PMC:4829102 / 22603-39960 JSONTXT

{"project":"2_test","denotations":[{"id":"26807646-20360682-73828204","span":{"begin":513,"end":515},"obj":"20360682"},{"id":"26807646-20360682-73828204","span":{"begin":513,"end":515},"obj":"20360682"},{"id":"26807646-20541610-73828205","span":{"begin":2569,"end":2571},"obj":"20541610"},{"id":"26807646-20541610-73828205","span":{"begin":2569,"end":2571},"obj":"20541610"},{"id":"26807646-21293454-73828206","span":{"begin":5547,"end":5549},"obj":"21293454"},{"id":"26807646-21293454-73828206","span":{"begin":5547,"end":5549},"obj":"21293454"},{"id":"26807646-25794620-73828207","span":{"begin":8454,"end":8456},"obj":"25794620"},{"id":"26807646-25794620-73828207","span":{"begin":8454,"end":8456},"obj":"25794620"},{"id":"26807646-17965729-73828208","span":{"begin":8880,"end":8882},"obj":"17965729"},{"id":"26807646-17965729-73828208","span":{"begin":8880,"end":8882},"obj":"17965729"},{"id":"26807646-25794620-73828209","span":{"begin":9514,"end":9516},"obj":"25794620"},{"id":"26807646-25794620-73828209","span":{"begin":9514,"end":9516},"obj":"25794620"},{"id":"26807646-20541610-73828210","span":{"begin":10590,"end":10592},"obj":"20541610"},{"id":"26807646-20541610-73828210","span":{"begin":10590,"end":10592},"obj":"20541610"},{"id":"26807646-22692201-73828211","span":{"begin":12904,"end":12906},"obj":"22692201"},{"id":"26807646-22692201-73828211","span":{"begin":12904,"end":12906},"obj":"22692201"},{"id":"26807646-10587307-73828212","span":{"begin":13570,"end":13572},"obj":"10587307"},{"id":"26807646-10587307-73828212","span":{"begin":13570,"end":13572},"obj":"10587307"},{"id":"26807646-24362840-73828213","span":{"begin":14597,"end":14599},"obj":"24362840"},{"id":"26807646-24362840-73828213","span":{"begin":14597,"end":14599},"obj":"24362840"},{"id":"26807646-24362840-73828214","span":{"begin":14870,"end":14872},"obj":"24362840"},{"id":"26807646-24362840-73828214","span":{"begin":14870,"end":14872},"obj":"24362840"},{"id":"26807646-24362840-73828215","span":{"begin":15131,"end":15133},"obj":"24362840"},{"id":"26807646-24362840-73828215","span":{"begin":15131,"end":15133},"obj":"24362840"},{"id":"26807646-24362840-73828216","span":{"begin":15198,"end":15200},"obj":"24362840"},{"id":"26807646-24362840-73828216","span":{"begin":15198,"end":15200},"obj":"24362840"},{"id":"26807646-23287718-73828217","span":{"begin":15676,"end":15678},"obj":"23287718"},{"id":"26807646-23287718-73828217","span":{"begin":15676,"end":15678},"obj":"23287718"},{"id":"26807646-11046155-73828218","span":{"begin":16371,"end":16373},"obj":"11046155"},{"id":"26807646-11046155-73828218","span":{"begin":16371,"end":16373},"obj":"11046155"},{"id":"26807646-24534091-73828219","span":{"begin":16375,"end":16377},"obj":"24534091"},{"id":"26807646-24534091-73828219","span":{"begin":16375,"end":16377},"obj":"24534091"}],"text":"METHODS\n\nCell lines\nHEK 293FT cells were a kind gift from Dr G. Stewart while HeLa and U2OS cells were a generous gift from Dr F. Esashi. These cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and standard antibiotics. U2OS cells stably expressing GFP-CtIP and U2OS cells harbouring the HR reporter DR-GFP were a generous gift from Prof. S.P. Jackson and were maintained in media supplemented with 500 μg ml−1 G-418. The ER-AsiSI U2OS cell line 47, a kind gift from Prof. G. Legube, was maintained in DMEM media without phenol red supplemented with 10% dialysed FBS (Life Technologies) and 1 μg ml−1 Puromycin. Cell lines stably expressing FLAG-HA EXD2 WT or D108A/E110A fusion proteins were generated by transfection of U2OS cells with these plasmid constructs followed by clonal selection of cells grown in media containing 500 μg ml−1 G418 (Life Technologies). All cell lines have been verified mycoplasma free by PCR based test (Takara).\n\nPlasmids\nThe open reading frame (ORF) of human EXD2 was purchased as a gateway entry clone in the pDONR221 plasmid backbone from DNASU Plasmid Repository (HsCD00295838). Discrepancies in the amino-acid sequence in comparison to the reference sequence for human EXD2 (NM_001193360.1) were corrected by site-directed mutagenesis. Site-directed mutagenesis was then employed to generate EXD2 D108A–E110A in pDONR221.\nFlag–HA–EXD2 WT and D108A–E110A as well as GST–EXD2 WT and D108A–E110A plasmid constructs were generated by recombination of the WT or D108A–E110A EXD2 ORF in pDONR221 by LR Clonase reaction into either the pHAGE-N-Flag–HA destination vector (a gift from R. Chapman, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), or the pDEST-pGEX6P-1 destination vector (a gift from C. Green, The Wellcome Trust Centre for Human Genetics, University of Oxford, UK), respectively. LR Clonase reactions were carried out using the Gateway LR Clonase II enzyme mix according to the instructions of the manufacturer (Life Technologies). The pCMV-I-Sce1 plasmid was a gift from V. Macaulay (Department of Oncology, University of Oxford, UK). pmCherry-C1 was obtained from Clontech. pX335-GFP plasmid (pX335 vector48 containing PGK-EGFP-P2A-Neo-pA) was a gift from J. Riepsaame and M. de Bruijn (MRC Molecular Haematology Unit, Weatherall Institute of Molecular Medicine, University of Oxford, UK).\nHis–EXD2 (Lys76–Ser589) construct was generated by cloning of truncated human EXD2 (Lys76–Ser589) in the expression vector pNIC28-Bsa4 (ref. 49), containing an amino-terminal His tag followed by a tobacco etch virus protease cleavage site. The construct was subsequently subjected to site-directed mutagenesis to introduce the D108A–E110A mutations. Plasmids were transfected into human cells using Lipofectamine 2000 (Life Technologies), according to the manufacturer’s instructions.\n\nImmunoblotting\nCell extracts were prepared by lysing cells in urea buffer (9 M urea, 50 mM Tris HCL, pH 7.3, 150 mM β-mercaptoethanol) followed by sonication using a soniprep 150 (MSE) probe sonicator. Proteins were resolved by SDS-PAGE and transferred to PVDF. Immunoblots were carried out using the indicated antibodies (See Supplementary Table 1)\n\nCell Survival Assay\nAlamar Blue survival assays were performed in accordance with the manufacturer’s recommendations (Life Technologies). Briefly, 300 cells per well in 96-well plates were untreated or treated with indicated doses of camptothecin, ionising radiation, phleomycin or olaparib and incubated for 7 days. Alamar blue reagent (Life Technologies) was added to each well and fluorometric measurements taken after 2h incubation at 37°C.\n\nRNAi treatment\nsiRNAs used in this study are listed in Supplementary Table 2. ON-TARGETplus Non-targeting Pool or siRNA targeting luciferase 50 were used as control siRNAs where appropriate.\n\nImmunofluorescence microscopy\nAntibodies employed for immunofluorescence are listed in Supplementary Table 1. For visualisation of RPA foci, cells were pre-extracted on ice for 2 min (10 mM PIPES, pH 6.8, 300 mM Sucrose, 100 mM NaCl, 1.5 mM MgCl2 and 0.5% TritonX-100) and fixed with 4% paraformaldehyde in PBS for 10 min at room temperature. Coverslips were washed 3 × in PBS and blocked in 10% FBS in PBS for 30 min before incubation with primary antibody in 0.1% FBS in PBS for 1h at room temperature. Unbound primary antibody was removed by washing 4 × 5 min in PBS at room temperature followed by incubation with the indicated secondary antibody for 45 min at room temperature. Slides were then washed 4 × 5 min in PBS before mounting with Vectashield mounting medium (Vector Laboratories) with DAPI.\nIn order to visualise ssDNA foci, the same protocol for RPA focus staining was used, preceded by treatment of cells growing on coverslips with 10 μM BrdU for 24 hours before fixation.\nIn order to visualise RAD51 foci, cells grown on coverslips were fixed with 4% paraformaldehyde in PBS for 10 min at room temperature followed by permeabilisation with 0.5% TritonX-100 in PBS for 10 min at room temperature. Cells were then blocked, incubated with primary and secondary antibodies and mounted for analysis as described above. Confocal microscopy was carried out using a Zeiss LSM 510 laser scanning confocal microscope with Zen 2009 software using a 63x objective. Image analysis was carried out with FIJI (ImageJ) software.\n\nMicroirradiation experiments\nInduction of localised DSBs in human cells was carried out as described previously 43. Briefly, cells were grown on coverslips and pre-treated for 24h with 10 μM BrdU before microirradiation. To induce localised DSBs, the media was removed and cells were washed once in PBS, with subsequent removal of excess PBS. Isopore membrane filters (Millipore TMTP02500, 0.5 μM pore size) were placed on top of the coverslips and cells were exposed to 30 J m−2 UVC using a Stratagene UV Stratalinker 2400. Membrane filters were removed and media placed back on the cells which were allowed to recover for the indicated times before fixation. Cells were fixed, permeabilised and blocked as per RAD51 focus staining (described above). Cells expressing GFP-CtIP were stained for GFP (using the GFP-Booster reagent, Chromotek, 1:200,) and γH2AX using the indicated secondary antibody. Images of microirradiated cells were acquired using a DeltaVision DV Elite microscope using either a 40x objective. Image analysis was carried out with FIJI (ImageJ) and Huygens Professional (Scientific Volume Imaging) software. U2OS cells were stained for MRE11 and γH2AX and visualised on a Zeiss LSM 510 confocal microscope using a 40x objective. Image analysis was carried out using FIJI (ImageJ).\n\nImmunoprecipitation experiments\nLysates for co-immunoprecipitation experiments were prepared as follows; cells were washed twice in PBS and then lysed in IP buffer (100 mM NaCl, 0.2% Igepal CA-630, 1 mM MgCl2, 10% glycerol, 5 mM NaF, 50 mM Tris-HCl, pH 7.5), supplemented with complete EDTA-free protease inhibitor cocktail (Roche) and 25 U ml−1 Benzonase (Novagen). After Benzonase digestion, the NaCl and EDTA concentrations were adjusted to 200 mM and 2 mM, respectively, and lysates cleared by centrifugation (16,000 × g for 25 min). Lysates were then incubated with 20 μl of GFP-Trap agarose beads (ChromoTek) blocked with 5% BSA in IP lysis buffer for 1h at 4 °C in the case of GFP trap IPs or with 20 μl of anti-FLAG M2 affinity gel in the case of FLAG IPs for 2 hours with end-to-end mixing at 4 °C. Complexes were washed extensively in IP buffer (including 200mM NaCl and 2 mM EDTA) before elution. In the case of GFP trap IPs, beads were resuspended in 2X SDS sample buffer and boiled for 3 min before centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was retained as the eluate. In the case of FLAG IPs, beads were incubated for 30 min with gentle agitation at 4 °C in IP buffer supplemented with 400 μM 3x FLAG peptide (Sigma) followed by centrifugation at 5000 × g for 5 min. The resultant supernatant fraction was collected as eluate.\nFor mass spectrometry analyses eluates from immunoprecipitation experiments were analysed by the Mass Spectrometry Laboratory (IBB PAS, Warsaw, Poland) using the Thermo Orbitrap Velos system and protein hits were identified by MASCOT.\n\nChromosomal aberrations\nCells were prepared for analyses of chromosomal aberrations as described previously 51. Biriefly, Colcemid (0.1 μg/ml) was added 4 hours prior to cell harvesting. Cells were trypsinized and incubated in 0.075 M KCl for 20 min. After fixing in methanol:acetic acid (3:1) for 30 min, cells were dropped onto slides and stained with Leishman’s solution for 2 min. Slides were then coded and scored blind to the observer.\n\nHomologous recombination DR-GFP assay\n48 hours after siRNA transfection, U2OS DR-GFP cells 16 were co-transfected using Amaxa nucleofection with an I-SceI expression vector (pCMV-I-SceI) and a vector expressing mCherry fluorescent protein (pmCherry-C1). 24 hours after I-SceI transfection cells were harvested and analysed by flow cytometry (CyAn ADP Analyzer, Beckman Coulter). The percentage of GFP-positive cells among transfected cells (mCherry-positive cells) was determined using Summit 4.3 software. siControl treated sample was set as 100%. Statistical significance was determined with the Student’s t-test.\n\nRecombinant protein purification\nGlutathione S-transferase (GST) tagged proteins were purified as described 51 with some modifications. Briefly, GST protein expression was induced with 0.1 mM IPTG (isopropyl-β-d-thiogalactopyranoside) (Sigma-Aldrich) at 16°C for 18 hours. Bacteria were harvested by centrifugation and resuspended in lysis buffer containing 50 mM Tris-HCl pH 8.0, 150 mM NaCl, 2 mM EDTA, 1 mM DTT, 1% Triton X-100, and protease inhibitors. Lysates were sonicated and cleared by centrifugation. Supernatants were incubated with Glutathione HiCap Matrix (Qiagen) for 2 h with rotation at 4°C. Beads were washed with lysis buffer containing increasing NaCl concentration, elution buffer (50 mM Tris-HCl pH 7.0, 150 mM NaCl, 1 mM EDTA, 1 mM DTT, 0.2% Triton X-100) and resuspended in elution buffer supplemented with PreScission Protease (50 units/ml) (GE Healthcare) and incubated for 18 h with rotation at 4°C. Eluates were dialysed to buffer containing 20 mM Hepes-KOH pH7.2, 100 mM NaCl, 1 mM DTT, 10% glycerol, aliquoted and stored at −80°C. His-EXD2 (K76-S589) protein and corresponding D108A/E110A mutant protein were expressed in E. coli BL21(DE3)-R3-pRARE2cells 49 grown in TB medium and induced with 0.5 mM IPTG at 18°C overnight. Cells were harvested by centrifugation and resuspended in a lysis buffer containing 50mM HEPES, pH 7.5, 500mM NaCl, 10mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, supplemented with a protease inhibitor mixture (Roche Applied Science). The cells were sonicated, polyethyleneimine was added to 0.15% (w v−1) from a 5% pH7.5 stock solution, and lysates cleared by centrifugation. The supernatant was applied to a Ni-sepharose resin, washed with 50 mM HEPES, pH 7.5, 300 mM NaCl, 45 mM imidazole, 5% glycerol, 1 mM TCEP, 0.5% Triton, 1 mM PMSF and 2 mM benzamidine, and eluted in 50 mM HEPES, pH 7.5, 300 mM NaCl, 300 mM imidazole, 5% glycerol, 1 mM TCEP, 1 mM PMSF and 2 mM benzamidine. The eluate was further purified on two sequential Superdex S200 gel filtration columns in GF buffer (50 mM HEPES, pH 7.5, 500 mM NaCl, 5% glycerol, 1 mM TCEP, 0.1% Triton, 1 mM PMSF and 2 mM benzamidine). At each stage the presence of protein was confirmed on an InstantBlue-stained SDS-PAGE gel, and the identity of the final preparation was confirmed using electrospray ionisation-TOF mass spectrometry. Mass spectrometry indicated that both the WT and D108A, E110A mutant proteins had a shorter mass than predicted. Analysis using PAWS software (Genomic Solutions) suggests the proteins were lacking amino acids 565-589 at the C-terminus, probably due to proteolysis resulting in an EXD2 protein (WT or mutant) that consisted of amino acids K76-V564.\n\nIn vitro nuclease assay\nSequences of DNA oligos used are listed in Supplementary Table 3. In order to generate 3′ end labeled substrates, the indicated ssDNA oligo was labeled using [α-32P] dATP and TdT enzyme (New England Biolabs). To generate 5′ end labeled substrates, the indicated ssDNA oligo was labeled using [γ-32P] dATP and PNK enzyme (New England Biolabs). To obtain dsDNA substrates, complementary ssDNA oligos (as indicated in Supplementary Table 3) were mixed in an equimolar ratio and annealed by heating at 100 °C for 5 min followed by gradual cooling to room temperature. Where indicated DNA substrates with biotin label at 3′ end were used and pre-incubated 5 min at room temperature with 10-fold molar excess of streptavidin (Sigma).\nExonuclease assays were performed as described 52 with some modifications. Briefly, reactions were carried out in a buffer containing 20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 10 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, and 50 ng of EXD2 protein and initiated by adding the indicated amount of substrate and incubated at 37 °C for the indicated amounts of time. Reactions were stopped by addition of EDTA to a final concentration of 20 mM and 1/5 volume of formamide. The samples were resolved on denaturing 20% polyacrylamide TBE-Urea gels. Gels were fixed, dried and visualised using a Typhoon FLA 9500 instrument (GE Healthcare).\nThin layer chromatography (TLC) was performed as described 53. Briefly, exonuclease reactions were terminated by addition of stop solution (2% SDS, 120 mM EDTA), 1 μl of reaction mixtures was spotted on PEI cellulose thin layer plates (Merck). Plates were developed in 1.0 M Sodium formate pH 3.4 and subsequently visualised using Typhoon FLA 9500 instrument (GE Healthcare).\nThe PhiX174 circular single-stranded substrate (30 μM nucleotides) from New England Biolabs was incubated with MRN complex (50 nM) in the presence or absence of His-EXD2 (K76-S589) (350 nM) or corresponding mutant protein in buffer containing (20 mM HEPES-KOH, pH 7.5, 50 mM KCl, 0.5 mM DTT, 5 mM MnCl2, 0.05% Triton-X, 0.1 mg ml−1 BSA, 5% glycerol, 1 mM ATP). After 2 hours the reaction was stopped by adding 1/5 volume of Stop solution (2% SDS, 50 mM EDTA). Reactions were resolved on agarose gels, stained with Sybr Gold and visualised using a Typhoon FLA 9500 instrument (GE Healthcare).\n\nER-AsiSI resection assay\nThe level of resection adjacent to specific DSB (Chr 1: 89231183) was measured as described 40 with some modifications. Briefly ER-AsiSI U2OS cells were treated with 300 nM of 4-hydroxytamoxifen (4-OHT, Sigma) for 1 hour to allow the AsiSI enzyme to enter the nucleus and induce DSBs. Cells were then harvested and genomic DNA was extracted as previously described 40. Genomic DNA was then digested with the BsrGI enzyme or mock digested and was used as a template for qPCR performed using iTaq Universal Sybr Green Mix (Bio-Rad) and Rotor-Gene (Corbett Research) qPCR system. Primers used are listed in Supplementary Table 4 40. The percentage of ssDNA was calculated as previously described 40. All data were then related to the siControl treated sample, which was set as 100%. Statistical significance was determined with the Student’s t-test.\n\nGeneration of EXD2−/− cells by CRISP/Cas9\nThe following guide RNA (gRNA) sequences targeting first exon of EXD2 were selected using Optimized CRISPR Design tool (http://crispr.mit.edu; 54: gRNA1 AAGGCATCCAGCGCCGCCGA, gRNA2 CCCTACAGCCACACCCAGAA.\nDNA oligonucleotides were purchased from IDT and cloned into pX335-GFP vector 48 to generate targeting constructs that were subsequently co-transfected in an equimolar ratio into HeLa cells using Lipofectamine. 24 hours after transfection, cells were sorted using a MoFlo cell sorter (Beckman Coulter) for cells expressing Cas9 nickase (GFP-positive cells) and left to recover for 6 days before sorting for single cells and allowing colonies to form. EXD2 expression was analysed by western blotting. Two clones showing loss of all detectable EXD2 were selected for subsequent analysis.\n\nChromatin fractionation\nHeLa cells were treated with 500 μM phleomycin for 1 hour, washed with ice cold PBS, scraped into PBS and the chromatin fractionation was performed as described 55, 56. Briefly, cells were resuspended in buffer A (10 mM Hepes-KOH pH7.9, 10 mM KCl, 1.5 MgCl2, 340 mM Sucrose, 10% glycerol, 1 mM DTT, protease inhibitors) and Triton X-100 was added to final concentration 0.1 %. After 5 min incubation on ice, nuclei were spun down at 1300 × g for 4 min. Pelleted nuclei were washed with buffer A, resuspended in buffer B (3 mM EDTA, 0.2 mM EGTA, 1 mM DTT, protease inhibitors) and lysed for 20 min on ice before centrifugation at 1700 × g for 5 min. Supernatant (nuclear soluble fraction) was saved, and pellet (chromatin fraction) was washed with buffer B, resuspended in urea buffer (9 M urea, 50 mM Tris-HCl, pH 7.3) and sonicated.\n\nStatistics and reproducibility\nMicrosoft Excel or Prism 6 software were used to perform statistical analyses. Detailed information (statistical tests used, number of independent experiments, P values) are listed in individual figure legends. All experiments were repeated at least twice unless stated otherwise.\n"}