punct |
", ",are |
| R836 |
T1590 |
T1591 |
compound |
BMP,signaling |
| R837 |
T1591 |
T1592 |
compound |
signaling,components |
| R838 |
T1592 |
T1588 |
nsubj |
components,are |
| R839 |
T1593 |
T1588 |
acomp |
present,are |
| R840 |
T1594 |
T1588 |
prep |
in,are |
| R841 |
T1595 |
T1596 |
nmod |
adult,cartilage |
| R842 |
T1596 |
T1594 |
pobj |
cartilage,in |
| R843 |
T1597 |
T1596 |
amod |
articular,cartilage |
| R844 |
T1598 |
T1588 |
punct |
", ",are |
| R845 |
T1599 |
T1588 |
advcl |
suggesting,are |
| R846 |
T1600 |
T1601 |
mark |
that,function |
| R847 |
T1601 |
T1599 |
ccomp |
function,suggesting |
| R848 |
T1602 |
T1601 |
nsubj |
they,function |
| R849 |
T1603 |
T1601 |
aux |
may,function |
| R850 |
T1604 |
T1601 |
prep |
during,function |
| R851 |
T1605 |
T1606 |
det |
the,development |
| R852 |
T1606 |
T1604 |
pobj |
development,during |
| R853 |
T1607 |
T1606 |
amod |
late,development |
| R854 |
T1608 |
T1606 |
cc |
or,development |
| R855 |
T1609 |
T1606 |
conj |
maintenance,development |
| R856 |
T1610 |
T1606 |
prep |
of,development |
| R857 |
T1611 |
T1612 |
det |
this,structure |
| R858 |
T1612 |
T1610 |
pobj |
structure,of |
| R859 |
T1613 |
T1612 |
amod |
critical,structure |
| R860 |
T1614 |
T1615 |
punct |
(,Erlacher |
| R861 |
T1615 |
T1588 |
meta |
Erlacher,are |
| R862 |
T1616 |
T1615 |
nmod |
et,Erlacher |
| R863 |
T1617 |
T1615 |
nmod |
al.,Erlacher |
| R864 |
T1618 |
T1615 |
nummod |
1998,Erlacher |
| R865 |
T1619 |
T1615 |
punct |
;,Erlacher |
| R866 |
T1620 |
T1615 |
nmod |
Chubinskaya,Erlacher |
| R867 |
T1621 |
T1615 |
nmod |
et,Erlacher |
| R868 |
T1622 |
T1615 |
nmod |
al.,Erlacher |
| R869 |
T1623 |
T1615 |
nummod |
2000,Erlacher |
| R870 |
T1624 |
T1615 |
punct |
;,Erlacher |
| R871 |
T1625 |
T1615 |
nmod |
Muehleman,Erlacher |
| R872 |
T1626 |
T1615 |
nmod |
et,Erlacher |
| R873 |
T1627 |
T1615 |
nmod |
al.,Erlacher |
| R874 |
T1628 |
T1615 |
nummod |
2002,Erlacher |
| R875 |
T1629 |
T1615 |
punct |
;,Erlacher |
| R876 |
T1630 |
T1615 |
nmod |
Bau,Erlacher |
| R877 |
T1631 |
T1615 |
nmod |
et,Erlacher |
| R878 |
T1632 |
T1615 |
nmod |
al.,Erlacher |
| R879 |
T1633 |
T1615 |
nummod |
2002,Erlacher |
| R880 |
T1634 |
T1615 |
punct |
;,Erlacher |
| R881 |
T1635 |
T1615 |
nmod |
Bobacz,Erlacher |
| R882 |
T1636 |
T1615 |
nmod |
et,Erlacher |
| R883 |
T1637 |
T1615 |
nmod |
al.,Erlacher |
| R884 |
T1638 |
T1615 |
nummod |
2003,Erlacher |
| R885 |
T1639 |
T1615 |
punct |
),Erlacher |
| R886 |
T1640 |
T1588 |
punct |
.,are |
| R887 |
T1642 |
T1643 |
nsubj |
BMPs,bind |
| R888 |
T1644 |
T1645 |
amod |
tetrameric,complexes |
| R889 |
T1645 |
T1643 |
dobj |
complexes,bind |
| R890 |
T1646 |
T1645 |
prep |
of,complexes |
| R891 |
T1647 |
T1648 |
nummod |
two,type |
| R892 |
T1648 |
T1646 |
pobj |
type,of |
| R893 |
T1649 |
T1648 |
nummod |
I,type |
| R894 |
T1650 |
T1648 |
cc |
and,type |
| R895 |
T1651 |
T1652 |
nummod |
two,type |
| R896 |
T1652 |
T1653 |
nmod |
type,receptors |
| R897 |
T1653 |
T1648 |
conj |
receptors,type |
| R898 |
T1654 |
T1652 |
nummod |
II,type |
| R899 |
T1655 |
T1653 |
amod |
transmembrane,receptors |
| R900 |
T1656 |
T1657 |
compound |
serine,threonine |
| R901 |
T1657 |
T1653 |
compound |
threonine,receptors |
| R902 |
T1658 |
T1657 |
punct |
-,threonine |
| R903 |
T1659 |
T1653 |
compound |
kinase,receptors |
| R904 |
T1660 |
T1643 |
punct |
.,bind |
| R905 |
T1662 |
T1663 |
prep |
Upon,transduce |
| R906 |
T1664 |
T1665 |
compound |
BMP,binding |
| R907 |
T1665 |
T1662 |
pobj |
binding,Upon |
| R908 |
T1666 |
T1663 |
punct |
", ",transduce |
| R909 |
T1667 |
T1668 |
det |
these,complexes |
| R910 |
T1668 |
T1663 |
nsubj |
complexes,transduce |
| R911 |
T1669 |
T1670 |
det |
a,signal |
| R912 |
T1670 |
T1663 |
dobj |
signal,transduce |
| R913 |
T1671 |
T1663 |
prep |
by,transduce |
| R914 |
T1672 |
T1671 |
pcomp |
phosphorylating,by |
| R915 |
T1673 |
T1672 |
dobj |
members,phosphorylating |
| R916 |
T1674 |
T1673 |
prep |
of,members |
| R917 |
T1675 |
T1676 |
det |
the,family |
| R918 |
T1676 |
T1674 |
pobj |
family,of |
| R919 |
T1677 |
T1676 |
compound |
Smad,family |
| R920 |
T1678 |
T1676 |
prep |
of,family |
| R921 |
T1679 |
T1680 |
compound |
transcription,factors |
| R922 |
T1680 |
T1678 |
pobj |
factors,of |
| R923 |
T1681 |
T1682 |
punct |
(,Massague |
| R924 |
T1682 |
T1663 |
meta |
Massague,transduce |
| R925 |
T1683 |
T1682 |
nummod |
1996,Massague |
| R926 |
T1684 |
T1682 |
punct |
),Massague |
| R927 |
T1685 |
T1663 |
punct |
.,transduce |
| R928 |
T1687 |
T1688 |
amod |
Recent,experiments |
| R929 |
T1688 |
T1689 |
nsubj |
experiments,implicated |
| R930 |
T1690 |
T1689 |
aux |
have,implicated |
| R931 |
T1691 |
T1692 |
nummod |
two,receptors |
| R932 |
T1692 |
T1689 |
dative |
receptors,implicated |
| R933 |
T1693 |
T1692 |
amod |
different,receptors |
| R934 |
T1694 |
T1692 |
nmod |
BMP,receptors |
| R935 |
T1695 |
T1692 |
nmod |
type,receptors |
| R936 |
T1696 |
T1695 |
nummod |
I,type |
| R937 |
T1697 |
T1689 |
prep |
in,implicated |
| R938 |
T1698 |
T1699 |
amod |
skeletal,patterning |
| R939 |
T1699 |
T1697 |
pobj |
patterning,in |
| R940 |
T1700 |
T1689 |
punct |
", ",implicated |
| R941 |
T1701 |
T1689 |
dobj |
BMPR1A,implicated |
| R942 |
T1702 |
T1701 |
cc |
and,BMPR1A |
| R943 |
T1703 |
T1701 |
conj |
BMPR1B,BMPR1A |
| R944 |
T1704 |
T1689 |
punct |
.,implicated |
| R945 |
T1706 |
T1707 |
det |
Both,receptors |
| R946 |
T1707 |
T1708 |
nsubj |
receptors,bind |
| R947 |
T1709 |
T1708 |
aux |
can,bind |
| R948 |
T1710 |
T1708 |
dobj |
BMP2,bind |
| R949 |
T1711 |
T1710 |
punct |
", ",BMP2 |
| R950 |
T1712 |
T1710 |
conj |
BMP4,BMP2 |
| R951 |
T1713 |
T1712 |
punct |
", ",BMP4 |
| R952 |
T1714 |
T1712 |
cc |
and,BMP4 |
| R953 |
T1715 |
T1712 |
conj |
GDF5,BMP4 |
| R954 |
T1716 |
T1708 |
punct |
", ",bind |
| R955 |
T1717 |
T1718 |
mark |
although,shows |
| R956 |
T1718 |
T1708 |
advcl |
shows,bind |
| R957 |
T1719 |
T1718 |
nsubj |
GDF5,shows |
| R958 |
T1720 |
T1721 |
amod |
higher,affinity |
| R959 |
T1721 |
T1718 |
dobj |
affinity,shows |
| R960 |
T1722 |
T1721 |
prep |
for,affinity |
| R961 |
T1723 |
T1722 |
pobj |
BMPR1B,for |
| R962 |
T1724 |
T1725 |
punct |
(,Koenig |
| R963 |
T1725 |
T1708 |
meta |
Koenig,bind |
| R964 |
T1726 |
T1725 |
nmod |
et,Koenig |
| R965 |
T1727 |
T1725 |
nmod |
al.,Koenig |
| R966 |
T1728 |
T1725 |
nummod |
1994,Koenig |
| R967 |
T1729 |
T1725 |
punct |
;,Koenig |
| R968 |
T1730 |
T1725 |
nmod |
ten,Koenig |
| R969 |
T1731 |
T1725 |
nmod |
Dijke,Koenig |
| R970 |
T1732 |
T1725 |
nmod |
et,Koenig |
| R971 |
T1733 |
T1725 |
nmod |
al.,Koenig |
| R972 |
T1734 |
T1725 |
nummod |
1994,Koenig |
| R973 |
T1735 |
T1725 |
punct |
;,Koenig |
| R974 |
T1736 |
T1725 |
nmod |
Yamaji,Koenig |
| R975 |
T1737 |
T1725 |
nmod |
et,Koenig |
| R976 |
T1738 |
T1725 |
nmod |
al.,Koenig |
| R977 |
T1739 |
T1725 |
nummod |
1994,Koenig |
| R978 |
T1740 |
T1725 |
punct |
;,Koenig |
| R979 |
T1741 |
T1725 |
nmod |
Nishitoh,Koenig |
| R980 |
T1742 |
T1725 |
nmod |
et,Koenig |
| R981 |
T1743 |
T1725 |
nmod |
al.,Koenig |
| R982 |
T1744 |
T1725 |
nummod |
1996,Koenig |
| R983 |
T1745 |
T1725 |
punct |
;,Koenig |
| R984 |
T1746 |
T1725 |
nmod |
Chalaux,Koenig |
| R985 |
T1747 |
T1725 |
nmod |
et,Koenig |
| R986 |
T1748 |
T1725 |
nmod |
al.,Koenig |
| R987 |
T1749 |
T1725 |
nummod |
1998,Koenig |
| R988 |
T1750 |
T1725 |
punct |
),Koenig |
| R989 |
T1751 |
T1708 |
punct |
.,bind |
| R990 |
T1753 |
T1754 |
det |
Both,receptors |
| R991 |
T1754 |
T1755 |
nsubjpass |
receptors,expressed |
| R992 |
T1756 |
T1755 |
auxpass |
are,expressed |
| R993 |
T1757 |
T1755 |
advmod |
also,expressed |
| R994 |
T1758 |
T1755 |
prep |
in,expressed |
| R995 |
T1759 |
T1760 |
amod |
dynamic,patterns |
| R996 |
T1760 |
T1758 |
pobj |
patterns,in |
| R997 |
T1802 |
T1801 |
amod |
precartilaginous,cells |
| R998 |
T1761 |
T1755 |
prep |
during,expressed |
| R999 |
T1803 |
T1801 |
amod |
mesenchymal,cells |
| R1000 |
T1762 |
T1763 |
amod |
normal,development |
| R1001 |
T1804 |
T1801 |
punct |
", ",cells |
| R1002 |
T1805 |
T1801 |
appos |
regions,cells |
| R1003 |
T1763 |
T1761 |
pobj |
development,during |
| R1004 |
T1806 |
T1805 |
acl |
flanking,regions |
| R1005 |
T1807 |
T1808 |
compound |
joint,interzones |
| R1006 |
T1764 |
T1755 |
punct |
.,expressed |
| R1007 |
T1808 |
T1806 |
dobj |
interzones,flanking |
| R1008 |
T1809 |
T1808 |
punct |
", ",interzones |
| R1009 |
T1810 |
T1808 |
conj |
perichondrium,interzones |
| R1010 |
T1766 |
T1767 |
prep |
In,becomes |
| R1011 |
T1811 |
T1810 |
punct |
", ",perichondrium |
| R1012 |
T1812 |
T1810 |
cc |
and,perichondrium |
| R1013 |
T1813 |
T1814 |
amod |
periarticular,cartilage |
| R1014 |
T1814 |
T1810 |
conj |
cartilage,perichondrium |
| R1015 |
T1768 |
T1766 |
pobj |
limbs,In |
| R1016 |
T1815 |
T1816 |
punct |
(,Dewulf |
| R1017 |
T1816 |
T1792 |
meta |
Dewulf,seen |
| R1018 |
T1817 |
T1816 |
nmod |
et,Dewulf |
| R1019 |
T1818 |
T1816 |
nmod |
al.,Dewulf |
| R1020 |
T1769 |
T1767 |
punct |
", ",becomes |
| R1021 |
T1819 |
T1816 |
nummod |
1995,Dewulf |
| R1022 |
T1820 |
T1816 |
punct |
;,Dewulf |
| R1023 |
T1770 |
T1771 |
compound |
Bmpr1a,expression |
| R1024 |
T1821 |
T1816 |
nmod |
Mishina,Dewulf |
| R1025 |
T1822 |
T1816 |
nmod |
et,Dewulf |
| R1026 |
T1823 |
T1816 |
nmod |
al.,Dewulf |
| R1027 |
T1771 |
T1767 |
nsubj |
expression,becomes |
| R1028 |
T1824 |
T1816 |
nummod |
1995,Dewulf |
| R1029 |
T1825 |
T1816 |
punct |
;,Dewulf |
| R1030 |
T1826 |
T1816 |
nmod |
Zou,Dewulf |
| R1031 |
T1772 |
T1767 |
oprd |
restricted,becomes |
| R1032 |
T1827 |
T1816 |
nmod |
et,Dewulf |
| R1033 |
T1828 |
T1816 |
nmod |
al.,Dewulf |
| R1034 |
T1829 |
T1816 |
nummod |
1997,Dewulf |
| R1035 |
T1830 |
T1816 |
punct |
;,Dewulf |
| R1036 |
T1831 |
T1816 |
nmod |
Baur,Dewulf |
| R1037 |
T1773 |
T1772 |
prep |
to,restricted |
| R1038 |
T1832 |
T1816 |
nmod |
et,Dewulf |
| R1039 |
T1833 |
T1816 |
nmod |
al.,Dewulf |
| R1040 |
T1834 |
T1816 |
nummod |
2000,Dewulf |
| R1041 |
T1774 |
T1775 |
compound |
joint,interzones |
| R1042 |
T1835 |
T1816 |
punct |
),Dewulf |
| R1043 |
T1836 |
T1792 |
punct |
.,seen |
| R1044 |
T1775 |
T1773 |
pobj |
interzones,to |
| R1045 |
T1838 |
T1839 |
amod |
Null,mutations |
| R1046 |
T1839 |
T1840 |
nsubj |
mutations,produce |
| R1047 |
T1776 |
T1775 |
punct |
", ",interzones |
| R1048 |
T1841 |
T1839 |
prep |
in,mutations |
| R1049 |
T1842 |
T1843 |
det |
the,gene |
| R1050 |
T1777 |
T1775 |
conj |
perichondrium,interzones |
| R1051 |
T1843 |
T1841 |
pobj |
gene,in |
| R1052 |
T1844 |
T1843 |
compound |
Bmpr1b,gene |
| R1053 |
T1845 |
T1846 |
amod |
viable,mice |
| R1054 |
T1778 |
T1777 |
punct |
", ",perichondrium |
| R1055 |
T1846 |
T1840 |
dobj |
mice,produce |
| R1056 |
T1847 |
T1846 |
prep |
with,mice |
| R1057 |
T1779 |
T1780 |
amod |
periarticular,cartilage |
| R1058 |
T1848 |
T1847 |
pobj |
defects,with |
| R1059 |
T1849 |
T1848 |
prep |
in,defects |
| R1060 |
T1850 |
T1851 |
nmod |
bone,formation |
| R1061 |
T1780 |
T1777 |
conj |
cartilage,perichondrium |
| R1062 |
T1851 |
T1849 |
pobj |
formation,in |
| R1063 |
T1852 |
T1850 |
cc |
and,bone |
| R1064 |
T1853 |
T1850 |
conj |
joint,bone |
| R1065 |
T1781 |
T1780 |
punct |
", ",cartilage |
| R1066 |
T1854 |
T1855 |
dep |
that,resemble |
| R1067 |
T1855 |
T1848 |
relcl |
resemble,defects |
| R1068 |
T1856 |
T1855 |
advmod |
closely,resemble |
| R1069 |
T1782 |
T1783 |
amod |
hypertrophic,chondrocytes |
| R1070 |
T1857 |
T1855 |
dobj |
those,resemble |
| R1071 |
T1858 |
T1857 |
acl |
seen,those |
| R1072 |
T1783 |
T1780 |
conj |
chondrocytes,cartilage |
| R1073 |
T1859 |
T1858 |
prep |
in,seen |
| R1074 |
T1860 |
T1859 |
pobj |
mice,in |
| R1075 |
T1861 |
T1860 |
acl |
missing,mice |
| R1076 |
T1784 |
T1783 |
punct |
", ",chondrocytes |
| R1077 |
T1862 |
T1861 |
dobj |
Gdf5,missing |
| R1078 |
T1863 |
T1864 |
punct |
(,Storm |
| R1079 |
T1785 |
T1783 |
cc |
and,chondrocytes |
| R1083 |
T1786 |
T1787 |
amod |
interdigital,mesenchyme |
| R1084 |
T1867 |
T1866 |
nummod |
1996,Kingsley |
| R1085 |
T1868 |
T1866 |
punct |
;,Kingsley |
| R1086 |
T1869 |
T1866 |
conj |
Baur,Kingsley |
| R1087 |
T1870 |
T1869 |
nmod |
et,Baur |
| R1088 |
T1871 |
T1869 |
nmod |
al.,Baur |
| R1089 |
T1787 |
T1783 |
conj |
mesenchyme,chondrocytes |
| R1090 |
T1872 |
T1869 |
nummod |
2000,Baur |
| R1091 |
T1873 |
T1869 |
punct |
;,Baur |
| R1092 |
T1874 |
T1869 |
conj |
Yi,Baur |
| R1093 |
T1788 |
T1787 |
compound |
limb,mesenchyme |
| R1094 |
T1875 |
T1874 |
nmod |
et,Yi |
| R1095 |
T1789 |
T1767 |
punct |
.,becomes |
| R1096 |
T1876 |
T1874 |
nmod |
al.,Yi |
| R1097 |
T1877 |
T1874 |
nummod |
2000,Yi |
| R1098 |
T1791 |
T1792 |
prep |
In,seen |
| R1099 |
T1878 |
T1874 |
punct |
),Yi |
| R1100 |
T1879 |
T1840 |
punct |
.,produce |
| R1101 |
T1793 |
T1791 |
pobj |
comparison,In |
| R1102 |
T1881 |
T1882 |
amod |
Null,mutations |
| R1103 |
T1882 |
T1883 |
nsubj |
mutations,cause |
| R1104 |
T1884 |
T1882 |
prep |
in,mutations |
| R1105 |
T1794 |
T1792 |
punct |
", ",seen |
| R1106 |
T1885 |
T1884 |
pobj |
Bmpr1a,in |
| R1107 |
T1886 |
T1887 |
amod |
early,lethality |
| R1108 |
T1795 |
T1796 |
compound |
Bmpr1b,expression |
| R1109 |
T1887 |
T1883 |
dobj |
lethality,cause |
| R1110 |
T1888 |
T1887 |
amod |
embryonic,lethality |
| R1111 |
T1889 |
T1883 |
punct |
", ",cause |
| R1112 |
T1796 |
T1792 |
nsubjpass |
expression,seen |
| R1113 |
T1890 |
T1891 |
mark |
with,similar |
| R1114 |
T1891 |
T1883 |
advcl |
similar,cause |
| R1115 |
T1892 |
T1891 |
nsubj |
defects,similar |
| R1116 |
T1797 |
T1792 |
auxpass |
is,seen |
| R1117 |
T1893 |
T1892 |
prep |
in,defects |
| R1118 |
T1894 |
T1893 |
pobj |
gastrulation,in |
| R1119 |
T1895 |
T1891 |
prep |
to,similar |
| R1120 |
T1798 |
T1792 |
advmod |
primarily,seen |
| R1121 |
T1896 |
T1895 |
pobj |
those,to |
| R1122 |
T1897 |
T1896 |
acl |
seen,those |
| R1123 |
T1799 |
T1792 |
prep |
in,seen |
| R1124 |
T1898 |
T1897 |
prep |
in,seen |
| R1125 |
T1899 |
T1898 |
pobj |
mice,in |
| R1126 |
T1900 |
T1899 |
prep |
with,mice |
| R1127 |
T1800 |
T1801 |
amod |
condensing,cells |
| R1128 |
T1901 |
T1900 |
pobj |
mutations,with |
| R1129 |
T1902 |
T1901 |
prep |
in,mutations |
| R1130 |
T1903 |
T1902 |
pobj |
Bmp4,in |
| R1131 |
T1801 |
T1799 |
pobj |
cells,in |
| R1132 |
T1904 |
T1905 |
punct |
(,Mishina |
| R1133 |
T1905 |
T1883 |
meta |
Mishina,cause |
| R1134 |
T1906 |
T1905 |
nmod |
et,Mishina |
| R1135 |
T1908 |
T1905 |
nummod |
1995,Mishina |
| R1136 |
T1907 |
T1905 |
nmod |
al.,Mishina |
| R1137 |
T1909 |
T1905 |
punct |
;,Mishina |
| R1138 |
T1910 |
T1905 |
nmod |
Winnier,Mishina |
| R1139 |
T1911 |
T1905 |
nmod |
et,Mishina |
| R1140 |
T2014 |
T2015 |
aux |
to,remove |
| R1141 |
T2015 |
T2011 |
advcl |
remove,used |
| R1142 |
T1912 |
T1905 |
nmod |
al.,Mishina |
| R1143 |
T2016 |
T2015 |
cc |
or,remove |
| R1144 |
T2017 |
T2018 |
advmod |
ectopically,express |
| R1145 |
T2018 |
T2015 |
conj |
express,remove |
| R1146 |
T1913 |
T1905 |
nummod |
1995,Mishina |
| R1147 |
T2019 |
T2018 |
dobj |
genes,express |
| R1148 |
T2020 |
T2019 |
prep |
in,genes |
| R1149 |
T1914 |
T1905 |
punct |
),Mishina |
| R1150 |
T2021 |
T2020 |
pobj |
joints,in |
| R1151 |
T2022 |
T1980 |
punct |
.,take |
| R1152 |
T1915 |
T1883 |
punct |
.,cause |
| R1153 |
T2024 |
T2025 |
nsubj |
Tests,show |
| R1154 |
T1917 |
T1918 |
amod |
Recent,studies |
| R1155 |
T2026 |
T2024 |
prep |
with,Tests |
| R1156 |
T2027 |
T2028 |
compound |
reporter,mice |
| R1157 |
T2028 |
T2026 |
pobj |
mice,with |
| R1158 |
T1918 |
T1919 |
nsubj |
studies,suggest |
| R1159 |
T2029 |
T2030 |
mark |
that,is |
| R1160 |
T2030 |
T2025 |
ccomp |
is,show |
| R1161 |
T2031 |
T2032 |
det |
this,system |
| R1162 |
T1920 |
T1918 |
prep |
with,studies |
| R1163 |
T2032 |
T2030 |
nsubj |
system,is |
| R1164 |
T2033 |
T2030 |
acomp |
capable,is |
| R1165 |
T2034 |
T2033 |
prep |
of,capable |
| R1166 |
T2035 |
T2034 |
pcomp |
modifying,of |
| R1167 |
T2036 |
T2035 |
dobj |
genes,modifying |
| R1168 |
T1921 |
T1922 |
amod |
floxed,alleles |
| R1169 |
T2037 |
T2035 |
prep |
in,modifying |
| R1170 |
T2038 |
T2037 |
pobj |
all,in |
| R1171 |
T1922 |
T1920 |
pobj |
alleles,with |
| R1172 |
T2039 |
T2038 |
prep |
of,all |
| R1173 |
T2040 |
T2041 |
det |
the,structures |
| R1174 |
T2041 |
T2039 |
pobj |
structures,of |
| R1175 |
T1923 |
T1924 |
mark |
that,required |
| R1176 |
T2042 |
T2041 |
prep |
of,structures |
| R1177 |
T2043 |
T2044 |
det |
the,joint |
| R1178 |
T2044 |
T2042 |
pobj |
joint,of |
| R1179 |
T1924 |
T1919 |
ccomp |
required,suggest |
| R1180 |
T2045 |
T2044 |
amod |
mature,joint |
| R1181 |
T2046 |
T2044 |
amod |
synovial,joint |
| R1182 |
T1925 |
T1924 |
nsubjpass |
Bmpr1a,required |
| R1183 |
T2047 |
T2038 |
punct |
", ",all |
| R1184 |
T1926 |
T1924 |
auxpass |
is,required |
| R1185 |
T2048 |
T2038 |
prep |
including,all |
| R1186 |
T1927 |
T1924 |
advmod |
also,required |
| R1187 |
T2049 |
T2050 |
det |
the,ligaments |
| R1188 |
T2050 |
T2048 |
pobj |
ligaments,including |
| R1189 |
T2051 |
T2050 |
prep |
of,ligaments |
| R1190 |
T2052 |
T2053 |
det |
the,capsule |
| R1191 |
T1928 |
T1924 |
prep |
for,required |
| R1192 |
T1929 |
T1930 |
amod |
many,events |
| R1193 |
T2053 |
T2051 |
pobj |
capsule,of |
| R1194 |
T2054 |
T2053 |
compound |
joint,capsule |
| R1195 |
T1930 |
T1928 |
pobj |
events,for |
| R1196 |
T2055 |
T2050 |
punct |
", ",ligaments |
| R1197 |
T2056 |
T2057 |
det |
the,membrane |
| R1198 |
T1931 |
T1930 |
amod |
later,events |
| R1199 |
T2057 |
T2050 |
conj |
membrane,ligaments |
| R1200 |
T2058 |
T2057 |
amod |
synovial,membrane |
| R1201 |
T1932 |
T1930 |
amod |
developmental,events |
| R1202 |
T2059 |
T2057 |
punct |
", ",membrane |
| R1203 |
T2060 |
T2057 |
cc |
and,membrane |
| R1204 |
T2061 |
T2062 |
det |
the,cartilage |
| R1205 |
T1933 |
T1919 |
punct |
", ",suggest |
| R1206 |
T2062 |
T2057 |
conj |
cartilage,membrane |
| R1207 |
T2063 |
T2062 |
amod |
articular,cartilage |
| R1208 |
T1934 |
T1919 |
cc |
but,suggest |
| R1209 |
T2064 |
T2025 |
punct |
.,show |
| R1210 |
T2066 |
T2067 |
compound |
Gdf5,Cre |
| R1211 |
T1935 |
T1936 |
poss |
its,roles |
| R1212 |
T2067 |
T2069 |
compound |
Cre,recombination |
| R1213 |
T2068 |
T2067 |
punct |
-,Cre |
| R1214 |
T2069 |
T2070 |
nsubj |
recombination,bypasses |
| R1215 |
T1936 |
T1937 |
nsubjpass |
roles,tested |
| R1216 |
T2071 |
T2072 |
det |
the,lethality |
| R1217 |
T1937 |
T1919 |
conj |
tested,suggest |
| R1218 |
T2072 |
T2070 |
dobj |
lethality,bypasses |
| R1219 |
T2073 |
T2074 |
amod |
early,embryonic |
| R1220 |
T2074 |
T2072 |
amod |
embryonic,lethality |
| R1221 |
T1938 |
T1936 |
prep |
in,roles |
| R1222 |
T2075 |
T2072 |
prep |
of,lethality |
| R1223 |
T2076 |
T2077 |
amod |
null,mutations |
| R1224 |
T1939 |
T1940 |
nmod |
bone,formation |
| R1225 |
T2077 |
T2075 |
pobj |
mutations,of |
| R1226 |
T2078 |
T2070 |
prep |
in,bypasses |
| R1227 |
T2079 |
T2078 |
pobj |
Bmpr1a,in |
| R1228 |
T1940 |
T1938 |
pobj |
formation,in |
| R1229 |
T2080 |
T2070 |
punct |
", ",bypasses |
| R1230 |
T2081 |
T2070 |
cc |
and,bypasses |
| R1231 |
T2082 |
T2070 |
conj |
shows,bypasses |
| R1232 |
T1941 |
T1939 |
cc |
and,bone |
| R1233 |
T2083 |
T2084 |
mark |
that,required |
| R1234 |
T2084 |
T2082 |
ccomp |
required,shows |
| R1235 |
T1942 |
T1939 |
conj |
joint,bone |
| R1236 |
T2085 |
T2086 |
det |
this,receptor |
| R1237 |
T2086 |
T2084 |
nsubjpass |
receptor,required |
| R1238 |
T2087 |
T2084 |
auxpass |
is,required |
| R1239 |
T1943 |
T1937 |
aux |
have,tested |
| R1240 |
T2088 |
T2084 |
prep |
for,required |
| R1241 |
T2089 |
T2090 |
amod |
early,formation |
| R1242 |
T2090 |
T2088 |
pobj |
formation,for |
| R1243 |
T2091 |
T2090 |
compound |
joint,formation |
| R1244 |
T2092 |
T2090 |
prep |
at,formation |
| R1245 |
T2093 |
T2094 |
det |
some,locations |
| R1246 |
T1944 |
T1937 |
neg |
not,tested |
| R1247 |
T2094 |
T2092 |
pobj |
locations,at |
| R1248 |
T2095 |
T2088 |
cc |
and,for |
| R1249 |
T2096 |
T2088 |
conj |
for,for |
| R1250 |
T1945 |
T1937 |
advmod |
yet,tested |
| R1251 |
T2097 |
T2096 |
pobj |
initiation,for |
| R1252 |
T2098 |
T2097 |
prep |
of,initiation |
| R1253 |
T2099 |
T2100 |
amod |
programmed,death |
| R1254 |
T2100 |
T2098 |
pobj |
death,of |
| R1255 |
T1946 |
T1937 |
auxpass |
been,tested |
| R1256 |
T2101 |
T2100 |
compound |
cell,death |
| R1257 |
T2102 |
T2100 |
prep |
in,death |
| R1258 |
T1947 |
T1948 |
punct |
(,Mishina |
| R1259 |
T2103 |
T2102 |
pobj |
webbing,in |
| R1260 |
T1948 |
T1937 |
meta |
Mishina,tested |
| R1261 |
T2104 |
T2103 |
prep |
between,webbing |
| R1262 |
T2105 |
T2104 |
pobj |
digits,between |
| R1263 |
T2106 |
T2070 |
punct |
.,bypasses |
| R1264 |
T1949 |
T1948 |
nummod |
2003,Mishina |
| R1265 |
T2108 |
T2109 |
advmod |
Interestingly,is |
| R1266 |
T1950 |
T1948 |
punct |
),Mishina |
| R1267 |
T2110 |
T2109 |
punct |
", ",is |
| R1268 |
T2111 |
T2109 |
nsubj |
Bmpr1a,is |
| R1269 |
T2112 |
T2109 |
advmod |
also,is |
| R1270 |
T1951 |
T1937 |
punct |
.,tested |
| R1271 |
T2113 |
T2109 |
acomp |
required,is |
| R1272 |
T2114 |
T2109 |
prep |
for,is |
| R1273 |
T2115 |
T2116 |
amod |
postnatal,maintenance |
| R1274 |
T1953 |
T1954 |
det |
A,system |
| R1275 |
T2116 |
T2114 |
pobj |
maintenance,for |
| R1276 |
T2117 |
T2116 |
prep |
of,maintenance |
| R1277 |
T2118 |
T2119 |
amod |
articular,cartilage |
| R1278 |
T2119 |
T2117 |
pobj |
cartilage,of |
| R1279 |
T1954 |
T1956 |
nsubj |
system,be |
| R1280 |
T2120 |
T2109 |
prep |
throughout,is |
| R1281 |
T1955 |
T1954 |
amod |
genetic,system |
| R1282 |
T1957 |
T1954 |
prep |
for,system |
| R1283 |
T2121 |
T2120 |
pobj |
most,throughout |
| R1284 |
T1958 |
T1957 |
pcomp |
activating,for |
| R1285 |
T2122 |
T2121 |
prep |
of,most |
| R1286 |
T2123 |
T2124 |
det |
the,skeleton |
| R1287 |
T2124 |
T2122 |
pobj |
skeleton,of |
| R1288 |
T1959 |
T1958 |
cc |
or,activating |
| R1289 |
T2125 |
T2109 |
punct |
.,is |
| R1290 |
T2127 |
T2128 |
prep |
In,forms |
| R1291 |
T1960 |
T1958 |
conj |
inactivating,activating |
| R1292 |
T2129 |
T2130 |
nmod |
Gdf5,Cre |
| R1293 |
T2130 |
T2132 |
nmod |
Cre,mice |
| R1294 |
T2131 |
T2130 |
punct |
-,Cre |
| R1295 |
T2132 |
T2127 |
pobj |
mice,In |
| R1296 |
T2133 |
T2130 |
punct |
/,Cre |
| R1297 |
T1961 |
T1960 |
dobj |
genes,inactivating |
| R1298 |
T2134 |
T2130 |
appos |
Bmpr1afloxP,Cre |
| R1299 |
T1962 |
T1963 |
advmod |
specifically,in |
| R1300 |
T2135 |
T2128 |
punct |
", ",forms |
| R1301 |
T2136 |
T2137 |
amod |
articular,cartilage |
| R1302 |
T1963 |
T1960 |
prep |
in,inactivating |
| R1303 |
T2137 |
T2128 |
nsubj |
cartilage,forms |
| R1304 |
T2138 |
T2128 |
advmod |
initially,forms |
| R1305 |
T2139 |
T2128 |
advmod |
normally,forms |
| R1306 |
T1964 |
T1965 |
compound |
joint,tissues |
| R1307 |
T2140 |
T2128 |
punct |
", ",forms |
| R1308 |
T2141 |
T2128 |
cc |
but,forms |
| R1309 |
T1965 |
T1963 |
pobj |
tissues,in |
| R1310 |
T2142 |
T2143 |
advmod |
subsequently,loses |
| R1311 |
T2143 |
T2128 |
conj |
loses,forms |
| R1312 |
T1966 |
T1956 |
aux |
would,be |
| R1313 |
T2144 |
T2143 |
dobj |
expression,loses |
| R1314 |
T2145 |
T2144 |
prep |
of,expression |
| R1315 |
T2146 |
T2147 |
amod |
several,markers |
| R1316 |
T1967 |
T1968 |
advmod |
particularly,useful |
| R1317 |
T2147 |
T2145 |
pobj |
markers,of |
| R1318 |
T2148 |
T2147 |
amod |
key,markers |
| R1319 |
T1968 |
T1956 |
acomp |
useful,be |
| R1320 |
T2149 |
T2147 |
compound |
cartilage,markers |
| R1321 |
T2150 |
T2143 |
prep |
after,loses |
| R1322 |
T2151 |
T2150 |
pobj |
birth,after |
| R1323 |
T1969 |
T1968 |
prep |
for,useful |
| R1324 |
T2152 |
T2128 |
punct |
.,forms |
| R1325 |
T1970 |
T1971 |
amod |
further,studies |
| R1326 |
T2154 |
T2155 |
nsubj |
It,fibrillates |
| R1327 |
T1971 |
T1969 |
pobj |
studies,for |
| R1328 |
T2156 |
T2155 |
advmod |
ultimately,fibrillates |
| R1329 |
T2157 |
T2155 |
cc |
and,fibrillates |
| R1330 |
T2158 |
T2155 |
conj |
degenerates,fibrillates |
| R1331 |
T1972 |
T1971 |
prep |
of,studies |
| R1332 |
T2159 |
T2158 |
punct |
", ",degenerates |
| R1333 |
T2160 |
T2158 |
conj |
resulting,degenerates |
| R1334 |
T2161 |
T2160 |
prep |
in,resulting |
| R1335 |
T1973 |
T1974 |
compound |
joint,formation |
| R1336 |
T2162 |
T2163 |
amod |
severe,osteoarthritis |
| R1337 |
T2163 |
T2161 |
pobj |
osteoarthritis,in |
| R1338 |
T2164 |
T2163 |
cc |
and,osteoarthritis |
| R1339 |
T1974 |
T1972 |
pobj |
formation,of |
| R1340 |
T2165 |
T2163 |
conj |
loss,osteoarthritis |
| R1341 |
T2166 |
T2165 |
prep |
of,loss |
| R1342 |
T1975 |
T1974 |
cc |
and,formation |
| R1343 |
T2167 |
T2166 |
pobj |
mobility,of |
| R1344 |
T2168 |
T2155 |
punct |
.,fibrillates |
| R1345 |
T2170 |
T2171 |
det |
These,experiments |
| R1346 |
T2171 |
T2172 |
nsubj |
experiments,suggest |
| R1347 |
T1976 |
T1974 |
conj |
maintenance,formation |
| R1348 |
T2173 |
T2174 |
mark |
that,required |
| R1349 |
T2174 |
T2172 |
advcl |
required,suggest |
| R1350 |
T1977 |
T1956 |
punct |
.,be |
| R1351 |
T2175 |
T2176 |
compound |
BMP,signaling |
| R1352 |
T2176 |
T2174 |
nsubjpass |
signaling,required |
| R1353 |
T2177 |
T2174 |
auxpass |
is,required |
| R1354 |
T1979 |
T1980 |
advmod |
Here,take |
| R1355 |
T2178 |
T2174 |
prep |
for,required |
| R1356 |
T2179 |
T2180 |
amod |
normal,maintenance |
| R1357 |
T2180 |
T2178 |
pobj |
maintenance,for |
| R1358 |
T2181 |
T2180 |
prep |
of,maintenance |
| R1359 |
T1981 |
T1980 |
nsubj |
we,take |
| R1360 |
T2182 |
T2183 |
amod |
postnatal,cartilage |
| R1361 |
T2183 |
T2181 |
pobj |
cartilage,of |
| R1362 |
T2184 |
T2183 |
amod |
articular,cartilage |
| R1363 |
T1982 |
T1980 |
dobj |
advantage,take |
| R1364 |
T2185 |
T2174 |
punct |
", ",required |
| R1365 |
T2186 |
T2174 |
cc |
and,required |
| R1366 |
T2187 |
T2188 |
mark |
that,play |
| R1367 |
T1983 |
T1980 |
prep |
of,take |
| R1368 |
T2188 |
T2174 |
conj |
play,required |
| R1369 |
T2189 |
T2188 |
nsubj |
modulation,play |
| R1370 |
T1984 |
T1985 |
det |
the,pattern |
| R1371 |
T2190 |
T2189 |
prep |
of,modulation |
| R1372 |
T2191 |
T2192 |
det |
the,pathway |
| R1373 |
T2192 |
T2190 |
pobj |
pathway,of |
| R1374 |
T1985 |
T1983 |
pobj |
pattern,of |
| R1375 |
T2193 |
T2194 |
compound |
BMP,signaling |
| R1376 |
T2194 |
T2192 |
compound |
signaling,pathway |
| R1377 |
T2195 |
T2188 |
aux |
may,play |
| R1378 |
T1986 |
T1987 |
npadvmod |
tissue,specific |
| R1379 |
T2196 |
T2197 |
det |
an,role |
| R1380 |
T2197 |
T2188 |
dobj |
role,play |
| R1381 |
T2198 |
T2197 |
amod |
important,role |
| R1382 |
T2199 |
T2188 |
prep |
in,play |
| R1383 |
T1987 |
T1985 |
amod |
specific,pattern |
| R1384 |
T2200 |
T2201 |
compound |
joint,disease |
| R1385 |
T2201 |
T2199 |
pobj |
disease,in |
| R1386 |
T1988 |
T1987 |
punct |
-,specific |
| R1387 |
T2202 |
T2172 |
punct |
.,suggest |
| R1388 |
T1989 |
T1985 |
compound |
expression,pattern |
| R1389 |
T1990 |
T1985 |
prep |
of,pattern |
| R1390 |
T1991 |
T1992 |
det |
the,gene |
| R1391 |
T1992 |
T1990 |
pobj |
gene,of |
| R1392 |
T1993 |
T1992 |
compound |
Gdf5,gene |
| R1393 |
T1994 |
T1995 |
aux |
to,engineer |
| R1394 |
T1995 |
T1980 |
advcl |
engineer,take |
| R1395 |
T1996 |
T1997 |
det |
a,system |
| R1396 |
T1997 |
T1995 |
dobj |
system,engineer |
| R1397 |
T1998 |
T1999 |
compound |
Cre,loxP |
| R1398 |
T1999 |
T1997 |
compound |
loxP,system |
| R1399 |
T2000 |
T1999 |
punct |
/,loxP |
| R1400 |
T2001 |
T2002 |
punct |
(,Nagy |
| R1401 |
T2002 |
T1997 |
meta |
Nagy,system |
| R1402 |
T2003 |
T2002 |
nummod |
2000,Nagy |
| R1403 |
T2004 |
T2002 |
punct |
),Nagy |
| R1404 |
T2005 |
T1997 |
punct |
", ",system |
| R1405 |
T2006 |
T2007 |
compound |
Gdf5,Cre |
| R1406 |
T2007 |
T1997 |
appos |
Cre,system |
| R1407 |
T2008 |
T2007 |
punct |
-,Cre |
| R1408 |
T2009 |
T1997 |
punct |
", ",system |
| R1409 |
T2010 |
T2011 |
dep |
that,used |
| R1410 |
T2011 |
T1997 |
relcl |
used,system |
| R1411 |
T2012 |
T2011 |
aux |
can,used |
| R1412 |
T2013 |
T2011 |
auxpass |
be,used |
| R1427 |
T2682 |
T2683 |
amod |
Genetic,System |
| R1428 |
T2684 |
T2683 |
prep |
for,System |
| R1429 |
T2685 |
T2684 |
pcomp |
Testing,for |
| R1430 |
T2686 |
T2687 |
det |
the,Function |
| R1431 |
T2687 |
T2685 |
dobj |
Function,Testing |
| R1432 |
T2688 |
T2687 |
prep |
of,Function |
| R1433 |
T2689 |
T2688 |
pobj |
Genes,of |
| R1434 |
T2690 |
T2687 |
prep |
in,Function |
| R1435 |
T2691 |
T2692 |
compound |
Joint,Development |
| R1436 |
T2692 |
T2690 |
pobj |
Development,in |
| R1437 |
T2694 |
T2695 |
aux |
To,generate |
| R1438 |
T2695 |
T2696 |
advcl |
generate,engineered |
| R1439 |
T2697 |
T2698 |
det |
a,system |
| R1440 |
T2698 |
T2695 |
dobj |
system,generate |
| R1441 |
T2699 |
T2698 |
amod |
general,system |
| R1442 |
T2700 |
T2698 |
amod |
capable,system |
| R1443 |
T2701 |
T2700 |
prep |
of,capable |
| R1444 |
T2702 |
T2703 |
advmod |
specifically,testing |
| R1445 |
T2703 |
T2701 |
pcomp |
testing,of |
| R1446 |
T2704 |
T2703 |
dobj |
genes,testing |
| R1447 |
T2705 |
T2703 |
prep |
for,testing |
| R1448 |
T2706 |
T2705 |
pobj |
functions,for |
| R1449 |
T2707 |
T2706 |
prep |
in,functions |
| R1450 |
T2708 |
T2709 |
amod |
skeletal,development |
| R1451 |
T2709 |
T2707 |
pobj |
development,in |
| R1452 |
T2710 |
T2709 |
compound |
joint,development |
| R1453 |
T2711 |
T2696 |
punct |
", ",engineered |
| R1454 |
T2712 |
T2696 |
nsubj |
we,engineered |
| R1455 |
T2713 |
T2714 |
amod |
transgenic,mice |
| R1456 |
T2714 |
T2696 |
dobj |
mice,engineered |
| R1457 |
T2715 |
T2716 |
aux |
to,express |
| R1458 |
T2716 |
T2696 |
xcomp |
express,engineered |
| R1459 |
T2717 |
T2718 |
compound |
Cre,recombinase |
| R1460 |
T2718 |
T2716 |
dobj |
recombinase,express |
| R1461 |
T2719 |
T2716 |
prep |
in,express |
| R1462 |
T2720 |
T2721 |
amod |
developing,joints |
| R1463 |
T2721 |
T2719 |
pobj |
joints,in |
| R1464 |
T2722 |
T2723 |
punct |
(,Figure |
| R1465 |
T2723 |
T2696 |
parataxis |
Figure,engineered |
| R1466 |
T2724 |
T2723 |
nummod |
1,Figure |
| R1467 |
T2725 |
T2723 |
punct |
),Figure |
| R1468 |
T2726 |
T2696 |
punct |
.,engineered |
| R1469 |
T2728 |
T2729 |
nsubj |
Gdf5,is |
| R1470 |
T2730 |
T2731 |
det |
a,gene |
| R1471 |
T2731 |
T2729 |
attr |
gene,is |
| R1472 |
T2732 |
T2733 |
advmod |
strongly,expressed |
| R1473 |
T2733 |
T2731 |
acl |
expressed,gene |
| R1474 |
T2734 |
T2733 |
prep |
in,expressed |
| R1475 |
T2735 |
T2734 |
pobj |
stripes,in |
| R1476 |
T2736 |
T2733 |
prep |
across,expressed |
| R1477 |
T2737 |
T2738 |
amod |
developing,elements |
| R1478 |
T2738 |
T2736 |
pobj |
elements,across |
| R1479 |
T2739 |
T2738 |
amod |
skeletal,elements |
| R1480 |
T2740 |
T2733 |
prep |
during,expressed |
| R1481 |
T2741 |
T2742 |
amod |
embryonic,formation |
| R1482 |
T2742 |
T2740 |
pobj |
formation,during |
| R1483 |
T2743 |
T2742 |
compound |
joint,formation |
| R1484 |
T2744 |
T2729 |
punct |
.,is |
| R1485 |
T2746 |
T2747 |
det |
A,chromosome |
| R1486 |
T2747 |
T2750 |
nsubjpass |
chromosome,modified |
| R1487 |
T2748 |
T2749 |
amod |
bacterial,artificial |
| R1488 |
T2749 |
T2747 |
amod |
artificial,chromosome |
| R1489 |
T2751 |
T2747 |
punct |
(,chromosome |
| R1490 |
T2752 |
T2747 |
appos |
BAC,chromosome |
| R1491 |
T2753 |
T2747 |
punct |
),chromosome |
| R1492 |
T2754 |
T2747 |
acl |
containing,chromosome |
| R1493 |
T2755 |
T2756 |
det |
the,locus |
| R1494 |
T2756 |
T2754 |
dobj |
locus,containing |
| R1495 |
T2757 |
T2756 |
compound |
Gdf5,locus |
| R1496 |
T2758 |
T2750 |
auxpass |
was,modified |
| R1497 |
T2759 |
T2750 |
prep |
by,modified |
| R1498 |
T2760 |
T2761 |
amod |
homologous,recombination |
| R1499 |
T2761 |
T2759 |
pobj |
recombination,by |
| R1500 |
T2762 |
T2750 |
prep |
in,modified |
| R1501 |
T2763 |
T2762 |
pobj |
bacteria,in |
| R1502 |
T2764 |
T2765 |
aux |
to,insert |
| R1503 |
T2765 |
T2750 |
advcl |
insert,modified |
| R1504 |
T2766 |
T2767 |
det |
a,cassette |
| R1505 |
T2767 |
T2765 |
dobj |
cassette,insert |
| R1506 |
T2768 |
T2767 |
acl |
encoding,cassette |
| R1507 |
T2769 |
T2770 |
nmod |
Cre,phosphatase |
| R1508 |
T2770 |
T2768 |
dobj |
phosphatase,encoding |
| R1509 |
T2771 |
T2770 |
punct |
-,phosphatase |
| R1510 |
T2772 |
T2773 |
amod |
internal,entry |
| R1511 |
T2773 |
T2775 |
nmod |
entry,site |
| R1512 |
T2774 |
T2773 |
nmod |
ribosome,entry |
| R1513 |
T2775 |
T2770 |
nmod |
site,phosphatase |
| R1514 |
T2776 |
T2775 |
punct |
(,site |
| R1515 |
T2777 |
T2775 |
appos |
IRES,site |
| R1516 |
T2778 |
T2775 |
punct |
),site |
| R1517 |
T2779 |
T2770 |
punct |
-,phosphatase |
| R1518 |
T2780 |
T2781 |
amod |
human,placental |
| R1519 |
T2781 |
T2770 |
amod |
placental,phosphatase |
| R1520 |
T2782 |
T2770 |
compound |
alkaline,phosphatase |
| R1521 |
T2783 |
T2770 |
punct |
(,phosphatase |
| R1522 |
T2784 |
T2770 |
appos |
hPLAP,phosphatase |
| R1523 |
T2785 |
T2770 |
punct |
),phosphatase |
| R1524 |
T2786 |
T2765 |
prep |
into,insert |
| R1525 |
T2787 |
T2788 |
det |
the,site |
| R1526 |
T2788 |
T2786 |
pobj |
site,into |
| R1527 |
T2789 |
T2788 |
compound |
translation,site |
| R1528 |
T2790 |
T2788 |
compound |
start,site |
| R1529 |
T2791 |
T2788 |
prep |
of,site |
| R1530 |
T2792 |
T2791 |
pobj |
Gdf5,of |
| R1531 |
T2793 |
T2794 |
punct |
(,Figure |
| R1532 |
T2794 |
T2765 |
parataxis |
Figure,insert |
| R1533 |
T2795 |
T2794 |
nummod |
1A,Figure |
| R1534 |
T2796 |
T2794 |
punct |
),Figure |
| R1535 |
T2797 |
T2750 |
punct |
.,modified |
| R1536 |
T2799 |
T2800 |
det |
This,BAC |
| R1537 |
T2800 |
T2802 |
nsubjpass |
BAC,used |
| R1538 |
T2801 |
T2800 |
amod |
modified,BAC |
| R1539 |
T2803 |
T2802 |
auxpass |
was,used |
| R1540 |
T2804 |
T2802 |
advmod |
then,used |
| R1541 |
T2805 |
T2806 |
aux |
to,make |
| R1542 |
T2806 |
T2802 |
advcl |
make,used |
| R1543 |
T2807 |
T2806 |
dobj |
lines,make |
| R1544 |
T2808 |
T2807 |
prep |
of,lines |
| R1545 |
T2809 |
T2810 |
amod |
transgenic,mice |
| R1546 |
T2810 |
T2808 |
pobj |
mice,of |
| R1547 |
T2811 |
T2802 |
punct |
.,used |
| R1548 |
T2813 |
T2814 |
det |
The,mice |
| R1549 |
T2814 |
T2820 |
nsubjpass |
mice,tested |
| R1550 |
T2815 |
T2814 |
amod |
resulting,mice |
| R1551 |
T2816 |
T2817 |
nmod |
Gdf5,Cre |
| R1552 |
T2817 |
T2814 |
nmod |
Cre,mice |
| R1553 |
T2818 |
T2817 |
punct |
-,Cre |
| R1554 |
T2819 |
T2814 |
amod |
transgenic,mice |
| R1555 |
T2821 |
T2820 |
auxpass |
were,tested |
| R1556 |
T2822 |
T2820 |
prep |
for,tested |
| R1557 |
T2823 |
T2824 |
compound |
transgene,expression |
| R1558 |
T2824 |
T2822 |
pobj |
expression,for |
| R1559 |
T2825 |
T2824 |
cc |
and,expression |
| R1560 |
T2826 |
T2827 |
compound |
Cre,recombinase |
| R1561 |
T2827 |
T2828 |
compound |
recombinase,activity |
| R1562 |
T2828 |
T2824 |
conj |
activity,expression |
| R1563 |
T2829 |
T2820 |
prep |
by,tested |
| R1564 |
T2830 |
T2829 |
pcomp |
crossing,by |
| R1565 |
T2831 |
T2830 |
dobj |
them,crossing |
| R1566 |
T2832 |
T2830 |
prep |
to,crossing |
| R1567 |
T2833 |
T2834 |
compound |
R26R,reporter |
| R1568 |
T2834 |
T2835 |
compound |
reporter,mice |
| R1569 |
T2835 |
T2832 |
pobj |
mice,to |
| R1570 |
T2836 |
T2837 |
dep |
that,activate |
| R1571 |
T2837 |
T2835 |
relcl |
activate,mice |
| R1572 |
T2838 |
T2839 |
det |
the,expression |
| R1573 |
T2839 |
T2837 |
dobj |
expression,activate |
| R1574 |
T2840 |
T2839 |
prep |
of,expression |
| R1575 |
T2841 |
T2840 |
pobj |
lacZ,of |
| R1576 |
T2842 |
T2837 |
prep |
after,activate |
| R1577 |
T2843 |
T2844 |
npadvmod |
Cre,mediated |
| R1578 |
T2844 |
T2846 |
amod |
mediated,removal |
| R1579 |
T2845 |
T2844 |
punct |
-,mediated |
| R1580 |
T2846 |
T2842 |
pobj |
removal,after |
| R1581 |
T2847 |
T2846 |
prep |
of,removal |
| R1582 |
T2848 |
T2849 |
amod |
transcriptional,sequences |
| R1583 |
T2849 |
T2847 |
pobj |
sequences,of |
| R1584 |
T2850 |
T2849 |
compound |
stop,sequences |
| R1585 |
T2851 |
T2852 |
punct |
(,Soriano |
| R1586 |
T2852 |
T2820 |
meta |
Soriano,tested |
| R1587 |
T2853 |
T2852 |
nummod |
1999,Soriano |
| R1588 |
T2854 |
T2852 |
punct |
),Soriano |
| R1589 |
T2855 |
T2820 |
punct |
.,tested |
| R1590 |
T2857 |
T2858 |
det |
The,progeny |
| R1591 |
T2858 |
T2860 |
nsubjpass |
progeny,analyzed |
| R1592 |
T2859 |
T2858 |
amod |
resulting,progeny |
| R1593 |
T2861 |
T2860 |
auxpass |
were,analyzed |
| R1594 |
T2862 |
T2860 |
preconj |
both,analyzed |
| R1595 |
T2863 |
T2860 |
conj |
for,analyzed |
| R1596 |
T2864 |
T2863 |
pobj |
expression,for |
| R1597 |
T2865 |
T2864 |
prep |
of,expression |
| R1598 |
T2866 |
T2867 |
det |
the,transgene |
| R1599 |
T2867 |
T2865 |
pobj |
transgene,of |
| R1600 |
T2868 |
T2863 |
prep |
by,for |
| R1601 |
T2869 |
T2868 |
pcomp |
assaying,by |
| R1602 |
T2870 |
T2871 |
compound |
HPLAP,activity |
| R1603 |
T2871 |
T2869 |
dobj |
activity,assaying |
| R1604 |
T2872 |
T2860 |
cc |
and,analyzed |
| R1605 |
T2873 |
T2860 |
conj |
for,analyzed |
| R1606 |
T2874 |
T2873 |
pobj |
recombination,for |
| R1607 |
T2875 |
T2874 |
prep |
of,recombination |
| R1608 |
T2876 |
T2875 |
pobj |
DNA,of |
| R1609 |
T2877 |
T2873 |
prep |
by,for |
| R1610 |
T2878 |
T2877 |
pcomp |
assaying,by |
| R1611 |
T2879 |
T2880 |
compound |
LACZ,activity |
| R1612 |
T2880 |
T2878 |
dobj |
activity,assaying |
| R1613 |
T2881 |
T2860 |
punct |
.,analyzed |
| R1614 |
T2883 |
T2884 |
det |
The,progeny |
| R1615 |
T2884 |
T2885 |
nsubj |
progeny,showed |
| R1616 |
T2886 |
T2884 |
prep |
from,progeny |
| R1617 |
T2887 |
T2888 |
det |
all,lines |
| R1618 |
T2888 |
T2886 |
pobj |
lines,from |
| R1619 |
T2889 |
T2888 |
nummod |
three,lines |
| R1620 |
T2890 |
T2891 |
amod |
strong,expression |
| R1621 |
T2891 |
T2885 |
dobj |
expression,showed |
| R1622 |
T2892 |
T2891 |
compound |
LACZ,expression |
| R1623 |
T2893 |
T2894 |
advmod |
primarily,in |
| R1624 |
T2894 |
T2885 |
prep |
in,showed |
| R1625 |
T2895 |
T2894 |
pobj |
joints,in |
| R1626 |
T2896 |
T2885 |
punct |
", ",showed |
| R1627 |
T2897 |
T2885 |
cc |
and,showed |
| R1628 |
T2898 |
T2899 |
prep |
in,seen |
| R1629 |
T2899 |
T2885 |
conj |
seen,showed |
| R1630 |
T2900 |
T2901 |
quantmod |
two,three |
| R1631 |
T2901 |
T2903 |
nummod |
three,lines |
| R1632 |
T2902 |
T2901 |
quantmod |
of,three |
| R1633 |
T2903 |
T2898 |
pobj |
lines,in |
| R1634 |
T2904 |
T2905 |
compound |
HPLAP,expression |
| R1635 |
T2905 |
T2899 |
nsubjpass |
expression,seen |
| R1636 |
T2906 |
T2899 |
aux |
could,seen |
| R1637 |
T2907 |
T2899 |
advmod |
also,seen |
| R1638 |
T2908 |
T2899 |
auxpass |
be,seen |
| R1639 |
T2909 |
T2899 |
prep |
in,seen |
| R1640 |
T2910 |
T2911 |
compound |
joint,regions |
| R1641 |
T2911 |
T2909 |
pobj |
regions,in |
| R1642 |
T2912 |
T2899 |
punct |
.,seen |
| R1643 |
T2914 |
T2915 |
advmod |
Interestingly,seen |
| R1644 |
T2916 |
T2915 |
punct |
", ",seen |
| R1645 |
T2917 |
T2918 |
compound |
HPLAP,expression |
| R1646 |
T2918 |
T2915 |
nsubjpass |
expression,seen |
| R1647 |
T2919 |
T2918 |
prep |
in,expression |
| R1648 |
T2920 |
T2921 |
det |
the,line |
| R1649 |
T2921 |
T2919 |
pobj |
line,in |
| R1650 |
T2922 |
T2923 |
nmod |
Gdf5,Cre |
| R1651 |
T2923 |
T2921 |
nmod |
Cre,line |
| R1652 |
T2924 |
T2923 |
punct |
-,Cre |
| R1653 |
T2925 |
T2923 |
amod |
transgenic,Cre |
| R1654 |
T2926 |
T2927 |
nmod |
GAC,A |
| R1655 |
T2927 |
T2923 |
appos |
A,Cre |
| R1656 |
T2928 |
T2927 |
punct |
(,A |
| R1657 |
T2929 |
T2927 |
punct |
),A |
| R1658 |
T2930 |
T2921 |
acl |
used,line |
| R1659 |
T2931 |
T2930 |
prep |
for,used |
| R1660 |
T2932 |
T2933 |
det |
all,experiments |
| R1661 |
T2933 |
T2931 |
pobj |
experiments,for |
| R1662 |
T2934 |
T2933 |
amod |
subsequent,experiments |
| R1663 |
T2935 |
T2933 |
compound |
breeding,experiments |
| R1664 |
T2936 |
T2915 |
auxpass |
was,seen |
| R1665 |
T2937 |
T2938 |
aux |
to,precede |
| R1666 |
T2938 |
T2915 |
xcomp |
precede,seen |
| R1667 |
T2939 |
T2940 |
compound |
LACZ,expression |
| R1668 |
T2940 |
T2938 |
dobj |
expression,precede |
| R1669 |
T2941 |
T2938 |
prep |
during,precede |
| R1670 |
T2942 |
T2943 |
amod |
successive,development |
| R1671 |
T2943 |
T2941 |
pobj |
development,during |
| R1672 |
T2944 |
T2943 |
prep |
of,development |
| R1673 |
T2945 |
T2944 |
pobj |
joints,of |
| R1674 |
T2946 |
T2943 |
prep |
in,development |
| R1675 |
T2947 |
T2948 |
det |
the,digits |
| R1676 |
T2948 |
T2946 |
pobj |
digits,in |
| R1677 |
T2949 |
T2950 |
punct |
(,Figure |
| R1678 |
T2950 |
T2915 |
parataxis |
Figure,seen |
| R1679 |
T2951 |
T2950 |
nummod |
1C,Figure |
| R1680 |
T2952 |
T2950 |
punct |
),Figure |
| R1681 |
T2953 |
T2954 |
punct |
(,data |
| R1682 |
T2954 |
T2915 |
meta |
data,seen |
| R1683 |
T2955 |
T2954 |
amod |
unpublished,data |
| R1684 |
T2956 |
T2954 |
punct |
),data |
| R1685 |
T2957 |
T2915 |
punct |
.,seen |
| R1686 |
T2959 |
T2960 |
det |
These,experiments |
| R1687 |
T2960 |
T2961 |
nsubj |
experiments,demonstrate |
| R1688 |
T2962 |
T2961 |
advmod |
clearly,demonstrate |
| R1689 |
T2963 |
T2964 |
mark |
that,expresses |
| R1690 |
T2964 |
T2961 |
ccomp |
expresses,demonstrate |
| R1691 |
T2965 |
T2966 |
det |
the,transgene |
| R1692 |
T2966 |
T2964 |
nsubj |
transgene,expresses |
| R1693 |
T2967 |
T2968 |
compound |
Gdf5,Cre |
| R1694 |
T2968 |
T2966 |
compound |
Cre,transgene |
| R1695 |
T2969 |
T2968 |
punct |
-,Cre |
| R1696 |
T2970 |
T2971 |
compound |
Cre,recombinase |
| R1697 |
T2971 |
T2964 |
dobj |
recombinase,expresses |
| R1698 |
T2972 |
T2964 |
cc |
and,expresses |
| R1699 |
T2973 |
T2964 |
conj |
causes,expresses |
| R1700 |
T2974 |
T2975 |
compound |
DNA,recombination |
| R1701 |
T2975 |
T2973 |
dobj |
recombination,causes |
| R1702 |
T2976 |
T2964 |
prep |
in,expresses |
| R1703 |
T2977 |
T2978 |
amod |
developing,regions |
| R1704 |
T2978 |
T2976 |
pobj |
regions,in |
| R1705 |
T2979 |
T2978 |
compound |
joint,regions |
| R1706 |
T2980 |
T2961 |
punct |
.,demonstrate |
| R1707 |
T2982 |
T2983 |
nmod |
GAC,A |
| R1708 |
T2983 |
T2985 |
nmod |
A,mice |
| R1709 |
T2984 |
T2983 |
punct |
(,A |
| R1710 |
T2985 |
T2987 |
nsubjpass |
mice,crossed |
| R1711 |
T2986 |
T2983 |
punct |
),A |
| R1712 |
T2988 |
T2987 |
auxpass |
were,crossed |
| R1713 |
T2989 |
T2987 |
prep |
with,crossed |
| R1714 |
T2990 |
T2991 |
nmod |
lacZ,Cre |
| R1715 |
T2991 |
T2993 |
nmod |
Cre,reporter |
| R1716 |
T2992 |
T2991 |
nmod |
ROSA26,Cre |
| R1717 |
T2993 |
T2994 |
nmod |
reporter,strain |
| R1718 |
T2994 |
T2995 |
nmod |
strain,mice |
| R1719 |
T2995 |
T2989 |
pobj |
mice,with |
| R1720 |
T2996 |
T2997 |
punct |
(,R26R |
| R1721 |
T2997 |
T2994 |
appos |
R26R,strain |
| R1722 |
T2998 |
T2997 |
punct |
),R26R |
| R1723 |
T2999 |
T3000 |
aux |
to,analyze |
| R1724 |
T3000 |
T2987 |
advcl |
analyze,crossed |
| R1725 |
T3001 |
T3002 |
det |
the,pattern |
| R1726 |
T3002 |
T3000 |
dobj |
pattern,analyze |
| R1727 |
T3003 |
T3002 |
prep |
of,pattern |
| R1728 |
T3004 |
T3005 |
npadvmod |
Cre,mediated |
| R1729 |
T3005 |
T3007 |
amod |
mediated,recombination |
| R1730 |
T3006 |
T3005 |
punct |
-,mediated |
| R1731 |
T3007 |
T3003 |
pobj |
recombination,of |
| R1732 |
T3008 |
T3007 |
compound |
lacZ,recombination |
| R1733 |
T3009 |
T3000 |
prep |
throughout,analyze |
| R1734 |
T3010 |
T3009 |
pobj |
development,throughout |
| R1735 |
T3011 |
T2987 |
punct |
.,crossed |
| R1736 |
T3013 |
T3014 |
nsubj |
Joints,begin |
| R1737 |
T3015 |
T3013 |
prep |
in,Joints |
| R1738 |
T3016 |
T3017 |
amod |
developing,limbs |
| R1739 |
T3017 |
T3015 |
pobj |
limbs,in |
| R1740 |
T3018 |
T3014 |
xcomp |
forming,begin |
| R1741 |
T3019 |
T3018 |
prep |
in,forming |
| R1742 |
T3020 |
T3021 |
det |
a,pattern |
| R1743 |
T3021 |
T3019 |
pobj |
pattern,in |
| R1744 |
T3022 |
T3023 |
amod |
proximal,distal |
| R1745 |
T3023 |
T3021 |
amod |
distal,pattern |
| R1746 |
T3024 |
T3023 |
punct |
-,distal |
| R1747 |
T3025 |
T3026 |
amod |
such,forms |
| R1748 |
T3026 |
T3018 |
advcl |
forms,forming |
| R1749 |
T3027 |
T3026 |
mark |
that,forms |
| R1750 |
T3028 |
T3029 |
det |
the,joint |
| R1751 |
T3029 |
T3026 |
nsubj |
joint,forms |
| R1752 |
T3030 |
T3029 |
compound |
shoulder,joint |
| R1753 |
T3031 |
T3026 |
advmod |
prior,forms |
| R1754 |
T3032 |
T3031 |
prep |
to,prior |
| R1755 |
T3033 |
T3034 |
det |
the,joint |
| R1756 |
T3034 |
T3032 |
pobj |
joint,to |
| R1757 |
T3035 |
T3034 |
compound |
elbow,joint |
| R1758 |
T3036 |
T3014 |
punct |
.,begin |
| R1759 |
T3038 |
T3039 |
prep |
In,defined |
| R1760 |
T3040 |
T3038 |
pobj |
addition,In |
| R1761 |
T3041 |
T3039 |
punct |
", ",defined |
| R1762 |
T3042 |
T3043 |
nummod |
three,stages |
| R1763 |
T3043 |
T3039 |
nsubjpass |
stages,defined |
| R1764 |
T3044 |
T3043 |
amod |
major,stages |
| R1765 |
T3045 |
T3043 |
prep |
of,stages |
| R1766 |
T3046 |
T3047 |
amod |
early,development |
| R1767 |
T3047 |
T3045 |
pobj |
development,of |
| R1768 |
T3048 |
T3047 |
compound |
joint,development |
| R1769 |
T3049 |
T3039 |
aux |
have,defined |
| R1770 |
T3050 |
T3039 |
auxpass |
been,defined |
| R1771 |
T3051 |
T3039 |
agent |
by,defined |
| R1772 |
T3052 |
T3051 |
pobj |
histology,by |
| R1773 |
T3053 |
T3039 |
prep |
as,defined |
| R1774 |
T3054 |
T3055 |
punct |
(,1 |
| R1775 |
T3055 |
T3056 |
meta |
1,formation |
| R1776 |
T3056 |
T3053 |
pobj |
formation,as |
| R1777 |
T3057 |
T3055 |
punct |
),1 |
| R1778 |
T3058 |
T3056 |
compound |
interzone,formation |
| R1779 |
T3059 |
T3056 |
punct |
", ",formation |
| R1780 |
T3060 |
T3061 |
punct |
(,2 |
| R1781 |
T3061 |
T3062 |
meta |
2,formation |
| R1782 |
T3062 |
T3056 |
conj |
formation,formation |
| R1783 |
T3063 |
T3061 |
punct |
),2 |
| R1784 |
T3064 |
T3065 |
nummod |
three,layer |
| R1785 |
T3065 |
T3062 |
compound |
layer,formation |
| R1786 |
T3066 |
T3065 |
punct |
-,layer |
| R1787 |
T3067 |
T3062 |
compound |
interzone,formation |
| R1788 |
T3068 |
T3062 |
punct |
", ",formation |
| R1789 |
T3069 |
T3062 |
cc |
and,formation |
| R1790 |
T3070 |
T3071 |
punct |
(,3 |
| R1791 |
T3071 |
T3072 |
meta |
3,cavitation |
| R1792 |
T3072 |
T3062 |
conj |
cavitation,formation |
| R1793 |
T3073 |
T3071 |
punct |
),3 |
| R1794 |
T3074 |
T3075 |
punct |
(,Mitrovic |
| R1795 |
T3075 |
T3039 |
meta |
Mitrovic,defined |
| R1796 |
T3076 |
T3075 |
nummod |
1978,Mitrovic |
| R1797 |
T3077 |
T3075 |
punct |
),Mitrovic |
| R1798 |
T3078 |
T3039 |
punct |
.,defined |
| R1799 |
T3080 |
T3081 |
advcl |
Consistent,seen |
| R1800 |
T3082 |
T3080 |
prep |
with,Consistent |
| R1801 |
T3083 |
T3084 |
det |
the,pattern |
| R1802 |
T3084 |
T3082 |
pobj |
pattern,with |
| R1803 |
T3085 |
T3086 |
amod |
proximal,distal |
| R1804 |
T3086 |
T3084 |
amod |
distal,pattern |
| R1805 |
T3087 |
T3086 |
punct |
-,distal |
| R1806 |
T3088 |
T3084 |
prep |
of,pattern |
| R1807 |
T3089 |
T3090 |
compound |
joint,development |
| R1808 |
T3090 |
T3088 |
pobj |
development,of |
| R1809 |
T3091 |
T3084 |
prep |
in,pattern |
| R1810 |
T3092 |
T3093 |
det |
the,limbs |
| R1811 |
T3093 |
T3091 |
pobj |
limbs,in |
| R1812 |
T3094 |
T3081 |
punct |
", ",seen |
| R1813 |
T3095 |
T3096 |
compound |
LACZ,activity |
| R1814 |
T3096 |
T3081 |
nsubjpass |
activity,seen |
| R1815 |
T3097 |
T3081 |
auxpass |
is,seen |
| R1816 |
T3098 |
T3081 |
prep |
at,seen |
| R1817 |
T3099 |
T3100 |
amod |
embryonic,day |
| R1818 |
T3100 |
T3098 |
pobj |
day,at |
| R1819 |
T3101 |
T3100 |
nummod |
12.5,day |
| R1820 |
T3102 |
T3100 |
punct |
(,day |
| R1821 |
T3103 |
T3100 |
appos |
E12.5,day |
| R1822 |
T3104 |
T3100 |
punct |
),day |
| R1823 |
T3105 |
T3081 |
prep |
in,seen |
| R1824 |
T3106 |
T3107 |
det |
the,joints |
| R1825 |
T3107 |
T3105 |
pobj |
joints,in |
| R1826 |
T3108 |
T3109 |
advmod |
more,proximal |
| R1827 |
T3109 |
T3107 |
amod |
proximal,joints |
| R1828 |
T3110 |
T3107 |
punct |
", ",joints |
| R1829 |
T3111 |
T3107 |
prep |
including,joints |
| R1830 |
T3112 |
T3113 |
det |
the,shoulder |
| R1831 |
T3113 |
T3111 |
pobj |
shoulder,including |
| R1832 |
T3114 |
T3113 |
cc |
and,shoulder |
| R1833 |
T3115 |
T3113 |
conj |
knee,shoulder |
| R1834 |
T3116 |
T3117 |
punct |
(,data |
| R1835 |
T3117 |
T3081 |
meta |
data,seen |
| R1836 |
T3118 |
T3117 |
amod |
unpublished,data |
| R1837 |
T3119 |
T3117 |
punct |
),data |
| R1838 |
T3120 |
T3081 |
punct |
.,seen |
| R1839 |
T3122 |
T3123 |
prep |
By,seen |
| R1840 |
T3124 |
T3122 |
pobj |
E14.5,By |
| R1841 |
T3125 |
T3123 |
punct |
", ",seen |
| R1842 |
T3126 |
T3127 |
compound |
LACZ,expression |
| R1843 |
T3127 |
T3123 |
nsubjpass |
expression,seen |
| R1844 |
T3128 |
T3123 |
auxpass |
is,seen |
| R1845 |
T3129 |
T3123 |
advmod |
typically,seen |
| R1846 |
T3130 |
T3123 |
prep |
in,seen |
| R1847 |
T3131 |
T3130 |
pobj |
all,in |
| R1848 |
T3132 |
T3131 |
prep |
but,all |
| R1849 |
T3133 |
T3134 |
det |
the,joints |
| R1850 |
T3134 |
T3132 |
pobj |
joints,but |
| R1851 |
T3135 |
T3136 |
advmod |
most,distal |
| R1852 |
T3136 |
T3134 |
amod |
distal,joints |
| R1853 |
T3137 |
T3134 |
prep |
of,joints |
| R1854 |
T3138 |
T3139 |
det |
the,limbs |
| R1855 |
T3139 |
T3137 |
pobj |
limbs,of |
| R1856 |
T3140 |
T3141 |
punct |
(,1B |
| R1857 |
T3141 |
T3123 |
parataxis |
1B,seen |
| R1858 |
T3142 |
T3141 |
nmod |
Figure,1B |
| R1859 |
T3143 |
T3141 |
cc |
and,1B |
| R1860 |
T3144 |
T3141 |
conj |
1C,1B |
| R1861 |
T3145 |
T3141 |
punct |
),1B |
| R1862 |
T3146 |
T3123 |
punct |
", ",seen |
| R1863 |
T3147 |
T3123 |
cc |
but,seen |
| R1864 |
T3148 |
T3147 |
prep |
with,but |
| R1865 |
T3149 |
T3150 |
det |
some,variability |
| R1866 |
T3150 |
T3148 |
pobj |
variability,with |
| R1867 |
T3151 |
T3150 |
prep |
in,variability |
| R1868 |
T3152 |
T3153 |
preconj |
both,strength |
| R1869 |
T3153 |
T3151 |
pobj |
strength,in |
| R1870 |
T3154 |
T3153 |
cc |
and,strength |
| R1871 |
T3155 |
T3153 |
conj |
extent,strength |
| R1872 |
T3156 |
T3153 |
prep |
of,strength |
| R1873 |
T3157 |
T3156 |
pobj |
expression,of |
| R1874 |
T3158 |
T3150 |
prep |
from,variability |
| R1875 |
T3159 |
T3158 |
pobj |
embryo,from |
| R1876 |
T3160 |
T3158 |
prep |
to,from |
| R1877 |
T3161 |
T3160 |
pobj |
embryo,to |
| R1878 |
T3162 |
T3123 |
punct |
.,seen |
| R1879 |
T3164 |
T3165 |
det |
The,embryos |
| R1880 |
T3165 |
T3169 |
nsubj |
embryos,have |
| R1881 |
T3166 |
T3167 |
advmod |
strongest,staining |
| R1882 |
T3167 |
T3165 |
amod |
staining,embryos |
| R1883 |
T3168 |
T3167 |
punct |
-,staining |
| R1884 |
T3170 |
T3169 |
advmod |
often,have |
| R1885 |
T3171 |
T3172 |
amod |
additional,staining |
| R1886 |
T3172 |
T3169 |
dobj |
staining,have |
| R1887 |
T3173 |
T3172 |
prep |
in,staining |
| R1888 |
T3174 |
T3173 |
pobj |
fingertips,in |
| R1889 |
T3175 |
T3176 |
punct |
(,seen |
| R1890 |
T3176 |
T3169 |
parataxis |
seen,have |
| R1891 |
T3177 |
T3176 |
neg |
not,seen |
| R1892 |
T3178 |
T3176 |
prep |
in,seen |
| R1893 |
T3179 |
T3180 |
det |
the,embryo |
| R1894 |
T3180 |
T3178 |
pobj |
embryo,in |
| R1895 |
T3181 |
T3180 |
compound |
E14.5,embryo |
| R1896 |
T3182 |
T3180 |
prep |
in,embryo |
| R1897 |
T3183 |
T3182 |
pobj |
Figure,in |
| R1898 |
T3184 |
T3183 |
nummod |
1C,Figure |
| R1899 |
T3185 |
T3176 |
punct |
", ",seen |
| R1900 |
T3186 |
T3176 |
cc |
but,seen |
| R1901 |
T3187 |
T3188 |
advmod |
clearly,detectable |
| R1902 |
T3188 |
T3176 |
conj |
detectable,seen |
| R1903 |
T3189 |
T3188 |
prep |
in,detectable |
| R1904 |
T3190 |
T3191 |
det |
the,embryo |
| R1905 |
T3191 |
T3189 |
pobj |
embryo,in |
| R1906 |
T3192 |
T3191 |
compound |
E13.5,embryo |
| R1907 |
T3193 |
T3191 |
acl |
shown,embryo |
| R1908 |
T3194 |
T3193 |
prep |
in,shown |
| R1909 |
T3195 |
T3194 |
pobj |
Figure,in |
| R1910 |
T3196 |
T3195 |
nummod |
2,Figure |
| R1911 |
T3197 |
T3176 |
punct |
),seen |
| R1912 |
T3198 |
T3169 |
punct |
.,have |
| R1913 |
T3200 |
T3201 |
nsubj |
Sections,show |
| R1914 |
T3202 |
T3200 |
prep |
through,Sections |
| R1915 |
T3203 |
T3204 |
amod |
developing,joints |
| R1916 |
T3204 |
T3202 |
pobj |
joints,through |
| R1917 |
T3205 |
T3206 |
mark |
that,is |
| R1918 |
T3206 |
T3201 |
ccomp |
is,show |
| R1919 |
T3207 |
T3206 |
nsubj |
LACZ,is |
| R1920 |
T3208 |
T3206 |
acomp |
present,is |
| R1921 |
T3209 |
T3206 |
prep |
in,is |
| R1922 |
T3210 |
T3211 |
amod |
many,cells |
| R1923 |
T3211 |
T3209 |
pobj |
cells,in |
| R1924 |
T3212 |
T3206 |
prep |
at,is |
| R1925 |
T3213 |
T3214 |
det |
the,stage |
| R1926 |
T3214 |
T3212 |
pobj |
stage,at |
| R1927 |
T3215 |
T3214 |
compound |
interzone,stage |
| R1928 |
T3216 |
T3217 |
punct |
(,data |
| R1929 |
T3217 |
T3201 |
meta |
data,show |
| R1930 |
T3218 |
T3217 |
amod |
unpublished,data |
| R1931 |
T3219 |
T3217 |
punct |
),data |
| R1932 |
T3220 |
T3201 |
punct |
.,show |
| R1933 |
T3222 |
T3223 |
advmod |
However,achieved |
| R1934 |
T3224 |
T3223 |
punct |
", ",achieved |
| R1935 |
T3225 |
T3223 |
nsubjpass |
expression,achieved |
| R1936 |
T3226 |
T3225 |
prep |
of,expression |
| R1937 |
T3227 |
T3226 |
pobj |
LACZ,of |
| R1938 |
T3228 |
T3225 |
prep |
in,expression |
| R1939 |
T3229 |
T3230 |
advmod |
nearly,100 |
| R1940 |
T3230 |
T3231 |
nummod |
100,% |
| R1941 |
T3231 |
T3228 |
pobj |
%,in |
| R1942 |
T3232 |
T3231 |
prep |
of,% |
| R1943 |
T3233 |
T3234 |
compound |
joint,cells |
| R1944 |
T3234 |
T3232 |
pobj |
cells,of |
| R1945 |
T3235 |
T3223 |
auxpass |
is,achieved |
| R1946 |
T3236 |
T3223 |
neg |
not,achieved |
| R1947 |
T3237 |
T3223 |
prep |
until,achieved |
| R1948 |
T3238 |
T3239 |
det |
the,stage |
| R1949 |
T3239 |
T3237 |
pobj |
stage,until |
| R1950 |
T3240 |
T3241 |
nummod |
three,layer |
| R1951 |
T3241 |
T3239 |
compound |
layer,stage |
| R1952 |
T3242 |
T3241 |
punct |
-,layer |
| R1953 |
T3243 |
T3239 |
compound |
interzone,stage |
| R1954 |
T3244 |
T3245 |
punct |
(,for |
| R1955 |
T3245 |
T3223 |
parataxis |
for,achieved |
| R1956 |
T3246 |
T3245 |
pobj |
example,for |
| R1957 |
T3247 |
T3245 |
punct |
", ",for |
| R1958 |
T3248 |
T3245 |
conj |
in,for |
| R1959 |
T3249 |
T3250 |
det |
the,joint |
| R1960 |
T3250 |
T3248 |
pobj |
joint,in |
| R1961 |
T3251 |
T3250 |
compound |
knee,joint |
| R1962 |
T3252 |
T3250 |
prep |
at,joint |
| R1963 |
T3253 |
T3252 |
pobj |
E14.5,at |
| R1964 |
T3254 |
T3248 |
cc |
or,in |
| R1965 |
T3255 |
T3248 |
conj |
in,in |
| R1966 |
T3256 |
T3255 |
pobj |
any,in |
| R1967 |
T3257 |
T3256 |
prep |
of,any |
| R1968 |
T3258 |
T3259 |
det |
the,joints |
| R1969 |
T3259 |
T3257 |
pobj |
joints,of |
| R1970 |
T3260 |
T3259 |
amod |
phalangeal,joints |
| R1971 |
T3261 |
T3256 |
prep |
at,any |
| R1972 |
T3262 |
T3261 |
pobj |
E16.5,at |
| R1973 |
T3263 |
T3264 |
punct |
(,data |
| R1974 |
T3264 |
T3223 |
meta |
data,achieved |
| R1975 |
T3265 |
T3264 |
amod |
unpublished,data |
| R1976 |
T3266 |
T3264 |
punct |
),data |
| R1977 |
T3267 |
T3223 |
punct |
.,achieved |
| R1978 |
T3269 |
T3270 |
prep |
Within,remains |
| R1979 |
T3271 |
T3272 |
det |
the,skeleton |
| R1980 |
T3272 |
T3269 |
pobj |
skeleton,Within |
| R1981 |
T3273 |
T3272 |
amod |
developing,skeleton |
| R1982 |
T3274 |
T3270 |
punct |
", ",remains |
| R1983 |
T3275 |
T3276 |
npadvmod |
Cre,mediated |
| R1984 |
T3276 |
T3278 |
amod |
mediated,expression |
| R1985 |
T3277 |
T3276 |
punct |
-,mediated |
| R1986 |
T3278 |
T3270 |
nsubj |
expression,remains |
| R1987 |
T3279 |
T3278 |
prep |
of,expression |
| R1988 |
T3280 |
T3279 |
pobj |
LACZ,of |
| R1989 |
T3281 |
T3282 |
advmod |
strikingly,specific |
| R1990 |
T3282 |
T3270 |
oprd |
specific,remains |
| R1991 |
T3283 |
T3282 |
prep |
to,specific |
| R1992 |
T3284 |
T3283 |
pobj |
joints,to |
| R1993 |
T3285 |
T3270 |
prep |
throughout,remains |
| R1994 |
T3286 |
T3285 |
pobj |
development,throughout |
| R1995 |
T3287 |
T3270 |
punct |
.,remains |
| R1996 |
T3289 |
T3290 |
advmod |
Furthermore,seen |
| R1997 |
T3291 |
T3290 |
punct |
", ",seen |
| R1998 |
T3292 |
T3290 |
nsubjpass |
it,seen |
| R1999 |
T3293 |
T3290 |
auxpass |
is,seen |
| R2000 |
T3294 |
T3290 |
prep |
in,seen |
| R2001 |
T3295 |
T3296 |
predet |
all,structures |
| R2002 |
T3296 |
T3294 |
pobj |
structures,in |
| R2003 |
T3297 |
T3296 |
det |
the,structures |
| R2004 |
T3298 |
T3296 |
prep |
of,structures |
| R2005 |
T3299 |
T3300 |
amod |
postnatal,joints |
| R2006 |
T3300 |
T3298 |
pobj |
joints,of |
| R2007 |
T3301 |
T3300 |
amod |
synovial,joints |
| R2008 |
T3302 |
T3296 |
prep |
including,structures |
| R2009 |
T3303 |
T3304 |
det |
the,cartilage |
| R2010 |
T3304 |
T3302 |
pobj |
cartilage,including |
| R2011 |
T3305 |
T3304 |
amod |
articular,cartilage |
| R2012 |
T3306 |
T3304 |
punct |
", ",cartilage |
| R2013 |
T3307 |
T3308 |
compound |
joint,capsule |
| R2014 |
T3308 |
T3304 |
conj |
capsule,cartilage |
| R2015 |
T3309 |
T3308 |
punct |
", ",capsule |
| R2016 |
T3310 |
T3308 |
cc |
and,capsule |
| R2017 |
T3311 |
T3312 |
amod |
synovial,membrane |
| R2018 |
T3312 |
T3308 |
conj |
membrane,capsule |
| R2019 |
T3313 |
T3314 |
punct |
(,Figure |
| R2020 |
T3314 |
T3290 |
parataxis |
Figure,seen |
| R2021 |
T3315 |
T3314 |
nummod |
1D,Figure |
| R2022 |
T3316 |
T3314 |
cc |
and,Figure |
| R2023 |
T3317 |
T3314 |
conj |
1E,Figure |
| R2024 |
T3318 |
T3314 |
punct |
),Figure |
| R2025 |
T3319 |
T3320 |
punct |
(,data |
| R2026 |
T3320 |
T3290 |
meta |
data,seen |
| R2027 |
T3321 |
T3320 |
amod |
unpublished,data |
| R2028 |
T3322 |
T3320 |
punct |
),data |
| R2029 |
T3323 |
T3290 |
punct |
.,seen |
| R2030 |
T3325 |
T3326 |
det |
These,patterns |
| R2031 |
T3326 |
T3327 |
nsubj |
patterns,are |
| R2032 |
T3328 |
T3327 |
acomp |
consistent,are |
| R2033 |
T3329 |
T3328 |
prep |
with,consistent |
| R2034 |
T3330 |
T3331 |
det |
the,expression |
| R2035 |
T3331 |
T3329 |
pobj |
expression,with |
| R2036 |
T3332 |
T3333 |
advmod |
well,established |
| R2037 |
T3333 |
T3331 |
amod |
established,expression |
| R2038 |
T3334 |
T3333 |
punct |
-,established |
| R2039 |
T3335 |
T3331 |
prep |
of,expression |
| R2040 |
T3336 |
T3335 |
pobj |
Gdf5,of |
| R2041 |
T3337 |
T3331 |
prep |
in,expression |
| R2042 |
T3338 |
T3339 |
compound |
interzone,regions |
| R2043 |
T3339 |
T3337 |
pobj |
regions,in |
| R2044 |
T3340 |
T3331 |
prep |
during,expression |
| R2045 |
T3341 |
T3342 |
amod |
embryonic,development |
| R2046 |
T3342 |
T3340 |
pobj |
development,during |
| R2047 |
T3343 |
T3344 |
punct |
(,Storm |
| R2048 |
T3344 |
T3327 |
meta |
Storm,are |
| R2049 |
T3345 |
T3344 |
cc |
and,Storm |
| R2050 |
T3346 |
T3344 |
conj |
Kingsley,Storm |
| R2051 |
T3347 |
T3346 |
nummod |
1996,Kingsley |
| R2052 |
T3348 |
T3346 |
punct |
),Kingsley |
| R2053 |
T3349 |
T3327 |
punct |
.,are |
| R2054 |
T3351 |
T3352 |
compound |
Adult,patterns |
| R2055 |
T3352 |
T3354 |
nsubj |
patterns,are |
| R2056 |
T3353 |
T3352 |
compound |
expression,patterns |
| R2057 |
T3355 |
T3352 |
prep |
of,patterns |
| R2058 |
T3356 |
T3357 |
det |
the,gene |
| R2059 |
T3357 |
T3355 |
pobj |
gene,of |
| R2060 |
T3358 |
T3357 |
compound |
Gdf5,gene |
| R2061 |
T3359 |
T3354 |
neg |
not,are |
| R2062 |
T3360 |
T3361 |
advmod |
as,characterized |
| R2063 |
T3361 |
T3354 |
acomp |
characterized,are |
| R2064 |
T3362 |
T3361 |
advmod |
well,characterized |
| R2065 |
T3363 |
T3354 |
punct |
", ",are |
| R2066 |
T3364 |
T3354 |
cc |
but,are |
| R2067 |
T3365 |
T3366 |
compound |
Gdf5,expression |
| R2068 |
T3366 |
T3367 |
nsubjpass |
expression,detected |
| R2069 |
T3367 |
T3354 |
conj |
detected,are |
| R2070 |
T3368 |
T3367 |
aux |
has,detected |
| R2071 |
T3369 |
T3367 |
advmod |
previously,detected |
| R2072 |
T3370 |
T3367 |
auxpass |
been,detected |
| R2073 |
T3371 |
T3367 |
prep |
in,detected |
| R2074 |
T3372 |
T3373 |
nmod |
adult,cartilage |
| R2075 |
T3479 |
T3480 |
prep |
At,expressed |
| R2076 |
T3481 |
T3479 |
pobj |
birth,At |
| R2077 |
T3482 |
T3480 |
punct |
", ",expressed |
| R2078 |
T3483 |
T3480 |
nsubjpass |
LACZ,expressed |
| R2079 |
T3484 |
T3480 |
auxpass |
is,expressed |
| R2080 |
T3373 |
T3371 |
pobj |
cartilage,in |
| R2081 |
T3485 |
T3480 |
advmod |
also,expressed |
| R2082 |
T3374 |
T3373 |
amod |
articular,cartilage |
| R2083 |
T3486 |
T3480 |
prep |
in,expressed |
| R2084 |
T3375 |
T3367 |
advcl |
using,detected |
| R2085 |
T3376 |
T3377 |
preconj |
both,PCR |
| R2086 |
T3377 |
T3375 |
dobj |
PCR,using |
| R2087 |
T3378 |
T3377 |
compound |
RT,PCR |
| R2088 |
T3379 |
T3377 |
punct |
-,PCR |
| R2089 |
T3487 |
T3486 |
pobj |
tendons,in |
| R2090 |
T3380 |
T3377 |
cc |
and,PCR |
| R2091 |
T3381 |
T3377 |
conj |
immunocytochemistry,PCR |
| R2092 |
T3382 |
T3383 |
punct |
(,Chang |
| R2093 |
T3383 |
T3367 |
meta |
Chang,detected |
| R2094 |
T3384 |
T3383 |
nmod |
et,Chang |
| R2095 |
T3488 |
T3487 |
acl |
running,tendons |
| R2096 |
T3385 |
T3383 |
nmod |
al.,Chang |
| R2097 |
T3386 |
T3383 |
nummod |
1994,Chang |
| R2098 |
T3387 |
T3383 |
punct |
;,Chang |
| R2099 |
T3489 |
T3488 |
prep |
along,running |
| R2100 |
T3388 |
T3383 |
nmod |
Erlacher,Chang |
| R2101 |
T3490 |
T3491 |
det |
the,column |
| R2102 |
T3491 |
T3489 |
pobj |
column,along |
| R2103 |
T3389 |
T3383 |
nmod |
et,Chang |
| R2104 |
T3390 |
T3383 |
nmod |
al.,Chang |
| R2105 |
T3391 |
T3383 |
nummod |
1998,Chang |
| R2106 |
T3492 |
T3491 |
amod |
vertebral,column |
| R2107 |
T3392 |
T3383 |
punct |
;,Chang |
| R2108 |
T3393 |
T3383 |
nmod |
Bobacz,Chang |
| R2109 |
T3493 |
T3487 |
punct |
", ",tendons |
| R2110 |
T3394 |
T3383 |
nmod |
et,Chang |
| R2111 |
T3395 |
T3383 |
nmod |
al.,Chang |
| R2112 |
T3396 |
T3383 |
nummod |
2002,Chang |
| R2113 |
T3494 |
T3487 |
conj |
regions,tendons |
| R2114 |
T3397 |
T3383 |
punct |
),Chang |
| R2115 |
T3398 |
T3367 |
punct |
.,detected |
| R2116 |
T3495 |
T3494 |
prep |
of,regions |
| R2117 |
T3400 |
T3401 |
amod |
Other,sites |
| R2118 |
T3496 |
T3495 |
pobj |
tendons,of |
| R2119 |
T3401 |
T3402 |
nsubj |
sites,have |
| R2120 |
T3497 |
T3494 |
prep |
in,regions |
| R2121 |
T3403 |
T3401 |
prep |
besides,sites |
| R2122 |
T3404 |
T3405 |
compound |
limb,joints |
| R2123 |
T3498 |
T3499 |
det |
the,wrist |
| R2124 |
T3405 |
T3403 |
pobj |
joints,besides |
| R2125 |
T3406 |
T3402 |
advmod |
also,have |
| R2126 |
T3407 |
T3408 |
npadvmod |
Cre,mediated |
| R2127 |
T3408 |
T3410 |
amod |
mediated,expression |
| R2128 |
T3499 |
T3497 |
pobj |
wrist,in |
| R2129 |
T3409 |
T3408 |
punct |
-,mediated |
| R2130 |
T3410 |
T3402 |
dobj |
expression,have |
| R2131 |
T3411 |
T3410 |
compound |
lacZ,expression |
| R2132 |
T3500 |
T3499 |
cc |
and,wrist |
| R2133 |
T3412 |
T3402 |
punct |
.,have |
| R2134 |
T3414 |
T3415 |
advcl |
Starting,detected |
| R2135 |
T3501 |
T3499 |
conj |
ankle,wrist |
| R2136 |
T3416 |
T3414 |
prep |
at,Starting |
| R2137 |
T3502 |
T3494 |
punct |
", ",regions |
| R2138 |
T3417 |
T3416 |
pobj |
E13.5,at |
| R2139 |
T3418 |
T3415 |
punct |
", ",detected |
| R2140 |
T3419 |
T3420 |
compound |
LACZ,activity |
| R2141 |
T3420 |
T3415 |
nsubjpass |
activity,detected |
| R2142 |
T3421 |
T3415 |
auxpass |
is,detected |
| R2143 |
T3422 |
T3415 |
prep |
in,detected |
| R2144 |
T3423 |
T3424 |
det |
an,domain |
| R2145 |
T3503 |
T3494 |
cc |
and,regions |
| R2146 |
T3424 |
T3422 |
pobj |
domain,in |
| R2147 |
T3425 |
T3424 |
amod |
anterior,domain |
| R2148 |
T3426 |
T3425 |
cc |
and,anterior |
| R2149 |
T3427 |
T3425 |
conj |
posterior,anterior |
| R2150 |
T3504 |
T3505 |
det |
some,insertions |
| R2151 |
T3428 |
T3424 |
prep |
of,domain |
| R2152 |
T3429 |
T3430 |
det |
the,bud |
| R2153 |
T3505 |
T3494 |
conj |
insertions,regions |
| R2154 |
T3430 |
T3428 |
pobj |
bud,of |
| R2155 |
T3431 |
T3430 |
compound |
limb,bud |
| R2156 |
T3432 |
T3433 |
punct |
(,Figure |
| R2157 |
T3506 |
T3505 |
compound |
tendon,insertions |
| R2158 |
T3433 |
T3415 |
parataxis |
Figure,detected |
| R2159 |
T3434 |
T3433 |
nummod |
2C,Figure |
| R2160 |
T3435 |
T3433 |
punct |
),Figure |
| R2161 |
T3507 |
T3508 |
punct |
(,Figure |
| R2162 |
T3436 |
T3415 |
punct |
.,detected |
| R2163 |
T3438 |
T3439 |
prep |
At,is |
| R2164 |
T3508 |
T3480 |
parataxis |
Figure,expressed |
| R2165 |
T3440 |
T3438 |
pobj |
E14.5,At |
| R2166 |
T3441 |
T3439 |
punct |
", ",is |
| R2167 |
T3509 |
T3508 |
nummod |
1D,Figure |
| R2168 |
T3442 |
T3443 |
compound |
LACZ,activity |
| R2169 |
T3443 |
T3439 |
nsubj |
activity,is |
| R2170 |
T3510 |
T3508 |
punct |
),Figure |
| R2171 |
T3444 |
T3439 |
acomp |
detectable,is |
| R2172 |
T3445 |
T3439 |
prep |
in,is |
| R2173 |
T3446 |
T3447 |
det |
the,pinnae |
| R2174 |
T3511 |
T3512 |
punct |
(,data |
| R2175 |
T3447 |
T3445 |
pobj |
pinnae,in |
| R2176 |
T3448 |
T3447 |
amod |
developing,pinnae |
| R2177 |
T3449 |
T3447 |
compound |
ear,pinnae |
| R2178 |
T3512 |
T3480 |
meta |
data,expressed |
| R2179 |
T3450 |
T3447 |
punct |
", ",pinnae |
| R2180 |
T3451 |
T3447 |
appos |
ribs,pinnae |
| R2181 |
T3513 |
T3512 |
amod |
unpublished,data |
| R2182 |
T3452 |
T3447 |
punct |
", ",pinnae |
| R2183 |
T3453 |
T3447 |
appos |
sternum,pinnae |
| R2184 |
T3454 |
T3447 |
punct |
", ",pinnae |
| R2185 |
T3514 |
T3512 |
punct |
),data |
| R2186 |
T3455 |
T3447 |
appos |
tissues,pinnae |
| R2187 |
T3456 |
T3439 |
prep |
in,is |
| R2188 |
T3457 |
T3458 |
det |
the,face |
| R2189 |
T3515 |
T3480 |
punct |
.,expressed |
| R2190 |
T3458 |
T3456 |
pobj |
face,in |
| R2191 |
T3459 |
T3458 |
punct |
", ",face |
| R2192 |
T3460 |
T3458 |
cc |
and,face |
| R2193 |
T3461 |
T3462 |
det |
some,regions |
| R2194 |
T3462 |
T3458 |
conj |
regions,face |
| R2195 |
T3463 |
T3462 |
prep |
of,regions |
| R2196 |
T3517 |
T3518 |
prep |
By,expressed |
| R2197 |
T3464 |
T3465 |
det |
the,brain |
| R2198 |
T3465 |
T3463 |
pobj |
brain,of |
| R2199 |
T3466 |
T3465 |
cc |
and,brain |
| R2200 |
T3467 |
T3468 |
amod |
spinal,cord |
| R2201 |
T3468 |
T3465 |
conj |
cord,brain |
| R2202 |
T3519 |
T3520 |
nummod |
5,wk |
| R2203 |
T3469 |
T3470 |
punct |
(,Figure |
| R2204 |
T3470 |
T3439 |
parataxis |
Figure,is |
| R2205 |
T3471 |
T3470 |
nummod |
1B,Figure |
| R2206 |
T3472 |
T3470 |
punct |
),Figure |
| R2207 |
T3473 |
T3474 |
punct |
(,data |
| R2208 |
T3520 |
T3517 |
pobj |
wk,By |
| R2209 |
T3474 |
T3439 |
meta |
data,is |
| R2210 |
T3475 |
T3474 |
amod |
unpublished,data |
| R2211 |
T3521 |
T3520 |
prep |
of,wk |
| R2212 |
T3476 |
T3474 |
punct |
),data |
| R2213 |
T3522 |
T3521 |
pobj |
age,of |
| R2214 |
T3477 |
T3439 |
punct |
.,is |
| R2215 |
T3523 |
T3518 |
punct |
", ",expressed |
| R2216 |
T3524 |
T3518 |
nsubjpass |
LACZ,expressed |
| R2217 |
T3525 |
T3518 |
auxpass |
is,expressed |
| R2218 |
T3526 |
T3518 |
advmod |
also,expressed |
| R2219 |
T3527 |
T3518 |
prep |
in,expressed |
| R2220 |
T3528 |
T3529 |
det |
the,follicles |
| R2221 |
T3529 |
T3527 |
pobj |
follicles,in |
| R2222 |
T3530 |
T3529 |
compound |
hair,follicles |
| R2223 |
T3585 |
T3586 |
dep |
which,extend |
| R2224 |
T3531 |
T3529 |
punct |
", ",follicles |
| R2225 |
T3586 |
T3579 |
relcl |
extend,expression |
| R2226 |
T3587 |
T3586 |
aux |
can,extend |
| R2227 |
T3588 |
T3586 |
prep |
throughout,extend |
| R2228 |
T3532 |
T3533 |
compound |
ear,cartilage |
| R2229 |
T3589 |
T3590 |
amod |
many,tissues |
| R2230 |
T3590 |
T3588 |
pobj |
tissues,throughout |
| R2231 |
T3591 |
T3590 |
amod |
different,tissues |
| R2232 |
T3533 |
T3529 |
appos |
cartilage,follicles |
| R2233 |
T3592 |
T3590 |
prep |
in,tissues |
| R2234 |
T3593 |
T3594 |
det |
the,animal |
| R2235 |
T3594 |
T3592 |
pobj |
animal,in |
| R2236 |
T3534 |
T3529 |
punct |
", ",follicles |
| R2237 |
T3595 |
T3561 |
punct |
.,show |
| R2238 |
T3535 |
T3536 |
det |
some,cells |
| R2239 |
T3597 |
T3598 |
advmod |
However,is |
| R2240 |
T3599 |
T3598 |
punct |
", ",is |
| R2241 |
T3536 |
T3529 |
conj |
cells,follicles |
| R2242 |
T3600 |
T3601 |
amod |
sustained,expression |
| R2243 |
T3601 |
T3598 |
nsubj |
expression,is |
| R2244 |
T3602 |
T3601 |
prep |
of,expression |
| R2245 |
T3603 |
T3604 |
det |
the,transgene |
| R2246 |
T3604 |
T3602 |
pobj |
transgene,of |
| R2247 |
T3605 |
T3604 |
appos |
itself,transgene |
| R2248 |
T3537 |
T3536 |
prep |
in,cells |
| R2249 |
T3606 |
T3598 |
punct |
", ",is |
| R2250 |
T3607 |
T3608 |
mark |
as,assayed |
| R2251 |
T3608 |
T3598 |
advcl |
assayed,is |
| R2252 |
T3538 |
T3539 |
det |
the,plate |
| R2253 |
T3609 |
T3608 |
prep |
by,assayed |
| R2254 |
T3610 |
T3611 |
compound |
HPLAP,activity |
| R2255 |
T3611 |
T3609 |
pobj |
activity,by |
| R2256 |
T3539 |
T3537 |
pobj |
plate,in |
| R2257 |
T3612 |
T3598 |
punct |
", ",is |
| R2258 |
T3613 |
T3598 |
advmod |
still,is |
| R2259 |
T3614 |
T3598 |
acomp |
restricted,is |
| R2260 |
T3540 |
T3539 |
compound |
growth,plate |
| R2261 |
T3615 |
T3616 |
advmod |
primarily,to |
| R2262 |
T3616 |
T3614 |
prep |
to,restricted |
| R2263 |
T3617 |
T3616 |
pobj |
joints,to |
| R2264 |
T3541 |
T3539 |
prep |
of,plate |
| R2265 |
T3618 |
T3617 |
prep |
in,joints |
| R2266 |
T3619 |
T3618 |
pobj |
animals,in |
| R2267 |
T3620 |
T3621 |
dep |
that,show |
| R2268 |
T3542 |
T3543 |
det |
the,bones |
| R2269 |
T3621 |
T3619 |
relcl |
show,animals |
| R2270 |
T3622 |
T3621 |
dobj |
evidence,show |
| R2271 |
T3623 |
T3622 |
prep |
of,evidence |
| R2272 |
T3543 |
T3541 |
pobj |
bones,of |
| R2273 |
T3624 |
T3625 |
advmod |
more,generalized |
| R2274 |
T3625 |
T3626 |
amod |
generalized,recombination |
| R2275 |
T3626 |
T3623 |
pobj |
recombination,of |
| R2276 |
T3544 |
T3543 |
amod |
long,bones |
| R2277 |
T3627 |
T3621 |
prep |
based,show |
| R2278 |
T3628 |
T3627 |
prep |
on,based |
| R2279 |
T3629 |
T3630 |
compound |
LACZ,expression |
| R2280 |
T3545 |
T3536 |
punct |
", ",cells |
| R2281 |
T3630 |
T3628 |
pobj |
expression,on |
| R2282 |
T3631 |
T3632 |
punct |
(,data |
| R2283 |
T3632 |
T3598 |
meta |
data,is |
| R2284 |
T3546 |
T3536 |
cc |
and,cells |
| R2285 |
T3633 |
T3632 |
amod |
unpublished,data |
| R2286 |
T3634 |
T3632 |
punct |
),data |
| R2287 |
T3635 |
T3598 |
punct |
.,is |
| R2288 |
T3547 |
T3536 |
conj |
portions,cells |
| R2289 |
T3637 |
T3638 |
nsubj |
This,suggests |
| R2290 |
T3548 |
T3547 |
prep |
of,portions |
| R2291 |
T3639 |
T3640 |
mark |
that,is |
| R2292 |
T3549 |
T3550 |
det |
the,brain |
| R2293 |
T3550 |
T3548 |
pobj |
brain,of |
| R2294 |
T3640 |
T3638 |
ccomp |
is,suggests |
| R2295 |
T3641 |
T3640 |
prep |
in,is |
| R2296 |
T3642 |
T3643 |
det |
a,fraction |
| R2297 |
T3643 |
T3641 |
pobj |
fraction,in |
| R2298 |
T3644 |
T3643 |
prep |
of,fraction |
| R2299 |
T3551 |
T3550 |
cc |
and,brain |
| R2300 |
T3645 |
T3644 |
pobj |
animals,of |
| R2301 |
T3646 |
T3640 |
punct |
", ",is |
| R2302 |
T3647 |
T3648 |
amod |
sporadic,expression |
| R2303 |
T3552 |
T3553 |
amod |
spinal,cord |
| R2304 |
T3648 |
T3640 |
nsubj |
expression,is |
| R2305 |
T3649 |
T3648 |
prep |
of,expression |
| R2306 |
T3650 |
T3649 |
pobj |
Cre,of |
| R2307 |
T3553 |
T3550 |
conj |
cord,brain |
| R2311 |
T3554 |
T3555 |
punct |
(,data |
| R2312 |
T3654 |
T3653 |
advmod |
early,time |
| R2313 |
T3655 |
T3654 |
prep |
in,early |
| R2314 |
T3656 |
T3655 |
pobj |
development,in |
| R2315 |
T3555 |
T3547 |
meta |
data,portions |
| R2316 |
T3657 |
T3640 |
acomp |
sufficient,is |
| R2317 |
T3658 |
T3659 |
aux |
to,lead |
| R2318 |
T3556 |
T3555 |
amod |
unpublished,data |
| R2319 |
T3659 |
T3657 |
xcomp |
lead,sufficient |
| R2320 |
T3660 |
T3659 |
prep |
to,lead |
| R2321 |
T3661 |
T3662 |
preconj |
both,recombination |
| R2322 |
T3557 |
T3555 |
punct |
),data |
| R2323 |
T3662 |
T3660 |
pobj |
recombination,to |
| R2324 |
T3663 |
T3662 |
amod |
ectopic,recombination |
| R2325 |
T3664 |
T3662 |
cc |
and,recombination |
| R2326 |
T3558 |
T3518 |
punct |
.,expressed |
| R2327 |
T3665 |
T3666 |
compound |
LACZ,expression |
| R2328 |
T3666 |
T3662 |
conj |
expression,recombination |
| R2329 |
T3667 |
T3638 |
punct |
.,suggests |
| R2330 |
T3560 |
T3561 |
advmod |
Surprisingly,show |
| R2331 |
T3669 |
T3670 |
mark |
While,tracked |
| R2332 |
T3670 |
T3681 |
advcl |
tracked,offer |
| R2333 |
T3671 |
T3672 |
det |
the,fraction |
| R2334 |
T3562 |
T3561 |
punct |
", ",show |
| R2335 |
T3672 |
T3670 |
nsubj |
fraction,tracked |
| R2336 |
T3673 |
T3672 |
prep |
of,fraction |
| R2337 |
T3674 |
T3673 |
pobj |
animals,of |
| R2338 |
T3563 |
T3564 |
quantmod |
23,63 |
| R2339 |
T3675 |
T3674 |
prep |
with,animals |
| R2340 |
T3676 |
T3677 |
amod |
broader,patterns |
| R2341 |
T3677 |
T3675 |
pobj |
patterns,with |
| R2342 |
T3564 |
T3561 |
nsubj |
63,show |
| R2343 |
T3678 |
T3677 |
compound |
recombination,patterns |
| R2344 |
T3679 |
T3670 |
aux |
must,tracked |
| R2345 |
T3680 |
T3670 |
aux |
be,tracked |
| R2346 |
T3682 |
T3670 |
cc |
and,tracked |
| R2347 |
T3683 |
T3670 |
conj |
accounted,tracked |
| R2348 |
T3565 |
T3564 |
quantmod |
of,63 |
| R2349 |
T3684 |
T3683 |
prep |
for,accounted |
| R2350 |
T3685 |
T3670 |
prep |
during,tracked |
| R2351 |
T3686 |
T3685 |
pobj |
experiments,during |
| R2352 |
T3566 |
T3564 |
punct |
", ",63 |
| R2353 |
T3687 |
T3681 |
punct |
", ",offer |
| R2354 |
T3688 |
T3689 |
det |
these,animals |
| R2355 |
T3689 |
T3681 |
nsubj |
animals,offer |
| R2356 |
T3567 |
T3564 |
cc |
or,63 |
| R2357 |
T3690 |
T3691 |
det |
the,benefit |
| R2358 |
T3568 |
T3569 |
nummod |
37,% |
| R2359 |
T3569 |
T3564 |
conj |
%,63 |
| R2360 |
T3691 |
T3681 |
dobj |
benefit,offer |
| R2361 |
T3570 |
T3564 |
prep |
of,63 |
| R2362 |
T3692 |
T3691 |
amod |
potential,benefit |
| R2363 |
T3693 |
T3691 |
prep |
of,benefit |
| R2364 |
T3694 |
T3693 |
pcomp |
revealing,of |
| R2365 |
T3571 |
T3572 |
amod |
transgenic,mice |
| R2366 |
T3695 |
T3696 |
amod |
additional,functions |
| R2367 |
T3696 |
T3694 |
dobj |
functions,revealing |
| R2368 |
T3697 |
T3696 |
amod |
new,functions |
| R2369 |
T3572 |
T3570 |
pobj |
mice,of |
| R2370 |
T3698 |
T3696 |
prep |
of,functions |
| R2371 |
T3699 |
T3700 |
compound |
target,genes |
| R2372 |
T3700 |
T3698 |
pobj |
genes,of |
| R2373 |
T3573 |
T3572 |
acl |
analyzed,mice |
| R2374 |
T3701 |
T3702 |
dep |
that,studied |
| R2375 |
T3702 |
T3700 |
relcl |
studied,genes |
| R2376 |
T3703 |
T3702 |
aux |
could,studied |
| R2377 |
T3574 |
T3561 |
advmod |
also,show |
| R2378 |
T3704 |
T3702 |
auxpass |
be,studied |
| R2379 |
T3705 |
T3702 |
advmod |
subsequently,studied |
| R2380 |
T3706 |
T3702 |
prep |
with,studied |
| R2381 |
T3575 |
T3576 |
det |
some,degree |
| R2382 |
T3707 |
T3708 |
amod |
additional,drivers |
| R2383 |
T3708 |
T3706 |
pobj |
drivers,with |
| R2384 |
T3709 |
T3708 |
nmod |
site,drivers |
| R2385 |
T3576 |
T3561 |
dobj |
degree,show |
| R2386 |
T3710 |
T3709 |
punct |
-,site |
| R2387 |
T3711 |
T3709 |
amod |
specific,site |
| R2388 |
T3712 |
T3708 |
compound |
Cre,drivers |
| R2389 |
T3577 |
T3576 |
prep |
of,degree |
| R2390 |
T3713 |
T3681 |
punct |
.,offer |
| R2391 |
T3578 |
T3579 |
amod |
wider,expression |
| R2392 |
T3579 |
T3577 |
pobj |
expression,of |
| R2393 |
T3580 |
T3579 |
punct |
“,expression |
| R2394 |
T3581 |
T3579 |
amod |
ectopic,expression |
| R2395 |
T3582 |
T3579 |
punct |
”,expression |
| R2396 |
T3583 |
T3579 |
compound |
LACZ,expression |
| R2397 |
T3584 |
T3579 |
punct |
", ",expression |
| R2414 |
T3948 |
T3949 |
nmod |
Gdf5,Cre |
| R2415 |
T3949 |
T3951 |
nmod |
Cre,Animals |
| R2416 |
T3950 |
T3949 |
punct |
-,Cre |
| R2417 |
T3951 |
T3954 |
nsubj |
Animals,Survive |
| R2418 |
T3952 |
T3949 |
punct |
/,Cre |
| R2419 |
T3953 |
T3949 |
appos |
Bmpr1afloxP,Cre |
| R2420 |
T3955 |
T3954 |
prep |
to,Survive |
| R2421 |
T3956 |
T3955 |
pobj |
Adulthood,to |
| R2422 |
T3957 |
T3954 |
prep |
with,Survive |
| R2423 |
T3958 |
T3959 |
nmod |
Ear,Defects |
| R2424 |
T3959 |
T3957 |
pobj |
Defects,with |
| R2425 |
T3960 |
T3958 |
punct |
", ",Ear |
| R2426 |
T3961 |
T3958 |
conj |
Webbing,Ear |
| R2427 |
T3962 |
T3961 |
punct |
", ",Webbing |
| R2428 |
T3963 |
T3961 |
cc |
and,Webbing |
| R2429 |
T3964 |
T3961 |
conj |
Joint,Webbing |
| R2430 |
T3966 |
T3967 |
nsubj |
We,used |
| R2431 |
T3968 |
T3967 |
advmod |
next,used |
| R2432 |
T3969 |
T3970 |
det |
the,system |
| R2433 |
T3970 |
T3967 |
dobj |
system,used |
| R2434 |
T3971 |
T3972 |
compound |
Gdf5,Cre |
| R2435 |
T3972 |
T3970 |
compound |
Cre,system |
| R2436 |
T3973 |
T3972 |
punct |
-,Cre |
| R2437 |
T3974 |
T3975 |
aux |
to,test |
| R2438 |
T3975 |
T3967 |
advcl |
test,used |
| R2439 |
T3976 |
T3977 |
det |
the,role |
| R2440 |
T3977 |
T3975 |
dobj |
role,test |
| R2441 |
T3978 |
T3977 |
prep |
of,role |
| R2442 |
T3979 |
T3980 |
compound |
BMP,signaling |
| R2443 |
T3980 |
T3978 |
pobj |
signaling,of |
| R2444 |
T3981 |
T3975 |
prep |
during,test |
| R2445 |
T3982 |
T3983 |
amod |
normal,development |
| R2446 |
T3983 |
T3981 |
pobj |
development,during |
| R2447 |
T3984 |
T3983 |
compound |
joint,development |
| R2448 |
T3985 |
T3967 |
punct |
.,used |
| R2449 |
T3987 |
T3988 |
nmod |
Gdf5,Cre |
| R2450 |
T3988 |
T3990 |
nmod |
Cre,mice |
| R2451 |
T3989 |
T3988 |
punct |
-,Cre |
| R2452 |
T3990 |
T3992 |
nsubjpass |
mice,bred |
| R2453 |
T3991 |
T3990 |
amod |
transgenic,mice |
| R2454 |
T3993 |
T3992 |
auxpass |
were,bred |
| R2455 |
T3994 |
T3992 |
prep |
to,bred |
| R2456 |
T3995 |
T3994 |
pobj |
animals,to |
| R2457 |
T3996 |
T3995 |
acl |
carrying,animals |
| R2458 |
T3997 |
T3998 |
det |
a,allele |
| R2459 |
T3998 |
T3996 |
dobj |
allele,carrying |
| R2460 |
T3999 |
T3998 |
amod |
conditional,allele |
| R2461 |
T4000 |
T3998 |
amod |
floxed,allele |
| R2462 |
T4001 |
T3998 |
prep |
of,allele |
| R2463 |
T4002 |
T4003 |
det |
the,locus |
| R2464 |
T4003 |
T4001 |
pobj |
locus,of |
| R2465 |
T4004 |
T4003 |
compound |
Bmpr1a,locus |
| R2466 |
T4005 |
T4006 |
punct |
(,Mishina |
| R2467 |
T4006 |
T3992 |
meta |
Mishina,bred |
| R2468 |
T4007 |
T4006 |
nmod |
et,Mishina |
| R2469 |
T4008 |
T4006 |
nmod |
al.,Mishina |
| R2470 |
T4009 |
T4006 |
nummod |
2002,Mishina |
| R2471 |
T4010 |
T4006 |
punct |
),Mishina |
| R2472 |
T4011 |
T3992 |
punct |
", ",bred |
| R2473 |
T4012 |
T4013 |
advmod |
usually,in |
| R2474 |
T4013 |
T3992 |
prep |
in,bred |
| R2475 |
T4014 |
T4015 |
det |
the,presence |
| R2476 |
T4015 |
T4013 |
pobj |
presence,in |
| R2477 |
T4016 |
T4015 |
prep |
of,presence |
| R2478 |
T4017 |
T4018 |
det |
the,allele |
| R2479 |
T4018 |
T4016 |
pobj |
allele,of |
| R2480 |
T4019 |
T4020 |
compound |
R26R,reporter |
| R2481 |
T4020 |
T4018 |
compound |
reporter,allele |
| R2482 |
T4021 |
T4022 |
aux |
to,facilitate |
| R2483 |
T4022 |
T3992 |
advcl |
facilitate,bred |
| R2484 |
T4023 |
T4024 |
amod |
simultaneous,visualization |
| R2485 |
T4024 |
T4022 |
dobj |
visualization,facilitate |
| R2486 |
T4025 |
T4024 |
prep |
of,visualization |
| R2487 |
T4026 |
T4027 |
npadvmod |
Cre,mediated |
| R2488 |
T4027 |
T4029 |
amod |
mediated,patterns |
| R2489 |
T4028 |
T4027 |
punct |
-,mediated |
| R2490 |
T4029 |
T4025 |
pobj |
patterns,of |
| R2491 |
T4030 |
T4029 |
compound |
recombination,patterns |
| R2492 |
T4031 |
T4032 |
punct |
(,see |
| R2493 |
T4032 |
T3992 |
parataxis |
see,bred |
| R2494 |
T4033 |
T4034 |
amod |
typical,cross |
| R2495 |
T4034 |
T4032 |
dobj |
cross,see |
| R2496 |
T4035 |
T4032 |
prep |
in,see |
| R2497 |
T4036 |
T4035 |
pobj |
Figure,in |
| R2498 |
T4037 |
T4036 |
nummod |
3,Figure |
| R2499 |
T4038 |
T4032 |
punct |
),see |
| R2500 |
T4039 |
T3992 |
punct |
.,bred |
| R2501 |
T4041 |
T4042 |
compound |
PCR,amplification |
| R2502 |
T4042 |
T4043 |
nsubj |
amplification,confirmed |
| R2503 |
T4044 |
T4045 |
mark |
that,deleted |
| R2504 |
T4045 |
T4043 |
ccomp |
deleted,confirmed |
| R2505 |
T4046 |
T4047 |
det |
a,exon |
| R2506 |
T4047 |
T4045 |
nsubjpass |
exon,deleted |
| R2507 |
T4048 |
T4047 |
amod |
key,exon |
| R2508 |
T4049 |
T4047 |
prep |
of,exon |
| R2509 |
T4050 |
T4051 |
det |
the,gene |
| R2510 |
T4051 |
T4049 |
pobj |
gene,of |
| R2511 |
T4052 |
T4051 |
compound |
Bmpr1a,gene |
| R2512 |
T4053 |
T4045 |
auxpass |
was,deleted |
| R2513 |
T4054 |
T4045 |
prep |
in,deleted |
| R2514 |
T4055 |
T4054 |
pobj |
mice,in |
| R2515 |
T4056 |
T4057 |
dep |
that,carried |
| R2516 |
T4057 |
T4055 |
relcl |
carried,mice |
| R2517 |
T4058 |
T4057 |
advmod |
also,carried |
| R2518 |
T4059 |
T4060 |
det |
the,transgene |
| R2519 |
T4060 |
T4057 |
dobj |
transgene,carried |
| R2520 |
T4061 |
T4062 |
compound |
Gdf5,Cre |
| R2521 |
T4062 |
T4060 |
compound |
Cre,transgene |
| R2522 |
T4063 |
T4062 |
punct |
-,Cre |
| R2523 |
T4064 |
T4065 |
punct |
(,data |
| R2524 |
T4065 |
T4045 |
meta |
data,deleted |
| R2525 |
T4066 |
T4065 |
amod |
unpublished,data |
| R2526 |
T4067 |
T4065 |
punct |
),data |
| R2527 |
T4068 |
T4043 |
punct |
.,confirmed |
| R2528 |
T4070 |
T4071 |
amod |
Previous,studies |
| R2529 |
T4071 |
T4072 |
nsubj |
studies,shown |
| R2530 |
T4073 |
T4072 |
aux |
have,shown |
| R2531 |
T4074 |
T4075 |
mark |
that,mimics |
| R2532 |
T4075 |
T4072 |
ccomp |
mimics,shown |
| R2533 |
T4076 |
T4077 |
det |
the,allele |
| R2534 |
T4077 |
T4075 |
nsubj |
allele,mimics |
| R2535 |
T4078 |
T4077 |
amod |
recombined,allele |
| R2536 |
T4079 |
T4077 |
compound |
Bmpr1afloxP,allele |
| R2537 |
T4080 |
T4081 |
det |
a,allele |
| R2538 |
T4081 |
T4075 |
dobj |
allele,mimics |
| R2539 |
T4082 |
T4081 |
amod |
null,allele |
| R2540 |
T4083 |
T4081 |
prep |
of,allele |
| R2541 |
T4084 |
T4085 |
det |
the,locus |
| R2542 |
T4085 |
T4083 |
pobj |
locus,of |
| R2543 |
T4086 |
T4085 |
compound |
Bmpr1a,locus |
| R2544 |
T4087 |
T4088 |
advmod |
when,transmitted |
| R2545 |
T4088 |
T4075 |
advcl |
transmitted,mimics |
| R2546 |
T4089 |
T4088 |
prep |
through,transmitted |
| R2547 |
T4090 |
T4091 |
det |
the,germline |
| R2548 |
T4091 |
T4089 |
pobj |
germline,through |
| R2549 |
T4092 |
T4093 |
punct |
(,Mishina |
| R2550 |
T4093 |
T4072 |
meta |
Mishina,shown |
| R2551 |
T4094 |
T4093 |
nmod |
et,Mishina |
| R2552 |
T4095 |
T4093 |
nmod |
al.,Mishina |
| R2553 |
T4096 |
T4093 |
nummod |
2002,Mishina |
| R2554 |
T4097 |
T4093 |
punct |
),Mishina |
| R2555 |
T4098 |
T4072 |
punct |
.,shown |
| R2556 |
T4100 |
T4101 |
det |
The,mice |
| R2557 |
T4101 |
T4109 |
nsubj |
mice,were |
| R2558 |
T4102 |
T4103 |
nmod |
Gdf5,Cre |
| R2559 |
T4103 |
T4105 |
nmod |
Cre,Bmpr1afloxP |
| R2560 |
T4104 |
T4103 |
punct |
-,Cre |
| R2561 |
T4105 |
T4107 |
nmod |
Bmpr1afloxP,knockout |
| R2562 |
T4106 |
T4105 |
punct |
/,Bmpr1afloxP |
| R2563 |
T4107 |
T4101 |
compound |
knockout,mice |
| R2564 |
T4108 |
T4107 |
amod |
conditional,knockout |
| R2565 |
T4110 |
T4109 |
acomp |
viable,were |
| R2566 |
T4111 |
T4109 |
cc |
and,were |
| R2567 |
T4112 |
T4109 |
conj |
survived,were |
| R2568 |
T4113 |
T4112 |
prep |
to,survived |
| R2569 |
T4114 |
T4113 |
pobj |
adulthood,to |
| R2570 |
T4115 |
T4109 |
punct |
", ",were |
| R2571 |
T4116 |
T4109 |
advcl |
showing,were |
| R2572 |
T4117 |
T4118 |
mark |
that,bypass |
| R2573 |
T4118 |
T4116 |
ccomp |
bypass,showing |
| R2574 |
T4119 |
T4120 |
det |
the,driver |
| R2575 |
T4120 |
T4118 |
nsubj |
driver,bypass |
| R2576 |
T4121 |
T4122 |
compound |
Gdf5,Cre |
| R2577 |
T4122 |
T4120 |
compound |
Cre,driver |
| R2578 |
T4123 |
T4122 |
punct |
-,Cre |
| R2579 |
T4124 |
T4118 |
aux |
can,bypass |
| R2580 |
T4125 |
T4126 |
det |
the,lethality |
| R2581 |
T4126 |
T4118 |
dobj |
lethality,bypass |
| R2582 |
T4127 |
T4126 |
amod |
early,lethality |
| R2583 |
T4128 |
T4126 |
amod |
embryonic,lethality |
| R2584 |
T4129 |
T4130 |
advmod |
previously,reported |
| R2585 |
T4130 |
T4126 |
acl |
reported,lethality |
| R2586 |
T4131 |
T4130 |
prep |
in,reported |
| R2587 |
T4132 |
T4131 |
pobj |
animals,in |
| R2588 |
T4133 |
T4132 |
prep |
with,animals |
| R2589 |
T4134 |
T4135 |
det |
a,mutation |
| R2590 |
T4135 |
T4133 |
pobj |
mutation,with |
| R2591 |
T4136 |
T4135 |
amod |
null,mutation |
| R2592 |
T4137 |
T4135 |
prep |
in,mutation |
| R2593 |
T4138 |
T4139 |
det |
the,locus |
| R2594 |
T4139 |
T4137 |
pobj |
locus,in |
| R2595 |
T4140 |
T4139 |
compound |
Bmpr1a,locus |
| R2596 |
T4141 |
T4142 |
punct |
(,Mishina |
| R2597 |
T4142 |
T4109 |
meta |
Mishina,were |
| R2598 |
T4143 |
T4142 |
nmod |
et,Mishina |
| R2599 |
T4144 |
T4142 |
nmod |
al.,Mishina |
| R2600 |
T4145 |
T4142 |
nummod |
1995,Mishina |
| R2601 |
T4146 |
T4142 |
punct |
),Mishina |
| R2602 |
T4147 |
T4109 |
punct |
.,were |
| R2603 |
T4149 |
T4150 |
det |
The,mice |
| R2604 |
T4150 |
T4157 |
nsubj |
mice,showed |
| R2605 |
T4151 |
T4150 |
amod |
viable,mice |
| R2606 |
T4152 |
T4153 |
compound |
Gdf5,Cre |
| R2607 |
T4153 |
T4155 |
compound |
Cre,Bmpr1afloxP |
| R2608 |
T4154 |
T4153 |
punct |
-,Cre |
| R2609 |
T4155 |
T4150 |
compound |
Bmpr1afloxP,mice |
| R2610 |
T4156 |
T4155 |
punct |
/,Bmpr1afloxP |
| R2611 |
T4158 |
T4159 |
amod |
several,phenotypes |
| R2612 |
T4159 |
T4157 |
dobj |
phenotypes,showed |
| R2613 |
T4160 |
T4157 |
punct |
.,showed |
| R2614 |
T4162 |
T4163 |
advmod |
First,had |
| R2615 |
T4164 |
T4163 |
punct |
", ",had |
| R2616 |
T4165 |
T4166 |
det |
the,mice |
| R2617 |
T4166 |
T4163 |
nsubj |
mice,had |
| R2618 |
T4167 |
T4166 |
amod |
conditional,mice |
| R2619 |
T4168 |
T4166 |
compound |
knockout,mice |
| R2620 |
T4169 |
T4170 |
amod |
shorter,ears |
| R2621 |
T4170 |
T4163 |
dobj |
ears,had |
| R2622 |
T4171 |
T4172 |
dep |
that,lay |
| R2623 |
T4172 |
T4170 |
relcl |
lay,ears |
| R2624 |
T4173 |
T4172 |
advmod |
often,lay |
| R2625 |
T4174 |
T4172 |
advcl |
flatter,lay |
| R2626 |
T4175 |
T4174 |
prep |
against,flatter |
| R2627 |
T4176 |
T4177 |
poss |
their,heads |
| R2628 |
T4177 |
T4175 |
pobj |
heads,against |
| R2629 |
T4178 |
T4174 |
prep |
than,flatter |
| R2630 |
T4179 |
T4178 |
pobj |
controls,than |
| R2631 |
T4180 |
T4181 |
punct |
(,0.0001 |
| R2632 |
T4181 |
T4163 |
parataxis |
0.0001,had |
| R2633 |
T4182 |
T4183 |
nsubj |
controls,mm |
| R2634 |
T4183 |
T4181 |
dep |
mm,0.0001 |
| R2635 |
T4184 |
T4185 |
quantmod |
13.1,0.1 |
| R2636 |
T4185 |
T4183 |
nummod |
0.1,mm |
| R2637 |
T4186 |
T4185 |
punct |
±,0.1 |
| R2638 |
T4187 |
T4183 |
advmod |
long,mm |
| R2639 |
T4188 |
T4181 |
punct |
", ",0.0001 |
| R2640 |
T4189 |
T4190 |
nsubj |
n,38 |
| R2641 |
T4190 |
T4181 |
ccomp |
38,0.0001 |
| R2642 |
T4191 |
T4190 |
punct |
=,38 |
| R2643 |
T4192 |
T4181 |
punct |
;,0.0001 |
| R2644 |
T4193 |
T4194 |
nsubj |
mutants,mm |
| R2645 |
T4194 |
T4181 |
dep |
mm,0.0001 |
| R2646 |
T4195 |
T4196 |
quantmod |
11.8,0.2 |
| R2647 |
T4196 |
T4194 |
nummod |
0.2,mm |
| R2648 |
T4197 |
T4196 |
punct |
±,0.2 |
| R2649 |
T4198 |
T4181 |
punct |
", ",0.0001 |
| R2650 |
T4199 |
T4200 |
nsubj |
n,11 |
| R2651 |
T4200 |
T4181 |
ccomp |
11,0.0001 |
| R2652 |
T4201 |
T4200 |
punct |
=,11 |
| R2653 |
T4202 |
T4181 |
punct |
;,0.0001 |
| R2654 |
T4203 |
T4181 |
nsubj |
p,0.0001 |
| R2655 |
T4204 |
T4181 |
punct |
<,0.0001 |
| R2656 |
T4205 |
T4181 |
punct |
),0.0001 |
| R2657 |
T4206 |
T4163 |
punct |
.,had |
| R2658 |
T4208 |
T4209 |
compound |
BMP,signaling |
| R2659 |
T4209 |
T4210 |
nsubjpass |
signaling,known |
| R2660 |
T4211 |
T4210 |
auxpass |
is,known |
| R2661 |
T4212 |
T4213 |
aux |
to,required |
| R2662 |
T4213 |
T4210 |
xcomp |
required,known |
| R2663 |
T4214 |
T4213 |
auxpass |
be,required |
| R2664 |
T4215 |
T4213 |
prep |
for,required |
| R2665 |
T4216 |
T4215 |
pobj |
growth,for |
| R2666 |
T4217 |
T4216 |
prep |
of,growth |
| R2667 |
T4218 |
T4219 |
det |
the,ear |
| R2668 |
T4219 |
T4217 |
pobj |
ear,of |
| R2669 |
T4220 |
T4219 |
amod |
external,ear |
| R2670 |
T4221 |
T4219 |
prep |
of,ear |
| R2671 |
T4222 |
T4221 |
pobj |
mice,of |
| R2672 |
T4223 |
T4224 |
punct |
(,Kingsley |
| R2673 |
T4224 |
T4210 |
meta |
Kingsley,known |
| R2674 |
T4225 |
T4224 |
nmod |
et,Kingsley |
| R2675 |
T4226 |
T4224 |
nmod |
al.,Kingsley |
| R2676 |
T4227 |
T4224 |
nummod |
1992,Kingsley |
| R2677 |
T4228 |
T4224 |
punct |
),Kingsley |
| R2678 |
T4229 |
T4210 |
punct |
", ",known |
| R2679 |
T4230 |
T4210 |
cc |
and,known |
| R2680 |
T4231 |
T4232 |
det |
this,phenotype |
| R2681 |
T4232 |
T4233 |
nsubj |
phenotype,reflects |
| R2682 |
T4233 |
T4210 |
conj |
reflects,known |
| R2683 |
T4234 |
T4233 |
advmod |
likely,reflects |
| R2684 |
T4235 |
T4233 |
dobj |
loss,reflects |
| R2685 |
T4236 |
T4235 |
prep |
of,loss |
| R2686 |
T4237 |
T4238 |
compound |
Bmpr1a,function |
| R2687 |
T4238 |
T4236 |
pobj |
function,of |
| R2688 |
T4239 |
T4233 |
prep |
in,reflects |
| R2689 |
T4240 |
T4241 |
det |
the,fraction |
| R2690 |
T4241 |
T4239 |
pobj |
fraction,in |
| R2691 |
T4242 |
T4241 |
prep |
of,fraction |
| R2692 |
T4243 |
T4244 |
compound |
ear,cells |
| R2693 |
T4244 |
T4242 |
pobj |
cells,of |
| R2694 |
T4245 |
T4246 |
dep |
that,express |
| R2695 |
T4246 |
T4241 |
relcl |
express,fraction |
| R2696 |
T4247 |
T4248 |
det |
the,transgene |
| R2697 |
T4248 |
T4246 |
dobj |
transgene,express |
| R2698 |
T4249 |
T4250 |
compound |
Gdf5,Cre |
| R2699 |
T4250 |
T4248 |
compound |
Cre,transgene |
| R2700 |
T4251 |
T4250 |
punct |
-,Cre |
| R2701 |
T4252 |
T4233 |
punct |
.,reflects |
| R2702 |
T4254 |
T4255 |
amod |
Most,mice |
| R2703 |
T4255 |
T4257 |
nsubj |
mice,showed |
| R2704 |
T4256 |
T4255 |
compound |
mutant,mice |
| R2705 |
T4258 |
T4257 |
advmod |
also,showed |
| R2706 |
T4259 |
T4260 |
amod |
soft,tissue |
| R2707 |
T4260 |
T4261 |
compound |
tissue,syndactyly |
| R2708 |
T4261 |
T4257 |
dobj |
syndactyly,showed |
| R2709 |
T4262 |
T4261 |
cc |
or,syndactyly |
| R2710 |
T4263 |
T4261 |
conj |
retention,syndactyly |
| R2711 |
T4264 |
T4263 |
prep |
of,retention |
| R2712 |
T4265 |
T4264 |
pobj |
webbing,of |
| R2713 |
T4266 |
T4265 |
prep |
between,webbing |
| R2714 |
T4267 |
T4268 |
det |
the,digits |
| R2715 |
T4268 |
T4266 |
pobj |
digits,between |
| R2716 |
T4269 |
T4268 |
amod |
first,digits |
| R2717 |
T4270 |
T4269 |
cc |
and,first |
| R2718 |
T4271 |
T4269 |
conj |
second,first |
| R2719 |
T4272 |
T4268 |
prep |
of,digits |
| R2720 |
T4273 |
T4274 |
poss |
their,feet |
| R2721 |
T4274 |
T4272 |
pobj |
feet,of |
| R2722 |
T4275 |
T4261 |
punct |
", ",syndactyly |
| R2723 |
T4276 |
T4277 |
det |
a,phenotype |
| R2724 |
T4277 |
T4261 |
appos |
phenotype,syndactyly |
| R2725 |
T4278 |
T4279 |
dep |
that,was |
| R2726 |
T4279 |
T4277 |
relcl |
was,phenotype |
| R2727 |
T4280 |
T4281 |
advmod |
more,frequent |
| R2728 |
T4281 |
T4279 |
acomp |
frequent,was |
| R2729 |
T4282 |
T4281 |
cc |
and,frequent |
| R2730 |
T4283 |
T4284 |
advmod |
more,severe |
| R2731 |
T4284 |
T4281 |
conj |
severe,frequent |
| R2732 |
T4285 |
T4279 |
prep |
in,was |
| R2733 |
T4286 |
T4287 |
det |
the,forelimbs |
| R2734 |
T4287 |
T4285 |
pobj |
forelimbs,in |
| R2735 |
T4288 |
T4289 |
punct |
(,220 |
| R2736 |
T4289 |
T4279 |
parataxis |
220,was |
| R2737 |
T4290 |
T4289 |
quantmod |
201,220 |
| R2738 |
T4291 |
T4289 |
quantmod |
of,220 |
| R2739 |
T4292 |
T4289 |
punct |
", ",220 |
| R2740 |
T4293 |
T4289 |
cc |
or,220 |
| R2741 |
T4294 |
T4295 |
nummod |
91,% |
| R2742 |
T4295 |
T4289 |
conj |
%,220 |
| R2743 |
T4296 |
T4289 |
punct |
", ",220 |
| R2744 |
T4297 |
T4289 |
prep |
of,220 |
| R2745 |
T4298 |
T4297 |
pobj |
forefeet,of |
| R2746 |
T4299 |
T4289 |
cc |
and,220 |
| R2747 |
T4300 |
T4301 |
quantmod |
109,220 |
| R2748 |
T4301 |
T4289 |
conj |
220,220 |
| R2749 |
T4302 |
T4301 |
quantmod |
of,220 |
| R2750 |
T4303 |
T4301 |
punct |
", ",220 |
| R2751 |
T4304 |
T4301 |
cc |
or,220 |
| R2752 |
T4305 |
T4306 |
nummod |
50,% |
| R2753 |
T4306 |
T4301 |
conj |
%,220 |
| R2754 |
T4307 |
T4301 |
punct |
", ",220 |
| R2755 |
T4308 |
T4301 |
prep |
of,220 |
| R2756 |
T4309 |
T4308 |
pobj |
hindfeet,of |
| R2757 |
T4310 |
T4289 |
punct |
),220 |
| R2758 |
T4311 |
T4257 |
punct |
.,showed |
| R2759 |
T4313 |
T4314 |
advmod |
Finally,showed |
| R2760 |
T4315 |
T4314 |
punct |
", ",showed |
| R2761 |
T4316 |
T4317 |
compound |
mutant,animals |
| R2762 |
T4317 |
T4314 |
nsubj |
animals,showed |
| R2763 |
T4318 |
T4319 |
amod |
obvious,changes |
| R2764 |
T4319 |
T4314 |
dobj |
changes,showed |
| R2765 |
T4320 |
T4319 |
amod |
skeletal,changes |
| R2766 |
T4321 |
T4314 |
prep |
in,showed |
| R2767 |
T4322 |
T4323 |
amod |
whole,mount |
| R2768 |
T4323 |
T4325 |
nmod |
mount,preparations |
| R2769 |
T4324 |
T4323 |
punct |
-,mount |
| R2770 |
T4325 |
T4321 |
pobj |
preparations,in |
| R2771 |
T4326 |
T4325 |
amod |
skeletal,preparations |
| R2772 |
T4327 |
T4314 |
punct |
.,showed |
| R2773 |
T4329 |
T4330 |
prep |
At,seemed |
| R2774 |
T4331 |
T4332 |
det |
some,sites |
| R2775 |
T4332 |
T4329 |
pobj |
sites,At |
| R2776 |
T4333 |
T4332 |
prep |
in,sites |
| R2777 |
T4334 |
T4335 |
det |
the,ankles |
| R2778 |
T4335 |
T4333 |
pobj |
ankles,in |
| R2779 |
T4336 |
T4330 |
punct |
", ",seemed |
| R2780 |
T4337 |
T4330 |
nsubj |
joints,seemed |
| R2781 |
T4338 |
T4339 |
aux |
to,be |
| R2782 |
T4339 |
T4330 |
xcomp |
be,seemed |
| R2783 |
T4340 |
T4339 |
acomp |
missing,be |
| R2784 |
T4341 |
T4339 |
advmod |
entirely,be |
| R2785 |
T4342 |
T4339 |
punct |
", ",be |
| R2786 |
T4343 |
T4339 |
prep |
with,be |
| R2787 |
T4344 |
T4343 |
pobj |
fusion,with |
| R2788 |
T4345 |
T4344 |
prep |
of,fusion |
| R2789 |
T4346 |
T4345 |
pobj |
bones,of |
| R2790 |
T4347 |
T4348 |
dep |
that,be |
| R2791 |
T4348 |
T4346 |
relcl |
be,bones |
| R2792 |
T4349 |
T4348 |
aux |
would,be |
| R2793 |
T4350 |
T4348 |
advmod |
normally,be |
| R2794 |
T4351 |
T4348 |
acomp |
separate,be |
| R2795 |
T4352 |
T4330 |
punct |
.,seemed |
| R2796 |
T4354 |
T4355 |
prep |
For,fused |
| R2797 |
T4356 |
T4354 |
pobj |
example,For |
| R2798 |
T4357 |
T4355 |
punct |
", ",fused |
| R2799 |
T4358 |
T4359 |
det |
the,tarsal |
| R2800 |
T4359 |
T4355 |
nsubjpass |
tarsal,fused |
| R2801 |
T4360 |
T4359 |
amod |
second,tarsal |
| R2802 |
T4361 |
T4359 |
amod |
distal,tarsal |
| R2803 |
T4362 |
T4355 |
auxpass |
was,fused |
| R2804 |
T4363 |
T4355 |
prep |
to,fused |
| R2805 |
T4364 |
T4365 |
det |
the,bone |
| R2806 |
T4365 |
T4363 |
pobj |
bone,to |
| R2807 |
T4366 |
T4365 |
amod |
central,bone |
| R2808 |
T4367 |
T4365 |
amod |
tarsal,bone |
| R2809 |
T4368 |
T4355 |
prep |
in,fused |
| R2810 |
T4369 |
T4370 |
det |
every,animal |
| R2811 |
T4370 |
T4368 |
pobj |
animal,in |
| R2812 |
T4371 |
T4372 |
amod |
conditional,knockout |
| R2813 |
T4372 |
T4370 |
compound |
knockout,animal |
| R2814 |
T4373 |
T4370 |
acl |
examined,animal |
| R2815 |
T4374 |
T4375 |
punct |
(,18 |
| R2816 |
T4375 |
T4370 |
parataxis |
18,animal |
| R2817 |
T4376 |
T4375 |
quantmod |
18,18 |
| R2818 |
T4377 |
T4375 |
quantmod |
of,18 |
| R2819 |
T4378 |
T4375 |
punct |
),18 |
| R2820 |
T4379 |
T4355 |
punct |
", ",fused |
| R2821 |
T4380 |
T4381 |
det |
a,phenotype |
| R2822 |
T4381 |
T4355 |
npadvmod |
phenotype,fused |
| R2823 |
T4382 |
T4383 |
neg |
not,observed |
| R2824 |
T4383 |
T4381 |
acl |
observed,phenotype |
| R2825 |
T4384 |
T4383 |
prep |
in,observed |
| R2826 |
T4385 |
T4384 |
pobj |
controls,in |
| R2827 |
T4386 |
T4387 |
punct |
(,18 |
| R2828 |
T4387 |
T4383 |
parataxis |
18,observed |
| R2829 |
T4388 |
T4387 |
quantmod |
zero,18 |
| R2830 |
T4389 |
T4387 |
quantmod |
of,18 |
| R2831 |
T4390 |
T4387 |
punct |
),18 |
| R2832 |
T4391 |
T4392 |
punct |
(,Figure |
| R2833 |
T4392 |
T4355 |
parataxis |
Figure,fused |
| R2834 |
T4393 |
T4392 |
nummod |
3B,Figure |
| R2835 |
T4394 |
T4392 |
cc |
and,Figure |
| R2836 |
T4395 |
T4392 |
conj |
3C,Figure |
| R2837 |
T4396 |
T4392 |
punct |
),Figure |
| R2838 |
T4397 |
T4355 |
punct |
.,fused |
| R2839 |
T4399 |
T4400 |
prep |
At,formed |
| R2840 |
T4401 |
T4402 |
amod |
other,locations |
| R2841 |
T4402 |
T4399 |
pobj |
locations,At |
| R2842 |
T4403 |
T4400 |
punct |
", ",formed |
| R2843 |
T4404 |
T4400 |
nsubj |
joints,formed |
| R2844 |
T4405 |
T4400 |
aux |
had,formed |
| R2845 |
T4406 |
T4400 |
advmod |
clearly,formed |
| R2846 |
T4407 |
T4400 |
cc |
but,formed |
| R2847 |
T4408 |
T4400 |
conj |
showed,formed |
| R2848 |
T4409 |
T4410 |
amod |
dramatic,loss |
| R2849 |
T4410 |
T4408 |
dobj |
loss,showed |
| R2850 |
T4411 |
T4410 |
prep |
of,loss |
| R2851 |
T4412 |
T4411 |
pobj |
staining,of |
| R2852 |
T4413 |
T4412 |
prep |
with,staining |
| R2853 |
T4414 |
T4415 |
det |
the,marker |
| R2854 |
T4415 |
T4413 |
pobj |
marker,with |
| R2855 |
T4416 |
T4415 |
compound |
cartilage,marker |
| R2856 |
T4417 |
T4415 |
compound |
matrix,marker |
| R2857 |
T4418 |
T4419 |
amod |
Alcian,blue |
| R2858 |
T4419 |
T4415 |
appos |
blue,marker |
| R2859 |
T4420 |
T4421 |
punct |
(,3B |
| R2860 |
T4421 |
T4408 |
parataxis |
3B,showed |
| R2861 |
T4422 |
T4421 |
compound |
Figure,3B |
| R2862 |
T4423 |
T4424 |
punct |
–,3E |
| R2863 |
T4424 |
T4421 |
prep |
3E,3B |
| R2864 |
T4425 |
T4421 |
punct |
),3B |
| R2865 |
T4426 |
T4427 |
punct |
(,data |
| R2866 |
T4427 |
T4408 |
meta |
data,showed |
| R2867 |
T4428 |
T4427 |
amod |
unpublished,data |
| R2868 |
T4429 |
T4427 |
punct |
),data |
| R2869 |
T4430 |
T4400 |
punct |
.,formed |
| R2870 |
T4432 |
T4433 |
amod |
Normal,staining |
| R2871 |
T4433 |
T4436 |
nsubjpass |
staining,seen |
| R2872 |
T4434 |
T4435 |
amod |
Alcian,blue |
| R2873 |
T4435 |
T4433 |
compound |
blue,staining |
| R2874 |
T4437 |
T4436 |
auxpass |
was,seen |
| R2875 |
T4438 |
T4436 |
prep |
in,seen |
| R2876 |
T4439 |
T4440 |
amod |
non-articular,regions |
| R2877 |
T4440 |
T4438 |
pobj |
regions,in |
| R2878 |
T4441 |
T4440 |
punct |
", ",regions |
| R2879 |
T4442 |
T4443 |
amod |
such,as |
| R2880 |
T4443 |
T4440 |
prep |
as,regions |
| R2881 |
T4444 |
T4445 |
det |
the,plate |
| R2882 |
T4445 |
T4443 |
pobj |
plate,as |
| R2883 |
T4446 |
T4445 |
amod |
cartilaginous,plate |
| R2884 |
T4447 |
T4445 |
compound |
growth,plate |
| R2885 |
T4448 |
T4449 |
punct |
(,asterisk |
| R2886 |
T4449 |
T4436 |
parataxis |
asterisk,seen |
| R2887 |
T4450 |
T4451 |
nmod |
Figure,3D |
| R2888 |
T4451 |
T4449 |
dep |
3D,asterisk |
| R2889 |
T4452 |
T4451 |
cc |
and,3D |
| R2890 |
T4453 |
T4451 |
conj |
3E,3D |
| R2891 |
T4454 |
T4449 |
punct |
", ",asterisk |
| R2892 |
T4455 |
T4449 |
punct |
),asterisk |
| R2893 |
T4456 |
T4436 |
punct |
.,seen |
| R2894 |
T4458 |
T4459 |
det |
These,data |
| R2895 |
T4459 |
T4460 |
nsubj |
data,suggest |
| R2896 |
T4461 |
T4462 |
mark |
that,is |
| R2897 |
T4462 |
T4460 |
ccomp |
is,suggest |
| R2898 |
T4463 |
T4464 |
compound |
Bmpr1a,function |
| R2899 |
T4464 |
T4462 |
nsubj |
function,is |
| R2900 |
T4465 |
T4462 |
acomp |
required,is |
| R2901 |
T4466 |
T4462 |
prep |
for,is |
| R2902 |
T4467 |
T4468 |
det |
the,formation |
| R2903 |
T4468 |
T4466 |
pobj |
formation,for |
| R2904 |
T4469 |
T4468 |
prep |
of,formation |
| R2905 |
T4470 |
T4471 |
amod |
specific,joints |
| R2906 |
T4471 |
T4469 |
pobj |
joints,of |
| R2907 |
T4472 |
T4468 |
prep |
in,formation |
| R2908 |
T4473 |
T4474 |
det |
the,region |
| R2909 |
T4474 |
T4472 |
pobj |
region,in |
| R2910 |
T4475 |
T4474 |
compound |
ankle,region |
| R2911 |
T4476 |
T4466 |
cc |
and,for |
| R2912 |
T4477 |
T4466 |
conj |
for,for |
| R2913 |
T4478 |
T4479 |
preconj |
either,generation |
| R2914 |
T4479 |
T4477 |
pobj |
generation,for |
| R2915 |
T4480 |
T4479 |
cc |
or,generation |
| R2916 |
T4481 |
T4479 |
conj |
maintenance,generation |
| R2917 |
T4482 |
T4479 |
prep |
of,generation |
| R2918 |
T4483 |
T4484 |
amod |
articular,cartilage |
| R2919 |
T4484 |
T4482 |
pobj |
cartilage,of |
| R2920 |
T4485 |
T4479 |
prep |
in,generation |
| R2921 |
T4486 |
T4487 |
amod |
most,joints |
| R2922 |
T4487 |
T4485 |
pobj |
joints,in |
| R2923 |
T4488 |
T4487 |
amod |
other,joints |
| R2924 |
T4489 |
T4487 |
prep |
of,joints |
| R2925 |
T4490 |
T4491 |
det |
the,limb |
| R2926 |
T4491 |
T4489 |
pobj |
limb,of |
| R2927 |
T4492 |
T4460 |
punct |
.,suggest |
| R2946 |
T4677 |
T4678 |
amod |
Developmental,Origin |
| R2947 |
T4679 |
T4678 |
prep |
of,Origin |
| R2948 |
T4680 |
T4681 |
compound |
Webbing,Phenotype |
| R2949 |
T4681 |
T4679 |
pobj |
Phenotype,of |
| R2950 |
T4683 |
T4684 |
amod |
Interdigital,mesenchyme |
| R2951 |
T4684 |
T4685 |
nsubjpass |
mesenchyme,eliminated |
| R2952 |
T4686 |
T4685 |
auxpass |
is,eliminated |
| R2953 |
T4687 |
T4685 |
advmod |
normally,eliminated |
| R2954 |
T4688 |
T4685 |
agent |
by,eliminated |
| R2955 |
T4689 |
T4688 |
pobj |
apoptosis,by |
| R2956 |
T4690 |
T4685 |
prep |
during,eliminated |
| R2957 |
T4691 |
T4692 |
amod |
embryonic,development |
| R2958 |
T4692 |
T4690 |
pobj |
development,during |
| R2959 |
T4693 |
T4685 |
punct |
", ",eliminated |
| R2960 |
T4694 |
T4695 |
det |
a,process |
| R2961 |
T4695 |
T4685 |
npadvmod |
process,eliminated |
| R2962 |
T4696 |
T4697 |
dep |
that,stimulated |
| R2963 |
T4697 |
T4695 |
relcl |
stimulated,process |
| R2964 |
T4698 |
T4697 |
aux |
can,stimulated |
| R2965 |
T4699 |
T4697 |
auxpass |
be,stimulated |
| R2966 |
T4700 |
T4697 |
agent |
by,stimulated |
| R2967 |
T4701 |
T4702 |
compound |
BMP,beads |
| R2968 |
T4702 |
T4700 |
pobj |
beads,by |
| R2969 |
T4703 |
T4697 |
punct |
", ",stimulated |
| R2970 |
T4704 |
T4697 |
conj |
inhibited,stimulated |
| R2971 |
T4705 |
T4704 |
agent |
by,inhibited |
| R2972 |
T4706 |
T4705 |
pobj |
Noggin,by |
| R2973 |
T4707 |
T4704 |
punct |
", ",inhibited |
| R2974 |
T4708 |
T4704 |
cc |
or,inhibited |
| R2975 |
T4709 |
T4704 |
conj |
blocked,inhibited |
| R2976 |
T4710 |
T4709 |
agent |
by,blocked |
| R2977 |
T4711 |
T4710 |
pobj |
overexpression,by |
| R2978 |
T4712 |
T4711 |
prep |
of,overexpression |
| R2979 |
T4713 |
T4714 |
amod |
dominant,negative |
| R2980 |
T4714 |
T4716 |
nmod |
negative,receptors |
| R2981 |
T4715 |
T4714 |
punct |
-,negative |
| R2982 |
T4716 |
T4712 |
pobj |
receptors,of |
| R2983 |
T4717 |
T4716 |
compound |
BMP,receptors |
| R2984 |
T4718 |
T4719 |
punct |
(,Garcia |
| R2985 |
T4719 |
T4685 |
meta |
Garcia,eliminated |
| R2986 |
T4720 |
T4719 |
punct |
-,Garcia |
| R2987 |
T4721 |
T4719 |
nmod |
Martinez,Garcia |
| R2988 |
T4722 |
T4719 |
nmod |
et,Garcia |
| R2989 |
T4723 |
T4719 |
nmod |
al.,Garcia |
| R2990 |
T4724 |
T4719 |
nummod |
1993,Garcia |
| R2991 |
T4725 |
T4719 |
punct |
;,Garcia |
| R2992 |
T4726 |
T4719 |
conj |
Yokouchi,Garcia |
| R2993 |
T4727 |
T4726 |
nmod |
et,Yokouchi |
| R2994 |
T4728 |
T4726 |
nmod |
al.,Yokouchi |
| R2995 |
T4729 |
T4726 |
nummod |
1996,Yokouchi |
| R2996 |
T4730 |
T4726 |
punct |
;,Yokouchi |
| R2997 |
T4731 |
T4726 |
conj |
Zou,Yokouchi |
| R2998 |
T4732 |
T4731 |
cc |
and,Zou |
| R2999 |
T4733 |
T4731 |
conj |
Niswander,Zou |
| R3000 |
T4734 |
T4733 |
nummod |
1996,Niswander |
| R3001 |
T4735 |
T4733 |
punct |
;,Niswander |
| R3002 |
T4736 |
T4733 |
conj |
Guha,Niswander |
| R3003 |
T4737 |
T4736 |
nmod |
et,Guha |
| R3004 |
T4738 |
T4736 |
nmod |
al.,Guha |
| R3005 |
T4739 |
T4736 |
nummod |
2002,Guha |
| R3006 |
T4740 |
T4736 |
punct |
),Guha |
| R3007 |
T4741 |
T4685 |
punct |
.,eliminated |
| R3008 |
T4743 |
T4744 |
nsubj |
Limbs,showed |
| R3009 |
T4745 |
T4743 |
prep |
of,Limbs |
| R3010 |
T4746 |
T4747 |
compound |
Gdf5,Cre |
| R3011 |
T4747 |
T4749 |
compound |
Cre,Bmpr1afloxP |
| R3012 |
T4748 |
T4747 |
punct |
-,Cre |
| R3013 |
T4749 |
T4751 |
npadvmod |
Bmpr1afloxP,mutant |
| R3014 |
T4750 |
T4749 |
punct |
/,Bmpr1afloxP |
| R3015 |
T4751 |
T4752 |
amod |
mutant,embryos |
| R3016 |
T4752 |
T4745 |
pobj |
embryos,of |
| R3017 |
T4753 |
T4754 |
amod |
obvious,retention |
| R3018 |
T4754 |
T4744 |
dobj |
retention,showed |
| R3019 |
T4755 |
T4754 |
prep |
of,retention |
| R3020 |
T4756 |
T4757 |
amod |
interdigital,webbing |
| R3021 |
T4757 |
T4755 |
pobj |
webbing,of |
| R3022 |
T4758 |
T4757 |
prep |
between,webbing |
| R3023 |
T4759 |
T4760 |
det |
the,digits |
| R3024 |
T4760 |
T4758 |
pobj |
digits,between |
| R3025 |
T4761 |
T4760 |
amod |
first,digits |
| R3026 |
T4762 |
T4761 |
cc |
and,first |
| R3027 |
T4763 |
T4761 |
conj |
second,first |
| R3028 |
T4764 |
T4761 |
punct |
", ",first |
| R3029 |
T4765 |
T4761 |
cc |
but,first |
| R3030 |
T4766 |
T4765 |
neg |
not,but |
| R3031 |
T4767 |
T4761 |
conj |
other,first |
| R3032 |
T4768 |
T4760 |
punct |
", ",digits |
| R3033 |
T4769 |
T4760 |
prep |
of,digits |
| R3034 |
T4770 |
T4771 |
compound |
E14.5,forelimbs |
| R3035 |
T4771 |
T4769 |
pobj |
forelimbs,of |
| R3036 |
T4772 |
T4773 |
punct |
(,Figure |
| R3037 |
T4773 |
T4760 |
parataxis |
Figure,digits |
| R3038 |
T4774 |
T4773 |
nummod |
2A,Figure |
| R3039 |
T4775 |
T4773 |
cc |
and,Figure |
| R3040 |
T4776 |
T4773 |
conj |
2B,Figure |
| R3041 |
T4777 |
T4773 |
punct |
),Figure |
| R3042 |
T4778 |
T4744 |
punct |
", ",showed |
| R3043 |
T4779 |
T4780 |
det |
a,pattern |
| R3044 |
T4780 |
T4744 |
npadvmod |
pattern,showed |
| R3045 |
T4781 |
T4782 |
dep |
that,corresponds |
| R3046 |
T4782 |
T4780 |
relcl |
corresponds,pattern |
| R3047 |
T4783 |
T4782 |
prep |
to,corresponds |
| R3048 |
T4784 |
T4785 |
det |
the,presence |
| R3049 |
T4785 |
T4783 |
pobj |
presence,to |
| R3050 |
T4786 |
T4785 |
cc |
or,presence |
| R3051 |
T4787 |
T4785 |
conj |
absence,presence |
| R3052 |
T4788 |
T4785 |
prep |
of,presence |
| R3053 |
T4789 |
T4788 |
pobj |
webbing,of |
| R3054 |
T4790 |
T4789 |
acl |
seen,webbing |
| R3055 |
T4791 |
T4790 |
prep |
in,seen |
| R3056 |
T4792 |
T4793 |
det |
the,limb |
| R3057 |
T4793 |
T4791 |
pobj |
limb,in |
| R3058 |
T4794 |
T4793 |
compound |
adult,limb |
| R3059 |
T4795 |
T4744 |
punct |
.,showed |
| R3060 |
T4797 |
T4798 |
nsubj |
They,showed |
| R3061 |
T4799 |
T4798 |
advmod |
also,showed |
| R3062 |
T4800 |
T4801 |
amod |
excess,tissue |
| R3063 |
T4801 |
T4798 |
dobj |
tissue,showed |
| R3064 |
T4802 |
T4798 |
prep |
on,showed |
| R3065 |
T4803 |
T4804 |
det |
the,margin |
| R3066 |
T4804 |
T4802 |
pobj |
margin,on |
| R3067 |
T4805 |
T4804 |
amod |
posterior,margin |
| R3068 |
T4806 |
T4804 |
prep |
of,margin |
| R3069 |
T4807 |
T4808 |
det |
the,digit |
| R3070 |
T4808 |
T4806 |
pobj |
digit,of |
| R3071 |
T4809 |
T4808 |
amod |
fifth,digit |
| R3072 |
T4810 |
T4811 |
punct |
(,arrow |
| R3073 |
T4811 |
T4798 |
parataxis |
arrow,showed |
| R3074 |
T4812 |
T4811 |
dep |
Figure,arrow |
| R3075 |
T4813 |
T4812 |
nummod |
2B,Figure |
| R3076 |
T4814 |
T4811 |
punct |
", ",arrow |
| R3077 |
T4815 |
T4811 |
punct |
),arrow |
| R3078 |
T4816 |
T4798 |
punct |
.,showed |
| R3079 |
T4818 |
T4819 |
nsubj |
Analysis,showed |
| R3080 |
T4820 |
T4818 |
prep |
of,Analysis |
| R3081 |
T4821 |
T4822 |
compound |
LACZ,expression |
| R3082 |
T4822 |
T4820 |
pobj |
expression,of |
| R3083 |
T4823 |
T4818 |
prep |
in,Analysis |
| R3084 |
T4824 |
T4825 |
compound |
Gdf5,Cre |
| R3085 |
T4825 |
T4827 |
compound |
Cre,R26R |
| R3086 |
T4826 |
T4825 |
punct |
-,Cre |
| R3087 |
T4827 |
T4829 |
compound |
R26R,embryos |
| R3088 |
T4828 |
T4827 |
punct |
/,R26R |
| R3089 |
T4829 |
T4823 |
pobj |
embryos,in |
| R3090 |
T4830 |
T4829 |
compound |
reporter,embryos |
| R3091 |
T4831 |
T4832 |
mark |
that,occurred |
| R3092 |
T4832 |
T4819 |
ccomp |
occurred,showed |
| R3093 |
T4833 |
T4834 |
npadvmod |
Cre,mediated |
| R3094 |
T4834 |
T4836 |
amod |
mediated,recombination |
| R3095 |
T4835 |
T4834 |
punct |
-,mediated |
| R3096 |
T4836 |
T4832 |
nsubj |
recombination,occurred |
| R3097 |
T4837 |
T4832 |
aux |
has,occurred |
| R3098 |
T4838 |
T4832 |
prep |
by,occurred |
| R3099 |
T4839 |
T4838 |
pobj |
E13.5,by |
| R3100 |
T4840 |
T4832 |
prep |
in,occurred |
| R3101 |
T4841 |
T4842 |
det |
the,joints |
| R3102 |
T4842 |
T4840 |
pobj |
joints,in |
| R3103 |
T4843 |
T4844 |
amod |
metacarpal,phalangeal |
| R3104 |
T4844 |
T4842 |
amod |
phalangeal,joints |
| R3105 |
T4845 |
T4844 |
punct |
-,phalangeal |
| R3106 |
T4846 |
T4840 |
punct |
", ",in |
| R3107 |
T4847 |
T4840 |
cc |
and,in |
| R3108 |
T4848 |
T4840 |
conj |
in,in |
| R3109 |
T4849 |
T4850 |
det |
the,region |
| R3110 |
T4850 |
T4848 |
pobj |
region,in |
| R3111 |
T4851 |
T4850 |
amod |
interdigital,region |
| R3112 |
T4852 |
T4850 |
prep |
between,region |
| R3113 |
T4853 |
T4854 |
det |
the,digits |
| R3114 |
T4854 |
T4852 |
pobj |
digits,between |
| R3115 |
T4855 |
T4854 |
amod |
first,digits |
| R3116 |
T4856 |
T4855 |
cc |
and,first |
| R3117 |
T4857 |
T4855 |
conj |
second,first |
| R3118 |
T4858 |
T4855 |
punct |
", ",first |
| R3119 |
T4859 |
T4855 |
cc |
but,first |
| R3120 |
T4860 |
T4859 |
neg |
not,but |
| R3121 |
T4861 |
T4855 |
conj |
other,first |
| R3122 |
T4862 |
T4854 |
punct |
", ",digits |
| R3123 |
T4863 |
T4819 |
punct |
.,showed |
| R3124 |
T4865 |
T4866 |
prep |
In,seen |
| R3125 |
T4867 |
T4865 |
pobj |
addition,In |
| R3126 |
T4868 |
T4866 |
punct |
", ",seen |
| R3127 |
T4869 |
T4870 |
det |
a,domain |
| R3128 |
T4870 |
T4866 |
nsubjpass |
domain,seen |
| R3129 |
T4871 |
T4870 |
prep |
of,domain |
| R3130 |
T4872 |
T4871 |
pobj |
recombination,of |
| R3131 |
T4873 |
T4872 |
cc |
and,recombination |
| R3132 |
T4874 |
T4872 |
conj |
expression,recombination |
| R3133 |
T4875 |
T4872 |
prep |
of,recombination |
| R3134 |
T4876 |
T4875 |
pobj |
LACZ,of |
| R3135 |
T4877 |
T4866 |
auxpass |
is,seen |
| R3136 |
T4878 |
T4866 |
advmod |
also,seen |
| R3137 |
T4879 |
T4866 |
advmod |
reproducibly,seen |
| R3138 |
T4880 |
T4866 |
prep |
in,seen |
| R3139 |
T4881 |
T4882 |
det |
the,half |
| R3140 |
T4882 |
T4880 |
pobj |
half,in |
| R3141 |
T4883 |
T4882 |
amod |
posterior,half |
| R3142 |
T4884 |
T4882 |
prep |
of,half |
| R3143 |
T4885 |
T4886 |
det |
the,digit |
| R3144 |
T4886 |
T4884 |
pobj |
digit,of |
| R3145 |
T4887 |
T4886 |
amod |
fifth,digit |
| R3146 |
T4888 |
T4889 |
punct |
(,Figure |
| R3147 |
T4889 |
T4866 |
parataxis |
Figure,seen |
| R3148 |
T4890 |
T4889 |
nummod |
2C,Figure |
| R3149 |
T4891 |
T4889 |
punct |
),Figure |
| R3150 |
T4892 |
T4866 |
punct |
.,seen |
| R3151 |
T4894 |
T4895 |
amod |
Terminal,labeling |
| R3152 |
T4895 |
T4904 |
nmod |
labeling,staining |
| R3153 |
T4896 |
T4897 |
compound |
deoxynucleotidyl,transferase |
| R3154 |
T4897 |
T4898 |
npadvmod |
transferase,mediated |
| R3155 |
T4898 |
T4895 |
amod |
mediated,labeling |
| R3156 |
T4899 |
T4898 |
punct |
–,mediated |
| R3157 |
T4900 |
T4901 |
nmod |
deoxyuridine,triphosphate |
| R3158 |
T4901 |
T4895 |
nmod |
triphosphate,labeling |
| R3159 |
T4902 |
T4903 |
nmod |
nick,end |
| R3160 |
T4903 |
T4895 |
nmod |
end,labeling |
| R3161 |
T4904 |
T4908 |
nsubj |
staining,showed |
| R3162 |
T4905 |
T4906 |
punct |
(,TUNEL |
| R3163 |
T4906 |
T4895 |
appos |
TUNEL,labeling |
| R3164 |
T4907 |
T4906 |
punct |
),TUNEL |
| R3165 |
T4909 |
T4904 |
prep |
of,staining |
| R3166 |
T4910 |
T4911 |
amod |
interdigital,mesenchyme |
| R3167 |
T4911 |
T4909 |
pobj |
mesenchyme,of |
| R3168 |
T4912 |
T4911 |
prep |
between,mesenchyme |
| R3169 |
T4913 |
T4914 |
det |
the,digits |
| R3170 |
T4914 |
T4912 |
pobj |
digits,between |
| R3171 |
T4915 |
T4914 |
amod |
first,digits |
| R3172 |
T4916 |
T4915 |
cc |
and,first |
| R3173 |
T4917 |
T4915 |
conj |
second,first |
| R3174 |
T4918 |
T4919 |
punct |
(,Figure |
| R3175 |
T4919 |
T4914 |
parataxis |
Figure,digits |
| R3176 |
T4920 |
T4919 |
nummod |
2D,Figure |
| R3177 |
T4921 |
T4919 |
cc |
and,Figure |
| R3178 |
T4922 |
T4919 |
conj |
2E,Figure |
| R3179 |
T4923 |
T4919 |
punct |
),Figure |
| R3180 |
T4924 |
T4914 |
cc |
and,digits |
| R3181 |
T4925 |
T4926 |
det |
the,digit |
| R3182 |
T4926 |
T4914 |
conj |
digit,digits |
| R3183 |
T4927 |
T4926 |
amod |
fifth,digit |
| R3184 |
T4928 |
T4914 |
acl |
flanking,digits |
| R3185 |
T4929 |
T4928 |
dobj |
mesenchyme,flanking |
| R3186 |
T4930 |
T4931 |
det |
a,number |
| R3187 |
T4931 |
T4908 |
dobj |
number,showed |
| R3188 |
T4932 |
T4931 |
amod |
decreased,number |
| R3189 |
T4933 |
T4931 |
prep |
of,number |
| R3190 |
T4934 |
T4935 |
amod |
dying,cells |
| R3191 |
T4935 |
T4933 |
pobj |
cells,of |
| R3192 |
T4936 |
T4908 |
prep |
in,showed |
| R3193 |
T4937 |
T4938 |
det |
the,regions |
| R3194 |
T4938 |
T4936 |
pobj |
regions,in |
| R3195 |
T4939 |
T4940 |
advmod |
where,retained |
| R3196 |
T4940 |
T4938 |
relcl |
retained,regions |
| R3197 |
T4941 |
T4942 |
amod |
excess,tissue |
| R3198 |
T4942 |
T4940 |
nsubjpass |
tissue,retained |
| R3199 |
T4943 |
T4940 |
auxpass |
is,retained |
| R3200 |
T4944 |
T4940 |
prep |
in,retained |
| R3201 |
T4945 |
T4946 |
det |
the,limbs |
| R3202 |
T4946 |
T4944 |
pobj |
limbs,in |
| R3203 |
T4947 |
T4946 |
compound |
mutant,limbs |
| R3204 |
T4948 |
T4908 |
punct |
.,showed |
| R3205 |
T4950 |
T4951 |
nsubjpass |
Numbers,elevated |
| R3206 |
T4952 |
T4950 |
prep |
of,Numbers |
| R3207 |
T4953 |
T4954 |
amod |
phosphorylated,H3 |
| R3208 |
T4954 |
T4956 |
npadvmod |
H3,labeled |
| R3209 |
T4955 |
T4954 |
compound |
histone,H3 |
| R3210 |
T4956 |
T4958 |
amod |
labeled,cells |
| R3211 |
T4957 |
T4956 |
punct |
-,labeled |
| R3212 |
T4958 |
T4952 |
pobj |
cells,of |
| R3213 |
T4959 |
T4958 |
amod |
proliferating,cells |
| R3214 |
T4960 |
T4951 |
auxpass |
were,elevated |
| R3215 |
T4961 |
T4951 |
advmod |
also,elevated |
| R3216 |
T4962 |
T4951 |
prep |
in,elevated |
| R3217 |
T4963 |
T4964 |
det |
these,regions |
| R3218 |
T4964 |
T4962 |
pobj |
regions,in |
| R3219 |
T4965 |
T4966 |
punct |
(,Figure |
| R3220 |
T4966 |
T4951 |
parataxis |
Figure,elevated |
| R3221 |
T4967 |
T4966 |
nummod |
2F,Figure |
| R3222 |
T4968 |
T4966 |
punct |
),Figure |
| R3223 |
T4969 |
T4951 |
punct |
.,elevated |
| R3224 |
T4971 |
T4972 |
amod |
Most,cells |
| R3225 |
T4972 |
T4973 |
nsubj |
cells,expressed |
| R3226 |
T4974 |
T4972 |
acl |
found,cells |
| R3227 |
T4975 |
T4974 |
prep |
in,found |
| R3228 |
T4976 |
T4977 |
det |
the,region |
| R3229 |
T4977 |
T4975 |
pobj |
region,in |
| R3230 |
T4978 |
T4977 |
amod |
webbed,region |
| R3231 |
T4979 |
T4977 |
prep |
between,region |
| R3232 |
T4980 |
T4981 |
det |
the,digits |
| R3233 |
T4981 |
T4979 |
pobj |
digits,between |
| R3234 |
T4982 |
T4981 |
amod |
first,digits |
| R3235 |
T4983 |
T4982 |
cc |
and,first |
| R3236 |
T4984 |
T4982 |
conj |
second,first |
| R3237 |
T4985 |
T4974 |
prep |
at,found |
| R3238 |
T4986 |
T4985 |
pobj |
E15.5,at |
| R3239 |
T4987 |
T4973 |
advmod |
strongly,expressed |
| R3240 |
T4988 |
T4973 |
dobj |
LACZ,expressed |
| R3241 |
T4989 |
T4973 |
prep |
in,expressed |
| R3242 |
T4990 |
T4991 |
compound |
Gdf5,Cre |
| R3243 |
T4991 |
T4993 |
compound |
Cre,Bmpr1afloxP |
| R3244 |
T4992 |
T4991 |
punct |
-,Cre |
| R3245 |
T4993 |
T4995 |
compound |
Bmpr1afloxP,embryos |
| R3246 |
T4994 |
T4993 |
punct |
/,Bmpr1afloxP |
| R3247 |
T4995 |
T4989 |
pobj |
embryos,in |
| R3248 |
T4996 |
T4995 |
compound |
mutant,embryos |
| R3249 |
T4997 |
T4998 |
punct |
(,Figure |
| R3250 |
T4998 |
T4973 |
parataxis |
Figure,expressed |
| R3251 |
T4999 |
T4998 |
nummod |
2H,Figure |
| R3252 |
T5000 |
T4998 |
punct |
),Figure |
| R3253 |
T5001 |
T4973 |
punct |
.,expressed |
| R3254 |
T5003 |
T5004 |
det |
These,data |
| R3255 |
T5004 |
T5005 |
nsubj |
data,suggest |
| R3256 |
T5006 |
T5007 |
mark |
that,blocks |
| R3257 |
T5007 |
T5005 |
advcl |
blocks,suggest |
| R3258 |
T5008 |
T5009 |
amod |
regional,loss |
| R3259 |
T5009 |
T5007 |
nsubj |
loss,blocks |
| R3260 |
T5010 |
T5009 |
prep |
of,loss |
| R3261 |
T5011 |
T5012 |
compound |
BMPR1A,signaling |
| R3262 |
T5012 |
T5010 |
pobj |
signaling,of |
| R3263 |
T5013 |
T5012 |
compound |
receptor,signaling |
| R3264 |
T5014 |
T5015 |
amod |
programmed,death |
| R3265 |
T5015 |
T5007 |
dobj |
death,blocks |
| R3266 |
T5016 |
T5015 |
compound |
cell,death |
| R3267 |
T5017 |
T5007 |
prep |
in,blocks |
| R3268 |
T5018 |
T5019 |
amod |
interdigital,mesenchyme |
| R3269 |
T5019 |
T5017 |
pobj |
mesenchyme,in |
| R3270 |
T5020 |
T5007 |
punct |
", ",blocks |
| R3271 |
T5021 |
T5007 |
cc |
and,blocks |
| R3272 |
T5022 |
T5023 |
mark |
that,survive |
| R3273 |
T5023 |
T5007 |
conj |
survive,blocks |
| R3274 |
T5024 |
T5025 |
det |
the,cells |
| R3275 |
T5025 |
T5023 |
nsubj |
cells,survive |
| R3276 |
T5026 |
T5025 |
amod |
recombined,cells |
| R3277 |
T5027 |
T5023 |
cc |
and,survive |
| R3278 |
T5028 |
T5023 |
conj |
proliferate,survive |
| R3279 |
T5029 |
T5028 |
prep |
in,proliferate |
| R3280 |
T5030 |
T5031 |
det |
the,absence |
| R3281 |
T5031 |
T5029 |
pobj |
absence,in |
| R3282 |
T5032 |
T5031 |
prep |
of,absence |
| R3283 |
T5033 |
T5034 |
compound |
BMPR1A,signaling |
| R3284 |
T5034 |
T5032 |
pobj |
signaling,of |
| R3285 |
T5035 |
T5005 |
punct |
.,suggest |
| R3286 |
T5157 |
T5156 |
prep |
of,Failure |
| R3287 |
T5158 |
T5159 |
amod |
Early,Formation |
| R3288 |
T5159 |
T5157 |
pobj |
Formation,of |
| R3289 |
T5160 |
T5159 |
compound |
Joint,Formation |
| R3290 |
T5161 |
T5156 |
prep |
in,Failure |
| R3291 |
T5162 |
T5163 |
compound |
Ankle,Regions |
| R3292 |
T5163 |
T5161 |
pobj |
Regions,in |
| R3293 |
T5165 |
T5166 |
det |
The,gene |
| R3294 |
T5166 |
T5168 |
nsubjpass |
gene,expressed |
| R3295 |
T5167 |
T5166 |
compound |
Bmpr1a,gene |
| R3296 |
T5169 |
T5168 |
auxpass |
is,expressed |
| R3297 |
T5170 |
T5168 |
prep |
in,expressed |
| R3298 |
T5171 |
T5172 |
det |
the,region |
| R3299 |
T5172 |
T5170 |
pobj |
region,in |
| R3300 |
T5173 |
T5172 |
compound |
interzone,region |
| R3301 |
T5174 |
T5172 |
prep |
of,region |
| R3302 |
T5175 |
T5176 |
amod |
developing,joints |
| R3303 |
T5176 |
T5174 |
pobj |
joints,of |
| R3304 |
T5177 |
T5168 |
prep |
at,expressed |
| R3305 |
T5178 |
T5177 |
pobj |
E13.5,at |
| R3306 |
T5179 |
T5180 |
punct |
(,Baur |
| R3307 |
T5180 |
T5168 |
meta |
Baur,expressed |
| R3308 |
T5181 |
T5180 |
nmod |
et,Baur |
| R3309 |
T5182 |
T5180 |
nmod |
al.,Baur |
| R3310 |
T5183 |
T5180 |
nummod |
2000,Baur |
| R3311 |
T5184 |
T5180 |
punct |
),Baur |
| R3312 |
T5185 |
T5168 |
punct |
.,expressed |
| R3313 |
T5187 |
T5188 |
advmod |
In,situ |
| R3314 |
T5188 |
T5189 |
amod |
situ,hybridization |
| R3315 |
T5189 |
T5190 |
nsubj |
hybridization,showed |
| R3316 |
T5191 |
T5192 |
mark |
that,expressed |
| R3317 |
T5192 |
T5190 |
ccomp |
expressed,showed |
| R3318 |
T5193 |
T5194 |
det |
the,gene |
| R3319 |
T5194 |
T5192 |
nsubjpass |
gene,expressed |
| R3320 |
T5195 |
T5192 |
auxpass |
is,expressed |
| R3321 |
T5196 |
T5192 |
advmod |
also,expressed |
| R3322 |
T5197 |
T5192 |
prep |
in,expressed |
| R3323 |
T5198 |
T5199 |
det |
the,interzones |
| R3324 |
T5199 |
T5197 |
pobj |
interzones,in |
| R3325 |
T5200 |
T5199 |
prep |
of,interzones |
| R3326 |
T5201 |
T5202 |
compound |
ankle,joints |
| R3327 |
T5202 |
T5200 |
pobj |
joints,of |
| R3328 |
T5203 |
T5199 |
cc |
and,interzones |
| R3329 |
T5204 |
T5205 |
amod |
prospective,regions |
| R3330 |
T5205 |
T5199 |
conj |
regions,interzones |
| R3331 |
T5206 |
T5207 |
amod |
articular,cartilage |
| R3332 |
T5207 |
T5205 |
compound |
cartilage,regions |
| R3333 |
T5208 |
T5205 |
prep |
of,regions |
| R3334 |
T5209 |
T5210 |
compound |
digit,joints |
| R3335 |
T5210 |
T5208 |
pobj |
joints,of |
| R3336 |
T5211 |
T5192 |
prep |
at,expressed |
| R3337 |
T5212 |
T5211 |
pobj |
E15.5,at |
| R3338 |
T5213 |
T5214 |
punct |
(,Figure |
| R3339 |
T5214 |
T5190 |
parataxis |
Figure,showed |
| R3340 |
T5215 |
T5214 |
nummod |
4,Figure |
| R3341 |
T5216 |
T5214 |
punct |
),Figure |
| R3342 |
T5217 |
T5190 |
punct |
.,showed |
| R3343 |
T5219 |
T5220 |
compound |
LACZ,staining |
| R3344 |
T5220 |
T5221 |
nsubj |
staining,indicated |
| R3345 |
T5222 |
T5223 |
mark |
that,begins |
| R3346 |
T5223 |
T5221 |
ccomp |
begins,indicated |
| R3347 |
T5224 |
T5225 |
npadvmod |
Cre,mediated |
| R3348 |
T5225 |
T5227 |
amod |
mediated,recombination |
| R3349 |
T5226 |
T5225 |
punct |
-,mediated |
| R3350 |
T5227 |
T5223 |
nsubj |
recombination,begins |
| R3351 |
T5228 |
T5229 |
aux |
to,occur |
| R3352 |
T5229 |
T5223 |
xcomp |
occur,begins |
| R3353 |
T5230 |
T5229 |
prep |
in,occur |
| R3354 |
T5231 |
T5232 |
compound |
ankle,joints |
| R3355 |
T5232 |
T5230 |
pobj |
joints,in |
| R3356 |
T5233 |
T5229 |
prep |
around,occur |
| R3357 |
T5234 |
T5233 |
pobj |
E14.5,around |
| R3358 |
T5235 |
T5223 |
punct |
", ",begins |
| R3359 |
T5236 |
T5223 |
cc |
and,begins |
| R3360 |
T5237 |
T5223 |
conj |
is,begins |
| R3361 |
T5238 |
T5237 |
acomp |
extensive,is |
| R3362 |
T5239 |
T5237 |
prep |
by,is |
| R3363 |
T5240 |
T5239 |
pobj |
E15.5,by |
| R3364 |
T5241 |
T5242 |
punct |
(,Figure |
| R3365 |
T5242 |
T5221 |
parataxis |
Figure,indicated |
| R3366 |
T5243 |
T5242 |
nummod |
4G,Figure |
| R3367 |
T5244 |
T5242 |
cc |
and,Figure |
| R3368 |
T5245 |
T5242 |
conj |
4J,Figure |
| R3369 |
T5246 |
T5242 |
punct |
),Figure |
| R3370 |
T5247 |
T5248 |
punct |
(,data |
| R3371 |
T5248 |
T5221 |
meta |
data,indicated |
| R3372 |
T5249 |
T5248 |
amod |
unpublished,data |
| R3373 |
T5250 |
T5248 |
punct |
),data |
| R3374 |
T5251 |
T5221 |
punct |
.,indicated |
| R3375 |
T5253 |
T5254 |
prep |
In,seen |
| R3376 |
T5255 |
T5256 |
det |
the,regions |
| R3377 |
T5256 |
T5253 |
pobj |
regions,In |
| R3378 |
T5257 |
T5258 |
compound |
ankle,joint |
| R3379 |
T5258 |
T5256 |
compound |
joint,regions |
| R3380 |
T5259 |
T5260 |
dep |
that,fused |
| R3381 |
T5260 |
T5256 |
relcl |
fused,regions |
| R3382 |
T5261 |
T5260 |
auxpass |
were,fused |
| R3383 |
T5262 |
T5260 |
advmod |
obviously,fused |
| R3384 |
T5263 |
T5260 |
prep |
in,fused |
| R3385 |
T5264 |
T5265 |
amod |
postnatal,animals |
| R3386 |
T5265 |
T5263 |
pobj |
animals,in |
| R3387 |
T5266 |
T5265 |
compound |
mutant,animals |
| R3388 |
T5267 |
T5254 |
punct |
", ",seen |
| R3389 |
T5268 |
T5254 |
nsubjpass |
alterations,seen |
| R3390 |
T5269 |
T5268 |
prep |
in,alterations |
| R3391 |
T5270 |
T5271 |
amod |
early,expression |
| R3392 |
T5271 |
T5269 |
pobj |
expression,in |
| R3393 |
T5272 |
T5273 |
compound |
joint,marker |
| R3394 |
T5273 |
T5271 |
compound |
marker,expression |
| R3395 |
T5274 |
T5254 |
aux |
could,seen |
| R3396 |
T5275 |
T5254 |
advmod |
also,seen |
| R3397 |
T5276 |
T5254 |
auxpass |
be,seen |
| R3398 |
T5277 |
T5254 |
prep |
by,seen |
| R3399 |
T5278 |
T5277 |
pobj |
E15.5,by |
| R3400 |
T5279 |
T5254 |
punct |
.,seen |
| R3401 |
T5281 |
T5282 |
prep |
At,expressed |
| R3402 |
T5283 |
T5284 |
det |
this,stage |
| R3403 |
T5284 |
T5281 |
pobj |
stage,At |
| R3404 |
T5285 |
T5282 |
punct |
", ",expressed |
| R3405 |
T5286 |
T5287 |
det |
the,gene |
| R3406 |
T5287 |
T5282 |
nsubjpass |
gene,expressed |
| R3407 |
T5288 |
T5287 |
compound |
Gdf5,gene |
| R3408 |
T5289 |
T5282 |
auxpass |
is,expressed |
| R3409 |
T5290 |
T5282 |
advmod |
normally,expressed |
| R3410 |
T5291 |
T5282 |
prep |
in,expressed |
| R3411 |
T5292 |
T5291 |
pobj |
stripes,in |
| R3412 |
T5293 |
T5294 |
dep |
that,mark |
| R3413 |
T5294 |
T5292 |
relcl |
mark,stripes |
| R3414 |
T5295 |
T5296 |
det |
the,sites |
| R3415 |
T5296 |
T5294 |
dobj |
sites,mark |
| R3416 |
T5297 |
T5296 |
prep |
of,sites |
| R3417 |
T5298 |
T5299 |
compound |
joint,formation |
| R3418 |
T5299 |
T5297 |
pobj |
formation,of |
| R3419 |
T5300 |
T5301 |
punct |
(,Figure |
| R3420 |
T5301 |
T5282 |
parataxis |
Figure,expressed |
| R3421 |
T5302 |
T5301 |
nummod |
4F,Figure |
| R3422 |
T5303 |
T5301 |
punct |
),Figure |
| R3423 |
T5304 |
T5282 |
punct |
", ",expressed |
| R3424 |
T5305 |
T5282 |
cc |
and,expressed |
| R3425 |
T5306 |
T5307 |
det |
the,gene |
| R3426 |
T5307 |
T5308 |
nsubjpass |
gene,regulated |
| R3427 |
T5308 |
T5282 |
conj |
regulated,expressed |
| R3428 |
T5309 |
T5307 |
prep |
for,gene |
| R3429 |
T5310 |
T5311 |
det |
the,protein |
| R3430 |
T5311 |
T5309 |
pobj |
protein,for |
| R3431 |
T5312 |
T5311 |
amod |
major,protein |
| R3432 |
T5313 |
T5311 |
compound |
collagen,protein |
| R3433 |
T5314 |
T5311 |
prep |
of,protein |
| R3434 |
T5315 |
T5316 |
compound |
cartilage,matrix |
| R3435 |
T5316 |
T5314 |
pobj |
matrix,of |
| R3436 |
T5317 |
T5307 |
punct |
(,gene |
| R3437 |
T5318 |
T5307 |
appos |
Col2a1,gene |
| R3438 |
T5319 |
T5307 |
punct |
),gene |
| R3439 |
T5320 |
T5308 |
auxpass |
is,regulated |
| R3440 |
T5321 |
T5308 |
advmod |
down,regulated |
| R3441 |
T5322 |
T5308 |
punct |
-,regulated |
| R3442 |
T5323 |
T5308 |
prep |
in,regulated |
| R3443 |
T5324 |
T5325 |
det |
the,region |
| R3444 |
T5325 |
T5323 |
pobj |
region,in |
| R3445 |
T5326 |
T5325 |
compound |
interzone,region |
| R3446 |
T5327 |
T5328 |
punct |
(,Figure |
| R3447 |
T5328 |
T5308 |
parataxis |
Figure,regulated |
| R3448 |
T5329 |
T5328 |
nummod |
4E,Figure |
| R3449 |
T5330 |
T5328 |
punct |
),Figure |
| R3450 |
T5331 |
T5308 |
punct |
.,regulated |
| R3451 |
T5333 |
T5334 |
prep |
In,extended |
| R3452 |
T5335 |
T5333 |
pobj |
contrast,In |
| R3453 |
T5336 |
T5334 |
punct |
", ",extended |
| R3454 |
T5337 |
T5338 |
compound |
Col2a1,staining |
| R3455 |
T5338 |
T5334 |
nsubj |
staining,extended |
| R3456 |
T5339 |
T5334 |
advmod |
completely,extended |
| R3457 |
T5340 |
T5334 |
prep |
through,extended |
| R3458 |
T5341 |
T5342 |
det |
the,region |
| R3459 |
T5342 |
T5340 |
pobj |
region,through |
| R3460 |
T5343 |
T5342 |
compound |
joint,region |
| R3461 |
T5344 |
T5342 |
prep |
between,region |
| R3462 |
T5345 |
T5346 |
det |
the,tarsal |
| R3463 |
T5346 |
T5344 |
pobj |
tarsal,between |
| R3464 |
T5347 |
T5346 |
amod |
second,tarsal |
| R3465 |
T5348 |
T5347 |
cc |
and,second |
| R3466 |
T5349 |
T5347 |
conj |
central,second |
| R3467 |
T5350 |
T5346 |
prep |
of,tarsal |
| R3468 |
T5351 |
T5352 |
compound |
Gdf5,Cre |
| R3469 |
T5352 |
T5354 |
compound |
Cre,Bmpr1afloxP |
| R3470 |
T5353 |
T5352 |
punct |
-,Cre |
| R3471 |
T5354 |
T5356 |
compound |
Bmpr1afloxP,mutants |
| R3472 |
T5355 |
T5354 |
punct |
/,Bmpr1afloxP |
| R3473 |
T5356 |
T5350 |
pobj |
mutants,of |
| R3474 |
T5357 |
T5358 |
punct |
(,arrow |
| R3475 |
T5358 |
T5334 |
parataxis |
arrow,extended |
| R3476 |
T5359 |
T5358 |
dep |
Figure,arrow |
| R3477 |
T5360 |
T5359 |
nummod |
4H,Figure |
| R3478 |
T5361 |
T5358 |
punct |
", ",arrow |
| R3479 |
T5362 |
T5358 |
amod |
black,arrow |
| R3480 |
T5363 |
T5358 |
punct |
),arrow |
| R3481 |
T5364 |
T5334 |
punct |
", ",extended |
| R3482 |
T5365 |
T5334 |
cc |
and,extended |
| R3483 |
T5366 |
T5367 |
compound |
Gdf5,expression |
| R3484 |
T5367 |
T5368 |
nsubjpass |
expression,seen |
| R3485 |
T5368 |
T5334 |
conj |
seen,extended |
| R3486 |
T5369 |
T5368 |
auxpass |
was,seen |
| R3487 |
T5370 |
T5371 |
advmod |
only,as |
| R3488 |
T5371 |
T5368 |
prep |
as,seen |
| R3489 |
T5372 |
T5373 |
det |
a,notch |
| R3490 |
T5373 |
T5371 |
pobj |
notch,as |
| R3491 |
T5374 |
T5373 |
amod |
small,notch |
| R3492 |
T5375 |
T5373 |
acl |
extending,notch |
| R3493 |
T5376 |
T5375 |
prep |
into,extending |
| R3494 |
T5377 |
T5378 |
advmod |
where,forming |
| R3495 |
T5378 |
T5376 |
pcomp |
forming,into |
| R3496 |
T5379 |
T5380 |
det |
the,joint |
| R3497 |
T5380 |
T5378 |
nsubj |
joint,forming |
| R3498 |
T5381 |
T5378 |
aux |
should,forming |
| R3499 |
T5382 |
T5378 |
aux |
be,forming |
| R3500 |
T5383 |
T5384 |
punct |
(,bracket |
| R3501 |
T5384 |
T5368 |
parataxis |
bracket,seen |
| R3502 |
T5385 |
T5384 |
dep |
Figure,bracket |
| R3503 |
T5386 |
T5385 |
nummod |
4I,Figure |
| R3504 |
T5387 |
T5384 |
punct |
", ",bracket |
| R3505 |
T5388 |
T5384 |
punct |
),bracket |
| R3506 |
T5389 |
T5368 |
punct |
.,seen |
| R3507 |
T5391 |
T5392 |
det |
These,data |
| R3508 |
T5392 |
T5393 |
nsubj |
data,suggest |
| R3509 |
T5394 |
T5395 |
mark |
that,are |
| R3510 |
T5395 |
T5393 |
ccomp |
are,suggest |
| R3511 |
T5396 |
T5397 |
det |
the,fusions |
| R3512 |
T5397 |
T5395 |
nsubj |
fusions,are |
| R3513 |
T5398 |
T5397 |
acl |
seen,fusions |
| R3514 |
T5399 |
T5398 |
prep |
between,seen |
| R3515 |
T5400 |
T5401 |
compound |
ankle,bones |
| R3516 |
T5401 |
T5399 |
pobj |
bones,between |
| R3517 |
T5402 |
T5398 |
prep |
in,seen |
| R3518 |
T5403 |
T5404 |
amod |
postnatal,skeletons |
| R3519 |
T5404 |
T5402 |
pobj |
skeletons,in |
| R3520 |
T5405 |
T5404 |
compound |
mutant,skeletons |
| R3521 |
T5406 |
T5407 |
det |
the,result |
| R3522 |
T5407 |
T5395 |
attr |
result,are |
| R3523 |
T5408 |
T5407 |
prep |
of,result |
| R3524 |
T5409 |
T5410 |
amod |
incomplete,segmentation |
| R3525 |
T5410 |
T5408 |
pobj |
segmentation,of |
| R3526 |
T5411 |
T5410 |
prep |
of,segmentation |
| R3527 |
T5412 |
T5413 |
amod |
skeletal,precursors |
| R3528 |
T5413 |
T5411 |
pobj |
precursors,of |
| R3529 |
T5414 |
T5410 |
prep |
during,segmentation |
| R3530 |
T5415 |
T5416 |
amod |
embryonic,development |
| R3531 |
T5416 |
T5414 |
pobj |
development,during |
| R3532 |
T5417 |
T5410 |
punct |
", ",segmentation |
| R3533 |
T5418 |
T5419 |
det |
a,defect |
| R3534 |
T5419 |
T5410 |
appos |
defect,segmentation |
| R3535 |
T5420 |
T5419 |
acl |
confined,defect |
| R3536 |
T5421 |
T5420 |
prep |
to,confined |
| R3537 |
T5422 |
T5423 |
det |
some,locations |
| R3538 |
T5423 |
T5421 |
pobj |
locations,to |
| R3539 |
T5424 |
T5423 |
prep |
in,locations |
| R3540 |
T5425 |
T5426 |
det |
the,ankle |
| R3541 |
T5426 |
T5424 |
pobj |
ankle,in |
| R3542 |
T5427 |
T5393 |
punct |
.,suggest |
| R3551 |
T5887 |
T5888 |
aux |
to,Maintain |
| R3552 |
T5888 |
T5886 |
acl |
Maintain,Failure |
| R3553 |
T5889 |
T5890 |
amod |
Articular,Cartilage |
| R3554 |
T5890 |
T5888 |
dobj |
Cartilage,Maintain |
| R3555 |
T5891 |
T5888 |
prep |
in,Maintain |
| R3556 |
T5892 |
T5893 |
amod |
Other,Joints |
| R3557 |
T5893 |
T5891 |
pobj |
Joints,in |
| R3558 |
T5895 |
T5896 |
prep |
In,occurred |
| R3559 |
T5897 |
T5898 |
amod |
most,joints |
| R3560 |
T5898 |
T5895 |
pobj |
joints,In |
| R3561 |
T5899 |
T5898 |
prep |
of,joints |
| R3562 |
T5900 |
T5901 |
nmod |
Bmpr1a,knockout |
| R3563 |
T5901 |
T5903 |
compound |
knockout,mice |
| R3564 |
T5902 |
T5901 |
amod |
conditional,knockout |
| R3565 |
T5903 |
T5899 |
pobj |
mice,of |
| R3566 |
T5904 |
T5896 |
punct |
", ",occurred |
| R3567 |
T5905 |
T5906 |
amod |
embryonic,segmentation |
| R3568 |
T5906 |
T5896 |
nsubj |
segmentation,occurred |
| R3569 |
T5907 |
T5906 |
prep |
of,segmentation |
| R3570 |
T5908 |
T5909 |
amod |
skeletal,precursors |
| R3571 |
T5909 |
T5907 |
pobj |
precursors,of |
| R3572 |
T5910 |
T5896 |
advmod |
normally,occurred |
| R3573 |
T5911 |
T5896 |
punct |
.,occurred |
| R3574 |
T5913 |
T5914 |
mark |
Although,seen |
| R3575 |
T5914 |
T5922 |
advcl |
seen,seen |
| R3576 |
T5915 |
T5916 |
compound |
Gdf5,Cre |
| R3577 |
T5916 |
T5918 |
npadvmod |
Cre,mediated |
| R3578 |
T5917 |
T5916 |
punct |
-,Cre |
| R3579 |
T5918 |
T5920 |
amod |
mediated,recombination |
| R3580 |
T5919 |
T5918 |
punct |
-,mediated |
| R3581 |
T5920 |
T5914 |
nsubjpass |
recombination,seen |
| R3582 |
T5921 |
T5914 |
auxpass |
was,seen |
| R3583 |
T5923 |
T5924 |
advmod |
as,early |
| R3584 |
T5924 |
T5914 |
advmod |
early,seen |
| R3585 |
T5925 |
T5924 |
prep |
as,early |
| R3586 |
T5926 |
T5925 |
pobj |
E13.5,as |
| R3587 |
T5927 |
T5914 |
prep |
in,seen |
| R3588 |
T5928 |
T5929 |
compound |
digit,regions |
| R3589 |
T5929 |
T5927 |
pobj |
regions,in |
| R3590 |
T5930 |
T5929 |
compound |
interzone,regions |
| R3591 |
T5931 |
T5932 |
punct |
(,see |
| R3592 |
T5932 |
T5914 |
parataxis |
see,seen |
| R3593 |
T5933 |
T5932 |
dobj |
Figure,see |
| R3594 |
T5934 |
T5933 |
nummod |
2C,Figure |
| R3595 |
T5935 |
T5932 |
punct |
),see |
| R3596 |
T5936 |
T5922 |
punct |
", ",seen |
| R3597 |
T5937 |
T5938 |
det |
no,changes |
| R3598 |
T5938 |
T5922 |
nsubjpass |
changes,seen |
| R3599 |
T5939 |
T5938 |
prep |
in,changes |
| R3600 |
T5940 |
T5941 |
compound |
cell,death |
| R3601 |
T5941 |
T5939 |
pobj |
death,in |
| R3602 |
T5942 |
T5941 |
cc |
or,death |
| R3603 |
T5943 |
T5944 |
compound |
cell,proliferation |
| R3604 |
T5944 |
T5941 |
conj |
proliferation,death |
| R3605 |
T5945 |
T5922 |
aux |
could,seen |
| R3606 |
T5946 |
T5922 |
auxpass |
be,seen |
| R3607 |
T5947 |
T5922 |
prep |
in,seen |
| R3608 |
T5948 |
T5949 |
det |
the,joints |
| R3609 |
T5949 |
T5947 |
pobj |
joints,in |
| R3610 |
T5950 |
T5951 |
amod |
metacarpal,phalangeal |
| R3611 |
T5951 |
T5949 |
amod |
phalangeal,joints |
| R3612 |
T5952 |
T5951 |
punct |
-,phalangeal |
| R3613 |
T5953 |
T5951 |
cc |
or,phalangeal |
| R3614 |
T5954 |
T5955 |
amod |
metatarsal,phalangeal |
| R3615 |
T5955 |
T5951 |
conj |
phalangeal,phalangeal |
| R3616 |
T5956 |
T5955 |
punct |
-,phalangeal |
| R3617 |
T5957 |
T5922 |
prep |
at,seen |
| R3618 |
T5958 |
T5957 |
pobj |
E13.5,at |
| R3619 |
T5959 |
T5958 |
cc |
or,E13.5 |
| R3620 |
T5960 |
T5958 |
conj |
E14.5,E13.5 |
| R3621 |
T5961 |
T5962 |
punct |
(,data |
| R3622 |
T5962 |
T5922 |
meta |
data,seen |
| R3623 |
T5963 |
T5962 |
amod |
unpublished,data |
| R3624 |
T5964 |
T5962 |
punct |
),data |
| R3625 |
T5965 |
T5922 |
punct |
.,seen |
| R3626 |
T5967 |
T5968 |
advmod |
Similarly,seen |
| R3627 |
T5969 |
T5968 |
punct |
", ",seen |
| R3628 |
T5970 |
T5971 |
mark |
although,seen |
| R3629 |
T5971 |
T5968 |
advcl |
seen,seen |
| R3630 |
T5972 |
T5973 |
amod |
clear,expression |
| R3631 |
T5973 |
T5971 |
nsubjpass |
expression,seen |
| R3632 |
T5974 |
T5973 |
compound |
LACZ,expression |
| R3633 |
T5975 |
T5971 |
auxpass |
was,seen |
| R3634 |
T5976 |
T5971 |
prep |
by,seen |
| R3635 |
T5977 |
T5976 |
pobj |
E15.5,by |
| R3636 |
T5978 |
T5971 |
prep |
in,seen |
| R3637 |
T5979 |
T5980 |
amod |
interphalangeal,joints |
| R3638 |
T5980 |
T5978 |
pobj |
joints,in |
| R3639 |
T5981 |
T5980 |
cc |
and,joints |
| R3640 |
T5982 |
T5983 |
amod |
periarticular,regions |
| R3641 |
T5983 |
T5980 |
conj |
regions,joints |
| R3642 |
T5984 |
T5985 |
punct |
(,Figure |
| R3643 |
T5985 |
T5971 |
parataxis |
Figure,seen |
| R3644 |
T5986 |
T5985 |
nummod |
4D,Figure |
| R3645 |
T5987 |
T5985 |
punct |
),Figure |
| R3646 |
T5988 |
T5968 |
punct |
", ",seen |
| R3647 |
T5989 |
T5990 |
det |
no,difference |
| R3648 |
T5990 |
T5968 |
nsubjpass |
difference,seen |
| R3649 |
T5991 |
T5990 |
prep |
in,difference |
| R3650 |
T5992 |
T5991 |
pobj |
morphology,in |
| R3651 |
T5993 |
T5992 |
cc |
or,morphology |
| R3652 |
T5994 |
T5992 |
conj |
expression,morphology |
| R3653 |
T5995 |
T5992 |
prep |
of,morphology |
| R3654 |
T5996 |
T5995 |
pobj |
Col2a1,of |
| R3655 |
T5997 |
T5996 |
punct |
", ",Col2a1 |
| R3656 |
T5998 |
T5996 |
conj |
Gdf5,Col2a1 |
| R3657 |
T5999 |
T5998 |
punct |
", ",Gdf5 |
| R3658 |
T6000 |
T5998 |
cc |
or,Gdf5 |
| R3659 |
T6001 |
T5998 |
conj |
Bmpr1b,Gdf5 |
| R3660 |
T6002 |
T5968 |
auxpass |
was,seen |
| R3661 |
T6003 |
T5968 |
prep |
in,seen |
| R3662 |
T6004 |
T6005 |
det |
the,regions |
| R3663 |
T6005 |
T6003 |
pobj |
regions,in |
| R3664 |
T6006 |
T6005 |
amod |
articular,regions |
| R3665 |
T6007 |
T6005 |
prep |
of,regions |
| R3666 |
T6008 |
T6009 |
det |
the,phalanges |
| R3667 |
T6009 |
T6007 |
pobj |
phalanges,of |
| R3668 |
T6010 |
T5968 |
prep |
at,seen |
| R3669 |
T6011 |
T6012 |
det |
these,stages |
| R3670 |
T6012 |
T6010 |
pobj |
stages,at |
| R3671 |
T6013 |
T6014 |
punct |
(,data |
| R3672 |
T6014 |
T5968 |
meta |
data,seen |
| R3673 |
T6015 |
T6014 |
amod |
unpublished,data |
| R3674 |
T6016 |
T6014 |
punct |
),data |
| R3675 |
T6017 |
T5968 |
punct |
.,seen |
| R3676 |
T6019 |
T6020 |
prep |
At,were |
| R3677 |
T6020 |
T6025 |
ccomp |
were,were |
| R3678 |
T6021 |
T6019 |
pobj |
birth,At |
| R3679 |
T6022 |
T6020 |
punct |
", ",were |
| R3680 |
T6023 |
T6024 |
compound |
digit,joints |
| R3681 |
T6024 |
T6020 |
nsubj |
joints,were |
| R3682 |
T6026 |
T6020 |
advmod |
generally,were |
| R3683 |
T6027 |
T6020 |
acomp |
indistinguishable,were |
| R3684 |
T6028 |
T6027 |
prep |
from,indistinguishable |
| R3685 |
T6029 |
T6028 |
pobj |
those,from |
| R3686 |
T6030 |
T6029 |
prep |
in,those |
| R3687 |
T6031 |
T6032 |
compound |
control,animals |
| R3688 |
T6032 |
T6030 |
pobj |
animals,in |
| R3689 |
T6033 |
T6025 |
punct |
;,were |
| R3690 |
T6034 |
T6025 |
nsubj |
chondrocytes,were |
| R3691 |
T6035 |
T6025 |
acomp |
abundant,were |
| R3692 |
T6036 |
T6025 |
prep |
in,were |
| R3693 |
T6037 |
T6038 |
amod |
articular,regions |
| R3694 |
T6038 |
T6036 |
pobj |
regions,in |
| R3695 |
T6039 |
T6025 |
cc |
and,were |
| R3696 |
T6040 |
T6041 |
auxpass |
were,surrounded |
| R3697 |
T6041 |
T6025 |
conj |
surrounded,were |
| R3698 |
T6042 |
T6041 |
agent |
by,surrounded |
| R3699 |
T6043 |
T6044 |
amod |
typical,matrix |
| R3700 |
T6044 |
T6042 |
pobj |
matrix,by |
| R3701 |
T6045 |
T6044 |
compound |
cartilage,matrix |
| R3702 |
T6046 |
T6041 |
prep |
with,surrounded |
| R3703 |
T6047 |
T6048 |
amod |
normal,staining |
| R3704 |
T6048 |
T6046 |
pobj |
staining,with |
| R3705 |
T6049 |
T6048 |
prep |
by,staining |
| R3706 |
T6050 |
T6051 |
compound |
Safranin,O |
| R3707 |
T6051 |
T6049 |
pobj |
O,by |
| R3708 |
T6052 |
T6051 |
punct |
", ",O |
| R3709 |
T6053 |
T6054 |
det |
a,stain |
| R3710 |
T6054 |
T6051 |
appos |
stain,O |
| R3711 |
T6055 |
T6054 |
amod |
histological,stain |
| R3712 |
T6056 |
T6054 |
prep |
for,stain |
| R3713 |
T6057 |
T6056 |
pobj |
proteoglycans,for |
| R3714 |
T6058 |
T6059 |
punct |
(,Figure |
| R3715 |
T6059 |
T6041 |
parataxis |
Figure,surrounded |
| R3716 |
T6060 |
T6059 |
nummod |
5,Figure |
| R3717 |
T6061 |
T6059 |
punct |
),Figure |
| R3718 |
T6062 |
T6025 |
punct |
.,were |
| R3719 |
T6064 |
T6065 |
prep |
At,expressed |
| R3720 |
T6066 |
T6067 |
det |
this,stage |
| R3721 |
T6067 |
T6064 |
pobj |
stage,At |
| R3722 |
T6068 |
T6065 |
punct |
", ",expressed |
| R3723 |
T6069 |
T6070 |
preconj |
both,type |
| R3724 |
T6070 |
T6073 |
nmod |
type,cells |
| R3725 |
T6071 |
T6070 |
amod |
wild,type |
| R3726 |
T6072 |
T6070 |
punct |
-,type |
| R3727 |
T6073 |
T6065 |
nsubj |
cells,expressed |
| R3728 |
T6074 |
T6070 |
cc |
and,type |
| R3729 |
T6075 |
T6070 |
conj |
mutant,type |
| R3730 |
T6076 |
T6073 |
prep |
in,cells |
| R3731 |
T6077 |
T6078 |
amod |
articular,regions |
| R3732 |
T6078 |
T6076 |
pobj |
regions,in |
| R3733 |
T6079 |
T6065 |
advmod |
also,expressed |
| R3734 |
T6080 |
T6081 |
amod |
high,levels |
| R3735 |
T6081 |
T6065 |
dobj |
levels,expressed |
| R3736 |
T6082 |
T6081 |
prep |
of,levels |
| R3737 |
T6083 |
T6082 |
pobj |
Col2a1,of |
| R3738 |
T6084 |
T6083 |
cc |
and,Col2a1 |
| R3739 |
T6085 |
T6083 |
conj |
Aggrecan,Col2a1 |
| R3740 |
T6086 |
T6085 |
punct |
(,Aggrecan |
| R3741 |
T6087 |
T6085 |
appos |
Agg,Aggrecan |
| R3742 |
T6088 |
T6085 |
punct |
),Aggrecan |
| R3743 |
T6089 |
T6083 |
punct |
", ",Col2a1 |
| R3744 |
T6090 |
T6091 |
det |
the,genes |
| R3745 |
T6091 |
T6083 |
appos |
genes,Col2a1 |
| R3746 |
T6092 |
T6091 |
acl |
encoding,genes |
| R3747 |
T6093 |
T6094 |
det |
the,proteins |
| R3748 |
T6094 |
T6092 |
dobj |
proteins,encoding |
| R3749 |
T6095 |
T6094 |
amod |
major,proteins |
| R3750 |
T6096 |
T6094 |
amod |
structural,proteins |
| R3751 |
T6097 |
T6094 |
prep |
of,proteins |
| R3752 |
T6098 |
T6099 |
compound |
cartilage,matrix |
| R3753 |
T6099 |
T6097 |
pobj |
matrix,of |
| R3754 |
T6100 |
T6101 |
punct |
(,Figure |
| R3755 |
T6101 |
T6065 |
parataxis |
Figure,expressed |
| R3756 |
T6102 |
T6101 |
nummod |
5B,Figure |
| R3757 |
T6103 |
T6101 |
cc |
and,Figure |
| R3758 |
T6104 |
T6101 |
conj |
5G,Figure |
| R3759 |
T6105 |
T6101 |
punct |
),Figure |
| R3760 |
T6106 |
T6107 |
punct |
(,data |
| R3761 |
T6107 |
T6065 |
meta |
data,expressed |
| R3762 |
T6108 |
T6107 |
amod |
unpublished,data |
| R3763 |
T6109 |
T6107 |
punct |
),data |
| R3764 |
T6110 |
T6065 |
punct |
.,expressed |
| R3765 |
T6112 |
T6113 |
det |
No,alterations |
| R3766 |
T6113 |
T6114 |
nsubjpass |
alterations,observed |
| R3767 |
T6115 |
T6113 |
prep |
in,alterations |
| R3768 |
T6116 |
T6117 |
amod |
cellular,apoptosis |
| R3769 |
T6117 |
T6115 |
pobj |
apoptosis,in |
| R3770 |
T6118 |
T6117 |
cc |
or,apoptosis |
| R3771 |
T6119 |
T6117 |
conj |
proliferation,apoptosis |
| R3772 |
T6120 |
T6114 |
auxpass |
were,observed |
| R3773 |
T6121 |
T6122 |
punct |
(,data |
| R3774 |
T6122 |
T6114 |
meta |
data,observed |
| R3775 |
T6123 |
T6122 |
amod |
unpublished,data |
| R3776 |
T6124 |
T6122 |
punct |
),data |
| R3777 |
T6125 |
T6114 |
punct |
.,observed |
| R3778 |
T6127 |
T6128 |
aux |
To,determine |
| R3779 |
T6128 |
T6129 |
advcl |
determine,analyzed |
| R3780 |
T6130 |
T6131 |
mark |
whether,specified |
| R3781 |
T6131 |
T6128 |
ccomp |
specified,determine |
| R3782 |
T6132 |
T6133 |
amod |
articular,cells |
| R3783 |
T6133 |
T6131 |
nsubjpass |
cells,specified |
| R3784 |
T6134 |
T6131 |
auxpass |
were,specified |
| R3785 |
T6135 |
T6131 |
advmod |
properly,specified |
| R3786 |
T6136 |
T6131 |
prep |
in,specified |
| R3787 |
T6137 |
T6136 |
pobj |
mutants,in |
| R3788 |
T6138 |
T6129 |
punct |
", ",analyzed |
| R3789 |
T6139 |
T6129 |
nsubj |
we,analyzed |
| R3790 |
T6140 |
T6129 |
advmod |
also,analyzed |
| R3791 |
T6141 |
T6129 |
dobj |
expression,analyzed |
| R3792 |
T6142 |
T6141 |
prep |
of,expression |
| R3793 |
T6143 |
T6142 |
pobj |
Matrilin,of |
| R3794 |
T6144 |
T6143 |
punct |
-,Matrilin |
| R3795 |
T6145 |
T6143 |
nummod |
4,Matrilin |
| R3796 |
T6146 |
T6143 |
punct |
(,Matrilin |
| R3797 |
T6147 |
T6143 |
appos |
Mat4,Matrilin |
| R3798 |
T6148 |
T6143 |
punct |
),Matrilin |
| R3799 |
T6149 |
T6143 |
punct |
", ",Matrilin |
| R3800 |
T6150 |
T6151 |
det |
a,gene |
| R3801 |
T6151 |
T6143 |
appos |
gene,Matrilin |
| R3802 |
T6152 |
T6151 |
acl |
expressed,gene |
| R3803 |
T6153 |
T6152 |
advmod |
specifically,expressed |
| R3804 |
T6154 |
T6152 |
prep |
in,expressed |
| R3805 |
T6155 |
T6156 |
det |
the,regions |
| R3806 |
T6156 |
T6154 |
pobj |
regions,in |
| R3807 |
T6157 |
T6156 |
amod |
periarticular,regions |
| R3808 |
T6158 |
T6157 |
cc |
and,periarticular |
| R3809 |
T6159 |
T6157 |
conj |
perichondral,periarticular |
| R3810 |
T6160 |
T6156 |
prep |
of,regions |
| R3811 |
T6161 |
T6162 |
amod |
developing,joints |
| R3812 |
T6162 |
T6160 |
pobj |
joints,of |
| R3813 |
T6163 |
T6164 |
punct |
(,Klatt |
| R3814 |
T6164 |
T6129 |
meta |
Klatt,analyzed |
| R3815 |
T6165 |
T6164 |
nmod |
et,Klatt |
| R3816 |
T6166 |
T6164 |
nmod |
al.,Klatt |
| R3817 |
T6167 |
T6164 |
nummod |
2001,Klatt |
| R3818 |
T6168 |
T6164 |
punct |
),Klatt |
| R3819 |
T6169 |
T6129 |
punct |
.,analyzed |
| R3820 |
T6171 |
T6172 |
prep |
In,was |
| R3821 |
T6173 |
T6174 |
preconj |
both,control |
| R3822 |
T6174 |
T6175 |
nmod |
control,animals |
| R3823 |
T6175 |
T6171 |
pobj |
animals,In |
| R3824 |
T6176 |
T6174 |
cc |
and,control |
| R3825 |
T6177 |
T6174 |
conj |
mutant,control |
| R3826 |
T6178 |
T6172 |
punct |
", ",was |
| R3827 |
T6179 |
T6172 |
nsubj |
transcription,was |
| R3828 |
T6180 |
T6179 |
prep |
of,transcription |
| R3829 |
T6181 |
T6180 |
pobj |
Mat4,of |
| R3830 |
T6182 |
T6172 |
advmod |
clearly,was |
| R3831 |
T6183 |
T6172 |
acomp |
detectable,was |
| R3832 |
T6184 |
T6172 |
prep |
in,was |
| R3833 |
T6185 |
T6186 |
det |
the,layers |
| R3834 |
T6186 |
T6184 |
pobj |
layers,in |
| R3835 |
T6187 |
T6188 |
amod |
articular,cartilage |
| R3836 |
T6188 |
T6186 |
compound |
cartilage,layers |
| R3837 |
T6189 |
T6186 |
prep |
of,layers |
| R3838 |
T6190 |
T6191 |
amod |
newborn,joints |
| R3839 |
T6191 |
T6189 |
pobj |
joints,of |
| R3840 |
T6192 |
T6193 |
punct |
(,5D |
| R3841 |
T6193 |
T6172 |
parataxis |
5D,was |
| R3842 |
T6194 |
T6193 |
nmod |
Figure,5D |
| R3843 |
T6195 |
T6193 |
cc |
and,5D |
| R3844 |
T6196 |
T6193 |
conj |
5I,5D |
| R3845 |
T6197 |
T6193 |
punct |
),5D |
| R3846 |
T6198 |
T6172 |
punct |
.,was |
| R3847 |
T6200 |
T6201 |
prep |
In,indicated |
| R3848 |
T6202 |
T6203 |
det |
all,experiments |
| R3849 |
T6203 |
T6200 |
pobj |
experiments,In |
| R3850 |
T6204 |
T6201 |
punct |
", ",indicated |
| R3851 |
T6205 |
T6201 |
nsubj |
expression,indicated |
| R3852 |
T6206 |
T6205 |
prep |
of,expression |
| R3853 |
T6207 |
T6206 |
pobj |
LACZ,of |
| R3854 |
T6208 |
T6205 |
prep |
throughout,expression |
| R3855 |
T6209 |
T6210 |
amod |
articular,regions |
| R3856 |
T6210 |
T6208 |
pobj |
regions,throughout |
| R3857 |
T6211 |
T6212 |
mark |
that,occurred |
| R3858 |
T6212 |
T6201 |
ccomp |
occurred,indicated |
| R3859 |
T6213 |
T6214 |
npadvmod |
Cre,mediated |
| R3860 |
T6214 |
T6216 |
amod |
mediated,recombination |
| R3861 |
T6215 |
T6214 |
punct |
-,mediated |
| R3862 |
T6216 |
T6212 |
nsubj |
recombination,occurred |
| R3863 |
T6217 |
T6212 |
aux |
had,occurred |
| R3864 |
T6218 |
T6212 |
prep |
throughout,occurred |
| R3865 |
T6219 |
T6220 |
det |
the,regions |
| R3866 |
T6220 |
T6218 |
pobj |
regions,throughout |
| R3867 |
T6221 |
T6220 |
amod |
articular,regions |
| R3868 |
T6222 |
T6223 |
punct |
(,Figure |
| R3869 |
T6223 |
T6201 |
parataxis |
Figure,indicated |
| R3870 |
T6224 |
T6223 |
nummod |
5C,Figure |
| R3871 |
T6225 |
T6223 |
punct |
", ",Figure |
| R3872 |
T6226 |
T6223 |
nummod |
5H,Figure |
| R3873 |
T6227 |
T6223 |
punct |
", ",Figure |
| R3874 |
T6228 |
T6223 |
nummod |
5E,Figure |
| R3875 |
T6229 |
T6223 |
punct |
", ",Figure |
| R3876 |
T6230 |
T6223 |
cc |
and,Figure |
| R3877 |
T6231 |
T6223 |
conj |
5J,Figure |
| R3878 |
T6232 |
T6223 |
punct |
),Figure |
| R3879 |
T6233 |
T6201 |
punct |
.,indicated |
| R3880 |
T6235 |
T6236 |
det |
The,appearance |
| R3881 |
T6236 |
T6239 |
nsubj |
appearance,suggest |
| R3882 |
T6237 |
T6236 |
amod |
normal,appearance |
| R3883 |
T6238 |
T6236 |
amod |
histological,appearance |
| R3884 |
T6240 |
T6236 |
punct |
", ",appearance |
| R3885 |
T6241 |
T6242 |
amod |
staining,properties |
| R3886 |
T6242 |
T6236 |
conj |
properties,appearance |
| R3887 |
T6243 |
T6242 |
punct |
", ",properties |
| R3888 |
T6244 |
T6242 |
cc |
and,properties |
| R3889 |
T6245 |
T6246 |
compound |
marker,gene |
| R3890 |
T6246 |
T6247 |
compound |
gene,patterns |
| R3891 |
T6247 |
T6242 |
conj |
patterns,properties |
| R3892 |
T6248 |
T6247 |
compound |
expression,patterns |
| R3893 |
T6249 |
T6250 |
mark |
that,required |
| R3894 |
T6250 |
T6239 |
ccomp |
required,suggest |
| R3895 |
T6251 |
T6250 |
nsubjpass |
Bmpr1a,required |
| R3896 |
T6252 |
T6250 |
auxpass |
is,required |
| R3897 |
T6253 |
T6250 |
neg |
not,required |
| R3898 |
T6254 |
T6250 |
prep |
for,required |
| R3899 |
T6255 |
T6256 |
det |
the,formation |
| R3900 |
T6256 |
T6254 |
pobj |
formation,for |
| R3901 |
T6257 |
T6256 |
amod |
initial,formation |
| R3902 |
T6258 |
T6256 |
cc |
or,formation |
| R3903 |
T6259 |
T6256 |
conj |
specification,formation |
| R3904 |
T6260 |
T6256 |
prep |
of,formation |
| R3905 |
T6261 |
T6262 |
amod |
articular,cartilage |
| R3906 |
T6262 |
T6260 |
pobj |
cartilage,of |
| R3907 |
T6263 |
T6239 |
punct |
.,suggest |
| R3908 |
T6265 |
T6266 |
prep |
By,began |
| R3909 |
T6267 |
T6268 |
nummod |
1,wk |
| R3910 |
T6268 |
T6265 |
pobj |
wk,By |
| R3911 |
T6269 |
T6268 |
prep |
after,wk |
| R3912 |
T6270 |
T6269 |
pobj |
birth,after |
| R3913 |
T6271 |
T6266 |
punct |
", ",began |
| R3914 |
T6272 |
T6273 |
amod |
obvious,differences |
| R3915 |
T6273 |
T6266 |
nsubj |
differences,began |
| R3916 |
T6274 |
T6275 |
aux |
to,detected |
| R3917 |
T6275 |
T6266 |
xcomp |
detected,began |
| R3918 |
T6276 |
T6275 |
auxpass |
be,detected |
| R3919 |
T6277 |
T6275 |
prep |
in,detected |
| R3920 |
T6278 |
T6279 |
det |
the,regions |
| R3921 |
T6279 |
T6277 |
pobj |
regions,in |
| R3922 |
T6280 |
T6279 |
amod |
articular,regions |
| R3923 |
T6281 |
T6279 |
prep |
of,regions |
| R3924 |
T6282 |
T6283 |
compound |
mutant,animals |
| R3925 |
T6283 |
T6281 |
pobj |
animals,of |
| R3926 |
T6284 |
T6266 |
punct |
.,began |
| R3927 |
T6286 |
T6287 |
det |
The,expression |
| R3928 |
T6287 |
T6288 |
nsubjpass |
expression,reduced |
| R3929 |
T6289 |
T6287 |
prep |
of,expression |
| R3930 |
T6290 |
T6289 |
pobj |
Col2a1,of |
| R3931 |
T6291 |
T6288 |
auxpass |
was,reduced |
| R3932 |
T6292 |
T6288 |
prep |
throughout,reduced |
| R3933 |
T6293 |
T6294 |
det |
the,surfaces |
| R3934 |
T6294 |
T6292 |
pobj |
surfaces,throughout |
| R3935 |
T6295 |
T6294 |
amod |
articular,surfaces |
| R3936 |
T6296 |
T6294 |
prep |
of,surfaces |
| R3937 |
T6297 |
T6298 |
det |
the,carpals |
| R3938 |
T6298 |
T6296 |
pobj |
carpals,of |
| R3939 |
T6299 |
T6298 |
punct |
", ",carpals |
| R3940 |
T6300 |
T6298 |
conj |
metacarpals,carpals |
| R3941 |
T6301 |
T6300 |
punct |
", ",metacarpals |
| R3942 |
T6302 |
T6300 |
cc |
and,metacarpals |
| R3943 |
T6303 |
T6300 |
conj |
phalanges,metacarpals |
| R3944 |
T6304 |
T6298 |
prep |
of,carpals |
| R3945 |
T6305 |
T6306 |
det |
the,forefeet |
| R3946 |
T6306 |
T6304 |
pobj |
forefeet,of |
| R3947 |
T6307 |
T6308 |
punct |
(,data |
| R3948 |
T6308 |
T6288 |
meta |
data,reduced |
| R3949 |
T6309 |
T6308 |
amod |
unpublished,data |
| R3950 |
T6310 |
T6308 |
punct |
),data |
| R3951 |
T6311 |
T6288 |
punct |
.,reduced |
| R3952 |
T6313 |
T6314 |
advmod |
Less,severe |
| R3953 |
T6314 |
T6315 |
amod |
severe,reductions |
| R3954 |
T6315 |
T6316 |
nsubjpass |
reductions,seen |
| R3955 |
T6317 |
T6316 |
auxpass |
were,seen |
| R3956 |
T6318 |
T6316 |
advmod |
also,seen |
| R3957 |
T6319 |
T6316 |
prep |
in,seen |
| R3958 |
T6320 |
T6321 |
amod |
articular,cells |
| R3959 |
T6321 |
T6319 |
pobj |
cells,in |
| R3960 |
T6322 |
T6321 |
prep |
of,cells |
| R3961 |
T6323 |
T6322 |
pobj |
tarsals,of |
| R3962 |
T6324 |
T6323 |
cc |
and,tarsals |
| R3963 |
T6325 |
T6323 |
conj |
metatarsals,tarsals |
| R3964 |
T6326 |
T6323 |
prep |
in,tarsals |
| R3965 |
T6327 |
T6328 |
det |
the,hindfeet |
| R3966 |
T6328 |
T6326 |
pobj |
hindfeet,in |
| R3967 |
T6329 |
T6330 |
punct |
(,data |
| R3968 |
T6330 |
T6316 |
meta |
data,seen |
| R3969 |
T6331 |
T6330 |
amod |
unpublished,data |
| R3970 |
T6332 |
T6330 |
punct |
),data |
| R3971 |
T6333 |
T6316 |
punct |
.,seen |
| R3972 |
T6335 |
T6336 |
prep |
By,reduced |
| R3973 |
T6337 |
T6338 |
nummod |
2,wk |
| R3974 |
T6338 |
T6335 |
pobj |
wk,By |
| R3975 |
T6339 |
T6338 |
prep |
of,wk |
| R3976 |
T6340 |
T6339 |
pobj |
age,of |
| R3977 |
T6341 |
T6336 |
punct |
", ",reduced |
| R3978 |
T6342 |
T6343 |
compound |
Col2a1,expression |
| R3979 |
T6343 |
T6336 |
nsubjpass |
expression,reduced |
| R3980 |
T6344 |
T6336 |
auxpass |
was,reduced |
| R3981 |
T6345 |
T6336 |
prep |
in,reduced |
| R3982 |
T6346 |
T6347 |
amod |
most,cells |
| R3983 |
T6347 |
T6345 |
pobj |
cells,in |
| R3984 |
T6348 |
T6347 |
prep |
of,cells |
| R3985 |
T6349 |
T6350 |
det |
the,region |
| R3986 |
T6350 |
T6348 |
pobj |
region,of |
| R3987 |
T6351 |
T6350 |
amod |
articular,region |
| R3988 |
T6352 |
T6353 |
punct |
(,Figure |
| R3989 |
T6353 |
T6336 |
parataxis |
Figure,reduced |
| R3990 |
T6354 |
T6353 |
nummod |
5L,Figure |
| R3991 |
T6355 |
T6353 |
cc |
and,Figure |
| R3992 |
T6356 |
T6353 |
conj |
5Q,Figure |
| R3993 |
T6357 |
T6353 |
punct |
),Figure |
| R3994 |
T6358 |
T6336 |
punct |
", ",reduced |
| R3995 |
T6359 |
T6336 |
advcl |
accompanied,reduced |
| R3996 |
T6360 |
T6359 |
agent |
by,accompanied |
| R3997 |
T6361 |
T6362 |
advmod |
markedly,reduced |
| R3998 |
T6362 |
T6363 |
amod |
reduced,staining |
| R3999 |
T6363 |
T6360 |
pobj |
staining,by |
| R4000 |
T6364 |
T6365 |
compound |
Safranin,O |
| R4001 |
T6365 |
T6363 |
compound |
O,staining |
| R4002 |
T6366 |
T6367 |
punct |
(,Figure |
| R4003 |
T6367 |
T6363 |
parataxis |
Figure,staining |
| R4004 |
T6368 |
T6367 |
nummod |
5K,Figure |
| R4005 |
T6369 |
T6367 |
cc |
and,Figure |
| R4006 |
T6370 |
T6367 |
conj |
5P,Figure |
| R4007 |
T6371 |
T6367 |
punct |
),Figure |
| R4008 |
T6372 |
T6363 |
punct |
", ",staining |
| R4009 |
T6373 |
T6363 |
cc |
and,staining |
| R4010 |
T6374 |
T6375 |
amod |
decreased,expression |
| R4011 |
T6375 |
T6363 |
conj |
expression,staining |
| R4012 |
T6376 |
T6375 |
prep |
of,expression |
| R4013 |
T6377 |
T6376 |
pobj |
Agg,of |
| R4014 |
T6378 |
T6377 |
cc |
and,Agg |
| R4015 |
T6379 |
T6380 |
nummod |
two,genes |
| R4016 |
T6380 |
T6377 |
conj |
genes,Agg |
| R4017 |
T6381 |
T6382 |
advmod |
normally,expressed |
| R4018 |
T6382 |
T6380 |
acl |
expressed,genes |
| R4019 |
T6383 |
T6382 |
prep |
in,expressed |
| R4020 |
T6384 |
T6385 |
advmod |
more,mature |
| R4021 |
T6385 |
T6386 |
amod |
mature,cells |
| R4022 |
T6386 |
T6383 |
pobj |
cells,in |
| R4023 |
T6387 |
T6388 |
amod |
articular,cartilage |
| R4024 |
T6388 |
T6386 |
compound |
cartilage,cells |
| R4025 |
T6389 |
T6380 |
punct |
", ",genes |
| R4026 |
T6390 |
T6380 |
appos |
Collagen,genes |
| R4027 |
T6391 |
T6390 |
nummod |
3,Collagen |
| R4028 |
T6392 |
T6390 |
punct |
(,Collagen |
| R4029 |
T6393 |
T6390 |
appos |
Col3a1,Collagen |
| R4030 |
T6394 |
T6390 |
punct |
),Collagen |
| R4031 |
T6395 |
T6390 |
cc |
and,Collagen |
| R4032 |
T6396 |
T6390 |
conj |
Collagen,Collagen |
| R4033 |
T6397 |
T6396 |
nummod |
10,Collagen |
| R4034 |
T6398 |
T6396 |
punct |
(,Collagen |
| R4035 |
T6399 |
T6396 |
appos |
Col10a1,Collagen |
| R4036 |
T6400 |
T6396 |
punct |
),Collagen |
| R4037 |
T6401 |
T6402 |
punct |
(,Figure |
| R4038 |
T6402 |
T6336 |
parataxis |
Figure,reduced |
| R4039 |
T6403 |
T6402 |
nummod |
5M,Figure |
| R4040 |
T6404 |
T6402 |
cc |
and,Figure |
| R4041 |
T6405 |
T6402 |
conj |
5R,Figure |
| R4042 |
T6406 |
T6402 |
punct |
),Figure |
| R4043 |
T6407 |
T6408 |
punct |
(,data |
| R4044 |
T6408 |
T6336 |
meta |
data,reduced |
| R4045 |
T6409 |
T6408 |
amod |
unpublished,data |
| R4046 |
T6410 |
T6408 |
punct |
),data |
| R4047 |
T6411 |
T6412 |
punct |
(,Eyre |
| R4048 |
T6412 |
T6336 |
meta |
Eyre,reduced |
| R4049 |
T6413 |
T6412 |
nummod |
2002,Eyre |
| R4050 |
T6414 |
T6412 |
punct |
),Eyre |
| R4051 |
T6415 |
T6336 |
punct |
.,reduced |
| R4052 |
T6417 |
T6418 |
nsubjpass |
Inhibition,reported |
| R4053 |
T6419 |
T6417 |
prep |
of,Inhibition |
| R4054 |
T6420 |
T6421 |
compound |
BMP,signaling |
| R4055 |
T6421 |
T6419 |
pobj |
signaling,of |
| R4056 |
T6422 |
T6417 |
prep |
in,Inhibition |
| R4057 |
T6423 |
T6424 |
amod |
cultured,chondrocytes |
| R4058 |
T6424 |
T6422 |
pobj |
chondrocytes,in |
| R4059 |
T6425 |
T6418 |
aux |
has,reported |
| R4060 |
T6426 |
T6418 |
advmod |
previously,reported |
| R4061 |
T6427 |
T6418 |
auxpass |
been,reported |
| R4062 |
T6428 |
T6429 |
aux |
to,induce |
| R4063 |
T6429 |
T6418 |
xcomp |
induce,reported |
| R4064 |
T6430 |
T6431 |
nmod |
Collagen,expression |
| R4065 |
T6431 |
T6429 |
dobj |
expression,induce |
| R4066 |
T6432 |
T6430 |
nummod |
1,Collagen |
| R4067 |
T6433 |
T6430 |
punct |
(,Collagen |
| R4068 |
T6434 |
T6430 |
appos |
Col1a1,Collagen |
| R4069 |
T6435 |
T6430 |
punct |
),Collagen |
| R4070 |
T6436 |
T6429 |
punct |
", ",induce |
| R4071 |
T6437 |
T6429 |
conj |
increase,induce |
| R4072 |
T6438 |
T6437 |
dobj |
proliferation,increase |
| R4073 |
T6439 |
T6437 |
punct |
", ",increase |
| R4074 |
T6440 |
T6437 |
cc |
and,increase |
| R4075 |
T6441 |
T6437 |
conj |
result,increase |
| R4076 |
T6442 |
T6441 |
prep |
in,result |
| R4077 |
T6443 |
T6442 |
pobj |
cells,in |
| R4078 |
T6444 |
T6443 |
prep |
with,cells |
| R4079 |
T6445 |
T6446 |
amod |
flattened,morphology |
| R4080 |
T6446 |
T6444 |
pobj |
morphology,with |
| R4081 |
T6447 |
T6446 |
punct |
", ",morphology |
| R4082 |
T6448 |
T6449 |
npadvmod |
fibroblast,like |
| R4083 |
T6449 |
T6446 |
amod |
like,morphology |
| R4084 |
T6450 |
T6449 |
punct |
-,like |
| R4085 |
T6451 |
T6452 |
punct |
(,Enomoto |
| R4086 |
T6452 |
T6418 |
meta |
Enomoto,reported |
| R4087 |
T6453 |
T6452 |
punct |
-,Enomoto |
| R4088 |
T6454 |
T6452 |
nmod |
Iwamoto,Enomoto |
| R4089 |
T6455 |
T6452 |
nmod |
et,Enomoto |
| R4090 |
T6456 |
T6452 |
nmod |
al.,Enomoto |
| R4091 |
T6457 |
T6452 |
nummod |
1998,Enomoto |
| R4092 |
T6458 |
T6452 |
punct |
),Enomoto |
| R4093 |
T6459 |
T6418 |
punct |
.,reported |
| R4094 |
T6461 |
T6462 |
advmod |
However,saw |
| R4095 |
T6463 |
T6462 |
punct |
", ",saw |
| R4096 |
T6464 |
T6462 |
nsubj |
we,saw |
| R4097 |
T6465 |
T6466 |
det |
no,increase |
| R4098 |
T6466 |
T6462 |
dobj |
increase,saw |
| R4099 |
T6467 |
T6466 |
prep |
in,increase |
| R4100 |
T6468 |
T6469 |
det |
the,expression |
| R4101 |
T6469 |
T6467 |
pobj |
expression,in |
| R4102 |
T6470 |
T6469 |
prep |
of,expression |
| R4103 |
T6471 |
T6470 |
pobj |
Col1a1,of |
| R4104 |
T6472 |
T6466 |
prep |
in,increase |
| R4105 |
T6473 |
T6474 |
nmod |
mutant,cartilage |
| R4106 |
T6474 |
T6472 |
pobj |
cartilage,in |
| R4107 |
T6475 |
T6474 |
amod |
articular,cartilage |
| R4108 |
T6476 |
T6462 |
punct |
", ",saw |
| R4109 |
T6477 |
T6462 |
cc |
and,saw |
| R4110 |
T6478 |
T6479 |
det |
no,proliferation |
| R4111 |
T6479 |
T6480 |
nsubjpass |
proliferation,detected |
| R4112 |
T6480 |
T6462 |
conj |
detected,saw |
| R4113 |
T6481 |
T6480 |
auxpass |
was,detected |
| R4114 |
T6482 |
T6480 |
prep |
in,detected |
| R4115 |
T6483 |
T6484 |
amod |
articular,cells |
| R4116 |
T6484 |
T6482 |
pobj |
cells,in |
| R4117 |
T6485 |
T6484 |
prep |
of,cells |
| R4118 |
T6486 |
T6487 |
preconj |
either,mutant |
| R4119 |
T6487 |
T6488 |
amod |
mutant,animals |
| R4120 |
T6488 |
T6485 |
pobj |
animals,of |
| R4121 |
T6489 |
T6487 |
cc |
or,mutant |
| R4122 |
T6490 |
T6487 |
conj |
control,mutant |
| R4123 |
T6491 |
T6492 |
punct |
(,data |
| R4124 |
T6492 |
T6480 |
meta |
data,detected |
| R4125 |
T6493 |
T6492 |
amod |
unpublished,data |
| R4126 |
T6494 |
T6492 |
punct |
),data |
| R4127 |
T6495 |
T6480 |
punct |
.,detected |
| R4128 |
T6497 |
T6498 |
mark |
While,detected |
| R4129 |
T6498 |
T6504 |
advcl |
detected,observed |
| R4130 |
T6499 |
T6500 |
amod |
recombined,expression |
| R4131 |
T6500 |
T6498 |
nsubjpass |
expression,detected |
| R4132 |
T6501 |
T6502 |
compound |
LACZ,marker |
| R4133 |
T6502 |
T6500 |
compound |
marker,expression |
| R4134 |
T6503 |
T6498 |
auxpass |
was,detected |
| R4135 |
T6505 |
T6498 |
prep |
in,detected |
| R4136 |
T6506 |
T6507 |
amod |
most,cells |
| R4137 |
T6507 |
T6505 |
pobj |
cells,in |
| R4138 |
T6508 |
T6509 |
amod |
articular,cartilage |
| R4139 |
T6509 |
T6507 |
compound |
cartilage,cells |
| R4140 |
T6510 |
T6504 |
punct |
", ",observed |
| R4141 |
T6511 |
T6504 |
nsubjpass |
it,observed |
| R4142 |
T6512 |
T6504 |
auxpass |
was,observed |
| R4143 |
T6513 |
T6504 |
advmod |
also,observed |
| R4144 |
T6514 |
T6504 |
prep |
in,observed |
| R4145 |
T6515 |
T6516 |
amod |
scattered,chondrocytes |
| R4146 |
T6516 |
T6514 |
pobj |
chondrocytes,in |
| R4147 |
T6517 |
T6516 |
amod |
subarticular,chondrocytes |
| R4148 |
T6518 |
T6516 |
punct |
", ",chondrocytes |
| R4149 |
T6519 |
T6520 |
compound |
growth,plate |
| R4150 |
T6520 |
T6521 |
compound |
plate,chondrocytes |
| R4151 |
T6521 |
T6516 |
conj |
chondrocytes,chondrocytes |
| R4152 |
T6522 |
T6521 |
punct |
", ",chondrocytes |
| R4153 |
T6523 |
T6521 |
cc |
and,chondrocytes |
| R4154 |
T6524 |
T6521 |
conj |
osteoblasts,chondrocytes |
| R4155 |
T6525 |
T6526 |
punct |
(,Figure |
| R4156 |
T6526 |
T6504 |
parataxis |
Figure,observed |
| R4157 |
T6527 |
T6526 |
nummod |
5O,Figure |
| R4158 |
T6528 |
T6526 |
cc |
and,Figure |
| R4159 |
T6529 |
T6526 |
conj |
5T,Figure |
| R4160 |
T6530 |
T6526 |
punct |
),Figure |
| R4161 |
T6531 |
T6532 |
punct |
(,data |
| R4162 |
T6532 |
T6504 |
meta |
data,observed |
| R4163 |
T6533 |
T6532 |
amod |
unpublished,data |
| R4164 |
T6534 |
T6532 |
punct |
),data |
| R4165 |
T6535 |
T6504 |
punct |
.,observed |
| R4166 |
T6537 |
T6538 |
mark |
Although,implies |
| R4167 |
T6538 |
T6540 |
advcl |
implies,confined |
| R4168 |
T6539 |
T6538 |
nsubj |
this,implies |
| R4169 |
T6541 |
T6542 |
mark |
that,was |
| R4170 |
T6542 |
T6538 |
ccomp |
was,implies |
| R4171 |
T6543 |
T6544 |
compound |
BMP,signaling |
| R4172 |
T6544 |
T6542 |
nsubj |
signaling,was |
| R4173 |
T6545 |
T6542 |
acomp |
defective,was |
| R4174 |
T6546 |
T6542 |
prep |
in,was |
| R4175 |
T6547 |
T6548 |
amod |
multiple,types |
| R4176 |
T6548 |
T6546 |
pobj |
types,in |
| R4177 |
T6549 |
T6548 |
compound |
cell,types |
| R4178 |
T6550 |
T6540 |
punct |
", ",confined |
| R4179 |
T6551 |
T6552 |
det |
the,defects |
| R4180 |
T6552 |
T6540 |
nsubjpass |
defects,confined |
| R4181 |
T6553 |
T6552 |
amod |
observed,defects |
| R4182 |
T6554 |
T6540 |
auxpass |
were,confined |
| R4183 |
T6555 |
T6540 |
prep |
to,confined |
| R4184 |
T6556 |
T6557 |
det |
the,cartilage |
| R4185 |
T6557 |
T6555 |
pobj |
cartilage,to |
| R4186 |
T6558 |
T6557 |
amod |
articular,cartilage |
| R4187 |
T6559 |
T6540 |
punct |
.,confined |
| R4188 |
T6561 |
T6562 |
prep |
For,appeared |
| R4189 |
T6563 |
T6561 |
pobj |
example,For |
| R4190 |
T6564 |
T6562 |
punct |
", ",appeared |
| R4191 |
T6565 |
T6566 |
nmod |
Osteocalcin,expression |
| R4192 |
T6566 |
T6562 |
nsubj |
expression,appeared |
| R4193 |
T6567 |
T6565 |
cc |
and,Osteocalcin |
| R4194 |
T6568 |
T6565 |
conj |
Col1a1,Osteocalcin |
| R4195 |
T6569 |
T6562 |
oprd |
normal,appeared |
| R4196 |
T6570 |
T6562 |
prep |
in,appeared |
| R4197 |
T6571 |
T6570 |
pobj |
osteoblasts,in |
| R4198 |
T6572 |
T6573 |
punct |
(,data |
| R4199 |
T6573 |
T6562 |
meta |
data,appeared |
| R4200 |
T6574 |
T6573 |
amod |
unpublished,data |
| R4201 |
T6575 |
T6573 |
punct |
),data |
| R4202 |
T6576 |
T6562 |
punct |
.,appeared |
| R4203 |
T6578 |
T6579 |
advmod |
Together,suggest |
| R4204 |
T6580 |
T6579 |
punct |
", ",suggest |
| R4205 |
T6581 |
T6582 |
det |
these,data |
| R4206 |
T6582 |
T6579 |
nsubj |
data,suggest |
| R4207 |
T6583 |
T6584 |
mark |
that,required |
| R4208 |
T6584 |
T6579 |
ccomp |
required,suggest |
| R4209 |
T6585 |
T6586 |
compound |
BMPR1A,activity |
| R4210 |
T6586 |
T6584 |
nsubjpass |
activity,required |
| R4211 |
T6587 |
T6584 |
auxpass |
is,required |
| R4212 |
T6588 |
T6584 |
prep |
in,required |
| R4213 |
T6589 |
T6590 |
amod |
postnatal,cartilage |
| R4214 |
T6590 |
T6588 |
pobj |
cartilage,in |
| R4215 |
T6591 |
T6592 |
npadvmod |
joint,articular |
| R4216 |
T6592 |
T6590 |
amod |
articular,cartilage |
| R4217 |
T6593 |
T6594 |
aux |
to,maintain |
| R4218 |
T6594 |
T6584 |
advcl |
maintain,required |
| R4219 |
T6595 |
T6594 |
dobj |
expression,maintain |
| R4220 |
T6596 |
T6595 |
prep |
of,expression |
| R4221 |
T6597 |
T6598 |
amod |
many,genes |
| R4222 |
T6598 |
T6596 |
pobj |
genes,of |
| R4223 |
T6599 |
T6598 |
acl |
encoding,genes |
| R4224 |
T6600 |
T6601 |
amod |
structural,components |
| R4225 |
T6601 |
T6599 |
dobj |
components,encoding |
| R4226 |
T6602 |
T6601 |
prep |
of,components |
| R4227 |
T6603 |
T6604 |
compound |
cartilage,matrix |
| R4228 |
T6604 |
T6602 |
pobj |
matrix,of |
| R4229 |
T6605 |
T6579 |
punct |
.,suggest |
| R4230 |
T6607 |
T6608 |
amod |
Previous,studies |
| R4231 |
T6608 |
T6609 |
nsubj |
studies,shown |
| R4232 |
T6610 |
T6609 |
aux |
have,shown |
| R4233 |
T6611 |
T6612 |
mark |
that,required |
| R4234 |
T6612 |
T6609 |
ccomp |
required,shown |
| R4235 |
T6613 |
T6612 |
nsubjpass |
Sox9,required |
| R4236 |
T6614 |
T6612 |
auxpass |
is,required |
| R4237 |
T6615 |
T6612 |
prep |
for,required |
| R4238 |
T6616 |
T6617 |
amod |
normal,differentiation |
| R4239 |
T6617 |
T6615 |
pobj |
differentiation,for |
| R4240 |
T6618 |
T6617 |
compound |
cartilage,differentiation |
| R4241 |
T6619 |
T6615 |
punct |
", ",for |
| R4242 |
T6620 |
T6615 |
prep |
for,for |
| R4243 |
T6621 |
T6620 |
pobj |
expression,for |
| R4244 |
T6622 |
T6621 |
prep |
of,expression |
| R4245 |
T6623 |
T6624 |
nmod |
cartilage,matrix |
| R4246 |
T6624 |
T6626 |
nmod |
matrix,genes |
| R4247 |
T6625 |
T6624 |
amod |
extracellular,matrix |
| R4248 |
T6626 |
T6622 |
pobj |
genes,of |
| R4249 |
T6627 |
T6624 |
punct |
(,matrix |
| R4250 |
T6628 |
T6624 |
appos |
ECM,matrix |
| R4251 |
T6629 |
T6624 |
punct |
),matrix |
| R4252 |
T6630 |
T6626 |
prep |
including,genes |
| R4253 |
T6631 |
T6630 |
pobj |
Agg,including |
| R4254 |
T6632 |
T6612 |
punct |
", ",required |
| R4255 |
T6633 |
T6612 |
cc |
and,required |
| R4256 |
T6634 |
T6612 |
conj |
is,required |
| R4257 |
T6635 |
T6636 |
det |
a,regulator |
| R4258 |
T6636 |
T6634 |
attr |
regulator,is |
| R4259 |
T6637 |
T6636 |
amod |
direct,regulator |
| R4260 |
T6638 |
T6636 |
amod |
transcriptional,regulator |
| R4261 |
T6639 |
T6636 |
prep |
of,regulator |
| R4262 |
T6640 |
T6641 |
det |
the,Col2a1 |
| R4263 |
T6641 |
T6639 |
pobj |
Col2a1,of |
| R4264 |
T6642 |
T6641 |
amod |
key,Col2a1 |
| R4265 |
T6643 |
T6644 |
compound |
cartilage,matrix |
| R4266 |
T6644 |
T6641 |
compound |
matrix,Col2a1 |
| R4267 |
T6645 |
T6641 |
compound |
gene,Col2a1 |
| R4268 |
T6646 |
T6647 |
punct |
(,Bell |
| R4269 |
T6647 |
T6634 |
meta |
Bell,is |
| R4270 |
T6648 |
T6647 |
nmod |
et,Bell |
| R4271 |
T6649 |
T6647 |
nmod |
al.,Bell |
| R4272 |
T6650 |
T6647 |
nummod |
1997,Bell |
| R4273 |
T6651 |
T6647 |
punct |
;,Bell |
| R4274 |
T6652 |
T6647 |
nmod |
Lefebvre,Bell |
| R4275 |
T6653 |
T6647 |
nmod |
et,Bell |
| R4276 |
T6654 |
T6647 |
nmod |
al.,Bell |
| R4277 |
T6655 |
T6647 |
nummod |
1997,Bell |
| R4278 |
T6656 |
T6647 |
punct |
;,Bell |
| R4279 |
T6657 |
T6647 |
nmod |
Bi,Bell |
| R4280 |
T6658 |
T6647 |
nmod |
et,Bell |
| R4281 |
T6659 |
T6647 |
nmod |
al.,Bell |
| R4282 |
T6660 |
T6647 |
nummod |
1999,Bell |
| R4283 |
T6661 |
T6647 |
punct |
;,Bell |
| R4284 |
T6662 |
T6647 |
nmod |
Sekiya,Bell |
| R4285 |
T6663 |
T6647 |
nmod |
et,Bell |
| R4286 |
T6664 |
T6647 |
nmod |
al.,Bell |
| R4287 |
T6665 |
T6647 |
nummod |
2000,Bell |
| R4288 |
T6666 |
T6647 |
punct |
),Bell |
| R4289 |
T6667 |
T6609 |
punct |
.,shown |
| R4290 |
T6669 |
T6670 |
advmod |
Notably,was |
| R4291 |
T6671 |
T6670 |
punct |
", ",was |
| R4292 |
T6672 |
T6670 |
prep |
despite,was |
| R4293 |
T6673 |
T6674 |
amod |
reduced,expression |
| R4294 |
T6674 |
T6672 |
pobj |
expression,despite |
| R4295 |
T6675 |
T6674 |
prep |
of,expression |
| R4296 |
T6676 |
T6677 |
amod |
many,genes |
| R4297 |
T6677 |
T6675 |
pobj |
genes,of |
| R4298 |
T6678 |
T6679 |
compound |
cartilage,matrix |
| R4299 |
T6679 |
T6677 |
compound |
matrix,genes |
| R4300 |
T6680 |
T6677 |
compound |
marker,genes |
| R4301 |
T6681 |
T6674 |
prep |
in,expression |
| R4302 |
T6682 |
T6683 |
npadvmod |
Bmpr1a,mutant |
| R4303 |
T6683 |
T6684 |
amod |
mutant,mice |
| R4304 |
T6684 |
T6681 |
pobj |
mice,in |
| R4305 |
T6685 |
T6670 |
punct |
", ",was |
| R4306 |
T6686 |
T6687 |
det |
the,protein |
| R4307 |
T6687 |
T6670 |
nsubj |
protein,was |
| R4308 |
T6688 |
T6687 |
compound |
SOX9,protein |
| R4309 |
T6689 |
T6670 |
acomp |
present,was |
| R4310 |
T6690 |
T6670 |
prep |
at,was |
| R4311 |
T6691 |
T6692 |
amod |
normal,levels |
| R4312 |
T6692 |
T6690 |
pobj |
levels,at |
| R4313 |
T6693 |
T6670 |
prep |
in,was |
| R4314 |
T6694 |
T6695 |
amod |
articular,regions |
| R4315 |
T6695 |
T6693 |
pobj |
regions,in |
| R4316 |
T6696 |
T6670 |
prep |
at,was |
| R4317 |
T6697 |
T6698 |
det |
all,stages |
| R4318 |
T6698 |
T6696 |
pobj |
stages,at |
| R4319 |
T6699 |
T6698 |
acl |
examined,stages |
| R4320 |
T6700 |
T6698 |
punct |
", ",stages |
| R4321 |
T6701 |
T6698 |
prep |
including,stages |
| R4322 |
T6702 |
T6703 |
amod |
newborn,mice |
| R4323 |
T6703 |
T6701 |
pobj |
mice,including |
| R4324 |
T6704 |
T6702 |
punct |
", ",newborn |
| R4325 |
T6705 |
T6706 |
nummod |
2,wk |
| R4326 |
T6706 |
T6708 |
npadvmod |
wk,old |
| R4327 |
T6707 |
T6706 |
punct |
-,wk |
| R4328 |
T6708 |
T6702 |
conj |
old,newborn |
| R4329 |
T6709 |
T6708 |
punct |
-,old |
| R4330 |
T6710 |
T6708 |
punct |
", ",old |
| R4331 |
T6711 |
T6712 |
nummod |
7,wk |
| R4332 |
T6712 |
T6714 |
npadvmod |
wk,old |
| R4333 |
T6713 |
T6712 |
punct |
-,wk |
| R4334 |
T6714 |
T6708 |
conj |
old,old |
| R4335 |
T6715 |
T6714 |
punct |
-,old |
| R4336 |
T6716 |
T6714 |
punct |
", ",old |
| R4337 |
T6717 |
T6714 |
cc |
and,old |
| R4338 |
T6718 |
T6719 |
nummod |
9,mo |
| R4339 |
T6719 |
T6721 |
npadvmod |
mo,old |
| R4340 |
T6720 |
T6719 |
punct |
-,mo |
| R4341 |
T6721 |
T6714 |
conj |
old,old |
| R4342 |
T6722 |
T6721 |
punct |
-,old |
| R4343 |
T6723 |
T6724 |
punct |
(,Figure |
| R4344 |
T6724 |
T6670 |
parataxis |
Figure,was |
| R4345 |
T6725 |
T6724 |
nummod |
5N,Figure |
| R4346 |
T6726 |
T6724 |
cc |
and,Figure |
| R4347 |
T6727 |
T6724 |
conj |
5S,Figure |
| R4348 |
T6728 |
T6724 |
punct |
),Figure |
| R4349 |
T6729 |
T6730 |
punct |
(,data |
| R4350 |
T6730 |
T6670 |
meta |
data,was |
| R4351 |
T6731 |
T6730 |
amod |
unpublished,data |
| R4352 |
T6732 |
T6730 |
punct |
),data |
| R4353 |
T6733 |
T6670 |
punct |
.,was |
| R4354 |
T6897 |
T6898 |
amod |
Synovial,Hypertrophy |
| R4355 |
T6899 |
T6898 |
punct |
", ",Hypertrophy |
| R4356 |
T6900 |
T6901 |
compound |
Cartilage,Erosion |
| R4357 |
T6901 |
T6898 |
conj |
Erosion,Hypertrophy |
| R4358 |
T6902 |
T6901 |
punct |
", ",Erosion |
| R4359 |
T6903 |
T6901 |
cc |
and,Erosion |
| R4360 |
T6904 |
T6905 |
amod |
Accelerated,Maturation |
| R4361 |
T6905 |
T6901 |
conj |
Maturation,Erosion |
| R4362 |
T6906 |
T6905 |
compound |
Cartilage,Maturation |
| R4363 |
T6908 |
T6909 |
amod |
Conditional,loss |
| R4364 |
T6909 |
T6910 |
nsubj |
loss,led |
| R4365 |
T6911 |
T6909 |
prep |
of,loss |
| R4366 |
T6912 |
T6911 |
pobj |
Bmpr1a,of |
| R4367 |
T6913 |
T6910 |
prep |
to,led |
| R4368 |
T6914 |
T6915 |
amod |
marked,hypertrophy |
| R4369 |
T6915 |
T6913 |
pobj |
hypertrophy,to |
| R4370 |
T6916 |
T6915 |
prep |
of,hypertrophy |
| R4371 |
T6917 |
T6918 |
det |
the,membrane |
| R4372 |
T6918 |
T6916 |
pobj |
membrane,of |
| R4373 |
T6919 |
T6918 |
amod |
synovial,membrane |
| R4374 |
T6920 |
T6915 |
prep |
in,hypertrophy |
| R4375 |
T6921 |
T6922 |
det |
the,capsule |
| R4376 |
T6922 |
T6920 |
pobj |
capsule,in |
| R4377 |
T6923 |
T6922 |
compound |
joint,capsule |
| R4378 |
T6924 |
T6922 |
prep |
of,capsule |
| R4379 |
T6925 |
T6926 |
det |
some,joints |
| R4380 |
T6926 |
T6924 |
pobj |
joints,of |
| R4381 |
T6927 |
T6915 |
punct |
", ",hypertrophy |
| R4382 |
T6928 |
T6929 |
advmod |
particularly,in |
| R4383 |
T6929 |
T6915 |
prep |
in,hypertrophy |
| R4384 |
T6930 |
T6931 |
det |
the,region |
| R4385 |
T6931 |
T6929 |
pobj |
region,in |
| R4386 |
T6932 |
T6931 |
compound |
ankle,region |
| R4387 |
T6933 |
T6910 |
punct |
.,led |
| R4388 |
T6935 |
T6936 |
prep |
In,grew |
| R4389 |
T6937 |
T6938 |
det |
the,joints |
| R4390 |
T6938 |
T6935 |
pobj |
joints,In |
| R4391 |
T6939 |
T6940 |
advmod |
most,severely |
| R4392 |
T6940 |
T6941 |
advmod |
severely,affected |
| R4393 |
T6941 |
T6938 |
amod |
affected,joints |
| R4394 |
T6942 |
T6936 |
punct |
", ",grew |
| R4395 |
T6943 |
T6944 |
det |
the,membrane |
| R4396 |
T6944 |
T6936 |
nsubj |
membrane,grew |
| R4397 |
T6945 |
T6944 |
amod |
expanded,membrane |
| R4398 |
T6946 |
T6944 |
amod |
synovial,membrane |
| R4399 |
T6947 |
T6936 |
prep |
into,grew |
| R4400 |
T6948 |
T6949 |
det |
the,space |
| R4401 |
T6949 |
T6947 |
pobj |
space,into |
| R4402 |
T6950 |
T6949 |
compound |
joint,space |
| R4403 |
T6951 |
T6936 |
cc |
and,grew |
| R4404 |
T6952 |
T6953 |
auxpass |
was,associated |
| R4405 |
T6953 |
T6936 |
conj |
associated,grew |
| R4406 |
T6954 |
T6953 |
prep |
with,associated |
| R4407 |
T6955 |
T6956 |
amod |
obvious,loss |
| R4408 |
T6956 |
T6954 |
pobj |
loss,with |
| R4409 |
T6957 |
T6956 |
cc |
or,loss |
| R4410 |
T6958 |
T6956 |
conj |
erosion,loss |
| R4411 |
T6959 |
T6956 |
prep |
of,loss |
| R4412 |
T6960 |
T6961 |
det |
the,cartilage |
| R4413 |
T6961 |
T6959 |
pobj |
cartilage,of |
| R4414 |
T6962 |
T6961 |
amod |
articular,cartilage |
| R4415 |
T6963 |
T6964 |
punct |
(,arrows |
| R4416 |
T6964 |
T6953 |
parataxis |
arrows,associated |
| R4417 |
T6965 |
T6964 |
dep |
Figure,arrows |
| R4418 |
T6966 |
T6965 |
nummod |
6A,Figure |
| R4419 |
T6967 |
T6965 |
cc |
and,Figure |
| R4420 |
T6968 |
T6965 |
conj |
6B,Figure |
| R4421 |
T6969 |
T6964 |
punct |
", ",arrows |
| R4422 |
T6970 |
T6964 |
dep |
asterisks,arrows |
| R4423 |
T6971 |
T6964 |
punct |
", ",arrows |
| R4424 |
T6972 |
T6964 |
punct |
),arrows |
| R4425 |
T6973 |
T6936 |
punct |
.,grew |
| R4426 |
T6975 |
T6976 |
amod |
Accelerated,maturation |
| R4427 |
T6976 |
T6978 |
nsubjpass |
maturation,seen |
| R4428 |
T6977 |
T6976 |
compound |
cartilage,maturation |
| R4429 |
T6979 |
T6976 |
cc |
and,maturation |
| R4430 |
T6980 |
T6981 |
amod |
increased,expression |
| R4431 |
T6981 |
T6976 |
conj |
expression,maturation |
| R4432 |
T6982 |
T6981 |
prep |
of,expression |
| R4433 |
T6983 |
T6982 |
pobj |
Col10a1,of |
| R4434 |
T6984 |
T6978 |
auxpass |
was,seen |
| R4435 |
T6985 |
T6978 |
advmod |
frequently,seen |
| R4436 |
T6986 |
T6978 |
prep |
in,seen |
| R4437 |
T6987 |
T6988 |
det |
the,chondrocytes |
| R4438 |
T6988 |
T6986 |
pobj |
chondrocytes,in |
| R4439 |
T6989 |
T6988 |
acl |
underlying,chondrocytes |
| R4440 |
T6990 |
T6991 |
det |
the,erosions |
| R4441 |
T6991 |
T6989 |
dobj |
erosions,underlying |
| R4442 |
T6992 |
T6991 |
amod |
articular,erosions |
| R4443 |
T6993 |
T6994 |
punct |
(,brackets |
| R4444 |
T6994 |
T6978 |
parataxis |
brackets,seen |
| R4445 |
T6995 |
T6994 |
dep |
Figure,brackets |
| R4446 |
T6996 |
T6995 |
nummod |
6C,Figure |
| R4447 |
T6997 |
T6995 |
cc |
and,Figure |
| R4448 |
T6998 |
T6995 |
conj |
6D,Figure |
| R4449 |
T6999 |
T6994 |
punct |
", ",brackets |
| R4450 |
T7000 |
T6994 |
punct |
),brackets |
| R4451 |
T7001 |
T7002 |
punct |
(,data |
| R4452 |
T7002 |
T6978 |
meta |
data,seen |
| R4453 |
T7003 |
T7002 |
amod |
unpublished,data |
| R4454 |
T7004 |
T7002 |
punct |
),data |
| R4455 |
T7005 |
T6978 |
punct |
.,seen |
| R4456 |
T7007 |
T7008 |
advmod |
Interestingly,correspond |
| R4457 |
T7009 |
T7008 |
punct |
", ",correspond |
| R4458 |
T7010 |
T7011 |
det |
the,regions |
| R4459 |
T7011 |
T7008 |
nsubj |
regions,correspond |
| R4460 |
T7012 |
T7011 |
prep |
of,regions |
| R4461 |
T7013 |
T7014 |
amod |
increased,expression |
| R4462 |
T7014 |
T7012 |
pobj |
expression,of |
| R4463 |
T7015 |
T7014 |
compound |
Col10a1,expression |
| R4464 |
T7016 |
T7008 |
aux |
did,correspond |
| R4465 |
T7017 |
T7008 |
neg |
not,correspond |
| R4466 |
T7018 |
T7008 |
prep |
to,correspond |
| R4467 |
T7019 |
T7020 |
det |
the,regions |
| R4468 |
T7020 |
T7018 |
pobj |
regions,to |
| R4469 |
T7021 |
T7022 |
dep |
that,undergone |
| R4470 |
T7022 |
T7020 |
relcl |
undergone,regions |
| R4471 |
T7023 |
T7022 |
aux |
had,undergone |
| R4472 |
T7024 |
T7025 |
npadvmod |
Cre,mediated |
| R4473 |
T7025 |
T7027 |
amod |
mediated,recombination |
| R4474 |
T7026 |
T7025 |
punct |
-,mediated |
| R4475 |
T7027 |
T7022 |
dobj |
recombination,undergone |
| R4476 |
T7028 |
T7008 |
punct |
.,correspond |
| R4477 |
T7030 |
T7031 |
advmod |
Instead,seen |
| R4478 |
T7032 |
T7031 |
punct |
", ",seen |
| R4479 |
T7033 |
T7034 |
amod |
increased,expression |
| R4480 |
T7034 |
T7031 |
nsubjpass |
expression,seen |
| R4481 |
T7035 |
T7034 |
prep |
of,expression |
| R4482 |
T7036 |
T7035 |
pobj |
Col10a1,of |
| R4483 |
T7037 |
T7031 |
auxpass |
was,seen |
| R4484 |
T7038 |
T7031 |
prep |
in,seen |
| R4485 |
T7039 |
T7040 |
det |
a,zone |
| R4486 |
T7040 |
T7038 |
pobj |
zone,in |
| R4487 |
T7041 |
T7040 |
prep |
of,zone |
| R4488 |
T7042 |
T7043 |
advmod |
largely,cells |
| R4489 |
T7043 |
T7041 |
pobj |
cells,of |
| R4490 |
T7044 |
T7045 |
npadvmod |
LACZ,negative |
| R4491 |
T7045 |
T7043 |
amod |
negative,cells |
| R4492 |
T7046 |
T7045 |
punct |
-,negative |
| R4493 |
T7047 |
T7040 |
acl |
stretching,zone |
| R4494 |
T7048 |
T7047 |
prep |
from,stretching |
| R4495 |
T7049 |
T7050 |
det |
the,cartilage |
| R4496 |
T7050 |
T7048 |
pobj |
cartilage,from |
| R4497 |
T7051 |
T7050 |
amod |
adjacent,cartilage |
| R4498 |
T7052 |
T7051 |
prep |
to,adjacent |
| R4499 |
T7053 |
T7054 |
det |
the,front |
| R4500 |
T7054 |
T7052 |
pobj |
front,to |
| R4501 |
T7055 |
T7054 |
compound |
ossification,front |
| R4502 |
T7056 |
T7050 |
punct |
(,cartilage |
| R4503 |
T7057 |
T7058 |
advmod |
where,expressed |
| R4504 |
T7058 |
T7050 |
relcl |
expressed,cartilage |
| R4505 |
T7059 |
T7058 |
nsubjpass |
Col10a1,expressed |
| R4506 |
T7060 |
T7058 |
auxpass |
is,expressed |
| R4507 |
T7061 |
T7058 |
advmod |
normally,expressed |
| R4508 |
T7062 |
T7058 |
prep |
in,expressed |
| R4509 |
T7063 |
T7064 |
amod |
maturing,cells |
| R4510 |
T7064 |
T7062 |
pobj |
cells,in |
| R4511 |
T7065 |
T7064 |
compound |
cartilage,cells |
| R4512 |
T7066 |
T7050 |
punct |
),cartilage |
| R4513 |
T7067 |
T7047 |
punct |
", ",stretching |
| R4514 |
T7068 |
T7047 |
prep |
toward,stretching |
| R4515 |
T7069 |
T7070 |
det |
the,regions |
| R4516 |
T7070 |
T7068 |
pobj |
regions,toward |
| R4517 |
T7071 |
T7072 |
advmod |
where,was |
| R4518 |
T7072 |
T7070 |
relcl |
was,regions |
| R4519 |
T7073 |
T7074 |
nmod |
surface,cartilage |
| R4520 |
T7074 |
T7072 |
nsubj |
cartilage,was |
| R4521 |
T7075 |
T7074 |
amod |
articular,cartilage |
| R4522 |
T7076 |
T7077 |
advmod |
severely,eroded |
| R4523 |
T7077 |
T7072 |
acomp |
eroded,was |
| R4524 |
T7078 |
T7077 |
cc |
or,eroded |
| R4525 |
T7079 |
T7077 |
conj |
missing,eroded |
| R4526 |
T7080 |
T7081 |
punct |
(,arrowheads |
| R4527 |
T7081 |
T7072 |
parataxis |
arrowheads,was |
| R4528 |
T7082 |
T7081 |
dep |
Figure,arrowheads |
| R4529 |
T7083 |
T7082 |
nummod |
6A,Figure |
| R4530 |
T7084 |
T7082 |
cc |
and,Figure |
| R4531 |
T7085 |
T7082 |
conj |
6B,Figure |
| R4532 |
T7086 |
T7081 |
punct |
", ",arrowheads |
| R4533 |
T7087 |
T7081 |
punct |
),arrowheads |
| R4534 |
T7088 |
T7031 |
punct |
.,seen |
| R4535 |
T7090 |
T7091 |
amod |
Previous,studies |
| R4536 |
T7091 |
T7092 |
nsubj |
studies,suggest |
| R4537 |
T7093 |
T7094 |
mark |
that,inhibit |
| R4538 |
T7094 |
T7092 |
ccomp |
inhibit,suggest |
| R4539 |
T7095 |
T7096 |
compound |
parathyroid,hormone |
| R4540 |
T7096 |
T7097 |
npadvmod |
hormone,related |
| R4541 |
T7097 |
T7099 |
amod |
related,protein |
| R4542 |
T7098 |
T7097 |
punct |
-,related |
| R4543 |
T7099 |
T7094 |
nsubj |
protein,inhibit |
| R4544 |
T7100 |
T7099 |
punct |
", ",protein |
| R4545 |
T7101 |
T7102 |
det |
a,signal |
| R4546 |
T7102 |
T7099 |
appos |
signal,protein |
| R4547 |
T7103 |
T7102 |
amod |
diffusible,signal |
| R4548 |
T7104 |
T7102 |
acl |
made,signal |
| R4549 |
T7105 |
T7104 |
prep |
in,made |
| R4550 |
T7106 |
T7107 |
det |
the,surface |
| R4551 |
T7107 |
T7105 |
pobj |
surface,in |
| R4552 |
T7108 |
T7107 |
amod |
articular,surface |
| R4553 |
T7109 |
T7094 |
punct |
", ",inhibit |
| R4554 |
T7110 |
T7094 |
aux |
may,inhibit |
| R4555 |
T7111 |
T7094 |
advmod |
normally,inhibit |
| R4556 |
T7112 |
T7094 |
dobj |
maturation,inhibit |
| R4557 |
T7113 |
T7112 |
prep |
of,maturation |
| R4558 |
T7114 |
T7115 |
amod |
underlying,cartilage |
| R4559 |
T7115 |
T7113 |
pobj |
cartilage,of |
| R4560 |
T7116 |
T7117 |
punct |
(,Vortkamp |
| R4561 |
T7117 |
T7092 |
meta |
Vortkamp,suggest |
| R4562 |
T7118 |
T7117 |
nmod |
et,Vortkamp |
| R4563 |
T7119 |
T7117 |
nmod |
al.,Vortkamp |
| R4564 |
T7120 |
T7117 |
nummod |
1996,Vortkamp |
| R4565 |
T7121 |
T7117 |
punct |
;,Vortkamp |
| R4566 |
T7122 |
T7117 |
nmod |
Weir,Vortkamp |
| R4567 |
T7123 |
T7117 |
nmod |
et,Vortkamp |
| R4568 |
T7124 |
T7117 |
nmod |
al.,Vortkamp |
| R4569 |
T7125 |
T7117 |
nummod |
1996,Vortkamp |
| R4570 |
T7126 |
T7117 |
punct |
),Vortkamp |
| R4571 |
T7127 |
T7092 |
punct |
.,suggest |
| R4572 |
T7129 |
T7130 |
amod |
Local,loss |
| R4573 |
T7130 |
T7131 |
nsubj |
loss,remove |
| R4574 |
T7132 |
T7130 |
prep |
of,loss |
| R4575 |
T7133 |
T7134 |
det |
the,surface |
| R4576 |
T7134 |
T7132 |
pobj |
surface,of |
| R4577 |
T7135 |
T7134 |
amod |
articular,surface |
| R4578 |
T7136 |
T7131 |
aux |
could,remove |
| R4579 |
T7137 |
T7138 |
det |
this,inhibition |
| R4580 |
T7138 |
T7131 |
dobj |
inhibition,remove |
| R4581 |
T7139 |
T7131 |
cc |
and,remove |
| R4582 |
T7140 |
T7131 |
conj |
lead,remove |
| R4583 |
T7141 |
T7140 |
prep |
to,lead |
| R4584 |
T7142 |
T7143 |
det |
a,acceleration |
| R4585 |
T7143 |
T7141 |
pobj |
acceleration,to |
| R4586 |
T7144 |
T7145 |
npadvmod |
cell,nonautonomous |
| R4587 |
T7145 |
T7143 |
amod |
nonautonomous,acceleration |
| R4588 |
T7146 |
T7145 |
punct |
-,nonautonomous |
| R4589 |
T7147 |
T7143 |
prep |
of,acceleration |
| R4590 |
T7148 |
T7147 |
pobj |
maturation,of |
| R4591 |
T7149 |
T7140 |
prep |
in,lead |
| R4592 |
T7150 |
T7149 |
pobj |
chondrocytes,in |
| R4593 |
T7151 |
T7150 |
acl |
underlying,chondrocytes |
| R4594 |
T7152 |
T7151 |
dobj |
points,underlying |
| R4595 |
T7153 |
T7152 |
prep |
of,points |
| R4596 |
T7154 |
T7155 |
amod |
articular,erosion |
| R4597 |
T7155 |
T7153 |
pobj |
erosion,of |
| R4598 |
T7156 |
T7131 |
punct |
.,remove |
| R4599 |
T7158 |
T7159 |
det |
This,hypertrophy |
| R4600 |
T7159 |
T7161 |
nsubjpass |
hypertrophy,associated |
| R4601 |
T7160 |
T7159 |
amod |
synovial,hypertrophy |
| R4602 |
T7162 |
T7161 |
auxpass |
is,associated |
| R4603 |
T7163 |
T7161 |
prep |
with,associated |
| R4604 |
T7164 |
T7165 |
amod |
increased,numbers |
| R4605 |
T7165 |
T7163 |
pobj |
numbers,with |
| R4606 |
T7166 |
T7165 |
prep |
of,numbers |
| R4607 |
T7167 |
T7168 |
amod |
mononuclear,cells |
| R4608 |
T7168 |
T7166 |
pobj |
cells,of |
| R4609 |
T7169 |
T7168 |
acl |
resembling,cells |
| R4610 |
T7170 |
T7169 |
dobj |
synoviocytes,resembling |
| R4611 |
T7171 |
T7170 |
cc |
or,synoviocytes |
| R4612 |
T7172 |
T7170 |
conj |
macrophages,synoviocytes |
| R4613 |
T7173 |
T7170 |
punct |
", ",synoviocytes |
| R4614 |
T7174 |
T7175 |
compound |
cell,types |
| R4615 |
T7175 |
T7170 |
appos |
types,synoviocytes |
| R4616 |
T7176 |
T7177 |
dep |
that,are |
| R4617 |
T7177 |
T7175 |
relcl |
are,types |
| R4618 |
T7178 |
T7177 |
acomp |
difficult,are |
| R4619 |
T7179 |
T7180 |
aux |
to,distinguish |
| R4620 |
T7180 |
T7178 |
advcl |
distinguish,difficult |
| R4621 |
T7181 |
T7182 |
advmod |
even,with |
| R4622 |
T7182 |
T7180 |
prep |
with,distinguish |
| R4623 |
T7183 |
T7184 |
compound |
surface,markers |
| R4624 |
T7184 |
T7182 |
pobj |
markers,with |
| R4625 |
T7185 |
T7177 |
prep |
at,are |
| R4626 |
T7186 |
T7187 |
amod |
early,stages |
| R4627 |
T7187 |
T7185 |
pobj |
stages,at |
| R4628 |
T7188 |
T7187 |
amod |
postnatal,stages |
| R4629 |
T7189 |
T7161 |
punct |
.,associated |
| R4630 |
T7191 |
T7192 |
advmod |
However,observed |
| R4631 |
T7193 |
T7192 |
punct |
", ",observed |
| R4632 |
T7194 |
T7195 |
det |
no,neutrophils |
| R4633 |
T7195 |
T7192 |
nsubjpass |
neutrophils,observed |
| R4634 |
T7196 |
T7192 |
auxpass |
were,observed |
| R4635 |
T7197 |
T7192 |
punct |
", ",observed |
| R4636 |
T7198 |
T7192 |
advcl |
suggesting,observed |
| R4637 |
T7199 |
T7200 |
mark |
that,is |
| R4638 |
T7200 |
T7198 |
ccomp |
is,suggesting |
| R4639 |
T7201 |
T7200 |
expl |
there,is |
| R4640 |
T7202 |
T7203 |
amod |
little,inflammation |
| R4641 |
T7203 |
T7200 |
attr |
inflammation,is |
| R4642 |
T7204 |
T7192 |
punct |
.,observed |
| R4643 |
T7206 |
T7207 |
prep |
At,reduced |
| R4644 |
T7208 |
T7209 |
amod |
later,stages |
| R4645 |
T7209 |
T7206 |
pobj |
stages,At |
| R4646 |
T7210 |
T7211 |
amod |
synovial,hypertrophy |
| R4647 |
T7211 |
T7207 |
nsubjpass |
hypertrophy,reduced |
| R4648 |
T7212 |
T7207 |
auxpass |
is,reduced |
| R4649 |
T7213 |
T7207 |
punct |
.,reduced |
| R4650 |
T7215 |
T7216 |
amod |
Further,work |
| R4651 |
T7216 |
T7217 |
nsubjpass |
work,needed |
| R4652 |
T7218 |
T7217 |
aux |
will,needed |
| R4653 |
T7219 |
T7217 |
auxpass |
be,needed |
| R4654 |
T7220 |
T7221 |
aux |
to,determine |
| R4655 |
T7221 |
T7217 |
advcl |
determine,needed |
| R4656 |
T7222 |
T7223 |
mark |
whether,regulated |
| R4657 |
T7223 |
T7221 |
advcl |
regulated,determine |
| R4658 |
T7224 |
T7225 |
amod |
synovial,development |
| R4659 |
T7225 |
T7223 |
nsubjpass |
development,regulated |
| R4660 |
T7226 |
T7223 |
auxpass |
is,regulated |
| R4661 |
T7227 |
T7223 |
agent |
by,regulated |
| R4662 |
T7228 |
T7229 |
compound |
BMP,signaling |
| R4663 |
T7229 |
T7227 |
pobj |
signaling,by |
| R4664 |
T7230 |
T7223 |
punct |
", ",regulated |
| R4665 |
T7231 |
T7223 |
cc |
or,regulated |
| R4666 |
T7232 |
T7233 |
mark |
whether,becomes |
| R4667 |
T7233 |
T7223 |
conj |
becomes,regulated |
| R4668 |
T7234 |
T7235 |
det |
the,synovium |
| R4669 |
T7235 |
T7233 |
nsubj |
synovium,becomes |
| R4670 |
T7236 |
T7233 |
acomp |
enlarged,becomes |
| R4671 |
T7237 |
T7233 |
prep |
as,becomes |
| R4672 |
T7238 |
T7239 |
det |
a,response |
| R4673 |
T7239 |
T7237 |
pobj |
response,as |
| R4674 |
T7240 |
T7239 |
prep |
to,response |
| R4675 |
T7241 |
T7242 |
amod |
nearby,malformations |
| R4676 |
T7242 |
T7240 |
pobj |
malformations,to |
| R4677 |
T7243 |
T7242 |
amod |
skeletal,malformations |
| R4678 |
T7244 |
T7242 |
punct |
(,malformations |
| R4679 |
T7245 |
T7246 |
amod |
such,as |
| R4680 |
T7246 |
T7242 |
prep |
as,malformations |
| R4681 |
T7247 |
T7246 |
pobj |
fusion,as |
| R4682 |
T7248 |
T7247 |
prep |
of,fusion |
| R4683 |
T7249 |
T7250 |
det |
the,tarsals |
| R4684 |
T7250 |
T7248 |
pobj |
tarsals,of |
| R4685 |
T7251 |
T7250 |
amod |
second,tarsals |
| R4686 |
T7252 |
T7251 |
cc |
and,second |
| R4687 |
T7253 |
T7251 |
conj |
central,second |
| R4688 |
T7254 |
T7247 |
cc |
or,fusion |
| R4689 |
T7255 |
T7247 |
conj |
defects,fusion |
| R4690 |
T7256 |
T7255 |
prep |
in,defects |
| R4691 |
T7257 |
T7258 |
det |
the,cartilage |
| R4692 |
T7258 |
T7256 |
pobj |
cartilage,in |
| R4693 |
T7259 |
T7258 |
amod |
articular,cartilage |
| R4694 |
T7260 |
T7242 |
punct |
),malformations |
| R4695 |
T7261 |
T7217 |
punct |
.,needed |
| R4702 |
T7528 |
T7529 |
amod |
Noninflammatory,Degeneration |
| R4703 |
T7530 |
T7529 |
prep |
of,Degeneration |
| R4704 |
T7531 |
T7532 |
amod |
Articular,Cartilage |
| R4705 |
T7532 |
T7530 |
pobj |
Cartilage,of |
| R4706 |
T7533 |
T7529 |
prep |
in,Degeneration |
| R4707 |
T7534 |
T7535 |
nmod |
Digit,Joints |
| R4708 |
T7535 |
T7533 |
pobj |
Joints,in |
| R4709 |
T7536 |
T7534 |
cc |
and,Digit |
| R4710 |
T7537 |
T7534 |
conj |
Knee,Digit |
| R4711 |
T7539 |
T7540 |
prep |
Outside,seen |
| R4712 |
T7541 |
T7539 |
prep |
of,Outside |
| R4713 |
T7542 |
T7543 |
det |
the,region |
| R4714 |
T7543 |
T7541 |
pobj |
region,of |
| R4715 |
T7544 |
T7543 |
compound |
ankle,region |
| R4716 |
T7545 |
T7540 |
punct |
", ",seen |
| R4717 |
T7546 |
T7540 |
nsubjpass |
little,seen |
| R4718 |
T7547 |
T7546 |
cc |
or,little |
| R4719 |
T7548 |
T7549 |
nmod |
no,evidence |
| R4720 |
T7549 |
T7546 |
conj |
evidence,little |
| R4721 |
T7550 |
T7540 |
auxpass |
was,seen |
| R4722 |
T7551 |
T7540 |
prep |
for,seen |
| R4723 |
T7552 |
T7551 |
pobj |
expansion,for |
| R4724 |
T7553 |
T7552 |
prep |
of,expansion |
| R4725 |
T7554 |
T7555 |
det |
the,membrane |
| R4726 |
T7555 |
T7553 |
pobj |
membrane,of |
| R4727 |
T7556 |
T7555 |
amod |
synovial,membrane |
| R4728 |
T7557 |
T7540 |
punct |
.,seen |
| R4729 |
T7559 |
T7560 |
advmod |
Instead,showed |
| R4730 |
T7561 |
T7560 |
punct |
", ",showed |
| R4731 |
T7562 |
T7563 |
compound |
mutant,mice |
| R4732 |
T7563 |
T7560 |
nsubj |
mice,showed |
| R4733 |
T7564 |
T7565 |
amod |
histological,signs |
| R4734 |
T7565 |
T7560 |
dobj |
signs,showed |
| R4735 |
T7566 |
T7565 |
prep |
of,signs |
| R4736 |
T7567 |
T7566 |
pobj |
osteoarthritis,of |
| R4737 |
T7568 |
T7565 |
punct |
", ",signs |
| R4738 |
T7569 |
T7570 |
amod |
such,as |
| R4739 |
T7570 |
T7565 |
prep |
as,signs |
| R4740 |
T7571 |
T7570 |
pobj |
fibrillation,as |
| R4741 |
T7572 |
T7571 |
prep |
of,fibrillation |
| R4742 |
T7573 |
T7574 |
det |
the,surface |
| R4743 |
T7574 |
T7572 |
pobj |
surface,of |
| R4744 |
T7575 |
T7574 |
amod |
articular,surface |
| R4745 |
T7576 |
T7577 |
punct |
(,Figure |
| R4746 |
T7577 |
T7560 |
parataxis |
Figure,showed |
| R4747 |
T7578 |
T7577 |
nummod |
7,Figure |
| R4748 |
T7579 |
T7577 |
punct |
),Figure |
| R4749 |
T7580 |
T7560 |
punct |
.,showed |
| R4750 |
T7582 |
T7583 |
mark |
As,seen |
| R4751 |
T7583 |
T7585 |
advcl |
seen,reduced |
| R4752 |
T7584 |
T7583 |
advmod |
previously,seen |
| R4753 |
T7586 |
T7583 |
prep |
in,seen |
| R4754 |
T7587 |
T7588 |
nummod |
1,wk |
| R4755 |
T7588 |
T7593 |
npadvmod |
wk,old |
| R4756 |
T7589 |
T7587 |
punct |
-,1 |
| R4757 |
T7590 |
T7587 |
cc |
and,1 |
| R4758 |
T7591 |
T7587 |
conj |
2,1 |
| R4759 |
T7592 |
T7591 |
punct |
-,2 |
| R4760 |
T7593 |
T7595 |
amod |
old,animals |
| R4761 |
T7594 |
T7593 |
punct |
-,old |
| R4762 |
T7595 |
T7586 |
pobj |
animals,in |
| R4763 |
T7596 |
T7585 |
punct |
", ",reduced |
| R4764 |
T7597 |
T7598 |
compound |
Safranin,O |
| R4765 |
T7598 |
T7599 |
compound |
O,staining |
| R4766 |
T7599 |
T7585 |
nsubjpass |
staining,reduced |
| R4767 |
T7600 |
T7599 |
cc |
and,staining |
| R4768 |
T7601 |
T7602 |
nmod |
Agg,expression |
| R4769 |
T7602 |
T7599 |
conj |
expression,staining |
| R4770 |
T7603 |
T7601 |
cc |
and,Agg |
| R4771 |
T7604 |
T7601 |
conj |
Col10,Agg |
| R4772 |
T7605 |
T7585 |
auxpass |
were,reduced |
| R4773 |
T7606 |
T7585 |
advmod |
all,reduced |
| R4774 |
T7607 |
T7585 |
prep |
in,reduced |
| R4775 |
T7608 |
T7609 |
nmod |
mutant,regions |
| R4776 |
T7609 |
T7607 |
pobj |
regions,in |
| R4777 |
T7610 |
T7609 |
amod |
articular,regions |
| R4778 |
T7611 |
T7609 |
prep |
of,regions |
| R4779 |
T7612 |
T7613 |
det |
the,forefeet |
| R4780 |
T7613 |
T7611 |
pobj |
forefeet,of |
| R4781 |
T7614 |
T7613 |
cc |
and,forefeet |
| R4782 |
T7615 |
T7613 |
conj |
hindfeet,forefeet |
| R4783 |
T7616 |
T7585 |
prep |
by,reduced |
| R4784 |
T7617 |
T7618 |
nummod |
7,wk |
| R4785 |
T7618 |
T7616 |
pobj |
wk,by |
| R4786 |
T7619 |
T7618 |
prep |
of,wk |
| R4787 |
T7620 |
T7619 |
pobj |
age,of |
| R4788 |
T7621 |
T7585 |
punct |
", ",reduced |
| R4789 |
T7622 |
T7585 |
cc |
and,reduced |
| R4790 |
T7623 |
T7624 |
det |
the,signs |
| R4791 |
T7624 |
T7626 |
nsubjpass |
signs,observed |
| R4792 |
T7625 |
T7624 |
compound |
beginning,signs |
| R4793 |
T7626 |
T7585 |
conj |
observed,reduced |
| R4794 |
T7627 |
T7624 |
prep |
of,signs |
| R4795 |
T7628 |
T7629 |
compound |
cartilage,loss |
| R4796 |
T7629 |
T7627 |
pobj |
loss,of |
| R4797 |
T7630 |
T7626 |
auxpass |
were,observed |
| R4798 |
T7631 |
T7632 |
punct |
(,data |
| R4799 |
T7632 |
T7626 |
meta |
data,observed |
| R4800 |
T7633 |
T7632 |
amod |
unpublished,data |
| R4801 |
T7634 |
T7632 |
punct |
),data |
| R4802 |
T7635 |
T7626 |
punct |
.,observed |
| R4803 |
T7637 |
T7638 |
prep |
By,were |
| R4804 |
T7639 |
T7640 |
nummod |
9,mo |
| R4805 |
T7640 |
T7637 |
pobj |
mo,By |
| R4806 |
T7641 |
T7640 |
prep |
of,mo |
| R4807 |
T7642 |
T7641 |
pobj |
age,of |
| R4808 |
T7643 |
T7638 |
punct |
", ",were |
| R4809 |
T7644 |
T7645 |
amod |
many,regions |
| R4810 |
T7645 |
T7638 |
nsubj |
regions,were |
| R4811 |
T7646 |
T7645 |
prep |
of,regions |
| R4812 |
T7647 |
T7648 |
amod |
articular,cartilage |
| R4813 |
T7648 |
T7646 |
pobj |
cartilage,of |
| R4814 |
T7649 |
T7650 |
advmod |
completely,missing |
| R4815 |
T7650 |
T7638 |
acomp |
missing,were |
| R4816 |
T7651 |
T7650 |
cc |
or,missing |
| R4817 |
T7652 |
T7653 |
advmod |
extremely,fibrillated |
| R4818 |
T7653 |
T7650 |
conj |
fibrillated,missing |
| R4819 |
T7654 |
T7638 |
punct |
", ",were |
| R4820 |
T7655 |
T7638 |
advcl |
leaving,were |
| R4821 |
T7656 |
T7655 |
dobj |
regions,leaving |
| R4822 |
T7657 |
T7656 |
prep |
of,regions |
| R4823 |
T7658 |
T7659 |
amod |
exposed,bone |
| R4824 |
T7659 |
T7657 |
pobj |
bone,of |
| R4825 |
T7660 |
T7655 |
prep |
on,leaving |
| R4826 |
T7661 |
T7662 |
det |
the,surface |
| R4827 |
T7662 |
T7660 |
pobj |
surface,on |
| R4828 |
T7663 |
T7664 |
punct |
(,7A |
| R4829 |
T7664 |
T7638 |
parataxis |
7A,were |
| R4830 |
T7665 |
T7664 |
nmod |
Figure,7A |
| R4831 |
T7666 |
T7667 |
punct |
–,7D |
| R4832 |
T7667 |
T7664 |
prep |
7D,7A |
| R4833 |
T7668 |
T7664 |
punct |
),7A |
| R4834 |
T7669 |
T7638 |
punct |
.,were |
| R4835 |
T7671 |
T7672 |
det |
No,alterations |
| R4836 |
T7672 |
T7673 |
nsubjpass |
alterations,seen |
| R4837 |
T7674 |
T7673 |
auxpass |
were,seen |
| R4838 |
T7675 |
T7673 |
prep |
in,seen |
| R4839 |
T7676 |
T7677 |
det |
the,expression |
| R4840 |
T7677 |
T7675 |
pobj |
expression,in |
| R4841 |
T7678 |
T7677 |
prep |
of,expression |
| R4842 |
T7679 |
T7678 |
pobj |
Osteocalcin,of |
| R4843 |
T7680 |
T7679 |
punct |
", ",Osteocalcin |
| R4844 |
T7681 |
T7679 |
conj |
Col1a1,Osteocalcin |
| R4845 |
T7682 |
T7681 |
punct |
", ",Col1a1 |
| R4846 |
T7683 |
T7681 |
cc |
or,Col1a1 |
| R4847 |
T7684 |
T7685 |
compound |
matrix,metalloprotease |
| R4848 |
T7685 |
T7681 |
conj |
metalloprotease,Col1a1 |
| R4849 |
T7686 |
T7685 |
punct |
-,metalloprotease |
| R4850 |
T7687 |
T7685 |
nummod |
13,metalloprotease |
| R4851 |
T7688 |
T7673 |
prep |
at,seen |
| R4852 |
T7689 |
T7690 |
preconj |
either,wk |
| R4853 |
T7690 |
T7688 |
pobj |
wk,at |
| R4854 |
T7691 |
T7690 |
nummod |
7,wk |
| R4855 |
T7692 |
T7690 |
cc |
or,wk |
| R4856 |
T7693 |
T7694 |
nummod |
9,mo |
| R4857 |
T7694 |
T7690 |
conj |
mo,wk |
| R4858 |
T7695 |
T7673 |
punct |
.,seen |
| R4859 |
T7697 |
T7698 |
det |
The,joint |
| R4860 |
T7698 |
T7703 |
nsubj |
joint,showed |
| R4861 |
T7699 |
T7698 |
amod |
major,joint |
| R4862 |
T7700 |
T7698 |
nmod |
weight,joint |
| R4863 |
T7701 |
T7700 |
punct |
-,weight |
| R4864 |
T7702 |
T7700 |
amod |
bearing,weight |
| R4865 |
T7704 |
T7698 |
prep |
of,joint |
| R4866 |
T7705 |
T7706 |
det |
the,hindlimb |
| R4867 |
T7706 |
T7704 |
pobj |
hindlimb,of |
| R4868 |
T7707 |
T7698 |
punct |
", ",joint |
| R4869 |
T7708 |
T7709 |
det |
the,knee |
| R4870 |
T7709 |
T7698 |
appos |
knee,joint |
| R4871 |
T7710 |
T7703 |
punct |
", ",showed |
| R4872 |
T7711 |
T7703 |
dobj |
changes,showed |
| R4873 |
T7712 |
T7713 |
dep |
that,paralleled |
| R4874 |
T7713 |
T7711 |
relcl |
paralleled,changes |
| R4875 |
T7714 |
T7713 |
advmod |
closely,paralleled |
| R4876 |
T7715 |
T7713 |
dobj |
that,paralleled |
| R4877 |
T7716 |
T7715 |
acl |
seen,that |
| R4878 |
T7717 |
T7716 |
prep |
in,seen |
| R4879 |
T7718 |
T7719 |
det |
the,joints |
| R4880 |
T7719 |
T7717 |
pobj |
joints,in |
| R4881 |
T7720 |
T7719 |
compound |
foot,joints |
| R4882 |
T7721 |
T7703 |
punct |
.,showed |
| R4883 |
T7723 |
T7724 |
det |
All,markers |
| R4884 |
T7724 |
T7725 |
nsubj |
markers,looked |
| R4885 |
T7726 |
T7724 |
prep |
of,markers |
| R4886 |
T7727 |
T7728 |
compound |
cartilage,matrix |
| R4887 |
T7728 |
T7726 |
pobj |
matrix,of |
| R4888 |
T7729 |
T7725 |
acomp |
similar,looked |
| R4889 |
T7730 |
T7729 |
prep |
to,similar |
| R4890 |
T7731 |
T7730 |
pobj |
controls,to |
| R4891 |
T7732 |
T7725 |
prep |
at,looked |
| R4892 |
T7733 |
T7732 |
pobj |
E16.5,at |
| R4893 |
T7734 |
T7725 |
punct |
", ",looked |
| R4894 |
T7735 |
T7725 |
advcl |
suggesting,looked |
| R4895 |
T7736 |
T7737 |
mark |
that,disrupted |
| R4896 |
T7737 |
T7735 |
ccomp |
disrupted,suggesting |
| R4897 |
T7738 |
T7739 |
amod |
early,stages |
| R4898 |
T7739 |
T7737 |
nsubjpass |
stages,disrupted |
| R4899 |
T7740 |
T7739 |
prep |
of,stages |
| R4900 |
T7741 |
T7742 |
compound |
joint,formation |
| R4901 |
T7742 |
T7740 |
pobj |
formation,of |
| R4902 |
T7743 |
T7737 |
auxpass |
were,disrupted |
| R4903 |
T7744 |
T7737 |
neg |
not,disrupted |
| R4904 |
T7745 |
T7746 |
punct |
(,data |
| R4905 |
T7746 |
T7725 |
meta |
data,looked |
| R4906 |
T7747 |
T7746 |
amod |
unpublished,data |
| R4907 |
T7748 |
T7746 |
punct |
),data |
| R4908 |
T7749 |
T7725 |
punct |
.,looked |
| R4909 |
T7751 |
T7752 |
prep |
By,reduced |
| R4910 |
T7753 |
T7754 |
amod |
postnatal,day |
| R4911 |
T7754 |
T7751 |
pobj |
day,By |
| R4912 |
T7755 |
T7754 |
nummod |
7,day |
| R4913 |
T7756 |
T7752 |
punct |
", ",reduced |
| R4914 |
T7757 |
T7758 |
compound |
Safranin,O |
| R4915 |
T7758 |
T7759 |
compound |
O,staining |
| R4916 |
T7759 |
T7752 |
nsubjpass |
staining,reduced |
| R4917 |
T7760 |
T7759 |
cc |
and,staining |
| R4918 |
T7761 |
T7762 |
nmod |
Col2a1,expression |
| R4919 |
T7762 |
T7759 |
conj |
expression,staining |
| R4920 |
T7763 |
T7761 |
cc |
and,Col2a1 |
| R4921 |
T7764 |
T7761 |
conj |
Agg,Col2a1 |
| R4922 |
T7765 |
T7752 |
auxpass |
were,reduced |
| R4923 |
T7766 |
T7752 |
advmod |
clearly,reduced |
| R4924 |
T7767 |
T7752 |
prep |
in,reduced |
| R4925 |
T7768 |
T7769 |
det |
the,mutant |
| R4926 |
T7769 |
T7767 |
pobj |
mutant,in |
| R4927 |
T7770 |
T7752 |
punct |
", ",reduced |
| R4928 |
T7771 |
T7752 |
prep |
despite,reduced |
| R4929 |
T7772 |
T7773 |
amod |
continued,expression |
| R4930 |
T7773 |
T7771 |
pobj |
expression,despite |
| R4931 |
T7774 |
T7773 |
prep |
of,expression |
| R4932 |
T7775 |
T7774 |
pobj |
Sox9,of |
| R4933 |
T7776 |
T7777 |
punct |
(,data |
| R4934 |
T7777 |
T7752 |
meta |
data,reduced |
| R4935 |
T7778 |
T7777 |
amod |
unpublished,data |
| R4936 |
T7779 |
T7777 |
punct |
),data |
| R4937 |
T7780 |
T7752 |
punct |
.,reduced |
| R4938 |
T7782 |
T7783 |
det |
The,shape |
| R4939 |
T7783 |
T7785 |
nsubj |
shape,appeared |
| R4940 |
T7784 |
T7783 |
amod |
overall,shape |
| R4941 |
T7786 |
T7783 |
prep |
of,shape |
| R4942 |
T7787 |
T7788 |
nmod |
mutant,knee |
| R4943 |
T7788 |
T7789 |
nmod |
knee,elements |
| R4944 |
T7789 |
T7786 |
pobj |
elements,of |
| R4945 |
T7790 |
T7789 |
amod |
skeletal,elements |
| R4946 |
T7791 |
T7785 |
oprd |
similar,appeared |
| R4947 |
T7792 |
T7791 |
prep |
to,similar |
| R4948 |
T7793 |
T7792 |
pobj |
controls,to |
| R4949 |
T7794 |
T7785 |
punct |
", ",appeared |
| R4950 |
T7795 |
T7796 |
mark |
although,appeared |
| R4951 |
T7796 |
T7785 |
advcl |
appeared,appeared |
| R4952 |
T7797 |
T7798 |
det |
the,meniscus |
| R4953 |
T7798 |
T7796 |
nsubj |
meniscus,appeared |
| R4954 |
T7799 |
T7798 |
compound |
fibrocartilaginous,meniscus |
| R4955 |
T7800 |
T7801 |
dep |
that,resides |
| R4956 |
T7801 |
T7798 |
relcl |
resides,meniscus |
| R4957 |
T7802 |
T7801 |
prep |
between,resides |
| R4958 |
T7803 |
T7804 |
det |
the,femur |
| R4959 |
T7804 |
T7802 |
pobj |
femur,between |
| R4960 |
T7805 |
T7804 |
cc |
and,femur |
| R4961 |
T7806 |
T7804 |
conj |
tibia,femur |
| R4962 |
T7807 |
T7808 |
advmod |
much,less |
| R4963 |
T7808 |
T7809 |
advmod |
less,dense |
| R4964 |
T7809 |
T7796 |
oprd |
dense,appeared |
| R4965 |
T7810 |
T7796 |
prep |
in,appeared |
| R4966 |
T7811 |
T7810 |
pobj |
mutants,in |
| R4967 |
T7812 |
T7796 |
prep |
at,appeared |
| R4968 |
T7813 |
T7812 |
pobj |
E16.5,at |
| R4969 |
T7814 |
T7785 |
punct |
.,appeared |
| R4970 |
T7816 |
T7817 |
det |
Some,cartilage |
| R4971 |
T7817 |
T7818 |
nsubj |
cartilage,formed |
| R4972 |
T7819 |
T7818 |
prep |
in,formed |
| R4973 |
T7820 |
T7821 |
det |
the,region |
| R4974 |
T7821 |
T7819 |
pobj |
region,in |
| R4975 |
T7822 |
T7821 |
compound |
meniscus,region |
| R4976 |
T7823 |
T7818 |
punct |
", ",formed |
| R4977 |
T7824 |
T7818 |
cc |
but,formed |
| R4978 |
T7825 |
T7826 |
det |
the,size |
| R4979 |
T7826 |
T7827 |
nsubjpass |
size,reduced |
| R4980 |
T7827 |
T7818 |
conj |
reduced,formed |
| R4981 |
T7828 |
T7826 |
prep |
of,size |
| R4982 |
T7829 |
T7830 |
det |
these,elements |
| R4983 |
T7830 |
T7828 |
pobj |
elements,of |
| R4984 |
T7831 |
T7827 |
auxpass |
was,reduced |
| R4985 |
T7832 |
T7827 |
advmod |
greatly,reduced |
| R4986 |
T7833 |
T7827 |
cc |
and,reduced |
| R4987 |
T7834 |
T7827 |
conj |
contained,reduced |
| R4988 |
T7835 |
T7836 |
amod |
abundant,cells |
| R4989 |
T7836 |
T7834 |
dobj |
cells,contained |
| R4990 |
T7837 |
T7836 |
prep |
with,cells |
| R4991 |
T7838 |
T7839 |
amod |
fibrous,appearance |
| R4992 |
T7839 |
T7837 |
pobj |
appearance,with |
| R4993 |
T7840 |
T7839 |
punct |
", ",appearance |
| R4994 |
T7841 |
T7839 |
amod |
noncartilaginous,appearance |
| R4995 |
T7842 |
T7843 |
punct |
(,data |
| R4996 |
T7843 |
T7834 |
meta |
data,contained |
| R4997 |
T7844 |
T7843 |
amod |
unpublished,data |
| R4998 |
T7845 |
T7843 |
punct |
),data |
| R4999 |
T7846 |
T7827 |
punct |
.,reduced |
| R5000 |
T7848 |
T7849 |
det |
This,reduction |
| R5001 |
T7849 |
T7850 |
nsubjpass |
reduction,seen |
| R5002 |
T7851 |
T7849 |
prep |
of,reduction |
| R5003 |
T7852 |
T7853 |
det |
the,meniscus |
| R5004 |
T7853 |
T7851 |
pobj |
meniscus,of |
| R5005 |
T7854 |
T7850 |
aux |
can,seen |
| R5006 |
T7855 |
T7850 |
advmod |
also,seen |
| R5007 |
T7856 |
T7850 |
auxpass |
be,seen |
| R5008 |
T7857 |
T7850 |
prep |
in,seen |
| R5009 |
T7858 |
T7857 |
pobj |
sections,in |
| R5010 |
T7859 |
T7858 |
prep |
from,sections |
| R5011 |
T7860 |
T7861 |
nummod |
7,wk |
| R5012 |
T7861 |
T7863 |
npadvmod |
wk,old |
| R5013 |
T7862 |
T7861 |
punct |
-,wk |
| R5014 |
T7863 |
T7870 |
amod |
old,animals |
| R5015 |
T7864 |
T7861 |
punct |
-,wk |
| R5016 |
T7865 |
T7861 |
cc |
and,wk |
| R5017 |
T7866 |
T7867 |
nummod |
9,mo |
| R5018 |
T7867 |
T7861 |
conj |
mo,wk |
| R5019 |
T7868 |
T7867 |
punct |
-,mo |
| R5020 |
T7869 |
T7863 |
punct |
-,old |
| R5021 |
T7870 |
T7859 |
pobj |
animals,from |
| R5022 |
T7871 |
T7872 |
punct |
(,arrows |
| R5023 |
T7872 |
T7850 |
parataxis |
arrows,seen |
| R5024 |
T7873 |
T7872 |
dep |
Figure,arrows |
| R5025 |
T7874 |
T7873 |
nummod |
7E,Figure |
| R5026 |
T7875 |
T7873 |
punct |
", ",Figure |
| R5027 |
T7876 |
T7873 |
nummod |
7H,Figure |
| R5028 |
T7877 |
T7873 |
punct |
", ",Figure |
| R5029 |
T7878 |
T7873 |
nummod |
7K,Figure |
| R5030 |
T7879 |
T7873 |
punct |
", ",Figure |
| R5031 |
T7880 |
T7873 |
cc |
and,Figure |
| R5032 |
T7881 |
T7873 |
conj |
7N,Figure |
| R5033 |
T7882 |
T7872 |
punct |
", ",arrows |
| R5034 |
T7883 |
T7872 |
punct |
),arrows |
| R5035 |
T7884 |
T7850 |
punct |
.,seen |
| R5036 |
T7886 |
T7887 |
prep |
At,flattened |
| R5037 |
T7888 |
T7889 |
nummod |
7,wk |
| R5038 |
T7889 |
T7886 |
pobj |
wk,At |
| R5039 |
T7890 |
T7889 |
prep |
of,wk |
| R5040 |
T7891 |
T7890 |
pobj |
age,of |
| R5041 |
T7892 |
T7893 |
det |
the,epiphysis |
| R5042 |
T7893 |
T7887 |
nsubjpass |
epiphysis,flattened |
| R5043 |
T7894 |
T7895 |
advmod |
normally,domed |
| R5044 |
T7895 |
T7893 |
amod |
domed,epiphysis |
| R5045 |
T7896 |
T7893 |
amod |
tibial,epiphysis |
| R5046 |
T7897 |
T7887 |
auxpass |
was,flattened |
| R5047 |
T7898 |
T7887 |
cc |
and,flattened |
| R5048 |
T7899 |
T7887 |
conj |
depressed,flattened |
| R5049 |
T7900 |
T7899 |
prep |
in,depressed |
| R5050 |
T7901 |
T7902 |
det |
the,knees |
| R5051 |
T7902 |
T7900 |
pobj |
knees,in |
| R5052 |
T7903 |
T7902 |
prep |
of,knees |
| R5053 |
T7904 |
T7905 |
compound |
mutant,animals |
| R5054 |
T7905 |
T7903 |
pobj |
animals,of |
| R5055 |
T7906 |
T7899 |
punct |
", ",depressed |
| R5056 |
T7907 |
T7908 |
advmod |
markedly,reducing |
| R5057 |
T7908 |
T7899 |
conj |
reducing,depressed |
| R5058 |
T7909 |
T7910 |
det |
the,distance |
| R5059 |
T7910 |
T7908 |
dobj |
distance,reducing |
| R5060 |
T7911 |
T7910 |
prep |
between,distance |
| R5061 |
T7912 |
T7913 |
det |
the,plate |
| R5062 |
T7913 |
T7911 |
pobj |
plate,between |
| R5063 |
T7914 |
T7913 |
compound |
growth,plate |
| R5064 |
T7915 |
T7913 |
cc |
and,plate |
| R5065 |
T7916 |
T7917 |
amod |
articular,surface |
| R5066 |
T7917 |
T7913 |
conj |
surface,plate |
| R5067 |
T7918 |
T7919 |
punct |
(,bar |
| R5068 |
T7919 |
T7908 |
parataxis |
bar,reducing |
| R5069 |
T7920 |
T7919 |
dep |
Figure,bar |
| R5070 |
T7921 |
T7920 |
nummod |
7E,Figure |
| R5071 |
T7922 |
T7920 |
cc |
and,Figure |
| R5072 |
T7923 |
T7920 |
conj |
7H,Figure |
| R5073 |
T7924 |
T7919 |
punct |
", ",bar |
| R5074 |
T7925 |
T7919 |
amod |
vertical,bar |
| R5075 |
T7926 |
T7919 |
punct |
),bar |
| R5076 |
T7927 |
T7887 |
punct |
.,flattened |
| R5077 |
T7929 |
T7930 |
amod |
Articular,cartilage |
| R5078 |
T7930 |
T7931 |
nsubj |
cartilage,was |
| R5079 |
T7932 |
T7931 |
advmod |
also,was |
| R5080 |
T7933 |
T7931 |
acomp |
thinner,was |
| R5081 |
T7934 |
T7933 |
prep |
than,thinner |
| R5082 |
T7935 |
T7934 |
prep |
in,than |
| R5083 |
T7936 |
T7937 |
compound |
control,animals |
| R5084 |
T7937 |
T7935 |
pobj |
animals,in |
| R5085 |
T7938 |
T7931 |
punct |
", ",was |
| R5086 |
T7939 |
T7931 |
conj |
showed,was |
| R5087 |
T7940 |
T7941 |
advmod |
nearly,complete |
| R5088 |
T7941 |
T7942 |
amod |
complete,absence |
| R5089 |
T7942 |
T7939 |
dobj |
absence,showed |
| R5090 |
T7943 |
T7942 |
prep |
of,absence |
| R5091 |
T7944 |
T7945 |
compound |
Safranin,O |
| R5092 |
T7945 |
T7946 |
compound |
O,staining |
| R5093 |
T7946 |
T7943 |
pobj |
staining,of |
| R5094 |
T7947 |
T7939 |
punct |
", ",showed |
| R5095 |
T7948 |
T7939 |
cc |
and,showed |
| R5096 |
T7949 |
T7939 |
conj |
was,showed |
| R5097 |
T7950 |
T7951 |
preconj |
either,acellular |
| R5098 |
T7951 |
T7949 |
acomp |
acellular,was |
| R5099 |
T7952 |
T7951 |
cc |
or,acellular |
| R5100 |
T7953 |
T7951 |
conj |
beginning,acellular |
| R5101 |
T7954 |
T7955 |
aux |
to,fibrillate |
| R5102 |
T7955 |
T7953 |
xcomp |
fibrillate,beginning |
| R5103 |
T7956 |
T7953 |
prep |
in,beginning |
| R5104 |
T7957 |
T7958 |
amod |
many,regions |
| R5105 |
T7958 |
T7956 |
pobj |
regions,in |
| R5106 |
T7959 |
T7960 |
punct |
(,Figure |
| R5107 |
T7960 |
T7949 |
parataxis |
Figure,was |
| R5108 |
T7961 |
T7960 |
nummod |
7F,Figure |
| R5109 |
T7962 |
T7960 |
cc |
and,Figure |
| R5110 |
T7963 |
T7960 |
conj |
7I,Figure |
| R5111 |
T7964 |
T7960 |
punct |
),Figure |
| R5112 |
T7965 |
T7931 |
punct |
.,was |
| R5113 |
T7967 |
T7968 |
det |
The,cells |
| R5114 |
T7968 |
T7975 |
nsubj |
cells,appeared |
| R5115 |
T7969 |
T7968 |
amod |
few,cells |
| R5116 |
T7970 |
T7968 |
amod |
large,cells |
| R5117 |
T7971 |
T7972 |
compound |
Safranin,O |
| R5118 |
T7972 |
T7973 |
npadvmod |
O,stained |
| R5119 |
T7973 |
T7968 |
amod |
stained,cells |
| R5120 |
T7974 |
T7973 |
punct |
-,stained |
| R5121 |
T7976 |
T7977 |
advmod |
still,apparent |
| R5122 |
T7977 |
T7968 |
relcl |
apparent,cells |
| R5123 |
T7978 |
T7977 |
prep |
in,apparent |
| R5124 |
T7979 |
T7980 |
nmod |
mutant,regions |
| R5125 |
T7980 |
T7978 |
pobj |
regions,in |
| R5126 |
T7981 |
T7980 |
amod |
articular,regions |
| R5127 |
T7982 |
T7983 |
aux |
to,correspond |
| R5128 |
T7983 |
T7975 |
xcomp |
correspond,appeared |
| R5129 |
T7984 |
T7983 |
prep |
in,correspond |
| R5130 |
T7985 |
T7984 |
pobj |
position,in |
| R5131 |
T7986 |
T7983 |
prep |
to,correspond |
| R5132 |
T7987 |
T7988 |
amod |
rare,cells |
| R5133 |
T7988 |
T7986 |
pobj |
cells,to |
| R5134 |
T7989 |
T7990 |
npadvmod |
LACZ,negative |
| R5135 |
T7990 |
T7988 |
amod |
negative,cells |
| R5136 |
T7991 |
T7990 |
punct |
-,negative |
| R5137 |
T7992 |
T7988 |
prep |
in,cells |
| R5138 |
T7993 |
T7994 |
amod |
adjacent,sections |
| R5139 |
T7994 |
T7992 |
pobj |
sections,in |
| R5140 |
T7995 |
T7975 |
punct |
", ",appeared |
| R5141 |
T7996 |
T7975 |
advcl |
suggesting,appeared |
| R5142 |
T7997 |
T7998 |
mark |
that,required |
| R5143 |
T7998 |
T7996 |
ccomp |
required,suggesting |
| R5144 |
T7999 |
T7998 |
nsubjpass |
Bmpr1a,required |
| R5145 |
T8000 |
T7998 |
auxpass |
is,required |
| R5146 |
T8001 |
T8002 |
npadvmod |
cell,autonomously |
| R5147 |
T8002 |
T7998 |
advmod |
autonomously,required |
| R5148 |
T8003 |
T8002 |
punct |
-,autonomously |
| R5149 |
T8004 |
T7998 |
prep |
in,required |
| R5150 |
T8005 |
T8006 |
amod |
articular,cartilage |
| R5151 |
T8006 |
T8004 |
pobj |
cartilage,in |
| R5152 |
T8007 |
T8008 |
punct |
(,arrowheads |
| R5153 |
T8008 |
T7975 |
parataxis |
arrowheads,appeared |
| R5154 |
T8009 |
T8008 |
dep |
Figure,arrowheads |
| R5155 |
T8010 |
T8009 |
nummod |
7I,Figure |
| R5156 |
T8011 |
T8009 |
cc |
and,Figure |
| R5157 |
T8012 |
T8009 |
conj |
7J,Figure |
| R5158 |
T8013 |
T8008 |
punct |
", ",arrowheads |
| R5159 |
T8014 |
T8008 |
amod |
white,arrowheads |
| R5160 |
T8015 |
T8008 |
punct |
),arrowheads |
| R5161 |
T8016 |
T7975 |
punct |
.,appeared |
| R5162 |
T8018 |
T8019 |
prep |
By,were |
| R5163 |
T8020 |
T8021 |
nummod |
9,mo |
| R5164 |
T8021 |
T8018 |
pobj |
mo,By |
| R5165 |
T8022 |
T8019 |
punct |
", ",were |
| R5166 |
T8023 |
T8024 |
amod |
large,areas |
| R5167 |
T8024 |
T8019 |
nsubj |
areas,were |
| R5168 |
T8025 |
T8024 |
prep |
of,areas |
| R5169 |
T8026 |
T8027 |
compound |
mutant,knees |
| R5170 |
T8027 |
T8025 |
pobj |
knees,of |
| R5171 |
T8028 |
T8019 |
acomp |
devoid,were |
| R5172 |
T8029 |
T8028 |
prep |
of,devoid |
| R5173 |
T8030 |
T8031 |
amod |
articular,cells |
| R5174 |
T8031 |
T8029 |
pobj |
cells,of |
| R5175 |
T8032 |
T8019 |
punct |
", ",were |
| R5176 |
T8033 |
T8019 |
cc |
and,were |
| R5177 |
T8034 |
T8035 |
det |
the,bones |
| R5178 |
T8035 |
T8036 |
nsubj |
bones,appeared |
| R5179 |
T8036 |
T8019 |
conj |
appeared,were |
| R5180 |
T8037 |
T8035 |
prep |
of,bones |
| R5181 |
T8038 |
T8039 |
det |
the,femur |
| R5182 |
T8039 |
T8037 |
pobj |
femur,of |
| R5183 |
T8040 |
T8039 |
cc |
and,femur |
| R5184 |
T8041 |
T8039 |
conj |
tibia,femur |
| R5185 |
T8042 |
T8043 |
aux |
to,rub |
| R5186 |
T8043 |
T8036 |
xcomp |
rub,appeared |
| R5187 |
T8044 |
T8043 |
advmod |
directly,rub |
| R5188 |
T8045 |
T8043 |
prep |
against,rub |
| R5189 |
T8046 |
T8047 |
det |
each,other |
| R5190 |
T8047 |
T8045 |
pobj |
other,against |
| R5191 |
T8048 |
T8036 |
punct |
.,appeared |
| R5192 |
T8050 |
T8051 |
advmod |
Furthermore,was |
| R5193 |
T8052 |
T8051 |
punct |
", ",was |
| R5194 |
T8053 |
T8054 |
det |
the,epiphysis |
| R5195 |
T8054 |
T8051 |
nsubj |
epiphysis,was |
| R5196 |
T8055 |
T8054 |
prep |
of,epiphysis |
| R5197 |
T8056 |
T8057 |
det |
the,tibia |
| R5198 |
T8057 |
T8055 |
pobj |
tibia,of |
| R5199 |
T8058 |
T8051 |
advmod |
extremely,was |
| R5200 |
T8059 |
T8051 |
acomp |
depressed,was |
| R5201 |
T8060 |
T8051 |
punct |
", ",was |
| R5202 |
T8061 |
T8051 |
prep |
to,was |
| R5203 |
T8062 |
T8063 |
det |
the,point |
| R5204 |
T8063 |
T8061 |
pobj |
point,to |
| R5205 |
T8064 |
T8065 |
mark |
that,exposed |
| R5206 |
T8065 |
T8063 |
acl |
exposed,point |
| R5207 |
T8066 |
T8067 |
compound |
growth,cartilage |
| R5208 |
T8067 |
T8065 |
nsubjpass |
cartilage,exposed |
| R5209 |
T8068 |
T8067 |
compound |
plate,cartilage |
| R5210 |
T8069 |
T8065 |
auxpass |
was,exposed |
| R5211 |
T8070 |
T8065 |
advmod |
almost,exposed |
| R5212 |
T8071 |
T8065 |
prep |
through,exposed |
| R5213 |
T8072 |
T8073 |
det |
the,surface |
| R5214 |
T8073 |
T8071 |
pobj |
surface,through |
| R5215 |
T8074 |
T8073 |
prep |
of,surface |
| R5216 |
T8075 |
T8076 |
det |
the,bone |
| R5217 |
T8076 |
T8074 |
pobj |
bone,of |
| R5218 |
T8077 |
T8078 |
punct |
(,7K |
| R5219 |
T8078 |
T8051 |
parataxis |
7K,was |
| R5220 |
T8079 |
T8078 |
nmod |
Figure,7K |
| R5221 |
T8080 |
T8078 |
punct |
", ",7K |
| R5222 |
T8081 |
T8078 |
conj |
7L,7K |
| R5223 |
T8082 |
T8081 |
punct |
", ",7L |
| R5224 |
T8083 |
T8081 |
conj |
7N,7L |
| R5225 |
T8084 |
T8083 |
punct |
", ",7N |
| R5226 |
T8085 |
T8083 |
cc |
and,7N |
| R5227 |
T8086 |
T8083 |
conj |
7O,7N |
| R5228 |
T8087 |
T8078 |
punct |
),7K |
| R5229 |
T8088 |
T8051 |
punct |
.,was |
| R5230 |
T8090 |
T8091 |
prep |
In,showed |
| R5231 |
T8092 |
T8090 |
pobj |
addition,In |
| R5232 |
T8093 |
T8091 |
punct |
", ",showed |
| R5233 |
T8094 |
T8091 |
nsubj |
mutants,showed |
| R5234 |
T8095 |
T8094 |
prep |
at,mutants |
| R5235 |
T8096 |
T8097 |
nummod |
7,wk |
| R5236 |
T8097 |
T8095 |
pobj |
wk,at |
| R5237 |
T8098 |
T8097 |
cc |
and,wk |
| R5238 |
T8099 |
T8100 |
nummod |
9,mo |
| R5239 |
T8100 |
T8097 |
conj |
mo,wk |
| R5240 |
T8101 |
T8102 |
amod |
subchondral,sclerosis |
| R5241 |
T8102 |
T8091 |
dobj |
sclerosis,showed |
| R5242 |
T8103 |
T8091 |
punct |
", ",showed |
| R5243 |
T8104 |
T8105 |
advmod |
especially,in |
| R5244 |
T8105 |
T8091 |
prep |
in,showed |
| R5245 |
T8106 |
T8107 |
det |
the,epiphysis |
| R5246 |
T8107 |
T8105 |
pobj |
epiphysis,in |
| R5247 |
T8108 |
T8107 |
prep |
of,epiphysis |
| R5248 |
T8109 |
T8110 |
det |
the,femur |
| R5249 |
T8110 |
T8108 |
pobj |
femur,of |
| R5250 |
T8111 |
T8112 |
punct |
(,asterisks |
| R5251 |
T8112 |
T8091 |
parataxis |
asterisks,showed |
| R5252 |
T8113 |
T8114 |
nmod |
Figure,7E |
| R5253 |
T8114 |
T8112 |
dep |
7E,asterisks |
| R5254 |
T8115 |
T8114 |
punct |
", ",7E |
| R5255 |
T8116 |
T8114 |
conj |
7H,7E |
| R5256 |
T8117 |
T8116 |
punct |
", ",7H |
| R5257 |
T8118 |
T8116 |
conj |
7K,7H |
| R5258 |
T8119 |
T8118 |
punct |
", ",7K |
| R5259 |
T8120 |
T8118 |
cc |
and,7K |
| R5260 |
T8121 |
T8118 |
conj |
7N,7K |
| R5261 |
T8122 |
T8112 |
punct |
", ",asterisks |
| R5262 |
T8123 |
T8112 |
punct |
),asterisks |
| R5263 |
T8124 |
T8091 |
punct |
.,showed |
| R5264 |
T8126 |
T8127 |
mark |
While,seen |
| R5265 |
T8127 |
T8132 |
advcl |
seen,is |
| R5266 |
T8128 |
T8129 |
amod |
subchondral,sclerosis |
| R5267 |
T8129 |
T8127 |
nsubjpass |
sclerosis,seen |
| R5268 |
T8130 |
T8127 |
auxpass |
is,seen |
| R5269 |
T8131 |
T8127 |
advmod |
commonly,seen |
| R5270 |
T8133 |
T8127 |
prep |
in,seen |
| R5271 |
T8134 |
T8133 |
pobj |
cases,in |
| R5272 |
T8135 |
T8134 |
prep |
of,cases |
| R5273 |
T8136 |
T8135 |
pobj |
osteoarthritis,of |
| R5274 |
T8137 |
T8132 |
punct |
", ",is |
| R5275 |
T8138 |
T8132 |
nsubj |
it,is |
| R5276 |
T8139 |
T8132 |
acomp |
unclear,is |
| R5277 |
T8140 |
T8132 |
prep |
in,is |
| R5278 |
T8141 |
T8142 |
det |
this,case |
| R5279 |
T8142 |
T8140 |
pobj |
case,in |
| R5280 |
T8143 |
T8144 |
mark |
whether,is |
| R5281 |
T8144 |
T8132 |
advcl |
is,is |
| R5282 |
T8145 |
T8146 |
det |
the,sclerosis |
| R5283 |
T8146 |
T8144 |
nsubj |
sclerosis,is |
| R5284 |
T8147 |
T8144 |
advmod |
mainly,is |
| R5285 |
T8148 |
T8149 |
det |
a,response |
| R5286 |
T8149 |
T8144 |
attr |
response,is |
| R5287 |
T8150 |
T8149 |
prep |
of,response |
| R5288 |
T8151 |
T8152 |
compound |
bone,formation |
| R5289 |
T8152 |
T8150 |
pobj |
formation,of |
| R5290 |
T8153 |
T8154 |
aux |
to,compensate |
| R5291 |
T8154 |
T8149 |
advcl |
compensate,response |
| R5292 |
T8155 |
T8154 |
prep |
for,compensate |
| R5293 |
T8156 |
T8157 |
amod |
decreased,cartilage |
| R5294 |
T8157 |
T8155 |
pobj |
cartilage,for |
| R5295 |
T8158 |
T8157 |
amod |
articular,cartilage |
| R5296 |
T8159 |
T8144 |
punct |
", ",is |
| R5297 |
T8160 |
T8144 |
cc |
or,is |
| R5298 |
T8161 |
T8162 |
mark |
whether,is |
| R5299 |
T8162 |
T8144 |
conj |
is,is |
| R5300 |
T8163 |
T8162 |
nsubj |
it,is |
| R5301 |
T8164 |
T8165 |
det |
the,effect |
| R5302 |
T8165 |
T8162 |
attr |
effect,is |
| R5303 |
T8166 |
T8165 |
prep |
of,effect |
| R5304 |
T8167 |
T8166 |
pobj |
loss,of |
| R5305 |
T8168 |
T8167 |
prep |
of,loss |
| R5306 |
T8169 |
T8170 |
compound |
Bmpr1a,signaling |
| R5307 |
T8170 |
T8168 |
pobj |
signaling,of |
| R5308 |
T8171 |
T8165 |
prep |
in,effect |
| R5309 |
T8172 |
T8173 |
det |
some,cells |
| R5310 |
T8173 |
T8171 |
pobj |
cells,in |
| R5311 |
T8174 |
T8175 |
npadvmod |
LACZ,positive |
| R5312 |
T8175 |
T8173 |
amod |
positive,cells |
| R5313 |
T8176 |
T8175 |
punct |
-,positive |
| R5314 |
T8177 |
T8178 |
dep |
that,observed |
| R5315 |
T8178 |
T8173 |
relcl |
observed,cells |
| R5316 |
T8179 |
T8178 |
auxpass |
are,observed |
| R5317 |
T8180 |
T8178 |
advmod |
also,observed |
| R5318 |
T8181 |
T8178 |
prep |
in,observed |
| R5319 |
T8182 |
T8183 |
det |
these,regions |
| R5320 |
T8183 |
T8181 |
pobj |
regions,in |
| R5321 |
T8184 |
T8185 |
punct |
(,data |
| R5322 |
T8185 |
T8162 |
meta |
data,is |
| R5323 |
T8186 |
T8185 |
amod |
unpublished,data |
| R5324 |
T8187 |
T8185 |
punct |
),data |
| R5325 |
T8188 |
T8132 |
punct |
.,is |
| R5326 |
T8190 |
T8191 |
det |
The,signs |
| R5327 |
T8191 |
T8193 |
nsubjpass |
signs,accompanied |
| R5328 |
T8192 |
T8191 |
amod |
histological,signs |
| R5329 |
T8194 |
T8191 |
prep |
of,signs |
| R5330 |
T8195 |
T8196 |
compound |
joint,arthritis |
| R5331 |
T8196 |
T8194 |
pobj |
arthritis,of |
| R5332 |
T8197 |
T8193 |
auxpass |
were,accompanied |
| R5333 |
T8198 |
T8193 |
agent |
by,accompanied |
| R5334 |
T8199 |
T8200 |
amod |
functional,impairments |
| R5335 |
T8200 |
T8198 |
pobj |
impairments,by |
| R5336 |
T8201 |
T8200 |
prep |
in,impairments |
| R5337 |
T8202 |
T8203 |
preconj |
both,ability |
| R5338 |
T8203 |
T8201 |
pobj |
ability,in |
| R5339 |
T8204 |
T8203 |
amod |
grasping,ability |
| R5340 |
T8205 |
T8203 |
cc |
and,ability |
| R5341 |
T8206 |
T8203 |
conj |
range,ability |
| R5342 |
T8207 |
T8206 |
prep |
of,range |
| R5343 |
T8208 |
T8207 |
pobj |
motion,of |
| R5344 |
T8209 |
T8193 |
prep |
in,accompanied |
| R5345 |
T8210 |
T8211 |
compound |
mutant,animals |
| R5346 |
T8211 |
T8209 |
pobj |
animals,in |
| R5347 |
T8212 |
T8193 |
punct |
.,accompanied |
| R5348 |
T8214 |
T8215 |
compound |
Gdf5,Cre |
| R5349 |
T8215 |
T8217 |
compound |
Cre,Bmpr1afloxP |
| R5350 |
T8216 |
T8215 |
punct |
-,Cre |
| R5351 |
T8217 |
T8219 |
npadvmod |
Bmpr1afloxP,mutant |
| R5352 |
T8218 |
T8217 |
punct |
/,Bmpr1afloxP |
| R5353 |
T8219 |
T8220 |
amod |
mutant,animals |
| R5354 |
T8220 |
T8221 |
nsubj |
animals,showed |
| R5355 |
T8222 |
T8223 |
det |
a,ability |
| R5356 |
T8223 |
T8221 |
dobj |
ability,showed |
| R5357 |
T8224 |
T8225 |
advmod |
highly,significantly |
| R5358 |
T8225 |
T8226 |
advmod |
significantly,reduced |
| R5359 |
T8226 |
T8223 |
amod |
reduced,ability |
| R5360 |
T8227 |
T8228 |
aux |
to,grasp |
| R5361 |
T8228 |
T8223 |
acl |
grasp,ability |
| R5362 |
T8229 |
T8228 |
cc |
and,grasp |
| R5363 |
T8230 |
T8228 |
conj |
remain,grasp |
| R5364 |
T8231 |
T8230 |
oprd |
suspended,remain |
| R5365 |
T8232 |
T8231 |
prep |
on,suspended |
| R5366 |
T8233 |
T8234 |
det |
a,rod |
| R5367 |
T8234 |
T8230 |
dobj |
rod,remain |
| R5368 |
T8235 |
T8234 |
amod |
slender,rod |
| R5369 |
T8236 |
T8237 |
punct |
(,time |
| R5370 |
T8237 |
T8221 |
parataxis |
time,showed |
| R5371 |
T8238 |
T8237 |
amod |
mean,time |
| R5372 |
T8239 |
T8237 |
compound |
suspension,time |
| R5373 |
T8240 |
T8237 |
punct |
: ,time |
| R5374 |
T8241 |
T8242 |
nsubj |
controls,s |
| R5375 |
T8242 |
T8246 |
dep |
s,s |
| R5376 |
T8243 |
T8244 |
quantmod |
38,6 |
| R5377 |
T8244 |
T8242 |
nummod |
6,s |
| R5378 |
T8245 |
T8244 |
punct |
±,6 |
| R5379 |
T8246 |
T8237 |
dep |
s,time |
| R5380 |
T8247 |
T8242 |
punct |
", ",s |
| R5381 |
T8248 |
T8249 |
nsubj |
n,39 |
| R5382 |
T8249 |
T8242 |
advcl |
39,s |
| R5383 |
T8250 |
T8249 |
punct |
=,39 |
| R5384 |
T8251 |
T8246 |
punct |
;,s |
| R5385 |
T8252 |
T8246 |
nsubj |
mutants,s |
| R5386 |
T8253 |
T8254 |
quantmod |
6,3 |
| R5387 |
T8254 |
T8246 |
nummod |
3,s |
| R5388 |
T8255 |
T8254 |
punct |
±,3 |
| R5389 |
T8256 |
T8246 |
punct |
", ",s |
| R5390 |
T8257 |
T8258 |
nsubj |
n,11 |
| R5391 |
T8258 |
T8246 |
advcl |
11,s |
| R5392 |
T8259 |
T8258 |
punct |
=,11 |
| R5393 |
T8260 |
T8246 |
punct |
;,s |
| R5394 |
T8261 |
T8262 |
nsubj |
p,0.0001 |
| R5395 |
T8262 |
T8246 |
advcl |
0.0001,s |
| R5396 |
T8263 |
T8262 |
punct |
<,0.0001 |
| R5397 |
T8264 |
T8237 |
punct |
),time |
| R5398 |
T8265 |
T8221 |
punct |
.,showed |
| R5399 |
T8267 |
T8268 |
compound |
Mutant,mice |
| R5400 |
T8268 |
T8269 |
nsubj |
mice,showed |
| R5401 |
T8270 |
T8269 |
advmod |
also,showed |
| R5402 |
T8271 |
T8272 |
det |
a,decrease |
| R5403 |
T8272 |
T8269 |
dobj |
decrease,showed |
| R5404 |
T8273 |
T8272 |
amod |
clear,decrease |
| R5405 |
T8274 |
T8272 |
prep |
in,decrease |
| R5406 |
T8275 |
T8276 |
det |
the,range |
| R5407 |
T8276 |
T8274 |
pobj |
range,in |
| R5408 |
T8277 |
T8276 |
amod |
maximum,range |
| R5409 |
T8278 |
T8276 |
prep |
of,range |
| R5410 |
T8279 |
T8278 |
pobj |
mobility,of |
| R5411 |
T8280 |
T8276 |
prep |
of,range |
| R5412 |
T8281 |
T8282 |
nummod |
two,joints |
| R5413 |
T8282 |
T8280 |
pobj |
joints,of |
| R5414 |
T8283 |
T8282 |
amod |
different,joints |
| R5415 |
T8284 |
T8282 |
prep |
in,joints |
| R5416 |
T8285 |
T8286 |
det |
the,digits |
| R5417 |
T8286 |
T8284 |
pobj |
digits,in |
| R5418 |
T8287 |
T8269 |
punct |
", ",showed |
| R5419 |
T8288 |
T8289 |
mark |
as,assayed |
| R5420 |
T8289 |
T8269 |
advcl |
assayed,showed |
| R5421 |
T8290 |
T8289 |
agent |
by,assayed |
| R5422 |
T8291 |
T8292 |
amod |
passive,manipulation |
| R5423 |
T8292 |
T8290 |
pobj |
manipulation,by |
| R5424 |
T8293 |
T8294 |
punct |
(,0.05 |
| R5425 |
T8294 |
T8269 |
parataxis |
0.05,showed |
| R5426 |
T8295 |
T8296 |
compound |
MT,P1 |
| R5427 |
T8296 |
T8298 |
compound |
P1,joint |
| R5428 |
T8297 |
T8296 |
punct |
/,P1 |
| R5429 |
T8298 |
T8299 |
dep |
joint,0.0003 |
| R5430 |
T8299 |
T8294 |
dep |
0.0003,0.05 |
| R5431 |
T8300 |
T8299 |
punct |
: ,0.0003 |
| R5432 |
T8301 |
T8302 |
dep |
controls,26 |
| R5433 |
T8302 |
T8299 |
dep |
26,0.0003 |
| R5434 |
T8303 |
T8304 |
quantmod |
100,0 |
| R5435 |
T8304 |
T8306 |
nummod |
0,° |
| R5436 |
T8305 |
T8304 |
punct |
±,0 |
| R5437 |
T8306 |
T8302 |
dep |
°,26 |
| R5438 |
T8307 |
T8302 |
punct |
", ",26 |
| R5439 |
T8308 |
T8302 |
nsubj |
n,26 |
| R5440 |
T8309 |
T8302 |
punct |
=,26 |
| R5441 |
T8310 |
T8299 |
punct |
;,0.0003 |
| R5442 |
T8311 |
T8312 |
dep |
mutants,8 |
| R5443 |
T8312 |
T8299 |
dep |
8,0.0003 |
| R5444 |
T8313 |
T8314 |
quantmod |
82,3 |
| R5445 |
T8314 |
T8316 |
nummod |
3,° |
| R5446 |
T8315 |
T8314 |
punct |
±,3 |
| R5447 |
T8316 |
T8312 |
dep |
°,8 |
| R5448 |
T8317 |
T8312 |
punct |
", ",8 |
| R5449 |
T8318 |
T8312 |
nsubj |
n,8 |
| R5450 |
T8319 |
T8312 |
punct |
=,8 |
| R5451 |
T8320 |
T8299 |
punct |
;,0.0003 |
| R5452 |
T8321 |
T8299 |
nsubj |
p,0.0003 |
| R5453 |
T8322 |
T8299 |
punct |
<,0.0003 |
| R5454 |
T8323 |
T8294 |
punct |
;,0.05 |
| R5455 |
T8324 |
T8325 |
compound |
P1,P2 |
| R5456 |
T8325 |
T8327 |
compound |
P2,joint |
| R5457 |
T8326 |
T8325 |
punct |
/,P2 |
| R5458 |
T8327 |
T8294 |
dep |
joint,0.05 |
| R5459 |
T8328 |
T8294 |
punct |
: ,0.05 |
| R5460 |
T8329 |
T8330 |
dep |
controls,23 |
| R5461 |
T8330 |
T8294 |
dep |
23,0.05 |
| R5462 |
T8331 |
T8332 |
quantmod |
152,1 |
| R5463 |
T8332 |
T8334 |
nummod |
1,° |
| R5464 |
T8333 |
T8332 |
punct |
±,1 |
| R5465 |
T8334 |
T8330 |
dep |
°,23 |
| R5466 |
T8335 |
T8330 |
punct |
", ",23 |
| R5467 |
T8336 |
T8330 |
nsubj |
n,23 |
| R5468 |
T8337 |
T8330 |
punct |
=,23 |
| R5469 |
T8338 |
T8294 |
punct |
;,0.05 |
| R5470 |
T8339 |
T8340 |
dep |
mutants,6 |
| R5471 |
T8340 |
T8294 |
dep |
6,0.05 |
| R5472 |
T8341 |
T8342 |
quantmod |
140,5 |
| R5473 |
T8342 |
T8344 |
nummod |
5,° |
| R5474 |
T8343 |
T8342 |
punct |
±,5 |
| R5475 |
T8344 |
T8340 |
dep |
°,6 |
| R5476 |
T8345 |
T8340 |
punct |
", ",6 |
| R5477 |
T8346 |
T8340 |
nsubj |
n,6 |
| R5478 |
T8347 |
T8340 |
punct |
=,6 |
| R5479 |
T8348 |
T8340 |
punct |
;,6 |
| R5480 |
T8349 |
T8294 |
nsubj |
p,0.05 |
| R5481 |
T8350 |
T8294 |
punct |
<,0.05 |
| R5482 |
T8351 |
T8294 |
punct |
),0.05 |
| R5483 |
T8352 |
T8269 |
punct |
.,showed |
| R5484 |
T8354 |
T8355 |
det |
The,changes |
| R5485 |
T8355 |
T8366 |
nsubj |
changes,demonstrate |
| R5486 |
T8356 |
T8355 |
amod |
structural,changes |
| R5487 |
T8357 |
T8356 |
punct |
", ",structural |
| R5488 |
T8358 |
T8356 |
conj |
histological,structural |
| R5489 |
T8359 |
T8358 |
punct |
", ",histological |
| R5490 |
T8360 |
T8361 |
compound |
marker,gene |
| R5491 |
T8361 |
T8362 |
compound |
gene,expression |
| R5492 |
T8362 |
T8358 |
conj |
expression,histological |
| R5493 |
T8363 |
T8362 |
punct |
", ",expression |
| R5494 |
T8364 |
T8362 |
cc |
and,expression |
| R5495 |
T8365 |
T8362 |
conj |
functional,expression |
| R5496 |
T8367 |
T8355 |
prep |
in,changes |
| R5497 |
T8368 |
T8369 |
compound |
mutant,mice |
| R5498 |
T8369 |
T8367 |
pobj |
mice,in |
| R5499 |
T8370 |
T8371 |
mark |
that,required |
| R5500 |
T8371 |
T8366 |
ccomp |
required,demonstrate |
| R5501 |
T8372 |
T8371 |
nsubjpass |
BMPR1A,required |
| R5502 |
T8373 |
T8371 |
auxpass |
is,required |
| R5503 |
T8374 |
T8371 |
prep |
for,required |
| R5504 |
T8375 |
T8376 |
amod |
normal,maintenance |
| R5505 |
T8376 |
T8374 |
pobj |
maintenance,for |
| R5506 |
T8377 |
T8376 |
amod |
postnatal,maintenance |
| R5507 |
T8378 |
T8376 |
prep |
of,maintenance |
| R5508 |
T8379 |
T8380 |
amod |
articular,cartilage |
| R5509 |
T8380 |
T8378 |
pobj |
cartilage,of |
| R5510 |
T8381 |
T8366 |
punct |
.,demonstrate |
| R5531 |
T9223 |
T9224 |
amod |
Previous,studies |
| R5532 |
T9224 |
T9225 |
nsubj |
studies,suggest |
| R5533 |
T9226 |
T9227 |
mark |
that,involved |
| R5534 |
T9227 |
T9225 |
ccomp |
involved,suggest |
| R5535 |
T9228 |
T9229 |
compound |
BMP,signaling |
| R5536 |
T9229 |
T9227 |
nsubjpass |
signaling,involved |
| R5537 |
T9230 |
T9227 |
auxpass |
is,involved |
| R5538 |
T9231 |
T9227 |
prep |
in,involved |
| R5539 |
T9232 |
T9233 |
det |
a,number |
| R5540 |
T9233 |
T9231 |
pobj |
number,in |
| R5541 |
T9234 |
T9233 |
amod |
large,number |
| R5542 |
T9235 |
T9233 |
prep |
of,number |
| R5543 |
T9236 |
T9237 |
amod |
developmental,events |
| R5544 |
T9237 |
T9235 |
pobj |
events,of |
| R5545 |
T9238 |
T9225 |
punct |
.,suggest |
| R5546 |
T9240 |
T9241 |
nsubj |
Many,occur |
| R5547 |
T9242 |
T9240 |
prep |
of,Many |
| R5548 |
T9243 |
T9244 |
det |
these,events |
| R5549 |
T9244 |
T9242 |
pobj |
events,of |
| R5550 |
T9245 |
T9241 |
advmod |
early,occur |
| R5551 |
T9246 |
T9241 |
prep |
in,occur |
| R5552 |
T9247 |
T9246 |
pobj |
embryogenesis,in |
| R5553 |
T9248 |
T9241 |
punct |
", ",occur |
| R5554 |
T9249 |
T9241 |
cc |
and,occur |
| R5555 |
T9250 |
T9251 |
amod |
complete,inactivation |
| R5556 |
T9251 |
T9252 |
nsubj |
inactivation,causes |
| R5557 |
T9252 |
T9241 |
conj |
causes,occur |
| R5558 |
T9253 |
T9251 |
prep |
of,inactivation |
| R5559 |
T9254 |
T9255 |
compound |
BMP,receptors |
| R5560 |
T9255 |
T9253 |
pobj |
receptors,of |
| R5561 |
T9256 |
T9252 |
dobj |
death,causes |
| R5562 |
T9257 |
T9252 |
prep |
by,causes |
| R5563 |
T9258 |
T9257 |
pobj |
E9.5,by |
| R5564 |
T9259 |
T9260 |
punct |
(,Mishina |
| R5565 |
T9260 |
T9252 |
meta |
Mishina,causes |
| R5566 |
T9261 |
T9260 |
nmod |
et,Mishina |
| R5567 |
T9262 |
T9260 |
nmod |
al.,Mishina |
| R5568 |
T9263 |
T9260 |
nummod |
1995,Mishina |
| R5569 |
T9264 |
T9260 |
punct |
),Mishina |
| R5570 |
T9265 |
T9252 |
punct |
.,causes |
| R5571 |
T9267 |
T9268 |
det |
The,system |
| R5572 |
T9268 |
T9273 |
nsubj |
system,bypasses |
| R5573 |
T9269 |
T9270 |
compound |
Gdf5,Cre |
| R5574 |
T9270 |
T9268 |
compound |
Cre,system |
| R5575 |
T9271 |
T9270 |
punct |
-,Cre |
| R5576 |
T9272 |
T9268 |
compound |
recombination,system |
| R5577 |
T9274 |
T9275 |
det |
the,lethality |
| R5578 |
T9275 |
T9273 |
dobj |
lethality,bypasses |
| R5579 |
T9276 |
T9275 |
amod |
early,lethality |
| R5580 |
T9277 |
T9275 |
amod |
embryonic,lethality |
| R5581 |
T9278 |
T9275 |
prep |
of,lethality |
| R5582 |
T9279 |
T9280 |
compound |
Bmpr1a,mutations |
| R5583 |
T9280 |
T9278 |
pobj |
mutations,of |
| R5584 |
T9281 |
T9273 |
punct |
", ",bypasses |
| R5585 |
T9282 |
T9273 |
cc |
and,bypasses |
| R5586 |
T9283 |
T9273 |
conj |
provides,bypasses |
| R5587 |
T9284 |
T9285 |
amod |
important,information |
| R5588 |
T9285 |
T9283 |
dobj |
information,provides |
| R5589 |
T9286 |
T9285 |
amod |
new,information |
| R5590 |
T9287 |
T9285 |
prep |
about,information |
| R5591 |
T9288 |
T9289 |
det |
the,role |
| R5592 |
T9289 |
T9287 |
pobj |
role,about |
| R5593 |
T9290 |
T9289 |
prep |
of,role |
| R5594 |
T9291 |
T9292 |
det |
this,receptor |
| R5595 |
T9292 |
T9290 |
pobj |
receptor,of |
| R5596 |
T9293 |
T9289 |
prep |
in,role |
| R5597 |
T9294 |
T9295 |
nmod |
limb,development |
| R5598 |
T9295 |
T9293 |
pobj |
development,in |
| R5599 |
T9296 |
T9294 |
cc |
and,limb |
| R5600 |
T9297 |
T9294 |
conj |
skeletal,limb |
| R5601 |
T9298 |
T9273 |
punct |
.,bypasses |
| R5602 |
T9300 |
T9301 |
det |
The,phenotypes |
| R5603 |
T9301 |
T9305 |
nsubj |
phenotypes,include |
| R5604 |
T9302 |
T9301 |
nummod |
three,phenotypes |
| R5605 |
T9303 |
T9301 |
amod |
major,phenotypes |
| R5606 |
T9304 |
T9301 |
compound |
limb,phenotypes |
| R5607 |
T9306 |
T9301 |
acl |
revealed,phenotypes |
| R5608 |
T9307 |
T9306 |
agent |
by,revealed |
| R5609 |
T9308 |
T9307 |
pcomp |
eliminating,by |
| R5610 |
T9309 |
T9308 |
dobj |
Bmpr1a,eliminating |
| R5611 |
T9310 |
T9308 |
prep |
with,eliminating |
| R5612 |
T9311 |
T9312 |
npadvmod |
Gdf5,driven |
| R5613 |
T9312 |
T9314 |
amod |
driven,Cre |
| R5614 |
T9313 |
T9312 |
punct |
-,driven |
| R5615 |
T9314 |
T9310 |
pobj |
Cre,with |
| R5616 |
T9315 |
T9305 |
dobj |
webbing,include |
| R5617 |
T9316 |
T9315 |
prep |
between,webbing |
| R5618 |
T9317 |
T9316 |
pobj |
digits,between |
| R5619 |
T9318 |
T9315 |
punct |
", ",webbing |
| R5620 |
T9319 |
T9315 |
conj |
lack,webbing |
| R5621 |
T9320 |
T9319 |
prep |
of,lack |
| R5622 |
T9321 |
T9322 |
compound |
joint,formation |
| R5623 |
T9322 |
T9320 |
pobj |
formation,of |
| R5624 |
T9323 |
T9319 |
prep |
at,lack |
| R5625 |
T9324 |
T9325 |
amod |
specific,locations |
| R5626 |
T9325 |
T9323 |
pobj |
locations,at |
| R5627 |
T9326 |
T9325 |
prep |
in,locations |
| R5628 |
T9327 |
T9328 |
det |
the,ankle |
| R5629 |
T9328 |
T9326 |
pobj |
ankle,in |
| R5630 |
T9329 |
T9319 |
punct |
", ",lack |
| R5631 |
T9330 |
T9319 |
cc |
and,lack |
| R5632 |
T9331 |
T9319 |
conj |
failure,lack |
| R5633 |
T9332 |
T9333 |
aux |
to,maintain |
| R5634 |
T9333 |
T9331 |
acl |
maintain,failure |
| R5635 |
T9334 |
T9335 |
amod |
articular,cartilage |
| R5636 |
T9335 |
T9333 |
dobj |
cartilage,maintain |
| R5637 |
T9336 |
T9333 |
prep |
after,maintain |
| R5638 |
T9337 |
T9336 |
pobj |
birth,after |
| R5639 |
T9338 |
T9333 |
punct |
", ",maintain |
| R5640 |
T9339 |
T9333 |
advcl |
resulting,maintain |
| R5641 |
T9340 |
T9339 |
prep |
in,resulting |
| R5642 |
T9341 |
T9342 |
amod |
severe,arthritis |
| R5643 |
T9342 |
T9340 |
pobj |
arthritis,in |
| R5644 |
T9343 |
T9305 |
punct |
.,include |
| R5645 |
T9345 |
T9346 |
amod |
Previous,studies |
| R5646 |
T9346 |
T9347 |
nsubj |
studies,shown |
| R5647 |
T9348 |
T9347 |
aux |
have,shown |
| R5648 |
T9349 |
T9350 |
mark |
that,alters |
| R5649 |
T9350 |
T9347 |
ccomp |
alters,shown |
| R5650 |
T9351 |
T9350 |
nsubj |
manipulation,alters |
| R5651 |
T9352 |
T9351 |
prep |
of,manipulation |
| R5652 |
T9353 |
T9354 |
compound |
BMP,signaling |
| R5653 |
T9354 |
T9352 |
pobj |
signaling,of |
| R5654 |
T9355 |
T9356 |
amod |
interdigital,apoptosis |
| R5655 |
T9356 |
T9350 |
dobj |
apoptosis,alters |
| R5656 |
T9357 |
T9350 |
prep |
during,alters |
| R5657 |
T9358 |
T9357 |
pobj |
development,during |
| R5658 |
T9359 |
T9358 |
prep |
of,development |
| R5659 |
T9360 |
T9361 |
det |
the,limb |
| R5660 |
T9361 |
T9359 |
pobj |
limb,of |
| R5661 |
T9362 |
T9347 |
punct |
", ",shown |
| R5662 |
T9363 |
T9347 |
cc |
but,shown |
| R5663 |
T9364 |
T9365 |
det |
no,experiment |
| R5664 |
T9365 |
T9366 |
nsubj |
experiment,identified |
| R5665 |
T9366 |
T9347 |
conj |
identified,shown |
| R5666 |
T9367 |
T9366 |
aux |
has,identified |
| R5667 |
T9368 |
T9369 |
det |
a,member |
| R5668 |
T9369 |
T9366 |
dobj |
member,identified |
| R5669 |
T9370 |
T9369 |
amod |
specific,member |
| R5670 |
T9371 |
T9369 |
prep |
of,member |
| R5671 |
T9372 |
T9373 |
det |
the,pathway |
| R5672 |
T9373 |
T9371 |
pobj |
pathway,of |
| R5673 |
T9374 |
T9375 |
compound |
BMP,signaling |
| R5674 |
T9375 |
T9373 |
compound |
signaling,pathway |
| R5675 |
T9376 |
T9377 |
dep |
that,required |
| R5676 |
T9377 |
T9369 |
relcl |
required,member |
| R5677 |
T9378 |
T9377 |
auxpass |
is,required |
| R5678 |
T9379 |
T9377 |
prep |
for,required |
| R5679 |
T9380 |
T9381 |
det |
this,process |
| R5680 |
T9381 |
T9379 |
pobj |
process,for |
| R5681 |
T9382 |
T9383 |
punct |
(,Yokouchi |
| R5682 |
T9383 |
T9366 |
meta |
Yokouchi,identified |
| R5683 |
T9384 |
T9383 |
nmod |
et,Yokouchi |
| R5684 |
T9385 |
T9383 |
nmod |
al.,Yokouchi |
| R5685 |
T9386 |
T9383 |
nummod |
1996,Yokouchi |
| R5686 |
T9387 |
T9383 |
punct |
;,Yokouchi |
| R5687 |
T9388 |
T9383 |
conj |
Zou,Yokouchi |
| R5688 |
T9389 |
T9388 |
cc |
and,Zou |
| R5689 |
T9390 |
T9388 |
conj |
Niswander,Zou |
| R5690 |
T9391 |
T9390 |
nummod |
1996,Niswander |
| R5691 |
T9392 |
T9390 |
punct |
;,Niswander |
| R5692 |
T9393 |
T9390 |
conj |
Zou,Niswander |
| R5693 |
T9394 |
T9393 |
nmod |
et,Zou |
| R5694 |
T9395 |
T9393 |
nmod |
al.,Zou |
| R5695 |
T9396 |
T9393 |
nummod |
1997,Zou |
| R5696 |
T9397 |
T9393 |
punct |
;,Zou |
| R5697 |
T9398 |
T9393 |
conj |
Guha,Zou |
| R5698 |
T9399 |
T9398 |
nmod |
et,Guha |
| R5699 |
T9400 |
T9398 |
nmod |
al.,Guha |
| R5700 |
T9401 |
T9398 |
nummod |
2002,Guha |
| R5701 |
T9402 |
T9398 |
punct |
),Guha |
| R5702 |
T9403 |
T9366 |
punct |
.,identified |
| R5703 |
T9405 |
T9406 |
poss |
Our,data |
| R5704 |
T9406 |
T9413 |
nsubj |
data,confirm |
| R5705 |
T9407 |
T9406 |
amod |
new,data |
| R5706 |
T9408 |
T9406 |
nmod |
loss,data |
| R5707 |
T9409 |
T9408 |
punct |
-,loss |
| R5708 |
T9410 |
T9408 |
prep |
of,loss |
| R5709 |
T9411 |
T9410 |
punct |
-,of |
| R5710 |
T9412 |
T9410 |
pobj |
function,of |
| R5711 |
T9414 |
T9415 |
mark |
that,required |
| R5712 |
T9415 |
T9413 |
ccomp |
required,confirm |
| R5713 |
T9416 |
T9417 |
compound |
BMP,signaling |
| R5714 |
T9417 |
T9415 |
nsubjpass |
signaling,required |
| R5715 |
T9418 |
T9415 |
auxpass |
is,required |
| R5716 |
T9419 |
T9415 |
prep |
for,required |
| R5717 |
T9420 |
T9421 |
amod |
interdigital,apoptosis |
| R5718 |
T9421 |
T9419 |
pobj |
apoptosis,for |
| R5719 |
T9422 |
T9415 |
cc |
and,required |
| R5720 |
T9423 |
T9415 |
conj |
suggests,required |
| R5721 |
T9424 |
T9425 |
mark |
that,is |
| R5722 |
T9425 |
T9423 |
ccomp |
is,suggests |
| R5723 |
T9426 |
T9425 |
nsubj |
Bmpr1a,is |
| R5724 |
T9427 |
T9428 |
det |
a,component |
| R5725 |
T9428 |
T9425 |
attr |
component,is |
| R5726 |
T9429 |
T9428 |
amod |
critical,component |
| R5727 |
T9430 |
T9428 |
prep |
for,component |
| R5728 |
T9431 |
T9430 |
pcomp |
mediating,for |
| R5729 |
T9432 |
T9433 |
det |
this,signal |
| R5730 |
T9433 |
T9431 |
dobj |
signal,mediating |
| R5731 |
T9434 |
T9413 |
punct |
.,confirm |
| R5732 |
T9436 |
T9437 |
prep |
At,leads |
| R5733 |
T9438 |
T9439 |
det |
some,sites |
| R5734 |
T9439 |
T9436 |
pobj |
sites,At |
| R5735 |
T9440 |
T9437 |
punct |
", ",leads |
| R5736 |
T9441 |
T9437 |
nsubj |
loss,leads |
| R5737 |
T9442 |
T9441 |
prep |
of,loss |
| R5738 |
T9443 |
T9444 |
compound |
Bmpr1a,function |
| R5739 |
T9444 |
T9442 |
pobj |
function,of |
| R5740 |
T9445 |
T9437 |
prep |
to,leads |
| R5741 |
T9446 |
T9447 |
det |
a,defect |
| R5742 |
T9447 |
T9445 |
pobj |
defect,to |
| R5743 |
T9448 |
T9447 |
prep |
in,defect |
| R5744 |
T9449 |
T9450 |
det |
the,stages |
| R5745 |
T9450 |
T9448 |
pobj |
stages,in |
| R5746 |
T9451 |
T9450 |
amod |
early,stages |
| R5747 |
T9452 |
T9450 |
prep |
of,stages |
| R5748 |
T9453 |
T9454 |
compound |
joint,formation |
| R5749 |
T9454 |
T9452 |
pobj |
formation,of |
| R5750 |
T9455 |
T9437 |
punct |
", ",leads |
| R5751 |
T9456 |
T9437 |
advcl |
resulting,leads |
| R5752 |
T9457 |
T9456 |
prep |
in,resulting |
| R5753 |
T9458 |
T9459 |
det |
a,failure |
| R5754 |
T9459 |
T9457 |
pobj |
failure,in |
| R5755 |
T9460 |
T9459 |
amod |
complete,failure |
| R5756 |
T9461 |
T9462 |
aux |
to,form |
| R5757 |
T9462 |
T9459 |
acl |
form,failure |
| R5758 |
T9463 |
T9464 |
det |
a,joint |
| R5759 |
T9464 |
T9462 |
dobj |
joint,form |
| R5760 |
T9465 |
T9459 |
cc |
and,failure |
| R5761 |
T9466 |
T9459 |
conj |
fusion,failure |
| R5762 |
T9467 |
T9466 |
prep |
of,fusion |
| R5763 |
T9468 |
T9467 |
pobj |
bones,of |
| R5764 |
T9469 |
T9466 |
prep |
in,fusion |
| R5765 |
T9470 |
T9471 |
det |
the,ankle |
| R5766 |
T9471 |
T9469 |
pobj |
ankle,in |
| R5767 |
T9472 |
T9437 |
punct |
.,leads |
| R5768 |
T9474 |
T9475 |
nsubj |
Mutations,produce |
| R5769 |
T9476 |
T9474 |
prep |
in,Mutations |
| R5770 |
T9477 |
T9478 |
nummod |
two,ligands |
| R5771 |
T9478 |
T9476 |
pobj |
ligands,in |
| R5772 |
T9479 |
T9478 |
amod |
different,ligands |
| R5773 |
T9480 |
T9478 |
prep |
in,ligands |
| R5774 |
T9481 |
T9482 |
det |
the,family |
| R5775 |
T9482 |
T9480 |
pobj |
family,in |
| R5776 |
T9483 |
T9482 |
compound |
BMP,family |
| R5777 |
T9484 |
T9478 |
punct |
", ",ligands |
| R5778 |
T9485 |
T9478 |
appos |
Gdf5,ligands |
| R5779 |
T9486 |
T9485 |
cc |
and,Gdf5 |
| R5780 |
T9487 |
T9485 |
conj |
Gdf6,Gdf5 |
| R5781 |
T9488 |
T9478 |
punct |
", ",ligands |
| R5782 |
T9489 |
T9490 |
det |
the,receptor |
| R5783 |
T9490 |
T9478 |
appos |
receptor,ligands |
| R5784 |
T9491 |
T9490 |
compound |
Bmpr1b,receptor |
| R5785 |
T9492 |
T9476 |
punct |
", ",in |
| R5786 |
T9493 |
T9476 |
cc |
and,in |
| R5787 |
T9494 |
T9476 |
conj |
in,in |
| R5788 |
T9495 |
T9496 |
det |
the,locus |
| R5789 |
T9496 |
T9494 |
pobj |
locus,in |
| R5790 |
T9497 |
T9496 |
amod |
human,locus |
| R5791 |
T9498 |
T9496 |
compound |
Noggin,locus |
| R5792 |
T9499 |
T9500 |
punct |
(,Storm |
| R5793 |
T9500 |
T9474 |
meta |
Storm,Mutations |
| R5794 |
T9501 |
T9500 |
cc |
and,Storm |
| R5795 |
T9502 |
T9500 |
conj |
Kingsley,Storm |
| R5796 |
T9503 |
T9502 |
nummod |
1996,Kingsley |
| R5797 |
T9504 |
T9502 |
punct |
;,Kingsley |
| R5798 |
T9505 |
T9502 |
conj |
Gong,Kingsley |
| R5799 |
T9506 |
T9505 |
nmod |
et,Gong |
| R5800 |
T9507 |
T9505 |
nmod |
al.,Gong |
| R5801 |
T9508 |
T9505 |
nummod |
1999,Gong |
| R5802 |
T9509 |
T9505 |
punct |
;,Gong |
| R5803 |
T9510 |
T9505 |
conj |
Baur,Gong |
| R5804 |
T9511 |
T9510 |
nmod |
et,Baur |
| R5805 |
T9512 |
T9510 |
nmod |
al.,Baur |
| R5806 |
T9513 |
T9510 |
nummod |
2000,Baur |
| R5807 |
T9514 |
T9510 |
punct |
;,Baur |
| R5808 |
T9515 |
T9510 |
conj |
Yi,Baur |
| R5809 |
T9516 |
T9515 |
nmod |
et,Yi |
| R5810 |
T9517 |
T9515 |
nmod |
al.,Yi |
| R5811 |
T9518 |
T9515 |
nummod |
2000,Yi |
| R5812 |
T9519 |
T9515 |
punct |
;,Yi |
| R5813 |
T9520 |
T9515 |
conj |
Settle,Yi |
| R5814 |
T9521 |
T9520 |
nmod |
et,Settle |
| R5815 |
T9522 |
T9520 |
nmod |
al.,Settle |
| R5816 |
T9523 |
T9520 |
nummod |
2003,Settle |
| R5817 |
T9524 |
T9520 |
punct |
),Settle |
| R5818 |
T9525 |
T9475 |
advmod |
also,produce |
| R5819 |
T9526 |
T9475 |
dobj |
defects,produce |
| R5820 |
T9527 |
T9526 |
prep |
in,defects |
| R5821 |
T9528 |
T9529 |
compound |
joint,formation |
| R5822 |
T9529 |
T9527 |
pobj |
formation,in |
| R5823 |
T9530 |
T9475 |
prep |
at,produce |
| R5824 |
T9531 |
T9532 |
amod |
specific,locations |
| R5825 |
T9532 |
T9530 |
pobj |
locations,at |
| R5826 |
T9533 |
T9532 |
prep |
in,locations |
| R5827 |
T9534 |
T9535 |
det |
the,limbs |
| R5828 |
T9535 |
T9533 |
pobj |
limbs,in |
| R5829 |
T9536 |
T9475 |
punct |
.,produce |
| R5830 |
T9538 |
T9539 |
det |
The,defects |
| R5831 |
T9539 |
T9541 |
nsubj |
defects,provide |
| R5832 |
T9540 |
T9539 |
compound |
joint,defects |
| R5833 |
T9542 |
T9539 |
acl |
associated,defects |
| R5834 |
T9543 |
T9542 |
prep |
with,associated |
| R5835 |
T9544 |
T9545 |
amod |
multiple,components |
| R5836 |
T9545 |
T9543 |
pobj |
components,with |
| R5837 |
T9546 |
T9545 |
prep |
of,components |
| R5838 |
T9547 |
T9548 |
det |
the,pathway |
| R5839 |
T9548 |
T9546 |
pobj |
pathway,of |
| R5840 |
T9549 |
T9548 |
compound |
BMP,pathway |
| R5841 |
T9550 |
T9551 |
amod |
strong,evidence |
| R5842 |
T9551 |
T9541 |
dobj |
evidence,provide |
| R5843 |
T9552 |
T9553 |
mark |
that,required |
| R5844 |
T9553 |
T9551 |
acl |
required,evidence |
| R5845 |
T9554 |
T9555 |
compound |
BMP,signaling |
| R5846 |
T9555 |
T9553 |
nsubjpass |
signaling,required |
| R5847 |
T9556 |
T9553 |
auxpass |
is,required |
| R5848 |
T9557 |
T9553 |
prep |
for,required |
| R5849 |
T9558 |
T9559 |
amod |
early,stages |
| R5850 |
T9559 |
T9557 |
pobj |
stages,for |
| R5851 |
T9560 |
T9559 |
prep |
of,stages |
| R5852 |
T9561 |
T9562 |
compound |
joint,formation |
| R5853 |
T9562 |
T9560 |
pobj |
formation,of |
| R5854 |
T9563 |
T9553 |
prep |
at,required |
| R5855 |
T9564 |
T9565 |
det |
some,locations |
| R5856 |
T9565 |
T9563 |
pobj |
locations,at |
| R5857 |
T9566 |
T9565 |
amod |
anatomical,locations |
| R5858 |
T9567 |
T9541 |
punct |
.,provide |
| R5859 |
T9569 |
T9570 |
amod |
Most,joints |
| R5860 |
T9570 |
T9571 |
nsubj |
joints,form |
| R5861 |
T9572 |
T9571 |
advmod |
still,form |
| R5862 |
T9573 |
T9571 |
advmod |
normally,form |
| R5863 |
T9574 |
T9575 |
advmod |
when,knocked |
| R5864 |
T9575 |
T9571 |
advcl |
knocked,form |
| R5865 |
T9576 |
T9575 |
nsubjpass |
Bmpr1a,knocked |
| R5866 |
T9577 |
T9575 |
auxpass |
is,knocked |
| R5867 |
T9578 |
T9575 |
prt |
out,knocked |
| R5868 |
T9579 |
T9575 |
prep |
in,knocked |
| R5869 |
T9580 |
T9581 |
compound |
Gdf5,domains |
| R5870 |
T9581 |
T9579 |
pobj |
domains,in |
| R5871 |
T9582 |
T9581 |
compound |
expression,domains |
| R5872 |
T9583 |
T9571 |
punct |
.,form |
| R5873 |
T9585 |
T9586 |
det |
The,lack |
| R5874 |
T9586 |
T9587 |
nsubj |
lack,be |
| R5875 |
T9588 |
T9586 |
prep |
of,lack |
| R5876 |
T9589 |
T9590 |
compound |
joint,fusions |
| R5877 |
T9590 |
T9588 |
pobj |
fusions,of |
| R5878 |
T9591 |
T9586 |
prep |
outside,lack |
| R5879 |
T9592 |
T9593 |
det |
the,region |
| R5880 |
T9593 |
T9591 |
pobj |
region,outside |
| R5881 |
T9594 |
T9593 |
compound |
ankle,region |
| R5882 |
T9595 |
T9587 |
aux |
could,be |
| R5883 |
T9596 |
T9587 |
prep |
due,be |
| R5884 |
T9597 |
T9596 |
prep |
to,due |
| R5885 |
T9598 |
T9597 |
pobj |
differences,to |
| R5886 |
T9599 |
T9598 |
prep |
in,differences |
| R5887 |
T9600 |
T9599 |
pobj |
requirement,in |
| R5888 |
T9601 |
T9600 |
prep |
for,requirement |
| R5889 |
T9602 |
T9603 |
compound |
BMP,signaling |
| R5890 |
T9603 |
T9601 |
pobj |
signaling,for |
| R5891 |
T9604 |
T9598 |
prep |
in,differences |
| R5892 |
T9605 |
T9606 |
amod |
different,joints |
| R5893 |
T9606 |
T9604 |
pobj |
joints,in |
| R5894 |
T9607 |
T9597 |
punct |
", ",to |
| R5895 |
T9608 |
T9597 |
conj |
to,to |
| R5896 |
T9609 |
T9610 |
amod |
compensating,expression |
| R5897 |
T9610 |
T9608 |
pobj |
expression,to |
| R5898 |
T9611 |
T9610 |
prep |
of,expression |
| R5899 |
T9612 |
T9613 |
amod |
other,receptors |
| R5900 |
T9613 |
T9611 |
pobj |
receptors,of |
| R5901 |
T9614 |
T9613 |
compound |
BMP,receptors |
| R5902 |
T9615 |
T9613 |
prep |
outside,receptors |
| R5903 |
T9616 |
T9617 |
det |
the,ankles |
| R5904 |
T9617 |
T9615 |
pobj |
ankles,outside |
| R5905 |
T9618 |
T9608 |
punct |
", ",to |
| R5906 |
T9619 |
T9608 |
cc |
or,to |
| R5907 |
T9620 |
T9608 |
conj |
to,to |
| R5908 |
T9621 |
T9620 |
pobj |
differences,to |
| R5909 |
T9622 |
T9621 |
prep |
in,differences |
| R5910 |
T9623 |
T9624 |
det |
the,timing |
| R5911 |
T9624 |
T9622 |
pobj |
timing,in |
| R5912 |
T9625 |
T9624 |
amod |
detailed,timing |
| R5913 |
T9626 |
T9624 |
prep |
of,timing |
| R5914 |
T9627 |
T9628 |
compound |
Gdf5,Cre |
| R5915 |
T9628 |
T9630 |
npadvmod |
Cre,stimulated |
| R5916 |
T9629 |
T9628 |
punct |
-,Cre |
| R5917 |
T9630 |
T9631 |
amod |
stimulated,inactivation |
| R5918 |
T9631 |
T9626 |
pobj |
inactivation,of |
| R5919 |
T9632 |
T9631 |
compound |
gene,inactivation |
| R5920 |
T9633 |
T9631 |
prep |
in,inactivation |
| R5921 |
T9634 |
T9633 |
pobj |
ankles,in |
| R5922 |
T9635 |
T9634 |
cc |
and,ankles |
| R5923 |
T9636 |
T9637 |
amod |
other,regions |
| R5924 |
T9637 |
T9634 |
conj |
regions,ankles |
| R5925 |
T9638 |
T9637 |
compound |
joint,regions |
| R5926 |
T9639 |
T9587 |
punct |
.,be |
| R5927 |
T9641 |
T9642 |
nsubj |
Comparison,suggests |
| R5928 |
T9643 |
T9641 |
prep |
of,Comparison |
| R5929 |
T9644 |
T9645 |
det |
the,expression |
| R5930 |
T9645 |
T9643 |
pobj |
expression,of |
| R5931 |
T9646 |
T9645 |
prep |
of,expression |
| R5932 |
T9647 |
T9648 |
det |
the,marker |
| R5933 |
T9648 |
T9646 |
pobj |
marker,of |
| R5934 |
T9649 |
T9648 |
compound |
HPLAP,marker |
| R5935 |
T9650 |
T9648 |
punct |
(,marker |
| R5936 |
T9651 |
T9648 |
acl |
driven,marker |
| R5937 |
T9652 |
T9651 |
advmod |
directly,driven |
| R5938 |
T9653 |
T9651 |
agent |
by,driven |
| R5939 |
T9654 |
T9655 |
compound |
Gdf5,elements |
| R5940 |
T9655 |
T9653 |
pobj |
elements,by |
| R5941 |
T9656 |
T9655 |
compound |
control,elements |
| R5942 |
T9657 |
T9648 |
punct |
),marker |
| R5943 |
T9658 |
T9648 |
cc |
and,marker |
| R5944 |
T9659 |
T9660 |
det |
the,marker |
| R5945 |
T9660 |
T9648 |
conj |
marker,marker |
| R5946 |
T9661 |
T9662 |
compound |
R26R,LACZ |
| R5947 |
T9662 |
T9660 |
compound |
LACZ,marker |
| R5948 |
T9663 |
T9660 |
punct |
(,marker |
| R5949 |
T9664 |
T9660 |
acl |
expressed,marker |
| R5950 |
T9665 |
T9664 |
advcl |
following,expressed |
| R5951 |
T9666 |
T9667 |
compound |
Gdf5,Cre |
| R5952 |
T9667 |
T9669 |
compound |
Cre,recombination |
| R5953 |
T9668 |
T9667 |
punct |
-,Cre |
| R5954 |
T9669 |
T9665 |
dobj |
recombination,following |
| R5955 |
T9670 |
T9660 |
punct |
),marker |
| R5956 |
T9671 |
T9672 |
mark |
that,delayed |
| R5957 |
T9672 |
T9642 |
ccomp |
delayed,suggests |
| R5958 |
T9673 |
T9674 |
npadvmod |
recombination,stimulated |
| R5959 |
T9674 |
T9676 |
amod |
stimulated,changes |
| R5960 |
T9675 |
T9674 |
punct |
-,stimulated |
| R5961 |
T9676 |
T9672 |
nsubjpass |
changes,delayed |
| R5962 |
T9677 |
T9676 |
prep |
in,changes |
| R5963 |
T9678 |
T9679 |
compound |
gene,expression |
| R5964 |
T9679 |
T9677 |
pobj |
expression,in |
| R5965 |
T9680 |
T9672 |
aux |
may,delayed |
| R5966 |
T9681 |
T9672 |
auxpass |
be,delayed |
| R5967 |
T9682 |
T9672 |
prep |
for,delayed |
| R5968 |
T9683 |
T9684 |
det |
a,d |
| R5969 |
T9684 |
T9682 |
pobj |
d,for |
| R5970 |
T9685 |
T9686 |
quantmod |
0.5,1 |
| R5971 |
T9686 |
T9684 |
nummod |
1,d |
| R5972 |
T9687 |
T9686 |
punct |
–,1 |
| R5973 |
T9688 |
T9672 |
prep |
in,delayed |
| R5974 |
T9689 |
T9690 |
det |
the,region |
| R5975 |
T9690 |
T9688 |
pobj |
region,in |
| R5976 |
T9691 |
T9690 |
compound |
digit,region |
| R5977 |
T9692 |
T9693 |
punct |
(,see |
| R5978 |
T9693 |
T9642 |
parataxis |
see,suggests |
| R5979 |
T9694 |
T9693 |
dobj |
Figure,see |
| R5980 |
T9695 |
T9694 |
nummod |
1C,Figure |
| R5981 |
T9696 |
T9693 |
punct |
),see |
| R5982 |
T9697 |
T9642 |
punct |
.,suggests |
| R5983 |
T9699 |
T9700 |
prep |
In,persist |
| R5984 |
T9701 |
T9699 |
pobj |
addition,In |
| R5985 |
T9702 |
T9700 |
punct |
", ",persist |
| R5986 |
T9703 |
T9700 |
nsubj |
levels,persist |
| R5987 |
T9704 |
T9703 |
prep |
of,levels |
| R5988 |
T9705 |
T9706 |
compound |
Bmpr1a,mRNA |
| R5989 |
T9706 |
T9704 |
pobj |
mRNA,of |
| R5990 |
T9707 |
T9706 |
cc |
and,mRNA |
| R5991 |
T9708 |
T9706 |
conj |
protein,mRNA |
| R5992 |
T9709 |
T9700 |
aux |
may,persist |
| R5993 |
T9710 |
T9700 |
prep |
for,persist |
| R5994 |
T9711 |
T9712 |
det |
some,time |
| R5995 |
T9712 |
T9710 |
pobj |
time,for |
| R5996 |
T9713 |
T9700 |
prep |
following,persist |
| R5997 |
T9714 |
T9715 |
compound |
Gdf5,Cre |
| R5998 |
T9715 |
T9717 |
npadvmod |
Cre,stimulated |
| R5999 |
T9716 |
T9715 |
punct |
-,Cre |
| R6000 |
T9717 |
T9718 |
amod |
stimulated,recombination |
| R6001 |
T9718 |
T9713 |
pobj |
recombination,following |
| R6002 |
T9719 |
T9700 |
punct |
", ",persist |
| R6003 |
T9720 |
T9700 |
advcl |
making,persist |
| R6004 |
T9721 |
T9722 |
nsubj |
it,possible |
| R6005 |
T9722 |
T9720 |
ccomp |
possible,making |
| R6006 |
T9723 |
T9724 |
aux |
to,bypass |
| R6007 |
T9724 |
T9722 |
advcl |
bypass,possible |
| R6008 |
T9725 |
T9726 |
det |
an,requirement |
| R6009 |
T9726 |
T9724 |
dobj |
requirement,bypass |
| R6010 |
T9727 |
T9726 |
amod |
early,requirement |
| R6011 |
T9728 |
T9726 |
prep |
for,requirement |
| R6012 |
T9729 |
T9728 |
pobj |
Bmpr1a,for |
| R6013 |
T9730 |
T9726 |
prep |
in,requirement |
| R6014 |
T9731 |
T9732 |
compound |
joint,formation |
| R6015 |
T9732 |
T9730 |
pobj |
formation,in |
| R6016 |
T9733 |
T9732 |
prep |
at,formation |
| R6017 |
T9734 |
T9735 |
det |
some,locations |
| R6018 |
T9735 |
T9733 |
pobj |
locations,at |
| R6019 |
T9736 |
T9700 |
punct |
.,persist |
| R6020 |
T9738 |
T9739 |
prep |
Following,result |
| R6021 |
T9740 |
T9741 |
det |
the,decay |
| R6022 |
T9741 |
T9738 |
pobj |
decay,Following |
| R6023 |
T9742 |
T9741 |
prep |
of,decay |
| R6024 |
T9743 |
T9744 |
compound |
Bmpr1a,mRNA |
| R6025 |
T9744 |
T9742 |
pobj |
mRNA,of |
| R6026 |
T9745 |
T9744 |
cc |
and,mRNA |
| R6027 |
T9746 |
T9744 |
conj |
protein,mRNA |
| R6028 |
T9747 |
T9739 |
punct |
", ",result |
| R6029 |
T9748 |
T9749 |
det |
the,strategy |
| R6030 |
T9749 |
T9739 |
nsubj |
strategy,result |
| R6031 |
T9750 |
T9751 |
compound |
Gdf5,Cre |
| R6032 |
T9751 |
T9749 |
compound |
Cre,strategy |
| R6033 |
T9752 |
T9751 |
punct |
-,Cre |
| R6034 |
T9753 |
T9739 |
aux |
should,result |
| R6035 |
T9754 |
T9739 |
prep |
in,result |
| R6036 |
T9755 |
T9756 |
amod |
permanent,inactivation |
| R6037 |
T9756 |
T9754 |
pobj |
inactivation,in |
| R6038 |
T9757 |
T9756 |
prep |
of,inactivation |
| R6039 |
T9758 |
T9759 |
compound |
Bmpr1a,function |
| R6040 |
T9759 |
T9757 |
pobj |
function,of |
| R6041 |
T9760 |
T9756 |
prep |
in,inactivation |
| R6042 |
T9761 |
T9762 |
amod |
recombined,cells |
| R6043 |
T9762 |
T9760 |
pobj |
cells,in |
| R6044 |
T9763 |
T9739 |
punct |
.,result |
| R6045 |
T9765 |
T9766 |
det |
This,system |
| R6046 |
T9766 |
T9767 |
nsubj |
system,provides |
| R6047 |
T9768 |
T9767 |
advmod |
thus,provides |
| R6048 |
T9769 |
T9767 |
dobj |
one,provides |
| R6049 |
T9770 |
T9769 |
prep |
of,one |
| R6050 |
T9771 |
T9772 |
det |
the,tests |
| R6051 |
T9772 |
T9770 |
pobj |
tests,of |
| R6052 |
T9773 |
T9772 |
amod |
first,tests |
| R6053 |
T9774 |
T9772 |
amod |
strong,tests |
| R6054 |
T9775 |
T9772 |
amod |
genetic,tests |
| R6055 |
T9776 |
T9772 |
prep |
of,tests |
| R6056 |
T9777 |
T9778 |
compound |
Bmpr1a,function |
| R6057 |
T9778 |
T9776 |
pobj |
function,of |
| R6058 |
T9779 |
T9767 |
prep |
at,provides |
| R6059 |
T9780 |
T9781 |
amod |
later,stages |
| R6060 |
T9781 |
T9779 |
pobj |
stages,at |
| R6061 |
T9782 |
T9781 |
prep |
of,stages |
| R6062 |
T9783 |
T9784 |
compound |
joint,development |
| R6063 |
T9784 |
T9782 |
pobj |
development,of |
| R6064 |
T9785 |
T9767 |
punct |
.,provides |
| R6065 |
T9787 |
T9788 |
prep |
Despite,are |
| R6066 |
T9789 |
T9790 |
det |
the,appearance |
| R6067 |
T9790 |
T9787 |
pobj |
appearance,Despite |
| R6068 |
T9791 |
T9790 |
amod |
normal,appearance |
| R6069 |
T9792 |
T9790 |
prep |
of,appearance |
| R6070 |
T9793 |
T9794 |
amod |
articular,regions |
| R6071 |
T9794 |
T9792 |
pobj |
regions,of |
| R6072 |
T9795 |
T9794 |
cc |
and,regions |
| R6073 |
T9796 |
T9797 |
compound |
gene,expression |
| R6074 |
T9797 |
T9794 |
conj |
expression,regions |
| R6075 |
T9798 |
T9799 |
advmod |
immediately,after |
| R6076 |
T9799 |
T9790 |
prep |
after,appearance |
| R6077 |
T9800 |
T9799 |
pobj |
birth,after |
| R6078 |
T9801 |
T9788 |
punct |
", ",are |
| R6079 |
T9802 |
T9803 |
npadvmod |
Bmpr1a,deficient |
| R6080 |
T9803 |
T9805 |
amod |
deficient,animals |
| R6081 |
T9804 |
T9803 |
punct |
-,deficient |
| R6082 |
T9805 |
T9788 |
nsubj |
animals,are |
| R6083 |
T9806 |
T9788 |
acomp |
unable,are |
| R6084 |
T9807 |
T9808 |
aux |
to,maintain |
| R6085 |
T9808 |
T9806 |
xcomp |
maintain,unable |
| R6086 |
T9809 |
T9810 |
det |
the,state |
| R6087 |
T9810 |
T9808 |
dobj |
state,maintain |
| R6088 |
T9811 |
T9810 |
amod |
normal,state |
| R6089 |
T9812 |
T9810 |
amod |
differentiated,state |
| R6090 |
T9813 |
T9810 |
prep |
of,state |
| R6091 |
T9814 |
T9815 |
amod |
articular,cartilage |
| R6092 |
T9815 |
T9813 |
pobj |
cartilage,of |
| R6093 |
T9816 |
T9817 |
mark |
as,continue |
| R6094 |
T9817 |
T9808 |
advcl |
continue,maintain |
| R6095 |
T9818 |
T9817 |
nsubj |
they,continue |
| R6096 |
T9819 |
T9820 |
aux |
to,develop |
| R6097 |
T9820 |
T9817 |
xcomp |
develop,continue |
| R6098 |
T9821 |
T9820 |
cc |
and,develop |
| R6099 |
T9822 |
T9820 |
conj |
age,develop |
| R6100 |
T9823 |
T9788 |
punct |
.,are |
| R6101 |
T9825 |
T9826 |
det |
These,results |
| R6102 |
T9826 |
T9827 |
nsubj |
results,suggest |
| R6103 |
T9828 |
T9829 |
mark |
that,is |
| R6104 |
T9829 |
T9827 |
ccomp |
is,suggest |
| R6105 |
T9830 |
T9831 |
compound |
BMP,receptor |
| R6106 |
T9831 |
T9832 |
compound |
receptor,signaling |
| R6107 |
T9832 |
T9829 |
nsubj |
signaling,is |
| R6108 |
T9833 |
T9829 |
acomp |
essential,is |
| R6109 |
T9834 |
T9833 |
prep |
for,essential |
| R6110 |
T9835 |
T9836 |
amod |
continued,health |
| R6111 |
T9836 |
T9834 |
pobj |
health,for |
| R6112 |
T9837 |
T9836 |
cc |
and,health |
| R6113 |
T9838 |
T9836 |
conj |
integrity,health |
| R6114 |
T9839 |
T9838 |
prep |
of,integrity |
| R6115 |
T9840 |
T9841 |
amod |
articular,cartilage |
| R6116 |
T9841 |
T9839 |
pobj |
cartilage,of |
| R6117 |
T9842 |
T9829 |
prep |
in,is |
| R6118 |
T9843 |
T9844 |
det |
the,period |
| R6119 |
T9844 |
T9842 |
pobj |
period,in |
| R6120 |
T9845 |
T9844 |
amod |
postnatal,period |
| R6121 |
T9846 |
T9827 |
punct |
.,suggest |
| R6122 |
T9848 |
T9849 |
amod |
Articular,cartilage |
| R6123 |
T9849 |
T9850 |
nsubj |
cartilage,is |
| R6124 |
T9851 |
T9852 |
det |
a,component |
| R6125 |
T9852 |
T9850 |
attr |
component,is |
| R6126 |
T9853 |
T9852 |
amod |
key,component |
| R6127 |
T9854 |
T9852 |
prep |
of,component |
| R6128 |
T9855 |
T9856 |
amod |
synovial,joints |
| R6129 |
T9856 |
T9854 |
pobj |
joints,of |
| R6130 |
T9857 |
T9850 |
cc |
and,is |
| R6131 |
T9858 |
T9850 |
conj |
is,is |
| R6132 |
T9859 |
T9858 |
attr |
one,is |
| R6133 |
T9860 |
T9859 |
prep |
of,one |
| R6134 |
T9861 |
T9862 |
det |
the,regions |
| R6135 |
T9862 |
T9860 |
pobj |
regions,of |
| R6136 |
T9863 |
T9862 |
amod |
few,regions |
| R6137 |
T9864 |
T9862 |
prep |
in,regions |
| R6138 |
T9865 |
T9866 |
det |
the,skeleton |
| R6139 |
T9866 |
T9864 |
pobj |
skeleton,in |
| R6140 |
T9867 |
T9868 |
advmod |
where,maintained |
| R6141 |
T9868 |
T9862 |
relcl |
maintained,regions |
| R6142 |
T9869 |
T9868 |
nsubjpass |
cartilage,maintained |
| R6143 |
T9870 |
T9868 |
auxpass |
is,maintained |
| R6144 |
T9871 |
T9868 |
prep |
into,maintained |
| R6145 |
T9872 |
T9871 |
pobj |
adulthood,into |
| R6146 |
T9873 |
T9850 |
punct |
.,is |
| R6147 |
T9875 |
T9876 |
prep |
Despite,known |
| R6148 |
T9877 |
T9878 |
det |
the,importance |
| R6149 |
T9878 |
T9875 |
pobj |
importance,Despite |
| R6150 |
T9879 |
T9878 |
prep |
of,importance |
| R6151 |
T9880 |
T9881 |
amod |
articular,cartilage |
| R6152 |
T9881 |
T9879 |
pobj |
cartilage,of |
| R6153 |
T9882 |
T9878 |
prep |
in,importance |
| R6154 |
T9883 |
T9884 |
compound |
joint,health |
| R6155 |
T9884 |
T9882 |
pobj |
health,in |
| R6156 |
T9885 |
T9884 |
cc |
and,health |
| R6157 |
T9886 |
T9884 |
conj |
mobility,health |
| R6158 |
T9887 |
T9876 |
punct |
", ",known |
| R6159 |
T9888 |
T9876 |
nsubjpass |
little,known |
| R6160 |
T9889 |
T9876 |
auxpass |
is,known |
| R6161 |
T9890 |
T9876 |
prep |
about,known |
| R6162 |
T9891 |
T9892 |
det |
the,factors |
| R6163 |
T9892 |
T9890 |
pobj |
factors,about |
| R6164 |
T9893 |
T9894 |
dep |
that,create |
| R6165 |
T9894 |
T9892 |
relcl |
create,factors |
| R6166 |
T9895 |
T9894 |
cc |
and,create |
| R6167 |
T9896 |
T9894 |
conj |
maintain,create |
| R6168 |
T9897 |
T9896 |
dobj |
it,maintain |
| R6169 |
T9898 |
T9896 |
prep |
in,maintain |
| R6170 |
T9899 |
T9900 |
amod |
thin,layers |
| R6171 |
T9900 |
T9898 |
pobj |
layers,in |
| R6172 |
T9901 |
T9900 |
prep |
at,layers |
| R6173 |
T9902 |
T9903 |
det |
the,ends |
| R6174 |
T9903 |
T9901 |
pobj |
ends,at |
| R6175 |
T9904 |
T9903 |
prep |
of,ends |
| R6176 |
T9905 |
T9906 |
amod |
long,bones |
| R6177 |
T9906 |
T9904 |
pobj |
bones,of |
| R6178 |
T9907 |
T9876 |
punct |
.,known |
| R6179 |
T9909 |
T9910 |
prep |
In,retains |
| R6180 |
T9911 |
T9912 |
poss |
our,experiments |
| R6181 |
T9912 |
T9909 |
pobj |
experiments,In |
| R6182 |
T9913 |
T9910 |
punct |
", ",retains |
| R6183 |
T9914 |
T9915 |
amod |
articular,cartilage |
| R6184 |
T9915 |
T9916 |
npadvmod |
cartilage,lacking |
| R6185 |
T9916 |
T9917 |
amod |
lacking,Bmpr1a |
| R6186 |
T9917 |
T9910 |
nsubj |
Bmpr1a,retains |
| R6187 |
T9918 |
T9919 |
det |
some,characteristics |
| R6188 |
T9919 |
T9910 |
dobj |
characteristics,retains |
| R6189 |
T9920 |
T9919 |
amod |
normal,characteristics |
| R6190 |
T9921 |
T9910 |
punct |
", ",retains |
| R6191 |
T9922 |
T9923 |
mark |
in,maintains |
| R6192 |
T9923 |
T9910 |
advcl |
maintains,retains |
| R6193 |
T9924 |
T9923 |
mark |
that,maintains |
| R6194 |
T9925 |
T9923 |
nsubj |
it,maintains |
| R6195 |
T9926 |
T9927 |
det |
a,rate |
| R6196 |
T9927 |
T9923 |
dobj |
rate,maintains |
| R6197 |
T9928 |
T9929 |
advmod |
very,low |
| R6198 |
T9929 |
T9927 |
amod |
low,rate |
| R6199 |
T9930 |
T9927 |
compound |
proliferation,rate |
| R6200 |
T9931 |
T9923 |
punct |
", ",maintains |
| R6201 |
T9932 |
T9933 |
aux |
does,express |
| R6202 |
T9933 |
T9923 |
conj |
express,maintains |
| R6203 |
T9934 |
T9933 |
neg |
not,express |
| R6204 |
T9935 |
T9933 |
dobj |
Col1a1,express |
| R6205 |
T9936 |
T9933 |
punct |
", ",express |
| R6206 |
T9937 |
T9933 |
cc |
and,express |
| R6207 |
T9938 |
T9933 |
conj |
continues,express |
| R6208 |
T9939 |
T9940 |
aux |
to,express |
| R6209 |
T9940 |
T9938 |
xcomp |
express,continues |
| R6210 |
T9941 |
T9940 |
dobj |
SOX9,express |
| R6211 |
T9942 |
T9941 |
punct |
", ",SOX9 |
| R6212 |
T9943 |
T9944 |
det |
a,factor |
| R6213 |
T9944 |
T9941 |
appos |
factor,SOX9 |
| R6214 |
T9945 |
T9944 |
amod |
major,factor |
| R6215 |
T9946 |
T9944 |
compound |
transcription,factor |
| R6216 |
T9947 |
T9944 |
acl |
regulating,factor |
| R6217 |
T9948 |
T9947 |
dobj |
expression,regulating |
| R6218 |
T9949 |
T9948 |
prep |
of,expression |
| R6219 |
T9950 |
T9951 |
amod |
structural,components |
| R6220 |
T9951 |
T9949 |
pobj |
components,of |
| R6221 |
T9952 |
T9951 |
prep |
of,components |
| R6222 |
T9953 |
T9954 |
compound |
cartilage,matrix |
| R6223 |
T9954 |
T9952 |
pobj |
matrix,of |
| R6224 |
T9955 |
T9910 |
punct |
.,retains |
| R6225 |
T9957 |
T9958 |
advmod |
However,fail |
| R6226 |
T9959 |
T9958 |
punct |
", ",fail |
| R6227 |
T9960 |
T9958 |
nsubj |
several,fail |
| R6228 |
T9961 |
T9960 |
prep |
of,several |
| R6229 |
T9962 |
T9963 |
det |
the,components |
| R6230 |
T9963 |
T9961 |
pobj |
components,of |
| R6231 |
T9964 |
T9965 |
advmod |
most,prominent |
| R6232 |
T9965 |
T9963 |
amod |
prominent,components |
| R6233 |
T9966 |
T9963 |
amod |
structural,components |
| R6234 |
T9967 |
T9963 |
prep |
of,components |
| R6235 |
T9968 |
T9969 |
compound |
cartilage,matrix |
| R6236 |
T9969 |
T9967 |
pobj |
matrix,of |
| R6237 |
T9970 |
T9971 |
aux |
to,maintained |
| R6238 |
T9971 |
T9958 |
xcomp |
maintained,fail |
| R6239 |
T9972 |
T9971 |
auxpass |
be,maintained |
| R6240 |
T9973 |
T9971 |
prep |
in,maintained |
| R6241 |
T9974 |
T9975 |
compound |
mutant,animals |
| R6242 |
T9975 |
T9973 |
pobj |
animals,in |
| R6243 |
T9976 |
T9971 |
punct |
", ",maintained |
| R6244 |
T9977 |
T9971 |
advcl |
resulting,maintained |
| R6245 |
T9978 |
T9977 |
prep |
in,resulting |
| R6246 |
T9979 |
T9980 |
amod |
decreased,synthesis |
| R6247 |
T9980 |
T9978 |
pobj |
synthesis,in |
| R6248 |
T9981 |
T9980 |
prep |
of,synthesis |
| R6249 |
T9982 |
T9981 |
pobj |
Col2a1,of |
| R6250 |
T9983 |
T9982 |
punct |
", ",Col2a1 |
| R6251 |
T9984 |
T9982 |
conj |
Agg,Col2a1 |
| R6252 |
T9985 |
T9984 |
punct |
", ",Agg |
| R6253 |
T9986 |
T9984 |
cc |
and,Agg |
| R6254 |
T9987 |
T9984 |
conj |
proteoglycans,Agg |
| R6255 |
T9988 |
T9958 |
punct |
.,fail |
| R6256 |
T9990 |
T9991 |
advmod |
Therefore,appears |
| R6257 |
T9992 |
T9991 |
punct |
", ",appears |
| R6258 |
T9993 |
T9991 |
nsubj |
BMPR1A,appears |
| R6259 |
T9994 |
T9995 |
aux |
to,maintain |
| R6260 |
T9995 |
T9991 |
xcomp |
maintain,appears |
| R6261 |
T9996 |
T9997 |
amod |
articular,cartilage |
| R6262 |
T9997 |
T9995 |
dobj |
cartilage,maintain |
| R6263 |
T9998 |
T9999 |
advmod |
primarily,through |
| R6264 |
T9999 |
T9995 |
prep |
through,maintain |
| R6265 |
T10000 |
T9999 |
pcomp |
inducing,through |
| R6266 |
T10001 |
T10000 |
dobj |
expression,inducing |
| R6267 |
T10002 |
T10001 |
prep |
of,expression |
| R6268 |
T10003 |
T10004 |
amod |
key,components |
| R6269 |
T10004 |
T10002 |
pobj |
components,of |
| R6270 |
T10005 |
T10004 |
compound |
ECM,components |
| R6271 |
T10006 |
T9991 |
punct |
.,appears |
| R6272 |
T10008 |
T10009 |
nsubj |
It,is |
| R6273 |
T10010 |
T10009 |
acomp |
interesting,is |
| R6274 |
T10011 |
T10012 |
mark |
that,continues |
| R6275 |
T10012 |
T10009 |
ccomp |
continues,is |
| R6276 |
T10013 |
T10014 |
det |
the,factor |
| R6277 |
T10014 |
T10012 |
nsubj |
factor,continues |
| R6278 |
T10015 |
T10016 |
compound |
SOX9,transcription |
| R6279 |
T10016 |
T10014 |
compound |
transcription,factor |
| R6280 |
T10017 |
T10018 |
aux |
to,expressed |
| R6281 |
T10018 |
T10012 |
xcomp |
expressed,continues |
| R6282 |
T10019 |
T10018 |
auxpass |
be,expressed |
| R6283 |
T10020 |
T10018 |
prep |
in,expressed |
| R6284 |
T10021 |
T10022 |
compound |
mutant,cartilage |
| R6285 |
T10022 |
T10020 |
pobj |
cartilage,in |
| R6286 |
T10023 |
T10018 |
prep |
despite,expressed |
| R6287 |
T10024 |
T10023 |
pobj |
loss,despite |
| R6288 |
T10025 |
T10024 |
prep |
of,loss |
| R6289 |
T10026 |
T10025 |
pobj |
Col2a1,of |
| R6290 |
T10027 |
T10026 |
punct |
", ",Col2a1 |
| R6291 |
T10028 |
T10029 |
det |
a,target |
| R6292 |
T10029 |
T10026 |
appos |
target,Col2a1 |
| R6293 |
T10030 |
T10029 |
amod |
direct,target |
| R6294 |
T10031 |
T10029 |
prep |
of,target |
| R6295 |
T10032 |
T10033 |
det |
this,factor |
| R6296 |
T10033 |
T10031 |
pobj |
factor,of |
| R6297 |
T10034 |
T10033 |
compound |
transcription,factor |
| R6298 |
T10035 |
T10036 |
punct |
(,Bell |
| R6299 |
T10036 |
T10009 |
meta |
Bell,is |
| R6300 |
T10037 |
T10036 |
nmod |
et,Bell |
| R6301 |
T10038 |
T10036 |
nmod |
al.,Bell |
| R6302 |
T10039 |
T10036 |
nummod |
1997,Bell |
| R6303 |
T10040 |
T10036 |
punct |
;,Bell |
| R6304 |
T10041 |
T10036 |
nmod |
Lefebvre,Bell |
| R6305 |
T10042 |
T10036 |
nmod |
et,Bell |
| R6306 |
T10043 |
T10036 |
nmod |
al.,Bell |
| R6307 |
T10044 |
T10036 |
nummod |
1997,Bell |
| R6308 |
T10045 |
T10036 |
punct |
),Bell |
| R6309 |
T10046 |
T10009 |
punct |
.,is |
| R6310 |
T10048 |
T10049 |
amod |
Previous,studies |
| R6311 |
T10049 |
T10050 |
nsubj |
studies,suggest |
| R6312 |
T10051 |
T10052 |
mark |
that,modified |
| R6313 |
T10052 |
T10050 |
ccomp |
modified,suggest |
| R6314 |
T10053 |
T10054 |
compound |
SOX9,activity |
| R6315 |
T10054 |
T10052 |
nsubjpass |
activity,modified |
| R6316 |
T10055 |
T10052 |
aux |
can,modified |
| R6317 |
T10056 |
T10052 |
auxpass |
be,modified |
| R6318 |
T10057 |
T10052 |
prep |
by,modified |
| R6319 |
T10058 |
T10059 |
compound |
protein,A |
| R6320 |
T10059 |
T10061 |
npadvmod |
A,dependent |
| R6321 |
T10060 |
T10059 |
compound |
kinase,A |
| R6322 |
T10061 |
T10066 |
amod |
dependent,phosphorylation |
| R6323 |
T10062 |
T10059 |
punct |
(,A |
| R6324 |
T10063 |
T10059 |
appos |
PKA,A |
| R6325 |
T10064 |
T10059 |
punct |
),A |
| R6326 |
T10065 |
T10061 |
punct |
-,dependent |
| R6327 |
T10066 |
T10057 |
pobj |
phosphorylation,by |
| R6328 |
T10067 |
T10066 |
compound |
protein,phosphorylation |
| R6329 |
T10068 |
T10057 |
punct |
", ",by |
| R6330 |
T10069 |
T10057 |
cc |
or,by |
| R6331 |
T10070 |
T10057 |
conj |
by,by |
| R6332 |
T10071 |
T10070 |
pobj |
coexpression,by |
| R6333 |
T10072 |
T10071 |
prep |
of,coexpression |
| R6334 |
T10073 |
T10074 |
nummod |
two,proteins |
| R6335 |
T10074 |
T10072 |
pobj |
proteins,of |
| R6336 |
T10075 |
T10074 |
amod |
related,proteins |
| R6337 |
T10076 |
T10074 |
punct |
", ",proteins |
| R6338 |
T10077 |
T10078 |
compound |
L,SOX5 |
| R6339 |
T10078 |
T10074 |
appos |
SOX5,proteins |
| R6340 |
T10079 |
T10078 |
punct |
-,SOX5 |
| R6341 |
T10080 |
T10078 |
cc |
and,SOX5 |
| R6342 |
T10081 |
T10078 |
conj |
SOX6,SOX5 |
| R6343 |
T10082 |
T10083 |
punct |
(,Lefebvre |
| R6344 |
T10083 |
T10050 |
meta |
Lefebvre,suggest |
| R6345 |
T10084 |
T10083 |
nmod |
et,Lefebvre |
| R6346 |
T10085 |
T10083 |
nmod |
al.,Lefebvre |
| R6347 |
T10086 |
T10083 |
nummod |
1998,Lefebvre |
| R6348 |
T10087 |
T10083 |
punct |
;,Lefebvre |
| R6349 |
T10088 |
T10083 |
nmod |
Huang,Lefebvre |
| R6350 |
T10089 |
T10083 |
nmod |
et,Lefebvre |
| R6351 |
T10090 |
T10083 |
nmod |
al.,Lefebvre |
| R6352 |
T10091 |
T10083 |
nummod |
2000,Lefebvre |
| R6353 |
T10092 |
T10083 |
punct |
),Lefebvre |
| R6354 |
T10093 |
T10050 |
punct |
.,suggest |
| R6355 |
T10095 |
T10096 |
prep |
In,reveals |
| R6356 |
T10097 |
T10095 |
pobj |
addition,In |
| R6357 |
T10098 |
T10096 |
punct |
", ",reveals |
| R6358 |
T10099 |
T10100 |
amod |
close,examination |
| R6359 |
T10100 |
T10096 |
nsubj |
examination,reveals |
| R6360 |
T10101 |
T10100 |
prep |
of,examination |
| R6361 |
T10102 |
T10103 |
det |
the,order |
| R6362 |
T10103 |
T10101 |
pobj |
order,of |
| R6363 |
T10104 |
T10103 |
prep |
of,order |
| R6364 |
T10105 |
T10104 |
pobj |
genes,of |
| R6365 |
T10106 |
T10105 |
acl |
induced,genes |
| R6366 |
T10107 |
T10106 |
prep |
during,induced |
| R6367 |
T10108 |
T10109 |
compound |
chicken,formation |
| R6368 |
T10109 |
T10107 |
pobj |
formation,during |
| R6369 |
T10110 |
T10109 |
compound |
digit,formation |
| R6370 |
T10111 |
T10112 |
mark |
that,turns |
| R6371 |
T10112 |
T10096 |
ccomp |
turns,reveals |
| R6372 |
T10113 |
T10112 |
nsubj |
Sox9,turns |
| R6373 |
T10114 |
T10112 |
prt |
on,turns |
| R6374 |
T10115 |
T10112 |
advmod |
first,turns |
| R6375 |
T10116 |
T10112 |
punct |
", ",turns |
| R6376 |
T10117 |
T10112 |
advcl |
followed,turns |
| R6377 |
T10118 |
T10117 |
agent |
by,followed |
| R6378 |
T10119 |
T10118 |
pobj |
Bmpr1b,by |
| R6379 |
T10120 |
T10119 |
prep |
with,Bmpr1b |
| R6380 |
T10121 |
T10122 |
compound |
L,Sox5 |
| R6381 |
T10122 |
T10120 |
pobj |
Sox5,with |
| R6382 |
T10123 |
T10122 |
punct |
-,Sox5 |
| R6383 |
T10124 |
T10119 |
punct |
", ",Bmpr1b |
| R6384 |
T10125 |
T10119 |
cc |
and,Bmpr1b |
| R6385 |
T10126 |
T10127 |
advmod |
then,Sox6 |
| R6386 |
T10127 |
T10119 |
conj |
Sox6,Bmpr1b |
| R6387 |
T10128 |
T10127 |
cc |
and,Sox6 |
| R6388 |
T10129 |
T10130 |
det |
the,components |
| R6389 |
T10130 |
T10127 |
conj |
components,Sox6 |
| R6390 |
T10131 |
T10132 |
nmod |
cartilage,matrix |
| R6391 |
T10132 |
T10130 |
nmod |
matrix,components |
| R6392 |
T10133 |
T10130 |
amod |
structural,components |
| R6393 |
T10134 |
T10130 |
appos |
Col2a1,components |
| R6394 |
T10135 |
T10134 |
cc |
and,Col2a1 |
| R6395 |
T10136 |
T10134 |
conj |
Agg,Col2a1 |
| R6396 |
T10137 |
T10138 |
punct |
(,Chimal |
| R6397 |
T10138 |
T10096 |
meta |
Chimal,reveals |
| R6398 |
T10139 |
T10138 |
punct |
-,Chimal |
| R6399 |
T10140 |
T10138 |
nmod |
Monroy,Chimal |
| R6400 |
T10141 |
T10138 |
nmod |
et,Chimal |
| R6401 |
T10142 |
T10138 |
nmod |
al.,Chimal |
| R6402 |
T10143 |
T10138 |
nummod |
2003,Chimal |
| R6403 |
T10144 |
T10138 |
punct |
),Chimal |
| R6404 |
T10145 |
T10096 |
punct |
.,reveals |
| R6405 |
T10147 |
T10148 |
det |
These,results |
| R6406 |
T10148 |
T10149 |
nsubj |
results,suggest |
| R6407 |
T10150 |
T10148 |
punct |
", ",results |
| R6408 |
T10151 |
T10148 |
advmod |
together,results |
| R6409 |
T10152 |
T10151 |
prep |
with,together |
| R6410 |
T10153 |
T10154 |
det |
the,pattern |
| R6411 |
T10154 |
T10152 |
pobj |
pattern,with |
| R6412 |
T10155 |
T10154 |
amod |
altered,pattern |
| R6413 |
T10156 |
T10154 |
prep |
of,pattern |
| R6414 |
T10157 |
T10158 |
compound |
gene,expression |
| R6415 |
T10158 |
T10156 |
pobj |
expression,of |
| R6416 |
T10159 |
T10154 |
acl |
seen,pattern |
| R6417 |
T10160 |
T10159 |
prep |
in,seen |
| R6418 |
T10161 |
T10162 |
poss |
our,mice |
| R6419 |
T10162 |
T10160 |
pobj |
mice,in |
| R6420 |
T10163 |
T10164 |
npadvmod |
Bmpr1a,deficient |
| R6421 |
T10164 |
T10162 |
amod |
deficient,mice |
| R6422 |
T10165 |
T10164 |
punct |
-,deficient |
| R6423 |
T10166 |
T10149 |
punct |
", ",suggest |
| R6424 |
T10167 |
T10168 |
mark |
that,act |
| R6425 |
T10168 |
T10149 |
ccomp |
act,suggest |
| R6426 |
T10169 |
T10170 |
compound |
BMPR1A,signaling |
| R6427 |
T10170 |
T10168 |
nsubj |
signaling,act |
| R6428 |
T10171 |
T10168 |
aux |
may,act |
| R6429 |
T10172 |
T10168 |
advmod |
normally,act |
| R6430 |
T10173 |
T10174 |
aux |
to,stimulate |
| R6431 |
T10174 |
T10168 |
xcomp |
stimulate,act |
| R6432 |
T10175 |
T10174 |
dobj |
SOX9,stimulate |
| R6433 |
T10176 |
T10174 |
prep |
by,stimulate |
| R6434 |
T10177 |
T10178 |
amod |
post-translational,modification |
| R6435 |
T10178 |
T10176 |
pobj |
modification,by |
| R6436 |
T10179 |
T10178 |
compound |
protein,modification |
| R6437 |
T10180 |
T10174 |
punct |
", ",stimulate |
| R6438 |
T10181 |
T10174 |
cc |
or,stimulate |
| R6439 |
T10182 |
T10183 |
aux |
to,induce |
| R6440 |
T10183 |
T10174 |
conj |
induce,stimulate |
| R6441 |
T10184 |
T10185 |
compound |
L,Sox5 |
| R6442 |
T10185 |
T10183 |
dobj |
Sox5,induce |
| R6443 |
T10186 |
T10185 |
punct |
-,Sox5 |
| R6444 |
T10187 |
T10185 |
cc |
or,Sox5 |
| R6445 |
T10188 |
T10185 |
conj |
Sox6,Sox5 |
| R6446 |
T10189 |
T10183 |
prep |
in,induce |
| R6447 |
T10190 |
T10189 |
pobj |
cartilage,in |
| R6448 |
T10191 |
T10192 |
aux |
to,maintain |
| R6449 |
T10192 |
T10183 |
advcl |
maintain,induce |
| R6450 |
T10193 |
T10192 |
dobj |
expression,maintain |
| R6451 |
T10194 |
T10193 |
prep |
of,expression |
| R6452 |
T10195 |
T10196 |
compound |
ECM,components |
| R6453 |
T10196 |
T10194 |
pobj |
components,of |
| R6454 |
T10197 |
T10149 |
punct |
.,suggest |
| R6455 |
T10199 |
T10200 |
det |
These,models |
| R6456 |
T10200 |
T10201 |
nsubj |
models,are |
| R6457 |
T10202 |
T10201 |
acomp |
consistent,are |
| R6458 |
T10203 |
T10202 |
prep |
with,consistent |
| R6459 |
T10204 |
T10205 |
det |
the,ability |
| R6460 |
T10205 |
T10203 |
pobj |
ability,with |
| R6461 |
T10206 |
T10205 |
prep |
of,ability |
| R6462 |
T10207 |
T10206 |
pobj |
BMP2,of |
| R6463 |
T10208 |
T10209 |
aux |
to,increase |
| R6464 |
T10209 |
T10205 |
acl |
increase,ability |
| R6465 |
T10210 |
T10209 |
preconj |
both,increase |
| R6466 |
T10211 |
T10212 |
compound |
PKA,activity |
| R6467 |
T10212 |
T10209 |
dobj |
activity,increase |
| R6468 |
T10213 |
T10209 |
cc |
and,increase |
| R6469 |
T10214 |
T10209 |
conj |
induce,increase |
| R6470 |
T10215 |
T10214 |
dobj |
expression,induce |
| R6471 |
T10216 |
T10215 |
prep |
of,expression |
| R6472 |
T10217 |
T10216 |
pobj |
Sox6,of |
| R6473 |
T10218 |
T10214 |
prep |
in,induce |
| R6474 |
T10219 |
T10220 |
compound |
tissue,cells |
| R6475 |
T10220 |
T10218 |
pobj |
cells,in |
| R6476 |
T10221 |
T10220 |
compound |
culture,cells |
| R6477 |
T10222 |
T10223 |
punct |
(,Lee |
| R6478 |
T10223 |
T10201 |
meta |
Lee,are |
| R6479 |
T10224 |
T10223 |
cc |
and,Lee |
| R6480 |
T10225 |
T10223 |
conj |
Chuong,Lee |
| R6481 |
T10226 |
T10225 |
nummod |
1997,Chuong |
| R6482 |
T10227 |
T10225 |
punct |
;,Chuong |
| R6483 |
T10228 |
T10225 |
conj |
Fernandez,Chuong |
| R6484 |
T10229 |
T10228 |
punct |
-,Fernandez |
| R6485 |
T10230 |
T10228 |
nmod |
Lloris,Fernandez |
| R6486 |
T10231 |
T10228 |
nmod |
et,Fernandez |
| R6487 |
T10232 |
T10228 |
nmod |
al.,Fernandez |
| R6488 |
T10233 |
T10228 |
nummod |
2003,Fernandez |
| R6489 |
T10234 |
T10228 |
punct |
),Fernandez |
| R6490 |
T10235 |
T10201 |
punct |
.,are |
| R6491 |
T10237 |
T10238 |
mark |
Although,tried |
| R6492 |
T10238 |
T10241 |
advcl |
tried,been |
| R6493 |
T10239 |
T10238 |
nsubj |
we,tried |
| R6494 |
T10240 |
T10238 |
aux |
have,tried |
| R6495 |
T10242 |
T10243 |
aux |
to,monitor |
| R6496 |
T10243 |
T10238 |
xcomp |
monitor,tried |
| R6497 |
T10244 |
T10245 |
det |
the,expression |
| R6498 |
T10245 |
T10243 |
dobj |
expression,monitor |
| R6499 |
T10246 |
T10245 |
prep |
of,expression |
| R6500 |
T10247 |
T10248 |
compound |
L,Sox5 |
| R6501 |
T10248 |
T10246 |
pobj |
Sox5,of |
| R6502 |
T10249 |
T10248 |
punct |
-,Sox5 |
| R6503 |
T10250 |
T10248 |
cc |
or,Sox5 |
| R6504 |
T10251 |
T10248 |
conj |
Sox6,Sox5 |
| R6505 |
T10252 |
T10243 |
prep |
in,monitor |
| R6506 |
T10253 |
T10254 |
amod |
postnatal,cartilage |
| R6507 |
T10254 |
T10252 |
pobj |
cartilage,in |
| R6508 |
T10255 |
T10254 |
amod |
articular,cartilage |
| R6509 |
T10256 |
T10243 |
punct |
", ",monitor |
| R6510 |
T10257 |
T10243 |
cc |
and,monitor |
| R6511 |
T10258 |
T10243 |
conj |
test,monitor |
| R6512 |
T10259 |
T10260 |
det |
the,state |
| R6513 |
T10260 |
T10258 |
dobj |
state,test |
| R6514 |
T10261 |
T10260 |
compound |
phosphorylation,state |
| R6515 |
T10262 |
T10260 |
prep |
of,state |
| R6516 |
T10263 |
T10262 |
pobj |
SOX9,of |
| R6517 |
T10264 |
T10258 |
advcl |
using,test |
| R6518 |
T10265 |
T10266 |
advmod |
previously,described |
| R6519 |
T10266 |
T10267 |
amod |
described,reagents |
| R6520 |
T10267 |
T10264 |
dobj |
reagents,using |
| R6521 |
T10268 |
T10269 |
punct |
(,Lefebvre |
| R6522 |
T10269 |
T10258 |
meta |
Lefebvre,test |
| R6523 |
T10270 |
T10269 |
nmod |
et,Lefebvre |
| R6524 |
T10271 |
T10269 |
nmod |
al.,Lefebvre |
| R6525 |
T10272 |
T10269 |
nummod |
1998,Lefebvre |
| R6526 |
T10273 |
T10269 |
punct |
;,Lefebvre |
| R6527 |
T10274 |
T10269 |
nmod |
Huang,Lefebvre |
| R6528 |
T10275 |
T10269 |
nmod |
et,Lefebvre |
| R6529 |
T10276 |
T10269 |
nmod |
al.,Lefebvre |
| R6530 |
T10277 |
T10269 |
nummod |
2000,Lefebvre |
| R6531 |
T10278 |
T10269 |
punct |
),Lefebvre |
| R6532 |
T10279 |
T10241 |
punct |
", ",been |
| R6533 |
T10280 |
T10241 |
nsubj |
we,been |
| R6534 |
T10281 |
T10241 |
aux |
have,been |
| R6535 |
T10282 |
T10241 |
acomp |
unable,been |
| R6536 |
T10283 |
T10284 |
aux |
to,obtain |
| R6537 |
T10284 |
T10282 |
xcomp |
obtain,unable |
| R6538 |
T10285 |
T10286 |
amod |
specific,signal |
| R6539 |
T10286 |
T10284 |
dobj |
signal,obtain |
| R6540 |
T10287 |
T10284 |
prep |
at,obtain |
| R6541 |
T10288 |
T10289 |
det |
the,stages |
| R6542 |
T10289 |
T10287 |
pobj |
stages,at |
| R6543 |
T10290 |
T10289 |
amod |
late,stages |
| R6544 |
T10291 |
T10289 |
amod |
postnatal,stages |
| R6545 |
T10292 |
T10289 |
acl |
required,stages |
| R6546 |
T10293 |
T10294 |
punct |
(,data |
| R6547 |
T10294 |
T10241 |
meta |
data,been |
| R6548 |
T10295 |
T10294 |
amod |
unpublished,data |
| R6549 |
T10296 |
T10294 |
punct |
),data |
| R6550 |
T10297 |
T10241 |
punct |
.,been |
| R6551 |
T10299 |
T10300 |
advmod |
Furthermore,cause |
| R6552 |
T10301 |
T10300 |
punct |
", ",cause |
| R6553 |
T10302 |
T10303 |
amod |
null,mutations |
| R6554 |
T10303 |
T10300 |
nsubj |
mutations,cause |
| R6555 |
T10304 |
T10303 |
prep |
in,mutations |
| R6556 |
T10305 |
T10306 |
compound |
L,Sox5 |
| R6557 |
T10306 |
T10304 |
pobj |
Sox5,in |
| R6558 |
T10307 |
T10306 |
punct |
-,Sox5 |
| R6559 |
T10308 |
T10306 |
cc |
or,Sox5 |
| R6560 |
T10309 |
T10306 |
conj |
Sox,Sox5 |
| R6561 |
T10310 |
T10309 |
punct |
-,Sox |
| R6562 |
T10311 |
T10309 |
nummod |
6,Sox |
| R6563 |
T10312 |
T10300 |
dobj |
lethality,cause |
| R6564 |
T10313 |
T10312 |
prep |
at,lethality |
| R6565 |
T10314 |
T10313 |
cc |
or,at |
| R6566 |
T10315 |
T10316 |
advmod |
soon,after |
| R6567 |
T10316 |
T10313 |
conj |
after,at |
| R6568 |
T10317 |
T10316 |
pobj |
birth,after |
| R6569 |
T10318 |
T10300 |
punct |
", ",cause |
| R6570 |
T10319 |
T10300 |
cc |
and,cause |
| R6571 |
T10320 |
T10321 |
det |
no,effect |
| R6572 |
T10321 |
T10322 |
nsubjpass |
effect,reported |
| R6573 |
T10322 |
T10300 |
conj |
reported,cause |
| R6574 |
T10323 |
T10321 |
prep |
on,effect |
| R6575 |
T10324 |
T10325 |
compound |
cartilage,maintenance |
| R6576 |
T10325 |
T10323 |
pobj |
maintenance,on |
| R6577 |
T10326 |
T10322 |
aux |
has,reported |
| R6578 |
T10327 |
T10322 |
auxpass |
been,reported |
| R6579 |
T10328 |
T10329 |
punct |
(,Smits |
| R6580 |
T10329 |
T10322 |
meta |
Smits,reported |
| R6581 |
T10330 |
T10329 |
nmod |
et,Smits |
| R6582 |
T10331 |
T10329 |
nmod |
al.,Smits |
| R6583 |
T10332 |
T10329 |
nummod |
2001,Smits |
| R6584 |
T10333 |
T10329 |
punct |
),Smits |
| R6585 |
T10334 |
T10322 |
punct |
.,reported |
| R6586 |
T10336 |
T10337 |
advmod |
However,seems |
| R6587 |
T10338 |
T10337 |
punct |
", ",seems |
| R6588 |
T10339 |
T10337 |
nsubj |
it,seems |
| R6589 |
T10340 |
T10337 |
oprd |
likely,seems |
| R6590 |
T10341 |
T10342 |
mark |
that,cooperate |
| R6591 |
T10342 |
T10337 |
ccomp |
cooperate,seems |
| R6592 |
T10343 |
T10342 |
nsubj |
these,cooperate |
| R6593 |
T10344 |
T10343 |
cc |
or,these |
| R6594 |
T10345 |
T10346 |
amod |
other,processes |
| R6595 |
T10346 |
T10343 |
conj |
processes,these |
| R6596 |
T10347 |
T10346 |
acl |
regulated,processes |
| R6597 |
T10348 |
T10347 |
agent |
by,regulated |
| R6598 |
T10349 |
T10350 |
compound |
BMP,signaling |
| R6599 |
T10350 |
T10348 |
pobj |
signaling,by |
| R6600 |
T10351 |
T10342 |
prep |
with,cooperate |
| R6601 |
T10352 |
T10351 |
pobj |
SOX9,with |
| R6602 |
T10353 |
T10354 |
aux |
to,induce |
| R6603 |
T10354 |
T10342 |
advcl |
induce,cooperate |
| R6604 |
T10355 |
T10356 |
amod |
target,genes |
| R6605 |
T10356 |
T10354 |
dobj |
genes,induce |
| R6606 |
T10357 |
T10354 |
prep |
in,induce |
| R6607 |
T10358 |
T10359 |
amod |
articular,cartilage |
| R6608 |
T10359 |
T10357 |
pobj |
cartilage,in |
| R6609 |
T10360 |
T10337 |
punct |
.,seems |
| R6610 |
T10362 |
T10363 |
nsubj |
Mutation,disrupts |
| R6611 |
T10364 |
T10362 |
prep |
of,Mutation |
| R6612 |
T10365 |
T10364 |
pobj |
Smad3,of |
| R6613 |
T10366 |
T10362 |
cc |
or,Mutation |
| R6614 |
T10367 |
T10362 |
conj |
expression,Mutation |
| R6615 |
T10368 |
T10367 |
prep |
of,expression |
| R6616 |
T10369 |
T10370 |
amod |
dominant,receptor |
| R6617 |
T10370 |
T10368 |
pobj |
receptor,of |
| R6618 |
T10371 |
T10370 |
amod |
negative,receptor |
| R6619 |
T10372 |
T10373 |
amod |
transforming,β |
| R6620 |
T10373 |
T10370 |
nmod |
β,receptor |
| R6621 |
T10374 |
T10373 |
nmod |
growth,β |
| R6622 |
T10375 |
T10373 |
nmod |
factor,β |
| R6623 |
T10376 |
T10373 |
punct |
(,β |
| R6624 |
T10377 |
T10378 |
compound |
TGF,β |
| R6625 |
T10378 |
T10373 |
appos |
β,β |
| R6626 |
T10379 |
T10378 |
punct |
-,β |
| R6627 |
T10380 |
T10373 |
punct |
),β |
| R6628 |
T10381 |
T10370 |
nmod |
type,receptor |
| R6629 |
T10382 |
T10381 |
nummod |
II,type |
| R6630 |
T10383 |
T10363 |
advmod |
also,disrupts |
| R6631 |
T10384 |
T10385 |
amod |
normal,maintenance |
| R6632 |
T10385 |
T10363 |
dobj |
maintenance,disrupts |
| R6633 |
T10386 |
T10387 |
amod |
articular,cartilage |
| R6634 |
T10387 |
T10385 |
compound |
cartilage,maintenance |
| R6635 |
T10388 |
T10389 |
punct |
(,Serra |
| R6636 |
T10389 |
T10363 |
meta |
Serra,disrupts |
| R6637 |
T10390 |
T10389 |
nmod |
et,Serra |
| R6638 |
T10391 |
T10389 |
nmod |
al.,Serra |
| R6639 |
T10392 |
T10389 |
nummod |
1997,Serra |
| R6640 |
T10393 |
T10389 |
punct |
;,Serra |
| R6641 |
T10394 |
T10389 |
nmod |
Yang,Serra |
| R6642 |
T10395 |
T10389 |
nmod |
et,Serra |
| R6643 |
T10396 |
T10389 |
nmod |
al.,Serra |
| R6644 |
T10397 |
T10389 |
nummod |
2001,Serra |
| R6645 |
T10398 |
T10389 |
punct |
),Serra |
| R6646 |
T10399 |
T10363 |
punct |
.,disrupts |
| R6647 |
T10401 |
T10402 |
det |
Both,manipulations |
| R6648 |
T10402 |
T10403 |
nsubj |
manipulations,disrupt |
| R6649 |
T10404 |
T10403 |
aux |
should,disrupt |
| R6650 |
T10405 |
T10403 |
dobj |
TGFβ,disrupt |
| R6651 |
T10406 |
T10407 |
amod |
rather,than |
| R6652 |
T10407 |
T10405 |
prep |
than,TGFβ |
| R6653 |
T10408 |
T10409 |
compound |
BMP,signaling |
| R6654 |
T10409 |
T10407 |
pobj |
signaling,than |
| R6655 |
T10410 |
T10403 |
punct |
", ",disrupt |
| R6656 |
T10411 |
T10403 |
cc |
and,disrupt |
| R6657 |
T10412 |
T10413 |
det |
both,manipulations |
| R6658 |
T10413 |
T10414 |
nsubj |
manipulations,cause |
| R6659 |
T10414 |
T10403 |
conj |
cause,disrupt |
| R6660 |
T10415 |
T10416 |
amod |
articular,cartilage |
| R6661 |
T10416 |
T10417 |
nsubj |
cartilage,hypertrophy |
| R6662 |
T10417 |
T10414 |
ccomp |
hypertrophy,cause |
| R6663 |
T10418 |
T10417 |
aux |
to,hypertrophy |
| R6664 |
T10419 |
T10417 |
cc |
and,hypertrophy |
| R6665 |
T10420 |
T10421 |
auxpass |
be,replaced |
| R6666 |
T10421 |
T10417 |
conj |
replaced,hypertrophy |
| R6667 |
T10422 |
T10421 |
agent |
by,replaced |
| R6668 |
T10423 |
T10422 |
pobj |
bone,by |
| R6669 |
T10424 |
T10414 |
punct |
.,cause |
| R6670 |
T10426 |
T10427 |
prep |
In,showed |
| R6671 |
T10428 |
T10426 |
pobj |
contrast,In |
| R6672 |
T10429 |
T10427 |
punct |
", ",showed |
| R6673 |
T10430 |
T10431 |
poss |
our,analysis |
| R6674 |
T10431 |
T10427 |
nsubj |
analysis,showed |
| R6675 |
T10432 |
T10431 |
prep |
of,analysis |
| R6676 |
T10433 |
T10434 |
nmod |
Bmpr1a,mutant |
| R6677 |
T10434 |
T10435 |
nmod |
mutant,cartilage |
| R6678 |
T10435 |
T10432 |
pobj |
cartilage,of |
| R6679 |
T10436 |
T10435 |
amod |
articular,cartilage |
| R6680 |
T10437 |
T10438 |
det |
a,loss |
| R6681 |
T10438 |
T10427 |
dobj |
loss,showed |
| R6682 |
T10439 |
T10438 |
prep |
of,loss |
| R6683 |
T10440 |
T10441 |
compound |
ECM,components |
| R6684 |
T10441 |
T10439 |
pobj |
components,of |
| R6685 |
T10442 |
T10438 |
punct |
", ",loss |
| R6686 |
T10443 |
T10438 |
cc |
but,loss |
| R6687 |
T10444 |
T10445 |
det |
no,signs |
| R6688 |
T10445 |
T10438 |
conj |
signs,loss |
| R6689 |
T10446 |
T10445 |
prep |
of,signs |
| R6690 |
T10447 |
T10446 |
pobj |
hypertrophy,of |
| R6691 |
T10448 |
T10447 |
cc |
or,hypertrophy |
| R6692 |
T10449 |
T10450 |
compound |
bone,replacement |
| R6693 |
T10450 |
T10447 |
conj |
replacement,hypertrophy |
| R6694 |
T10451 |
T10427 |
punct |
.,showed |
| R6695 |
T10453 |
T10454 |
advmod |
Therefore,playing |
| R6696 |
T10455 |
T10454 |
punct |
", ",playing |
| R6697 |
T10456 |
T10457 |
nmod |
TGFβ,signaling |
| R6698 |
T10457 |
T10454 |
nsubj |
signaling,playing |
| R6699 |
T10458 |
T10456 |
cc |
and,TGFβ |
| R6700 |
T10459 |
T10456 |
conj |
BMP,TGFβ |
| R6701 |
T10460 |
T10454 |
aux |
are,playing |
| R6702 |
T10461 |
T10462 |
amod |
distinct,roles |
| R6703 |
T10462 |
T10454 |
dobj |
roles,playing |
| R6704 |
T10463 |
T10461 |
cc |
but,distinct |
| R6705 |
T10464 |
T10461 |
conj |
necessary,distinct |
| R6706 |
T10465 |
T10466 |
aux |
to,maintain |
| R6707 |
T10466 |
T10462 |
advcl |
maintain,roles |
| R6708 |
T10467 |
T10468 |
amod |
articular,cartilage |
| R6709 |
T10468 |
T10466 |
dobj |
cartilage,maintain |
| R6710 |
T10469 |
T10454 |
punct |
.,playing |
| R6711 |
T10471 |
T10472 |
mark |
Although,isolated |
| R6712 |
T10472 |
T10476 |
advcl |
isolated,stimulated |
| R6713 |
T10473 |
T10472 |
nsubjpass |
BMPs,isolated |
| R6714 |
T10474 |
T10472 |
auxpass |
were,isolated |
| R6715 |
T10475 |
T10472 |
advmod |
originally,isolated |
| R6716 |
T10477 |
T10472 |
prep |
on,isolated |
| R6717 |
T10478 |
T10479 |
det |
the,basis |
| R6718 |
T10479 |
T10477 |
pobj |
basis,on |
| R6719 |
T10480 |
T10479 |
prep |
of,basis |
| R6720 |
T10481 |
T10482 |
poss |
their,ability |
| R6721 |
T10482 |
T10480 |
pobj |
ability,of |
| R6722 |
T10483 |
T10484 |
aux |
to,induce |
| R6723 |
T10484 |
T10482 |
acl |
induce,ability |
| R6724 |
T10485 |
T10486 |
amod |
ectopic,formation |
| R6725 |
T10486 |
T10484 |
dobj |
formation,induce |
| R6726 |
T10487 |
T10486 |
compound |
bone,formation |
| R6727 |
T10488 |
T10476 |
punct |
", ",stimulated |
| R6728 |
T10489 |
T10490 |
poss |
their,presence |
| R6729 |
T10490 |
T10476 |
nsubj |
presence,stimulated |
| R6730 |
T10521 |
T10520 |
nmod |
et,Erlacher |
| R6731 |
T10491 |
T10490 |
prep |
in,presence |
| R6732 |
T10522 |
T10520 |
nmod |
al.,Erlacher |
| R6733 |
T10492 |
T10493 |
amod |
articular,cartilage |
| R6734 |
T10523 |
T10520 |
nummod |
1998,Erlacher |
| R6735 |
T10493 |
T10491 |
pobj |
cartilage,in |
| R6736 |
T10494 |
T10490 |
cc |
and,presence |
| R6737 |
T10524 |
T10520 |
punct |
;,Erlacher |
| R6738 |
T10495 |
T10496 |
amod |
strong,effect |
| R6739 |
T10525 |
T10520 |
conj |
Edwards,Erlacher |
| R6740 |
T10526 |
T10525 |
cc |
and,Edwards |
| R6741 |
T10496 |
T10490 |
conj |
effect,presence |
| R6742 |
T10527 |
T10525 |
conj |
Francis,Edwards |
| R6743 |
T10528 |
T10527 |
punct |
-,Francis |
| R6744 |
T10497 |
T10496 |
prep |
on,effect |
| R6745 |
T10529 |
T10527 |
nmod |
West,Francis |
| R6746 |
T10530 |
T10527 |
nummod |
2001,Francis |
| R6747 |
T10531 |
T10527 |
punct |
;,Francis |
| R6748 |
T10498 |
T10499 |
compound |
cartilage,formation |
| R6749 |
T10532 |
T10527 |
conj |
Chubinskaya,Francis |
| R6750 |
T10533 |
T10532 |
cc |
and,Chubinskaya |
| R6751 |
T10499 |
T10497 |
pobj |
formation,on |
| R6752 |
T10534 |
T10532 |
conj |
Kuettner,Chubinskaya |
| R6753 |
T10535 |
T10534 |
nummod |
2003,Kuettner |
| R6754 |
T10500 |
T10476 |
aux |
has,stimulated |
| R6755 |
T10536 |
T10534 |
punct |
),Kuettner |
| R6756 |
T10537 |
T10476 |
punct |
.,stimulated |
| R6757 |
T10539 |
T10540 |
det |
The,failure |
| R6758 |
T10540 |
T10541 |
nsubj |
failure,suggests |
| R6759 |
T10501 |
T10476 |
dobj |
interest,stimulated |
| R6760 |
T10542 |
T10543 |
aux |
to,maintain |
| R6761 |
T10543 |
T10540 |
acl |
maintain,failure |
| R6762 |
T10502 |
T10501 |
prep |
in,interest |
| R6763 |
T10544 |
T10545 |
amod |
articular,cartilage |
| R6764 |
T10545 |
T10543 |
dobj |
cartilage,maintain |
| R6765 |
T10546 |
T10543 |
prep |
in,maintain |
| R6766 |
T10503 |
T10502 |
pcomp |
using,in |
| R6767 |
T10547 |
T10548 |
det |
the,absence |
| R6768 |
T10548 |
T10546 |
pobj |
absence,in |
| R6769 |
T10549 |
T10548 |
prep |
of,absence |
| R6770 |
T10504 |
T10503 |
dobj |
them,using |
| R6771 |
T10550 |
T10551 |
amod |
normal,function |
| R6772 |
T10551 |
T10549 |
pobj |
function,of |
| R6773 |
T10505 |
T10506 |
aux |
to,repair |
| R6774 |
T10552 |
T10551 |
compound |
BMPR1A,function |
| R6775 |
T10506 |
T10503 |
advcl |
repair,using |
| R6776 |
T10553 |
T10554 |
mark |
that,be |
| R6777 |
T10554 |
T10541 |
ccomp |
be,suggests |
| R6778 |
T10555 |
T10554 |
nsubj |
ligands,be |
| R6779 |
T10556 |
T10555 |
cc |
or,ligands |
| R6780 |
T10557 |
T10558 |
amod |
small,agonists |
| R6781 |
T10507 |
T10506 |
cc |
or,repair |
| R6782 |
T10558 |
T10555 |
conj |
agonists,ligands |
| R6783 |
T10559 |
T10558 |
compound |
molecule,agonists |
| R6784 |
T10560 |
T10561 |
dep |
that,interact |
| R6785 |
T10508 |
T10506 |
conj |
regenerate,repair |
| R6786 |
T10561 |
T10555 |
relcl |
interact,ligands |
| R6787 |
T10562 |
T10561 |
advmod |
specifically,interact |
| R6788 |
T10563 |
T10561 |
prep |
with,interact |
| R6789 |
T10509 |
T10510 |
compound |
cartilage,defects |
| R6790 |
T10564 |
T10565 |
det |
this,subtype |
| R6791 |
T10565 |
T10563 |
pobj |
subtype,with |
| R6792 |
T10566 |
T10565 |
compound |
receptor,subtype |
| R6793 |
T10510 |
T10508 |
dobj |
defects,regenerate |
| R6794 |
T10567 |
T10554 |
aux |
may,be |
| R6795 |
T10568 |
T10569 |
advmod |
particularly,good |
| R6796 |
T10569 |
T10570 |
amod |
good,candidates |
| R6797 |
T10511 |
T10508 |
prep |
in,regenerate |
| R6798 |
T10570 |
T10554 |
attr |
candidates,be |
| R6799 |
T10571 |
T10570 |
prep |
for,candidates |
| R6800 |
T10512 |
T10513 |
compound |
adult,animals |
| R6801 |
T10572 |
T10571 |
pcomp |
designing,for |
| R6802 |
T10573 |
T10574 |
amod |
new,approaches |
| R6803 |
T10574 |
T10572 |
dobj |
approaches,designing |
| R6804 |
T10513 |
T10511 |
pobj |
animals,in |
| R6805 |
T10575 |
T10576 |
aux |
to,maintain |
| R6806 |
T10576 |
T10574 |
acl |
maintain,approaches |
| R6807 |
T10514 |
T10515 |
punct |
(,Chang |
| R6808 |
T10577 |
T10576 |
cc |
or,maintain |
| R6809 |
T10578 |
T10576 |
conj |
heal,maintain |
| R6810 |
T10579 |
T10580 |
amod |
articular,cartilage |
| R6811 |
T10580 |
T10578 |
dobj |
cartilage,heal |
| R6812 |
T10581 |
T10578 |
prep |
at,heal |
| R6813 |
T10582 |
T10583 |
amod |
postnatal,stages |
| R6814 |
T10515 |
T10476 |
meta |
Chang,stimulated |
| R6815 |
T10583 |
T10581 |
pobj |
stages,at |
| R6816 |
T10584 |
T10541 |
punct |
.,suggests |
| R6817 |
T10516 |
T10515 |
nmod |
et,Chang |
| R6818 |
T10586 |
T10587 |
nsubj |
Lack,results |
| R6819 |
T10517 |
T10515 |
nmod |
al.,Chang |
| R6820 |
T10588 |
T10586 |
prep |
of,Lack |
| R6821 |
T10589 |
T10590 |
compound |
Bmpr1a,function |
| R6822 |
T10590 |
T10588 |
pobj |
function,of |
| R6823 |
T10518 |
T10515 |
nummod |
1994,Chang |
| R6824 |
T10591 |
T10590 |
prep |
in,function |
| R6825 |
T10592 |
T10593 |
amod |
articular,cartilage |
| R6826 |
T10519 |
T10515 |
punct |
;,Chang |
| R6827 |
T10593 |
T10591 |
pobj |
cartilage,in |
| R6828 |
T10520 |
T10515 |
conj |
Erlacher,Chang |
| R6829 |
T10594 |
T10587 |
prep |
in,results |
| R6830 |
T10595 |
T10596 |
amod |
severe,fibrillation |
| R6831 |
T10596 |
T10594 |
pobj |
fibrillation,in |
| R6832 |
T10597 |
T10596 |
prep |
of,fibrillation |
| R6833 |
T10627 |
T10625 |
pobj |
signaling,in |
| R6834 |
T10598 |
T10599 |
det |
the,surface |
| R6835 |
T10628 |
T10623 |
advmod |
also,contribute |
| R6836 |
T10599 |
T10597 |
pobj |
surface,of |
| R6837 |
T10600 |
T10599 |
amod |
articular,surface |
| R6838 |
T10601 |
T10596 |
cc |
and,fibrillation |
| R6839 |
T10629 |
T10623 |
prep |
to,contribute |
| R6840 |
T10602 |
T10596 |
conj |
loss,fibrillation |
| R6841 |
T10603 |
T10602 |
prep |
of,loss |
| R6842 |
T10630 |
T10631 |
amod |
human,disease |
| R6843 |
T10604 |
T10605 |
compound |
joint,mobility |
| R6844 |
T10605 |
T10603 |
pobj |
mobility,of |
| R6845 |
T10606 |
T10587 |
punct |
.,results |
| R6846 |
T10631 |
T10629 |
pobj |
disease,to |
| R6847 |
T10608 |
T10609 |
det |
The,development |
| R6848 |
T10609 |
T10610 |
nsubj |
development,raises |
| R6849 |
T10632 |
T10631 |
compound |
joint,disease |
| R6850 |
T10633 |
T10610 |
punct |
.,raises |
| R6851 |
T10611 |
T10609 |
prep |
of,development |
| R6852 |
T10635 |
T10636 |
nsubjpass |
Osteoarthritis,known |
| R6853 |
T10612 |
T10613 |
amod |
severe,symptoms |
| R6854 |
T10613 |
T10611 |
pobj |
symptoms,of |
| R6855 |
T10614 |
T10613 |
compound |
arthritis,symptoms |
| R6856 |
T10615 |
T10609 |
prep |
in,development |
| R6857 |
T10637 |
T10636 |
auxpass |
is,known |
| R6858 |
T10616 |
T10617 |
npadvmod |
Bmpr1a,deficient |
| R6859 |
T10617 |
T10619 |
amod |
deficient,mice |
| R6860 |
T10618 |
T10617 |
punct |
-,deficient |
| R6861 |
T10619 |
T10615 |
pobj |
mice,in |
| R6862 |
T10620 |
T10621 |
det |
the,possibility |
| R6863 |
T10621 |
T10610 |
dobj |
possibility,raises |
| R6864 |
T10638 |
T10639 |
aux |
to,have |
| R6865 |
T10639 |
T10636 |
xcomp |
have,known |
| R6866 |
T10622 |
T10623 |
mark |
that,contribute |
| R6867 |
T10640 |
T10641 |
det |
a,component |
| R6868 |
T10623 |
T10621 |
acl |
contribute,possibility |
| R6869 |
T10624 |
T10623 |
nsubj |
defects,contribute |
| R6870 |
T10641 |
T10639 |
dobj |
component,have |
| R6871 |
T10625 |
T10624 |
prep |
in,defects |
| R6872 |
T10626 |
T10627 |
compound |
BMP,signaling |
| R6873 |
T10642 |
T10641 |
amod |
significant,component |
| R6874 |
T10643 |
T10641 |
amod |
genetic,component |
| R6875 |
T10644 |
T10636 |
punct |
", ",known |
| R6876 |
T10645 |
T10636 |
cc |
but,known |
| R6877 |
T10733 |
T10731 |
pobj |
study,in |
| R6878 |
T10646 |
T10647 |
nsubj |
it,involves |
| R6879 |
T10734 |
T10725 |
acomp |
heterozygous,were |
| R6880 |
T10735 |
T10734 |
prep |
for,heterozygous |
| R6881 |
T10647 |
T10636 |
conj |
involves,known |
| R6882 |
T10736 |
T10737 |
det |
a,allele |
| R6883 |
T10737 |
T10735 |
pobj |
allele,for |
| R6884 |
T10738 |
T10737 |
amod |
null,allele |
| R6885 |
T10648 |
T10647 |
advmod |
likely,involves |
| R6886 |
T10739 |
T10737 |
prep |
of,allele |
| R6887 |
T10740 |
T10739 |
pobj |
Bmpr1a,of |
| R6888 |
T10741 |
T10725 |
punct |
", ",were |
| R6889 |
T10649 |
T10650 |
amod |
multiple,factors |
| R6890 |
T10742 |
T10725 |
cc |
and,were |
| R6891 |
T10743 |
T10744 |
nsubj |
they,showed |
| R6892 |
T10744 |
T10725 |
conj |
showed,were |
| R6893 |
T10650 |
T10647 |
dobj |
factors,involves |
| R6894 |
T10745 |
T10746 |
amod |
little,sign |
| R6895 |
T10746 |
T10744 |
dobj |
sign,showed |
| R6896 |
T10651 |
T10650 |
amod |
genetic,factors |
| R6897 |
T10747 |
T10746 |
prep |
of,sign |
| R6898 |
T10748 |
T10747 |
pobj |
osteoarthritis,of |
| R6899 |
T10749 |
T10750 |
advmod |
even,late |
| R6900 |
T10652 |
T10653 |
dep |
that,been |
| R6901 |
T10750 |
T10744 |
advmod |
late,showed |
| R6902 |
T10751 |
T10750 |
prep |
in,late |
| R6903 |
T10752 |
T10751 |
pobj |
life,in |
| R6904 |
T10653 |
T10650 |
relcl |
been,factors |
| R6905 |
T10753 |
T10744 |
punct |
.,showed |
| R6906 |
T10654 |
T10653 |
aux |
have,been |
| R6907 |
T10755 |
T10756 |
amod |
Several,regions |
| R6908 |
T10756 |
T10758 |
nsubjpass |
regions,linked |
| R6909 |
T10757 |
T10756 |
compound |
chromosome,regions |
| R6910 |
T10655 |
T10653 |
acomp |
difficult,been |
| R6911 |
T10759 |
T10758 |
aux |
have,linked |
| R6912 |
T10760 |
T10758 |
auxpass |
been,linked |
| R6913 |
T10761 |
T10758 |
advmod |
previously,linked |
| R6914 |
T10762 |
T10758 |
prep |
to,linked |
| R6915 |
T10763 |
T10764 |
compound |
arthritis,phenotypes |
| R6916 |
T10656 |
T10657 |
aux |
to,identify |
| R6917 |
T10764 |
T10762 |
pobj |
phenotypes,to |
| R6918 |
T10765 |
T10758 |
prep |
in,linked |
| R6919 |
T10766 |
T10765 |
pobj |
humans,in |
| R6920 |
T10657 |
T10655 |
advcl |
identify,difficult |
| R6921 |
T10767 |
T10758 |
advcl |
using,linked |
| R6922 |
T10768 |
T10769 |
preconj |
either,studies |
| R6923 |
T10769 |
T10767 |
dobj |
studies,using |
| R6924 |
T10658 |
T10659 |
punct |
(,Spector |
| R6925 |
T10770 |
T10769 |
compound |
association,studies |
| R6926 |
T10771 |
T10769 |
prep |
in,studies |
| R6927 |
T10772 |
T10771 |
pobj |
populations,in |
| R6928 |
T10659 |
T10647 |
meta |
Spector,involves |
| R6929 |
T10773 |
T10769 |
cc |
or,studies |
| R6930 |
T10774 |
T10775 |
compound |
linkage,studies |
| R6931 |
T10775 |
T10769 |
conj |
studies,studies |
| R6932 |
T10660 |
T10659 |
nmod |
et,Spector |
| R6933 |
T10776 |
T10775 |
prep |
in,studies |
| R6934 |
T10777 |
T10776 |
pobj |
families,in |
| R6935 |
T10778 |
T10758 |
punct |
.,linked |
| R6936 |
T10661 |
T10659 |
nmod |
al.,Spector |
| R6937 |
T10780 |
T10781 |
nsubj |
It,is |
| R6938 |
T10662 |
T10659 |
nummod |
1996,Spector |
| R6939 |
T10782 |
T10781 |
acomp |
interesting,is |
| R6940 |
T10663 |
T10659 |
punct |
;,Spector |
| R6941 |
T10783 |
T10784 |
aux |
to,note |
| R6942 |
T10664 |
T10659 |
nmod |
Felson,Spector |
| R6943 |
T10784 |
T10781 |
xcomp |
note,is |
| R6944 |
T10665 |
T10659 |
nmod |
et,Spector |
| R6945 |
T10785 |
T10786 |
mark |
that,contain |
| R6946 |
T10786 |
T10784 |
ccomp |
contain,note |
| R6947 |
T10787 |
T10786 |
nsubj |
several,contain |
| R6948 |
T10788 |
T10787 |
prep |
of,several |
| R6949 |
T10666 |
T10659 |
nmod |
al.,Spector |
| R6950 |
T10789 |
T10790 |
det |
these,regions |
| R6951 |
T10790 |
T10788 |
pobj |
regions,of |
| R6952 |
T10791 |
T10790 |
compound |
chromosome,regions |
| R6953 |
T10667 |
T10659 |
nummod |
1998,Spector |
| R6954 |
T10792 |
T10786 |
dobj |
genes,contain |
| R6955 |
T10793 |
T10792 |
acl |
encoding,genes |
| R6956 |
T10668 |
T10659 |
punct |
;,Spector |
| R6957 |
T10794 |
T10795 |
amod |
different,members |
| R6958 |
T10795 |
T10793 |
dobj |
members,encoding |
| R6959 |
T10669 |
T10659 |
nmod |
Hirsch,Spector |
| R6960 |
T10796 |
T10795 |
prep |
of,members |
| R6961 |
T10797 |
T10798 |
det |
the,pathway |
| R6962 |
T10798 |
T10796 |
pobj |
pathway,of |
| R6963 |
T10670 |
T10659 |
nmod |
et,Spector |
| R6964 |
T10799 |
T10800 |
compound |
BMP,signaling |
| R6965 |
T10800 |
T10798 |
compound |
signaling,pathway |
| R6966 |
T10801 |
T10792 |
punct |
", ",genes |
| R6967 |
T10802 |
T10792 |
prep |
including,genes |
| R6968 |
T10803 |
T10804 |
det |
the,gene |
| R6969 |
T10804 |
T10802 |
pobj |
gene,including |
| R6970 |
T10671 |
T10659 |
nmod |
al.,Spector |
| R6971 |
T10805 |
T10804 |
compound |
BMP5,gene |
| R6972 |
T10806 |
T10804 |
prep |
on,gene |
| R6973 |
T10807 |
T10808 |
amod |
human,6p12 |
| R6974 |
T10672 |
T10659 |
nummod |
1998,Spector |
| R6975 |
T10808 |
T10806 |
pobj |
6p12,on |
| R6976 |
T10809 |
T10808 |
compound |
chromosome,6p12 |
| R6977 |
T10810 |
T10811 |
punct |
(,Loughlin |
| R6978 |
T10673 |
T10659 |
punct |
),Spector |
| R6979 |
T10811 |
T10804 |
meta |
Loughlin,gene |
| R6980 |
T10812 |
T10811 |
nmod |
et,Loughlin |
| R6981 |
T10674 |
T10647 |
punct |
.,involves |
| R6982 |
T10813 |
T10811 |
nmod |
al.,Loughlin |
| R6983 |
T10814 |
T10811 |
nummod |
2002,Loughlin |
| R6984 |
T10815 |
T10811 |
punct |
),Loughlin |
| R6985 |
T10676 |
T10677 |
nsubjpass |
Humans,known |
| R6986 |
T10816 |
T10804 |
punct |
", ",gene |
| R6987 |
T10817 |
T10818 |
det |
the,gene |
| R6988 |
T10818 |
T10804 |
conj |
gene,gene |
| R6989 |
T10819 |
T10818 |
compound |
MADH1,gene |
| R6990 |
T10820 |
T10818 |
prep |
on,gene |
| R6991 |
T10678 |
T10679 |
dep |
that,are |
| R6992 |
T10821 |
T10822 |
amod |
human,4q26 |
| R6993 |
T10822 |
T10820 |
pobj |
4q26,on |
| R6994 |
T10823 |
T10822 |
compound |
chromosome,4q26 |
| R6995 |
T10824 |
T10825 |
punct |
–,4q31 |
| R6996 |
T10679 |
T10676 |
relcl |
are,Humans |
| R6997 |
T10825 |
T10822 |
prep |
4q31,4q26 |
| R6998 |
T10680 |
T10679 |
acomp |
heterozygous,are |
| R6999 |
T10826 |
T10827 |
punct |
(,Leppavuori |
| R7000 |
T10827 |
T10818 |
meta |
Leppavuori,gene |
| R7001 |
T10828 |
T10827 |
nmod |
et,Leppavuori |
| R7002 |
T10829 |
T10827 |
nmod |
al.,Leppavuori |
| R7003 |
T10681 |
T10680 |
prep |
for,heterozygous |
| R7004 |
T10830 |
T10827 |
nummod |
1999,Leppavuori |
| R7005 |
T10831 |
T10827 |
punct |
;,Leppavuori |
| R7006 |
T10682 |
T10683 |
nmod |
loss,mutations |
| R7007 |
T10832 |
T10827 |
nmod |
Kent,Leppavuori |
| R7008 |
T10833 |
T10827 |
nmod |
et,Leppavuori |
| R7009 |
T10834 |
T10827 |
nmod |
al.,Leppavuori |
| R7010 |
T10683 |
T10681 |
pobj |
mutations,for |
| R7011 |
T10835 |
T10827 |
nummod |
2002,Leppavuori |
| R7012 |
T10836 |
T10827 |
punct |
),Leppavuori |
| R7013 |
T10837 |
T10818 |
punct |
", ",gene |
| R7014 |
T10684 |
T10682 |
punct |
-,loss |
| R7015 |
T10838 |
T10818 |
cc |
and,gene |
| R7016 |
T10685 |
T10682 |
prep |
of,loss |
| R7017 |
T10686 |
T10685 |
punct |
-,of |
| R7018 |
T10687 |
T10685 |
pobj |
function,of |
| R7019 |
T10839 |
T10840 |
det |
the,receptor |
| R7020 |
T10688 |
T10683 |
prep |
in,mutations |
| R7021 |
T10840 |
T10818 |
conj |
receptor,gene |
| R7022 |
T10841 |
T10840 |
compound |
BMPR2,receptor |
| R7023 |
T10842 |
T10840 |
prep |
on,receptor |
| R7024 |
T10689 |
T10688 |
pobj |
BMPR1A,in |
| R7025 |
T10843 |
T10844 |
amod |
human,2q33 |
| R7026 |
T10844 |
T10842 |
pobj |
2q33,on |
| R7027 |
T10845 |
T10844 |
compound |
chromosome,2q33 |
| R7028 |
T10690 |
T10677 |
auxpass |
are,known |
| R7029 |
T10846 |
T10847 |
punct |
(,Wright |
| R7030 |
T10847 |
T10840 |
meta |
Wright,receptor |
| R7031 |
T10848 |
T10847 |
nmod |
et,Wright |
| R7032 |
T10691 |
T10692 |
aux |
to,be |
| R7033 |
T10849 |
T10847 |
nmod |
al.,Wright |
| R7034 |
T10850 |
T10847 |
nummod |
1996,Wright |
| R7035 |
T10851 |
T10847 |
punct |
),Wright |
| R7036 |
T10692 |
T10677 |
xcomp |
be,known |
| R7037 |
T10852 |
T10781 |
punct |
.,is |
| R7038 |
T10854 |
T10855 |
det |
The,nature |
| R7039 |
T10693 |
T10692 |
prep |
at,be |
| R7040 |
T10855 |
T10857 |
nsubj |
nature,suggests |
| R7041 |
T10856 |
T10855 |
amod |
complex,nature |
| R7042 |
T10694 |
T10693 |
pobj |
risk,at |
| R7043 |
T10858 |
T10855 |
prep |
of,nature |
| R7044 |
T10695 |
T10694 |
prep |
for,risk |
| R7045 |
T10859 |
T10860 |
amod |
human,osteoarthritis |
| R7046 |
T10860 |
T10858 |
pobj |
osteoarthritis,of |
| R7047 |
T10861 |
T10862 |
mark |
that,involved |
| R7048 |
T10696 |
T10697 |
amod |
juvenile,polyposis |
| R7049 |
T10697 |
T10695 |
pobj |
polyposis,for |
| R7050 |
T10862 |
T10857 |
ccomp |
involved,suggests |
| R7051 |
T10698 |
T10699 |
punct |
(,Howe |
| R7052 |
T10863 |
T10862 |
nsubjpass |
interactions,involved |
| R7053 |
T10864 |
T10863 |
prep |
between,interactions |
| R7054 |
T10865 |
T10866 |
amod |
multiple,genes |
| R7055 |
T10699 |
T10677 |
meta |
Howe,known |
| R7056 |
T10866 |
T10864 |
pobj |
genes,between |
| R7057 |
T10867 |
T10862 |
aux |
may,involved |
| R7058 |
T10868 |
T10862 |
auxpass |
be,involved |
| R7059 |
T10700 |
T10699 |
nmod |
et,Howe |
| R7060 |
T10869 |
T10862 |
prep |
in,involved |
| R7061 |
T10870 |
T10869 |
pcomp |
modifying,in |
| R7062 |
T10701 |
T10699 |
nmod |
al.,Howe |
| R7063 |
T10871 |
T10870 |
dobj |
susceptibility,modifying |
| R7064 |
T10872 |
T10871 |
prep |
to,susceptibility |
| R7065 |
T10873 |
T10874 |
det |
the,disease |
| R7066 |
T10702 |
T10699 |
nummod |
2001,Howe |
| R7067 |
T10874 |
T10872 |
pobj |
disease,to |
| R7068 |
T10875 |
T10857 |
punct |
.,suggests |
| R7069 |
T10877 |
T10878 |
det |
The,inclusion |
| R7070 |
T10878 |
T10879 |
nsubj |
inclusion,help |
| R7071 |
T10703 |
T10699 |
punct |
;,Howe |
| R7072 |
T10880 |
T10878 |
prep |
of,inclusion |
| R7073 |
T10881 |
T10882 |
amod |
genetic,markers |
| R7074 |
T10704 |
T10699 |
nmod |
Zhou,Howe |
| R7075 |
T10882 |
T10880 |
pobj |
markers,of |
| R7076 |
T10883 |
T10882 |
prep |
near,markers |
| R7077 |
T10884 |
T10885 |
compound |
BMP,components |
| R7078 |
T10705 |
T10699 |
nmod |
et,Howe |
| R7079 |
T10885 |
T10883 |
pobj |
components,near |
| R7080 |
T10886 |
T10885 |
compound |
signaling,components |
| R7081 |
T10887 |
T10879 |
aux |
may,help |
| R7082 |
T10706 |
T10699 |
nmod |
al.,Howe |
| R7083 |
T10888 |
T10879 |
xcomp |
identify,help |
| R7084 |
T10889 |
T10890 |
amod |
additional,loci |
| R7085 |
T10890 |
T10888 |
dobj |
loci,identify |
| R7086 |
T10707 |
T10699 |
nummod |
2001,Howe |
| R7087 |
T10891 |
T10892 |
compound |
osteoarthritis,susceptibility |
| R7088 |
T10892 |
T10890 |
compound |
susceptibility,loci |
| R7089 |
T10708 |
T10699 |
punct |
),Howe |
| R7090 |
T10893 |
T10888 |
cc |
and,identify |
| R7091 |
T10894 |
T10888 |
conj |
facilitate,identify |
| R7092 |
T10895 |
T10896 |
det |
the,search |
| R7093 |
T10709 |
T10677 |
punct |
", ",known |
| R7094 |
T10896 |
T10894 |
dobj |
search,facilitate |
| R7095 |
T10897 |
T10896 |
prep |
for,search |
| R7096 |
T10898 |
T10899 |
amod |
causative,mutations |
| R7097 |
T10710 |
T10677 |
cc |
but,known |
| R7098 |
T10899 |
T10897 |
pobj |
mutations,for |
| R7099 |
T10900 |
T10879 |
punct |
.,help |
| R7100 |
T10711 |
T10712 |
det |
the,risk |
| R7101 |
T10902 |
T10903 |
nmod |
Development,processes |
| R7102 |
T10903 |
T10906 |
nsubj |
processes,been |
| R7103 |
T10712 |
T10713 |
nsubjpass |
risk,reported |
| R7104 |
T10904 |
T10902 |
cc |
and,Development |
| R7105 |
T10905 |
T10902 |
conj |
disease,Development |
| R7106 |
T10713 |
T10677 |
conj |
reported,known |
| R7107 |
T10907 |
T10903 |
prep |
in,processes |
| R7108 |
T10908 |
T10909 |
amod |
synovial,joints |
| R7109 |
T10714 |
T10712 |
prep |
of,risk |
| R7110 |
T10909 |
T10907 |
pobj |
joints,in |
| R7111 |
T10910 |
T10906 |
aux |
have,been |
| R7112 |
T10911 |
T10906 |
acomp |
difficult,been |
| R7113 |
T10715 |
T10714 |
pobj |
osteoarthritis,of |
| R7114 |
T10912 |
T10913 |
aux |
to,study |
| R7115 |
T10913 |
T10911 |
advcl |
study,difficult |
| R7116 |
T10716 |
T10712 |
prep |
for,risk |
| R7117 |
T10914 |
T10913 |
advmod |
genetically,study |
| R7118 |
T10915 |
T10906 |
punct |
", ",been |
| R7119 |
T10916 |
T10917 |
mark |
because,generated |
| R7120 |
T10917 |
T10906 |
advcl |
generated,been |
| R7121 |
T10918 |
T10919 |
amod |
synovial,joints |
| R7122 |
T10919 |
T10917 |
nsubjpass |
joints,generated |
| R7123 |
T10920 |
T10917 |
auxpass |
are,generated |
| R7124 |
T10717 |
T10718 |
det |
these,people |
| R7125 |
T10921 |
T10917 |
cc |
and,generated |
| R7126 |
T10922 |
T10917 |
conj |
function,generated |
| R7127 |
T10923 |
T10917 |
prep |
at,generated |
| R7128 |
T10718 |
T10716 |
pobj |
people,for |
| R7129 |
T10924 |
T10925 |
advmod |
relatively,late |
| R7130 |
T10925 |
T10926 |
amod |
late,stages |
| R7131 |
T10926 |
T10923 |
pobj |
stages,at |
| R7132 |
T10719 |
T10713 |
aux |
has,reported |
| R7133 |
T10927 |
T10926 |
prep |
of,stages |
| R7134 |
T10928 |
T10929 |
compound |
vertebrate,development |
| R7135 |
T10929 |
T10927 |
pobj |
development,of |
| R7136 |
T10720 |
T10713 |
neg |
not,reported |
| R7137 |
T10930 |
T10906 |
punct |
.,been |
| R7138 |
T10721 |
T10713 |
auxpass |
been,reported |
| R7139 |
T10932 |
T10933 |
det |
The,system |
| R7140 |
T10933 |
T10937 |
nsubj |
system,provides |
| R7141 |
T10934 |
T10935 |
compound |
Gdf5,Cre |
| R7142 |
T10722 |
T10713 |
punct |
.,reported |
| R7143 |
T10935 |
T10933 |
compound |
Cre,system |
| R7144 |
T10936 |
T10935 |
punct |
-,Cre |
| R7145 |
T10724 |
T10725 |
advmod |
However,were |
| R7146 |
T10938 |
T10939 |
det |
a,method |
| R7147 |
T10939 |
T10937 |
dobj |
method,provides |
| R7148 |
T10940 |
T10939 |
amod |
new,method |
| R7149 |
T10941 |
T10939 |
prep |
for,method |
| R7150 |
T10726 |
T10725 |
punct |
", ",were |
| R7151 |
T10942 |
T10941 |
pcomp |
restricting,for |
| R7152 |
T10943 |
T10944 |
compound |
gene,expression |
| R7153 |
T10944 |
T10942 |
dobj |
expression,restricting |
| R7154 |
T10727 |
T10728 |
det |
the,mice |
| R7155 |
T10728 |
T10725 |
nsubj |
mice,were |
| R7156 |
T10729 |
T10728 |
compound |
control,mice |
| R7157 |
T10945 |
T10944 |
cc |
or,expression |
| R7158 |
T10730 |
T10728 |
acl |
used,mice |
| R7159 |
T10946 |
T10944 |
conj |
inactivation,expression |
| R7160 |
T10947 |
T10948 |
advmod |
primarily,to |
| R7161 |
T10948 |
T10942 |
prep |
to,restricting |
| R7162 |
T10731 |
T10730 |
prep |
in,used |
| R7163 |
T10949 |
T10950 |
amod |
articular,regions |
| R7164 |
T10950 |
T10948 |
pobj |
regions,to |
| R7165 |
T10732 |
T10733 |
det |
this,study |
| R7166 |
T10951 |
T10942 |
punct |
", ",restricting |
| R7167 |
T10952 |
T10953 |
advmod |
thus,avoiding |
| R7168 |
T10953 |
T10942 |
advcl |
avoiding,restricting |
| R7169 |
T10954 |
T10955 |
det |
the,functions |
| R7170 |
T10955 |
T10953 |
dobj |
functions,avoiding |
| R7171 |
T10956 |
T10955 |
amod |
pleiotropic,functions |
| R7172 |
T10957 |
T10955 |
prep |
of,functions |
| R7173 |
T10958 |
T10959 |
amod |
many,genes |
| R7174 |
T10959 |
T10957 |
pobj |
genes,of |
| R7175 |
T10960 |
T10955 |
prep |
in,functions |
| R7176 |
T10961 |
T10962 |
amod |
other,tissues |
| R7177 |
T10962 |
T10960 |
pobj |
tissues,in |
| R7178 |
T10963 |
T10937 |
punct |
.,provides |
| R7179 |
T10965 |
T10966 |
prep |
Depending,used |
| R7180 |
T10967 |
T10965 |
prep |
on,Depending |
| R7181 |
T10968 |
T10969 |
det |
the,configuration |
| R7182 |
T10969 |
T10967 |
pobj |
configuration,on |
| R7183 |
T10970 |
T10969 |
prep |
of,configuration |
| R7184 |
T10971 |
T10972 |
det |
the,gene |
| R7185 |
T10972 |
T10970 |
pobj |
gene,of |
| R7186 |
T10973 |
T10972 |
amod |
floxed,gene |
| R7187 |
T10974 |
T10972 |
compound |
target,gene |
| R7188 |
T10975 |
T10966 |
punct |
", ",used |
| R7189 |
T10976 |
T10977 |
det |
this,system |
| R7190 |
T10977 |
T10966 |
nsubjpass |
system,used |
| R7191 |
T10978 |
T10966 |
aux |
can,used |
| R7192 |
T10979 |
T10966 |
auxpass |
be,used |
| R7193 |
T10980 |
T10981 |
aux |
to,activate |
| R7194 |
T10981 |
T10966 |
advcl |
activate,used |
| R7195 |
T10982 |
T10981 |
preconj |
either,activate |
| R7196 |
T10983 |
T10984 |
det |
the,expression |
| R7197 |
T10984 |
T10981 |
dobj |
expression,activate |
| R7198 |
T10985 |
T10984 |
prep |
of,expression |
| R7199 |
T10986 |
T10987 |
det |
a,gene |
| R7200 |
T10987 |
T10985 |
pobj |
gene,of |
| R7201 |
T10988 |
T10989 |
advmod |
primarily,in |
| R7202 |
T10989 |
T10981 |
prep |
in,activate |
| R7203 |
T10990 |
T10991 |
amod |
developing,joints |
| R7204 |
T10991 |
T10989 |
pobj |
joints,in |
| R7205 |
T10992 |
T10993 |
punct |
(,ssee |
| R7206 |
T10993 |
T10981 |
parataxis |
ssee,activate |
| R7207 |
T10994 |
T10995 |
nmod |
Figure,1B |
| R7208 |
T10995 |
T10993 |
dobj |
1B,ssee |
| R7209 |
T10996 |
T10997 |
punct |
–,1D |
| R7210 |
T10997 |
T10995 |
prep |
1D,1B |
| R7211 |
T10998 |
T10993 |
punct |
),ssee |
| R7212 |
T10999 |
T10981 |
punct |
", ",activate |
| R7213 |
T11000 |
T10981 |
cc |
or,activate |
| R7214 |
T11001 |
T11002 |
aux |
to,inactivate |
| R7215 |
T11002 |
T10981 |
conj |
inactivate,activate |
| R7216 |
T11003 |
T11004 |
compound |
gene,function |
| R7217 |
T11004 |
T11002 |
dobj |
function,inactivate |
| R7218 |
T11005 |
T11002 |
prep |
in,inactivate |
| R7219 |
T11006 |
T11007 |
amod |
articular,regions |
| R7220 |
T11007 |
T11005 |
pobj |
regions,in |
| R7221 |
T11008 |
T11009 |
punct |
(,see |
| R7222 |
T11009 |
T10966 |
parataxis |
see,used |
| R7223 |
T11010 |
T11009 |
dobj |
Figure,see |
| R7224 |
T11011 |
T11010 |
nummod |
3,Figure |
| R7225 |
T11012 |
T11009 |
punct |
),see |
| R7226 |
T11013 |
T10966 |
punct |
.,used |
| R7227 |
T11015 |
T11016 |
amod |
Additional,studies |
| R7228 |
T11016 |
T11017 |
nsubj |
studies,enhance |
| R7229 |
T11018 |
T11016 |
prep |
with,studies |
| R7230 |
T11019 |
T11020 |
det |
this,system |
| R7231 |
T11020 |
T11018 |
pobj |
system,with |
| R7232 |
T11021 |
T11017 |
aux |
should,enhance |
| R7233 |
T11022 |
T11017 |
advmod |
greatly,enhance |
| R7234 |
T11023 |
T11024 |
poss |
our,knowledge |
| R7235 |
T11024 |
T11017 |
dobj |
knowledge,enhance |
| R7236 |
T11025 |
T11024 |
prep |
of,knowledge |
| R7237 |
T11026 |
T11027 |
det |
the,mechanisms |
| R7238 |
T11027 |
T11025 |
pobj |
mechanisms,of |
| R7239 |
T11028 |
T11027 |
nmod |
development,mechanisms |
| R7240 |
T11029 |
T11028 |
punct |
", ",development |
| R7241 |
T11030 |
T11028 |
conj |
function,development |
| R7242 |
T11031 |
T11030 |
punct |
", ",function |
| R7243 |
T11032 |
T11030 |
cc |
and,function |
| R7244 |
T11033 |
T11030 |
conj |
disease,function |
| R7245 |
T11034 |
T11027 |
prep |
of,mechanisms |
| R7246 |
T11035 |
T11034 |
pobj |
joints,of |
| R7247 |
T11036 |
T11017 |
punct |
", ",enhance |
| R7248 |
T11037 |
T11017 |
cc |
and,enhance |
| R7266 |
T11314 |
T11313 |
prep |
of,Generation |
| R7267 |
T11315 |
T11316 |
compound |
Gdf5,Cre |
| R7268 |
T11316 |
T11318 |
npadvmod |
Cre,transgenic |
| R7269 |
T11317 |
T11316 |
punct |
-,Cre |
| R7270 |
T11318 |
T11319 |
amod |
transgenic,mice |
| R7271 |
T11319 |
T11314 |
pobj |
mice,of |
| R7272 |
T11321 |
T11322 |
det |
A,library |
| R7273 |
T11322 |
T11328 |
nsubjpass |
library,screened |
| R7274 |
T11323 |
T11324 |
compound |
mouse,BAC |
| R7275 |
T11324 |
T11322 |
compound |
BAC,library |
| R7276 |
T11325 |
T11326 |
compound |
129x1,SvJ |
| R7277 |
T11326 |
T11324 |
compound |
SvJ,BAC |
| R7278 |
T11327 |
T11326 |
punct |
/,SvJ |
| R7279 |
T11329 |
T11330 |
punct |
(,Invitrogen |
| R7280 |
T11330 |
T11322 |
parataxis |
Invitrogen,library |
| R7281 |
T11331 |
T11330 |
punct |
),Invitrogen |
| R7282 |
T11332 |
T11328 |
auxpass |
was,screened |
| R7283 |
T11333 |
T11334 |
aux |
to,identify |
| R7284 |
T11334 |
T11328 |
advcl |
identify,screened |
| R7285 |
T11335 |
T11336 |
det |
a,BAC |
| R7286 |
T11336 |
T11334 |
dobj |
BAC,identify |
| R7287 |
T11337 |
T11338 |
nummod |
140,kb |
| R7288 |
T11338 |
T11336 |
compound |
kb,BAC |
| R7289 |
T11339 |
T11338 |
punct |
-,kb |
| R7290 |
T11340 |
T11336 |
prep |
from,BAC |
| R7291 |
T11341 |
T11342 |
det |
the,locus |
| R7292 |
T11342 |
T11340 |
pobj |
locus,from |
| R7293 |
T11343 |
T11342 |
compound |
Gdf5,locus |
| R7294 |
T11344 |
T11328 |
punct |
.,screened |
| R7295 |
T11346 |
T11347 |
det |
This,BAC |
| R7296 |
T11347 |
T11348 |
nsubjpass |
BAC,modified |
| R7297 |
T11349 |
T11348 |
auxpass |
was,modified |
| R7298 |
T11350 |
T11348 |
advcl |
using,modified |
| R7299 |
T11351 |
T11352 |
det |
a,system |
| R7300 |
T11352 |
T11350 |
dobj |
system,using |
| R7301 |
T11353 |
T11354 |
amod |
homologous,recombination |
| R7302 |
T11354 |
T11352 |
compound |
recombination,system |
| R7303 |
T11355 |
T11350 |
prep |
in,using |
| R7304 |
T11356 |
T11357 |
compound |
E.,coli |
| R7305 |
T11357 |
T11355 |
pobj |
coli,in |
| R7306 |
T11358 |
T11359 |
punct |
(,Yang |
| R7307 |
T11359 |
T11350 |
meta |
Yang,using |
| R7308 |
T11360 |
T11359 |
nmod |
et,Yang |
| R7309 |
T11361 |
T11359 |
nmod |
al.,Yang |
| R7310 |
T11362 |
T11359 |
nummod |
1997,Yang |
| R7311 |
T11363 |
T11359 |
punct |
),Yang |
| R7312 |
T11364 |
T11365 |
aux |
to,place |
| R7313 |
T11365 |
T11350 |
advcl |
place,using |
| R7314 |
T11366 |
T11367 |
amod |
nuclear,localized |
| R7315 |
T11367 |
T11369 |
amod |
localized,recombinase |
| R7316 |
T11368 |
T11367 |
punct |
-,localized |
| R7317 |
T11369 |
T11365 |
dobj |
recombinase,place |
| R7318 |
T11370 |
T11369 |
compound |
Cre,recombinase |
| R7319 |
T11371 |
T11369 |
punct |
(,recombinase |
| R7320 |
T11372 |
T11369 |
prep |
from,recombinase |
| R7321 |
T11373 |
T11374 |
compound |
plasmid,pML78 |
| R7322 |
T11374 |
T11372 |
pobj |
pML78,from |
| R7323 |
T11375 |
T11376 |
punct |
", ",gift |
| R7324 |
T11376 |
T11374 |
parataxis |
gift,pML78 |
| R7325 |
T11377 |
T11376 |
prep |
of,gift |
| R7326 |
T11378 |
T11379 |
compound |
Gail,Martin |
| R7327 |
T11379 |
T11377 |
pobj |
Martin,of |
| R7328 |
T11380 |
T11369 |
punct |
),recombinase |
| R7329 |
T11381 |
T11369 |
acl |
followed,recombinase |
| R7330 |
T11382 |
T11381 |
agent |
by,followed |
| R7331 |
T11383 |
T11384 |
compound |
IRES,hPLAP |
| R7332 |
T11384 |
T11382 |
pobj |
hPLAP,by |
| R7333 |
T11385 |
T11384 |
punct |
-,hPLAP |
| R7334 |
T11386 |
T11384 |
punct |
(,hPLAP |
| R7335 |
T11387 |
T11384 |
prep |
from,hPLAP |
| R7336 |
T11388 |
T11387 |
pobj |
plasmid,from |
| R7337 |
T11389 |
T11388 |
nummod |
1726,plasmid |
| R7338 |
T11390 |
T11388 |
punct |
", ",plasmid |
| R7339 |
T11391 |
T11388 |
parataxis |
gift,plasmid |
| R7340 |
T11392 |
T11391 |
prep |
of,gift |
| R7341 |
T11393 |
T11394 |
compound |
Oliver,Bogler |
| R7342 |
T11394 |
T11392 |
pobj |
Bogler,of |
| R7343 |
T11395 |
T11384 |
punct |
),hPLAP |
| R7344 |
T11396 |
T11397 |
advmod |
directly,behind |
| R7345 |
T11397 |
T11384 |
prep |
behind,hPLAP |
| R7346 |
T11398 |
T11399 |
det |
the,site |
| R7347 |
T11399 |
T11397 |
pobj |
site,behind |
| R7348 |
T11400 |
T11399 |
compound |
ATG,site |
| R7349 |
T11401 |
T11399 |
compound |
start,site |
| R7350 |
T11402 |
T11399 |
prep |
of,site |
| R7351 |
T11403 |
T11402 |
pobj |
Gdf5,of |
| R7352 |
T11404 |
T11348 |
punct |
.,modified |
| R7353 |
T11406 |
T11407 |
prep |
In,removed |
| R7354 |
T11408 |
T11409 |
det |
the,process |
| R7355 |
T11409 |
T11406 |
pobj |
process,In |
| R7356 |
T11410 |
T11407 |
punct |
", ",removed |
| R7357 |
T11411 |
T11412 |
nummod |
583,bp |
| R7358 |
T11412 |
T11407 |
nsubjpass |
bp,removed |
| R7359 |
T11413 |
T11412 |
prep |
of,bp |
| R7360 |
T11414 |
T11415 |
det |
the,exon |
| R7361 |
T11415 |
T11413 |
pobj |
exon,of |
| R7362 |
T11416 |
T11415 |
amod |
first,exon |
| R7363 |
T11417 |
T11415 |
prep |
of,exon |
| R7364 |
T11418 |
T11417 |
pobj |
Gdf5,of |
| R7365 |
T11419 |
T11407 |
auxpass |
was,removed |
| R7366 |
T11420 |
T11407 |
cc |
and,removed |
| R7367 |
T11421 |
T11422 |
det |
no,protein |
| R7368 |
T11422 |
T11425 |
nsubjpass |
protein,predicted |
| R7369 |
T11423 |
T11422 |
amod |
functional,protein |
| R7370 |
T11424 |
T11422 |
compound |
GDF5,protein |
| R7371 |
T11425 |
T11407 |
conj |
predicted,removed |
| R7372 |
T11426 |
T11425 |
auxpass |
is,predicted |
| R7373 |
T11427 |
T11428 |
aux |
to,produced |
| R7374 |
T11428 |
T11425 |
xcomp |
produced,predicted |
| R7375 |
T11429 |
T11428 |
auxpass |
be,produced |
| R7376 |
T11430 |
T11425 |
punct |
.,predicted |
| R7377 |
T11432 |
T11433 |
det |
The,arm |
| R7378 |
T11433 |
T11437 |
nsubjpass |
arm,subcloned |
| R7379 |
T11434 |
T11433 |
nummod |
5,arm |
| R7380 |
T11435 |
T11434 |
punct |
′,5 |
| R7381 |
T11436 |
T11433 |
compound |
homology,arm |
| R7382 |
T11438 |
T11437 |
auxpass |
was,subcloned |
| R7383 |
T11439 |
T11437 |
prep |
from,subcloned |
| R7384 |
T11440 |
T11441 |
det |
a,product |
| R7385 |
T11441 |
T11439 |
pobj |
product,from |
| R7386 |
T11442 |
T11441 |
compound |
PCR,product |
| R7387 |
T11443 |
T11441 |
acl |
tailed,product |
| R7388 |
T11444 |
T11443 |
prep |
with,tailed |
| R7389 |
T11445 |
T11446 |
nmod |
XhoI,sites |
| R7390 |
T11446 |
T11444 |
pobj |
sites,with |
| R7391 |
T11447 |
T11445 |
cc |
and,XhoI |
| R7392 |
T11448 |
T11445 |
conj |
Bsp120I,XhoI |
| R7393 |
T11449 |
T11446 |
compound |
restriction,sites |
| R7394 |
T11450 |
T11451 |
dep |
that,contains |
| R7395 |
T11451 |
T11441 |
relcl |
contains,product |
| R7396 |
T11452 |
T11453 |
nummod |
781,bp |
| R7397 |
T11453 |
T11451 |
dobj |
bp,contains |
| R7398 |
T11454 |
T11453 |
prep |
of,bp |
| R7399 |
T11455 |
T11456 |
nummod |
5,sequence |
| R7400 |
T11456 |
T11454 |
pobj |
sequence,of |
| R7401 |
T11457 |
T11455 |
punct |
′,5 |
| R7402 |
T11458 |
T11456 |
amod |
genomic,sequence |
| R7403 |
T11459 |
T11456 |
compound |
Gdf5,sequence |
| R7404 |
T11460 |
T11456 |
acl |
ending,sequence |
| R7405 |
T11461 |
T11460 |
prep |
at,ending |
| R7406 |
T11462 |
T11463 |
det |
the,site |
| R7407 |
T11463 |
T11461 |
pobj |
site,at |
| R7408 |
T11464 |
T11465 |
compound |
ATG,translation |
| R7409 |
T11465 |
T11463 |
compound |
translation,site |
| R7410 |
T11466 |
T11463 |
compound |
start,site |
| R7411 |
T11467 |
T11468 |
punct |
(,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7412 |
T11468 |
T11460 |
parataxis |
GTTTGGGCCCATCCTCTGGCCAGCCGCTG,ending |
| R7413 |
T11469 |
T11470 |
amod |
forward,primer |
| R7414 |
T11470 |
T11471 |
dep |
primer,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7415 |
T11471 |
T11468 |
dep |
CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7416 |
T11472 |
T11471 |
nummod |
5,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7417 |
T11473 |
T11472 |
punct |
′,5 |
| R7418 |
T11474 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7419 |
T11475 |
T11471 |
punct |
-,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7420 |
T11476 |
T11471 |
nummod |
3,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7421 |
T11477 |
T11471 |
punct |
′,CTGTCTCGAGATGAGGTGGAGGTGAAGACCCC |
| R7422 |
T11478 |
T11468 |
punct |
;,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7423 |
T11479 |
T11468 |
amod |
reverse,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7424 |
T11480 |
T11468 |
nummod |
5,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7425 |
T11481 |
T11480 |
punct |
′,5 |
| R7426 |
T11482 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7427 |
T11483 |
T11468 |
punct |
-,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7428 |
T11484 |
T11468 |
nummod |
3,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7429 |
T11485 |
T11468 |
punct |
′,GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7430 |
T11486 |
T11468 |
punct |
),GTTTGGGCCCATCCTCTGGCCAGCCGCTG |
| R7431 |
T11487 |
T11437 |
punct |
.,subcloned |
| R7432 |
T11489 |
T11490 |
nsubjpass |
Cre,subcloned |
| R7433 |
T11491 |
T11490 |
auxpass |
was,subcloned |
| R7434 |
T11492 |
T11490 |
prep |
from,subcloned |
| R7435 |
T11493 |
T11494 |
det |
a,fragment |
| R7436 |
T11494 |
T11492 |
pobj |
fragment,from |
| R7437 |
T11495 |
T11496 |
nummod |
1.1,kb |
| R7438 |
T11496 |
T11494 |
compound |
kb,fragment |
| R7439 |
T11497 |
T11496 |
punct |
-,kb |
| R7440 |
T11498 |
T11499 |
compound |
Bsp120I,EcoRI |
| R7441 |
T11499 |
T11494 |
compound |
EcoRI,fragment |
| R7442 |
T11500 |
T11499 |
punct |
/,EcoRI |
| R7443 |
T11501 |
T11494 |
prep |
of,fragment |
| R7444 |
T11502 |
T11501 |
pobj |
pML78,of |
| R7445 |
T11503 |
T11490 |
punct |
.,subcloned |
| R7446 |
T11505 |
T11506 |
compound |
IRES,hPLAP |
| R7447 |
T11506 |
T11507 |
nsubjpass |
hPLAP,subcloned |
| R7448 |
T11508 |
T11507 |
auxpass |
was,subcloned |
| R7449 |
T11509 |
T11507 |
prep |
from,subcloned |
| R7450 |
T11510 |
T11511 |
det |
a,product |
| R7451 |
T11511 |
T11509 |
pobj |
product,from |
| R7452 |
T11512 |
T11513 |
nummod |
2.1,kb |
| R7453 |
T11513 |
T11511 |
compound |
kb,product |
| R7454 |
T11514 |
T11513 |
punct |
-,kb |
| R7455 |
T11515 |
T11511 |
compound |
PCR,product |
| R7456 |
T11516 |
T11511 |
acl |
tailed,product |
| R7457 |
T11517 |
T11516 |
prep |
with,tailed |
| R7458 |
T11518 |
T11519 |
nmod |
EcoRI,sites |
| R7459 |
T11519 |
T11517 |
pobj |
sites,with |
| R7460 |
T11520 |
T11518 |
cc |
and,EcoRI |
| R7461 |
T11521 |
T11518 |
conj |
SpeI,EcoRI |
| R7462 |
T11522 |
T11523 |
dep |
that,contains |
| R7463 |
T11523 |
T11511 |
relcl |
contains,product |
| R7464 |
T11524 |
T11525 |
det |
the,site |
| R7465 |
T11525 |
T11523 |
dobj |
site,contains |
| R7466 |
T11526 |
T11527 |
compound |
hPLAP,translation |
| R7467 |
T11527 |
T11525 |
compound |
translation,site |
| R7468 |
T11528 |
T11525 |
compound |
stop,site |
| R7469 |
T11529 |
T11530 |
punct |
(,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7470 |
T11530 |
T11525 |
parataxis |
AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG,site |
| R7471 |
T11531 |
T11532 |
amod |
forward,primer |
| R7472 |
T11532 |
T11533 |
dep |
primer,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7473 |
T11533 |
T11530 |
dep |
ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7474 |
T11534 |
T11533 |
nummod |
5,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7475 |
T11535 |
T11534 |
punct |
′,5 |
| R7476 |
T11536 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7477 |
T11537 |
T11533 |
punct |
-,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7478 |
T11538 |
T11533 |
nummod |
3,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7479 |
T11539 |
T11533 |
punct |
′,ATCTCTCGAGGAATTCTCCACCATATTGCCGTCTTTTG |
| R7480 |
T11540 |
T11530 |
punct |
;,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7481 |
T11541 |
T11530 |
amod |
reverse,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7482 |
T11542 |
T11530 |
nummod |
5,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7483 |
T11543 |
T11542 |
punct |
′,5 |
| R7484 |
T11544 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7485 |
T11545 |
T11530 |
punct |
-,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7486 |
T11546 |
T11530 |
nummod |
3,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7487 |
T11547 |
T11530 |
punct |
′,AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7488 |
T11548 |
T11530 |
punct |
),AGAACTCGAGACTAGTCGGGACACTCAGGGAGTAGTGG |
| R7489 |
T11549 |
T11507 |
punct |
.,subcloned |
| R7490 |
T11551 |
T11552 |
det |
The,arm |
| R7491 |
T11552 |
T11556 |
nsubjpass |
arm,subcloned |
| R7492 |
T11553 |
T11552 |
nummod |
3,arm |
| R7493 |
T11554 |
T11553 |
punct |
′,3 |
| R7494 |
T11555 |
T11552 |
compound |
homology,arm |
| R7495 |
T11557 |
T11556 |
auxpass |
was,subcloned |
| R7496 |
T11558 |
T11556 |
prep |
from,subcloned |
| R7497 |
T11559 |
T11560 |
det |
a,product |
| R7498 |
T11560 |
T11558 |
pobj |
product,from |
| R7499 |
T11561 |
T11562 |
nummod |
0.8,kb |
| R7500 |
T11562 |
T11560 |
compound |
kb,product |
| R7501 |
T11563 |
T11562 |
punct |
-,kb |
| R7502 |
T11564 |
T11560 |
compound |
PCR,product |
| R7503 |
T11565 |
T11560 |
acl |
amplified,product |
| R7504 |
T11566 |
T11565 |
prep |
from,amplified |
| R7505 |
T11567 |
T11568 |
det |
a,subclone |
| R7506 |
T11568 |
T11566 |
pobj |
subclone,from |
| R7507 |
T11569 |
T11570 |
nummod |
0.9,kb |
| R7508 |
T11570 |
T11568 |
nmod |
kb,subclone |
| R7509 |
T11571 |
T11570 |
punct |
-,kb |
| R7510 |
T11572 |
T11573 |
nmod |
XhoI,Gdf5 |
| R7511 |
T11573 |
T11568 |
nmod |
Gdf5,subclone |
| R7512 |
T11574 |
T11568 |
amod |
genomic,subclone |
| R7513 |
T11575 |
T11568 |
acl |
containing,subclone |
| R7514 |
T11576 |
T11575 |
dobj |
part,containing |
| R7515 |
T11577 |
T11576 |
prep |
of,part |
| R7516 |
T11578 |
T11579 |
det |
the,exon |
| R7517 |
T11579 |
T11577 |
pobj |
exon,of |
| R7518 |
T11580 |
T11579 |
amod |
first,exon |
| R7519 |
T11581 |
T11579 |
cc |
and,exon |
| R7520 |
T11582 |
T11583 |
amod |
downstream,intron |
| R7521 |
T11583 |
T11579 |
conj |
intron,exon |
| R7522 |
T11584 |
T11556 |
punct |
.,subcloned |
| R7523 |
T11586 |
T11587 |
det |
The,primer |
| R7524 |
T11587 |
T11589 |
nsubj |
primer,contains |
| R7525 |
T11588 |
T11587 |
amod |
forward,primer |
| R7526 |
T11589 |
T11590 |
ccomp |
contains,is |
| R7527 |
T11591 |
T11592 |
det |
the,end |
| R7528 |
T11592 |
T11589 |
dobj |
end,contains |
| R7529 |
T11593 |
T11592 |
nummod |
3,end |
| R7530 |
T11594 |
T11593 |
punct |
′,3 |
| R7531 |
T11595 |
T11592 |
prep |
of,end |
| R7532 |
T11596 |
T11597 |
det |
the,exon |
| R7533 |
T11597 |
T11595 |
pobj |
exon,of |
| R7534 |
T11598 |
T11597 |
amod |
first,exon |
| R7535 |
T11599 |
T11589 |
cc |
and,contains |
| R7536 |
T11600 |
T11601 |
auxpass |
is,tailed |
| R7537 |
T11601 |
T11589 |
conj |
tailed,contains |
| R7538 |
T11602 |
T11601 |
prep |
with,tailed |
| R7539 |
T11603 |
T11604 |
det |
a,site |
| R7540 |
T11604 |
T11602 |
pobj |
site,with |
| R7541 |
T11605 |
T11604 |
compound |
SpeI,site |
| R7542 |
T11606 |
T11590 |
punct |
;,is |
| R7543 |
T11607 |
T11608 |
det |
the,primer |
| R7544 |
T11608 |
T11590 |
nsubj |
primer,is |
| R7545 |
T11609 |
T11608 |
amod |
reverse,primer |
| R7546 |
T11610 |
T11590 |
prep |
from,is |
| R7547 |
T11611 |
T11612 |
det |
the,promoter |
| R7548 |
T11612 |
T11610 |
pobj |
promoter,from |
| R7549 |
T11613 |
T11612 |
compound |
T7,promoter |
| R7550 |
T11614 |
T11612 |
prep |
of,promoter |
| R7551 |
T11615 |
T11616 |
det |
the,vector |
| R7552 |
T11616 |
T11614 |
pobj |
vector,of |
| R7553 |
T11617 |
T11616 |
acl |
containing,vector |
| R7554 |
T11618 |
T11619 |
det |
the,subclone |
| R7555 |
T11619 |
T11617 |
dobj |
subclone,containing |
| R7556 |
T11620 |
T11621 |
nummod |
0.9,kb |
| R7557 |
T11621 |
T11619 |
compound |
kb,subclone |
| R7558 |
T11622 |
T11621 |
punct |
-,kb |
| R7559 |
T11623 |
T11590 |
cc |
and,is |
| R7560 |
T11624 |
T11590 |
conj |
flanks,is |
| R7561 |
T11625 |
T11626 |
det |
the,site |
| R7562 |
T11626 |
T11624 |
dobj |
site,flanks |
| R7563 |
T11627 |
T11628 |
amod |
intronic,XhoI |
| R7564 |
T11628 |
T11626 |
compound |
XhoI,site |
| R7565 |
T11629 |
T11630 |
punct |
(,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7566 |
T11630 |
T11626 |
parataxis |
GATTTCTAGAGTAATACGACTCACTATAGGGC,site |
| R7567 |
T11631 |
T11632 |
amod |
forward,primer |
| R7568 |
T11632 |
T11633 |
dep |
primer,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7569 |
T11633 |
T11630 |
dep |
CTAAACTAGTCACCAGCTTTATTGACAAAGG,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7570 |
T11634 |
T11633 |
nummod |
5,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7571 |
T11635 |
T11634 |
punct |
′,5 |
| R7572 |
T11636 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7573 |
T11637 |
T11633 |
punct |
-,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7574 |
T11638 |
T11633 |
nummod |
3,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7575 |
T11639 |
T11633 |
punct |
′,CTAAACTAGTCACCAGCTTTATTGACAAAGG |
| R7576 |
T11640 |
T11630 |
punct |
;,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7577 |
T11641 |
T11630 |
amod |
reverse,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7578 |
T11642 |
T11630 |
nummod |
5,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7579 |
T11643 |
T11642 |
punct |
′,5 |
| R7580 |
T11644 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7581 |
T11645 |
T11630 |
punct |
-,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7582 |
T11646 |
T11630 |
nummod |
3,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7583 |
T11647 |
T11630 |
punct |
′,GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7584 |
T11648 |
T11630 |
punct |
),GATTTCTAGAGTAATACGACTCACTATAGGGC |
| R7585 |
T11649 |
T11590 |
punct |
.,is |
| R7586 |
T11651 |
T11652 |
det |
The,construct |
| R7587 |
T11652 |
T11654 |
nsubjpass |
construct,built |
| R7588 |
T11653 |
T11652 |
compound |
targeting,construct |
| R7589 |
T11655 |
T11654 |
auxpass |
was,built |
| R7590 |
T11656 |
T11654 |
cc |
and,built |
| R7591 |
T11657 |
T11654 |
conj |
verified,built |
| R7592 |
T11658 |
T11657 |
prep |
in,verified |
| R7593 |
T11659 |
T11658 |
pobj |
pBSSK,in |
| R7594 |
T11660 |
T11661 |
punct |
(,Stratagene |
| R7595 |
T11661 |
T11659 |
parataxis |
Stratagene,pBSSK |
| R7596 |
T11662 |
T11661 |
punct |
", ",Stratagene |
| R7597 |
T11663 |
T11664 |
compound |
La,Jolla |
| R7598 |
T11664 |
T11661 |
npadvmod |
Jolla,Stratagene |
| R7599 |
T11665 |
T11661 |
punct |
", ",Stratagene |
| R7600 |
T11666 |
T11661 |
npadvmod |
California,Stratagene |
| R7601 |
T11667 |
T11661 |
punct |
", ",Stratagene |
| R7602 |
T11668 |
T11669 |
compound |
United,States |
| R7603 |
T11669 |
T11661 |
npadvmod |
States,Stratagene |
| R7604 |
T11670 |
T11661 |
punct |
),Stratagene |
| R7605 |
T11671 |
T11654 |
punct |
", ",built |
| R7606 |
T11672 |
T11673 |
advmod |
then,digested |
| R7607 |
T11673 |
T11654 |
conj |
digested,built |
| R7608 |
T11674 |
T11673 |
prep |
with,digested |
| R7609 |
T11675 |
T11674 |
pobj |
XhoI,with |
| R7610 |
T11676 |
T11673 |
cc |
and,digested |
| R7611 |
T11677 |
T11673 |
conj |
subcloned,digested |
| R7612 |
T11678 |
T11677 |
prep |
into,subcloned |
| R7613 |
T11679 |
T11678 |
pobj |
pSV1,into |
| R7614 |
T11680 |
T11679 |
punct |
", ",pSV1 |
| R7615 |
T11681 |
T11682 |
det |
the,vector |
| R7616 |
T11682 |
T11679 |
appos |
vector,pSV1 |
| R7617 |
T11683 |
T11682 |
acl |
used,vector |
| R7618 |
T11684 |
T11683 |
prep |
for,used |
| R7619 |
T11685 |
T11686 |
amod |
homologous,recombination |
| R7620 |
T11686 |
T11684 |
pobj |
recombination,for |
| R7621 |
T11687 |
T11688 |
punct |
(,Yang |
| R7622 |
T11688 |
T11683 |
meta |
Yang,used |
| R7623 |
T11689 |
T11688 |
nmod |
et,Yang |
| R7624 |
T11690 |
T11688 |
nmod |
al.,Yang |
| R7625 |
T11691 |
T11688 |
nummod |
1997,Yang |
| R7626 |
T11692 |
T11688 |
punct |
),Yang |
| R7627 |
T11693 |
T11654 |
punct |
.,built |
| R7628 |
T11695 |
T11696 |
nmod |
Southern,blotting |
| R7629 |
T11696 |
T11697 |
nmod |
blotting,analysis |
| R7630 |
T11697 |
T11704 |
nsubj |
analysis,confirmed |
| R7631 |
T11698 |
T11696 |
punct |
", ",blotting |
| R7632 |
T11699 |
T11696 |
conj |
PCR,blotting |
| R7633 |
T11700 |
T11699 |
punct |
", ",PCR |
| R7634 |
T11701 |
T11699 |
cc |
and,PCR |
| R7635 |
T11702 |
T11703 |
compound |
DNA,sequence |
| R7636 |
T11703 |
T11699 |
conj |
sequence,PCR |
| R7637 |
T11705 |
T11706 |
det |
the,construct |
| R7638 |
T11706 |
T11709 |
nsubjpass |
construct,made |
| R7639 |
T11707 |
T11706 |
amod |
appropriate,construct |
| R7640 |
T11708 |
T11706 |
compound |
targeting,construct |
| R7641 |
T11709 |
T11704 |
advcl |
made,confirmed |
| R7642 |
T11710 |
T11706 |
cc |
and,construct |
| R7643 |
T11711 |
T11712 |
compound |
BAC,modifications |
| R7644 |
T11712 |
T11706 |
conj |
modifications,construct |
| R7645 |
T11713 |
T11709 |
auxpass |
were,made |
| R7646 |
T11714 |
T11715 |
punct |
(,data |
| R7647 |
T11715 |
T11709 |
meta |
data,made |
| R7648 |
T11716 |
T11715 |
amod |
unpublished,data |
| R7649 |
T11717 |
T11715 |
punct |
),data |
| R7650 |
T11718 |
T11704 |
punct |
.,confirmed |
| R7651 |
T11720 |
T11721 |
mark |
Before,injected |
| R7652 |
T11721 |
T11726 |
advcl |
injected,removed |
| R7653 |
T11722 |
T11723 |
det |
the,BAC |
| R7654 |
T11723 |
T11721 |
nsubjpass |
BAC,injected |
| R7655 |
T11724 |
T11723 |
amod |
modified,BAC |
| R7656 |
T11725 |
T11721 |
auxpass |
was,injected |
| R7657 |
T11727 |
T11728 |
aux |
to,produce |
| R7658 |
T11728 |
T11721 |
advcl |
produce,injected |
| R7659 |
T11729 |
T11730 |
amod |
transgenic,animals |
| R7660 |
T11730 |
T11728 |
dobj |
animals,produce |
| R7661 |
T11731 |
T11726 |
punct |
", ",removed |
| R7662 |
T11732 |
T11733 |
det |
a,site |
| R7663 |
T11733 |
T11726 |
nsubjpass |
site,removed |
| R7664 |
T11734 |
T11733 |
compound |
loxP,site |
| R7665 |
T11735 |
T11733 |
relcl |
present,site |
| R7666 |
T11736 |
T11735 |
prep |
in,present |
| R7667 |
T11737 |
T11738 |
det |
the,vector |
| R7668 |
T11738 |
T11736 |
pobj |
vector,in |
| R7669 |
T11739 |
T11738 |
compound |
BAC,vector |
| R7670 |
T11740 |
T11733 |
punct |
", ",site |
| R7671 |
T11741 |
T11733 |
appos |
pBeloBAC11,site |
| R7672 |
T11742 |
T11726 |
punct |
", ",removed |
| R7673 |
T11743 |
T11726 |
auxpass |
was,removed |
| R7674 |
T11744 |
T11745 |
aux |
to,prevent |
| R7675 |
T11745 |
T11726 |
advcl |
prevent,removed |
| R7676 |
T11746 |
T11747 |
det |
the,addition |
| R7677 |
T11747 |
T11745 |
dobj |
addition,prevent |
| R7678 |
T11748 |
T11747 |
prep |
of,addition |
| R7679 |
T11749 |
T11750 |
amod |
undesired,sites |
| R7680 |
T11750 |
T11748 |
pobj |
sites,of |
| R7681 |
T11751 |
T11750 |
compound |
Cre,sites |
| R7682 |
T11752 |
T11750 |
compound |
target,sites |
| R7683 |
T11753 |
T11747 |
prep |
into,addition |
| R7684 |
T11754 |
T11755 |
det |
the,genome |
| R7685 |
T11755 |
T11753 |
pobj |
genome,into |
| R7686 |
T11756 |
T11726 |
punct |
.,removed |
| R7687 |
T11758 |
T11759 |
aux |
To,do |
| R7688 |
T11759 |
T11760 |
advcl |
do,prepared |
| R7689 |
T11761 |
T11759 |
dobj |
this,do |
| R7690 |
T11762 |
T11760 |
punct |
", ",prepared |
| R7691 |
T11763 |
T11764 |
compound |
BAC,DNA |
| R7692 |
T11764 |
T11760 |
nsubjpass |
DNA,prepared |
| R7693 |
T11765 |
T11760 |
auxpass |
was,prepared |
| R7694 |
T11766 |
T11760 |
prep |
by,prepared |
| R7695 |
T11767 |
T11768 |
compound |
CsCl,separation |
| R7696 |
T11768 |
T11766 |
pobj |
separation,by |
| R7697 |
T11769 |
T11760 |
punct |
", ",prepared |
| R7698 |
T11770 |
T11760 |
conj |
digested,prepared |
| R7699 |
T11771 |
T11770 |
prep |
with,digested |
| R7700 |
T11772 |
T11771 |
pobj |
NotI,with |
| R7701 |
T11773 |
T11774 |
aux |
to,free |
| R7702 |
T11774 |
T11770 |
advcl |
free,digested |
| R7703 |
T11775 |
T11776 |
det |
the,insert |
| R7704 |
T11776 |
T11774 |
dobj |
insert,free |
| R7705 |
T11777 |
T11774 |
prep |
from,free |
| R7706 |
T11778 |
T11779 |
det |
the,vector |
| R7707 |
T11779 |
T11777 |
pobj |
vector,from |
| R7708 |
T11780 |
T11770 |
punct |
", ",digested |
| R7709 |
T11781 |
T11770 |
cc |
and,digested |
| R7710 |
T11782 |
T11783 |
dep |
size,fractionated |
| R7711 |
T11783 |
T11770 |
conj |
fractionated,digested |
| R7712 |
T11784 |
T11783 |
punct |
-,fractionated |
| R7713 |
T11785 |
T11783 |
prep |
over,fractionated |
| R7714 |
T11786 |
T11787 |
det |
a,gradient |
| R7715 |
T11787 |
T11785 |
pobj |
gradient,over |
| R7716 |
T11788 |
T11787 |
compound |
sucrose,gradient |
| R7717 |
T11789 |
T11760 |
punct |
.,prepared |
| R7718 |
T11791 |
T11792 |
nsubjpass |
Aliquots,run |
| R7719 |
T11793 |
T11791 |
prep |
of,Aliquots |
| R7720 |
T11794 |
T11793 |
pobj |
fractions,of |
| R7721 |
T11795 |
T11792 |
auxpass |
were,run |
| R7722 |
T11796 |
T11792 |
prep |
on,run |
| R7723 |
T11797 |
T11798 |
det |
a,gel |
| R7724 |
T11798 |
T11796 |
pobj |
gel,on |
| R7725 |
T11799 |
T11800 |
compound |
pulse,field |
| R7726 |
T11800 |
T11798 |
compound |
field,gel |
| R7727 |
T11801 |
T11800 |
punct |
-,field |
| R7728 |
T11802 |
T11792 |
cc |
and,run |
| R7729 |
T11803 |
T11804 |
dep |
Southern,blotted |
| R7730 |
T11804 |
T11792 |
conj |
blotted,run |
| R7731 |
T11805 |
T11804 |
advcl |
using,blotted |
| R7732 |
T11806 |
T11807 |
nmod |
vector,DNA |
| R7733 |
T11807 |
T11805 |
dobj |
DNA,using |
| R7734 |
T11808 |
T11806 |
punct |
-,vector |
| R7735 |
T11809 |
T11806 |
amod |
specific,vector |
| R7736 |
T11810 |
T11805 |
prep |
as,using |
| R7737 |
T11811 |
T11812 |
det |
a,probe |
| R7738 |
T11812 |
T11810 |
pobj |
probe,as |
| R7739 |
T11813 |
T11792 |
punct |
.,run |
| R7740 |
T11815 |
T11816 |
nsubjpass |
Fractions,dialyzed |
| R7741 |
T11817 |
T11815 |
acl |
containing,Fractions |
| R7742 |
T11818 |
T11819 |
amod |
unsheared,insert |
| R7743 |
T11819 |
T11817 |
dobj |
insert,containing |
| R7744 |
T11820 |
T11819 |
cc |
and,insert |
| R7745 |
T11821 |
T11822 |
advmod |
almost,DNA |
| R7746 |
T11822 |
T11819 |
conj |
DNA,insert |
| R7747 |
T11823 |
T11822 |
det |
no,DNA |
| R7748 |
T11824 |
T11822 |
amod |
detectable,DNA |
| R7749 |
T11825 |
T11822 |
compound |
vector,DNA |
| R7750 |
T11826 |
T11816 |
auxpass |
were,dialyzed |
| R7751 |
T11827 |
T11816 |
prep |
in,dialyzed |
| R7752 |
T11828 |
T11829 |
compound |
microinjection,buffer |
| R7753 |
T11829 |
T11827 |
pobj |
buffer,in |
| R7754 |
T11830 |
T11831 |
punct |
(,Tris |
| R7755 |
T11831 |
T11829 |
parataxis |
Tris,buffer |
| R7756 |
T11832 |
T11833 |
nummod |
10,mM |
| R7757 |
T11833 |
T11831 |
compound |
mM,Tris |
| R7758 |
T11834 |
T11831 |
punct |
[,Tris |
| R7759 |
T11835 |
T11831 |
npadvmod |
pH,Tris |
| R7760 |
T11836 |
T11835 |
nummod |
7.4,pH |
| R7761 |
T11837 |
T11831 |
punct |
],Tris |
| R7762 |
T11838 |
T11831 |
prep |
with,Tris |
| R7763 |
T11839 |
T11840 |
nummod |
0.15,mM |
| R7764 |
T11840 |
T11841 |
compound |
mM,EDTA |
| R7765 |
T11841 |
T11838 |
pobj |
EDTA,with |
| R7766 |
T11842 |
T11841 |
punct |
[,EDTA |
| R7767 |
T11843 |
T11841 |
npadvmod |
pH,EDTA |
| R7768 |
T11844 |
T11843 |
nummod |
8.0,pH |
| R7769 |
T11845 |
T11841 |
punct |
],EDTA |
| R7770 |
T11846 |
T11831 |
punct |
),Tris |
| R7771 |
T11847 |
T11816 |
advcl |
using,dialyzed |
| R7772 |
T11848 |
T11849 |
nmod |
Centriprep,concentrators |
| R7773 |
T11849 |
T11847 |
dobj |
concentrators,using |
| R7774 |
T11850 |
T11848 |
punct |
-,Centriprep |
| R7775 |
T11851 |
T11848 |
nummod |
30,Centriprep |
| R7776 |
T11852 |
T11853 |
punct |
(,Millipore |
| R7777 |
T11853 |
T11849 |
parataxis |
Millipore,concentrators |
| R7778 |
T11854 |
T11853 |
punct |
", ",Millipore |
| R7779 |
T11855 |
T11853 |
npadvmod |
Billerica,Millipore |
| R7780 |
T11856 |
T11853 |
punct |
", ",Millipore |
| R7781 |
T11857 |
T11853 |
npadvmod |
Massachusetts,Millipore |
| R7782 |
T11858 |
T11853 |
punct |
", ",Millipore |
| R7783 |
T11859 |
T11860 |
compound |
United,States |
| R7784 |
T11860 |
T11853 |
npadvmod |
States,Millipore |
| R7785 |
T11861 |
T11853 |
punct |
),Millipore |
| R7786 |
T11862 |
T11816 |
punct |
.,dialyzed |
| R7787 |
T11864 |
T11865 |
det |
This,DNA |
| R7788 |
T11865 |
T11868 |
nsubj |
DNA,adjusted |
| R7789 |
T11866 |
T11865 |
amod |
purified,DNA |
| R7790 |
T11867 |
T11865 |
compound |
insert,DNA |
| R7791 |
T11869 |
T11868 |
aux |
was,adjusted |
| R7792 |
T11870 |
T11868 |
prep |
to,adjusted |
| R7793 |
T11871 |
T11872 |
nummod |
1,ng |
| R7794 |
T11872 |
T11870 |
pobj |
ng,to |
| R7795 |
T11873 |
T11874 |
punct |
/,μl |
| R7796 |
T11874 |
T11872 |
prep |
μl,ng |
| R7797 |
T11875 |
T11868 |
cc |
and,adjusted |
| R7798 |
T11876 |
T11868 |
conj |
injected,adjusted |
| R7799 |
T11877 |
T11876 |
prep |
into,injected |
| R7800 |
T11878 |
T11879 |
det |
the,pronucleus |
| R7801 |
T11879 |
T11877 |
pobj |
pronucleus,into |
| R7802 |
T11880 |
T11879 |
prep |
of,pronucleus |
| R7803 |
T11881 |
T11882 |
amod |
fertilized,eggs |
| R7804 |
T11882 |
T11880 |
pobj |
eggs,of |
| R7805 |
T11883 |
T11882 |
prep |
from,eggs |
| R7806 |
T11884 |
T11885 |
compound |
FVB,N |
| R7807 |
T11885 |
T11887 |
compound |
N,mice |
| R7808 |
T11886 |
T11885 |
punct |
/,N |
| R7809 |
T11887 |
T11883 |
pobj |
mice,from |
| R7810 |
T11888 |
T11868 |
agent |
by,adjusted |
| R7811 |
T11889 |
T11890 |
det |
the,Facility |
| R7812 |
T11890 |
T11888 |
pobj |
Facility,by |
| R7813 |
T11891 |
T11890 |
compound |
Stanford,Facility |
| R7814 |
T11892 |
T11890 |
compound |
Transgenic,Facility |
| R7815 |
T11893 |
T11868 |
punct |
.,adjusted |
| R7816 |
T11895 |
T11896 |
amod |
Transgenic,mice |
| R7817 |
T11896 |
T11898 |
nsubjpass |
mice,identified |
| R7818 |
T11897 |
T11896 |
compound |
founder,mice |
| R7819 |
T11899 |
T11898 |
auxpass |
were,identified |
| R7820 |
T11900 |
T11898 |
prep |
by,identified |
| R7821 |
T11901 |
T11900 |
pobj |
PCR,by |
| R7822 |
T11902 |
T11901 |
acl |
using,PCR |
| R7823 |
T11903 |
T11904 |
npadvmod |
Cre,specific |
| R7824 |
T11904 |
T11906 |
amod |
specific,GCCTGCATTACCGGTCGATGCAACGA |
| R7825 |
T11905 |
T11904 |
punct |
-,specific |
| R7826 |
T11906 |
T11902 |
dobj |
GCCTGCATTACCGGTCGATGCAACGA,using |
| R7827 |
T11907 |
T11906 |
nmod |
primers,GCCTGCATTACCGGTCGATGCAACGA |
| R7828 |
T11908 |
T11906 |
nummod |
5,GCCTGCATTACCGGTCGATGCAACGA |
| R7829 |
T11909 |
T11908 |
punct |
′,5 |
| R7830 |
T11910 |
T11906 |
punct |
-,GCCTGCATTACCGGTCGATGCAACGA |
| R7831 |
T11911 |
T11906 |
punct |
-,GCCTGCATTACCGGTCGATGCAACGA |
| R7832 |
T11912 |
T11906 |
nummod |
3,GCCTGCATTACCGGTCGATGCAACGA |
| R7833 |
T11913 |
T11906 |
punct |
′,GCCTGCATTACCGGTCGATGCAACGA |
| R7834 |
T11914 |
T11906 |
cc |
and,GCCTGCATTACCGGTCGATGCAACGA |
| R7835 |
T11915 |
T11916 |
nummod |
5,GTGGCAGATGGCGCGGCAACACCATT |
| R7836 |
T11916 |
T11906 |
conj |
GTGGCAGATGGCGCGGCAACACCATT,GCCTGCATTACCGGTCGATGCAACGA |
| R7837 |
T11917 |
T11915 |
punct |
′,5 |
| R7838 |
T11918 |
T11916 |
punct |
-,GTGGCAGATGGCGCGGCAACACCATT |
| R7839 |
T11919 |
T11916 |
punct |
-,GTGGCAGATGGCGCGGCAACACCATT |
| R7840 |
T11920 |
T11916 |
nummod |
3,GTGGCAGATGGCGCGGCAACACCATT |
| R7841 |
T11921 |
T11916 |
punct |
′,GTGGCAGATGGCGCGGCAACACCATT |
| R7842 |
T11922 |
T11906 |
punct |
", ",GCCTGCATTACCGGTCGATGCAACGA |
| R7843 |
T11923 |
T11924 |
dep |
which,amplify |
| R7844 |
T11924 |
T11906 |
relcl |
amplify,GCCTGCATTACCGGTCGATGCAACGA |
| R7845 |
T11925 |
T11926 |
det |
a,product |
| R7846 |
T11926 |
T11924 |
dobj |
product,amplify |
| R7847 |
T11927 |
T11928 |
nummod |
725,bp |
| R7848 |
T11928 |
T11926 |
compound |
bp,product |
| R7849 |
T11929 |
T11928 |
punct |
-,bp |
| R7850 |
T11930 |
T11898 |
punct |
", ",identified |
| R7851 |
T11931 |
T11898 |
cc |
and,identified |
| R7852 |
T11932 |
T11933 |
auxpass |
were,assessed |
| R7853 |
T11933 |
T11898 |
conj |
assessed,identified |
| R7854 |
T11934 |
T11933 |
prep |
for,assessed |
| R7855 |
T11935 |
T11934 |
pobj |
absence,for |
| R7856 |
T11936 |
T11935 |
prep |
of,absence |
| R7857 |
T11937 |
T11938 |
compound |
BAC,vector |
| R7858 |
T11938 |
T11936 |
pobj |
vector,of |
| R7859 |
T11939 |
T11933 |
advcl |
using,assessed |
| R7860 |
T11940 |
T11941 |
nmod |
vector,primers |
| R7861 |
T11941 |
T11939 |
dobj |
primers,using |
| R7862 |
T11942 |
T11940 |
punct |
-,vector |
| R7863 |
T11943 |
T11940 |
amod |
specific,vector |
| R7864 |
T11944 |
T11945 |
nummod |
5,CGGAGTCTGATGCGGTTGCGATG |
| R7865 |
T11945 |
T11941 |
appos |
CGGAGTCTGATGCGGTTGCGATG,primers |
| R7866 |
T11946 |
T11944 |
punct |
′,5 |
| R7867 |
T11947 |
T11945 |
punct |
-,CGGAGTCTGATGCGGTTGCGATG |
| R7868 |
T11948 |
T11945 |
punct |
-,CGGAGTCTGATGCGGTTGCGATG |
| R7869 |
T11949 |
T11945 |
nummod |
3,CGGAGTCTGATGCGGTTGCGATG |
| R7870 |
T11950 |
T11945 |
punct |
′,CGGAGTCTGATGCGGTTGCGATG |
| R7871 |
T11951 |
T11945 |
cc |
and,CGGAGTCTGATGCGGTTGCGATG |
| R7872 |
T11952 |
T11953 |
nummod |
5,AGTGCTGTTCCCTGGTGCTTCCTC |
| R7873 |
T11953 |
T11945 |
conj |
AGTGCTGTTCCCTGGTGCTTCCTC,CGGAGTCTGATGCGGTTGCGATG |
| R7874 |
T11954 |
T11952 |
punct |
′,5 |
| R7875 |
T11955 |
T11953 |
punct |
-,AGTGCTGTTCCCTGGTGCTTCCTC |
| R7876 |
T11956 |
T11953 |
punct |
-,AGTGCTGTTCCCTGGTGCTTCCTC |
| R7877 |
T11957 |
T11953 |
nummod |
3,AGTGCTGTTCCCTGGTGCTTCCTC |
| R7878 |
T11958 |
T11953 |
punct |
′,AGTGCTGTTCCCTGGTGCTTCCTC |
| R7879 |
T11959 |
T11941 |
punct |
", ",primers |
| R7880 |
T11960 |
T11961 |
dep |
which,amplify |
| R7881 |
T11961 |
T11941 |
relcl |
amplify,primers |
| R7882 |
T11962 |
T11963 |
det |
a,product |
| R7883 |
T11963 |
T11961 |
dobj |
product,amplify |
| R7884 |
T11964 |
T11965 |
nummod |
465,bp |
| R7885 |
T11965 |
T11963 |
compound |
bp,product |
| R7886 |
T11966 |
T11965 |
punct |
-,bp |
| R7887 |
T11967 |
T11898 |
punct |
.,identified |
| R7888 |
T11969 |
T11970 |
nummod |
Three,lines |
| R7889 |
T11970 |
T11971 |
nsubjpass |
lines,established |
| R7890 |
T11972 |
T11970 |
prep |
of,lines |
| R7891 |
T11973 |
T11974 |
compound |
Gdf5,Cre |
| R7892 |
T11974 |
T11976 |
compound |
Cre,mice |
| R7893 |
T11975 |
T11974 |
punct |
-,Cre |
| R7894 |
T11976 |
T11972 |
pobj |
mice,of |
| R7895 |
T11977 |
T11971 |
auxpass |
were,established |
| R7896 |
T11978 |
T11971 |
cc |
and,established |
| R7897 |
T11979 |
T11971 |
conj |
maintained,established |
| R7898 |
T11980 |
T11979 |
prep |
on,maintained |
| R7899 |
T11981 |
T11982 |
det |
the,background |
| R7900 |
T11982 |
T11980 |
pobj |
background,on |
| R7901 |
T11983 |
T11982 |
compound |
FVB,background |
| R7902 |
T11984 |
T11971 |
punct |
.,established |
| R7903 |
T11986 |
T11987 |
nsubjpass |
Matings,used |
| R7904 |
T11988 |
T11986 |
prep |
with,Matings |
| R7905 |
T11989 |
T11990 |
compound |
R26R,Cre |
| R7906 |
T11990 |
T11991 |
npadvmod |
Cre,inducible |
| R7907 |
T11991 |
T11993 |
amod |
inducible,mice |
| R7908 |
T11992 |
T11991 |
punct |
-,inducible |
| R7909 |
T11993 |
T11988 |
pobj |
mice,with |
| R7910 |
T11994 |
T11995 |
compound |
LACZ,reporter |
| R7911 |
T11995 |
T11993 |
compound |
reporter,mice |
| R7912 |
T11996 |
T11997 |
punct |
(,Soriano |
| R7913 |
T11997 |
T11993 |
meta |
Soriano,mice |
| R7914 |
T11998 |
T11997 |
nummod |
1999,Soriano |
| R7915 |
T11999 |
T11997 |
punct |
),Soriano |
| R7916 |
T12000 |
T11987 |
auxpass |
were,used |
| R7917 |
T12001 |
T12002 |
aux |
to,test |
| R7918 |
T12002 |
T11987 |
advcl |
test,used |
| R7919 |
T12003 |
T12002 |
prep |
for,test |
| R7920 |
T12004 |
T12005 |
compound |
Cre,activity |
| R7921 |
T12005 |
T12003 |
pobj |
activity,for |
| R7922 |
T12006 |
T11987 |
punct |
.,used |
| R7923 |
T12008 |
T12009 |
nsubjpass |
Staining,accomplished |
| R7924 |
T12010 |
T12008 |
prep |
for,Staining |
| R7925 |
T12011 |
T12010 |
pobj |
LACZ,for |
| R7926 |
T12012 |
T12011 |
cc |
and,LACZ |
| R7927 |
T12013 |
T12011 |
conj |
HPLAP,LACZ |
| R7928 |
T12014 |
T12008 |
prep |
on,Staining |
| R7929 |
T12015 |
T12016 |
amod |
whole,embryos |
| R7930 |
T12016 |
T12014 |
pobj |
embryos,on |
| R7931 |
T12017 |
T12016 |
cc |
or,embryos |
| R7932 |
T12018 |
T12016 |
conj |
sections,embryos |
| R7933 |
T12019 |
T12018 |
prep |
of,sections |
| R7934 |
T12020 |
T12019 |
pobj |
embryos,of |
| R7935 |
T12021 |
T12009 |
auxpass |
was,accomplished |
| R7936 |
T12022 |
T12009 |
advcl |
following,accomplished |
| R7937 |
T12023 |
T12024 |
amod |
established,protocols |
| R7938 |
T12024 |
T12022 |
dobj |
protocols,following |
| R7939 |
T12025 |
T12026 |
punct |
(,Lobe |
| R7940 |
T12026 |
T12009 |
meta |
Lobe,accomplished |
| R7941 |
T12027 |
T12026 |
nmod |
et,Lobe |
| R7942 |
T12028 |
T12026 |
nmod |
al.,Lobe |
| R7943 |
T12029 |
T12026 |
nummod |
1999,Lobe |
| R7944 |
T12030 |
T12026 |
punct |
),Lobe |
| R7945 |
T12031 |
T12009 |
punct |
.,accomplished |
| R7946 |
T12033 |
T12034 |
det |
The,substrate |
| R7947 |
T12034 |
T12037 |
nsubj |
substrate,is |
| R7948 |
T12035 |
T12036 |
amod |
red,LACZ |
| R7949 |
T12036 |
T12034 |
compound |
LACZ,substrate |
| R7950 |
T12038 |
T12039 |
punct |
(,see |
| R7951 |
T12039 |
T12034 |
parataxis |
see,substrate |
| R7952 |
T12040 |
T12039 |
dobj |
Figure,see |
| R7953 |
T12041 |
T12040 |
nummod |
1E,Figure |
| R7954 |
T12042 |
T12039 |
punct |
),see |
| R7955 |
T12043 |
T12044 |
nummod |
6,galactopyranoside |
| R7956 |
T12044 |
T12037 |
attr |
galactopyranoside,is |
| R7957 |
T12045 |
T12044 |
punct |
-,galactopyranoside |
| R7958 |
T12046 |
T12044 |
nmod |
chloro,galactopyranoside |
| R7959 |
T12047 |
T12044 |
punct |
-,galactopyranoside |
| R7960 |
T12048 |
T12044 |
nummod |
3,galactopyranoside |
| R7961 |
T12049 |
T12044 |
punct |
-,galactopyranoside |
| R7962 |
T12050 |
T12044 |
compound |
indoxyl,galactopyranoside |
| R7963 |
T12051 |
T12044 |
punct |
-,galactopyranoside |
| R7964 |
T12052 |
T12044 |
compound |
beta,galactopyranoside |
| R7965 |
T12053 |
T12044 |
punct |
-,galactopyranoside |
| R7966 |
T12054 |
T12044 |
compound |
D,galactopyranoside |
| R7967 |
T12055 |
T12044 |
punct |
-,galactopyranoside |
| R7968 |
T12056 |
T12057 |
punct |
(,International |
| R7969 |
T12057 |
T12037 |
parataxis |
International,is |
| R7970 |
T12058 |
T12057 |
compound |
Biosynth,International |
| R7971 |
T12059 |
T12057 |
punct |
", ",International |
| R7972 |
T12060 |
T12057 |
npadvmod |
Naperville,International |
| R7973 |
T12061 |
T12057 |
punct |
", ",International |
| R7974 |
T12062 |
T12057 |
npadvmod |
Illinois,International |
| R7975 |
T12063 |
T12057 |
punct |
", ",International |
| R7976 |
T12064 |
T12065 |
compound |
United,States |
| R7977 |
T12065 |
T12057 |
npadvmod |
States,International |
| R7978 |
T12066 |
T12057 |
punct |
),International |
| R7979 |
T12067 |
T12037 |
punct |
.,is |
| R7980 |
T12177 |
T12178 |
amod |
General,characterization |
| R7981 |
T12179 |
T12178 |
prep |
of,characterization |
| R7982 |
T12180 |
T12181 |
npadvmod |
Bmpr1a,mutant |
| R7983 |
T12181 |
T12182 |
amod |
mutant,mice |
| R7984 |
T12182 |
T12179 |
pobj |
mice,of |
| R7985 |
T12184 |
T12185 |
npadvmod |
Bmpr1a,null |
| R7986 |
T12185 |
T12186 |
amod |
null,alleles |
| R7987 |
T12186 |
T12189 |
nsubjpass |
alleles,obtained |
| R7988 |
T12187 |
T12185 |
cc |
and,null |
| R7989 |
T12188 |
T12185 |
conj |
floxed,null |
| R7990 |
T12190 |
T12191 |
punct |
(,Ahn |
| R7991 |
T12191 |
T12186 |
meta |
Ahn,alleles |
| R7992 |
T12192 |
T12191 |
nmod |
et,Ahn |
| R7993 |
T12193 |
T12191 |
nmod |
al.,Ahn |
| R7994 |
T12194 |
T12191 |
nummod |
2001,Ahn |
| R7995 |
T12195 |
T12191 |
punct |
;,Ahn |
| R7996 |
T12196 |
T12191 |
nmod |
Mishina,Ahn |
| R7997 |
T12197 |
T12191 |
nmod |
et,Ahn |
| R7998 |
T12198 |
T12191 |
nmod |
al.,Ahn |
| R7999 |
T12199 |
T12191 |
nummod |
2002,Ahn |
| R8000 |
T12200 |
T12191 |
punct |
),Ahn |
| R8001 |
T12201 |
T12189 |
auxpass |
were,obtained |
| R8002 |
T12202 |
T12189 |
prep |
on,obtained |
| R8003 |
T12203 |
T12204 |
det |
a,background |
| R8004 |
T12204 |
T12202 |
pobj |
background,on |
| R8005 |
T12205 |
T12204 |
amod |
mixed,background |
| R8006 |
T12206 |
T12204 |
nummod |
129,background |
| R8007 |
T12207 |
T12206 |
cc |
and,129 |
| R8008 |
T12208 |
T12206 |
conj |
C57BL,129 |
| R8009 |
T12209 |
T12208 |
punct |
/,C57BL |
| R8010 |
T12210 |
T12208 |
nummod |
6,C57BL |
| R8011 |
T12211 |
T12189 |
cc |
and,obtained |
| R8012 |
T12212 |
T12189 |
conj |
maintained,obtained |
| R8013 |
T12213 |
T12212 |
prep |
by,maintained |
| R8014 |
T12214 |
T12215 |
amod |
random,breeding |
| R8015 |
T12215 |
T12213 |
pobj |
breeding,by |
| R8016 |
T12216 |
T12189 |
punct |
.,obtained |
| R8017 |
T12218 |
T12219 |
nsubjpass |
Mice,mated |
| R8018 |
T12220 |
T12218 |
acl |
carrying,Mice |
| R8019 |
T12221 |
T12222 |
det |
the,alleles |
| R8020 |
T12222 |
T12220 |
dobj |
alleles,carrying |
| R8021 |
T12223 |
T12222 |
amod |
null,alleles |
| R8022 |
T12224 |
T12223 |
cc |
and,null |
| R8023 |
T12225 |
T12223 |
conj |
floxed,null |
| R8024 |
T12226 |
T12219 |
auxpass |
were,mated |
| R8025 |
T12227 |
T12219 |
advmod |
typically,mated |
| R8026 |
T12228 |
T12219 |
prep |
to,mated |
| R8027 |
T12229 |
T12230 |
compound |
Gdf5,Cre |
| R8028 |
T12230 |
T12232 |
compound |
Cre,mice |
| R8029 |
T12231 |
T12230 |
punct |
-,Cre |
| R8030 |
T12232 |
T12228 |
pobj |
mice,to |
| R8031 |
T12233 |
T12234 |
mark |
as,shown |
| R8032 |
T12234 |
T12219 |
advcl |
shown,mated |
| R8033 |
T12235 |
T12234 |
prep |
in,shown |
| R8034 |
T12236 |
T12235 |
pobj |
Figure,in |
| R8035 |
T12237 |
T12236 |
nummod |
3,Figure |
| R8036 |
T12238 |
T12219 |
punct |
.,mated |
| R8037 |
T12240 |
T12241 |
det |
The,mice |
| R8038 |
T12241 |
T12243 |
nsubj |
mice,are |
| R8039 |
T12242 |
T12241 |
amod |
resulting,mice |
| R8040 |
T12244 |
T12243 |
prep |
on,are |
| R8041 |
T12245 |
T12246 |
det |
a,background |
| R8042 |
T12246 |
T12244 |
pobj |
background,on |
| R8043 |
T12247 |
T12246 |
amod |
mixed,background |
| R8044 |
T12248 |
T12246 |
nummod |
129,background |
| R8045 |
T12249 |
T12248 |
punct |
;,129 |
| R8046 |
T12250 |
T12248 |
appos |
C57Bl,129 |
| R8047 |
T12251 |
T12250 |
punct |
/,C57Bl |
| R8048 |
T12252 |
T12250 |
nummod |
6,C57Bl |
| R8049 |
T12253 |
T12248 |
punct |
;,129 |
| R8050 |
T12254 |
T12255 |
compound |
FVB,N |
| R8051 |
T12255 |
T12248 |
appos |
N,129 |
| R8052 |
T12256 |
T12255 |
punct |
/,N |
| R8053 |
T12257 |
T12243 |
punct |
", ",are |
| R8054 |
T12258 |
T12259 |
mark |
with,generated |
| R8055 |
T12259 |
T12243 |
advcl |
generated,are |
| R8056 |
T12260 |
T12261 |
preconj |
both,controls |
| R8057 |
T12261 |
T12259 |
nsubj |
controls,generated |
| R8058 |
T12262 |
T12261 |
cc |
and,controls |
| R8059 |
T12263 |
T12264 |
compound |
mutant,animals |
| R8060 |
T12264 |
T12261 |
conj |
animals,controls |
| R8061 |
T12265 |
T12259 |
prep |
as,generated |
| R8062 |
T12266 |
T12265 |
pobj |
littermates,as |
| R8063 |
T12267 |
T12266 |
prep |
from,littermates |
| R8064 |
T12268 |
T12269 |
det |
the,matings |
| R8065 |
T12269 |
T12267 |
pobj |
matings,from |
| R8066 |
T12270 |
T12269 |
amod |
same,matings |
| R8067 |
T12271 |
T12243 |
punct |
.,are |
| R8068 |
T12273 |
T12274 |
amod |
Whole,mount |
| R8069 |
T12274 |
T12276 |
nmod |
mount,preparations |
| R8070 |
T12275 |
T12274 |
punct |
-,mount |
| R8071 |
T12276 |
T12278 |
nsubjpass |
preparations,made |
| R8072 |
T12277 |
T12276 |
amod |
skeletal,preparations |
| R8073 |
T12279 |
T12278 |
auxpass |
were,made |
| R8074 |
T12280 |
T12278 |
prep |
from,made |
| R8075 |
T12281 |
T12282 |
quantmod |
34,36 |
| R8076 |
T12282 |
T12285 |
nummod |
36,d |
| R8077 |
T12283 |
T12282 |
punct |
-,36 |
| R8078 |
T12284 |
T12282 |
quantmod |
to,36 |
| R8079 |
T12285 |
T12287 |
npadvmod |
d,old |
| R8080 |
T12286 |
T12285 |
punct |
-,d |
| R8081 |
T12287 |
T12289 |
amod |
old,mice |
| R8082 |
T12288 |
T12287 |
punct |
-,old |
| R8083 |
T12289 |
T12280 |
pobj |
mice,from |
| R8084 |
T12290 |
T12291 |
punct |
(,Lufkin |
| R8085 |
T12291 |
T12278 |
meta |
Lufkin,made |
| R8086 |
T12292 |
T12291 |
nmod |
et,Lufkin |
| R8087 |
T12293 |
T12291 |
nmod |
al.,Lufkin |
| R8088 |
T12294 |
T12291 |
nummod |
1992,Lufkin |
| R8089 |
T12295 |
T12291 |
punct |
),Lufkin |
| R8090 |
T12296 |
T12278 |
punct |
.,made |
| R8091 |
T12298 |
T12299 |
nsubjpass |
Pairs,removed |
| R8092 |
T12300 |
T12298 |
prep |
of,Pairs |
| R8093 |
T12301 |
T12300 |
pobj |
ears,of |
| R8094 |
T12302 |
T12298 |
prep |
from,Pairs |
| R8095 |
T12303 |
T12304 |
amod |
euthanized,animals |
| R8096 |
T12304 |
T12302 |
pobj |
animals,from |
| R8097 |
T12305 |
T12306 |
nummod |
6,mo |
| R8098 |
T12306 |
T12308 |
npadvmod |
mo,old |
| R8099 |
T12307 |
T12306 |
punct |
-,mo |
| R8100 |
T12308 |
T12304 |
amod |
old,animals |
| R8101 |
T12309 |
T12308 |
punct |
-,old |
| R8102 |
T12310 |
T12299 |
auxpass |
were,removed |
| R8103 |
T12311 |
T12299 |
punct |
", ",removed |
| R8104 |
T12312 |
T12299 |
conj |
pinned,removed |
| R8105 |
T12313 |
T12312 |
punct |
", ",pinned |
| R8106 |
T12314 |
T12312 |
conj |
photographed,pinned |
| R8107 |
T12315 |
T12314 |
punct |
", ",photographed |
| R8108 |
T12316 |
T12314 |
conj |
projected,photographed |
| R8109 |
T12317 |
T12316 |
punct |
", ",projected |
| R8110 |
T12318 |
T12316 |
cc |
and,projected |
| R8111 |
T12319 |
T12316 |
conj |
measured,projected |
| R8112 |
T12320 |
T12319 |
prep |
from,measured |
| R8113 |
T12321 |
T12322 |
det |
the,base |
| R8114 |
T12322 |
T12320 |
pobj |
base,from |
| R8115 |
T12323 |
T12322 |
prep |
of,base |
| R8116 |
T12324 |
T12325 |
det |
the,curve |
| R8117 |
T12325 |
T12323 |
pobj |
curve,of |
| R8118 |
T12326 |
T12325 |
acl |
formed,curve |
| R8119 |
T12327 |
T12326 |
prep |
between,formed |
| R8120 |
T12328 |
T12329 |
det |
the,tragus |
| R8121 |
T12329 |
T12327 |
pobj |
tragus,between |
| R8122 |
T12330 |
T12329 |
cc |
and,tragus |
| R8123 |
T12331 |
T12329 |
conj |
antitragus,tragus |
| R8124 |
T12332 |
T12320 |
prep |
to,from |
| R8125 |
T12333 |
T12334 |
det |
the,point |
| R8126 |
T12334 |
T12332 |
pobj |
point,to |
| R8127 |
T12335 |
T12334 |
amod |
farthest,point |
| R8128 |
T12336 |
T12334 |
prep |
at,point |
| R8129 |
T12337 |
T12338 |
det |
the,edge |
| R8130 |
T12338 |
T12336 |
pobj |
edge,at |
| R8131 |
T12339 |
T12338 |
prep |
of,edge |
| R8132 |
T12340 |
T12341 |
det |
the,pinnae |
| R8133 |
T12341 |
T12339 |
pobj |
pinnae,of |
| R8134 |
T12342 |
T12299 |
punct |
.,removed |
| R8135 |
T12344 |
T12345 |
compound |
Grasping,ability |
| R8136 |
T12345 |
T12346 |
nsubjpass |
ability,measured |
| R8137 |
T12347 |
T12345 |
prep |
in,ability |
| R8138 |
T12348 |
T12349 |
nummod |
6,mo |
| R8139 |
T12349 |
T12351 |
npadvmod |
mo,old |
| R8140 |
T12350 |
T12349 |
punct |
-,mo |
| R8141 |
T12351 |
T12353 |
amod |
old,mice |
| R8142 |
T12352 |
T12351 |
punct |
-,old |
| R8143 |
T12353 |
T12347 |
pobj |
mice,in |
| R8144 |
T12354 |
T12346 |
auxpass |
was,measured |
| R8145 |
T12355 |
T12346 |
prep |
by,measured |
| R8146 |
T12356 |
T12355 |
pcomp |
placing,by |
| R8147 |
T12357 |
T12356 |
dobj |
animals,placing |
| R8148 |
T12358 |
T12356 |
prep |
on,placing |
| R8149 |
T12359 |
T12360 |
det |
a,rod |
| R8150 |
T12360 |
T12358 |
pobj |
rod,on |
| R8151 |
T12361 |
T12360 |
amod |
slender,rod |
| R8152 |
T12362 |
T12356 |
cc |
and,placing |
| R8153 |
T12363 |
T12356 |
conj |
timing,placing |
| R8154 |
T12364 |
T12365 |
advmod |
how,long |
| R8155 |
T12365 |
T12366 |
advmod |
long,remain |
| R8156 |
T12366 |
T12363 |
ccomp |
remain,timing |
| R8157 |
T12367 |
T12366 |
nsubj |
they,remain |
| R8158 |
T12368 |
T12366 |
aux |
could,remain |
| R8159 |
T12369 |
T12366 |
oprd |
suspended,remain |
| R8160 |
T12370 |
T12369 |
prep |
on,suspended |
| R8161 |
T12371 |
T12372 |
det |
the,rod |
| R8162 |
T12372 |
T12370 |
pobj |
rod,on |
| R8163 |
T12373 |
T12363 |
punct |
", ",timing |
| R8164 |
T12374 |
T12363 |
prep |
to,timing |
| R8165 |
T12375 |
T12376 |
det |
a,time |
| R8166 |
T12376 |
T12374 |
pobj |
time,to |
| R8167 |
T12377 |
T12376 |
amod |
maximum,time |
| R8168 |
T12378 |
T12376 |
acl |
allowed,time |
| R8169 |
T12379 |
T12376 |
prep |
of,time |
| R8170 |
T12380 |
T12381 |
nummod |
2,min |
| R8171 |
T12381 |
T12379 |
pobj |
min,of |
| R8172 |
T12382 |
T12346 |
punct |
.,measured |
| R8173 |
T12384 |
T12385 |
nsubjpass |
Data,averaged |
| R8174 |
T12386 |
T12384 |
prep |
from,Data |
| R8175 |
T12387 |
T12388 |
nummod |
five,trials |
| R8176 |
T12388 |
T12386 |
pobj |
trials,from |
| R8177 |
T12389 |
T12388 |
amod |
consecutive,trials |
| R8178 |
T12390 |
T12388 |
prep |
for,trials |
| R8179 |
T12391 |
T12392 |
det |
each,mouse |
| R8180 |
T12392 |
T12390 |
pobj |
mouse,for |
| R8181 |
T12393 |
T12385 |
auxpass |
were,averaged |
| R8182 |
T12394 |
T12385 |
punct |
.,averaged |
| R8183 |
T12396 |
T12397 |
nmod |
Range,assays |
| R8184 |
T12397 |
T12400 |
nsubjpass |
assays,conducted |
| R8185 |
T12398 |
T12396 |
prep |
of,Range |
| R8186 |
T12399 |
T12398 |
pobj |
motion,of |
| R8187 |
T12401 |
T12400 |
auxpass |
were,conducted |
| R8188 |
T12402 |
T12400 |
prep |
on,conducted |
| R8189 |
T12403 |
T12404 |
det |
the,joints |
| R8190 |
T12404 |
T12402 |
pobj |
joints,on |
| R8191 |
T12405 |
T12406 |
nmod |
MT,P1 |
| R8192 |
T12406 |
T12404 |
nmod |
P1,joints |
| R8193 |
T12407 |
T12406 |
punct |
/,P1 |
| R8194 |
T12408 |
T12406 |
cc |
and,P1 |
| R8195 |
T12409 |
T12410 |
compound |
P1,P2 |
| R8196 |
T12410 |
T12406 |
conj |
P2,P1 |
| R8197 |
T12411 |
T12410 |
punct |
/,P2 |
| R8198 |
T12412 |
T12404 |
prep |
of,joints |
| R8199 |
T12413 |
T12414 |
det |
the,digit |
| R8200 |
T12414 |
T12412 |
pobj |
digit,of |
| R8201 |
T12415 |
T12414 |
amod |
second,digit |
| R8202 |
T12416 |
T12414 |
compound |
hindlimb,digit |
| R8203 |
T12417 |
T12404 |
prep |
from,joints |
| R8204 |
T12418 |
T12419 |
amod |
euthanized,animals |
| R8205 |
T12419 |
T12417 |
pobj |
animals,from |
| R8206 |
T12420 |
T12421 |
nummod |
18,wk |
| R8207 |
T12421 |
T12423 |
npadvmod |
wk,old |
| R8208 |
T12422 |
T12421 |
punct |
-,wk |
| R8209 |
T12423 |
T12419 |
amod |
old,animals |
| R8210 |
T12424 |
T12423 |
punct |
-,old |
| R8211 |
T12425 |
T12400 |
punct |
.,conducted |
| R8212 |
T12427 |
T12428 |
nsubjpass |
Forceps,used |
| R8213 |
T12429 |
T12428 |
auxpass |
were,used |
| R8214 |
T12430 |
T12431 |
aux |
to,bend |
| R8215 |
T12431 |
T12428 |
advcl |
bend,used |
| R8216 |
T12432 |
T12433 |
det |
the,joint |
| R8217 |
T12433 |
T12431 |
dobj |
joint,bend |
| R8218 |
T12434 |
T12431 |
prep |
to,bend |
| R8219 |
T12435 |
T12436 |
poss |
its,position |
| R8220 |
T12436 |
T12434 |
pobj |
position,to |
| R8221 |
T12437 |
T12436 |
amod |
natural,position |
| R8222 |
T12438 |
T12436 |
compound |
stopping,position |
| R8223 |
T12439 |
T12428 |
punct |
", ",used |
| R8224 |
T12440 |
T12428 |
cc |
and,used |
| R8225 |
T12441 |
T12442 |
det |
the,angle |
| R8226 |
T12442 |
T12444 |
nsubjpass |
angle,measured |
| R8227 |
T12443 |
T12442 |
amod |
resulting,angle |
| R8228 |
T12444 |
T12428 |
conj |
measured,used |
| R8229 |
T12445 |
T12444 |
auxpass |
was,measured |
| R8230 |
T12446 |
T12444 |
prep |
to,measured |
| R8231 |
T12447 |
T12448 |
det |
the,° |
| R8232 |
T12448 |
T12446 |
pobj |
°,to |
| R8233 |
T12449 |
T12448 |
amod |
nearest,° |
| R8234 |
T12450 |
T12448 |
nummod |
10,° |
| R8235 |
T12451 |
T12444 |
prep |
under,measured |
| R8236 |
T12452 |
T12453 |
nummod |
12.5,magnification |
| R8237 |
T12453 |
T12451 |
pobj |
magnification,under |
| R8238 |
T12454 |
T12452 |
punct |
×,12.5 |
| R8239 |
T12455 |
T12444 |
advcl |
using,measured |
| R8240 |
T12456 |
T12457 |
det |
a,reticule |
| R8241 |
T12457 |
T12455 |
dobj |
reticule,using |
| R8242 |
T12458 |
T12459 |
nummod |
360,° |
| R8243 |
T12459 |
T12457 |
compound |
°,reticule |
| R8244 |
T12460 |
T12444 |
punct |
.,measured |
| R8245 |
T12462 |
T12463 |
nsubj |
Analysis,occurred |
| R8246 |
T12464 |
T12462 |
acl |
described,Analysis |
| R8247 |
T12465 |
T12464 |
prep |
in,described |
| R8248 |
T12466 |
T12467 |
det |
this,section |
| R8249 |
T12467 |
T12465 |
pobj |
section,in |
| R8250 |
T12468 |
T12463 |
prep |
on,occurred |
| R8251 |
T12469 |
T12468 |
pobj |
animals,on |
| R8252 |
T12470 |
T12469 |
acl |
lacking,animals |
| R8253 |
T12471 |
T12470 |
dobj |
R26R,lacking |
| R8254 |
T12472 |
T12463 |
punct |
.,occurred |
| R8255 |
T12474 |
T12475 |
compound |
Control,mice |
| R8256 |
T12475 |
T12476 |
nsubj |
mice,included |
| R8257 |
T12477 |
T12478 |
det |
all,genotypes |
| R8258 |
T12478 |
T12476 |
dobj |
genotypes,included |
| R8259 |
T12479 |
T12478 |
amod |
nonmutant,genotypes |
| R8260 |
T12480 |
T12478 |
acl |
generated,genotypes |
| R8261 |
T12481 |
T12480 |
prep |
by,generated |
| R8262 |
T12482 |
T12483 |
nsubj |
Parent,being |
| R8263 |
T12483 |
T12481 |
pobj |
being,by |
| R8264 |
T12484 |
T12482 |
nummod |
1,Parent |
| R8265 |
T12485 |
T12483 |
acomp |
heterozygous,being |
| R8266 |
T12486 |
T12485 |
prep |
for,heterozygous |
| R8267 |
T12487 |
T12488 |
compound |
Gdf5,Cre |
| R8268 |
T12488 |
T12486 |
pobj |
Cre,for |
| R8269 |
T12489 |
T12488 |
punct |
-,Cre |
| R8270 |
T12490 |
T12488 |
cc |
and,Cre |
| R8271 |
T12491 |
T12488 |
conj |
Bmpr1anull,Cre |
| R8272 |
T12492 |
T12483 |
cc |
and,being |
| R8273 |
T12493 |
T12494 |
nsubj |
Parent,being |
| R8274 |
T12494 |
T12483 |
conj |
being,being |
| R8275 |
T12495 |
T12493 |
nummod |
2,Parent |
| R8276 |
T12496 |
T12494 |
acomp |
heterozygous,being |
| R8277 |
T12497 |
T12496 |
prep |
for,heterozygous |
| R8278 |
T12498 |
T12497 |
pobj |
Bmpr1afloxP,for |
| R8279 |
T12499 |
T12500 |
punct |
(,see |
| R8280 |
T12500 |
T12494 |
parataxis |
see,being |
| R8281 |
T12501 |
T12500 |
dobj |
Figure,see |
| R8282 |
T12502 |
T12501 |
nummod |
3,Figure |
| R8283 |
T12503 |
T12500 |
punct |
),see |
| R8284 |
T12504 |
T12476 |
punct |
.,included |
| R8285 |
T12506 |
T12507 |
det |
All,analysis |
| R8286 |
T12507 |
T12509 |
nsubj |
analysis,used |
| R8287 |
T12508 |
T12507 |
amod |
statistical,analysis |
| R8288 |
T12510 |
T12511 |
det |
the,Student |
| R8289 |
T12511 |
T12512 |
poss |
Student,test |
| R8290 |
T12512 |
T12509 |
dobj |
test,used |
| R8291 |
T12513 |
T12511 |
case |
's,Student |
| R8292 |
T12514 |
T12512 |
compound |
t,test |
| R8293 |
T12515 |
T12512 |
punct |
-,test |
| R8294 |
T12516 |
T12512 |
cc |
or,test |
| R8295 |
T12517 |
T12518 |
poss |
Welch,test |
| R8296 |
T12518 |
T12512 |
conj |
test,test |
| R8297 |
T12519 |
T12517 |
case |
's,Welch |
| R8298 |
T12520 |
T12518 |
compound |
t,test |
| R8299 |
T12521 |
T12518 |
punct |
-,test |
| R8300 |
T12522 |
T12509 |
punct |
", ",used |
| R8301 |
T12523 |
T12509 |
cc |
and,used |
| R8302 |
T12524 |
T12525 |
nsubj |
values,are |
| R8303 |
T12525 |
T12509 |
conj |
are,used |
| R8304 |
T12526 |
T12524 |
acl |
listed,values |
| R8305 |
T12527 |
T12525 |
attr |
mean,are |
| R8306 |
T12528 |
T12527 |
punct |
±,mean |
| R8307 |
T12529 |
T12530 |
amod |
standard,error |
| R8308 |
T12530 |
T12527 |
appos |
error,mean |
| R8309 |
T12531 |
T12530 |
prep |
of,error |
| R8310 |
T12532 |
T12533 |
det |
the,mean |
| R8311 |
T12533 |
T12531 |
pobj |
mean,of |
| R8312 |
T12534 |
T12525 |
punct |
.,are |
| R8319 |
T12651 |
T12652 |
compound |
Cell,death |
| R8320 |
T12653 |
T12652 |
cc |
and,death |
| R8321 |
T12654 |
T12655 |
compound |
proliferation,assays |
| R8322 |
T12655 |
T12652 |
conj |
assays,death |
| R8323 |
T12657 |
T12658 |
nsubjpass |
Limbs,dissected |
| R8324 |
T12659 |
T12657 |
prep |
from,Limbs |
| R8325 |
T12660 |
T12661 |
amod |
mutant,animals |
| R8326 |
T12661 |
T12659 |
pobj |
animals,from |
| R8327 |
T12662 |
T12660 |
cc |
and,mutant |
| R8328 |
T12663 |
T12660 |
conj |
control,mutant |
| R8329 |
T12664 |
T12657 |
prep |
at,Limbs |
| R8330 |
T12665 |
T12664 |
pobj |
E13.5,at |
| R8331 |
T12666 |
T12665 |
cc |
and,E13.5 |
| R8332 |
T12667 |
T12665 |
conj |
E14.5,E13.5 |
| R8333 |
T12668 |
T12658 |
auxpass |
were,dissected |
| R8334 |
T12669 |
T12658 |
cc |
and,dissected |
| R8335 |
T12670 |
T12658 |
conj |
frozen,dissected |
| R8336 |
T12671 |
T12670 |
prep |
in,frozen |
| R8337 |
T12672 |
T12671 |
pobj |
OCT,in |
| R8338 |
T12673 |
T12674 |
punct |
(,Finetek |
| R8339 |
T12674 |
T12670 |
parataxis |
Finetek,frozen |
| R8340 |
T12675 |
T12674 |
compound |
Sakura,Finetek |
| R8341 |
T12676 |
T12674 |
punct |
",",Finetek |
| R8342 |
T12677 |
T12674 |
npadvmod |
Torrence,Finetek |
| R8343 |
T12678 |
T12674 |
punct |
", ",Finetek |
| R8344 |
T12679 |
T12674 |
npadvmod |
CA,Finetek |
| R8345 |
T12680 |
T12674 |
punct |
", ",Finetek |
| R8346 |
T12681 |
T12682 |
compound |
United,States |
| R8347 |
T12682 |
T12674 |
npadvmod |
States,Finetek |
| R8348 |
T12683 |
T12674 |
punct |
),Finetek |
| R8349 |
T12684 |
T12658 |
punct |
.,dissected |
| R8350 |
T12686 |
T12687 |
nsubjpass |
Cryosections,assayed |
| R8351 |
T12688 |
T12686 |
prep |
of,Cryosections |
| R8352 |
T12689 |
T12688 |
pobj |
tissue,of |
| R8353 |
T12690 |
T12687 |
auxpass |
were,assayed |
| R8354 |
T12691 |
T12687 |
prep |
by,assayed |
| R8355 |
T12692 |
T12691 |
pobj |
TUNEL,by |
| R8356 |
T12693 |
T12687 |
advcl |
using,assayed |
| R8357 |
T12694 |
T12695 |
det |
the,Kit |
| R8358 |
T12695 |
T12693 |
dobj |
Kit,using |
| R8359 |
T12696 |
T12697 |
advmod |
In,Situ |
| R8360 |
T12697 |
T12698 |
amod |
Situ,Detection |
| R8361 |
T12698 |
T12695 |
compound |
Detection,Kit |
| R8362 |
T12699 |
T12700 |
compound |
Cell,Death |
| R8363 |
T12700 |
T12698 |
compound |
Death,Detection |
| R8364 |
T12701 |
T12695 |
punct |
", ",Kit |
| R8365 |
T12702 |
T12695 |
npadvmod |
Fluorescein,Kit |
| R8366 |
T12703 |
T12702 |
punct |
(,Fluorescein |
| R8367 |
T12704 |
T12702 |
npadvmod |
Roche,Fluorescein |
| R8368 |
T12705 |
T12702 |
punct |
", ",Fluorescein |
| R8369 |
T12706 |
T12702 |
npadvmod |
Basel,Fluorescein |
| R8370 |
T12707 |
T12702 |
punct |
", ",Fluorescein |
| R8371 |
T12708 |
T12702 |
npadvmod |
Switzerland,Fluorescein |
| R8372 |
T12709 |
T12702 |
punct |
),Fluorescein |
| R8373 |
T12710 |
T12687 |
punct |
.,assayed |
| R8374 |
T12712 |
T12713 |
prep |
Following,washed |
| R8375 |
T12714 |
T12712 |
pobj |
TUNEL,Following |
| R8376 |
T12715 |
T12713 |
punct |
", ",washed |
| R8377 |
T12716 |
T12713 |
nsubjpass |
slides,washed |
| R8378 |
T12717 |
T12713 |
auxpass |
were,washed |
| R8379 |
T12718 |
T12713 |
prep |
in,washed |
| R8380 |
T12719 |
T12718 |
pobj |
PBS,in |
| R8381 |
T12720 |
T12713 |
punct |
", ",washed |
| R8382 |
T12721 |
T12713 |
conj |
blocked,washed |
| R8383 |
T12722 |
T12721 |
prep |
with,blocked |
| R8384 |
T12723 |
T12722 |
pobj |
PBS,with |
| R8385 |
T12724 |
T12723 |
punct |
+,PBS |
| R8386 |
T12725 |
T12726 |
nummod |
0.05,% |
| R8387 |
T12726 |
T12727 |
compound |
%,Tween |
| R8388 |
T12727 |
T12723 |
appos |
Tween,PBS |
| R8389 |
T12728 |
T12727 |
punct |
-,Tween |
| R8390 |
T12729 |
T12727 |
nummod |
20,Tween |
| R8391 |
T12730 |
T12723 |
punct |
+,PBS |
| R8392 |
T12731 |
T12732 |
nummod |
5,% |
| R8393 |
T12732 |
T12733 |
compound |
%,serum |
| R8394 |
T12733 |
T12723 |
appos |
serum,PBS |
| R8395 |
T12734 |
T12733 |
compound |
goat,serum |
| R8396 |
T12735 |
T12721 |
punct |
", ",blocked |
| R8397 |
T12736 |
T12721 |
conj |
washed,blocked |
| R8398 |
T12737 |
T12736 |
advmod |
again,washed |
| R8399 |
T12738 |
T12736 |
punct |
", ",washed |
| R8400 |
T12739 |
T12736 |
cc |
and,washed |
| R8401 |
T12740 |
T12736 |
conj |
incubated,washed |
| R8402 |
T12741 |
T12740 |
prep |
with,incubated |
| R8403 |
T12742 |
T12743 |
det |
a,dilution |
| R8404 |
T12743 |
T12741 |
pobj |
dilution,with |
| R8405 |
T12744 |
T12743 |
nummod |
1,dilution |
| R8406 |
T12745 |
T12746 |
punct |
:,200 |
| R8407 |
T12746 |
T12744 |
prep |
200,1 |
| R8408 |
T12747 |
T12743 |
prep |
of,dilution |
| R8409 |
T12748 |
T12749 |
det |
a,antibody |
| R8410 |
T12749 |
T12747 |
pobj |
antibody,of |
| R8411 |
T12750 |
T12749 |
nmod |
rabbit,antibody |
| R8412 |
T12751 |
T12752 |
amod |
anti-phospho-histone,H3 |
| R8413 |
T12752 |
T12749 |
compound |
H3,antibody |
| R8414 |
T12753 |
T12752 |
punct |
-,H3 |
| R8415 |
T12754 |
T12749 |
acl |
called,antibody |
| R8416 |
T12755 |
T12756 |
compound |
Mitosis,Marker |
| R8417 |
T12756 |
T12754 |
oprd |
Marker,called |
| R8418 |
T12757 |
T12758 |
punct |
(,Biotechnology |
| R8419 |
T12758 |
T12756 |
parataxis |
Biotechnology,Marker |
| R8420 |
T12759 |
T12758 |
compound |
Upstate,Biotechnology |
| R8421 |
T12760 |
T12758 |
punct |
", ",Biotechnology |
| R8422 |
T12761 |
T12762 |
compound |
Lake,Placid |
| R8423 |
T12762 |
T12758 |
npadvmod |
Placid,Biotechnology |
| R8424 |
T12763 |
T12758 |
punct |
", ",Biotechnology |
| R8425 |
T12764 |
T12765 |
compound |
New,York |
| R8426 |
T12765 |
T12758 |
npadvmod |
York,Biotechnology |
| R8427 |
T12766 |
T12758 |
punct |
", ",Biotechnology |
| R8428 |
T12767 |
T12768 |
compound |
United,States |
| R8429 |
T12768 |
T12758 |
npadvmod |
States,Biotechnology |
| R8430 |
T12769 |
T12758 |
punct |
),Biotechnology |
| R8431 |
T12770 |
T12771 |
aux |
to,identify |
| R8432 |
T12771 |
T12740 |
advcl |
identify,incubated |
| R8433 |
T12772 |
T12771 |
dobj |
cells,identify |
| R8434 |
T12773 |
T12772 |
prep |
in,cells |
| R8435 |
T12774 |
T12773 |
pobj |
mitosis,in |
| R8436 |
T12775 |
T12713 |
punct |
.,washed |
| R8437 |
T12777 |
T12778 |
npadvmod |
Cy3,labeled |
| R8438 |
T12778 |
T12780 |
amod |
labeled,antibody |
| R8439 |
T12779 |
T12778 |
punct |
-,labeled |
| R8440 |
T12780 |
T12783 |
nsubjpass |
antibody,used |
| R8441 |
T12781 |
T12780 |
amod |
anti-rabbit,antibody |
| R8442 |
T12782 |
T12780 |
amod |
secondary,antibody |
| R8443 |
T12784 |
T12783 |
auxpass |
was,used |
| R8444 |
T12785 |
T12786 |
aux |
to,detect |
| R8445 |
T12786 |
T12783 |
advcl |
detect,used |
| R8446 |
T12787 |
T12788 |
det |
the,antibody |
| R8447 |
T12788 |
T12786 |
dobj |
antibody,detect |
| R8448 |
T12789 |
T12783 |
punct |
.,used |
| R8449 |
T12791 |
T12792 |
compound |
Cell,nuclei |
| R8450 |
T12792 |
T12793 |
nsubjpass |
nuclei,labeled |
| R8451 |
T12794 |
T12793 |
auxpass |
were,labeled |
| R8452 |
T12795 |
T12793 |
prep |
with,labeled |
| R8453 |
T12796 |
T12795 |
pobj |
DAPI,with |
| R8454 |
T12797 |
T12793 |
punct |
", ",labeled |
| R8455 |
T12798 |
T12793 |
cc |
and,labeled |
| R8456 |
T12799 |
T12800 |
nsubjpass |
slides,mounted |
| R8457 |
T12800 |
T12793 |
conj |
mounted,labeled |
| R8458 |
T12801 |
T12800 |
auxpass |
were,mounted |
| R8459 |
T12802 |
T12800 |
prep |
in,mounted |
| R8460 |
T12803 |
T12802 |
pobj |
Vectamount,in |
| R8461 |
T12804 |
T12805 |
punct |
(,Laboratories |
| R8462 |
T12805 |
T12803 |
parataxis |
Laboratories,Vectamount |
| R8463 |
T12806 |
T12805 |
compound |
Vector,Laboratories |
| R8464 |
T12807 |
T12805 |
punct |
", ",Laboratories |
| R8465 |
T12808 |
T12805 |
npadvmod |
Burlingame,Laboratories |
| R8466 |
T12809 |
T12805 |
punct |
", ",Laboratories |
| R8467 |
T12810 |
T12805 |
npadvmod |
California,Laboratories |
| R8468 |
T12811 |
T12805 |
punct |
", ",Laboratories |
| R8469 |
T12812 |
T12813 |
compound |
United,States |
| R8470 |
T12813 |
T12805 |
npadvmod |
States,Laboratories |
| R8471 |
T12814 |
T12805 |
punct |
),Laboratories |
| R8472 |
T12815 |
T12800 |
cc |
and,mounted |
| R8473 |
T12816 |
T12800 |
conj |
visualized,mounted |
| R8474 |
T12817 |
T12816 |
prep |
at,visualized |
| R8475 |
T12818 |
T12819 |
nummod |
100,magnification |
| R8476 |
T12819 |
T12817 |
pobj |
magnification,at |
| R8477 |
T12820 |
T12818 |
punct |
×,100 |
| R8478 |
T12821 |
T12800 |
punct |
.,mounted |
| R8479 |
T12823 |
T12824 |
det |
The,area |
| R8480 |
T12824 |
T12825 |
nsubjpass |
area,measured |
| R8481 |
T12826 |
T12824 |
prep |
of,area |
| R8482 |
T12827 |
T12828 |
amod |
selected,sites |
| R8483 |
T12828 |
T12826 |
pobj |
sites,of |
| R8484 |
T12829 |
T12828 |
amod |
anatomical,sites |
| R8485 |
T12830 |
T12825 |
auxpass |
were,measured |
| R8486 |
T12831 |
T12825 |
punct |
", ",measured |
| R8487 |
T12832 |
T12825 |
cc |
and,measured |
| R8488 |
T12833 |
T12834 |
det |
the,number |
| R8489 |
T12834 |
T12835 |
nsubjpass |
number,counted |
| R8490 |
T12835 |
T12825 |
conj |
counted,measured |
| R8491 |
T12836 |
T12834 |
prep |
of,number |
| R8492 |
T12837 |
T12838 |
npadvmod |
TUNEL,labeled |
| R8493 |
T12838 |
T12840 |
amod |
labeled,fragments |
| R8494 |
T12839 |
T12838 |
punct |
-,labeled |
| R8495 |
T12840 |
T12836 |
pobj |
fragments,of |
| R8496 |
T12841 |
T12840 |
amod |
nuclear,fragments |
| R8497 |
T12842 |
T12834 |
cc |
and,number |
| R8498 |
T12843 |
T12844 |
det |
the,number |
| R8499 |
T12844 |
T12834 |
conj |
number,number |
| R8500 |
T12845 |
T12844 |
prep |
of,number |
| R8501 |
T12846 |
T12847 |
npadvmod |
Cy3,labeled |
| R8502 |
T12847 |
T12849 |
amod |
labeled,nuclei |
| R8503 |
T12848 |
T12847 |
punct |
-,labeled |
| R8504 |
T12849 |
T12845 |
pobj |
nuclei,of |
| R8505 |
T12850 |
T12835 |
auxpass |
were,counted |
| R8506 |
T12851 |
T12835 |
prep |
from,counted |
| R8507 |
T12852 |
T12853 |
nummod |
three,sections |
| R8508 |
T12853 |
T12851 |
pobj |
sections,from |
| R8509 |
T12854 |
T12855 |
nummod |
10,μm |
| R8510 |
T12855 |
T12853 |
compound |
μm,sections |
| R8511 |
T12856 |
T12855 |
punct |
-,μm |
| R8512 |
T12857 |
T12853 |
acl |
spanning,sections |
| R8513 |
T12858 |
T12859 |
nummod |
50,μm |
| R8514 |
T12859 |
T12857 |
dobj |
μm,spanning |
| R8515 |
T12860 |
T12853 |
punct |
", ",sections |
| R8516 |
T12861 |
T12853 |
prep |
from,sections |
| R8517 |
T12862 |
T12863 |
nummod |
three,control |
| R8518 |
T12863 |
T12861 |
pobj |
control,from |
| R8519 |
T12864 |
T12863 |
cc |
and,control |
| R8520 |
T12865 |
T12866 |
nummod |
three,mutant |
| R8521 |
T12866 |
T12867 |
compound |
mutant,animals |
| R8522 |
T12867 |
T12863 |
conj |
animals,control |
| R8523 |
T12868 |
T12835 |
punct |
.,counted |
| R8524 |
T12870 |
T12871 |
det |
The,number |
| R8525 |
T12871 |
T12872 |
nsubjpass |
number,counted |
| R8526 |
T12873 |
T12871 |
prep |
of,number |
| R8527 |
T12874 |
T12875 |
amod |
labeled,cells |
| R8528 |
T12875 |
T12873 |
pobj |
cells,of |
| R8529 |
T12876 |
T12871 |
prep |
in,number |
| R8530 |
T12877 |
T12878 |
det |
the,joints |
| R8531 |
T12878 |
T12876 |
pobj |
joints,in |
| R8532 |
T12879 |
T12880 |
amod |
metacarpal,phalangeal |
| R8533 |
T12880 |
T12878 |
amod |
phalangeal,joints |
| R8534 |
T12881 |
T12880 |
punct |
-,phalangeal |
| R8535 |
T12882 |
T12880 |
cc |
and,phalangeal |
| R8536 |
T12883 |
T12884 |
amod |
metatarsal,phalangeal |
| R8537 |
T12884 |
T12880 |
conj |
phalangeal,phalangeal |
| R8538 |
T12885 |
T12884 |
punct |
-,phalangeal |
| R8539 |
T12886 |
T12872 |
auxpass |
was,counted |
| R8540 |
T12887 |
T12872 |
prep |
in,counted |
| R8541 |
T12888 |
T12889 |
det |
a,rectangle |
| R8542 |
T12889 |
T12887 |
pobj |
rectangle,in |
| R8543 |
T12890 |
T12891 |
nummod |
290,μm |
| R8544 |
T12891 |
T12889 |
nmod |
μm,rectangle |
| R8545 |
T12892 |
T12893 |
punct |
×,μm |
| R8546 |
T12893 |
T12891 |
prep |
μm,μm |
| R8547 |
T12894 |
T12893 |
nummod |
365,μm |
| R8548 |
T12895 |
T12889 |
acl |
placed,rectangle |
| R8549 |
T12896 |
T12895 |
prep |
around,placed |
| R8550 |
T12897 |
T12898 |
det |
the,center |
| R8551 |
T12898 |
T12896 |
pobj |
center,around |
| R8552 |
T12899 |
T12898 |
prep |
of,center |
| R8553 |
T12900 |
T12901 |
det |
the,joint |
| R8554 |
T12901 |
T12899 |
pobj |
joint,of |
| R8555 |
T12902 |
T12872 |
punct |
.,counted |
| R8556 |
T12904 |
T12905 |
det |
The,region |
| R8557 |
T12905 |
T12907 |
nsubjpass |
region,defined |
| R8558 |
T12906 |
T12905 |
amod |
posterior,region |
| R8559 |
T12908 |
T12905 |
prep |
of,region |
| R8560 |
T12909 |
T12910 |
det |
the,digit |
| R8561 |
T12910 |
T12908 |
pobj |
digit,of |
| R8562 |
T12911 |
T12910 |
amod |
fifth,digit |
| R8563 |
T12912 |
T12907 |
auxpass |
was,defined |
| R8564 |
T12913 |
T12907 |
prep |
by,defined |
| R8565 |
T12914 |
T12913 |
pcomp |
drawing,by |
| R8566 |
T12915 |
T12916 |
det |
a,line |
| R8567 |
T12916 |
T12914 |
dobj |
line,drawing |
| R8568 |
T12917 |
T12914 |
prep |
from,drawing |
| R8569 |
T12918 |
T12919 |
det |
the,tip |
| R8570 |
T12919 |
T12917 |
pobj |
tip,from |
| R8571 |
T12920 |
T12919 |
prep |
of,tip |
| R8572 |
T12921 |
T12922 |
det |
the,digit |
| R8573 |
T12922 |
T12920 |
pobj |
digit,of |
| R8574 |
T12923 |
T12914 |
prep |
down,drawing |
| R8575 |
T12924 |
T12925 |
nummod |
2.15,mm |
| R8576 |
T12925 |
T12923 |
pobj |
mm,down |
| R8577 |
T12926 |
T12923 |
cc |
and,down |
| R8578 |
T12927 |
T12923 |
conj |
across,down |
| R8579 |
T12928 |
T12927 |
prep |
to,across |
| R8580 |
T12929 |
T12930 |
det |
the,edge |
| R8581 |
T12930 |
T12928 |
pobj |
edge,to |
| R8582 |
T12931 |
T12930 |
amod |
lateral,edge |
| R8583 |
T12932 |
T12930 |
prep |
of,edge |
| R8584 |
T12933 |
T12934 |
det |
the,tissue |
| R8585 |
T12934 |
T12932 |
pobj |
tissue,of |
| R8586 |
T12935 |
T12907 |
punct |
.,defined |
| R8587 |
T12937 |
T12938 |
prep |
For,was |
| R8588 |
T12939 |
T12940 |
det |
this,analysis |
| R8589 |
T12940 |
T12937 |
pobj |
analysis,For |
| R8590 |
T12941 |
T12938 |
punct |
", ",was |
| R8591 |
T12942 |
T12943 |
det |
the,reporter |
| R8592 |
T12943 |
T12938 |
nsubj |
reporter,was |
| R8593 |
T12944 |
T12945 |
compound |
R26R,Cre |
| R8594 |
T12945 |
T12943 |
compound |
Cre,reporter |
| R8595 |
T12946 |
T12938 |
neg |
not,was |
| R8596 |
T12947 |
T12938 |
acomp |
present,was |
| R8597 |
T12948 |
T12938 |
punct |
.,was |
| R8598 |
T13138 |
T13137 |
cc |
and,Histology |
| R8599 |
T13139 |
T13137 |
conj |
histochemistry,Histology |
| R8600 |
T13141 |
T13142 |
nsubjpass |
Tissue,prepared |
| R8601 |
T13143 |
T13141 |
prep |
from,Tissue |
| R8602 |
T13144 |
T13143 |
pobj |
animals,from |
| R8603 |
T13145 |
T13144 |
acl |
ranging,animals |
| R8604 |
T13146 |
T13145 |
prep |
from,ranging |
| R8605 |
T13147 |
T13148 |
compound |
stages,E14.5 |
| R8606 |
T13148 |
T13146 |
pobj |
E14.5,from |
| R8607 |
T13149 |
T13146 |
prep |
to,from |
| R8608 |
T13150 |
T13149 |
pobj |
P14,to |
| R8609 |
T13151 |
T13142 |
auxpass |
was,prepared |
| R8610 |
T13152 |
T13142 |
prep |
for,prepared |
| R8611 |
T13153 |
T13152 |
pobj |
analysis,for |
| R8612 |
T13154 |
T13142 |
prep |
by,prepared |
| R8613 |
T13155 |
T13154 |
pcomp |
fixing,by |
| R8614 |
T13156 |
T13155 |
prep |
in,fixing |
| R8615 |
T13157 |
T13158 |
nummod |
4,% |
| R8616 |
T13158 |
T13159 |
compound |
%,paraformaldehyde |
| R8617 |
T13159 |
T13156 |
pobj |
paraformaldehyde,in |
| R8618 |
T13160 |
T13161 |
punct |
(,PFA |
| R8619 |
T13161 |
T13159 |
parataxis |
PFA,paraformaldehyde |
| R8620 |
T13162 |
T13161 |
punct |
),PFA |
| R8621 |
T13163 |
T13159 |
prep |
in,paraformaldehyde |
| R8622 |
T13164 |
T13163 |
pobj |
PBS,in |
| R8623 |
T13165 |
T13155 |
prep |
for,fixing |
| R8624 |
T13166 |
T13167 |
nummod |
45,min |
| R8625 |
T13167 |
T13165 |
pobj |
min,for |
| R8626 |
T13168 |
T13167 |
prep |
to,min |
| R8627 |
T13169 |
T13170 |
nummod |
4,h |
| R8628 |
T13170 |
T13168 |
pobj |
h,to |
| R8629 |
T13171 |
T13167 |
prep |
depending,min |
| R8630 |
T13172 |
T13171 |
prep |
on,depending |
| R8631 |
T13173 |
T13174 |
det |
the,stage |
| R8632 |
T13174 |
T13172 |
pobj |
stage,on |
| R8633 |
T13175 |
T13155 |
punct |
;,fixing |
| R8634 |
T13176 |
T13155 |
conj |
washing,fixing |
| R8635 |
T13177 |
T13178 |
nummod |
three,times |
| R8636 |
T13178 |
T13176 |
npadvmod |
times,washing |
| R8637 |
T13179 |
T13176 |
prep |
in,washing |
| R8638 |
T13180 |
T13179 |
pobj |
PBS,in |
| R8639 |
T13181 |
T13176 |
punct |
", ",washing |
| R8640 |
T13182 |
T13176 |
conj |
once,washing |
| R8641 |
T13183 |
T13182 |
prep |
in,once |
| R8642 |
T13184 |
T13183 |
pobj |
PBS,in |
| R8643 |
T13185 |
T13184 |
punct |
+,PBS |
| R8644 |
T13186 |
T13187 |
nummod |
15,% |
| R8645 |
T13187 |
T13188 |
compound |
%,sucrose |
| R8646 |
T13188 |
T13184 |
appos |
sucrose,PBS |
| R8647 |
T13189 |
T13182 |
prep |
for,once |
| R8648 |
T13190 |
T13191 |
nummod |
1,h |
| R8649 |
T13191 |
T13189 |
pobj |
h,for |
| R8650 |
T13192 |
T13182 |
punct |
", ",once |
| R8651 |
T13193 |
T13182 |
cc |
and,once |
| R8652 |
T13194 |
T13182 |
conj |
once,once |
| R8653 |
T13195 |
T13194 |
prep |
in,once |
| R8654 |
T13196 |
T13195 |
pobj |
PBS,in |
| R8655 |
T13197 |
T13196 |
punct |
+,PBS |
| R8656 |
T13198 |
T13199 |
nummod |
30,% |
| R8657 |
T13199 |
T13200 |
compound |
%,sucrose |
| R8658 |
T13200 |
T13196 |
appos |
sucrose,PBS |
| R8659 |
T13201 |
T13194 |
prep |
for,once |
| R8660 |
T13202 |
T13203 |
nummod |
2,h |
| R8661 |
T13203 |
T13201 |
pobj |
h,for |
| R8662 |
T13204 |
T13203 |
prep |
to,h |
| R8663 |
T13205 |
T13204 |
pobj |
overnight,to |
| R8664 |
T13206 |
T13203 |
prep |
depending,h |
| R8665 |
T13207 |
T13206 |
prep |
on,depending |
| R8666 |
T13208 |
T13209 |
det |
the,stage |
| R8667 |
T13209 |
T13207 |
pobj |
stage,on |
| R8668 |
T13210 |
T13176 |
punct |
;,washing |
| R8669 |
T13211 |
T13176 |
cc |
and,washing |
| R8670 |
T13212 |
T13213 |
advmod |
then,freezing |
| R8671 |
T13213 |
T13176 |
conj |
freezing,washing |
| R8672 |
T13214 |
T13213 |
prep |
in,freezing |
| R8673 |
T13215 |
T13214 |
pobj |
OCT,in |
| R8674 |
T13216 |
T13142 |
punct |
.,prepared |
| R8675 |
T13218 |
T13219 |
nsubjpass |
Tissue,processed |
| R8676 |
T13220 |
T13218 |
prep |
from,Tissue |
| R8677 |
T13221 |
T13220 |
pobj |
animals,from |
| R8678 |
T13222 |
T13221 |
acl |
aged,animals |
| R8679 |
T13223 |
T13224 |
nummod |
7,wk |
| R8680 |
T13224 |
T13222 |
npadvmod |
wk,aged |
| R8681 |
T13225 |
T13224 |
prep |
to,wk |
| R8682 |
T13226 |
T13227 |
nummod |
9,mo |
| R8683 |
T13227 |
T13225 |
pobj |
mo,to |
| R8684 |
T13228 |
T13219 |
auxpass |
was,processed |
| R8685 |
T13229 |
T13219 |
advmod |
similarly,processed |
| R8686 |
T13230 |
T13229 |
prep |
to,similarly |
| R8687 |
T13231 |
T13232 |
amod |
earlier,stages |
| R8688 |
T13232 |
T13230 |
pobj |
stages,to |
| R8689 |
T13233 |
T13219 |
prep |
except,processed |
| R8690 |
T13234 |
T13235 |
mark |
that,decalcified |
| R8691 |
T13235 |
T13233 |
pcomp |
decalcified,except |
| R8692 |
T13236 |
T13235 |
nsubjpass |
it,decalcified |
| R8693 |
T13237 |
T13235 |
auxpass |
was,decalcified |
| R8694 |
T13238 |
T13235 |
prep |
in,decalcified |
| R8695 |
T13239 |
T13240 |
nummod |
0.5,M |
| R8696 |
T13240 |
T13241 |
compound |
M,EDTA |
| R8697 |
T13241 |
T13238 |
pobj |
EDTA,in |
| R8698 |
T13242 |
T13241 |
punct |
(,EDTA |
| R8699 |
T13243 |
T13241 |
npadvmod |
pH,EDTA |
| R8700 |
T13244 |
T13243 |
nummod |
7.4,pH |
| R8701 |
T13245 |
T13241 |
punct |
),EDTA |
| R8702 |
T13246 |
T13235 |
prep |
for,decalcified |
| R8703 |
T13247 |
T13248 |
nummod |
4,d |
| R8704 |
T13248 |
T13246 |
pobj |
d,for |
| R8705 |
T13249 |
T13250 |
amod |
prior,to |
| R8706 |
T13250 |
T13235 |
prep |
to,decalcified |
| R8707 |
T13251 |
T13250 |
pcomp |
incubating,to |
| R8708 |
T13252 |
T13251 |
prep |
in,incubating |
| R8709 |
T13253 |
T13252 |
pobj |
sucrose,in |
| R8710 |
T13254 |
T13219 |
punct |
.,processed |
| R8711 |
T13256 |
T13257 |
det |
All,solutions |
| R8712 |
T13257 |
T13258 |
nsubjpass |
solutions,prechilled |
| R8713 |
T13259 |
T13258 |
auxpass |
were,prechilled |
| R8714 |
T13260 |
T13258 |
cc |
and,prechilled |
| R8715 |
T13261 |
T13258 |
conj |
used,prechilled |
| R8716 |
T13262 |
T13261 |
prep |
at,used |
| R8717 |
T13263 |
T13264 |
nummod |
4,°C |
| R8718 |
T13264 |
T13262 |
pobj |
°C,at |
| R8719 |
T13265 |
T13261 |
prep |
with,used |
| R8720 |
T13266 |
T13265 |
pobj |
agitation,with |
| R8721 |
T13267 |
T13258 |
punct |
", ",prechilled |
| R8722 |
T13268 |
T13258 |
cc |
and,prechilled |
| R8723 |
T13269 |
T13270 |
nsubjpass |
skin,lacerated |
| R8724 |
T13270 |
T13258 |
conj |
lacerated,prechilled |
| R8725 |
T13271 |
T13269 |
prep |
from,skin |
| R8726 |
T13272 |
T13271 |
pobj |
tissues,from |
| R8727 |
T13273 |
T13272 |
prep |
of,tissues |
| R8728 |
T13274 |
T13275 |
nmod |
P0,mice |
| R8729 |
T13275 |
T13273 |
pobj |
mice,of |
| R8730 |
T13276 |
T13274 |
cc |
or,P0 |
| R8731 |
T13277 |
T13274 |
conj |
older,P0 |
| R8732 |
T13278 |
T13270 |
auxpass |
was,lacerated |
| R8733 |
T13279 |
T13270 |
cc |
or,lacerated |
| R8734 |
T13280 |
T13270 |
conj |
removed,lacerated |
| R8735 |
T13281 |
T13282 |
amod |
prior,to |
| R8736 |
T13282 |
T13280 |
prep |
to,removed |
| R8737 |
T13283 |
T13282 |
pobj |
processing,to |
| R8738 |
T13284 |
T13270 |
punct |
.,lacerated |
| R8739 |
T13286 |
T13287 |
nsubjpass |
Tissue,cryosectioned |
| R8740 |
T13288 |
T13287 |
auxpass |
was,cryosectioned |
| R8741 |
T13289 |
T13287 |
advmod |
then,cryosectioned |
| R8742 |
T13290 |
T13287 |
prep |
at,cryosectioned |
| R8743 |
T13291 |
T13292 |
nummod |
12,μm |
| R8744 |
T13292 |
T13290 |
pobj |
μm,at |
| R8745 |
T13293 |
T13287 |
cc |
and,cryosectioned |
| R8746 |
T13294 |
T13287 |
conj |
processed,cryosectioned |
| R8747 |
T13295 |
T13287 |
punct |
.,cryosectioned |
| R8748 |
T13297 |
T13298 |
nsubjpass |
Staining,carried |
| R8749 |
T13299 |
T13297 |
prep |
of,Staining |
| R8750 |
T13300 |
T13299 |
pobj |
sections,of |
| R8751 |
T13301 |
T13297 |
prep |
with,Staining |
| R8752 |
T13302 |
T13303 |
compound |
Safranin,O |
| R8753 |
T13303 |
T13301 |
pobj |
O,with |
| R8754 |
T13304 |
T13303 |
punct |
", ",O |
| R8755 |
T13305 |
T13306 |
amod |
Fast,Green |
| R8756 |
T13306 |
T13303 |
conj |
Green,O |
| R8757 |
T13307 |
T13306 |
punct |
", ",Green |
| R8758 |
T13308 |
T13306 |
cc |
and,Green |
| R8759 |
T13309 |
T13310 |
poss |
Harris,hematoxylin |
| R8760 |
T13310 |
T13306 |
conj |
hematoxylin,Green |
| R8761 |
T13311 |
T13309 |
case |
',Harris |
| R8762 |
T13312 |
T13298 |
auxpass |
was,carried |
| R8763 |
T13313 |
T13298 |
prt |
out,carried |
| R8764 |
T13314 |
T13298 |
advcl |
using,carried |
| R8765 |
T13315 |
T13316 |
amod |
standard,procedures |
| R8766 |
T13316 |
T13314 |
dobj |
procedures,using |
| R8767 |
T13317 |
T13316 |
amod |
histological,procedures |
| R8768 |
T13318 |
T13298 |
punct |
.,carried |
| R8769 |
T13320 |
T13321 |
nsubjpass |
Detection,performed |
| R8770 |
T13322 |
T13320 |
prep |
of,Detection |
| R8771 |
T13323 |
T13324 |
compound |
LACZ,activity |
| R8772 |
T13324 |
T13322 |
pobj |
activity,of |
| R8773 |
T13325 |
T13320 |
prep |
with,Detection |
| R8774 |
T13326 |
T13327 |
compound |
X,Gal |
| R8775 |
T13327 |
T13325 |
pobj |
Gal,with |
| R8776 |
T13328 |
T13327 |
punct |
-,Gal |
| R8777 |
T13329 |
T13321 |
auxpass |
was,performed |
| R8778 |
T13330 |
T13331 |
mark |
as,described |
| R8779 |
T13331 |
T13321 |
advcl |
described,performed |
| R8780 |
T13332 |
T13333 |
punct |
(,Lobe |
| R8781 |
T13333 |
T13331 |
meta |
Lobe,described |
| R8782 |
T13334 |
T13333 |
nmod |
et,Lobe |
| R8783 |
T13335 |
T13333 |
nmod |
al.,Lobe |
| R8784 |
T13336 |
T13333 |
nummod |
1999,Lobe |
| R8785 |
T13337 |
T13333 |
punct |
),Lobe |
| R8786 |
T13338 |
T13321 |
cc |
and,performed |
| R8787 |
T13339 |
T13340 |
auxpass |
was,followed |
| R8788 |
T13340 |
T13321 |
conj |
followed,performed |
| R8789 |
T13341 |
T13340 |
agent |
by,followed |
| R8790 |
T13342 |
T13341 |
pcomp |
refixing,by |
| R8791 |
T13343 |
T13342 |
prep |
in,refixing |
| R8792 |
T13344 |
T13345 |
nummod |
4,% |
| R8793 |
T13345 |
T13346 |
compound |
%,PFA |
| R8794 |
T13346 |
T13343 |
pobj |
PFA,in |
| R8795 |
T13347 |
T13342 |
punct |
", ",refixing |
| R8796 |
T13348 |
T13342 |
conj |
rinsing,refixing |
| R8797 |
T13349 |
T13348 |
prep |
with,rinsing |
| R8798 |
T13350 |
T13351 |
amod |
deionized,water |
| R8799 |
T13351 |
T13349 |
pobj |
water,with |
| R8800 |
T13352 |
T13348 |
punct |
", ",rinsing |
| R8801 |
T13353 |
T13348 |
conj |
counterstaining,rinsing |
| R8802 |
T13354 |
T13353 |
prep |
with,counterstaining |
| R8803 |
T13355 |
T13356 |
amod |
Nuclear,Red |
| R8804 |
T13356 |
T13354 |
pobj |
Red,with |
| R8805 |
T13357 |
T13356 |
amod |
Fast,Red |
| R8806 |
T13358 |
T13356 |
punct |
(,Red |
| R8807 |
T13359 |
T13360 |
compound |
Vector,Labs |
| R8808 |
T13360 |
T13356 |
npadvmod |
Labs,Red |
| R8809 |
T13361 |
T13356 |
punct |
),Red |
| R8810 |
T13362 |
T13353 |
punct |
", ",counterstaining |
| R8811 |
T13363 |
T13353 |
conj |
rinsing,counterstaining |
| R8812 |
T13364 |
T13363 |
prep |
with,rinsing |
| R8813 |
T13365 |
T13364 |
pobj |
water,with |
| R8814 |
T13366 |
T13363 |
advmod |
again,rinsing |
| R8815 |
T13367 |
T13363 |
punct |
", ",rinsing |
| R8816 |
T13368 |
T13363 |
cc |
and,rinsing |
| R8817 |
T13369 |
T13370 |
advmod |
then,mounting |
| R8818 |
T13370 |
T13363 |
conj |
mounting,rinsing |
| R8819 |
T13371 |
T13370 |
prep |
in,mounting |
| R8820 |
T13372 |
T13371 |
pobj |
Aquamount,in |
| R8821 |
T13373 |
T13374 |
punct |
(,Labs |
| R8822 |
T13374 |
T13372 |
parataxis |
Labs,Aquamount |
| R8823 |
T13375 |
T13374 |
compound |
Lerner,Labs |
| R8824 |
T13376 |
T13374 |
punct |
", ",Labs |
| R8825 |
T13377 |
T13374 |
npadvmod |
Pittsburgh,Labs |
| R8826 |
T13378 |
T13374 |
punct |
", ",Labs |
| R8827 |
T13379 |
T13374 |
npadvmod |
Pennsylvania,Labs |
| R8828 |
T13380 |
T13374 |
punct |
", ",Labs |
| R8829 |
T13381 |
T13382 |
compound |
United,States |
| R8830 |
T13382 |
T13374 |
npadvmod |
States,Labs |
| R8831 |
T13383 |
T13374 |
punct |
),Labs |
| R8832 |
T13384 |
T13321 |
punct |
.,performed |
| R8833 |
T13386 |
T13387 |
nmod |
RNA,hybridization |
| R8834 |
T13387 |
T13390 |
nsubjpass |
hybridization,performed |
| R8835 |
T13388 |
T13389 |
advmod |
in,situ |
| R8836 |
T13389 |
T13387 |
amod |
situ,hybridization |
| R8837 |
T13391 |
T13390 |
auxpass |
was,performed |
| R8838 |
T13392 |
T13393 |
mark |
as,described |
| R8839 |
T13393 |
T13390 |
advcl |
described,performed |
| R8840 |
T13394 |
T13395 |
punct |
(,Storm |
| R8841 |
T13395 |
T13393 |
meta |
Storm,described |
| R8842 |
T13396 |
T13395 |
cc |
and,Storm |
| R8843 |
T13397 |
T13395 |
conj |
Kingsley,Storm |
| R8844 |
T13398 |
T13397 |
nummod |
1996,Kingsley |
| R8845 |
T13399 |
T13397 |
punct |
),Kingsley |
| R8846 |
T13400 |
T13390 |
punct |
", ",performed |
| R8847 |
T13401 |
T13390 |
prep |
with,performed |
| R8848 |
T13402 |
T13403 |
det |
the,modifications |
| R8849 |
T13403 |
T13401 |
pobj |
modifications,with |
| R8850 |
T13404 |
T13403 |
amod |
following,modifications |
| R8851 |
T13405 |
T13390 |
punct |
: ,performed |
| R8852 |
T13406 |
T13407 |
punct |
(,1 |
| R8853 |
T13407 |
T13408 |
meta |
1,incubated |
| R8854 |
T13408 |
T13390 |
conj |
incubated,performed |
| R8855 |
T13409 |
T13407 |
punct |
),1 |
| R8856 |
T13410 |
T13411 |
amod |
Prior,to |
| R8857 |
T13411 |
T13408 |
prep |
to,incubated |
| R8858 |
T13412 |
T13413 |
det |
the,step |
| R8859 |
T13413 |
T13411 |
pobj |
step,to |
| R8860 |
T13414 |
T13413 |
compound |
acetylation,step |
| R8861 |
T13415 |
T13408 |
punct |
", ",incubated |
| R8862 |
T13416 |
T13408 |
nsubjpass |
sections,incubated |
| R8863 |
T13417 |
T13408 |
auxpass |
were,incubated |
| R8864 |
T13418 |
T13408 |
prep |
with,incubated |
| R8865 |
T13419 |
T13420 |
compound |
10,20 |
| R8866 |
T13420 |
T13422 |
nummod |
20,μg |
| R8867 |
T13421 |
T13420 |
punct |
–,20 |
| R8868 |
T13422 |
T13423 |
nmod |
μg,K |
| R8869 |
T13423 |
T13418 |
pobj |
K,with |
| R8870 |
T13424 |
T13425 |
punct |
/,ml |
| R8871 |
T13425 |
T13422 |
prep |
ml,μg |
| R8872 |
T13426 |
T13423 |
compound |
proteinase,K |
| R8873 |
T13427 |
T13408 |
prep |
for,incubated |
| R8874 |
T13428 |
T13429 |
nummod |
30,s |
| R8875 |
T13429 |
T13427 |
pobj |
s,for |
| R8876 |
T13430 |
T13429 |
prep |
to,s |
| R8877 |
T13431 |
T13432 |
nummod |
7,min |
| R8878 |
T13432 |
T13430 |
pobj |
min,to |
| R8879 |
T13433 |
T13408 |
prep |
at,incubated |
| R8880 |
T13434 |
T13435 |
compound |
room,temperature |
| R8881 |
T13435 |
T13433 |
pobj |
temperature,at |
| R8882 |
T13436 |
T13435 |
punct |
(,temperature |
| R8883 |
T13437 |
T13435 |
prep |
depending,temperature |
| R8884 |
T13438 |
T13437 |
prep |
on,depending |
| R8885 |
T13439 |
T13440 |
det |
the,stage |
| R8886 |
T13440 |
T13438 |
pobj |
stage,on |
| R8887 |
T13441 |
T13440 |
amod |
developmental,stage |
| R8888 |
T13442 |
T13435 |
punct |
),temperature |
| R8889 |
T13443 |
T13408 |
punct |
", ",incubated |
| R8890 |
T13444 |
T13408 |
advcl |
followed,incubated |
| R8891 |
T13445 |
T13444 |
agent |
by,followed |
| R8892 |
T13446 |
T13445 |
pcomp |
refixing,by |
| R8893 |
T13447 |
T13446 |
prep |
in,refixing |
| R8894 |
T13448 |
T13449 |
nummod |
4,% |
| R8895 |
T13449 |
T13450 |
compound |
%,PFA |
| R8896 |
T13450 |
T13447 |
pobj |
PFA,in |
| R8897 |
T13451 |
T13446 |
cc |
and,refixing |
| R8898 |
T13452 |
T13446 |
conj |
washing,refixing |
| R8899 |
T13453 |
T13454 |
nummod |
three,times |
| R8900 |
T13454 |
T13452 |
npadvmod |
times,washing |
| R8901 |
T13455 |
T13452 |
prep |
in,washing |
| R8902 |
T13456 |
T13455 |
pobj |
PBS,in |
| R8903 |
T13457 |
T13408 |
punct |
;,incubated |
| R8904 |
T13458 |
T13459 |
punct |
(,2 |
| R8905 |
T13459 |
T13460 |
meta |
2,skipped |
| R8906 |
T13460 |
T13408 |
conj |
skipped,incubated |
| R8907 |
T13461 |
T13459 |
punct |
),2 |
| R8908 |
T13462 |
T13463 |
compound |
prehybridization,step |
| R8909 |
T13463 |
T13460 |
nsubjpass |
step,skipped |
| R8910 |
T13464 |
T13460 |
auxpass |
was,skipped |
| R8911 |
T13465 |
T13460 |
punct |
", ",skipped |
| R8912 |
T13466 |
T13460 |
cc |
and,skipped |
| R8913 |
T13467 |
T13468 |
punct |
(,3 |
| R8914 |
T13468 |
T13469 |
meta |
3,used |
| R8915 |
T13469 |
T13460 |
conj |
used,skipped |
| R8916 |
T13470 |
T13468 |
punct |
),3 |
| R8917 |
T13471 |
T13472 |
amod |
embryonic,tissue |
| R8918 |
T13472 |
T13473 |
compound |
tissue,sections |
| R8919 |
T13473 |
T13469 |
nsubj |
sections,used |
| R8920 |
T13474 |
T13475 |
det |
a,mix |
| R8921 |
T13475 |
T13469 |
dobj |
mix,used |
| R8922 |
T13476 |
T13475 |
amod |
different,mix |
| R8923 |
T13477 |
T13475 |
compound |
color,mix |
| R8924 |
T13478 |
T13475 |
compound |
development,mix |
| R8925 |
T13479 |
T13480 |
punct |
(,Thut |
| R8926 |
T13480 |
T13469 |
meta |
Thut,used |
| R8927 |
T13481 |
T13480 |
nmod |
et,Thut |
| R8928 |
T13482 |
T13480 |
nmod |
al.,Thut |
| R8929 |
T13483 |
T13480 |
nummod |
2001,Thut |
| R8930 |
T13484 |
T13480 |
punct |
),Thut |
| R8931 |
T13485 |
T13469 |
punct |
.,used |
| R8932 |
T13487 |
T13488 |
nsubjpass |
Probes,published |
| R8933 |
T13489 |
T13487 |
prep |
for,Probes |
| R8934 |
T13490 |
T13491 |
det |
the,genes |
| R8935 |
T13491 |
T13489 |
pobj |
genes,for |
| R8936 |
T13492 |
T13491 |
amod |
following,genes |
| R8937 |
T13493 |
T13488 |
aux |
have,published |
| R8938 |
T13494 |
T13488 |
auxpass |
been,published |
| R8939 |
T13495 |
T13488 |
advmod |
previously,published |
| R8940 |
T13496 |
T13488 |
punct |
: ,published |
| R8941 |
T13497 |
T13488 |
dobj |
Bmpr1a,published |
| R8942 |
T13498 |
T13499 |
punct |
(,Mishina |
| R8943 |
T13499 |
T13497 |
meta |
Mishina,Bmpr1a |
| R8944 |
T13500 |
T13499 |
nmod |
et,Mishina |
| R8945 |
T13501 |
T13499 |
nmod |
al.,Mishina |
| R8946 |
T13502 |
T13499 |
nummod |
1995,Mishina |
| R8947 |
T13503 |
T13499 |
punct |
),Mishina |
| R8948 |
T13504 |
T13497 |
punct |
", ",Bmpr1a |
| R8949 |
T13505 |
T13497 |
conj |
Col2a1,Bmpr1a |
| R8950 |
T13506 |
T13507 |
punct |
(,Metsaranta |
| R8951 |
T13507 |
T13505 |
meta |
Metsaranta,Col2a1 |
| R8952 |
T13508 |
T13507 |
nmod |
et,Metsaranta |
| R8953 |
T13509 |
T13507 |
nmod |
al.,Metsaranta |
| R8954 |
T13510 |
T13507 |
nummod |
1991,Metsaranta |
| R8955 |
T13511 |
T13507 |
punct |
),Metsaranta |
| R8956 |
T13512 |
T13505 |
punct |
", ",Col2a1 |
| R8957 |
T13513 |
T13505 |
conj |
Col10a1,Col2a1 |
| R8958 |
T13514 |
T13515 |
punct |
(,Apte |
| R8959 |
T13515 |
T13513 |
meta |
Apte,Col10a1 |
| R8960 |
T13516 |
T13515 |
nmod |
et,Apte |
| R8961 |
T13517 |
T13515 |
nmod |
al.,Apte |
| R8962 |
T13518 |
T13515 |
nummod |
1992,Apte |
| R8963 |
T13519 |
T13515 |
punct |
),Apte |
| R8964 |
T13520 |
T13513 |
punct |
", ",Col10a1 |
| R8965 |
T13521 |
T13513 |
conj |
Gdf5,Col10a1 |
| R8966 |
T13522 |
T13523 |
punct |
(,Storm |
| R8967 |
T13523 |
T13521 |
meta |
Storm,Gdf5 |
| R8968 |
T13524 |
T13523 |
cc |
and,Storm |
| R8969 |
T13525 |
T13523 |
conj |
Kingsley,Storm |
| R8970 |
T13526 |
T13525 |
nummod |
1996,Kingsley |
| R8971 |
T13527 |
T13525 |
punct |
),Kingsley |
| R8972 |
T13528 |
T13521 |
punct |
", ",Gdf5 |
| R8973 |
T13529 |
T13521 |
conj |
Osteocalcin,Gdf5 |
| R8974 |
T13530 |
T13531 |
punct |
(,Celeste |
| R8975 |
T13531 |
T13529 |
meta |
Celeste,Osteocalcin |
| R8976 |
T13532 |
T13531 |
nmod |
et,Celeste |
| R8977 |
T13533 |
T13531 |
nmod |
al.,Celeste |
| R8978 |
T13534 |
T13531 |
nummod |
1986,Celeste |
| R8979 |
T13535 |
T13531 |
punct |
),Celeste |
| R8980 |
T13536 |
T13529 |
punct |
", ",Osteocalcin |
| R8981 |
T13537 |
T13529 |
cc |
and,Osteocalcin |
| R8982 |
T13538 |
T13529 |
conj |
Sox5,Osteocalcin |
| R8983 |
T13539 |
T13538 |
cc |
and,Sox5 |
| R8984 |
T13540 |
T13538 |
conj |
Sox6,Sox5 |
| R8985 |
T13541 |
T13542 |
punct |
(,Lefebvre |
| R8986 |
T13542 |
T13540 |
meta |
Lefebvre,Sox6 |
| R8987 |
T13543 |
T13542 |
nmod |
et,Lefebvre |
| R8988 |
T13544 |
T13542 |
nmod |
al.,Lefebvre |
| R8989 |
T13545 |
T13542 |
nummod |
1998,Lefebvre |
| R8990 |
T13546 |
T13542 |
punct |
),Lefebvre |
| R8991 |
T13547 |
T13488 |
punct |
.,published |
| R8992 |
T13549 |
T13550 |
det |
The,templates |
| R8993 |
T13550 |
T13553 |
nsubj |
templates,were |
| R8994 |
T13551 |
T13550 |
amod |
following,templates |
| R8995 |
T13552 |
T13550 |
compound |
probe,templates |
| R8996 |
T13553 |
T13554 |
ccomp |
were,made |
| R8997 |
T13555 |
T13553 |
attr |
gifts,were |
| R8998 |
T13556 |
T13553 |
punct |
: ,were |
| R8999 |
T13557 |
T13553 |
dobj |
Agg,were |
| R9000 |
T13558 |
T13557 |
punct |
", ",Agg |
| R9001 |
T13559 |
T13560 |
compound |
Dr.,Rosen |
| R9002 |
T13560 |
T13557 |
npadvmod |
Rosen,Agg |
| R9003 |
T13561 |
T13560 |
compound |
Vicki,Rosen |
| R9004 |
T13562 |
T13557 |
punct |
", ",Agg |
| R9005 |
T13563 |
T13564 |
compound |
Genetics,Institute |
| R9006 |
T13564 |
T13557 |
npadvmod |
Institute,Agg |
| R9007 |
T13565 |
T13557 |
punct |
;,Agg |
| R9008 |
T13566 |
T13557 |
appos |
Bmp2,Agg |
| R9009 |
T13567 |
T13566 |
cc |
and,Bmp2 |
| R9010 |
T13568 |
T13566 |
conj |
Bmp4,Bmp2 |
| R9011 |
T13569 |
T13566 |
punct |
", ",Bmp2 |
| R9012 |
T13570 |
T13571 |
compound |
Arend,Sidow |
| R9013 |
T13571 |
T13566 |
npadvmod |
Sidow,Bmp2 |
| R9014 |
T13572 |
T13566 |
punct |
", ",Bmp2 |
| R9015 |
T13573 |
T13574 |
compound |
Stanford,University |
| R9016 |
T13574 |
T13566 |
npadvmod |
University,Bmp2 |
| R9017 |
T13575 |
T13557 |
punct |
;,Agg |
| R9018 |
T13576 |
T13557 |
appos |
Col1a1,Agg |
| R9019 |
T13577 |
T13576 |
punct |
", ",Col1a1 |
| R9020 |
T13578 |
T13579 |
compound |
Bjorn,Olsen |
| R9021 |
T13579 |
T13576 |
npadvmod |
Olsen,Col1a1 |
| R9022 |
T13580 |
T13576 |
punct |
", ",Col1a1 |
| R9023 |
T13581 |
T13582 |
compound |
Harvard,School |
| R9024 |
T13582 |
T13576 |
npadvmod |
School,Col1a1 |
| R9025 |
T13583 |
T13582 |
compound |
Medical,School |
| R9026 |
T13584 |
T13554 |
punct |
;,made |
| R9027 |
T13585 |
T13586 |
nmod |
Bmpr1b,probes |
| R9028 |
T13586 |
T13554 |
nsubjpass |
probes,made |
| R9029 |
T13587 |
T13585 |
punct |
", ",Bmpr1b |
| R9030 |
T13588 |
T13585 |
conj |
Col3a1,Bmpr1b |
| R9031 |
T13589 |
T13588 |
punct |
", ",Col3a1 |
| R9032 |
T13590 |
T13588 |
cc |
and,Col3a1 |
| R9033 |
T13591 |
T13588 |
conj |
Mat4,Col3a1 |
| R9034 |
T13592 |
T13554 |
auxpass |
were,made |
| R9035 |
T13593 |
T13554 |
prep |
from,made |
| R9036 |
T13594 |
T13593 |
pobj |
ESTs,from |
| R9037 |
T13595 |
T13594 |
prep |
with,ESTs |
| R9038 |
T13596 |
T13597 |
compound |
IMAGE,numbers |
| R9039 |
T13597 |
T13595 |
pobj |
numbers,with |
| R9040 |
T13598 |
T13597 |
compound |
clone,numbers |
| R9041 |
T13599 |
T13597 |
appos |
5056341,numbers |
| R9042 |
T13600 |
T13599 |
punct |
", ",5056341 |
| R9043 |
T13601 |
T13599 |
conj |
478480,5056341 |
| R9044 |
T13602 |
T13601 |
punct |
", ",478480 |
| R9045 |
T13603 |
T13601 |
cc |
and,478480 |
| R9046 |
T13604 |
T13601 |
conj |
406027,478480 |
| R9047 |
T13605 |
T13554 |
punct |
", ",made |
| R9048 |
T13606 |
T13554 |
advmod |
respectively,made |
| R9049 |
T13607 |
T13608 |
punct |
(,Invitrogen |
| R9050 |
T13608 |
T13554 |
parataxis |
Invitrogen,made |
| R9051 |
T13609 |
T13608 |
punct |
", ",Invitrogen |
| R9052 |
T13610 |
T13608 |
npadvmod |
Carlsbad,Invitrogen |
| R9053 |
T13611 |
T13608 |
punct |
", ",Invitrogen |
| R9054 |
T13612 |
T13608 |
npadvmod |
California,Invitrogen |
| R9055 |
T13613 |
T13608 |
punct |
", ",Invitrogen |
| R9056 |
T13614 |
T13615 |
compound |
United,States |
| R9057 |
T13615 |
T13608 |
npadvmod |
States,Invitrogen |
| R9058 |
T13616 |
T13608 |
punct |
),Invitrogen |
| R9059 |
T13617 |
T13554 |
punct |
.,made |
| R9060 |
T13619 |
T13620 |
nsubjpass |
Sections,fixed |
| R9061 |
T13621 |
T13619 |
prep |
for,Sections |
| R9062 |
T13622 |
T13621 |
pobj |
immunohistochemistry,for |
| R9063 |
T13623 |
T13620 |
auxpass |
were,fixed |
| R9064 |
T13624 |
T13620 |
prep |
in,fixed |
| R9065 |
T13625 |
T13626 |
nummod |
4,% |
| R9066 |
T13626 |
T13627 |
compound |
%,PFA |
| R9067 |
T13627 |
T13624 |
pobj |
PFA,in |
| R9068 |
T13628 |
T13620 |
punct |
", ",fixed |
| R9069 |
T13629 |
T13630 |
advmod |
then,digested |
| R9070 |
T13630 |
T13620 |
dep |
digested,fixed |
| R9071 |
T13631 |
T13630 |
prep |
with,digested |
| R9072 |
T13632 |
T13633 |
quantmod |
942,"2,000" |
| R9073 |
T13633 |
T13635 |
nummod |
"2,000",U |
| R9074 |
T13634 |
T13633 |
punct |
–,"2,000" |
| R9075 |
T13635 |
T13636 |
nmod |
U,hyaluronindase |
| R9076 |
T13636 |
T13631 |
pobj |
hyaluronindase,with |
| R9077 |
T13637 |
T13638 |
punct |
/,ml |
| R9078 |
T13638 |
T13635 |
prep |
ml,U |
| R9079 |
T13639 |
T13640 |
nmod |
type,S |
| R9080 |
T13640 |
T13636 |
nmod |
S,hyaluronindase |
| R9081 |
T13641 |
T13640 |
nummod |
IV,S |
| R9082 |
T13642 |
T13640 |
punct |
-,S |
| R9083 |
T13643 |
T13636 |
amod |
bovine,hyaluronindase |
| R9084 |
T13644 |
T13645 |
punct |
(,Sigma |
| R9085 |
T13645 |
T13636 |
parataxis |
Sigma,hyaluronindase |
| R9086 |
T13646 |
T13645 |
punct |
", ",Sigma |
| R9087 |
T13647 |
T13648 |
compound |
St.,Louis |
| R9088 |
T13648 |
T13645 |
npadvmod |
Louis,Sigma |
| R9089 |
T13649 |
T13645 |
punct |
", ",Sigma |
| R9090 |
T13650 |
T13645 |
npadvmod |
Missouri,Sigma |
| R9091 |
T13651 |
T13645 |
punct |
", ",Sigma |
| R9092 |
T13652 |
T13653 |
compound |
United,States |
| R9093 |
T13653 |
T13645 |
npadvmod |
States,Sigma |
| R9094 |
T13654 |
T13645 |
punct |
),Sigma |
| R9095 |
T13655 |
T13630 |
prep |
in,digested |
| R9096 |
T13656 |
T13655 |
pobj |
PBS,in |
| R9097 |
T13657 |
T13656 |
punct |
(,PBS |
| R9098 |
T13658 |
T13656 |
npadvmod |
pH,PBS |
| R9099 |
T13659 |
T13658 |
nummod |
5,pH |
| R9100 |
T13660 |
T13656 |
punct |
),PBS |
| R9101 |
T13661 |
T13630 |
prep |
at,digested |
| R9102 |
T13662 |
T13663 |
nummod |
37,°C |
| R9103 |
T13663 |
T13661 |
pobj |
°C,at |
| R9104 |
T13664 |
T13630 |
prep |
for,digested |
| R9105 |
T13665 |
T13666 |
nummod |
30,min |
| R9106 |
T13666 |
T13664 |
pobj |
min,for |
| R9107 |
T13667 |
T13666 |
prep |
to,min |
| R9108 |
T13668 |
T13669 |
nummod |
2,h |
| R9109 |
T13669 |
T13667 |
pobj |
h,to |
| R9110 |
T13670 |
T13666 |
prep |
depending,min |
| R9111 |
T13671 |
T13670 |
prep |
on,depending |
| R9112 |
T13672 |
T13673 |
det |
the,stage |
| R9113 |
T13673 |
T13671 |
pobj |
stage,on |
| R9114 |
T13674 |
T13620 |
punct |
.,fixed |
| R9115 |
T13676 |
T13677 |
nsubjpass |
Slides,washed |
| R9116 |
T13678 |
T13677 |
auxpass |
were,washed |
| R9117 |
T13679 |
T13677 |
advmod |
then,washed |
| R9118 |
T13680 |
T13677 |
prep |
in,washed |
| R9119 |
T13681 |
T13680 |
pobj |
PBS,in |
| R9120 |
T13682 |
T13677 |
punct |
", ",washed |
| R9121 |
T13683 |
T13677 |
conj |
treated,washed |
| R9122 |
T13684 |
T13683 |
prep |
with,treated |
| R9123 |
T13685 |
T13686 |
nummod |
0.3,% |
| R9124 |
T13686 |
T13687 |
compound |
%,peroxide |
| R9125 |
T13687 |
T13684 |
pobj |
peroxide,with |
| R9126 |
T13688 |
T13687 |
compound |
hydrogen,peroxide |
| R9127 |
T13689 |
T13683 |
prep |
in,treated |
| R9128 |
T13690 |
T13691 |
nummod |
100,% |
| R9129 |
T13691 |
T13692 |
compound |
%,methanol |
| R9130 |
T13692 |
T13689 |
pobj |
methanol,in |
| R9131 |
T13693 |
T13683 |
prep |
for,treated |
| R9132 |
T13694 |
T13695 |
nummod |
30,min |
| R9133 |
T13695 |
T13693 |
pobj |
min,for |
| R9134 |
T13696 |
T13683 |
punct |
", ",treated |
| R9135 |
T13697 |
T13683 |
conj |
washed,treated |
| R9136 |
T13698 |
T13697 |
punct |
", ",washed |
| R9137 |
T13699 |
T13697 |
conj |
blocked,washed |
| R9138 |
T13700 |
T13699 |
prep |
with,blocked |
| R9139 |
T13701 |
T13700 |
pobj |
PBS,with |
| R9140 |
T13702 |
T13701 |
punct |
+,PBS |
| R9141 |
T13703 |
T13704 |
nummod |
0.05,% |
| R9142 |
T13704 |
T13705 |
compound |
%,Tween20 |
| R9143 |
T13705 |
T13701 |
appos |
Tween20,PBS |
| R9144 |
T13706 |
T13701 |
punct |
+,PBS |
| R9145 |
T13707 |
T13708 |
nummod |
5,% |
| R9146 |
T13708 |
T13709 |
nmod |
%,serum |
| R9147 |
T13709 |
T13701 |
appos |
serum,PBS |
| R9148 |
T13710 |
T13709 |
nmod |
goat,serum |
| R9149 |
T13711 |
T13710 |
cc |
or,goat |
| R9150 |
T13712 |
T13713 |
amod |
fetal,bovine |
| R9151 |
T13713 |
T13710 |
conj |
bovine,goat |
| R9152 |
T13714 |
T13699 |
punct |
", ",blocked |
| R9153 |
T13715 |
T13699 |
conj |
washed,blocked |
| R9154 |
T13716 |
T13715 |
advmod |
again,washed |
| R9155 |
T13717 |
T13715 |
punct |
", ",washed |
| R9156 |
T13718 |
T13715 |
cc |
and,washed |
| R9157 |
T13719 |
T13715 |
conj |
incubated,washed |
| R9158 |
T13720 |
T13719 |
prep |
with,incubated |
| R9159 |
T13721 |
T13722 |
amod |
primary,antibodies |
| R9160 |
T13722 |
T13720 |
pobj |
antibodies,with |
| R9161 |
T13723 |
T13719 |
prep |
in,incubated |
| R9162 |
T13724 |
T13723 |
pobj |
PBS,in |
| R9163 |
T13725 |
T13724 |
punct |
+,PBS |
| R9164 |
T13726 |
T13727 |
nummod |
0.05,% |
| R9165 |
T13727 |
T13728 |
compound |
%,Tween |
| R9166 |
T13728 |
T13724 |
appos |
Tween,PBS |
| R9167 |
T13729 |
T13728 |
nummod |
20,Tween |
| R9168 |
T13730 |
T13724 |
punct |
+,PBS |
| R9169 |
T13731 |
T13732 |
nummod |
1,% |
| R9170 |
T13732 |
T13733 |
nmod |
%,serum |
| R9171 |
T13733 |
T13724 |
appos |
serum,PBS |
| R9172 |
T13734 |
T13733 |
nmod |
goat,serum |
| R9173 |
T13735 |
T13734 |
cc |
or,goat |
| R9174 |
T13736 |
T13737 |
amod |
fetal,bovine |
| R9175 |
T13737 |
T13734 |
conj |
bovine,goat |
| R9176 |
T13738 |
T13719 |
advmod |
overnight,incubated |
| R9177 |
T13739 |
T13719 |
prep |
at,incubated |
| R9178 |
T13740 |
T13741 |
nummod |
4,°C |
| R9179 |
T13741 |
T13739 |
pobj |
°C,at |
| R9180 |
T13742 |
T13677 |
punct |
.,washed |
| R9181 |
T13744 |
T13745 |
npadvmod |
Biotin,labeled |
| R9182 |
T13745 |
T13747 |
amod |
labeled,antibodies |
| R9183 |
T13746 |
T13745 |
punct |
-,labeled |
| R9184 |
T13747 |
T13749 |
nsubjpass |
antibodies,tagged |
| R9185 |
T13748 |
T13747 |
amod |
secondary,antibodies |
| R9186 |
T13750 |
T13751 |
punct |
(,Labs |
| R9187 |
T13751 |
T13747 |
parataxis |
Labs,antibodies |
| R9188 |
T13752 |
T13751 |
compound |
Vector,Labs |
| R9189 |
T13753 |
T13751 |
punct |
),Labs |
| R9190 |
T13754 |
T13749 |
auxpass |
were,tagged |
| R9191 |
T13755 |
T13749 |
prep |
with,tagged |
| R9192 |
T13756 |
T13755 |
pobj |
HRP,with |
| R9193 |
T13757 |
T13749 |
advcl |
using,tagged |
| R9194 |
T13758 |
T13759 |
det |
the,kit |
| R9195 |
T13759 |
T13757 |
dobj |
kit,using |
| R9196 |
T13760 |
T13761 |
compound |
Vectastain,Elite |
| R9197 |
T13761 |
T13759 |
compound |
Elite,kit |
| R9198 |
T13762 |
T13759 |
compound |
ABC,kit |
| R9199 |
T13763 |
T13764 |
punct |
(,Labs |
| R9200 |
T13764 |
T13759 |
parataxis |
Labs,kit |
| R9201 |
T13765 |
T13764 |
compound |
Vector,Labs |
| R9202 |
T13766 |
T13764 |
punct |
),Labs |
| R9203 |
T13767 |
T13749 |
advcl |
followed,tagged |
| R9204 |
T13768 |
T13767 |
agent |
by,followed |
| R9205 |
T13769 |
T13768 |
pobj |
detection,by |
| R9206 |
T13770 |
T13769 |
prep |
with,detection |
| R9207 |
T13771 |
T13770 |
pobj |
DAB,with |
| R9208 |
T13772 |
T13773 |
punct |
(,Labs |
| R9209 |
T13773 |
T13771 |
parataxis |
Labs,DAB |
| R9210 |
T13774 |
T13773 |
compound |
Vector,Labs |
| R9211 |
T13775 |
T13773 |
punct |
),Labs |
| R9212 |
T13776 |
T13749 |
punct |
.,tagged |
| R9213 |
T13778 |
T13779 |
amod |
Primary,antibodies |
| R9214 |
T13779 |
T13780 |
nsubj |
antibodies,were |
| R9215 |
T13781 |
T13779 |
cc |
and,antibodies |
| R9216 |
T13782 |
T13779 |
conj |
dilutions,antibodies |
| R9217 |
T13783 |
T13779 |
acl |
used,antibodies |
| R9218 |
T13784 |
T13780 |
punct |
: ,were |
| R9219 |
T13785 |
T13786 |
nmod |
goat,MMP13 |
| R9220 |
T13786 |
T13780 |
attr |
MMP13,were |
| R9221 |
T13787 |
T13785 |
amod |
anti-mouse,goat |
| R9222 |
T13788 |
T13786 |
punct |
", ",MMP13 |
| R9223 |
T13789 |
T13786 |
npadvmod |
1,MMP13 |
| R9224 |
T13790 |
T13791 |
punct |
:,100 |
| R9225 |
T13791 |
T13789 |
prep |
100,1 |
| R9226 |
T13792 |
T13793 |
punct |
(,International |
| R9227 |
T13793 |
T13789 |
parataxis |
International,1 |
| R9228 |
T13794 |
T13793 |
compound |
Chemicon,International |
| R9229 |
T13795 |
T13793 |
punct |
", ",International |
| R9230 |
T13796 |
T13793 |
npadvmod |
Temecula,International |
| R9231 |
T13797 |
T13793 |
punct |
", ",International |
| R9232 |
T13798 |
T13793 |
npadvmod |
California,International |
| R9233 |
T13799 |
T13793 |
punct |
", ",International |
| R9234 |
T13800 |
T13801 |
compound |
United,States |
| R9235 |
T13801 |
T13793 |
npadvmod |
States,International |
| R9236 |
T13802 |
T13793 |
punct |
),International |
| R9237 |
T13803 |
T13786 |
punct |
;,MMP13 |
| R9238 |
T13804 |
T13805 |
nmod |
rabbit,SOX9 |
| R9239 |
T13805 |
T13786 |
appos |
SOX9,MMP13 |
| R9240 |
T13806 |
T13804 |
amod |
anti-human,rabbit |
| R9241 |
T13807 |
T13805 |
punct |
", ",SOX9 |
| R9242 |
T13808 |
T13805 |
npadvmod |
1,SOX9 |
| R9243 |
T13809 |
T13810 |
punct |
:,500 |
| R9244 |
T13810 |
T13808 |
prep |
500,1 |
| R9245 |
T13811 |
T13812 |
punct |
(,Morais |
| R9246 |
T13812 |
T13808 |
meta |
Morais,1 |
| R9247 |
T13813 |
T13812 |
nmod |
da,Morais |
| R9248 |
T13814 |
T13812 |
nmod |
Silva,Morais |
| R9249 |
T13815 |
T13812 |
nmod |
et,Morais |
| R9250 |
T13816 |
T13812 |
nmod |
al.,Morais |
| R9251 |
T13817 |
T13812 |
nummod |
1996,Morais |
| R9252 |
T13818 |
T13812 |
punct |
),Morais |
| R9253 |
T13819 |
T13786 |
punct |
;,MMP13 |
| R9254 |
T13820 |
T13821 |
nmod |
rabbit,SOX9 |
| R9255 |
T13821 |
T13786 |
appos |
SOX9,MMP13 |
| R9256 |
T13822 |
T13821 |
amod |
anti-phosphorylated,SOX9 |
| R9257 |
T13823 |
T13821 |
punct |
-,SOX9 |
| R9258 |
T13824 |
T13821 |
punct |
(,SOX9 |
| R9259 |
T13825 |
T13826 |
nmod |
SOX9,P |
| R9260 |
T13826 |
T13821 |
appos |
P,SOX9 |
| R9261 |
T13827 |
T13826 |
punct |
.,P |
| R9262 |
T13828 |
T13821 |
punct |
),SOX9 |
| R9263 |
T13829 |
T13821 |
punct |
", ",SOX9 |
| R9264 |
T13830 |
T13821 |
npadvmod |
1,SOX9 |
| R9265 |
T13831 |
T13832 |
punct |
:,10 |
| R9266 |
T13832 |
T13830 |
prep |
10,1 |
| R9267 |
T13833 |
T13834 |
punct |
–,1 |
| R9268 |
T13834 |
T13830 |
prep |
1,1 |
| R9269 |
T13835 |
T13836 |
punct |
:,250 |
| R9270 |
T13836 |
T13834 |
prep |
250,1 |
| R9271 |
T13837 |
T13838 |
punct |
(,Huang |
| R9272 |
T13838 |
T13780 |
meta |
Huang,were |
| R9273 |
T13839 |
T13838 |
nmod |
et,Huang |
| R9274 |
T13840 |
T13838 |
nmod |
al.,Huang |
| R9275 |
T13841 |
T13838 |
nummod |
2000,Huang |
| R9276 |
T13842 |
T13838 |
punct |
),Huang |
| R9277 |
T13843 |
T13780 |
punct |
.,were |
| R94 |
T331 |
T327 |
parataxis |
member,gene |
| R2308 |
T3651 |
T3648 |
prep |
at,expression |
| R2309 |
T3652 |
T3653 |
det |
some,time |
| R2310 |
T3653 |
T3651 |
pobj |
time,at |
| R1080 |
T1864 |
T1840 |
meta |
Storm,produce |
| R1081 |
T1865 |
T1864 |
cc |
and,Storm |
| R1082 |
T1866 |
T1864 |
conj |
Kingsley,Storm |
| R7249 |
T11038 |
T11039 |
aux |
may,bring |
| R7250 |
T11039 |
T11017 |
conj |
bring,enhance |
| R7251 |
T11040 |
T11039 |
dobj |
us,bring |
| R7252 |
T11041 |
T11039 |
advcl |
closer,bring |
| R7253 |
T11042 |
T11041 |
prep |
to,closer |
| R7254 |
T11043 |
T11044 |
amod |
better,prevention |
| R7255 |
T11044 |
T11042 |
pobj |
prevention,to |
| R7256 |
T11045 |
T11044 |
cc |
and,prevention |
| R7257 |
T11046 |
T11044 |
conj |
treatment,prevention |
| R7258 |
T11047 |
T11044 |
prep |
of,prevention |
| R7259 |
T11048 |
T11049 |
compound |
joint,diseases |
| R7260 |
T11049 |
T11047 |
pobj |
diseases,of |
| R7261 |
T11050 |
T11017 |
punct |
.,enhance |